article
stringlengths 0
682k
| abstract
stringlengths 146
3.69k
|
|---|---|
in a study of patients with sepsis, velissaris and colleagues showed that high mixed venous blood oxygen saturation (svo2) levels do not exclude fluid responsiveness. svo2 is assumed to reflect the balance between arterial oxygen delivery (do2) and oxygen consumption (vo2) provided arterial blood oxygen saturation (sao2) is normal. indeed, the modified fick equation states : svo2=sao2-vo2/cardiac output hb 1.34 where hb is the hemoglobin concentration. nevertheless, the interpretation of svo2 and its changes in shock states must be cautious for at least four reasons. first, in any shock state, oxygen demand exceeds vo2 by definition such that svo2 can not reflect the balance between do2 and oxygen demand, which is better assessed by markers of anaerobic metabolism such as the blood lactate level. second, as vo2/do2 dependency is a characteristic pattern of shock states, any increase in do2 during resuscitation will be associated with a simultaneous increase in vo2 and hence with no or only a small increase in svo2 until a critical do2 is reached. third, the tissue oxygen utilization is impaired in severe sepsis so vo2 may decrease relative to oxygen demand, even if do2 is normal or high. fourth, because of the hyperbolic relation ship between svo2 and cardiac output (graphical representation of the modified fick equation), svo2 should not change much in response to an increase in cardiac output in cases of hyperdynamic shock states. for all these reasons, interest in svo2 monitoring in septic shock has been debated - although svo2 or its surrogate, central venous oxygen saturation, has been recommended as a major hemodynamic target of early resuscitation in septic shock. nevertheless, svo2 might still play an important role in the monitoring of septic shock by identifying the patients in whom do2 could be further augmented and then by guiding the therapy aimed at increasing do2. this point is of particular importance since systematic maximization of do2 is not recommended in every patient with septic shock. velissaris and colleagues showed that a given value of svo2 can not be used to predict a positive response to fluid challenge. preload responsiveness is an intrinsic property of cardiac performance, indicating that the heart is operating on the steep ascending part of the frank - starling relationship. preload responsiveness is therefore by nature a concept that differs from the concept of global vo2/do2 balance and thus from svo2. patients with low svo2 can be either fluid responsive in cases of hypovolemic shock or fluid unresponsive in cases of cardiogenic shock. in the study by velissaris and colleagues almost two - thirds of patients with a low svo2 (70%) at baseline. this confirms that preload responsiveness can coexist with the presence of reduced oxygen extraction capacities and thus high svo2. a reliable prediction of fluid responsiveness would also be important to obtain in cases of high svo2. whether the presence of preload responsiveness should lead to the decision to infuse fluid, however, is still uncertain. one should anticipate that abnormally high svo2 is an indicator of profoundly decreased oxygen extraction capacities so that the additional increase in do2 can not be effectively distributed and/or utilized in the most injured peripheral tissues. in other words, one can reasonably postulate in cases of tissue hypoxia that the higher the svo2, the less likely the correction of tissue hypoxia with fluid infusion, even in the presence of indicators of preload responsiveness. since the study by velissaris and colleagues was not designed to confirm this hypothesis, do2 : oxygen delivery ; hb : hemoglobin concentration ; sao2 : arterial blood oxygen saturation ; svo2 : mixed venous blood oxygen saturation ; vo2 : oxygen consumption. j - lt and xm are members of the medical advisory board of pulsion medical systems (munich, germany). | real - time monitoring of mixed venous oxygen blood saturation (svo2) or of central venous oxygen blood saturation is often used during resuscitation of septic shock. however, the meaning of these parameters is far from straightforward. in the present commentary, we emphasize that svo2 - a global marker of tissue oxygen balance - can never be simplistically used as a marker of preload responsiveness, which is an intrinsic marker of cardiac performance. in some septic shock patients, because of profound hypovolemia or myocardial dysfunction, svo2 can be low but obviously can not alone indicate whether a fluid challenge would increase cardiac output. in other patients, because of a profound impairment of oxygen extraction capacities, svo2 can be abnormally high even in patients who are still able to respond positively to fluid infusion. in any case, other reliable dynamic parameters can help to address the important question of fluid responsiveness / unresponsiveness. however, whether fluid administration in fluid responders and high svo2 would be efficacious to reduce tissue dysoxia in the most injured tissues is still uncertain. |
the patients who are admitted to icu may pose an immense diagnostic and therapeutic challenge for the intensivist as a high index of suspicion for intoxication is warranted. the profile of patients with acute poisoning and their choice of agents not only depend upon the socioeconomic, religious and cultural status, but it also greatly varies between different countries.[15 ] this may be attributed to the easy availability of a particular agent.[13 ] the clinical course and ultimate outcome, in turn, is related to the agent, the dose, pre - existing comorbidities, the time from exposure to presentation to a healthcare facility and the experience of care provider. however, there is scarcity of data from the indian subcontinent regarding the epidemiology and outcome of patients presenting with acute poisoning, especially from those patients admitted to icu. hence, we aimed to determine the profile and outcome of acute toxicology in patients admitted to icu of a tertiary care hospital in the cosmopolitan city of new delhi, india. the study was conducted in a 28-bedded critical care department of a tertiary care private hospital in the metropolitan city of new delhi, catering primarily to urban population. data on patient demographics, psychological analysis, toxins involved and use of toxicology screen were collected for all the patients admitted to the icu with acute poisoning between july 2006 and march 2009. in addition, data on presence of organ failure, need for organ support and icu mortality were also collected. patients admitted to icus out of critical care department and those admitted in cardiac critical care unit were not included. patients whose stay was less than 24 hours and those who were less than 18 years old were also excluded from the study. patients were admitted to icu according to icu admission policy for toxicology patients based on international recommendations. disease severity at admission to icu was assessed by means of acute physiology and chronic health evaluation (apache) ii score. organ failure assessment was done by sequential organ failure assessment (sofa) score, with sofa score greater than three for any organ system denoting its failure. they were managed according to the standard protocols including the abcs (airway, breathing, circulation), resuscitation with intravenous fluids, inotropes (if mean arterial pressure was less than 60 mm hg, in spite of fluid resuscitation) and use of renal replacement therapy (rrt) (if serum creatinine was progressively increasing, with worsening of acidemia, with or without hyperkalemia or to clear the toxins) as required. similarly, the patterns of weaning from inotropes and mechanical ventilation were as per standard icu protocols. prevention of absorption of toxin was attempted, with gastric lavage and activated charcoal, in selected patients presenting within 4 hours of oral ingestion of toxin. blood toxin levels, urine toxicology screen and gastric lavage for toxins were sent as and when indicated. specific antidotes were administered where indicated. abstracted patient data were entered into microsoft excel and further analysed using spss 16.0 (spss inc., chicago, il, usa) software. unpaired student 's t test was used to compare continuous data between two groups and categorical data were evaluated using chi - square or fisher 's exact test, as appropriate. all tests were two - tailed and a p value of less than 0.05 was considered to be statistically significant. of the total 1478 patients admitted to icu during the study period, 138 (9.3%) presented with acute poisoning. the most common mode of poisoning was suicidal (78.26%), with the commonest route being oral (97.8%). the highest incidence of poisoning was due to drugs (46.3%), with benzodiazepines being the commonest [table 2 ]. thirty - two patients (23%) consumed either two or more toxins or there was a history of alcohol co - ingestion. in 26.1% patients, the agent of poisoning remained unknown. patient characteristics many of them had history of psychological disorders, majority (34.8%) being depression followed by anxiety (11.6%). urine toxicology screen was used in 66/138 (47.8%) and was positive for 45/66 (68.2%) [table 3 ]. organ failure, as assessed by sofa score equal to or more than three for a particular organ system, was present in 67 patients (48.5%) [table 3 ]. during their icu course, rrt was used in four patients, two each for organ support and toxin removal. one patient each of methanol poisoning and salicylate overdose required haemodialysis for toxin removal. out of the four patients receiving rrt, three received haemodialysis and one received continuous rrt (crrt) as the patient was hypotensive.. characteristics of the three patients who died during the study period are given in table 4. rrt was required in all three patients but only one could receive crrt as the other two were too haemodynamically unstable, in spite of high vasopressor support, to receive any kind of rrt. acute poisoning constitutes a significant proportion of icu admissions and even though the overall mortality may be low, they may utilise considerable icu resources. icu course and outcome varies, but mortality may be high in patients with acute pesticide poisoning, especially aluminium phosphide poisoning. characteristic clinical syndromes, called toxidromes, may be associated with certain poisonings and, hence, may aid in diagnosis of an unknown poison. however, all patients may not have all features associated with a particular toxin and toxidromes may overlap in patients who have consumed more than one agent. hence urine toxicology screening can provide direct evidence of intoxication, can identify a specific toxin for which an antidote may be available and can also quantify a toxin allowing for titrated therapy. however, as only a few drugs can be detected, a negative screen does not rule out the possibility of poisoning. in addition, certain drugs which the patient might have taken in therapeutic amounts, like opioids or benzodiazepines, may also be detected even though they are causing no toxic symptoms and the timing of sampling can also affect the results. as it rarely alters the course of management, urine screening may not be indicated routinely. drugs which we assessed in urine toxicology screen were amphetamines, barbiturates, benzodiazepines, cannabinoids, cocaine, opioids and phencyclidine. we used toxicology screen in only 47.8% of our patients and it was positive in 68% of these patients. surprisingly, we observed a slight male preponderance in our cohort, but higher suicide rates among men has been reported in many other indian studies too.[1517 ] other studies have also observed that the maximum number of patients belonged to 21 - 30 years age group and the most common cause for poisoning was suicidal, as in our cohort. pesticide self - poisoning accounts for about one - third of the world 's suicides, with developing countries like india accounting for a major portion of it. understandably, due to their easy availability, pesticides have been reported as the most common agent for acute poisoning from the indian subcontinent and drugs being more common in western countries. however, most of the indian data have emerged from the rural background and the scenario in urban cities may resemble western countries. this may explain the fact that drugs were the most common agents of poisoning in our cohort of patients, which basically represent urban india. even though organ failure was present in almost 50% of the patients, only 15% required organ support in the form of rrt, vasopressor or invasive ventilatory support. this may suggest that the organ failure is generally mild and self limiting and early aggressive care can reverse organ failure in most of these patients and, in turn, may reduce mortality. in advanced centres, the case fatality rate for self - poisonings is approximately 0.5%, but it is as high as 10 to 20% in the developing countries where critical care resources are lacking. we observed a mortality rate of 2.8% as our centre is well equipped with advanced life and organ support systems. even though the commonest agents for poisoning in our group of patients were the drugs, all three patients who died had consumed pesticide poison (aluminium phosphide). drugs like analgesics, sedatives and antidepressants which have been associated with maximum mortality in case series from western countries may become secondary to pesticide poisoning in indian context where exposure to agricultural poisons is rampant and is associated with higher mortality. in addition, among the various pesticides, the majority of deaths occur due to exposure to organophosphates, organochlorines and aluminium phosphide. aluminium phosphide is a commonly used, low cost, easily available rodenticide used as a grain preservative in northern india. although the case fatality with aluminium phosphide poisoning has reduced in the recent years secondary to advanced intensive care management, it is still associated with high mortality rates. we observed 100% mortality in our three patients, who presented with aluminium phosphide poisoning, which may be attributed to their poor condition on admission reflected by their high apache ii and sofa scores [table 4 ]. presence of shock has been reported as an independent predictor of mortality, and all three of our patients presented with profound shock not responding to vasopressor therapy. other factors related to poor outcome in aluminium phosphide poisoning like poor sensorium and presence of metabolic acidosis, were also present in our patients, contributing to poor outcome in spite of aggressive management. this retrospective study was conducted in a single centre equipped with high - end facilities located in a metropolitan city ; hence, the results can not be generalised. in addition, because of a small cohort size and low mortality rate, assessment of factors predicting outcome could not be done. this retrospective study was conducted in a single centre equipped with high - end facilities located in a metropolitan city ; hence, the results can not be generalised. in addition, because of a small cohort size and low mortality rate, assessment of factors predicting outcome could not be done. the present data give an insight into epidemiology of poisoning and represents a trend in urban india. there is an increasing variety and complexity of toxins and hence a high index of suspicion is warranted because early diagnosis and aggressive therapy can reduce mortality rate. | background and aim : there is scarcity of data from the indian subcontinent regarding the profile and outcome of patients presenting with acute poisoning admitted to intensive care units (icu). we undertook this retrospective analysis to assess the course and outcome of such patients admitted in an icu of a tertiary care private hospital.methods:we analyzed data from 138 patients admitted to icu with acute poisoning between july 2006 and march 2009. data regarding type of poisoning, time of presentation, reason for icu admission, icu course and outcome were obtained.results:seventy (50.7%) patients were males and majority (47.8%) of admissions were from age group 21 to 30 years. the most common agents were benzodiazepines, 41/138 (29.7%), followed by alcohol, 34/138 (24.63%) and opioids, 10/138 (7.2%). thirty - two (23%) consumed two or more agents. commonest mode of toxicity was suicidal (78.3%) and the route of exposure was mainly oral (97.8%). the highest incidence of toxicity was due to drugs (46.3%) followed by household agents (13%). organ failure was present in 67 patients (48.5%). during their icu course, dialysis was required in four, inotropic support in 14 and ventilator support in 13 patients. icu mortality was 3/138 (2.8%). all deaths were due to aluminium phosphide poisoning.conclusions:the present data give an insight into epidemiology of poisoning and represents a trend in urban india. the spectrum differs as we cater to urban middle and upper class. there is an increasing variety and complexity of toxins, with substance abuse attributing to significant number of cases. |
gastrointestinal tract duplications are uncommon congenital anomalies and found anywhere along the alimentary tract from the mouth to the anus. almost all of the reported cases were detected with respiratory distress manifestation in the early days of life. most eds are found in the distal third of the esophagus and are frequently incidental findings on routine chest radiography. ed is divided into three types : cystic (the most common type), tubular, and diverticular. ed can be associated with other congenital anomalies such as small intestine duplications, esophageal atresia, bronchoesophageal fistulas (befs), and spinal abnormalities. less than 20% of eds have communication with the main lumen through a tubular tract. communicating tubular ed is extremely rare, and only one case report of communicating tubular ed combined with bef in an adult has been published in the japanese literature (in 1994). here, we report a case of communicating tubular ed combined with bef, diagnosed on the basis of endoscopy and esophagography findings during the postoperational evaluation of bef. a 49-year - old male patient was admitted to our hospital s emergency center because of herbicide poisoning. after drinking several glasses of alcohol and herbicide, he presented with persistent nausea and vomiting. he had been drinking about 54 g alcohol daily and had 50-pack - year history of cigarette smoking. he had a history of pulmonary tuberculosis and received antituberculosis medication 8 years ago. at that time on admission, initial physical examination revealed no specific finding except for an elevated respiratory rate of 28/min. the results of laboratory tests were as follows : white blood cell count 15,660/mm, hemoglobin 12.9 g / dl, hematocrit 38.1%, platelet count 155,000/mm, total protein 7.9 g / dl, albumin 3.7 g / dl, aspartate aminotransferase 80 u / l, alanine aminotransferase 37 u / l, prothrombin time 1.03, and c - reactive protein 3.48 mg / dl. the results of blood gas analysis were ph 7.513, pco2 35.2 mm hg, po2 80.5 mm hg, and hco3 27.7 mmol / l. after aspiration pneumonia was diagnosed, the patient was treated with conservative management. on the second hospital day on endoscopic and bronchoscopic examinations, a fistula opening was found at the mid - esophagus, and the opening had a whitish surface with a slightly screwed pattern without inflammatory sign or discharge (fig. we could not localize the other opening or a fistula tract. a previous esophagography image (fig. 1b) taken at a local hospital revealed a communicating fistula tract between the bronchus and the lower esophagus (bef) ; however, a chest computed tomography (ct) scan, also taken at the local hospital, did not show discrete bef. on the 6th hospital day, his pneumonic condition was well improved and he could ambulate. on the 10th hospital day, he underwent surgical operation for the repair of the bef. during the operation, a 2-cm - long fistula tract between the lower esophagus and the medial basal segment of the left lung was noted, which was successfully removed and repaired. his condition was stable, and he had no complication. on the 3rd postoperational day, a follow - up esophagography for the postoperational evaluation revealed contrast leakage at the left side of the mid - esophagus and drainage to the distal esophagus (fig. we thought that the leakage resulted from an unidentified condition, such as ed with esophago - esophageal fistula (fig. a proximal fistula opening was found at the mid - esophagus and the distal opening was found on the cardia of the stomach, located in the hiatal hernia (fig. an about 7-mm air - filled tract was noted, one end of which was connected to the distal esophagus and the other end was connected to the cardia of the stomach (fig. initially, he was operated for the symptomatic bef ; however, a communicating ed was later detected incidentally during a postoperational follow - up. the symptoms of bef were improved without any unusual complication, and he wanted to be discharged without any further treatment or surgery. at 2 years of follow - up the only case of a communicating tubular ed with bef was published in the japanese literature. the patient was a 51-year - old woman who chronically experienced coughing when drinking water. esophagoscopy revealed tubular ed with bef, and endoscopy showed one small opening of ed. most eds are found in the distal third of the esophagus and are frequently asymptomatic ; however, dysphagia, respiratory distress, recurrent pneumonia, vomiting, failure to thrive, gastroesophageal reflux, melena, and anemia may also be present in rare cases. at the time of admission, our patient had chronic intermittent cough and knew about his bef. pneumonia might be considered a complication of drug intoxication or bef. on admission, persistent cough developed abruptly, chest ct and endoscopic examination did not reveal a communicating ed at that time ; however, postoperational follow - up esophagography for the confirmation of fistula closure revealed another remaining fistula tract. this fistula tract communicated not with the bronchus but with the distal esophagus as a tubular structure, which is an evidence of the possibility of ed. therefore, endoscopic reexamination and follow - up chest ct were done, and we finally confirmed ed. later, we incidentally found that he had a communicating tubular ed with bef, which we could not find on the initial evaluation. the ed was initially not detected because we thought the cough symptom was caused by the bef that was detected on esophagography at the previous hospital. the ed was congenitally accompanied by the bef, and they shared the same opening, which might have caused the relatively less influx of the contrast medium into the ed than into the bef, making the ed undetectable on esophagography. according to the assumption from interdisciplinary discussion, it is highly likely that the removal of the bef might have made the ed easily accessible for the contrast medium and thus more detectable on esophagography. this is also supported by the fact that ed was suspected on the review of the previous ct images (images not presented here). one major limitation of this case report is that the possibility of an esophagogastric fistula, not an ed, could not be confirmed by histology. in another report with a similar case to ours, ed was verified on the basis of the histological findings. however, as the endoscopic findings suggest (fig. 3b), the orifice inside the hiatal hernia appeared to be covered by the epithelium of the esophagus, suggesting the possibility of an orifice from the ed, rather than an esophagogastric fistula. a histological examination would be helpful for differential diagnosis in patients showing similar findings in the future. upper gastrointestinal endoscopy can help in the diagnosis through direct vision ; however, it can not determine whether the ed is a communicating or a noncommunicating type. in our case, the initial endoscopic examination for the confirmation of bef could not find a communicating tubular ed. however, the result of the follow - up esophagography revealed the possibility of a communicating tubular ed, and we conducted repeat endoscopy carefully. 3, the distal orifice of the ed was at the sliding hiatal hernia sac, and it was very difficult to find. the opening could be seen along the whole esophagus as a whitish or pinkish hole not discriminated from the surrounding opening tissue. esophagography may show displacement of the esophagus due to a paraesophageal mass ; however, a tubular ed may not influence the esophagus. contrast esophagographic evaluation could be useful in diagnosing a communicating ed preoperatively, and to confirm that a leak is not present during the postoperative follow - up period. ct could demonstrate the exact anatomic position of the fistular tract and influence the decision making about resectability. magnetic resonance imaging, endoscopic ultrasonography, and tc-99 m pertechnetate scintigraphy could be helpful for the diagnosis of this disease. however, these methods yield mainly inconclusive results. the management of ed is dependent on the type and size of the ed, and the severity of the symptoms. complete resection is a well - documented treatment for duplication of the esophagus ; however, conservative management can be an option for nonsymptomatic patients. symptomatic ed has mainly been managed with extensive surgery through a thoracotomy. with recent advances in minimally invasive surgery, surgical treatment has improved in efficacy and offers advantages to patients. a clear exposure and identification of the duplication are important for a successful operation. as our patient received primary repair of bef without knowledge of ed, and his symptoms disappeared, we did not conduct additional surgery for ed. after surgery, he has been doing well during the follow - up period. in conclusion, identifying a communicating ed with bef is difficult. on the diagnostic examination for a bef, the possibility of ed should be considered and careful endoscopic examination is also important for the detection of fistula orifices. | esophageal duplication (ed) is rarely diagnosed in adults and is usually asymptomatic. especially, ed that is connected to the esophagus through a tubular communication and combined with bronchoesophageal fistula (bef) is extremely rare and has never been reported in the english literature. this condition is very difficult to diagnose. although some combinations of several modalities, such as upper gastrointestinal endoscopy, esophagography, computed tomography, magnetic resonance imaging, and endoscopic ultrasonography, can be used for the diagnosis, the results might be inconclusive. here, we report on a patient with communicating tubular ed that was incidentally diagnosed on the basis of endoscopy and esophagography during the postoperational evaluation of bef. |
epithelial - mesenchymal interactions play important roles during tooth formation in the jaw. after the crown formation, the inner and outer enamel epithelium joins together and begins to migrate towards the apical area to form the tooth root. hers cells induce dental papilla cells to differentiate into odontoblasts to form the root dentin and they begin to fragment just before cementogenesis. after fragmentation of the hers, some epithelial cells move away from the root surface and remain throughout life in the periodontal ligament. those cell islands are called epithelial rests of malassez (erm) [13 ]. it has been reported that the functions of the erm are to regulate the width of the periodontal ligament space [4, 5 ], the growth induction of nerve endings, the differentiation of ameloblasts, the secretion of enamel protein, and the differentiation induction of cementoblasts [5, 9 ]. furthermore, the erm is known to respond to inflammatory cytokines, and this may induce increased numbers of cells of the erm and create either a pocket epithelium or the lining epithelium of the radicular cyst. moreover, sometimes this process is related to the formation of odontogenic tumors, such as ameloblastomas or odontogenic carcinomas [7, 11, 12 ]. the periodontal ligament is always exposed to mechanical stress such as compression forces or extension forces during occlusion and chewing. however, it is known that the periodontal space is kept fixed by instructions from stress immunity factors such as heat shock proteins (hsps) except in the case of excessive power [13, 14 ]. it is known that small amounts of hsp exist constantly in all cells, and levels of hsp increase following chemical or mechanical stimulations such as heat, oxidative stress [16, 17 ], acid, ischemia, or reperfusion in situ. when a tissue is subjected to stress as described above, hsp initiates biophylactic reactions and acts intracellularly as molecular chaperones and to maintain tissue homeostasis. vascular endothelial growth factor (vegf) vegf is produced by many kinds of cells during the vascularization process of developing embryos and during the pathophysiologic processes of ischemia or wound healing [22, 23 ]. osteopontin (opn) is a bone - related protein involved in the production of tooth enamel, dentin, and the cementum. however, it is known that opn has various other functions elsewhere. for these reasons, hsp, vegf, and opn morphological molecular studies [2527 ] have characterized processes when stretching forces are loaded on periodontal ligament fibroblasts in vivo and in vitro. however, only a few morphological studies have examined the effect of stretching forces on cells of the erm, and no molecular studies have characterized that. the purpose of this study was to investigate the behavior of cells derived from the erm against stretching forces in vitro, and to investigate them at the molecular level. abiko, department of dental science, institute of personalized medical science, health sciences university of hokkaido. erm cells were cultured in 75 cm tissue culture flasks (corning, tokyo, japan) with -mem (gibco, carlsbad, ca, usa) containing 10% fetal bovine serum (sigma, st. they were cultured by incubation in a humidified atmosphere of 95% air and 5% co2 at 37c. after the cells became confluent, they were detached using trypsin / ethylenediaminetetraacetic acid (edta) (0.25% w / v trypsin/0.02% edta, ph 7.2). subsequently, the cells were resuspended in the supplemented culture medium as described above and used in the following experiments. to identify epithelial cells, immunofluorescence staining was carried out using a primary antibody against cytokeratin 19 (1 : 100 dilution ; abcam, cambridge, uk) and a secondary antibody labeled with fitc (1 : 100 dilution ; invitrogen, carlsbad, ca, usa) and were observed using a laser scanning microscope (lsm5 duo, carl zeiss, oberkochen, germany). approximately 5.0 10 erm cells were seeded in flexible - bottomed culture plates coated with type i collagen (bioflex collagen ; flexcell international, mckeesport, pa, usa) and were cultured. after 1 week of culture, the erm cells were stretched for 1 hour, with a cycle of 18% elongation for 1 second followed by 1-second relaxation, using an fx-4000 flexercell strain unit (flexcell international). the flexible cell - covered elastomer membranes were stretched by applying an oscillating vacuum to the underside of the membranes and the duration, amplitude, and frequency of the stretch applied were controlled by a computer (figure 1). the vacuum manifold that held the plates was maintained at 37c in a humidified incubator with 95% air and 5% co2. the cells were collected at 0, 12, 24, 36, 48, and 72 hours after the initiation of the stretching force (stretching group). cell numbers were counted using a coulter counter (beckman coulter, tokyo, japan) at each of the time periods. erm cells were observed every day of the experiments using an eclipse ts100 phase microscope (nikon, tokyo, japan). for standard fluorescence microscopic observations, cells in the dishes were washed with pbs, fixed with 4% paraformaldehyde for 20 minutes at room temperature and then were permeabilized in 0.1% triton x-100 solution for 10 minutes. filamentous actin (f - actin) stress fibers were visualized using fitc - conjugated phalloidin (1 : 100 ; molecular probes, carlsbad) and were observed using a laser scanning microscope (lsm5 duo, carl zeiss, oberkochen). for investigating the effects of mechanical stretching in terms of protein levels, immunofluorescence staining was carried out using a primary antibody against hsp70 (1 : 200 dilution ; abcam, cambridge, uk) for 24 hours control and stretch group, vegf (1 : 50 dilution ; abcam) for 48 hours control and stretch group, and opn (1 : 40 dilution ; abcam) for 24 hours control and stretch group, a secondary antibody labeled with rhodamine (1 : 100 dilution ; invitrogen, carlsbad, ca, usa) and were observed using a laser scanning microscope. the line was drawn from center point to the periphery of the culture dish through the center of cell nucleus in both groups and the angle made by this line and each of the actin filament in the cytoplasm on the immunofluorescence picture was measured as actin filament direction (figure 2). for quantification, each angle created by actin filament against the line in the 5 cells on each of 5 culture dish in the both groups was analyzed using image j analysis software (nih, bethesda, md, usa). in order to investigate the effects of mechanical stretching in terms of mrna levels, quantitative real - time reverse transcriptase - polymerase chain reaction (rt - pcr) using a lightcycler total rna was extracted from each sample using the acid guanidinum thiocyanate / phenol - chloroform method. cultured cells at each of the time periods were homogenized using a bransonic sonicator (branson, danbury, ct, usa) and were solubilized in trizol reagent (invitrogen, tokyo, japan) and chloroform. supernatants were obtained by centrifugation at 13200 rpm for 20 minutes at 4c, added to isopropanol, stored for over 1 hour at 80c, and were finally centrifuged at 13200 rpm for 20 minutes at 4c. the rna pellets were dissolved in rnaase - free water and kept at 20c until use. total rna concentrations were measured by absorbance using a nanodrop (nd-1000 spectrophotometer, scrum, tokyo, japan). total rna (1 g) was reverse transcribed and amplified in 20 l using an rt - kit (qiagen, md, usa). cdna synthesis was carried out using a thermal cycler (thermohybrid ; thermobioanalysis, yokohama, japan), and samples were incubated at 42c for 15 minutes, heated to 99c, and then quick - chilled to 5c. quantitative rt - pcr assays were performed using a lightcycler (roche molecular biochemicals, tokyo, japan). each reaction mixture considered 2 l lightcycler - faststart dna master sybr green, 0.5 m of each primer, 5 mm mgcl2, and 2 l samples cdna. pcr was then carried out and mrna expression of hsp70, vegf, opn, and the housekeeping gene gapdh was measured using a lightcycler (roche diagnostics k.k.). the primer sequences for hsp70, vegf, opn, and gapdh are shown in table 1. data from each experiment were statistically analyzed, and the assumption of homogeneity of variances and normal distribution of errors were tested for the response variables evaluated. student 's t - test was used to compare the actin filament direction and number of cells. one - way analysis of variance (anova) and multiple comparison test (bonfferroni 's test) were used to compare mrna levels for the control and stretching groups, and student 's t - test was used to compare various time periods (p =.05). mer cells were stained for cytokeratin 19 using an immunofluorescence technique (figure 3). the numbers of cells in the stretching group were significantly less than in the control group at 0 hour. however, the numbers of cells in the stretching group were significantly increased compared to the control group at 12, 24, 36, and 48 hours (figure 4). there were no remarkable morphological changes that could be seen between the control group and the stretching group at 0 hour (figure 5). actin filaments were randomly oriented in the cytoplasm of the control group (43.9 5.2 degree), whereas in the stretching group, actin filaments were oriented parallel to the stretching direction (23.4 1.9 degree) (figures 6 and 7). there was a significant difference between the control groups and the test groups in terms of actin filament direction (p <.05). the expression of hsp70-mrna in the stretching group was significantly higher than that in the control group at 12, 24, and 36 hours (p <.05). the expression of hsp70-mrna in the stretching group showed the highest value at 24 hours and decreased with time (figure 8). the expression of vegf - mrna in the stretching group was significantly higher than that in the control group at 36, 48, and 72 hours (p <.05). the expression of vegf - mrna in the stretching group showed the highest values at 48 hours and decreased with time (figure 9). the expression of opn - mrna in the stretching group was significantly higher than that in the control group at 12, 24, and 36 hours (p <.05). the expression of opn - mrna in the stretching group showed the highest value at 24 hours (figure 10). the expression of hsp70-, vegf-, and opn - mrnas was not significantly different in the control groups at any of the time periods. mer cells were immunoreacted byr hsp70 at 24 hours stretch group (figure 11), vegf at 48 hours stretch group (figure 12), and opn at 24 hours stretch group (figure 13). the flexercell system used in this study assigned a specific stretching force to the cultured cells. using this system, we applied intermittent mechanical stretching to produce 18% elongation at the periphery of each well and that elongated each cell body equally approximately 18%. this force is almost identical to those used in previous studies in which 18% cell stretching is a slightly higher level than the physiological force reported earlier. in this study, we found that the direction of actin filaments in the experimental groups immediately after the stretching force was arranged depending on the attractive direction, while the filaments of the control groups were arranged randomly. however, buck and dartsch reported that the direction of actin filaments was arranged at a right angle to the stretching direction after 24 hours of stretching force and they concluded that the cells might be reacting against the stretching force. most probably, the cells initially react to the stretching force after which they recover naturally. actin filaments are known to combine with hsp70 constantly, and it is thought that cytoskeleton proteins and stress proteins interact in stressed cells. for this reason, it is thought that hsp70 may transmit the information in cooperation with integrins on the cell surface and cytoskeleton proteins when stretching forces are loaded. in the stretching groups, our study supports three reports and suggests that resistance of the erm to the stretching stress may be high in the same way as fibroblasts. beere and coworkers reported that hsp expresses by a steady state combines with other proteins such as actin filaments [35, 36 ]. so, hsp guided by stress is thought to be important to the resistance of cells. in this study, the expression of hsp70 mrna increased in the stretching group at 12, 24, and 36 hours, but not in the control group. this suggests that hsp70 probably reacts as autocrine to the damaged cells and maintains homeostasis of cells oneself. it has been reported that vegf resists the stresses of compression, hypoxia, and reoxygenation and restores and maintains the increased activity of cells in the tissues. the expression of vegf suggests that the cells have an important role in the homeostasis of the tissue in terms of nutrition. ohshima. reported that erm cells express vegf, but periodontal ligament fibroblasts express vegf in vitro. in this study, the expression of vegf was not detected in the control group ; however, increased expression of vegf at 24, 36, 48, and 72 hours was noted in the stretching group. as a result, the homeostasis of the periodontal ligament might be maintained by vegf secreted by cells of the mer under conditions of stretching as paracrine. erm cells are also known to produce opn in conjunction with cementogenesis and bone formation [39, 40 ]. furthermore, it has been reported that periodontal ligament cells produce opn under conditions of stretching. in addition, opn is related to the increased activity of vegf. in this study, the expression of opn was not remarkably changed in the control group ; however, there was a significant increase in opn mrna at all time periods in the stretching group. the expression of opn mrna may control the hard tissue formation in the periodontal ligament. from these results, this suggests that the erm most probably maintains cementogenesis and osteogenesis against mechanical stress by expression of opn. erm cells response against the stretching force by expressing hsp70, vegf, and opn. | background and objective. the aim of this study was to investigate the behavior of cells from epithelial rest of malassez (erm) against stretching force. material and methods. erm - cultured cells were stretched for 1 hour, at the cycle of 18% elongation for 1 second followed by 1-second relaxation. the cells without addition of stretching force were used as controls. the cells were observed by immunohistochmical staining using actin 0, 12, 24, 36, 48, and 72 hours. furthermore, expressions of hsp70-, vegf-, and opn - mrnas of cells were also evaluated using quantitative rt - pcr. results. actin filaments were randomly orientated in the cytoplasm in the control group, whereas in the stretching group, actin filaments were orientated comparatively parallel to the stretching direction. expression of hsp70-mrna in the stretching group was significantly higher than that of control group at 12, 24, 36 hours (p <.05). expression of vegf - mrna in the stretching group was significantly higher than that of control group at 24, 36, 48, and 72 hours (p <.05). expression of opn - mrna in the stretching group was significantly higher than that of control group at 12 and 24 hours (p <.05). conclusion. erm cells response against the stretching force by expressing hsp70, vegf, and opn. |
laryngomalacia is the most common congenital anomaly of the larynx and the commonest cause of stridor of unknown aetiology in infants, and accounts for around 75% of all laryngeal problems in infancy. osteogenesis imperfecta is a rare congenital anomaly of the connective tissues caused by the mutation of collagen type 1, colia1 or colia2 genes. it affects the bones, sclera and the inner ear and has an incidence of about 1 in 50,000. the co - existence of these diseases is rare and it presents unique anatomical and physiological challenges to the anaesthesiologist making every form of anaesthesia difficult. a 6-month - old male infant, 3.5 kg in weight, presented with the history of refusal to feed, tender abdomen, swelling in the right groin and constipation since 3 days. the child had a history of stridorous breathing since birth and was subsequently diagnosed as a case of congenital laryngomalacia. he was a full - term delivery by caesarean section for meconium - stained liquor. the infant was kept in the intensive care unit (icu) for 3 days post - delivery for breathing difficulties and neonatal jaundice. the child underwent a high resolution computed tomography (hrct) imaging of the chest along with virtual bronchoscopy to rule out any obstruction in the airway and there was a chance finding of three ununited rib fractures of the left side (4, 5and 6) [figure 2 ]. subsequent paediatric, orthopaedic and ophthalmologic evaluations revealed blue sclera, spontaneous rib fractures, failure to thrive and multiple hernias (umbilical and right inguinal) because of the lax abdominal wall. retrognathia in the child rib fractures seen in the ct scan high - risk consent and consent for post - operative ventilation was obtained. a paediatric fibreoptic bronchoscope was not available, so direct laryngoscopy was performed with a shoulder pad in place and intubation was achieved in the second attempt using size 1 miller blade, and a 3.5-mm uncuffed enotracheal tube (ett) was inserted. on direct laryngoscopy, the view was cormack - lehane grade iii. atracurium 0.5 mg / kg was administered and anaesthesia was maintained with oxygen, nitrous oxide, and sevoflurane. monitoring devices included a pulse oximeter, cardioscope, non - invasive blood pressure monitor, temperature monitor and capnometer. a quiet and pain - free post - operative period ensured that the patient did not have any breathing difficulties. laryngomalacia is defined as severe collapse of the epiglottis and the arytenoids (as seen by fibreoptic bronchoscopy) in children with audible stridor. congenital laryngomalacia presents in the neonatal period with stridor, that is high pitched in nature and inspiratory in timing and is aggravated when the child is upset or when the child hyperventilates. in more severe forms, upper airway obstruction, cyanotic spells, feeding difficulties, failure to thrive, the definitive diagnosis is made by suspension laryngoscopy and direct visualization of the larynx as it collapses during the inspiratory phase of spontaneous ventilation. osteogenesis imperfecta, also known as the brittle bone disease, is a genetic disorder caused due to the faulty formation of collagen type 1. the disease may cause cardiac valvular lesions, cor pulmonale, neurologic abnormalities, hyperhydrosis, cleft palate, metabolic abnormalities, malignant hyperthermia, obstructive uropathy and platelet dysfunction.[34 ] mild cases of laryngomalacia may require only history, clinical examination, complete blood count and electrolytes, with lateral neck and chest x - rays. an electrocardiogram (ecg) may be ordered if there are signs of cor pulmonale. barium studies, chest ct scan and angiography are reserved for those cases where a cardiovascular anomaly is present. premedication of patients with laryngomalacia is essential to prevent vagal responses and as an antisialogogue, sedation is to be used judiciously. we opted for mild sedation to prevent the child from crying and hyperventilating as it would have worsened the stridor. laryngomalacia may make mask ventilation a challenge as the airway may collapse when the muscle tone is lost following induction. facial anomalies associated with osteogenesis imperfecta like retrognathia, combined with a large head, short neck and propensity to mandibular fractures make mask ventilation difficult. the intubation of patients with laryngomalacia is difficult due to the large lax overhanging epiglottis. facial anomalies, risk of mandibular fractures, injury to teeth and high chances of cervical vertebrae injury associated with osteogenesis imperfecta make direct laryngoscopy and intubation difficult. intubation with a paediatric fibreoptic bronchoscope would be the method of choice in these cases. the use of a laryngeal mask airway (lma) in a case of laryngomalacia has a higher failure rate and it may not be able to protect the airway against reflux that is commonly seen in these patients. patients with osteogenesis imperfecta have a higher propensity to malignant hyperthermia as compared to the general population, but the incidence is low. in anticipation of a difficult airway, we proceeded with the use of sevoflurane with temperature and etco2 monitors in place. total intravenous anaesthesia would be the method of choice in cases where a difficult airway has been ruled out. other than triggering malignant hyperthermia in susceptible patients, succinylcholine - induced fasciculations can cause fractures and neck hyperextension leading to atlanto - occipital dislocations. also thyroid storms can occur intraoperatively, as 50% of the patients with osteogenesis imperfecta have increased levels of thyroxine. patients should be positioned carefully, with adequate padding as fractures and dislocations are very common in osteogenesis imperfecta. in a patient given general anaesthesia, dislocations and fractures occurring intraoperatively may go unnoticed. patients of osteogenesis imperfecta have a tendency for bleeds in spite of having a normal coagulation profile and bleeding time. therefore, due precautions regarding any unexpected bleeding were taken in the form of availability of adequate blood, fresh frozen plasma and platelet concentrates. regional anaesthesia is the method of choice for patients with osteogenesis imperfecta in view of all the difficulties enumerated above, but when combined with laryngomalacia, securing the airway gains prime importance. when general anaesthesia is considered, meticulous attention is required with the use of neuromuscular blocking agents, inhalational agents, airway management, positioning of the patient and acute pain management. | sometimes anaesthesiologists come across rare congenital anomalies in their practice. the inherent complications associated with the disorder necessitate tailor - made approaches for providing anaesthesia to even seemingly simple surgical interventions. here, we share our experience of anaesthesia management of an infant with congenital laryngomalacia and recently diagnosed osteogenesis imperfecta type 1 who had presented to us with an acute abdomen for a semi - emergency herniotomy. |
due to the occurrence of the industrialization and urbanization without environmental care, toxic elements such as lead (pb), cadmium (cd), and arsenic (as), coming mainly from mining, industrial processes, pesticides, chemical fertilizers, and atmospheric deposition, have become a major source of environmental contamination. toxic elements are considered highly hazardous to human health and they may cause acute or chronic poisoning. chronic exposure to lead has been associated with the induction of pathological changes and damage in organs and central nervous system, leading to lower intelligence quotient in children. cadmium is highly toxic to the kidneys and this metallic element is considered as carcinogenic. besides, cadmium may cause bone mineralization, osteoporosis being a critical effect resulting from this element exposure. arsenic is also considered as carcinogenic, and the majority of its chronic exposure reports are focused on skin problems like pigmentation and keratosis [1, 2 ]. because of the high soil mobility and availability of the total arsenic, cadmium, and lead derived from the human activities and natural sources, there is a general concern about their phytotoxicity and risks to organisms, as they are rapidly able to spread out at different levels in the food chain. it has been shown that plants growing in soils contaminated with toxic elements are not capable of preventing their uptake and accumulation in the plant tissue, but are capable of restricting them only. thus, the foods contaminated with metals have turned out to be serious problem due to the potential bioaccumulation in biosystems through contaminated water and soil. this circumstance is associated with the fact that some toxic elements are slowly eliminated from the human body, and they tend to accumulate in different tissues such as liver, muscles, and bones, threatening the human health. rice (oryza sativa l.) is one of the most consumed cereals in the world, and it is part of the staple diet of the world population ; and it is considered as the most important source of nutrients for billions of people around the world. rice provides 20.0% of energy and 15.0% of the daily requirement of protein for adults. brazil is the largest non - asian rice producer in the world, and the average consumption of this cereal per person is nearly 25.0 kgyear [1, 5 ]. according to the brazilian ministry of agriculture - livestock and food supply, brazil imported 372,567 tons of rice and exported 961,473 tons of the cereal in 2015. high concentrations of toxic elements are found in rice when compared to other plants grown under the normal conditions. many toxic elements ' accumulation in rice is associated with the plant characteristics and its cultivation, as it is usually grown in flooded or very humid areas, which optimize the transfer of such elements from the soil to the plant. only fish and seafood may carry higher concentrations of arsenic than rice ; however, while arsenic in rice occurs mainly as inorganic arsenic species, which are very toxic, arsenic in fish and seafood occurs primarily as organic species, which are less toxic [8, 9 ]. in this context, the scope of this study was to investigate a suitable method for rice sample preparation, as well as to validate a method for monitoring the concentration of total arsenic, cadmium, and lead, in rice using inductively coupled plasma mass spectrometry (icp - ms). the proposed method was applied for analyzing different rice types (polished, brown, and parboiled) coming from various brazilian regions in order to investigate whether they are in accordance with the national legislation, aiming at public health promotion. high purity deionized water (resistivity 18.2 m cm) from a millipore water purification system (bedford, ny, usa) was used throughout this study. lead (pb), cadmium (cd), arsenic (as), germanium (ge), indium (in), and rhenium (re) at 1000 g ml standard solutions, produced according to the iso guide 34, were acquired from inorganic ventures (christiansburg, va, usa). all of the employed reagents were of analytical grade. suprapur hno3 (65.0%) and h2o2 (30.0%) used in the digestion procedures were acquired from merck (darmstadt, hesse, germany). instrumental daily performance solution was purchased from perkinelmer (shelton, ct, usa). certified reference material irmm 804 rice flour was acquired from the joint research centre institute for reference materials and measurements (geel, antwerp, belgium). external calibration was performed using a five - point analytical curve, prepared by diluting the individual arsenic, cadmium, and lead standards with 5.0% (v / v) hno3. analytical curve concentrations ranged from 1.0 to 40, 1.2 to 24, and 1.0 to 20 g l for arsenic, cadmium, and lead, respectively. a multielement (germanium for arsenic, indium for cadmium, and rhenium for lead) internal standard solution with 5 g l of each element in 0.2% (v / v) hno3 solution was prepared by serial dilution of 1000 g ml monoelement stock solutions. internal standard solution was added in - line to the analyzed solutions through a mixing tee, used to blend in the internal standards with the samples after the peristaltic pumping and before the nebulizer. all of the measurements were conducted using an icp - ms (elan drc ii, perkinelmer) instrument, equipped with a glass meinhard (golden, co, usa) nebulizer and a cyclonic glass spray chamber. a standard 2.0 mm i d quartz injector and pt sampler (1.10 mm orifice diameter) and skimmer (0.9 mm orifice diameter) cones were used. standard, blank, and sample solutions were delivered using a s10 (perkinelmer) autosampler. l of mg, in, u, ce, and ba (perkinelmer). according to the instrument manufacturer, the following parameters were evaluated during the daily performance analysis : sensitivity (mg, in, and u), doubly charges (ba), and oxides (ce) formation. sample preparation procedure is a critical point for the success of the analysis, being considered an important source of error in analytical method development. in the present study different sample preparation procedures were investigated in order to check their suitability for rice decomposition aiming at determining the total arsenic, cadmium, and lead concentrations by means of icp - ms. a rice package (1 kg) of a given brand randomly selected was acquired in a market located in so paulo city, sp, brazil. at first, the samples were weighed using an analytical balance (shimadzu, kyoto, japan) and then grinded in an ika analytical mill (staufen, baden - wrttemberg, germany), except when performing the procedure carried out in the muffle furnace, where the entire grain was ashed. for investigating the analytes recovery for the various sample preparation procedures, the samples were spiked using arsenic, cadmium, and lead aqueous solutions. for each sample preparation procedure, three independent replicates of the sample were analyzed, and the respective procedural blanks were considered in the final results. samples were fortified in order to get final concentrations ranging from 8.0 to 30.0 g l (within the calibration curves concentration range) for all the analyzed elements in the final sample solutions. laboratory standard procedure for food samples mineralization was performed using a fornitec (so paulo, sp, brazil) muffle furnace. in a porcelain capsule, 2.0 g of the sample was weighted and 2 ml of 60.0% mg(no3)2 was added. the samples were initially ignited in a bunsen burner, and then they were taken into a muffle furnace with a heating ramp of 150c until reaching 420c, maintaining this temperature for 4 h. after cooling, 1 ml of hno3 was added and allowed to dryness on a heating plate. samples returned to the muffle furnace at 420c until reaching the complete destruction of the organic matter. samples were spiked in order to obtain a final concentration of 9.6 g l for arsenic, cadmium, and lead in 50 ml of at 5% (v / v) hno3. for the metallic block, 1 g of the sample was weighted in a polytetrafluorethylene (ptfe) flask. hno3 (1 ml) and h2o2 (2 ml) were used as reagents, and an overnight predigestion step was performed. digestion was performed in a marconi (piracicaba, sp, brazil) metallic block at 100c for 5 hours. samples were spiked in order to get a final concentration of 16.0, 9.6, and 8.0 g l of arsenic, cadmium, and lead, respectively, in 25 ml of deionized water. for digesting on the hot plate, 0.5 g of the sample was weighted in an erlenmeyer flask and 1 ml of hno3 and 2 ml of h2o2 were added. the mixture was left overnight and then heated on a hot plate (marconi) at 130c for 2 h. samples were spiked in order to get a final concentration of 8.0 g l of the elements in the sample solution (volume completed to 25 ml by adding deionized water). for the digestion assisted by microwave radiation, the method published by batista and coworkers was performed with some modifications. in the present study, 0.5 g of rice sample was weighted and transferred to the ptfe flask specific for the microwave oven used (ethos one from milestone, sorisole, bergamo, italy). two ml of hno3, 2 ml of h2o2, and 4 ml of h2o were added to the sample in the flask after an overnight predigestion step. the following program was run : 1000 w at 100c (5 min. samples were spiked in order to reach a final concentration of 30.0, 10.0, and 10.0 g l of arsenic, cadmium, and lead, respectively, in the final sample solution (volume completed to 25 ml by adding deionized water). for the method validation, the sample solution obtained from digestion in microwave oven was selected due to the lesser time consumption involved and the lower blank values. the analytical method validation was performed by considering the limit of detection (lod), limit of quantification (loq), linearity, precision (repeatability), and relative bias. lods and loqs were established as three and ten times, respectively, the standard deviation of six rice samples independently digested considered as having approximately 1 g l of arsenic and concentration of cadmium and lead < loq in the final sample solution. the final values of both parameters were calculated taking into account the samples dilution factor and the weight. linearity was established by preparing the calibration curves of all of the target elements by employing an unweighted least - squares linear regression. relative bias and repeatability of the method were evaluated by analyzing seven replicates of the certified reference material irmm 804 rice flour, for determining arsenic, cadmium, and lead. relative bias was obtained as the percentage difference between obtained and certified values, while the repeatability was calculated as relative standard deviation (rsd%). to evaluate the analytical method performance for determining the arsenic, cadmium, and lead in different rice types samples consumed by the brazilian population, 37 rice samples from different brands and lots were collected from various states of the country (cear, esprito santo, gois, paraba, rio grande do sul, rondnia, and so paulo). samples were collected by the health surveillance system from 2013 to 2015 and sent to the inorganic contaminants laboratory - adolfo lutz institute. they consisted of 27 polished rice samples, two parboiled rice samples, and eight brown rice samples. expanded uncertainty estimation (uc) for the obtained results was calculated according to the criteria described in eurachem / citac. for this evaluation, the following parameters were considered : analytical curve uncertainty associated with the linear least - square fitting procedure ; volumetric flasks calibration and temperature effect on the volumetric measurement ; and analytical balance calibration. expanded uncertainty was determined by multiplying the coverage factor (k) and the combined uncertainty (uc) : uc = k uc, considering the coverage factor k = 2, for a confidence level of 95.45%. the well - known polyatomic interference caused by arcl was considered in the total arsenic determination by using arithmetic correction. according to t - test (p = 0.005, n = 4) similar result was found by cai and coworkers for citrus leaves standard reference materials digested with hno3 and h2o2, reagents also used in the present study. this result can be explained by the fact that only 2% of the total chlorine contents in rice plants are present in the edible part. table 2 shows the analytes recovery in the spiked samples submitted to the different preparation procedures for determining total arsenic, cadmium, and lead in rice. recoveries varied from 81.0 to 115.0%, indicating that results for all elements determined in the sample submitted to different preparation procedures were within the percentages recommended by fda, which comprise the range between 80.0 and 120.0%. this finding highlights the possibility of using all of the sample preparation procedures employed in the present study, including arsenic determination whose volatility is well known. soylak and coworkers also compared various sample preparation procedures for determination of trace elements in turkey spices. recoveries ranged from 95.0 to 97.0% for muffle oven, 99.0 to 95.0% for hot plate, and 98.0 to 103.0% for microwave oven ; and these results are comparable to those found in the present investigation. the results found in the present study are in agreement with the data reported by wei., where acid digestion assisted by microwave radiation was carried out, reaching recoveries of 97.0, 106.0, and 103.0% for total arsenic, cadmium, and lead, respectively. nowadays, researches on sample preparation procedures have advanced, leaning more and more to the microwave technology, becoming difficult to find present - day publications using other procedures. the advantages of microwave technology are undeniable, but the use of less resourceful instruments may eventually be appropriate, providing good results for the analytes under study. the overall performance of the proposed method for total arsenic, cadmium, and lead determination in rice is summarized in tables 3 and 4. lods and loqs results were considered acceptable as the values were below the limits established by the brazilian legislation for arsenic, lead, and cadmium for rice and its derivatives : 0.30 mg kg, 0.20 mg kg, and 0.40 mg kg, respectively. the linearity of the calibration curve was evaluated by investigating the correlation coefficient (r) of the calibration curves. the r values were higher than 0.998 for all of the analytes, as shown in table 3, and the regression analyses showed that the linear correlation between concentration and signal intensity was significant (p < 0.05). relative bias (table 4) was assessed through the difference between the mean value of obtained results and the certified values. for all elements, the rsd (repeatability) was in compliance with the european commission decision 2002, and it did not exceed 10.0%. therefore, as expected, the use of microwave oven for rice acid digestion was appropriate for determining the total arsenic, cadmium, and lead concentrations in rice using icp - ms. the above was method applied for quantifying the concentration of total arsenic, cadmium, and lead in 37 rice samples (polished, parboiled, and brown rice). results are summarized in table 5. according to table 5, of 37 analyzed samples, 35 showed total arsenic concentration higher than the loq, ranging from 0.061 to 0.660 mg kg. in two polished rice samples, the average total arsenic concentration in parboiled rice was lower than that found in other rice types (0.071 mg kg), followed by polished rice (0.130 mg kg) and brown rice, which had the highest arsenic concentration (0.224 mg kg). in one brown rice sample, collected in the state of so paulo, the total arsenic concentration was 0.660 mg kg. this value was higher than that established by the brazilian legislation and the codex alimentarius, which is 0.30 mg kg. total arsenic concentrations were in agreement with the maximum level established for total arsenic in raw rice. total arsenic mean concentrations found in the present study were in agreement with those cited in the literature ; and the respective authors pointed out the evident occurrence of the highest arsenic concentrations in brown rice. this occurs owing to the fact that rice plants concentrate this element in the outer layer of the grain, in the region corresponding to the pericarp. a great amount of arsenic is removed during the rice polishing [21, 5052 ]. besides, variation in the arsenic concentration may occur due to different cultivars, geography, environment, water quality, and growth conditions [21, 24, 25, 29, 30, 37, 51, 5356 ]. the results obtained in the present work are comparable to others in investigations performed in brazil, as shown in table 6. usually, the data from several studies presented the same tendency, the total arsenic concentration being higher in brown rice, followed by polished and parboiled rice. the results found in this study on the total arsenic contents were also in agreement with those previously reported for rice analyzed in other countries (table 7). the exception is for arsenic concentration found in rice cultivated in bangladesh, one of the countries that have been mostly vulnerable to arsenic exposure, causing a serious public health problem [33, 34, 53 ]. in the 1970s, the plumbing pipes contaminated by arsenic were installed in the country, and it caused the contamination of the water consumed by the population. in consequence, it originated the contamination water used for rice irrigation. with respect to cadmium, only one polished rice sample had cadmium concentration above the loq (0.042 0.008 mg kg). in the other rice samples, cadmium concentration was below the lod in 17 samples, while in 19 samples it was below the loq. in none of the analyzed samples, cadmium concentrations exceeded the maximum value of 0.40 mg kg allowed by the brazilian legislation and the codex alimentarius. thus, referring to cadmium contamination, the polished, parboiled, and brown rice samples were considered as satisfactory for consumption. cadmium concentration found in the analyzed samples were similar to those reported in other studies carried out by brazilian investigators, as outlined in table 6. in all of the investigations, the cadmium levels were lower than those recommended by the brazilian legislation. the same is observed when the data on rice from other countries are compared (table 7). however, higher cadmium concentrations in rice have been reported, which can be attributed to the soil contaminated by metals in mining and industrial areas [31, 56, 58, 59 ]. as for lead, in 14 polished rice and one parboiled rice samples lead concentration was below the lod, and 11 polished rice and four brown rice samples had lead concentrations below the loq. in one parboiled rice (0.127 mg kg), two polished rice (0.0870.115 mg kg), and four brown rice (0.0650.124 mg kg) samples, the lead concentrations were above loq, with mean values of 0.101 mg kg for polished rice and 0.104 mg kg for brown rice. in all of the analyzed samples, the results indicated that the lead concentrations were lower than the maximum value allowed, which is 0.20 mg kg, according to the brazilian legislation and european community. thus, regarding to lead, the brazilian rice evaluated in this study was shown to be suitable for consumption. the lead concentrations found in brazilian rice (table 6) and other countries (table 7) were comparable, not exceeding the maximum value established by the brazilian legislation. higher lead contents found in some investigations might indicate the soil contamination by fertilizers, industrial, and/or mining activities [31, 56, 59 ]. regarding the sample preparation, all of the procedures (ashing in muffle furnace, acid digestion under heating on metallic block or hot plate, and acid digestion assisted by microwave radiation) led to good results (recoveries ranging from 80.0 to 120.0%). this information is important for laboratories that execute rice analyses, as the sample preparation may be cheaper. the parameters obtained for validation have demonstrated that the method fits for its purpose, which is to quantify the total arsenic, cadmium, and lead in complying with the brazilian legislation limits. regarding the parboiled, polished, and brown rice samples analyzed, the concentrations of total arsenic, cadmium, and lead were lower than the established limits according to the brazilian legislation, codex alimentarius, and european community, except for total arsenic in one sample. the other analyzed rice samples were considered satisfactory for human consumption regarding the investigated elements. the data obtained indicated that only the consumption of brown rice can represent risk to brazilian population. therefore, it is necessary to establish programs to focus attention on this type of rice aiming at promoting the public health, since rice might be an important route for human exposure to toxic elements, particularly in populations following diets based on this cereal, as is the case of the brazilian population. | this study is aimed at investigating a suitable method for rice sample preparation as well as validating and applying the method for monitoring the concentration of total arsenic, cadmium, and lead in rice by using inductively coupled plasma mass spectrometry (icp - ms). various rice sample preparation procedures were evaluated. the analytical method was validated by measuring several parameters including limit of detection (lod), limit of quantification (loq), linearity, relative bias, and repeatability. regarding the sample preparation, recoveries of spiked samples were within the acceptable range from 89.3 to 98.2% for muffle furnace, 94.2 to 103.3% for heating block, 81.0 to 115.0% for hot plate, and 92.8 to 108.2% for microwave. validation parameters showed that the method fits for its purpose, being the total arsenic, cadmium, and lead within the brazilian legislation limits. the method was applied for analyzing 37 rice samples (including polished, brown, and parboiled), consumed by the brazilian population. the total arsenic, cadmium, and lead contents were lower than the established legislative values, except for total arsenic in one brown rice sample. this study indicated the need to establish monitoring programs for emphasizing the study on this type of cereal, aiming at promoting the public health. |
the term, postcardiac arrest syndrome (pcas), describes organ damage from whole - body ischaemia and reperfusion after return of spontaneous circulation (rosc) caused by cardiac arrest (ca). mortality rates from pcas1 2 differ by country, region and facility.3 in the west, in - hospital mortality rates after transfer to hospital are 6070%.4 5 in japan, patients are given cardiopulmonary resuscitation (cpr) and transported to hospital even if a long time has passed since the ca, so in - hospital mortality rates are as high as around 90%.6 a recent study has reported the following factors related to poor outcome with pcas : (1) myoclonic status within 24 h of resuscitation or during three - day observation, (2) loss of light reflex or corneal reflex and (3) no motor response or extension in response to pain.7 all these factors were at 24 h after rosc and were outcome predictors for survival or mortality. pcas has high in - hospital mortality rates, so a key challenge from both a medical and social perspective is the clarification of factors to predict good outcomes at an early stage, rather than simply focusing on factors relating to survival and mortality immediately after rosc in patients with pcas. a smooth transition to life support8 9 is important if outcome in patients with out - of - hospital ca is to be improved. for cpr, transition to life support starts when an individual is found to have suddenly collapsed or to be unresponsive, immediately raising the suspicion of ca. once the possibility of ca arises, the emergency services are contacted for help (119 ; emergency call number in japan) and efforts are made to ensure the rapid arrival of specialists or emergency personnel bringing resuscitation equipment and an automated external defibrillator (aed). such equipment is used to perform basic life support (bls) rapidly, followed by advanced life support (als). after rosc, the patient must receive intensive care at a specialist institution as necessary, which should increase the likelihood of good outcome.10 good neurological outcome must be increased with successful achievement of the chain of survival, that is, rapid contact to the emergency services, rapid start of cpr, bls using electrical defibrillation, als and post - ca care.9 however, few studies showed which factor would be the most important. in this research, we performed a retrospective cohort study using a database and medical records of patients with out - of - hospital cardiogenic (including suspected cardiogenic) ca transported by ambulance to our hospital. the objective of the research was to clarify what was the factor to have the relationship of good neurological outcome, based on outcome - related factors before hospital, and procedures / treatments performed after arrival at hospital using an utstein style template11 in patients with pcas admitted to the intensive care unit (icu). when a 119 call is received, the emergency command center in the tokyo fire department (tfd) dispatches an emergency vehicle to the scene from the nearest fire station. emergency services teams supplied by tokyo 's public services comprise three emergency services personnel who are usually on duty across a 24-hour schedule. at least one of these team members is a qualified emergency medical technician (emt). emts can treat individuals experiencing ca at the scene, using bls ; securing an airway and providing a concentrated oxygen supply using bag - valve masks, laryngeal masks, oesophageal - tracheal combitubes (oesophageal obdurator airway) and tracheal tubes ; securing a venous route for crystalloid solutions ; intravenous administration of adrenaline ; and defibrillation using an aed. of these procedures, special procedures are defined as (1) securing an airway using equipment (oesophageal obdurator airway or laryngeal mask, securing an airway using a tracheal tube, and tracheal intubation by an individual accredited in this procedure) ; (2) securing a venous route and transfusion via a venous route using the lactate ringer 's solution and (3) drug administration using adrenaline (adrenaline administration by an individual accredited in drug administration). the box below shows the standards for performing special procedures at the scene by a emt (box 1). box 1standards for first - aid activities in special procedures performed by emergency medical technicians tokyo fire department first aid standardssecuring an airway laryngeal mask, oesophageal obdurator airway double balloon tube in state of cardiac arrest (ca) consciousness level japan coma scale 300, respiratory function halted tracheal tube in state of ca and has the following: choking on a foreign object if another emergency attending physician deems it necessarytransfusion by securing a peripheral venous route patients for securing venous access securing venous access is performed in the following case injured / sick individual in a state of ca comatose and with respiratory or cardiopulmonary arrest methods for securing venous access using a venous indwelling needle or a winged needle, puncture the site below, and transfuse lactate ringer 's solutionpharmacotherapy patient aged 8 years or older, or with a body weight of 25 kg or above, in a state of ca, and comply with the following; injured / sick individual presenting with ventricular fibrillation or pulseless ventricular tachycardia. injured / sick individual presenting with pulseless electrical activity injured / sick individual presenting with asystole standards for first - aid activities in special procedures performed by emergency medical technicians tokyo fire department first aid standards laryngeal mask, oesophageal obdurator airway double balloon tube in state of cardiac arrest (ca) consciousness level japan coma scale 300, respiratory function halted in state of ca and has the following : choking on a foreign object if another emergency attending physician deems it necessary transfusion by securing a peripheral venous route patients for securing venous access securing venous access is performed in the following case injured / sick individual in a state of ca comatose and with respiratory or cardiopulmonary arrest methods for securing venous access using a venous indwelling needle or a winged needle, puncture the site below, and transfuse lactate ringer 's solution patient aged 8 years or older, or with a body weight of 25 kg or above, in a state of ca, and comply with the following ; injured / sick individual presenting with ventricular fibrillation or pulseless ventricular tachycardia. injured / sick individual presenting with pulseless electrical activity injured / sick individual presenting with asystole this study was approved by the clinical research institutional review board (irb) of nihon university school of medicine itabashi hospital. study subjects were out - of - hospital ca patients (including those suspected of cardiogenic ca) where the cause was cardiogenic (including suspected cardiogenic cases) and who had pcas after rosc. the study enrolled patients with pcas transported to the emergency and critical care center of this hospital between 1 january 2008 and 31 december 2010. data on the ca patients were tabulated in accordance with the utstein style, and aggregate analyses were performed on the basis of the hospitalisation register. these aggregate analyses were subjected to peer review through a conference between the emergency medicine specialists and cardiovascular specialists the day after the ca patient was transported to the hospital, evaluated using the utstein style, and the data populated into a database. this study defines out - of - hospital ca patient as individuals where ca was confirmed at the scene by emt after a 119 call was made. there are no clear standards governing the performance of coronary angiography after rosc, but patients with suspected acute coronary syndrome based on ecg after rosc, echocardiography and other tests, were tested using coronary angiography before being admitted to the icu, and percutaneous coronary intervention (pci) was performed in the vessels responsible. in our hospital, therapeutic hypothermia (th) is indicated for cardiogenic (including suspected cardiogenic) ca patients in a coma after rosc and on admission to the icu. the temperature of the patients was maintained at 34c for 24 h from the start of cooling. the patients were gradually rewarmed from 34c to 36c for 24 h. exclusion criteria for th in pcas are (1) unstable haemodynamics even with the use of vasopressors (mean blood pressure < 60 mm hg or systolic blood pressure < 90 mm hg), (2) inadequate oxygenation (pao2/fio2 ratio < 200), (3) patients in the end - stage of chronic disease and (4) where family consent is not given.12 evaluation of the outcome from pcas was performed when the patient was discharged or transferred from this hospital. a good outcome was defined as cpc 1 (good recovery) or 2 (moderate disability), and a poor outcome was defined as cpc 3 (severe disability), 4 (vegetative state), or 5 (death).11 this research analysed the following factors related to outcome based on medical records and a ca patient database using the utstein style : (1) age, (2) gender, (3) witness present, (4) bystander cpr performed, (5) ecg waveform at the scene when emergency personnel arrived, (6) time interval from receipt of the 119 call to arrival of emergency personnel, (7) time interval from receipt of the 119 call to arrival at hospital, (8) prehospital defibrillation performed, (9) special procedures performed by emts and (10) time interval from receipt of the 119 call to rosc. the following factors relating to treatment after hospitalisation were also investigated : (1) coronary angiography and pci performed and (2) th performed. in order to compare factors related to neurological outcome in pcas, the primary endpoint was defined as a good neurological outcome (cpc 1, 2) or poor neurological outcome (cpc 3, 4, 5) when patients with pcas and admitted to the icu were discharged or transferred from our hospital. for the secondary endpoint of surviving to hospital discharge, we compared surviving to hospital discharge (cpc 1, 2, 3, 4) and death (cpc 5). statistical analysis was performed using stat - view v.5.0 (sas institute, cary, north carolina, usa ; 1998). student t test was used to compare continuous variables, and fisher 's exact test was used to compare categorical data. using these tests, we compared good and poor neurological outcome and compared survival and death. to predict outcome, we performed multiple logistic regression with a forced entry method, and calculated the ors and 95% cis using the dependent variables of good or poor neurological outcome and survival or death, and the independent variables from the categorical data and the continuous variable data. the forced entry method was used for age and gender as explanatory variables, but these are not shown in the table. this study was approved by the clinical research institutional review board (irb) of nihon university school of medicine itabashi hospital. study subjects were out - of - hospital ca patients (including those suspected of cardiogenic ca) where the cause was cardiogenic (including suspected cardiogenic cases) and who had pcas after rosc. the study enrolled patients with pcas transported to the emergency and critical care center of this hospital between 1 january 2008 and 31 december 2010. data on the ca patients were tabulated in accordance with the utstein style, and aggregate analyses were performed on the basis of the hospitalisation register. these aggregate analyses were subjected to peer review through a conference between the emergency medicine specialists and cardiovascular specialists the day after the ca patient was transported to the hospital, evaluated using the utstein style, and the data populated into a database. this study defines out - of - hospital ca patient as individuals where ca was confirmed at the scene by emt after a 119 call was made. there are no clear standards governing the performance of coronary angiography after rosc, but patients with suspected acute coronary syndrome based on ecg after rosc, echocardiography and other tests, were tested using coronary angiography before being admitted to the icu, and percutaneous coronary intervention (pci) was performed in the vessels responsible. in our hospital, therapeutic hypothermia (th) is indicated for cardiogenic (including suspected cardiogenic) ca patients in a coma after rosc and on admission to the icu. the temperature of the patients was maintained at 34c for 24 h from the start of cooling. the patients were gradually rewarmed from 34c to 36c for 24 h. exclusion criteria for th in pcas are (1) unstable haemodynamics even with the use of vasopressors (mean blood pressure < 60 mm hg or systolic blood pressure < 90 mm hg), (2) inadequate oxygenation (pao2/fio2 ratio < 200), (3) patients in the end - stage of chronic disease and (4) where family consent is not given.12 evaluation of the outcome from pcas was performed when the patient was discharged or transferred from this hospital. a good outcome was defined as cpc 1 (good recovery) or 2 (moderate disability), and a poor outcome was defined as cpc 3 (severe disability), 4 (vegetative state), or 5 (death).11 this research analysed the following factors related to outcome based on medical records and a ca patient database using the utstein style : (1) age, (2) gender, (3) witness present, (4) bystander cpr performed, (5) ecg waveform at the scene when emergency personnel arrived, (6) time interval from receipt of the 119 call to arrival of emergency personnel, (7) time interval from receipt of the 119 call to arrival at hospital, (8) prehospital defibrillation performed, (9) special procedures performed by emts and (10) time interval from receipt of the 119 call to rosc. the following factors relating to treatment after hospitalisation were also investigated : (1) coronary angiography and pci performed and (2) th performed. in order to compare factors related to neurological outcome in pcas, the primary endpoint was defined as a good neurological outcome (cpc 1, 2) or poor neurological outcome (cpc 3, 4, 5) when patients with pcas and admitted to the icu were discharged or transferred from our hospital. for the secondary endpoint of surviving to hospital discharge, we compared surviving to hospital discharge (cpc 1, 2, 3, 4) and death (cpc 5). statistical analysis was performed using stat - view v.5.0 (sas institute, cary, north carolina, usa ; 1998). student t test was used to compare continuous variables, and fisher 's exact test was used to compare categorical data. using these tests, we compared good and poor neurological outcome and compared survival and death. to predict outcome, we performed multiple logistic regression with a forced entry method, and calculated the ors and 95% cis using the dependent variables of good or poor neurological outcome and survival or death, and the independent variables from the categorical data and the continuous variable data. the forced entry method was used for age and gender as explanatory variables, but these are not shown in the table. of these, 950 were cardiogenic (including suspected cardiogenic) ca patients. excluding patients who suffered from ca inside a hospital or patients who were transported to this hospital after rosc left 915 patients. a total of 271 patients achieved rosc and 227 patients were admitted to the icu with pcas (159 males, 68 females). of the 227 patients admitted to the icu with pcas, 66 (29.1%) were treated with pci and 70 (30.8%) were treated with th. th was not performed in 157 patients because of (1) improvements in the level of consciousness (11 patients), (2) unstable haemodynamics (142 patients), (3) inadequate oxygenation (2 patients), or (4) end - stage chronic disease (2 patients). of the 227 pcas patients admitted to the icu, 29 (12.8%) achieved a good neurological outcome and 198 (87.2%) had a poor neurological outcome (figure 1). table 1 shows the characteristics of the pcas patients with a good neurological outcome and with a poor neurological outcome. the good neurological outcome group of patients with pcas at icu was young, included many men, and included a statistically significant higher proportion of witnesses to the patient 's collapse at the scene. a significantly higher (p<0.001) number of patients where the initial ecg showed ventricular fibrillation (vf) or pulseless ventricular tachycardia (pvt) achieved a good neurological outcome. of the prehospital care, there was a high proportion of patients receiving defibrillation after the 119 call and while being transported. however, there was no statistically significant difference in the proportion of patients receiving special procedures at the scene by emts. no statistically significant difference was seen in the time interval to the arrival of emergency personnel or the time interval from receipt of 119 call to arrival of the ca patient at hospital. the time interval from receipt of 119 call to rosc was significantly shorter in the good neurological outcome group. looking at the factors relating to the course after hospitalisation, the group with a good neurological outcome had a significantly higher proportion of patients receiving coronary angiography / pci or th. of these prehospitalisation and posthospitalisation factors, analysis of the independent variables related to neurological outcome using multiple logistic regression showed that there was only a relationship with the time interval from receipt of the 119 call to rosc ; a longer time to rosc (or : 0.86 ; 95% ci 0.81 to 0.92 ; p<0.001) was correlated with cpc 3, 4, 5 (poor neurological outcome) (table 2). comparison of factors related to neurological outcome in patients with postcardiac arrest syndrome special procedures refers to (1) securing an airway using equipment (oesophageal obdurator airway or laryngeal mask, securing an airway using a tracheal tube, and tracheal intubation by an individual accredited in this procedure) ; (2) securing a venous route and transfusion via a venous route using the crystalloid solution lactate ringer 's solution and (3) drug administration using adrenaline (adrenaline administration by an individual accredited in drug administration). cpc, cerebral - performance category, cpr, cardiopulmonary resuscitation ; pci, percutaneous coronary intervention ; pvt, pulseless ventricular tachycardia ; rosc, return of spontaneous circulation. factors related to a good neurological outcome in patients with postcardiac arrest syndrome special procedures refers to (1) securing an airway using equipment (oesophageal obdurator airway or laryngeal mask, securing an airway using a tracheal tube, and tracheal intubation by an individual accredited in this procedure) ; (2) securing a venous route and transfusion via a venous route using the crystalloid solution lactate ringer 's solution and (3) drug administration using adrenaline (adrenaline administration by an individual accredited in drug administration). cpr, cardiopulmonary resuscitation ; pci, percutaneous coronary intervention ; pvt, pulseless ventricular tachycardia ; rosc, return of spontaneous circulation. ca, cardiac arrest ; cpc, pittsburgh cerebral - performance categories ; icu, intensive care unit ; rosc, return of spontaneous circulation. for the secondary endpoints, tables 3 and 4 show the results when the patients with pcas admitted to the icu were divided into two groups according to outcome : survival and death. there were significantly more survivors when the emergency personnel arrived quickly, and significantly more survivors when emts performed special procedures at the scene. of these prehospital and posthospital factors, the independent factors related to surviving to hospital discharge that correlated to a good survival outcome were bystander cpr by a witness, special procedures performed by a emt, and a shorter time between receipt of the 119 call and rosc (table 4). comparison of factors related to survival and death in patients with postcardiac arrest syndrome special procedures refers to (1) securing an airway using equipment (oesophageal obdurator airway or laryngeal mask, securing an airway using a tracheal tube, and tracheal intubation by an individual accredited in this procedure) ; (2) securing a venous route and transfusion via a venous route using the crystalloid solution lactate ringer 's solution and (3) drug administration using adrenaline (adrenaline administration by an individual accredited in drug administration). cpc, cerebral - performance category, cpr, cardiopulmonary resuscitation ; pci, percutaneous coronary intervention ; pvt, pulseless ventricular tachycardia ; rosc, return of spontaneous circulation. factors related to survival in patients with postcardiac arrest syndrome special procedures refers to (1) securing an airway using equipment (oesophageal obdurator airway or laryngeal mask, securing an airway using a tracheal tube, and tracheal intubation by an individual accredited in this procedure) ; (2) securing a venous route and transfusion via a venous route using the crystalloid solution lactate ringer 's solution and (3) drug administration using adrenaline (adrenaline administration by an individual accredited in drug administration). cpr, cardiopulmonary resuscitation ; pci, percutaneous coronary intervention ; pvt, pulseless ventricular tachycardia ; rosc, return of spontaneous circulation. in this research, as in previously reported studies, there were significantly more patients achieving a good neurological outcome even with pcas where there were the prehospital factors of bystander cpr and vf / pvt on initial ecg and the posthospitalisation treatment - related factors of coronary angiography / pci and th after rosc. however, of note in this study was the finding that while it is important for a witness to the event to perform bystander cpr and emts to perform special procedures in order to increase survival rates in patients with pcas, this alone is insufficient to achieve a good neurological outcome. the key is how to reduce the time interval from receipt of the 119 call to rosc. hayakawa reported that time from collapse to rosc was one of the most important prognostic indicators for the patients after rosc. the present study also showed the importance of ischaemic time interval for the patients with pcas. generally, the outcome for ca patients treated with th is most strongly correlated with the time from collapse with ca to rosc (median 25 min), regardless of whether the initial ecg showed vf, asystole, or pulseless electrical activity.14 for neurological outcome, however, 57.9% of ca patients achieving rosc in 25 min or less had a good neurological outcome, compared with zero patients with a good outcome where time to rosc was over 25 min even with th. the same study also showed that a good neurological outcome was only achieved in 21.2% of patients where the time to rosc was 25 min or less but who were not treated with th. this suggests that a good outcome is influenced by the length of time the patient experiences cerebral ischaemia during the ca and cpr. the two cornerstone studies proved the efficacy of th for pcas patients.15 16 however, the present study showed that th was not associated with a good neurological outcome. one of the inclusion criteria of these two studies was vf / pvt as the initial cardiac rhythm.15 16 in the present study, the criteria of th included not only vf / pvt but also other non - shockable rhythm. for the pcas patients with non - shockable as the initial cardiac rhythm, th was reported not to be associated with good outcomes.17 the reason why th was not an independent factor for good neurological outcomes in the present study may be the difference in the criteria for initial cardiac rhythm. the design of the present study could not elucidate the answer to the efficacy of th. further study is needed. with the emergency medicine system in japan, it can be unclear as to when precisely the ca occurred, and the patient transported to hospital even if a long time has passed since the ca. similar results are obtained even in investigations restricted to only those patients with pcas where there was a witness to the event. the utstein style11 emphasises the time that has passed since the emergency call, so this research also calculated the time to rosc based on the time since the receipt of the 119 call rather than the time since the ca. the predicting score for survival consisted of immediate cause of ca, initial cardiac rhythm on ambulance arrival, presence of witnesses and bystander cpr and so on.1820 however, ischaemic time interval was not included in these scores. the collapse time was not an exact time and would be presumed in many cases. this may be the reason why the time interval from collapse to rosc was not included in these scores. in the present study we can show the effectiveness of the time interval from receipt of the 119 call to rosc, to predict a good neurological outcome for pcas patients, instead of the time interval from collapse to rosc. therefore, we may use the time from receipt of the call to rosc to create a predicting score for a good neurological outcome. this study showed that survival rates for patients with pcas are increased with bystander cpr and special procedures by emts, but the results suggested it may be even more important to try to reduce the time interval to rosc if the patient is to be a good neurological outcome. of particular interest is a study by yasunaga that analysed data from japan and showed that better outcomes can be achieved in more patients if bystander cpr is followed by als from physicians, rather than emts. according to yasunaga,21 special procedures performed by emts before hospital increase survival rates but his study supports the findings from another study by stiell.4 ambulances in japan have two emts providing cpr while the patient is being transported to hospital, so there may be limits to the amount of continuous bls or als they can provide inside the cramped vehicle and in a moving environment. dogs with ca and with no cpr for 5 min had 41% neurological deficit after resuscitation.22 cpr immediately after ca appears to be an essential factor from the aspect of brain resuscitation. the present study suggests cerebral blood flow may be insufficiently restored for the brain in the case of prolonged chest compression in cpr, because of attaining wide extent from 4% to 60% of normal level at standard external chest compression.23 the brain may have a time - sensitive vulnerability for whole - brain ischaemia even though cpr is performed. in studies to investigate lowering the body temperature by emergency personnel administering an infusion solution cooled to 4c to out - of - hospital ca patients either during cpr24 or after rosc,25 these techniques were shown to be safe even during cpr and effective in producing hypothermia even after rosc. these results suggest that in regions where it takes time to transport a patient to hospital, improved outcomes may be achieved through simple and effective methods to initiate th at the scene when rosc is achieved and thereafter. bystander cpr by a witness at the scene of the ca followed by special procedures performed by emergency personnel is important in increasing survival rates in patients with pcas. however, these factors are insufficient if the goal is to achieve a good neurological outcome. a good neurological outcome requires a shorter time interval from receipt of the 119 call to rosc. we should take measures to improve the emergency system for ca patients to achieve earlier rosc, and should develop brain protection during ca at the prehospital scene. | objectivefew studies have reported factors that result in a better neurological outcome in patients with postcardiac arrest syndrome (pcas) following return of spontaneous circulation (rosc). we investigated the factors affecting neurological outcome in terms of both prehospital care and treatments after arrival at hospital in patients with pcas.methodsthe study enrolled patients with cardiogenic cardiac arrest who were admitted to an intensive care unit after rosc with pcas. we investigated the association of the following factors with outcome : age, gender, witness to event present, bystander cardiopulmonary resuscitation (cpr) performed, ecg waveform at the scene, time interval from receipt of call to arrival of emergency personnel, time interval from receipt of call to arrival at hospital, prehospital defibrillation performed, special procedures performed by emergency medical technician, and time interval from receipt of call to rosc, coronary angiography / percutaneous coronary intervention (pci) and therapeutic hypothermia performed.resultsthe study enrolled 227 patients with pcas. compared with the poor neurological outcome group, the good neurological outcome group had a statistically significant higher proportion of the following factors : younger age, male, witness present, bystander cpr performed, first ecg showed ventricular fibrillation / pulseless ventricular tachycardia, defibrillation performed during transportation, short time interval from receipt of call to rosc, coronary angiography / pci and therapeutic hypothermia performed. of these factors, the only independent factor associated with good neurological outcome was the short time interval from receipt of the call to rosc.conclusionsin the present study, shortening time interval from receipt of call to rosc was the only important independent factor to achieve good neurological outcome in patients with pcas. |
defects have long been treated with durable dental materials, which all have a limited performance and eventually fail after a period of clinical service. pulp repair requires a sequence of cellular events resembling those involved in soft tissue wound healing. these events include chemotaxis, proliferation of mesenchymal cells at the site of injury and production of extracellular matrix. the mineralized reparative dentine, the ultimate evidence of pulp repair, is analogous to scar tissue formation in the connective tissues in other parts of the body. in the recent years, there has been a rising recognition that healing protocols for treatment of carious lesions are possible and clinicians no longer have to merely rely on surgical removal of the diseased tissue and placement of restorative materials. today, the use of biological molecules for the development of novel restorative treatment modalities in clinical dentistry is in sight. these modalities have potential applications in unexposed cavity preparations for protection of the pulp against the deleterious effects of dental materials by increasing the residual dentin thickness through reactionary dentinogenesis. also, these approaches may have potential applications in exposed pulp cases to restore the structural integrity of dentin by the induction of reparative dentinogenesis. such biological approaches may also have indications for use in the severely compromised dental pulps to seal the root canal in endodontic therapy. the dentine matrix serves as a potential reservoir of growth factors such as platelet - derived growth factor bb (pdgf - bb), transforming growth factor beta 1 (tgf-1) and other bio - active molecules, sequestered during dentinogenesis. these factors may be released by bacterial acids or dental materials during caries episodes or restorative treatments, and may contribute to dentine repair or regeneration. these molecules may have a role for potential use in dental therapy as bioactive agents for dentin - pulp repair or tissue engineering purposes. the non - collagenous matrix proteins may also serve as mediators of cell - matrix interactions, matrix maturation and mineralization. especially, the dentine matrix components released by edta etchants demonstrate significant morphogenetic activity and induce reparative dentinogenesis in vivo. it is generally accepted that dentin noncollagenous proteins (dncps) are involved in the promotion and regulation of dentin mineralization. also, dncps, composed of glycoproteins, sialoproteins, phosphoroteins, proteoglycans and growth factors, can promote cell differentiation [11 - 17 ]. when a carious lesion develops, the matrix - bound bioactive molecules such as tgf-1 family members may be released from the dentin by the activity of bacterial plaque acids, diffuse through the dentin, and induce odontoblast - like cell differentiation of potential progenitor cells in the pulp. previous experimental studies have highlighted the interactions between dentin and surrounding cells ; meanwhile evidence reveals that dentin molecules might function as regulatory signals for various mesenchymal stem cells to enhance the healing of injured pulp tissues. a more thorough understanding of how these signalling pathways are functionally linked can greatly help design therapeutic strategies targeting dental pulp stem cells (dpscs) in the dentin - pulp complex. considering the confirmed presence of direct dentin - pulp cell contact, we anticipate that concentration of different growth factors in dentin matrix may play a pivotal role in proliferation of dpscs during the first stage of pulp repair. therefore, this study sought to assess the effects of dentin matrix proteins, tgf-1 and pdgf - bb on cultured dpscs to better elucidate the process of tissue repair in teeth. phosphate buffered saline (pbs), fetal bovine serum (fbs), trypsin - edta and dulbecco s modied eagle s medium (dmem) were from gibco (paisley, uk). the dimethylsulfoxide (dmso), ethylenediaminetetraacetic acid (edta), phenylmethylsulfonyl fluoride (pmsf) and mtt and was from sigma - aldrich (steinheim, germany). recombinant human pdgf - bb and tgf-1 were from peprotech (hamburg, germany). all tissue culture plastic - wares were obtained from spl lifesciences (gyeonggi - do, south korea). isolation of dentine extracellular - matrix components dncps were isolated as explained by smith with some modifications. the extracted human teeth were obtained from the oral surgery department at the school of dentistry (shahid beheshti university of medical sciences) after obtaining informed patient consent. the teeth were stored in a saturated sodium chloride solution and then washed with water and air - dried. after soaking in ethanol for 20 h, the teeth were air - dried again. the root surfaces were prepared by removing the soft tissue residues using a surgical scalpel. the enamel and cementum were then removed by drilling with a high - speed diamond bur under water cooling. the remaining dentine was crushed into a fine powder using a percussion mill (spex 6700 freezer / mill, glen creston ltd., uk), cooled with dry ice and filtered through a 60 mm mesh sieve (veb metallweberei, germany). dentine matrix components were extracted from the powdered dentine using 10% edta solution (ph of 7.2). n - ethylmaleimide (nem) and 5 mm pmsf were also added to the solution. the demineralizing solution was changed every 48 h and the edta - soluble fraction in the supernatant was collected after centrifugation at 3000 rpm for 10 min (4 c, eppendorf, usa). the combined edta - soluble fractions over the 14 day period were transferred to dialysis sacs (sigma - aldrich, germany) and dialyzed exhaustively for 10 days against repeated changes of distilled water. the dialyzed extracts were lyophilized using a freeze dryer (mini - lyotrap, lte scientific ltd, oldham, uk). the dpscs were isolated from a healthy donor, cultured and expanded as previously described. the explants were stored in dmem containing 1% antibiotic - antimycotic and 10% fbs at 37 c in a humidied atmosphere with 5% co2 until proliferating cells became conuent. then, the digested cells with 0.25% trypsin were cultured at a low - cell density. proliferation potential and viability of dpscs treated or untreated with dncps, tgf-1 and/or pdgf - bb, two phases were performed. in the first phase, different concentrations of dncps (25 g / ml, 10 g / ml, 5 g / ml, 250 ng / ml, 10 ng / ml and 5 ng / ml) were added to dpscs, while the control group contained only the regular medium (dmem supplemented with 10% fbs and 1% antibiotic - antimycotic). in the second phase, the most efficient concentration of dncps resulted from phase one, was used to assess the behaviour of cells in presence of tgf-1, pdgf - bb and their combination with dncps. the concentrations of pdgf - bb and tgf-1 were selected based on previous studies, which indicated these to produce maximal stimulatory effect [22 - 24 ]. ten groups were set : group 1 : 5 ng / ml tgf-1 was added to the regular medium. group 2 : 5 ng / ml pdgf - bb was added to the regular medium. group 3 : 250 ng / ml dncps + 5 ng / ml tgf-1 was added to the regular medium. group 4 : 250 ng / ml dncps + 5 ng / ml pdgf - bb was added to the regular medium. group 5 : 250 ng / ml dncps + 5 ng / ml tgf-1 + 5 ng / ml pdgf - bb was added to the regular medium. group 7 : 10 ng / ml pdgf - bb was added to the regular medium. group 8 : 250 ng / ml dncps + 10 ng / ml tgf-1 was added to the regular medium. group 9 : 250 ng / ml dncps + 10 ng / ml pdgf - bb was added to the regular medium. group 10 : 250 ng / ml dncps + 10 ng / ml tgf-1 + 10 ng / ml pdgf - bb was added to the regular medium. cells were plated at a density of 5 103 cells / well in 96-well plates and cultured in the regular medium for 24 h. next, they were exposed to different materials (n = 5 in each group). the mtt assay was carried out at three different time points of 24, 48 and 72 hours after exposure. briey, the medium containing 10% mtt dye was added into each well at the end of experiments and cells were incubated for three hours. the supernatant in each well was then decanted and the insoluble formazan was eluted with dimethylsulfoxide (dmso). absorbance was read at 570 nm (620 nm reference) with a microplate elisa reader (anthos 2020, austria). cell viability was calculated as the ratio of values obtained for the treated cells and for untreated controls (as 100%). all quantitative tests were repeated three times and data were expressed as mean and standard deviation (m [sd ]). for the comparison of viability, statistical signicance was determined by one - way anova (tukey s post - hoc test) (graphpad prism software, version 6.01). cell viability and proliferation in the presence of different concentration of dncps as we can see in figure 1, although there is no significant difference between different concentration of dncps in 24 and 48 h time intervals, the best proliferation could be seen in the presence of 250 ng / ml dncps in 72 h (134.5 [17.7 ], p 0.05). although combination of 5 ng / ml tgf-1 and 250 ng / ml dncps caused no significant change in cell viability compared to the control group at 24 and 48 h, it significantly decreased cell viability at 72 h (71 [11.6 ], p 0.05). also, the combination of all three factors in the above - mentioned concentrations caused no significant change in comparison with the control group at any of the three time intervals (p > 0.05). as seen in figure 2b, the pulp stem cells in the presence of 10 ng / ml tgf-1 showed a significant higher viability (123.1 [14.8 ], p < 0.05) at 24 h compared to the control group (regular medium only). however, no significant difference with the control group was noted at 48 or 72 h. combination of 10 ng / ml tgf-1 and 250 ng / ml dncps did not cause a significant change in this regard in comparison with the control group at 24 h ; however, it significantly decreased cell viability at 48 and 72 h (87.6 [4.4 ] and 71 [11.6 ] respectively, p < 0.05). on the other hand, the significant reduction (~40%) in cell viability (72 vs 24 h) indicated that cell proliferation rate decreased during 24 - 72 h post - treatment in this group. cell viability profile in the presence of 10 ng / ml pdgf - bb was almost similar to that in the presence of 5 ng / ml pdgf - bb ; at this concentration (10 ng / ml), significant increase in cell viability was noted at all three time points compared to the control group (~120 - 140%, p < 0.05). the combination of 10 ng / ml pdgf - bb and 250 ng / ml dncps caused a significant increase in cell viability at 24 and 48 h (147.5 [24.8 ] and 120.9 [15.9 ] respectively, p < 0.05), although there was no significant difference compared with the control group at 72 h. combining all three factors in the above - mentioned concentrations caused a significant increase in cell viability compared to the control group (~114 - 136%, p < 0.05). the progenitor cells in the dental pulp, which are capable of being induced to differentiate into odontoblast - like cells for secreting the reparative dentine and forming a dentinal bridge remain elusive. described a unique population of post - natal stem cells in the dental pulp that may be progenitors of odontoblast - like cells found at sites of dentine regeneration. on the basis of direct dentine - pulp cell contact, we used dpscs derived from extracted human teeth to better understand tissue repair in teeth. reparative dentine formation is a relatively complex event requiring the initial employment of appropriate progenitor cells from the pulp tissue followed by signalling of odontoblast - like cell differentiation. certainly, the bioactive signalling molecules released from the dentine matrix must be in suitable rate as recent studies demonstrated that increased concentrations of tgf-1 can cause unfavourable cellular effects including induction of apoptosis. the release of matrix - associated molecules may be pivotal for modulation of bioactivity ; since biological events may be modulated by the synergistic or antagonistic effects of growth factors and their interactions with the extracellular matrix. the effects of tgf-1, fibroblast growth factor 8 (fgf8), and dncps on different stem cells have been confirmed in previous investigations. until now, no study has compared the effects of tgf-1, pdgf - bb, dncps and their combinations on cell viability and proliferation. the results of the current study showed significant synergistic or antagonistic effects of these factors on dpscs. different materials are used for the purpose of extraction of dentine extracellular - matrix components such as edta, calcium hydroxide and white and grey mta (mineral trioxide aggregate). however, evidence indicates that the total yield of dentin matrix proteins is the greatest for edta [32 - 34 ]. we hypothesized that dentin matrix may act in conjunction with other factors to promote dentinogenesis by affecting the proliferation of small populations of dpscs. in the current study, the first step indicated that dncps at some concentrations had no effect on viability of dpscs but the concentration of 250 ng / ml promoted the proliferation of these cells. ma. demonstrated increased proliferation of human periodontal ligament stem cells (hpdlscs) treated with dncps (at a concentration of 250 ng / ml). in our study, extracts of whole dentin extracellular matrix components have been shown to increase the proliferation of stem cells in vitro at relatively low concentrations ; however, relatively high concentrations inhibit their proliferation. in the second step, we confirmed the antagonistic effects of some factors (dncp + tgf-1) and synergistic effects of some others (dncp + tgf-1 + pdgf - bb). the tgf- signalling pathway plays an important role in inhibiting proliferation while stimulating differentiation when appropriate. based on the result of our study, tgf-1 cause graduate decrease of cell viability. accordingly, suppressive effects of tgf-1 on the growth of bovine and rat dental pulp cells have been shown. chan, also reported the poor proliferative capacity of pulp cells in presence of tgf-1 (1 - 10 ng / ml). the mechanism of anti - proliferative effects of tgf- signalling pathway is mediated via regulation of some proteins that drive the g1 phase of the cell cycle. however, fujii. moreover, tgf-1 increases the cell proliferation and extracellular matrix production in culture of dental pulp tissue, and it`s effect can be synergistically upregulated by fibroblast growth fatocr-2 (fgf2). in the current study, we demonstrated that dncp + tgf-1 have greater deleterious effects on cell proliferation than tgf-1 alone. have shown in their study that dncps + tgf-1 were capable of inducing functional differentiation of stem cells. since, proliferation and differentiation have an inverse relationship, the synergistic effects of these two factors (dncp + tgf-1) in our study might have ultimately led to stem cell differentiation (time - dependent reduction in proliferation rate) rather than proliferation. based on our results, pdgf - bb in both concentrations had a stimulatory effect on cell proliferation. previous experiments have shown that pdgf - bb enhances the proliferation of bone marrow mesenchymal stem cells in vitro. rutherford. showed that separate addition of pdgf - bb and igf-1 to cultured human dental pulp cells elicits a weak mitogenic response. but, the mitogenic effect of the combination of pdgf - bb and igf-1 on cultured human dental pulp cells was found to be additive. however, in our study, the combination of pdgf - bb + dncps had no significant effect on cell proliferation ; although the combination of all three factors (tgf-1 + pdgf - bb + dncps) in 10 ng / ml concentration had a significant effect on cell proliferation. moreover, several doses might be needed in order to achieve a therapeutic effect. in the current study these ndings provide convincing evidence and useful data supporting the use of dentin matrix as a potent tool to induce tissue repair and regeneration. besides, dncps are achievable in great amounts from the human third molars and premolars scheduled for extraction due to orthodontic reasons or also from the dentin of developing teeth in animals. so, in comparison with other matrix proteins available in the market, dncps may have an advantage in that they are easily supplied. we comprehensively characterized the effects of pdgf - bb, dncps and tgf-1 on dpsc proliferation. but, the mechanism of the respective effect and the relationship of different matrix proteins should be further assessed in future studies. future work should also address the effects of the aforementioned bioactive molecules on cell differentiation. in conclusion, this study demonstrated that dentin noncollagenous proteins can efficiently stimulate the proliferation of dental pulp stem cells. the results showed that when dental pulp stem cells were treated with 10 ng / ml concentration of transforming growth factor beta 1 + platelet - derived growth factor bb + dentin noncollagenous proteins, cell viability and proliferation increased, while dentin noncollagenous proteins + transforming growth factor beta 1 inhibited cell proliferation. this suggests that the combination of transforming growth factor beta 1 + platelet - derived growth factor bb + dentin noncollagenous proteins at some concentrations serves as a mitogen for dental pulp stem cells proliferation. | abstractobjectivesthe dentin matrix servers as a reservoir of growth factors, sequestered during dentinogenesis. the aim of this study was to assess the viability and proliferation of dental pulp stem cells in the presence of dentin matrix - derived non - collagenous proteins and two growth factors ; platelet - derived growth factor bb and transforming growth factor beta 1.material and methodsthe dental pulp cells were isolated and cultured. the dentin proteins were extracted and purified. the mtt assay was performed for assessment of cell viability and proliferation in the presence of different concentrations of dentin proteins and growth factors during 24 - 72 h post-treatment.resultsthe cells treated with 250 ng / ml dentin proteins had the best viability and proliferation ability in comparison with other concentrations (p < 0.05). the mtt assay demonstrated that cells cultured with 5 ng / ml platelet - derived growth factor bb had the highest viability at each time point as compared to other groups (p < 0.05). however, in presence of platelet - derived growth factor bb alone and in combination with transforming growth factor beta 1 and dentin proteins (10 ng / ml), significant higher viability was seen at all time points (p < 0.05). the least viability and proliferation at each growth factor concentration was seen in cells treated with combination of transforming growth factor beta 1 and dentin proteins at 72 h (p < 0.05).conclusionsthe results indicated that the triple combination of growth factors and matrix - derived non - collagenous proteins (especially at 10 ng / ml concentration) has mitogenic effect on dental pulp stem cells. |
cardiac resynchronization therapy (crt) is an effective therapy in symptomatic, optimally treated heart failure (hf) patients with prolonged qrs duration and low ejection fraction (ef). long - term results of crt on exercise tolerance and disease progression, as evaluated by reversal of maladaptive remodelling process, are rather limited and mostly reported in patients with sinus rhythm (sr). permanent atrial fibrillation (af) is a common arrhythmia in hf patients and is associated with increased morbidity and mortality. some studies have reported significant acute and short - term benefits of crt in af patients with hf. we recently emphasized the importance of atrio - ventricular junction (avj) ablation in order to optimize crt in patients with permanent af. pure resynchronization effect which translates into significant long - term improvement in left ventricular function and remodelling. such a reverse remodelling effect has been shown to correlate with improved survival in hf patients with normal sr treated with crt over mid - term follow - up. to date, there is no information regarding this aspect in hf patients with af. the aim of the present study was two - fold : first, to investigate the effect of crt on long - term survival in hf patients with permanent af compared with sr patients ; second, to investigate whether the adjunct of avj ablation may influence long - term outcome in the af patient subgroup. for the purpose of the present study, the data were derived from the multicentre longitudinal observational study (milos) and included all consecutive patients undergoing crt pacemaker (crt - p) or crt defibrillator (crt - d) device implant from 1 august 1995 to 1 august 2004. among the 1303 patients enrolled in the registry, 18 had incomplete data or were lost to follow - up : the remaining 1285 patients, who represent the study population, were regularly followed in outpatient clinic settings (at 2, 6, and every 6 months thereafter), where the physicians were blinded to the avj ablation therapeutic scheme ; all presented complete information about cardiac rhythm and survival status ; the last follow - up was scheduled on november 2004. aetiology was assessed in all cases by coronary angiography, and causes of hf amenable to surgery or intervention were corrected at least 6 months before device implantation. because indication for cardioverter defibrillator therapy changed over time, patients received the most appropriate device on the basis of current available evidence and guidelines. two hundred and forty - three (19%) patients had permanent af at the time of implant, whereas the remaining 1042 were in sr. immediately after crt device implantation, every af patient received negative chronotropic drugs, and the rate adaptive mode plus specific pacing features (such as ventricular rate regularization and/or trigger function) were activated in order to maximize biventricular stimulation. for all centres, the choice of performing avj ablation was mainly based on the detection of inadequate bvp% derived from device counters at 2 month post - implant control. in the earlier phases, the evidence of frequent fusion, pseudo - fusion, or competitive spontaneous beats detected from standard, dynamic, or stress test ecg monitoring was utilized to further indicate avj ablation. therefore, in patients with bvp% 85, avj ablation was performed ; digoxin and amiodarone were subsequently suspended (amiodarone was continued only if significant ventricular tachyarrhythmias were present), whereas beta - blocker therapy was maintained. on the contrary, patients with bvp% > 85 continued throughout the follow - up the rate - control treatment regimen combining chronotropic negative drugs with activation of device features. because avj ablation was not a standardized clinical care, formal approval was obtained from the review boards of each institution. all patients gave their written informed consent to undergo the ablation procedure under the understanding that irreversible complete atrio - ventricular block would be created with subsequent pacemaker dependency. outcome data were collected at each participating centre by reviewing outpatient clinical files or by phone interviews with relatives and/or family doctors. at each centre, an adjudication committee was established to perform chart review and assign, by consensus, the mode of cardiac death. the adjudication committee was blinded to the strategy undertaken to achieve rate control in af patients as well as to the type of implanted device. cardiac deaths were classified as sudden (not preceded by hf or ischaemic symptoms) or due to hf according to epstein. patients undergoing left ventricle assist device or urgent heart transplant were classified as hf deaths. when the cause of death could not be determined using all available sources, it was classified as unknown. conventional ventricular leads were positioned in the right ventricular apex in all patients implanted with crt systems, and conventional atrial leads were used only in sr patients. in those patients in whom implantable defibrillator was necessary, transvenous left ventricular lead positioning was guided by coronary sinus venogram, preferring a lateral or postero - lateral vein as implantation site. in case of failure or technical difficulties by the transvenous approach (phrenic nerve stimulation, inability to cannulate the coronary sinus, etc.), epicardial screw - in or steroid - eluting passive lead was implanted through limited thoracotomy. the latter was the elective approach used before transvenous leads became routinely available. in patients with preserved sr, devices were programmed in ddd modality, usually with a minimum heart rate of 50 b.p.m., and rate adaptive response was activated in any af patient and the maximum rate was set at 85% of the theoretical maximum heart rate ; moreover, in order to achieve the higher biventricular pacing percentage, ventricular rate stabilization and/or ventricular rate regulation (vrr) and trigger mode were activated when available. descriptive statistics were computed as mean and standard deviation for continuous variables and as counts and percentage for categorical variables. patients characteristics were compared between groups with unpaired t - test or one - way analysis of variance and with fisher 's exact test, respectively. median follow - up and its 2575th percentiles were computed by means of the inverse kaplan meier method. the rates of fatal and of cardiac events per 100 person - year and their 95% confidence intervals (95% cis) were calculated. cox regression was used to assess the prognostic role of the presence of af when compared with sr and, among af patients, the presence or absence of avj ablation, while adjusting for a series of potential baseline confounders (age, gender, left ventricular ef, aetiology, qrs duration, functional nyha class, and the type of implanted device crt - p or crt - d), in a multivariable model stratified for centre. avj ablation was treated as a time - dependent variable. to better characterize the prognostic role of af and avj ablation on the different causes and modes of death, separate cox models were fitted for cardiac death, death from hf, and sudden death. in these cases, to avoid overfitting, confounding was addressed by including the quintiles of the propensity score (ps) in the cox model stratified by centre. the ps is a measure of the likelihood for a patient to undergo avj, given its presenting characteristics, derived from a multivariable logistic model. to build the ps, we included in the model all the demographic and clinical variables collected (age, gender, left ventricular ef, aetiology, qrs duration, functional nyha class, the type of implanted device, and centre), together with their two - way interactions, as well as the drug regimen administered (table 1). the balancing property of the ps was satisfied and the c - statistic for the model was computed to 0.80. moreover, the ability of the ps to control for confounding in the subsequent cox models was confirmed by its lack of statistical significance. baseline characteristics of global permanent atrial fibrillation patient population compared with sinus rhythm patients mean (sd) for continuous variables ; n (%) for categorical variables. sr, sinus rhythm ; af, atrial fibrillation ; crt - d, cardiac resynchronization therapy pacemaker with defibrillator ; arbs, angiotensin receptor blockers. stata 9 (statacorp, college station, tx, usa) was used for computation. a two - sided p - value 85 continued throughout the follow - up the rate - control treatment regimen combining chronotropic negative drugs with activation of device features. because avj ablation was not a standardized clinical care, formal approval was obtained from the review boards of each institution. all patients gave their written informed consent to undergo the ablation procedure under the understanding that irreversible complete atrio - ventricular block would be created with subsequent pacemaker dependency. outcome data were collected at each participating centre by reviewing outpatient clinical files or by phone interviews with relatives and/or family doctors. at each centre, an adjudication committee was established to perform chart review and assign, by consensus, the mode of cardiac death. the adjudication committee was blinded to the strategy undertaken to achieve rate control in af patients as well as to the type of implanted device. cardiac deaths were classified as sudden (not preceded by hf or ischaemic symptoms) or due to hf according to epstein. patients undergoing left ventricle assist device or urgent heart transplant were classified as hf deaths. when the cause of death could not be determined using all available sources, it was classified as unknown. conventional ventricular leads were positioned in the right ventricular apex in all patients implanted with crt systems, and conventional atrial leads were used only in sr patients. in those patients in whom implantable transvenous left ventricular lead positioning was guided by coronary sinus venogram, preferring a lateral or postero - lateral vein as implantation site. in case of failure or technical difficulties by the transvenous approach (phrenic nerve stimulation, inability to cannulate the coronary sinus, etc.), epicardial screw - in or steroid - eluting passive lead was implanted through limited thoracotomy. the latter was the elective approach used before transvenous leads became routinely available. in patients with preserved sr, devices were programmed in ddd modality, usually with a minimum heart rate of 50 b.p.m., and rate adaptive response was activated in any af patient and the maximum rate was set at 85% of the theoretical maximum heart rate ; moreover, in order to achieve the higher biventricular pacing percentage, ventricular rate stabilization and/or ventricular rate regulation (vrr) and trigger mode were activated when available. descriptive statistics were computed as mean and standard deviation for continuous variables and as counts and percentage for categorical variables. patients characteristics were compared between groups with unpaired t - test or one - way analysis of variance and with fisher 's exact test, respectively. median follow - up and its 2575th percentiles were computed by means of the inverse kaplan meier method. the rates of fatal and of cardiac events per 100 person - year and their 95% confidence intervals (95% cis) were calculated. cox regression was used to assess the prognostic role of the presence of af when compared with sr and, among af patients, the presence or absence of avj ablation, while adjusting for a series of potential baseline confounders (age, gender, left ventricular ef, aetiology, qrs duration, functional nyha class, and the type of implanted device crt - p or crt - d), in a multivariable model stratified for centre. avj ablation was treated as a time - dependent variable. to better characterize the prognostic role of af and avj ablation on the different causes and modes of death, separate cox models were fitted for cardiac death, death from hf, and sudden death. in these cases, to avoid overfitting, confounding was addressed by including the quintiles of the propensity score (ps) in the cox model stratified by centre. the ps is a measure of the likelihood for a patient to undergo avj, given its presenting characteristics, derived from a multivariable logistic model. to build the ps, we included in the model all the demographic and clinical variables collected (age, gender, left ventricular ef, aetiology, qrs duration, functional nyha class, the type of implanted device, and centre), together with their two - way interactions, as well as the drug regimen administered (table 1). the balancing property of the ps was satisfied and the c - statistic for the model was computed to 0.80 moreover, the ability of the ps to control for confounding in the subsequent cox models was confirmed by its lack of statistical significance. (sd) for continuous variables ; n (%) for categorical variables. sr, sinus rhythm ; af, atrial fibrillation ; crt - d, cardiac resynchronization therapy pacemaker with defibrillator ; arbs, angiotensin receptor blockers. stata 9 (statacorp, college station, tx, usa) was used for computation. a two - sided p - value 85 (mean 89.4 2.4%) and continued negative chronotropic drugs throughout the follow - up to maintain adequate bvp% (af - drugs group). the other 117 af patients with bvp% 85 at 2 months (mean 74.2 4.2%) underwent avj ablation within 3 months from device implant (avj - abl group). once ablation of the avj was performed, digoxin and amiodarone were discontinued (amiodarone was continued only in cases presenting relevant ventricular tachyarrhythmias), whereas beta - blockers were maintained. at the following control after avj ablation, device counters revealed full biventricular pacing effectiveness, with bvp% nearing 100 (mean 98.7 1.8%). the evaluation of drug therapy modifications in the af group was performed after 1 year of crt. dosage of beta - blockers increased compared with baseline (carvedilol increased from 14.6 to 19.5 mg / day, p 85 (mean 89.4 2.4%) and continued negative chronotropic drugs throughout the follow - up to maintain adequate bvp% (af - drugs group). the other 117 af patients with bvp% 85 at 2 months (mean 74.2 4.2%) underwent avj ablation within 3 months from device implant (avj - abl group). once ablation of the avj was performed, digoxin and amiodarone were discontinued (amiodarone was continued only in cases presenting relevant ventricular tachyarrhythmias), whereas beta - blockers were maintained. at the following control after avj ablation, device counters revealed full biventricular pacing effectiveness, with bvp% nearing 100 (mean 98.7 1.8%). the evaluation of drug therapy modifications in the af group was performed after 1 year of crt. dosage of beta - blockers increased compared with baseline (carvedilol increased from 14.6 to 19.5 mg / day, p < 0.001). no differences were detected in either beta - blocker or ace - inhibitor usage between the two af patient groups. of these events, 28/125 patients were observed in the af - drugs group and 11/118 patients in avj - abl group (figure 2a), with mortality rates of 14.2 (95% ci 9.720.5) and 4.6 (95% ci 2.58.2) per 100 person - year, respectively (figure 2a). total mortality was therefore significantly better in the avj - abl group compared with the af - drugs group (adjusted hr 0.26, 95% ci 0.090.73, p = 0.010, figure 3). comparison of kaplan meier estimates of overall (a), cardiac (b), and heart failure (c) survival between atrial fibrillation patients who underwent atrio - ventricular junction ablation (avj - abl) and atrial fibrillation patients treated only with negative chronotropic drugs (af - drugs). the p - values presented derive from the adjusted hazards ratio analysis stratified according to the corresponding cause of death. hazard ratio estimates stratified according to cause of death between atrial fibrillation patients who underwent atrio - ventricular junction ablation (avj - abl) and atrial fibrillation patients treated with negative chronotropic drugs (af - drugs) ; hazard ratio estimates were adjusted for centre, age, gender, aetiology, nyha class, qrs width, left ventricular ejection fraction, and device type. corresponding hazard ratio values for each cause of death are indicated with a square, the bar represents 95% confidence interval range, and the p - value for each estimate is presented on the right of the figure. with respect to the cause of death, cardiac deaths occurred in 24/125 patients of the af - drugs group compared with 10/118 patients in the avj - abl group (figure 2b), with cardiac mortality rates of 12.1 (95% ci 8.118.1) and 4.1 (95% ci 2.27.7) per 100 person - year, respectively (figure 2b), and an adjusted hr of 0.31 (95% ci 0.100.99, p = 0.048) for avj - abl vs. af - drugs patients (figure 3). a total of 28 events (death or urgent heart transplant or left ventricular assist device positioning) occurred as a result of worsening hf with an incidence of 22/125 in the af - drugs group, as opposed to only 6/118 in the avj - abl group, with a mortality rate of 11.1 per 100 person - year (95% ci 7.316.9) in the af - drugs group and of only 2.5 (95% ci 1.15.5) per 100 person - year in the avj - abl group (figure 2c) (adjusted hr 0.15, 95% ci 0.030.70, p = 0.016) (figure 3). the occurrence of sudden cardiac death was very rare and accounted for only two events in the af - drugs (1.01, 95% ci 0.34.1 per 100 person - year) and four events in the avj - abl group (1.7, 95% ci 0.64.4 per 100 person - year). crt confers significant reductions in left ventricular volumes and improvement of left ventricular ef in hf patients. such favourable changes have shown to correlate with mortality reduction over a mid - term follow - up in sr patients. we recently described significant long - term improvements in left ventricular ef and left ventricular reversal of maladaptive remodelling in af patients treated with the combined crt and avj approach. in af patients with preserved avj conduction, no consistent correlation has been reported until now between reverse remodelling and mortality reduction after crt in af patients. the present study may be considered an extension of the previous one and aimed to evaluate, in a much larger patient cohort, whether the effect of the combined avj ablation and crt strategy may also translate into favourable long - term survival of hf patients with permanent af. to our knowledge, this is the first study comparing outcomes among patients treated with crt, between those in sr and those with af, and, even more importantly, among patients with af, based on whether or not these patients underwent avj ablation. the dramatic difference in mortality rate observed between af - drugs and af - abl could support the view that avj ablation may be strongly recommended to achieve effective crt in af patients. however, our data should be confirmed by prospective randomized trials, possibly comparing in these patients vvir - icd and rate control vs. crt - d+avj ablation. despite a 20% prevalence of af among hf patients treated with crt, randomized controlled crt trials therefore, there are virtually no data investigating the effects of crt on survival in hf patients with permanent af. both ventricular conduction delay and af are associated with a poor prognosis in hf patients. small studies have shown beneficial effects of crt also in patients with hf and af, with an improvement in nyha class, exercise capacity, and quality of life. in the present study, the multivariable analysis did not detect any significant differences in overall, cardiac, and hf long - term mortality rates between patients in sr and in permanent af. our recent contribution described similar long - term improvements in left ventricular ef and left ventricular reversal of maladaptive remodelling between sr and af patients treated with crt. in this study, mean left ventricular ef increase at 1 year was of 6.5% absolute units in both the sr group and the af group, with a concomitant decrease in the left ventricular end - systolic volume of 20% in the sr patients compared with 15% in the af group. these results are consistent with the similar mortality rates that we observed in our patients with either sr or af. it is important to point out that studies reporting benefits of crt in permanent af included patients with either a low ventricular rate or a previously ablated avj. this situation is, however, not frequent in clinical practice and many patients with af have a high ventricular rate (at least during exertion) despite concomitant treatment with negative chronotropic af - drugs (e.g. beta - blockers, digitalis, amiodarone). moreover, the activation of rate - smoothing features such as vrr or trigger mode may effectively regularize heart rate, whereas forcing faster heart rates may become deleterious. hence, avj ablation may be the only procedure allowing a complete heart rate control in these patients. such a procedure offers the advantage of obtaining a regular ventricular rhythm and, probably more importantly, ensures effective crt through pure and constant biventricular pacing. achievement of a regular ventricular rhythm through avj ablation has been associated with an improvement in global cardiac mechanics. avj ablation may therefore find an elective indication in hf patients treated with crt, as it should allow greater benefits compared with those observed in the general population in which the ablate and pace strategy is conventionally used to obtain a more regular and slower heart rhythm. another possible explanation for the impressive effects on survival obtained as a result of avj ablation may be related to the fact that, after avj ablation, most patients suspended both digoxin and amiodarone : data derived from randomized trials suggest that digoxin and amiodarone may have a negative impact on morbidity and mortality in hf patients. recently published data have suggested that in hf patients with af, crt confers long - term improvements of ef, end - systolic volume, nyha class, and exercise capacity only in patients who undergo avj ablation. such extensive improvements in ef and in left ventricular geometry have already been correlated to favourable prognosis in hf patients in sr. the previous findings advocating that avj ablation optimizes crt delivery thus yielding a significant reverse remodelling effect are consistent with what has been described in the present study. the analysis of the different death modes, stratified on the propensity of a patient being ablated, given its presenting characteristics, allowed to elucidate the role of avj ablation in patients with permanent af treated with crt. overall, cardiac and hf deaths were significantly lower in af patients who underwent avj ablation compared with those who were not ablated. this survival benefit was mainly due to the protective effect of avj ablation on deaths for hf. af patients who underwent avj ablation had a nine - fold lower hf mortality compared with non - ablated af patients. kaplan - meier analysis revealed that the time pattern of survival for hf becomes apparent after 4 months of crt ; this time point, shortly after avj ablation, corresponds to the same period when the reverse remodelling process becomes manifest in the avj - abl population. taken together, these findings suggest, as previously described in sr patients, that the reverse remodelling effect produced by crt may translate to a lower incidence of hf death in the avj - abl group. no clear statement may be made regarding possible effects on mortality from sudden cardiac death in af patients treated with crt, due to the low number of sudden death events that occurred in our patient cohort and due to the significant difference in patients receiving icd back - up between the two groups. this observational study has several limitations, being a non - randomized study ; to consider, however, our cohort of 1285 patients with a median follow - up of 34 months represents one of the largest series evaluating the effects of crt reported so far. it may have been useful to have an af control group not treated with crt, but the data are derived from a pre - defined crt registry of consecutively implanted patients. also, outcome may have been biased by patients selection and changes in both pharmacological and non - pharmacological therapies over the study period. unfortunately, only two of the four centres rigorously collected follow - up echocardiographic data. for this reason, the observations of the present study were interpreted and integrated with the findings of the previous contribution. the limits posed by the differences in the baseline characteristics between the study groups were mitigated by the statistical analysis which considered possible confounding effects of centre, gender, age, aetiology, qrs duration, functional nyha class, baseline left ventricular ef, and device type in the fitted models. moreover, to avoid over - fitting, confounding was addressed by adjusting the cox models by the quintiles of the ps. given the longitudinal, observational design of the study, even these adjusted models may not guarantee complete suppression of some confounders, hence the need for confirmatory randomized studies. although the af group was numerically inferior to the sr group, the subdivision of af patients in avj - abl and af - drugs resulted in two numerically balanced groups with similar baseline characteristics. finally, the declining number of patients over the follow - up may represent a limitation, but this is the case of any observational cohort study. all the available patients were included and only few patients were either lost to follow - up or had incomplete outcome data ; the latter were excluded from the study. despite a 20% prevalence of af among hf patients treated with crt, randomized controlled crt trials have generally included only patients in sr. therefore, there are virtually no data investigating the effects of crt on survival in hf patients with permanent af. both ventricular conduction delay and af are associated with a poor prognosis in hf patients. small studies have shown beneficial effects of crt also in patients with hf and af, with an improvement in nyha class, exercise capacity, and quality of life. in the present study, the multivariable analysis did not detect any significant differences in overall, cardiac, and hf long - term mortality rates between patients in sr and in permanent af. our recent contribution described similar long - term improvements in left ventricular ef and left ventricular reversal of maladaptive remodelling between sr and af patients treated with crt. in this study, mean left ventricular ef increase at 1 year was of 6.5% absolute units in both the sr group and the af group, with a concomitant decrease in the left ventricular end - systolic volume of 20% in the sr patients compared with 15% in the af group. these results are consistent with the similar mortality rates that we observed in our patients with either sr or af. it is important to point out that studies reporting benefits of crt in permanent af included patients with either a low ventricular rate or a previously ablated avj. this situation is, however, not frequent in clinical practice and many patients with af have a high ventricular rate (at least during exertion) despite concomitant treatment with negative chronotropic af - drugs (e.g. beta - blockers, digitalis, amiodarone). moreover, the activation of rate - smoothing features such as vrr or trigger mode may effectively regularize heart rate, whereas forcing faster heart rates may become deleterious. hence, avj ablation may be the only procedure allowing a complete heart rate control in these patients. such a procedure offers the advantage of obtaining a regular ventricular rhythm and, probably more importantly, ensures effective crt through pure and constant biventricular pacing. achievement of a regular ventricular rhythm through avj ablation has been associated with an improvement in global cardiac mechanics. avj ablation may therefore find an elective indication in hf patients treated with crt, as it should allow greater benefits compared with those observed in the general population in which the ablate and pace strategy is conventionally used to obtain a more regular and slower heart rhythm. another possible explanation for the impressive effects on survival obtained as a result of avj ablation may be related to the fact that, after avj ablation, most patients suspended both digoxin and amiodarone : data derived from randomized trials suggest that digoxin and amiodarone may have a negative impact on morbidity and mortality in hf patients. recently published data have suggested that in hf patients with af, crt confers long - term improvements of ef, end - systolic volume, nyha class, and exercise capacity only in patients who undergo avj ablation. such extensive improvements in ef and in left ventricular geometry have already been correlated to favourable prognosis in hf patients in sr. the previous findings advocating that avj ablation optimizes crt delivery thus yielding a significant reverse remodelling effect are consistent with what has been described in the present study. the analysis of the different death modes, stratified on the propensity of a patient being ablated, given its presenting characteristics, allowed to elucidate the role of avj ablation in patients with permanent af treated with crt. overall, cardiac and hf deaths were significantly lower in af patients who underwent avj ablation compared with those who were not ablated. this survival benefit was mainly due to the protective effect of avj ablation on deaths for hf. af patients who underwent avj ablation had a nine - fold lower hf mortality compared with non - ablated af patients. kaplan - meier analysis revealed that the time pattern of survival for hf becomes apparent after 4 months of crt ; this time point, shortly after avj ablation, corresponds to the same period when the reverse remodelling process becomes manifest in the avj - abl population. taken together, these findings suggest, as previously described in sr patients, that the reverse remodelling effect produced by crt may translate to a lower incidence of hf death in the avj - abl group. no clear statement may be made regarding possible effects on mortality from sudden cardiac death in af patients treated with crt, due to the low number of sudden death events that occurred in our patient cohort and due to the significant difference in patients receiving icd back - up between the two groups. this observational study has several limitations, being a non - randomized study ; to consider, however, our cohort of 1285 patients with a median follow - up of 34 months represents one of the largest series evaluating the effects of crt reported so far. it may have been useful to have an af control group not treated with crt, but the data are derived from a pre - defined crt registry of consecutively implanted patients. also, outcome may have been biased by patients selection and changes in both pharmacological and non - pharmacological therapies over the study period. one limitation may be the lack of a direct correlation between remodelling effect and mortality data. unfortunately, only two of the four centres rigorously collected follow - up echocardiographic data. for this reason, the observations of the present study were interpreted and integrated with the findings of the previous contribution. the limits posed by the differences in the baseline characteristics between the study groups were mitigated by the statistical analysis which considered possible confounding effects of centre, gender, age, aetiology, qrs duration, functional nyha class, baseline left ventricular ef, and device type in the fitted models. moreover, to avoid over - fitting, confounding was addressed by adjusting the cox models by the quintiles of the ps. given the longitudinal, observational design of the study, even these adjusted models may not guarantee complete suppression of some confounders, hence the need for confirmatory randomized studies. although the af group was numerically inferior to the sr group, the subdivision of af patients in avj - abl and af - drugs resulted in two numerically balanced groups with similar baseline characteristics. finally, the declining number of patients over the follow - up may represent a limitation, but this is the case of any observational cohort study. all the available patients were included and only few patients were either lost to follow - up or had incomplete outcome data ; the latter were excluded from the study. in our large multicentre series, the long - term overall survival of drug refractory hf patients with permanent af and left ventricular conduction delay treated with crt was similar to that of sr patients. however, in hf patients with permanent af, avj ablation in addition to crt appears to improve long - term overall mortality compared with crt alone, primarily by reducing hf death. avj ablation seems to be a fundamental adjunct to ensure adequate crt delivery and thus reducing mortality in patients with permanent af. funding to pay the open access publication charges for this article was provided by mt tedeschi, irccs istituto clinico humanitas, clinical research department, rozzano (mi), italy. | aimsto investigate the effects of cardiac resynchronization therapy (crt) on survival in heart failure (hf) patients with permanent atrial fibrillation (af) and the role of atrio - ventricular junction (avj) ablation in these patients.methods and resultsdata from 1285 consecutive patients implanted with crt devices are presented : 1042 patients were in sinus rhythm (sr) and 243 (19%) in af. rate control in af was achieved by either ablating the avj in 118 patients (avj - abl) or prescribing negative chronotropic drugs (af - drugs). compared with sr, patients with af were significantly older, more likely to be non - ischaemic, with higher ejection fraction, shorter qrs duration, and less often received icd back - up. during a median follow - up of 34 months, 170/1042 patients in sr and 39/243 in af died (mortality : 8.4 and 8.9 per 100 person - year, respectively). adjusted hazard ratios were similar for all - cause and cardiac mortality [0.9 (0.571.42), p = 0.64 and 1.00 (0.601.66) p = 0.99, respectively ]. among af patients, only 11/118 avj - abl patients died vs. 28/125 af - drugs patients (mortality : 4.3 and 15.2 per 100 person - year, respectively, p < 0.001). adjusted hazard ratios of avj - abl vs. af - drugs was 0.26 [95% confidence interval (ci) 0.090.73, p = 0.010 ] for all - cause mortality, 0.31 (95% ci 0.100.99, p = 0.048) for cardiac mortality, and 0.15 (95% ci 0.030.70, p = 0.016) for hf mortality.conclusionpatients with hf and af treated with crt have similar mortality compared with patients in sr. in af, avj ablation in addition to crt significantly improves overall survival compared with crt alone, primarily by reducing hf death. |
during rapid maxillary expansion (rme), heavy orthodontic forces are transmitted to the maxilla through the teeth,1 and unfavorable changes may occur in the anchor teeth and their supporting tissues, including buccal crown tipping, root resorption, reduction of buccal bone thickness, and marginal bone loss.2 - 4 rungcharassaeng.4 performed a study on the cbct records of 30 subjects taken before and after rme, and found that buccal crown tipping, reduction of buccal bone thickness, and marginal bone loss had occurred within 3 months after rme. kartalian.5 compared 25 patients who underwent rme with age- and gender - matched controls using cone - beam computed tomography (cbct) scans, and showed that the alveoli (but not the teeth) had tipped buccally after rme. rme has also been reported to produce alveolar bone fenestration and/or dehiscence in the buccal aspects of the maxillary teeth.6,7 garib.6 investigated the periodontal effects of tooth- and tooth - tissue - borne appliances, and found that rme treatment could lead to bone dehiscence in the buccal aspects of the anchor teeth. baysal.8 evaluated root resorption after rme via cbct and found significant root volume loss in the posterior teeth. the probing of gingival tissues and radiographic methods are mostly preferred in evaluating the osseous support of the teeth.9 in radiographic methods, bitewing and periapical radiographs are widely used.10 however, radiographic methods have some limitations, including superimposition of the anatomic structures and difficulty in reproducing angles over time.11 moreover, the destruction of the buccal plate can not be distinguished from lingual defects.12 because of these various issues, conventional radiography remains a limited tool for periodontal diagnosis.13 recently, cbct was introduced for head and neck applications. the main advantage of cbct is the ability to evaluate the real anatomy without superimposition of the neighboring structures. cbct and conventional methods have been compared by linear measurements of periodontal defects, and the methods were found to be comparable in terms of accuracy.14 notably, cbct also provides the ability to observe defects in all three dimensions.15 although the effects of rme on cortical bone thickness and alveolar bone height were investigated in previous studies4,5 by means of cbct, no study evaluating the follow - up period has been published. therefore, the aim of this study was to evaluate the effects of rme on cortical bone thickness, alveolar bone height, and the incidence of dehiscence and fenestration after a 6-month follow - up period. for the purpose of this study, the null hypothesis assumed that no significant changes in the cortical bone thickness, alveolar bone height, and incidence of dehiscence and fenestration would occur after rme treatment. the cbct records of 20 subjects (9 boys, mean age : 13.97 1.17 years ; 11 girls, mean age : 13.53 2.12 years) were obtained from the archives of the oral and maxillofacial radiology department, dicle university (diyarbakr, turkey). all patients fulfilled the following criteria : 1) bilateral cross - bite related to a maxillary transverse deficiency ; 2) no history of previous orthodontic treatment or a systemic disease ; and 3) all maxillary teeth were present and fully erupted, with the exception of the third molars. all 20 patients had undergone rme with a hyrax - type expander as a part of their orthodontic treatment. t1 scans were obtained before the placement of the appliance, and t2 scans were acquired directly after the end of the activation. of the 20 patients, 10 patients had 6-month retention records (t3). ethical approval had already been obtained from the ethical committee of dicle university (dudfek 2009/21) for the aims of another study ; the patients were not exposed to extra radiation for this retrospective study. therefore, a second ethical approval was not obtained. in our department, the expansion protocol using the hyrax screw is as follows : the appliance consists of an expansion screw welded on the bands on the first premolar and molar teeth. the screw is turned twice a day (once in the morning and in the evening) until the palatal cusps of the upper posterior teeth are in contact with the buccal cusps of the lower posterior teeth. during the retention period, the expansion appliance is left in the mouth for the first 3 months, and is replaced with a transpalatal arch when the expander is removed. fixed orthodontic treatment is initiated after the retention period. all tomographs were obtained using i - cat (model 17 - 19 ; imaging sciences international, hatfield, pa, usa) by the same operator at the following settings : exposures were made at 5.0 ma and 120 kv for 9.6 seconds, and the axial slice thickness was 0.3 mm. the patients were positioned sitting upright in the cbct machine, with one strap placed over the forehead to orient the frankfort horizontal plane parallel to the floor. the digital imaging and communications in medicine (dicom) files were imported into dolphin 3d (dolphin imaging, chatsworth, ca, usa) for further analysis. in this program, the orientation of each 3-dimensional volumetric data set was standardized by using the frankfort horizontal line as the x - axis, the transporionic line as the y - axis, and the midsagittal line as the z - axis. the reference planes were defined by using the volumetric rendering view along with the multiple planar views.16 all of the cortical bone thickness and buccal alveolar height (bah) measurements were performed using dolphin imaging 11.0 premium (dolphin imaging) on hard tissue segmentation by one author who was blinded to the patient time points. the cortical bone thickness of the maxillary canine, the first and second premolars, and the first molar for the left and right segments were measured using the axial clipping function of the software. to measure the cortical bone thickness at 3 different levels, cross - sections parallel to the frankfort horizontal line were obtained at the trifurcation point, the middle of the distobuccal root, and the apex of the distobuccal root of the right first molar tooth. these levels were defined as the furcation - level, middle, and apical cortical bone thickness. to identify precisely the middle and apical thirds of the root, the length was measured with the program automatically on the coronally clipped images. the distances between the outer border of the cortical bone and the teeth were measured both buccally and palatally, and defined as the buccal and palatal cortical bone thickness (bcbt and pcbt, respectively) (figure 1). however, the method was modified in the following situations : if the roots of the upper premolars were shorter than the distobuccal roots of the first molars, the distances between the outer bone plate and the nearest point to the premolar apices were used for the measurements. when the maxillary sinuses spanned around the roots of the teeth, the distance between the apices and the sinus wall was accepted as zero. in the case of tooth rotation, the thickness was evaluated using the nearest point of the root to the bone plate. the other measurement was the bah of the maxillary posterior teeth. using the coronal clipping function of the program, the distance between the cusp tips of the posterior teeth and the buccal alveolar crest was determined separately for the right and left sides (figure 2). for the first molar teeth, the buccal crest level was determined from the mesiobuccal, middle, and distobuccal aspects of the teeth. the presence of dehiscence and fenestration was evaluated on the i - cat software program according to the method described by evangelista.17 (figures 3 and 4). the axial inclination of the tooth was placed perpendicular to the horizontal plane, and the total root length was evaluated in cross - sectional slices at the buccal and palatal surfaces. images that showed no cortical bone around the tooth in at least 3 consecutive views were recorded as having dehiscence or fenestration. the defect was classified as fenestration when the defect did not involve the alveolar crest. when the alveolar crest was more than 2 mm from the cemento - enamel junction, the defect was recorded as dehiscence.18 figures 5 and 6 show the examples of decrease in buccal cortical plate thickness and increase in the buccal alveolar height of maxillary molar teeth after rme, respectively. the palatal cortical bone thickness at baseline, after rme and after retention is presented in figure 7. all statistical analyses were performed with the spss 16.0 (spss inc, chicago, il, usa). the shapiro - wilk and levene 's variance homogeneity tests were used to determine the normality of the data. for comparing the mean values between the t1 and t2 measurements, a paired t - test and the wilcoxon signed rank test were used for normally and non - normally distributed data, respectively. for the statistical evaluation of the pre - expansion, post - expansion, and 6-month follow - up data, repeated measure anova with bonferroni correction was used for normally distributed data, while the friedman tests were used for non - normally distributed data. the arithmetic mean and standard deviation were calculated for all measurements. for determining the errors associated with cbct measurements, 15 tomographs were selected randomly, and their measurements were repeated 4 weeks after the first measurements by the same examiner. intraclass correlation coefficients were determined for the 2 sets of measurements and were found to be higher than 0.90, indicating that the reliability of all the measurements was acceptable. all statistical analyses were performed with the spss 16.0 (spss inc, chicago, il, usa). the shapiro - wilk and levene 's variance homogeneity tests were used to determine the normality of the data. for comparing the mean values between the t1 and t2 measurements, a paired t - test and the wilcoxon signed rank test were used for normally and non - normally distributed data, respectively. for the statistical evaluation of the pre - expansion, post - expansion, and 6-month follow - up data, repeated measure anova with bonferroni correction was used for normally distributed data, while the friedman tests were used for non - normally distributed data. the arithmetic mean and standard deviation were calculated for all measurements. for determining the errors associated with cbct measurements, 15 tomographs were selected randomly, and their measurements were repeated 4 weeks after the first measurements by the same examiner. intraclass correlation coefficients were determined for the 2 sets of measurements and were found to be higher than 0.90, indicating that the reliability of all the measurements was acceptable. a comparison of the bcbt and pcbt measurements before and after rme treatment is shown in table 1. with the exception of the apical region of the first and second left premolars, the mesial apical region of the right molar, and the middle region of the right canine, a decrease in the bcbt was observed at the 3 levels for all investigated teeth. for the canine and premolar teeth, the decrease in bcbt was statistically significant only at the furcation level for the right segment. for the second premolar teeth, the decrease was statistically significant in the middle region for both for the left and right segments. in terms of the decrease in bcbt, the first molar mesial and distal roots were the most severely affected among the investigated teeth. the decrease in bcbt was statistically significant for the middle and apical levels of the left segment and for the middle and furcation levels for the right segment. when the pcbt measurements were evaluated, a general decrease was observed, but the decrease was not symmetrical for the left and right segments. for the canine and second premolar teeth, a decrease was observed on the left side, while an increase occurred at the right side for the middle and apical levels. a comparison of the bah before and after rme is shown in table 2. the bah measurements of all investigated posterior teeth were increased. with the exception of the left molar midfurcation level, these differences were found to be statistically significant, indicating the vertical alveolar height decreased immediately after the expansion period. the descriptive statistics of the bcbt and pcbt measurements and the statistical comparisons of these values at the t1, t2, and t3 time periods are shown in table 3. except for the furcation level of the left canine, the bcbt decreased from the baseline to the end of the 6-month follow - up period at all 3 levels. meanwhile, no significant increase in bcbt was found during retention period (t2 - t3) at the furcation level of the left and right canines and the right premolar and right molar. for the other levels, gradual decreases from t2 to t3 was observed. for the apical part of the canine tooth, a dramatic and statistically significant decrease in the bcbt was observed during the t1 - t3 and t2 - t3 time periods. for the left premolar and molar teeth, no significant decreases were found for the furcation level. interestingly, for the right segment, no significant difference was recorded for the first premolar teeth. the only statistically significant difference at the furcation level during the t1 - t3 and t2 - t3 time periods was recorded for the right second premolar teeth. at the furcation level of the mesial and distal roots of the first molar, the difference was statistically significant at t2 and recovered at t3. the pcbt decreases were found to be statistically significant at the apical level for all teeth, with the exception of the left first premolar. the decreases were statistically significant for the right molar teeth at the furcation (t1 - t3), middle (t2 - t3), and apical (t2 - t3) levels. comparisons of the bah measurements from the baseline to the 6-month follow - up are shown in table 4. the increase in bah during the treatment period (t1 - t2) was statistically significant for the right canine tooth (p = 0.016). the changes in the t1 - t3 period for the left second premolar and right molar distobuccal level was statistically significant (p = 0.038 and p = 0.035, respectively). the incidence of alveolar defects in the 20 patients before and after rme are shown in table 5. meanwhile, the incidence of baseline, post - treatment, and post - retention alveolar defects in 10 of the patients is presented in table 6. in general, the incidence of dehiscence was greater for the post - treatment and post - retention values than for the baseline ones after rme. the percentage of fenestrations decreased after treatment. because the rme treatment had statistically significant effects on the surrounding alveolar bone, the null hypothesis of this study was rejected. rme is a common clinical procedure to correct maxillary constriction and arch length discrepancies.4 in adolescents, 65% of the total expansion was shown to be the result of dental movement,19 and it may be thought that rme may have detrimental effects on the teeth and their supporting tissues. cbct scanning provides information for rme, not obtainable from other methods especially from a periodontal perspective. moreover, as the current study was designed in accordance with the principle of alara (as low as reasonably achievable), individuals were not exposed to extra radiation beyond the needs for orthodontic treatment. also an informed consent form signed by the patients ' parents, doctor and technician has to be obtained from every patient that goes under cbct scanning in our university protocol. ekstrm.20 found that the mineralization of a midpalatal suture was completed 3 months after rme, and advocated a retention period of 3 to 6 months for a good long - term stability. in the current study, 6-month retention records were obtained from the archive and used in the analyses, since this period was thought to be adequate for the adaptation of the hard and soft tissues. the force generated by the activation of the appliance initially leads to compression of the periodontal ligament, bending of the alveolar bone, and tipping of the anchor teeth. afterwards, a gradual opening of the midpalatal suture occurs.21 hicks22 found that the angulation between the right and left molars increased from 1 to 24 during expansion and showed that these changes are due to alveolar bending and the tipping of the posterior teeth in the alveolar bone. hence, one can conclude that rme may result in the tipping of the maxillary posterior teeth. in the present study, the level of the buccal alveolar crest was lowered in all investigated teeth immediately after rme. these changes may be attributed to the tipping of the maxillary posterior teeth, and this tipping movement may lead to resorption of the crestal alveolar bone. this finding is in accordance with previous studies.23,24 after the retention period, the alveolar bone height did not change, but the buccal cortical bone generally continued to decrease. according to barber and sims,25 the residual loads may cause the alveolar bone to be compressed toward the buccal aspect of the anchor teeth, which are held rigidly by the expansion devices used as retainers. cotton26 stated that post - expansion angular changes of the maxillary molars might be due to the stretched fibers of the attached palatal mucosa. thus, the roots of the posterior teeth may move buccally, and the thickness of the buccal cortical bone may continue to decrease. in the palatal portion of the tooth, a trend toward an increase in the pcbt after the active phase of the rme was observed. this finding can be attributed to the buccal tipping of the posterior teeth, which increases the distance between the palatal cortical plate and the root surfaces. meanwhile, the decreases in pcbt in the retention period may show the compensatory resorption under the periosteum. sarikaya.27 showed compensatory resorption under buccal periosteum when the maxillary incisors were retracted. because of the considerable force needed to break the median palatine suture during rme, an evaluation of the periodontal structures, including the alveolar bone and gingival biotype, is an important aspect of the procedure.17 evangelista.17 compared the presence of alveolar defects (dehiscence and fenestration) in patients with different malocclusions, and found that the maxillary canines and first premolars showed a high prevalence of dehiscence. this finding is of importance for treatments involving rme, since the first premolars, and sometimes the canines, are the supporting teeth for orthopedic devices. in the current study, the incidence of dehiscence on the buccal surface of posterior teeth varied between 2.5% and 55.0% additionally, this incidence increased during the use of the tooth - borne rme appliance (range : 10.0 - 72.5%). we think that the effects of dental inclination and the decrease in alveolar bone height are associated with these alveolar defects. wainwright7 showed that when the apex of a tooth is moved facially, cortical bone penetration occurs. this penetration is closed with bone deposition on the buccal surface if the apex of the tooth is moved to the opposite direction and retained in that position. in the present study, the incidence of dehiscence and fenestration increased and decreased after rme, respectively. the potential of a fenestration to become a dehiscence28 may explain this increase. although a general increase was shown in the occurrence of these alveolar defects for the buccal surface of the first molar teeth, the percentage of alveolar defects decreased overall. this decrease is attributed to the horizontal bone loss. meanwhile, the least amount of alveolar defects was found in the second premolars. it is logical to find greater alveolar defects in the first premolar and molar teeth, as they are the anchor teeth. although the canines are not anchor teeth, the initial supra - alveolar position of these teeth might cause dehiscence at the buccal surfaces, and these might not recover. in the present study, cbct scans were used to evaluate the alveolar defects. as we can measure the bone around the teeth accurately by means of axial and cross - sectional sections, alveolar bone measurements and bone defects leung.28 evaluated the accuracy and reliability of cbct for measuring alveolar bone height and alveolar defects by correlating direct and indirect cbct measurements. the correlation coefficient with direct and cbct measurements was 0.870 for the bone margin measurements. on the other hand, the detection of fenestrations and dehiscence was more prone to error. the diagnosis of alveolar defects depends on the length and thickness of the alveolar cortical plate and the visualization of the periodontal ligament space.17 fuhrmann.29 observed that when the cortical thickness is less than 0.5 mm, the cbct scan is relatively accurate. therefore, the scoring of these thicknesses can be a possible limitation of our study. another limitation of this study is the small sample size. to overcome this limitation, moreover, the high accuracy of the quantitative measurements on the cbct images supports the reliability of the outcomes and makes the small sample size acceptable. furthermore, to prevent the underestimation of p - values, repeated measure anova, which is a much more powerful statistical approach than independent anova, was used. within the limitations of this study, the following conclusions can be drawn : 1) rme may have detrimental effects on the supporting alveolar bone, since the thickness and height of the buccal alveolar bone were decreased, 2) the increased dehiscence formation may support these findings. | objectiveto evaluate the changes in cortical bone thickness, alveolar bone height, and the incidence of dehiscence and fenestration in the surrounding alveolar bone of posterior teeth after rapid maxillary expansion (rme) treatment using cone - beam computed tomography (cbct).methodsthe cbct records of 20 subjects (9 boys, mean age : 13.97 1.17 years ; 11 girls, mean age : 13.53 2.12 year) that underwent rme were selected from the archives. cbct scans had been taken before (t1) and after (t2) the rme. moreover, 10 of the subjects had 6-month retention (t3) records. we used the cbct data to evaluate the buccal and palatal aspects of the canines, first and second premolars, and the first molars at 3 vertical levels. the cortical bone thickness and alveolar bone height at t1 and t2 were evaluated with the paired - samples t - test or the wilcoxon signed - rank test. repeated measure anova or the friedman test was used to evaluate the statistical significance at t1, t2, and t3. statistical significance was set at p < 0.05.resultsthe buccal cortical bone thickness decreased gradually from baseline to the end of the retention period. after expansion, the buccal alveolar bone height was reduced significantly ; however, this change was not statistically significant after the 6-month retention period. during the course of the treatment, the incidence of dehiscence and fenestration increased and decreased, respectively.conclusionsrme may have detrimental effects on the supporting alveolar bone, since the thickness and height of the buccal alveolar bone decreased during the retention period. |
such dislocations are usually caused by sports injuries, epileptic seizures, electrical shock, or electroconvulsive therapy. however, simultaneous bilateral anterior shoulder dislocation is very rare and usually is of traumatic in origin with only few cases described in literature. thorough clinical examination of the patient is mandatory in order to ensure that a bilateral dislocation is not missed. the following case report demonstrates a typical bilateral shoulder dislocation as a result of trauma in a 24-year - old male. a 24-year - old man presented to accident and emergency department with complaints of acute shoulder pain involving both shoulders after trying to prevent a fall. he tried to prevent falling backward by extending both arms behind his back. physical examination showed fullness over anterior aspect and bilateral squaring of his shoulders (epaulet sign). both humeral heads were palpated in the anterior aspect of each joint and there was a global, painful restriction of range of motion in both shoulders, without any evidence of peripheral motor, sensory and vascular deficit. radiographs confirmed bilateral anterior glenohumeral dislocation with greater tuberosity fracture on left side [figure 1 ]. reduction of both shoulders was obtained which was confirmed radiologically [figure 2a and b ]. since the greater tuberosity fracture of left shoulder returned to its anatomical position after reduction, so it was decided to manage the fracture conservatively. radiographs demonstrating the bilateral anterior shoulders dislocation with fracture greater tuberosity left side (a and b) post - reduction x - ray showing congruent reduction of bilateral shoulder joint and anatomically reduced greater tuberosity fracture left side the patient received physical therapy as tolerated and no further episodes of instability ensued. at follow - up of two months the patient reported no pain and had returned to his normal activities of daily living with minimal discomfort. both shoulders had near normal range of motion with pain only present at the extremes of motion. radiographs showed an anatomical consolidation of greater tuberosity fracture of left shoulder joint. at the end of one year follow up, the fracture has united with no restriction of motion and the shoulders were defined as stable. bilateral shoulder dislocation was first described in 1902 in patient in whom excessive muscular contractions occurred as a result of camphor overdose. dunlop., reported in 2002 of other cases in the literature, but most were associated with fractures. bilateral posterior shoulder dislocations occur mostly due to electrical shock, seizures or hypoglycaemic episodes, and these occur as a sequel of maximal involuntary muscle contractions. the weaker external rotating muscles are overpowered by the stronger internal rotators, resulting in adduction and internal rotation sufficient dislocate the humeral head posteriorly. unlike posterior dislocations, anterior dislocations occur more commonly following trauma. our patient had minor trauma after falling backwards with his arms extended behind his back. the dislocation mechanism in our case is a protective effort in an unbalanced position both created a typical shoulder dislocation mechanism. this is the first case reported of a patient dislocating both shoulder by this mechanism. cresswell and smith reported a case of bilateral anterior dislocation of the shoulder without any fractures in a bench - pressing athlete. singh and kumar reported a case of sequential bilateral anterior dislocation in which the left shoulder dislocated first due to trauma followed by atraumatic dislocation of the right shoulder. galois. early reduction and immobilisation should be followed by definite treatment, which may include active and passive physiotherapy or surgery in the younger, more active patient group. this poses obvious problems in the case of bilateral injuries when the patient may require remain in hospital for an extended period. a fracture of the greater tuberosity occurs in approximately 10% of dislocations and is usually associated with the humeral head in a subglenoid, low subcoracoid, or subclavicular position. in these cases, the greater tuberosity is displaced in the approximately 15% of all anterior shoulders dislocations of the shoulder. the diagnosis of a rotator cuff tear is almost sure when the fracture of the greater tuberosity is displaced. possible rotator cuff tears and other shoulder pathologies should be investigated by magnetic resonance imaging (mri). mri was not used in our cases because of financial constraints and plan of conservative treatment. functional impairment is commonly seen if the greater tuberosity is not reduced anatomically. in our patient it is important to take accurate clinical history, a thorough clinical examination and adequate imaging in order to exclude this injury. this is especially of concern, since the reported rate of late diagnosis is greater than 10%. predisposition to bilateral dislocations may be higher in older age group because of balance problems. | shoulder dislocations are the most common major joint dislocations encountered in the emergency departments. bilateral shoulder dislocations are rare and of these, bilateral posterior shoulder dislocations are more prevalent than bilateral anterior shoulder dislocations. bilateral anterior shoulder dislocation is very rare. we present a case of 24-year - old male who sustained bilateral anterior shoulder dislocation following minor trauma, with associated greater tuberosity fracture on one side. prompt closed reduction followed by immobilization in arm sling and subsequent rehabilitation ensured a good outcome. |
traumatic brain injury (tbi) is the most common cause of morbidity and mortality in children. many scoring systems have been established to predict the neurological outcomes in children with tbi. clinically, different scoring systems may show different characteristics and various effects in estimating children with tbi. however, the golden standard scoring system for predicting neurological outcome in children with tbi is still unclear. also, it is equivocal which clinical scoring system can be the most useful scale in the emergency department. this concern has led to renewed interest in clinical scoring systems to be better applied clinically and accurately predict neurological outcomes in children with tbi. tbi is the most common cause of morbidity and mortality in children over 1 year of age and young adults. clinically, many scoring systems may aid clinicians in evaluating the neurologic conditions and predicting the outcomes in patients with tbi. however, different scoring systems may show different characteristics for clinicians to evaluate these patients. on the basis of glasgow coma scale (gcs), the severity of the tbi is graded as mild (gcs 15 - 13), moderate (gcs 12 - 9) or severe (gcs 8 - 3). since the glasgow outcome scale (gos) published by jennett and bond in 1975, it becomes the most widely used scoring system in evaluating neurological outcome for head injury patients. the current recommendations are to use the gos at 6 months to measure outcome after severe head injury. however, it is likely to underestimate morbidity in children and is not always readily applicable in this group. in 2001, crouchman and colleagues developed a pediatric adaptation of the gos, the king 's outcome scale for childhood head injury (koschi). they expand the five categories of gos to provide more sensitivity at the milder end of the disability range. in the koschi, the gos category of persistent vegetative state was replaced by vegetative. severe disability, moderate disability and good recovery were allocated two categories, in acknowledgement of the long - term importance of relatively minor sequelae in a developing child. in addition, they suggested that the koschi could be used to (1) document recovery and monitor the burden of disability in individual children ; (2) plan service and evaluate rehabilitation programs ; and (3) assess effects of service and research interventions. in a prospective cohort study, calvert. reported that koschi scored at hospital discharge correlates with severity of injury and some cognitive, health status and health - related quality of life (hrql) outcomes early after tbi. in addition, another neurological outcome score for children was developed by okada. in 2003 such as neurologic outcome scale for infants and children (nosic). they recommended that the nosic was a practical, reliable, valid, nonproprietary instrument applicable to children with a broad range of ages and neurologic diagnoses. but the limitations of nosic were relatively low sensitivity to mild deficits, lacking much clinical experience and can not be administered by mail or telephone. it is really a big challenge for primary clinicians to early predict the outcome of individual patients with severe head injuries. however, predicting and establishing the prognosis after tbi is an important question for doctors, patients and their families, as well as for health organizations and insurers. previous studies had shown some important factors associated with poor outcome after pediatric tbi, including : low admission gcs score, poor pupil reflexes recovery, coagulopathy, brain computed tomography (ct) results : (subarachnoid hemorrhage with brain swelling and edema, subdural, intracerebral hemorrhage, and basal ganglion lesions), hyperglycemia, hypoxia, impaired cerebral autoregulation and early hypotension.[58 ] in this issue entitled outcome analysis and outcome predictors of traumatic head injury in childhood - analysis of 454 observations in journal of emergencies, trauma, and shock, the authors did their effort to evaluate the factors correlated with poor outcome in children with tbi. based on the results of multivariate analysis, they found that factors associated with a bad outcome (gos 145 mmol / l (p=0.04 ; or:4.41). the authors concluded that the neurological outcome measure (gos) was a very blunt instrument, especially for survivors who were not vegetative or severely disability. in addition, gos was not only poor - sensitive to children with neurobehavioral impairments but also less sensitive to children with substantial impact on academic, social function and quality of life. as most of previous studies mentioned,[58 ] gos was commonly used to evaluate patients neurological conditions. although gos appears to be simple and easy - recorded, the variables of gos involve more physical evaluation than cognitive, emotional and behavior surveys. this issue may lead clinicians to underestimate the severity and prognosis in tbi. moreover, the above study also has provided some important predictive factors associated with poor neurologic outcome. the results might be helpful for clinicians in further evaluation and management of tbi patients. however, even in tbi patients with initially good outcome indicators (good recovery and only mild - to - moderate disability), poor learning and poor social behavior functions may occur in 6 months after tbi events. during the recent 30 years, the survival rate and neurological outcome of tbi in children have improved a lot. however, the disabled survivors remain a significant financial burden on health, education and social - service budgets not only in developing countries but also in developed countries. in order to adequately evaluate neurological outcomes after tbi, some studies had used a variety of instruments from complex neuropsychological tests to simple clinical outcome scales. nevertheless, which is the gold standard neurological outcome scoring system in children with tbi remains equivocal. until now, there have been several particular challenges for clinicians in evaluating outcomes after childhood tbi. physical, behavioral, emotional and cognitive impairments make various contributions to the overall morbidity, depending on the age at injury, interval since injury and the severity of injury. in addition, measurements in children need to be considered to age - appropriate expectations, and since the process of development and growth continues after the injury, the shortfall between current functional status and age - dependent normality is dynamic. the dynamic correlation and interaction among the components of the morbidity developed after tbi may lead to dilemma in further management and evaluation. therefore, we think that to develop a practical, reliable and valid neurological outcome instrument in children is an important issue in forwarding research. furthermore, to achieve early accurate assessment, adequate rehabilitation and long - term follow - up is also the key point of improving neurological outcome in children with tbi. | traumatic brain injury is the most common cause of morbidity and mortality in children. however, it is still challengeable to early predict the outcome of individual patients with severe head injuries. glasgow outcome scale is the most widely used scoring system in evaluating neurological outcome for head injury patients. moreover, it is likely to underestimate morbidity and is not always readily applicable in children. it is an important issue to develop a practical, reliable and valid neurological outcome instrument in children in forwarding research. |
a 46-year - old female patient was admitted with complaints of severe pain and paresthetica in the right anterolateral femoral region, which started a month ago. at the time of admittance, the visual analog scale (vas) of the patient was 8, and she complained of excruciating pain in the right femoral region when she started to walk, causing her to rest more than 5 minutes before walking again. recently, she had even woken once or twice in the night from the pain in the right femoral region. the patient had visited a private orthopedics hospital, but there were no abnormalities in the lumbar x - ray, and despite continual physical modalities, there were no improvements in symptoms. after careful history taking, it was found that she had a total thyroidectomy 8 months previous because of a thyroid mass, and after the procedure her weight increased 27 kg, from 67 kg to 94 kg. in the standing position in the physical exam, the straight leg raising test was normal, there was numbness in the right lateral femoral region, and there were trigger points along the inguinal ligament that generated symptomatic pain when pressured. based on the past history and physical exam, meralgia paresthetica was suspected, so a lateral femoral cutaneous nerve block using ultrasound (s - nerve, sonosite inc., jelly was applied to the linear probe (13 - 6 hz) and disinfected transparent plastic was draped. the end of the linear probe was positioned at the anterior superior iliac spine (asis), and in line with the inguinal ligament it was moved down and confirmed the lfcn located above the sartorius and below the tensor fasciae latae (fig. a 23 gauge, 60 mm needle was inserted facing the lateral from the medial side of the patient and positioned near the lfcn by monitoring the current position using ultrasound. a mixture of 1:10,000 epinephrine 0.15 ml, 0.2% bupivacaine 9 ml, and triamcinolone acetonide 40 mg was injected around the nerve while monitoring medication diffusion with ultrasound. after injection, the patient was bed rested for 30 minutes and returned home without complications. in a visit a week later, the patient 's vas had been reduced to 3. using the same method as the first procedure, the procedure was performed once more but with half the amount of bupivacaine and triamcinolone acetonide, that is 1:10,000 epinephrine 0.15 ml, 0.2% bupivacaine 5 ml, and triamcinolone acetonide 20 mg. a week after the second procedure, a medical examination was conducted over the telephone and the vas had decreased to 0. lateral femoral cutaneous nerve block for the treatment of meralgia paresthetica is a commonly known treatment method, but there were no reports of procedures using ultrasound in south korea. hafer first presented meralgia paresthetica in 1885, reporting pressure on the lateral femoral cutaneous nerve as cause for the pain. from the greek words meros (thigh) and algos (pain), roth named it " meralgia paresthetica " in 1895, which has been used up to the present time. meralgia paresthetica is characterized by pain and paresthica along the lfcn and is caused by compression of the nerves from conditions that increase intra - abdominal pressure such as obesity, pregnancy, tight belts or pants, metabolic disorders (diabetes), alcohol and lead poisoning, or damage from surgeries near the inguinal region because of anatomical variability of the lfcn. obesity is considered to be the reason in our case since there was a recent 27 kg increase in body weight. the lfcn is a pure sensory nerve that originates from the 2, 3 lumbar nerves emerges from the side of the psoas major and passes the iliacus diagonally towards the asis. it then passes above, below or between the inguinal ligament, above the sartorius and into the subcutaneous tissue of the femoral region. then it is divided into anterior and posterior division : the front controls the frontal femoral region and up to the knee area, the rear controls the lateral femoral region up to the greater trochanter area. the anatomical variability of the lfcn is about 30%, and according to reports of bjurlin., the distance from the asis to the lfcn can vary from 0.3 - 6.5 cm. however, blind blocks have had a failure rate of more than 60% and there could be blockages of the femoral or obturator nerve or intra - abdominal insertion. nerve stimulators can reportedly increase the success rate up to 85%, but their use doubles the time needed and results can vary depending on the patient 's subjective complaints of paresthetica. recently, ultrasound usage has increased dramatically in the area of pain medicine since it can confirm the target nerve and surrounding structures to allow accurate diagnosis, reduce additional damage when injecting medication, and allow injection of steroids or local anesthetic agents in the exact location. ng. investigated whether ultrasound was an accurate tool to find the location of the lfcn in 20 cadavers and 10 volunteers. the location of the lfcn found through anatomical landmarks of 2.5 cm interior and 2.5 cm below the asis was compared with the location of the lfcn found using ultrasound. accuracy was confirmed by dissection of the cadavers, and location of the actual nerve was confirmed by using the transdermal nerve stimulators in the volunteers. location accuracy using anatomical landmarks was 5.3% in cadavers and 0% in volunteers, while accuracy of the ultrasound was 84.2% in cadavers and 80% in volunteers. this study demonstrated how inaccurate blind block according to anatomical landmarks can be due to anatomical variance of the lfcn, while highlighting the accuracy of ultrasound - guided procedures. from the three cases, two showed successful results, and the procedure was performed 4 and 3 times, respectively, for the 2 cases. although the type of local anesthesia used was different, since our case obtained effective treatment results with less local anesthesia in two procedures, it can be suggested that ultrasound - guided blockage of the lfcn is more effective than results from blind technique. it is commonly known that the amount of local anesthetic agent used is reduced in ultrasound - guided nerve blocks. when blocking the lfcn, the amount of local anesthetic agent used in blind blocks is no less than 30 ml, while in ultrasound - guided lfcn blocks, usually 10 to 15 ml is recommended. hurdle. also reported a 100% success rate in ultrasound - guided blockage of the lfcn in 10 patients with small anesthetic dosages of 1 ml to 8 ml. reducing the amount of local anesthetic agent used can reduce systemic toxicity as well as the risk of unintended blockage of the femoral or obturator nerves. one week after the second procedure was performed, there were improvements in the vas and no complaints of sensory impairment or motor weakness in unintended areas, despite using half the amount of local anesthetic agent compared to the first procedure. this effective result without unintended blocks was from accurate injection using ultrasound despite the small amount of local anesthetic agent used compared to blind blockage. future research regarding minimum dosage of local anesthetic agent required when performing ultrasound - guided blockage of lfcn will be necessary. | meralgia paresthetica is a rarely encountered sensory mononeuropathy characterized by paresthesia, pain or sensory impairment along the distribution of the lateral femoral cutaneous nerve (lfcn) caused by entrapment or compression of the nerve as it crossed the anterior superior iliac spine and runs beneath the inguinal ligament. there is great variability regarding the area where the nerve pierces the inguinal ligament, which makes it difficult to perform blind anesthetic blocks. ultrasound has developed into a powerful tool for the visualization of peripheral nerves including very small nerves such as accessory and sural nerves. the lfcn can be located successfully, and local anesthetic solution distribution around the nerve can be observed with ultrasound guidance. our successfully performed ultrasound - guided blockade of the lfcn in meralgia paresthetica suggests that this technique is a safe way to increase the success rate. |
the incidence of postpartum hemorrhage is reported to be 24% in normal delivery and 6% in cesarean section. typically, postpartum hemorrhage refers to blood loss of 500 ml or more after completion of the third stage of labor. delay in diagnosis and management of postpartum hemorrhage can cause many complications such as severe anemia, blood transfusion and its complications, disseminated intravascular coagulation (dic), sheehan 's syndrome, hysterectomy, and death. delay in diagnosis of bleeding can be due to underestimation of the actual amount of blood loss during delivery. studies have shown that caregivers estimate the blood volume based on their self - notion. the accuracy of visual estimation of blood loss can be increased by standardization of visual estimation of blood loss and training the observers in these areas. (2012) showed that the estimation of postpartum hemorrhage volume by healthcare staffs was not accurate and training them to improve their skills of the estimation of postpartum hemorrhage seems to be necessary. further, shafi. (2006) demonstrated that health caregivers are unable in visual estimation of postpartum hemorrhage volume and need to be trained in this area. a midwife is often the first person who is present at the time of bleeding. therefore, efforts to improve the quality of midwifery training play a decisive role on the health of the society and quality of patient care. achieving this goal will obviously require a complete and comprehensive education system. today, training in our country is offered more in conventional methods and by lecture using powerpoint. the majority of the students are inactive and do not have the experience of active learning environment. therefore, alternative methods and using the methods through which students gain the knowledge and skills are needed. the use of the methods based on personal learning has the greatest and most important effect. these methods include learning by the use of simulators in small groups by practicing on a model in the clinical skills training center, and using cds and multimedia. by providing simulators and models, simulation - based training creates an opportunity for the students to learn the communication and technical skills in a calm and guided environment before entering the clinical area and gaining the clinical competence. because the number of students and the volume of skills required for the students are high, the opportunities for learning are low for them, hence, the use of multimedia enabled teaching approaches, which uses different methods of teaching, seems to be useful. one of these approaches is self - directed learning methods such as web - based training. web - based training increases the rate of training and learning, and each student uses the available resources according to his individual potentiality. despite the unique advantages and opportunities that web - based training has provided, but like any emerging phenomenon it is encountered with some challenges and limitations, especially in developing countries. the disadvantages of this type of education are its cost, the lack of direct interaction between teachers and students, the lack of face - to - face learning, which causes feeling of isolation among the students, and an negative impact on their success rate in the courses. toledo., (2010) showed that there were no difference between web - based training and face - to - face training in terms of accuracy of estimation of postpartum hemorrhage volume. due to the importance of accuracy of estimation of postpartum hemorrhage volume by midwifery students who are future midwives, appropriate high quality teaching methods to train the students for achieving the skills of visual estimation of postpartum hemorrhage volume, and also the lack of enough studies in iran, the researcher aimed to compare the efficacy of web - based, simulation - based, and conventional training on the accuracy of visual estimation of postpartum hemorrhage volume in the midwifery students of mashhad nursing and midwifery school. this is a three - group randomized trial that was performed after obtaining approval from the ethics committee of mashhad university of medical sciences. the sampling started with a written introduction letter to the mashhad school of nursing and midwifery in 2013. we calculated the sample size based on a pilot study based on the formula of proportions. with parameters = 0.05 ; 1 (or power) = 0.80, ci : 95%, p1:0.71, p2:0.37, 30 participants were needed in each group. expecting that 15% of the recruited participants could be ineligible for the final analysis, we concluded that each group should consist of at least 35 participants. the total number of students eligible for entry to the study was 105 cases. to minimize the effects of other variables and further homogenization, the samples were selected randomly in each semester and were randomly divided into three groups by the table of random numbers. numbers 13 were assigned to each group and when the right figure of the selected number was similar to the code, that person was allocated to the related group, and in the case of no similarity of right figure, the figure of second, third, or fourth have been the criteria. observers and statistical analyzers did not know how participants were randomly allocated in the three groups that were conducted. inclusion criteria including rejection of guests or transited students, consent to participate in the study, and unpleasant events within previous 6 months. exclusion criteria were not participating in all phases of training such as absence in pretest, training session, post - test, internet disconnection and testing, and unfortunate occurrences such as death of one degree relatives, severe family disagreements, and financial problems, during training sessions and test period. at the beginning of the study, each group included 35 cases, but during the course of the study, one case of the web - based group and four cases of the conventional group were excluded due to lack of participation in the post - test [figure 1 ]. then, the researcher introduced himself and explained a brief description of the study. if the students had willingness to participate in the study, the informed consent form and the form for selecting the study units were completed through an interview. consort flow chart of participants data were collected by the researcher - made questionnaire of demographic characteristics and an objective structured clinical test. after completing the demographic questionnaire, the demographic characteristics questionnaire included age, status of residence, semester, marital status, work experience, and self - assessment of skill of estimation of postpartum hemorrhage volume (was measured by likert 5 option : very high, high, average, low, very low, and any) that its validity was evaluated by the method of content validity. 1, sterile gauze 10 10 stained to 10 cc blood ; station no. 5, large receiver containing 500 cc blood ; station no. 6, clot with volume of 40 cc blood ; station no. 7, pad under the patient stained to 350 cc blood, and station no. 8, patient 's bed stained to 1000 cc blood that was simulated in situations such as postpartum hemorrhage in the maternity and was reconstructed in the clinical skills center. the students just had to estimate the blood loss volume in a numerical and recorded in a form that the observer had provided for them and gave it to the observer before exiting the station. scenes of postpartum hemorrhage were reconstructed in the objective structured clinical test by using a graded syringe that is a valid tool and synthetic blood that has similar density of blood. the minimum score of zero and maximum score of one were obtained from each station, as the minimum score of the bleeding volume was zero and the maximum was eight. the total time of the objective structured clinical test for each individual lasted 8 min. the same educational content was offered in all the three groups based on national guideline providing obstetric services in loving mother hospitals and various methods of estimation of postpartum hemorrhage volume. in the conventional training group, educational materials as lectures with powerpoint and a training film for 4 h (two sessions of 2 h, from 8 am to 12 pm in nursing and midwifery school, mashhad) were presented by the researcher. in the simulation - based group, at first, a brief summary of the educational content as lectures, powerpoint, and a training film was explained for 45 min in the clinical skills center. then, the researcher poured different volumes of bleeding (10, 20, 30, 40, 60, 80, 100, 250, 350, 500, and 1000 cc) on the pad and showed the method of estimation of bleeding volume with different methods (based on the amount of bleeding, symptoms, visual, weighing, testing, and blood collection plastic bags) (total time of training was 4 h). in the web - based group, 1-h training on how to use educational website that contains educational researcher estimates, the volume of postpartum hemorrhage was taught, and username and password to the students in this group were given. after a week, username and password were out of date and students were no longer able to access educational content. before the inception of study, the researcher together with cameraman took photos of different volumes of blood loss (10, 20, 30, 40, 60, 80, 100, 250, 350, 500 and 1000 ml) in different containers and different materials such as pads and made a film of 1 h about how to estimate blood loss volume by different methods (on the basis of the amount of blood loss, visual signs, weight, tests, and plastic bag for collecting the blood). after revision of images and didactic film, they were uploaded on the website. during this time, the students contacted the researcher via email (asynchronous) or in person and asked their questions. the person who designed the website checked the online system to ensure that the system will not be disconnected during the training period. again, 1 week after the training sessions, the post - test was simultaneously given to all the three groups just as the pre - test. the pre- and post - test results were compared in the three groups by descriptive statistical tests,, wilcoxon, a two - way anova analysis, and spss software 11.5. the total number of students eligible for entry to the study was 105 participants, and 100 participants completed the study and were included in the analysis [figure 1 ]. the mean and sd of age were 24.97 5.44 in the students of the web - based group, 24.42 4.44 in the simulation - based group, and 25.63 4.95 in the conventional group. the mean and sd of the working experience was 2.03 4.08 years in the students of the web - based group, 1.02 1.66 in the simulation - based group, and 1.16 1.63 in the conventional group. further, 29.41% of students in the web - based group, 51.42% of the simulation - based group, and 51.61% of the conventional group were living in the dormitory. the three groups were similar in terms of these three variables : age (p = 0.622), working experience (p = 0.531), and residence (p = 0.277). the three groups were not statistically different in terms of course and education semesters, marital status, and self - assessment skill of estimation of postpartum hemorrhage volume [table 1 ]. frequency distribution of students according to personal characteristics of estimation of postpartum hemorrhage volume in the three groups of web - based, simulation - based, and conventional training the mean score of estimation of postpartum hemorrhage volume before and after training showed significant differences in the three groups (p 0.05) [table 4 ]. the mean comparison estimated blood loss accurately of accuracy of estimation of postpartum hemorrhage volume before and after training on marital status, course and education semester, and self - evaluation of the skill of estimation of postpartum hemorrhage volume the findings of this study showed that the accuracy of visual estimation of postpartum hemorrhage volume in bleeding volume 350 cc (except station no. 5 receiver with 500 cc blood) is less than the actual volume of blood loss and the results are in agreement with the previous studies. razavi 's study found that the visual estimation of low blood loss tends to be overestimated and vice versa, that is, the visual estimation of high blood loss tends to be underestimated. in this study, visual underestimation at station no. 4 may be due to the misconception of students from low level of staining of gauze 10 10 with blood, and the visual overestimation at station no. 5 may be because the students faced the blood assembled in the receiver with no blood adsorbent surface. studies showed that the kind of the material of surfaces inoculated in blood was effective in accuracy of blood loss volume estimation, in less absorbable surfaces such as polyvinyl volume of blood loss was overestimated, and in high absorbent surfaces such as forest soil and carpet the volume was underestimated. training is a useful tool for reducing the accuracy error of blood loss volume estimation. the studies have shown that the rate of error of blood loss volume estimation is more in untrained individuals than trained ones.. showed that 20 min of speech training increased the accuracy of blood loss volume estimation. reported that simulation - based training increases the accuracy of estimation of postpartum hemorrhage volume. in this study also, training led to increased accuracy of estimation of postpartum hemorrhage volume, but no significant differences were found between the three groups of web - based, simulation - based, and conventional training in terms of the mean score of accuracy of estimation of postpartum hemorrhage volume. on 16 nurses, who have been recently graduated, showed that there were no differences in their grades on physiology, health, and pharmacology between web - based and conventional training groups. participants in the group of face - to - face training put more hours (time) for learning compared with the web - based training group. the reason of this paradox maybe the few number of subjects (low sample number) for performing the study and loss of suitable cooperation of subjects. toledo., studied 372 participants of healthcare providers in chicago memorial and reported the similar results ; the accuracy of estimation of postpartum hemorrhage volume increased significantly after training, but the mean score of estimation of blood loss volume was not significantly different between the two groups of web - based training and face - to - face training. these results may indicate that providing only one standard approach of postpartum hemorrhage volume and training it will result in improved accuracy of estimation of bleeding volume. in gordon. study (2006) in the usa after training by two methods of simulation and conventional about myocardial infarction and respiratory system diseases, there was no significant differences in written exam grades. in this study, researchers have noted that loss of impact of training may depend on the type of evaluation which was written exam. moreno. (2010) in their study on 143 medical students showed that the laboratory performance of students in the web - based simulation was better than the control group. this incoherence (or loss of similarity) with the recent study results maybe for the reason that web - based training is multimedia and there is no interaction between the website and the student, but in moreno - gers., study, they used web - based simulation, they designed an environment like actual laboratory to allow students to decide and exam and make errors. short exposure to a web - based simulation with low costs improved performance and resulted in more improvement of actual performance of students in web - based simulation during practical sessions. erfanian., demonstrated that simulation - based training was more effective than conventional training in increasing the midwifery students skill for inserting iud. this result is not consistent with the results of this study which may be due to differences in the types of skills, length of practical training, and short interval between the practical training and test. the study of merlin., on 74 of nurse students showed that there was a significant relevance between years of experience and accuracy of estimated blood loss volume in low volumes of blood loss, because clinical experience increased and accuracy of estimated blood loss in low volume increased. however, the results of wendy., which was performed to assess the capacity of 145 physicians, medicine students, residents, and nurses in texas to estimate blood loss volume, were not in agreement with this study, and they showed that there was no relevance between clinical experience and accuracy of estimation of blood loss volume. meiser., showed, in their study on 22 surgery (anesthesiologist, general surgeons, and orthopedics) to evaluate accuracy of blood loss volume, showed that there was no relevance between age, experience, and accuracy of estimation, but capacity of blood loss estimation was influenced by course of studies. the results of some other studies also showed that there was no relevance between clinical experience and accuracy of estimated blood loss volume. in our study, there was no significant relevance between age, clinical work experience, level of students education and accuracy of blood loss estimation after delivery. although we know that clinical experience results in learning, the reasons of this paradox may be that midwifes, midwifery students, and other healthcare givers estimate the blood loss volume as a daily repeated work and they do that on the basis of their prior learning 's and experiences which they had in their mind. our study is the first study to evaluate the three methods of web - based, simulation - based, and conventional training. because there was no difference between these methods of training, web - based training, which is an available and a cost - effective method, can be used instead of the two more common methods of simulation - based and conventional training. the strength of this study was the use of synthetic blood with similar viscosity and density to teach the students and compare the three methods of training. the limitation of this study was asynchronous communication of the students with the researcher, its cost, temporary disconnection, and sometimes low speed of internet when using of website. it is recommended that training of visual estimation of postpartum hemorrhage volume be a part of midwifery student 's curriculum and the studies be conducted in terms of training the visual estimation of postpartum hemorrhage volume in the real environment of maternity. the results of our study showed that training increased the accuracy of estimation of postpartum hemorrhage volume and no significant differences were found among the three groups of web - based, simulation - based, and conventional training. we can use web based as a substitute or supplement of training along with two other more common simulation and conventional methods. by the use of web - based training, the trainers could utilize many education strategies to present the lessons and there is also active learning by students. | introduction : delay in diagnosis of bleeding can be due to underestimation of the actual amount of blood loss during delivery. therefore, this research aimed to compare the efficacy of web - based, simulation - based, and conventional training on the accuracy of visual estimation of postpartum hemorrhage volume.materials and methods : this three - group randomized clinical trial study was performed on 105 midwifery students in mashhad school of nursing and midwifery in 2013. the samples were selected by the convenience method and were randomly divided into three groups of web - based, simulation - based, and conventional training. the three groups participated before and 1 week after the training course in eight station practical tests, then, the students of the web - based group were trained on - line for 1 week, the students of the simulation - based group were trained in the clinical skills centre for 4 h, and the students of the conventional group were trained for 4 h presentation by researchers. the data gathering tool was a demographic questionnaire designed by the researchers and objective structured clinical examination. data were analyzed by software version 11.5.results:the accuracy of visual estimation of postpartum hemorrhage volume after training increased significantly in the three groups at all stations (1, 2, 4, 5, 6 and 7 (p = 0.001), 8 (p = 0.027)) except station 3 (blood loss of 20 cc, p = 0.095), but the mean score of blood loss estimation after training did not significantly different between the three groups (p = 0.95).conclusion : training increased the accuracy of estimation of postpartum hemorrhage, but no significant difference was found among the three training groups. we can use web - based training as a substitute or supplement of training along with two other more common simulation and conventional methods. |
people with intellectual disability (i d) experience significant health inequalities compared with the general population.1,2 for example, patients with i d have higher mortality rates, a shorter life expectancy, and higher levels of unmet health needs.1 previous studies have indicated that individuals with i d have higher levels of an overweight status and obesity than those without id,15 and moderate, but not severe, i d has been reported to be associated with being overweight.3,4 it has also been reported that the risk of developing i d is high among patients with epilepsy.69 valproic acid (vpa) is one of the most widely prescribed antiepileptic drugs worldwide.10 long - term treatment with vpa has been shown to be associated with metabolic and endocrine disorders, such as weight gain and hyperinsulinemia, which may contribute to the increased cardiovascular risks observed in patients with epilepsy.1113 although the real incidence and magnitude of vpa - induced weight gain is unknown, the reported frequency of weight gain varies between 10% and 70%.11,12 several potential risk factors for vpa - induced weight gain have been identified, including puberty and a pretreatment overweight status.11,12 however, there are presently no data available regarding the relationship between i d and vpa - induced weight gain. the primary objective of this exploratory study was to retrospectively investigate the influence of moderate i d on an overweight status in vpa - treated patients with epilepsy. furthermore, we determined potentially specific factors affecting weight gain in vpa - treated patients with moderate i d. a clinic - based retrospective longitudinal analysis was conducted among 143 japanese patients (89 males and 54 females) with epilepsy treated with vpa at kumamoto saishunso national hospital in kumamoto, japan, between june 1989 and april 2011. the study protocol was approved by the ethics committees of kumamoto saishunso national hospital and the faculty of life sciences, kumamoto university (kumamoto, japan). informed consent, including a statement regarding the privacy policy, was obtained in writing from each patient and his / her parent before entry into the study. patients were included if they fulfilled all the following conditions : younger than 18 years of age at the start of vpa therapy (baseline) ; treatment with sustained - release vpa for 6 months or longer and not taking any drugs that may alter the body weight, except for antiepileptic drugs ; and no history of severe or profound i d, eg, severe motor and intellectual disabilities, as well as other psychiatric disorders. the type of seizure and epileptic syndrome was classified according to the guidelines of the international league against epilepsy.14 in all patients, vpa therapy was chosen according to the treatment guidelines of the japan epilepsy society. the dose of vpa was escalated at weekly intervals by 510 mg / kg / day for each step up to the maximum tolerated dose. the data included the patient s weight, dose, and schedule of vpa and concomitant medications, evaluated at all visits during treatment with vpa. we used the international classification of diseases, 10th revision (icd-10) to identify individuals with moderate i d (icd-10 f71, consistent with an iq score of 3549) and defined patients with an iq score of 50 as being without moderate i d. the height and weight of each subject were measured, and the body mass index (bmi) was calculated. since the bmi in childhood changes substantially with age,15 the age- and sex - specific international bmi cutoff value for an overweight status in children, which was established by cole was used for diagnosis of being overweight when the patient was 17 years of age or under. when the patient was 18 years of age or older during vpa therapy, an overweight status was diagnosed as a bmi 25 kg / m. we determined the bmi gap in each patient at every follow - up visit using the following equation : bmi gap = patient s bmi value, the strength of the association between moderate i d and the risk of being overweight was measured as the odds ratio using a logistic regression analysis in all vpa - treated patients with epilepsy. among the patients who were not overweight at baseline, the cumulative incidence of becoming overweight according to the presence or absence of moderate i d was plotted based on the kaplan meier method, and the multivariable - adjusted hazard ratio (hr) was determined using a cox proportional hazards model. the odds ratio and hr were adjusted for potentially confounding factors,11,16 ie, the patient age at baseline, sex, dose of vpa, seizure locus, and the co - administration of antiepileptic drugs that may influence the body weight (ie, carbamazepine, clobazam, gabapentin, zonisamide) and other antiepileptic drugs. in order to identify specific factors influencing the fluctuation in weight in the patients with moderate i d, the associations between the patient age at baseline, sex, dose of vpa, seizure locus and co - administration of antiepileptic drugs and the longitudinal changes in the bmi gap were also measured using adjusted partial regression coefficients (b) separately in the patients with and without moderate i d. the b - values were calculated employing a multiple linear regression model based on the generalized estimating equations approach. in the multiple linear regression model, the variance structure model was best described using an autoregressive model. in order to assess the cumulative incidence of an overweight status and the multivariable - adjusted hr obtained using the cox proportional hazards model, we included all data acquired at every follow - up visit during the vpa therapy period. in order to assess the longitudinal changes in the bmi gap using the generalized estimating equations approach, we extracted the values for the bmi gap at yearly intervals after starting the vpa therapy. a p - value of 0.05). significant differences were observed between the patients with moderate i d and those without moderate i d in terms of the daily vpa dose ; number of patients receiving vpa only ; number of patients treated with co - administered carbamazepine, clobazam, or phenytoin ; seizure locus ; and seizure type (table 1). according to the logistic regression analysis in the 143 patients, moderate i d was not associated with the incidence of an overweight status at baseline (odds ratio = 1.18, 95% confidence intervals = 0.403.53, p=0.762). the patient characteristics of the 119 patients who were not overweight at baseline according to the presence or absence of moderate i d are shown in table 1. significant differences were also observed between the patients with moderate i d and those without moderate i d in the daily vpa dose ; number of patients receiving vpa only ; number of patients treated with co - administered carbamazepine, clobazam or phenytoin ; seizure locus ; and seizure type (table 1). no patients were treated with gabapentin, which may influence the body weight,16 during vpa therapy. the mean duration of follow - up was 3.62.1 years (4.12.1 years for the patients with moderate i d ; 3.11.9 years for those without moderate i d). sixteen (13.4%) patients (13 [21.3% ] patients with moderate i d, 3 patients [5.2% ] without moderate i d ] were newly diagnosed to be overweight during the vpa therapy period. figure 1 shows the cumulative incidence of becoming overweight in the patients with and without moderate i d. the presence of moderate i d was significantly associated with a higher incidence of an overweight status in the cox regression model (hr=6.72, 95% confidential intervals = 1.6627.15, p=0.007), which was adjusted for potential confounding factors, ie, the patient age at baseline, sex, dose of vpa, seizure locus, and co - administration of antiepileptic drugs that can influence the body weight (carbamazepine, clobazam, zonisamide) and other antiepileptic drugs. in order to identify factors influencing longitudinal changes in body weight during vpa therapy, we investigated the associations between the patient age at baseline, sex, dose of vpa, seizure locus, and co - administration of antiepileptic drugs and the longitudinal changes in the bmi gap separately in the patients with and without moderate i d (table 2). among the patients with moderate i d, the co - administration of carbamazepine and clobazam was significantly associated with an increased bmi gap, while a younger age at baseline and the co - administration of zonisamide was associated with a decreased bmi gap (table 2). among the patients without moderate i d, a younger age at baseline was associated with a decreased bmi gap, whereas none of the other patient characteristics were associated with the longitudinal changes in the bmi gap (table 2). table 3 shows the number of patients treated with carbamazepine, clobazam, or zonisamide at each time point used in the evaluation of the longitudinal changes in the bmi gap during vpa therapy. the number of patients treated with carbamazepine and clobazam tended to be higher among the subjects with moderate i d than among those without (table 3). the daily doses of carbamazepine and clobazam during vpa therapy also tended to be greater in the patients with moderate i d than in those without moderate i d (figure 2), whereas there were no differences in the dose of zonisamide (data not shown). the findings of this retrospective longitudinal study showed that moderate i d is associated with weight gain in patients with epilepsy under vpa therapy. it is known that vpa - induced weight gain may be associated with pathological consequences related to obesity, such as dyslipidemia, diabetes mellitus, and atherosclerosis.11,12,17 therefore, identifying patients at risk for weight gain will help clinicians to select the appropriate treatment and appropriately counsel these patients to avoid weight gain.11 the results of previous clinical studies suggest that various risk factors contribute to vpa - induced weight gain, including a female sex, puberty, a long duration of therapy, generalized seizures, and a pretreatment overweight status.11,12 the findings of the current study suggest that moderate i d may be a potential novel risk factor for weight gain in vpa - treated patients with epilepsy. the mechanism underlying vpa - induced weight gain is a matter of debate, and various hypotheses have been proposed to explain the effects of vpa on increases in weight. such mechanisms include dysregulation of the hypothalamic system and the effects of insulin resistance.11,12 it is known that treatment with vpa disrupts the hypothalamo hypophyseal gonadal axis in female rats,18 and it has been reported that vpa - treated patients who report weight gain develop an increased appetite and frequently consume calorie - rich beverages.11,12,19 it has also been demonstrated that people with i d, especially those with moderate i d, have higher levels of being overweight and obese than those without.25 proposed reasons for this observation include high levels of inactivity and comorbid health conditions, physical disabilities, or excessive eating in individuals with id.1,2,5 therefore, we speculate that the more pronounced vpa - induced weight gain observed in patients with moderate i d may be attributed to id - related physical inactivity or excessive eating, although the underlying mechanism remains unknown. in the present study, the co - administration of carbamazepine and clobazam was significantly associated with an increased bmi gap only in the patients with moderate i d (table 2). previous studies have reported that patients treated with carbamazepine experience weight gain in the same manner as vpa - treated patients,20,21 and the frequency of weight gain is observed to be as high as 19.1% in patients treated with clobazam.22 patients with epilepsy and i d often receive many antiepileptic drugs at high doses, as i d has been identified to be a potential predictor of intractable epilepsy.2325 in the present study, the number of patients treated with carbamazepine and clobazam tented to be higher among the subjects with moderate i d than those without (tables 1 and 3), and the doses of these antiepileptic drugs were greater in the patients with moderate i d (figure 2). when these findings are combined, the high incidence of an overweight status among the vpa - treated patients with moderate i d may also be attributed to the higher frequencies and greater doses of the co - administered carbamazepine and clobazam in these patients, although we adjusted for these potential confounding factors in the cox proportional hazards regression analysis. the findings of previous clinical studies have demonstrated that a decreased appetite and weight loss are frequently reported in patients treated with zonisamide.26,27 in the present study, the co - administration of zonisamide was associated with a decreased bmi gap only in the patients with moderate i d (table 2), whereas the number and daily dose of co - administrated zonisamide during vpa therapy did not differ between the patients with moderate i d and those without (tables 1 and 3). therefore, the weight loss inducing effect of zonisamide may be more pronounced in patients with moderate i d than in those without moderate i d. nevertheless, it remains to be definitively determined why co - administered zonisamide was associated with a decreased bmi gap only in the patients with moderate i d in the current study. therefore, further investigation with a larger number of patients is required to verify the associations discussed earlier. puberty has been identified to be a risk factor for weight gain in vpa - treated patients with epilepsy.11 previous studies have suggested that the mature endocrine system in adults may be necessary for the development of vpa - related obesity.11 in this study, a younger age at baseline was found to be associated with a decreased bmi gap in either the patients with or without moderate i d (table 2). within our study population, the findings of the present study suggest that a younger age at baseline may be associated with a low risk of vpa - induced weight gain in children, regardless of the presence of moderate i d. a major limitation of this study is the study design, which involved a retrospective investigation of a small number of patients. additionally, since we included only vpa - treated patients, we were unable to determine the relationships between the presence of moderate i d and the weight status in the patients treated with other antiepileptic drugs and nonepileptic subjects. furthermore, several potential covariates associated with being overweight were not included, such as a pretreatment overweight status, dietary habits, physical activity level, presence of sleep apnea, blood concentrations of vpa and other antiepileptic drugs, blood ammonia level, electroencephalogram finding, and type(s) of disability. sleep apnea, especially, has been reported to be associated with weight gain as well as cognitive function.28,29 however, since we did not screen sleep apnea in the study subjects, we could not identify the patients with sleep apnea among the subjects included. finally, since we excluded patients with a history of severe or profound i d in the present study, the association between the severity of i d and vpa - induced weight gain remains unknown. further investigations are thus needed to confirm and further clarify the association between i d and vpa - induced weight gain. in conclusion, this is, to the best of our knowledge, the first study to show that patients with moderate i d may have a high risk of becoming overweight during vpa therapy. additionally, this study demonstrated that the co - administration of carbamazepine and clobazam may be associated with vpa - induced weight gain in patients with moderate i d. the findings of the present study suggest that the potential for weight gain should be carefully monitored in vpa - treated patients with moderate i d, especially those receiving other co - administered antiepileptic drugs that facilitate weight gain, such as carbamazepine and clobazam. | backgroundalthough patients with moderate intellectual disability (i d) are known to have higher rates of being overweight and obese than those without i d, there are no current data regarding the relationship between i d and weight gain in epilepsy patients treated with valproic acid (vpa).patients and methodsthe possible association between moderate i d and an overweight status at the time of initiation of vpa therapy (baseline) was investigated using a logistic regression analysis in 143 patients with epilepsy. among the 119 nonoverweight patients at baseline, the longitudinal association between moderate i d and the weight status during vpa therapy was retrospectively examined using a cox hazards regression analysis and the generalized estimating equations approach, while also paying careful attention to associations with other patient characteristics.resultsthe proportion of patients with moderate i d was 52.4% among the 143 study subjects. the presence of moderate i d was not associated with an overweight status at baseline (p=0.762). among the nonoverweight patients at baseline, 16 subjects were newly diagnosed as being overweight during treatment with vpa (3.62.1 years). the presence of moderate i d was significantly associated with the incidence of an overweight status after starting vpa therapy (adjusted hazard ratio = 6.72, p=0.007). the patient age at baseline and treatment with co - administered carbamazepine, clobazam, and zonisamide significantly influenced the degree of weight fluctuation during vpa therapy among the patients with moderate i d (p<0.001, p<0.001, p=0.002, and p=0.028, respectively), whereas only patient age at baseline affected this parameter among the patients without moderate i d (p=0.022).conclusionthe present findings suggest that the weight status should be carefully monitored in vpa - treated patients with moderate i d, especially those receiving other co - administered antiepileptic drugs that facilitate weight gain, such as carbamazepine. |
childhood is considered the structuring period of life, during which such patterns as diet and lifestyle are formed and fixed. although atherosclerotic disease (ad) becomes symptomatic later in life, the early identification of predisposing factors and lifestyle modifications can significantly reduce the incidence of ad.1 findings indicating that atherosclerosis begins in childhood are not new and were first presented by saltykow in 1915 in studies involving autopsies of young patients. atherosclerosis has been appreciated as a pediatric problem since 1965.2 coronary atherosclerosis, a disease as old as the human species, is undoubtedly the best - documented pathology.3,4 this process begins in early childhood, and is highly reversible at that stage.5 children usually do not develop atherosclerosis ; however, they develop fatty streaks that are reversible.6 reports in the medical literature show that the degree of atherosclerosis in children and young adults can be correlated with the same risk factors identified in adults, and minimizing or reducing these known risk factors is prudent.7,8 therefore, investigating risk factors for that stage of life is fundamentally important, because these risk factors can have profound implications for disease manifestations in adulthood.912 in this systematic review, we analyze the main cardiovascular risk factors present in childhood and their prevalence. electronic searches were conducted for selected articles from pubmed, scielo, and cochrane from 1992 to 2012 using the following terms : physical activity, cardiovascular risk factors, obesity in childhood, children and adolescents, hypertension in childhood, and atherosclerotic disease. searches for books, dissertations, and theses were performed using the google scholar search tool. two authors independently reviewed the articles selected from the initial search for methodological quality, number of subjects studied, and results demonstrated. studies with dubious methodologies or with very low numbers of assessed individuals and studies that repeated information that was available in other studies were excluded. in the latter case, preference was given to the most recent study and to the study with the greatest number of individuals assessed, respectively. the identification of risk factors in children in combination with cooperative action by public agencies and medical professionals, especially pediatricians and cardiologists, can produce positive effects for one of the world s major public health problems. the finding that ad begins at an early stage of life reveals childhood and adolescence as critical periods for the detection of risk factors for cardiovascular disease and the prevention of future complications. monitoring these factors would help identify early signs that when modified can mitigate or even reverse the progression of those dysfunctions. a range of risk factors, including genetic factors, hypertension, dyslipidemia, obesity, metabolic syndrome (ms), an atherogenic diet, and physical inactivity, is associated with cardiovascular disease, and the prevalence of these factors is increasing among children and adolescents.1317 lifestyle and eating habits are fundamentally important for protection against the manifestation and progression of ad risk factors. ad is considered the main causal factor for cardiovascular disease,18,19 and therefore should be a key target of heart disease - prevention programs.20 the emphasis is on hypercholesterolemia, hypertriglyceridemia, overweight, hyperglycemia, hypertension, and physical inactivity.21 correlations between the plasma levels of cholesterol and a decrease or delay in ad progression by means of diet and lifestyle changes have been documented,22 with the hypothesis that for each 1% reduction in total cholesterol, a decrease of 2% in the occurrence of coronary artery disease was observed. studies have also reported that the degree of atherosclerosis in children and young adults can be correlated with the same risk factors that have been identified in adults. therefore, an increase in the incidence of cardiovascular disease is likely to occur when current teens enter adulthood. thus, as in other age - groups, it is prudent to minimize or reduce risk factors in youth.7 although ad becomes symptomatic later in life, the early identification and modification of risk factors can reduce its later incidence.1 these diseases are currently the most common causes of death. studies suggest that the ad process is as old as the human species.3,23 ad begins in childhood ; therefore, its prevention should begin early, because at this stage it is considered reversible, with high levels of blood lipoproteins playing a fundamental role in its manifestation.24 in children, fatty streaks in the aorta, although reversible, arise at around 3 years of age and already compromise 15% of this artery by 15 years of age. several studies cited by franoso and coates23 present evidence of fatty streaks and fibrous plaques in the coronary arteries of adolescents between 10 and 14 years of age and thickening of the inner layer (intima) of the coronary arteries in children less than 5 years of age. researchers have demonstrated that a fatty diet and other traditional vascular risk factors begin to influence blood lipid levels during the early years of life.6,23 due to the variety of criteria used to define optimal lipid levels in adolescents, it is difficult to compare results from across the world. however, studies have shown, for example, the presence of atheromatosis in aortic intima with cholesterol levels between 140 and 170 mg / dl. thus, the epidemiological goals for plasma cholesterol in children would be an average of 150 mg / dl.8 in a review of studies conducted in 26 countries (from 1975 to 1996) involving 60,494 children and adolescents aged 219 years, brotons found an average of 165 mg / dl for cholesterol, 60 mg / dl for hdl - cholesterol, and 67 mg / dl for triglycerides. table 2 demonstrates the lipid levels recommended in adolescents up to 19 years of age.26 studies conducted in brazil revealed higher levels of cholesterol in adolescents attending private schools compared to those attending public school.11,27 this trend was confirmed by other studies15,28,29 that showed that adolescents with lower family income and those that attend public schools have lower cholesterol levels than adolescents from higher - income families and private schools. these data support guimares s and guimaress29 proposition that families with higher socioeconomic levels do not necessarily have a better and healthier lifestyle. the lower household income in developing countries may prevent these children from consuming high levels of calories in diets heavy in saturated fats and cholesterol. in addition, students of public schools tend to expend more energy in their daily lives because they need to walk to school or use public transportation. despite methodological limitations for calculating low - density lipoprotein cholesterol as part of the lipid profile, its measurement is widely regarded as the gold standard for both risk assessment and intervention programs for cardiovascular diseases.8 because triglycerides are deposited on the vessel wall and initiate the process of low - density lipoprotein accumulation, they are strongly associated with the risk of developing ad.30,31 whether breastfeeding during the first year of life confers protection against future increases in the levels of plasma lipids and mortality by ad is controversial.32 the major health advantage of breastfeeding that has been clearly demonstrated remains in the protection of the infant from certain infections in early life. if there are other long - term health advantages, they have yet to be fully elucidated and confirmed. dyslipidemia that begins during childhood tends to be maintained through development, and studies describe a direct relationship between total cholesterol levels in children and heart disease in adults.33 studies conducted in brazil15,27,34 have shown that cholesterol levels in adolescence correlated with 87% of deaths due to heart disease in adulthood (figure 1) and showed that high levels of cholesterol are accompanied by a high mortality rate. an association between inflammatory processes and the development of atherosclerosis has recently been described, providing important correlations for understanding the mechanisms of atherogenesis and risk factors. several studies have examined different markers of inflammation in the bloodstream, such as cytokines and adhesion molecules, as potential predictors for the risk of heart disease. some clinical studies have suggested that serum levels of tumor necrosis factor-, interleukin-6, and c - reactive protein are elevated in patients with congestive heart failure, regardless of the etiology of the condition. furthermore, elevated blood levels of these inflammatory markers correlate with worsening functional class, increased hospitalization rates, and poorer survival.3538 in addition, structural and functional changes have been observed in the arteries of children with a familial predisposition for ad, and these changes are associated with groups of inflammatory factors and oxidation markers. during the development of atheromatous plaques, inflammation plays an essential role in the destabilization of arterial plaques, and in turn is associated with acute thromboembolic diseases. because lifestyle - modification trials have been successful in decreasing endothelial dysfunction and levels of inflammation markers among children and adolescents, controlling the inflammatory process is suggested in addition to expanding pharmacological therapies, which are considered a secondary means of preventing ad.39 obesity (more specifically, excessive adiposity), which is defined as an excessive accumulation of body fat, is a heterogeneous disorder with a common final pathway in which energy intake chronically exceeds energy expenditure. obesity features a combination of genetic and environmental factors.40 the energy imbalance often begins in childhood, and when this imbalance occurs the likelihood of obesity in adulthood increases. among young people, the prevalence of obesity has greatly increased in recent years and represents the most common chronic disorder.41 excessive adiposity in childhood represents a greater risk to adult health than obesity starting in adulthood. adults who were overweight as adolescents have an increased risk of diseases compared with adults who were of normal weight as adolescents.42,43 obesity is the result of a complex interaction of factors, including metabolic, physiological, environmental, genetic, behavioral, and social influences. the bogalusa heart study in louisiana (usa), which was conducted among children and adolescents, suggested significant correlations between obesity and both lipoprotein levels (low - density lipoprotein in particular) and insulinemia, which were correlated with the risk of cardiovascular diseases.44 although it is unclear if childhood obesity is an independent risk factor for cardiovascular disease, studies show a clear association between severe obesity and increased mortality. the importance of childhood obesity as a risk factor for cardiovascular disease is increasingly evident.17,45 obesity deserves particular attention because it is usually accompanied by two notorious and significant risk factors : diabetes and arterial hypertension.46,47 therefore, controlling obesity during childhood is important because the obesity acquired during this period of life tends to persist into adulthood.11 studies have reported a substantial increase in the number of overweight children and adolescents in recent decades, and this increase is associated with an increased risk of hypertension, lipid abnormalities, type ii diabetes, early atherosclerotic lesions, adult obesity, and mortality in young adulthood.7,4850 preventing childhood obesity is the best opportunity to introduce changes in lifestyle and thus reduce cardiovascular morbidity and mortality.5153 the diagnosis of overweight and obesity still presents difficulties, because the best criteria to determine these categories in this age - group remain unclear. however, the body mass index, based on international standards, is useful, inexpensive, and replicable.54 recently, the term obesity has been used to identify body mass index p95 in children and adolescents.50 data on childhood and adolescent obesity around the world are still limited, and the lack of uniformity among definitions and studied age - ranges complicates comparisons of prevalence. obesity in children and adolescents is increasing significantly, including in developing countries.55 a national study, nutre brasil infncia (nourish brazil childhood), indicated that 23% of brazilian children up to 5 years of age exhibit excess weight,56 while in developed countries, obesity mainly affects the lower - income social classes ; in brazil, for example, the most favored social classes are still the most affected, although there is a tendency toward change. the most recent studies conducted in brazil reveal that the prevalence of overweight in children and adolescents ranges from 8.4% to 19%, while that of obesity ranges from 3.1% to 18%;54,57 furthermore, the prevalence of overweight and obesity is greater in higher - income households.58,59 the national health and nutrition examination survey estimated a prevalence of 30% for overweight and obesity p85 and a prevalence of 15% for obesity p95 for the age - group between 6 and 19 years of age.60 in brazil, studies stress the physical inactivity of children as one of the most important factors associated with obesity.4954 ms is currently characterized as the combination of a number of risk factors for cardiovascular disease, including dyslipidemia, hypertension, carbohydrate - metabolism disorders, and obesity, especially abdominal obesity.61 in children, the global consensus regarding ms is still a matter of discussion.26 a direct association between obesity and insulin - resistance syndrome has been demonstrated in children, and was recently recognized as a major precursor of atherosclerotic cardiovascular disease and type ii diabetes.7,62 although we do not have a global consensus to define and diagnose ms in adults and children, ms is associated with a 1.5-fold increase in overall mortality and a 2.5-fold increase in cardiovascular mortality.63 given its importance, various organizations, including the world health organization,64 the national cholesterol education program adult treatment panel iii,65 the european group for the study of insulin resistance,66 and the international diabetes federation, have proposed criteria to define and treat ms. to determine the prevalence of ms in children and adolescents, either the adult criteria are modified for pediatric reference values,67 or specific cutoff points are used.68,69 some studies suggest cutoff points corresponding to the 95th percentiles of each variable by sex and age and the height percentile when including blood pressure (bp).70,71 however, the lack of consensus means that the prevalence of this syndrome is markedly different in different studies.72table 3 demonstrates the definition considered most suitable for ms, according to the department of metabolic syndrome of the brazilian society of diabetes.26 prospective studies have shown that obesity looms as the most important risk factor for ms and precedes the onset of insulin resistance by several years;62,73 insulin resistance is the leading cause of the hemodynamic and metabolic disorders of ms.74 ms is caused by a combination of genetic and environmental factors in which obesity plays a primary role and leads to excessive production of insulin, which is associated with an increase in bp and dyslipidemia.50 an estimated 1 million us adolescents already meet the criteria for ms,50 with a prevalence of 4% between 12 and 19 years of age. in addition, ms is present in 30%50% of overweight children.67,75 identified as one of the most common precursors of coronary artery disease, hypertension is usually asymptomatic, and prevention is the most efficient way to fight it and avoid the high social cost of its treatment and complications. therefore, the need to measure hypertension levels and identify those individuals with high bp is mandatory. the worldwide prevalence of hypertension in children is highly variable (2%13%), depending on the methodology employed. in brazil, for example, it is estimated that the prevalence of hypertension in children and adolescents is 4%,76 and the need for bp measurement is considered imperative from 3 years of age. arterial bp commonly rises with age, and its elevation in children is a prediction of hypertension in adulthood that may have started in childhood or adolescence.7,7780 bp should be interpreted as a result of the impact of environmental influences on the expression of several genes that in turn regulate other genes. it is influenced by angiotensin - converting enzyme gene expression and for endothelial no synthase gene expression.81,82 several known factors related to hypertension in adults, such as sex, age, family history, and the presence of increased body weight or obesity, are also observed in children and adolescents.83 high bp contributes to the development of cardiovascular complications. its association with multiple risk factors has a multiplier effect on the risk of cardiovascular events.8486 hypertension is diagnosed when the values of systolic bp and/or diastolic bp are greater than or equal to the 95th percentile for sex, age, and height, plus 5 mmhg, on three separate occasions. a prehypertensive group should also be defined and identified with the purpose of adopting stringent preventive measures. bp values 90th percentile and < 95th percentile characterize prehypertension ; values that are included in this range and exceed the limits of 120/80 mmhg should also be considered as prehypertensive and follow the same recommendations proposed by the seventh report of the joint national committee on prevention, detection, evaluation, and treatment of high blood pressure (jnc 7)85 for adults. table 4 summarizes the classification of bp for children and adolescents.87 it is estimated that 30% of children and adolescents with overweight / obesity have hypertension.88 thus, the presence of overweight / obesity appears to be one of the most important factors related to hypertension in children and adolescents worldwide.85,89,90 several studies have shown that the presence of overweight / obesity is positively correlated with the occurrence of prehypertension in children and adolescents, and this combination increases the risk of developing adult hypertension.9194 certain conditions are strongly associated with hypertension in teens, including smoking and the use of contraceptives, alcohol, cocaine, amphetamines, anabolic steroids, phenylpropanolamine, and pseudoephedrine (nasal decongestants). therefore, changes in lifestyle, such as weight control, reduction in sodium intake, and exercise, are fundamental for the prevention of hypertension. although threshold pressure levels are not yet well defined, bp most likely affects target organs in children, as in adults. dietary intervention, maintaining an ideal weight, and engaging in regular physical activity could be encouraged at this stage as a method of primary prevention.24 in a study on the stiffness of large arterial vessels, which is attributed to aging, the only studied factor that could explain the group with vessels that did not show signs of age was the lowest bp level presented.95 the death rate from cardiovascular disease is lower in individuals who exercise regularly, and there are no doubts about the improvement in quality of life that is achieved through a physical conditioning program. however, this improvement depends on a proper prescription, and intensity, duration, and modality have an important role for a satisfactory result. in adults, the recommended physical conditioning activities lie between the ventilatory threshold and the respiratory compensation point ; that range is most recommended for its beneficial effects on cardiopulmonary capacity.96 in children, the beneficial effects associated with physical activity include weight control, effects on cholesterol levels and insulin resistance, low bp, psychological well - being, and an increased predisposition for physical activity in young adulthood.7,97 adolescents should engage in physical activities of moderate to vigorous intensity for at least 60 minutes a day, 5 days a week ; this activity can be in or outside school and can be structured.97 a major challenge for public health authorities has been to increase the cardiorespiratory fitness of the population. childhood and adolescence appear to be periods for promoting good physical activity habits and preventing sedentary behavior in adulthood. therefore, the prevention of cardiovascular disease is also a pediatric problem.5 in recent decades, children have become less physically active, with energy expenditure approximately 600 kcal / day lower than their contemporaries 50 years ago.98 physical inactivity is recognized as an important determinant of chronic diseases, and an increase in the prevalence of these diseases during childhood has been documented.99 attention has been drawn to the need for physical education programs in schools and for community recreation facilities. however, few empirical studies have been conducted to determine the impact of such facilities and programs on physical activity and the level of inactivity in adolescents.100 among adolescents, there is a trend to engage less in school physical education activities and vigorous activities and to spend more time watching television.101,102 these behaviors can affect future health problems, whereas greater physical fitness has been linked to a lower cardiovascular risk profile in children and adolescents.103 identifying population values of maximal oxygen consumption (vo2max) is important in studies that attempt to relate physical fitness to cardiovascular risk. vo2max is a measurement that is used to guide the prescription of exercise and analyze the effect of training programs.104,105 aerobic capacity measured through vo2max depends on cardiovascular, respiratory, and hematological components, and the oxidative mechanisms of muscle in exercise. this value is determined by means of cardiopulmonary exercise testing, which allows the simultaneous assessment of the cardiovascular and respiratory systems ability to perform their main functions, such as gas exchange.104 measurements of gas exchange are fundamental to understand the limitations of exercise. however, multiple paths (direct or indirect) have been used to determine cardiorespiratory fitness. the differences in the methods used may be responsible for the differences found in the predictive power of this important physiological variable and whether cardiorespiratory fitness can serve as a predictor of blood lipids in children.106 however, the expected increase in bp with age is lower in children with better physical fitness.107 adolescence is the period of transition to adulthood, during which many structural, hormonal, and biochemical changes occur in physiological systems that affect vo2max.108 thus, it is necessary to establish specific vo2max values for this population. the international literature offers benchmarks for healthy children and adolescents.15,104,109 described as a behavior, physical activity includes many types of muscular activity that significantly increase energy expenditure. physical fitness is described as an attribute, and generally refers to the ability to perform physical work ; in addition, physical fitness is considered an adaptive state and is partly genetically determined.110 physical fitness measurements are preferred over physical activity measurements because they are more objective and less error - prone. in addition, thus, efforts should be intensified to identify the starting point for daily physical activity to increase physical fitness in youth.110112 however, determining this variable is not yet a global reality, and empirical evaluations have been performed. the use of cardiopulmonary exercise testing makes it possible to assess metabolic and cardiopulmonary capacity accurately through direct measurements of vo2 max. this value is the most important physiological measurement for determining aerobic capacity, the accurate level of physical fitness, and therefore the correct intensity of exercise to obtain the health benefits of a fitness program.96 the finding that ad begins at an early stage of life reveals childhood and adolescence as critical periods for the detection of risk factors for cardiovascular disease and the prevention of future complications. monitoring these factors would help identify early signs that when modified can mitigate or even reverse the progression of those dysfunctions. a range of risk factors, including genetic factors, hypertension, dyslipidemia, obesity, metabolic syndrome (ms), an atherogenic diet, and physical inactivity, is associated with cardiovascular disease, and the prevalence of these factors is increasing among children and adolescents.1317 lifestyle and eating habits are fundamentally important for protection against the manifestation and progression of ad risk factors. ad is considered the main causal factor for cardiovascular disease,18,19 and therefore should be a key target of heart disease - prevention programs.20 the emphasis is on hypercholesterolemia, hypertriglyceridemia, overweight, hyperglycemia, hypertension, and physical inactivity.21 correlations between the plasma levels of cholesterol and a decrease or delay in ad progression by means of diet and lifestyle changes have been documented,22 with the hypothesis that for each 1% reduction in total cholesterol, a decrease of 2% in the occurrence of coronary artery disease was observed. studies have also reported that the degree of atherosclerosis in children and young adults can be correlated with the same risk factors that have been identified in adults. therefore, an increase in the incidence of cardiovascular disease is likely to occur when current teens enter adulthood. thus, as in other age - groups, it is prudent to minimize or reduce risk factors in youth.7 although ad becomes symptomatic later in life, the early identification and modification of risk factors can reduce its later incidence.1 these diseases are currently the most common causes of death. studies suggest that the ad process is as old as the human species.3,23 ad begins in childhood ; therefore, its prevention should begin early, because at this stage it is considered reversible, with high levels of blood lipoproteins playing a fundamental role in its manifestation.24 in children, fatty streaks in the aorta, although reversible, arise at around 3 years of age and already compromise 15% of this artery by 15 years of age. several studies cited by franoso and coates23 present evidence of fatty streaks and fibrous plaques in the coronary arteries of adolescents between 10 and 14 years of age and thickening of the inner layer (intima) of the coronary arteries in children less than 5 years of age. researchers have demonstrated that a fatty diet and other traditional vascular risk factors begin to influence blood lipid levels during the early years of life.6,23 due to the variety of criteria used to define optimal lipid levels in adolescents, it is difficult to compare results from across the world. however, studies have shown, for example, the presence of atheromatosis in aortic intima with cholesterol levels between 140 and 170 mg / dl. thus, the epidemiological goals for plasma cholesterol in children would be an average of 150 mg / dl.8 in a review of studies conducted in 26 countries (from 1975 to 1996) involving 60,494 children and adolescents aged 219 years, brotons found an average of 165 mg / dl for cholesterol, 60 mg / dl for hdl - cholesterol, and 67 mg / dl for triglycerides. table 2 demonstrates the lipid levels recommended in adolescents up to 19 years of age.26 studies conducted in brazil revealed higher levels of cholesterol in adolescents attending private schools compared to those attending public school.11,27 this trend was confirmed by other studies15,28,29 that showed that adolescents with lower family income and those that attend public schools have lower cholesterol levels than adolescents from higher - income families and private schools. these data support guimares s and guimaress29 proposition that families with higher socioeconomic levels do not necessarily have a better and healthier lifestyle. the lower household income in developing countries may prevent these children from consuming high levels of calories in diets heavy in saturated fats and cholesterol. in addition, students of public schools tend to expend more energy in their daily lives because they need to walk to school or use public transportation. despite methodological limitations for calculating low - density lipoprotein cholesterol as part of the lipid profile, its measurement is widely regarded as the gold standard for both risk assessment and intervention programs for cardiovascular diseases.8 because triglycerides are deposited on the vessel wall and initiate the process of low - density lipoprotein accumulation, they are strongly associated with the risk of developing ad.30,31 whether breastfeeding during the first year of life confers protection against future increases in the levels of plasma lipids and mortality by ad is controversial.32 the major health advantage of breastfeeding that has been clearly demonstrated remains in the protection of the infant from certain infections in early life. if there are other long - term health advantages, they have yet to be fully elucidated and confirmed. dyslipidemia that begins during childhood tends to be maintained through development, and studies describe a direct relationship between total cholesterol levels in children and heart disease in adults.33 studies conducted in brazil15,27,34 have shown that cholesterol levels in adolescence correlated with 87% of deaths due to heart disease in adulthood (figure 1) and showed that high levels of cholesterol are accompanied by a high mortality rate. an association between inflammatory processes and the development of atherosclerosis has recently been described, providing important correlations for understanding the mechanisms of atherogenesis and risk factors. several studies have examined different markers of inflammation in the bloodstream, such as cytokines and adhesion molecules, as potential predictors for the risk of heart disease. some clinical studies have suggested that serum levels of tumor necrosis factor-, interleukin-6, and c - reactive protein are elevated in patients with congestive heart failure, regardless of the etiology of the condition. furthermore, elevated blood levels of these inflammatory markers correlate with worsening functional class, increased hospitalization rates, and poorer survival.3538 in addition, structural and functional changes have been observed in the arteries of children with a familial predisposition for ad, and these changes are associated with groups of inflammatory factors and oxidation markers. during the development of atheromatous plaques, inflammation plays an essential role in the destabilization of arterial plaques, and in turn is associated with acute thromboembolic diseases. because lifestyle - modification trials have been successful in decreasing endothelial dysfunction and levels of inflammation markers among children and adolescents, controlling the inflammatory process is suggested in addition to expanding pharmacological therapies, which are considered a secondary means of preventing ad.39 obesity (more specifically, excessive adiposity), which is defined as an excessive accumulation of body fat, is a heterogeneous disorder with a common final pathway in which energy intake chronically exceeds energy expenditure. obesity features a combination of genetic and environmental factors.40 the energy imbalance often begins in childhood, and when this imbalance occurs the likelihood of obesity in adulthood increases. among young people, the prevalence of obesity has greatly increased in recent years and represents the most common chronic disorder.41 excessive adiposity in childhood represents a greater risk to adult health than obesity starting in adulthood. adults who were overweight as adolescents have an increased risk of diseases compared with adults who were of normal weight as adolescents.42,43 obesity is the result of a complex interaction of factors, including metabolic, physiological, environmental, genetic, behavioral, and social influences. the bogalusa heart study in louisiana (usa), which was conducted among children and adolescents, suggested significant correlations between obesity and both lipoprotein levels (low - density lipoprotein in particular) and insulinemia, which were correlated with the risk of cardiovascular diseases.44 although it is unclear if childhood obesity is an independent risk factor for cardiovascular disease, studies show a clear association between severe obesity and increased mortality. the importance of childhood obesity as a risk factor for cardiovascular disease is increasingly evident.17,45 obesity deserves particular attention because it is usually accompanied by two notorious and significant risk factors : diabetes and arterial hypertension.46,47 therefore, controlling obesity during childhood is important because the obesity acquired during this period of life tends to persist into adulthood.11 studies have reported a substantial increase in the number of overweight children and adolescents in recent decades, and this increase is associated with an increased risk of hypertension, lipid abnormalities, type ii diabetes, early atherosclerotic lesions, adult obesity, and mortality in young adulthood.7,4850 preventing childhood obesity is the best opportunity to introduce changes in lifestyle and thus reduce cardiovascular morbidity and mortality.5153 the diagnosis of overweight and obesity still presents difficulties, because the best criteria to determine these categories in this age - group remain unclear. however, the body mass index, based on international standards, is useful, inexpensive, and replicable.54 recently, the term obesity has been used to identify body mass index p95 in children and adolescents.50 data on childhood and adolescent obesity around the world are still limited, and the lack of uniformity among definitions and studied age - ranges complicates comparisons of prevalence. obesity in children and adolescents is increasing significantly, including in developing countries.55 a national study, nutre brasil infncia (nourish brazil childhood), indicated that 23% of brazilian children up to 5 years of age exhibit excess weight,56 while in developed countries, obesity mainly affects the lower - income social classes ; in brazil, for example, the most favored social classes are still the most affected, although there is a tendency toward change. the most recent studies conducted in brazil reveal that the prevalence of overweight in children and adolescents ranges from 8.4% to 19%, while that of obesity ranges from 3.1% to 18%;54,57 furthermore, the prevalence of overweight and obesity is greater in higher - income households.58,59 the national health and nutrition examination survey estimated a prevalence of 30% for overweight and obesity p85 and a prevalence of 15% for obesity p95 for the age - group between 6 and 19 years of age.60 in brazil, studies stress the physical inactivity of children as one of the most important factors associated with obesity.4954 ms is currently characterized as the combination of a number of risk factors for cardiovascular disease, including dyslipidemia, hypertension, carbohydrate - metabolism disorders, and obesity, especially abdominal obesity.61 in children, the global consensus regarding ms is still a matter of discussion.26 a direct association between obesity and insulin - resistance syndrome has been demonstrated in children, and was recently recognized as a major precursor of atherosclerotic cardiovascular disease and type ii diabetes.7,62 although we do not have a global consensus to define and diagnose ms in adults and children, ms is associated with a 1.5-fold increase in overall mortality and a 2.5-fold increase in cardiovascular mortality.63 given its importance, various organizations, including the world health organization,64 the national cholesterol education program adult treatment panel iii,65 the european group for the study of insulin resistance,66 and the international diabetes federation, have proposed criteria to define and treat ms. to determine the prevalence of ms in children and adolescents, either the adult criteria are modified for pediatric reference values,67 or specific cutoff points are used.68,69 some studies suggest cutoff points corresponding to the 95th percentiles of each variable by sex and age and the height percentile when including blood pressure (bp).70,71 however, the lack of consensus means that the prevalence of this syndrome is markedly different in different studies.72table 3 demonstrates the definition considered most suitable for ms, according to the department of metabolic syndrome of the brazilian society of diabetes.26 prospective studies have shown that obesity looms as the most important risk factor for ms and precedes the onset of insulin resistance by several years;62,73 insulin resistance is the leading cause of the hemodynamic and metabolic disorders of ms.74 ms is caused by a combination of genetic and environmental factors in which obesity plays a primary role and leads to excessive production of insulin, which is associated with an increase in bp and dyslipidemia.50 an estimated 1 million us adolescents already meet the criteria for ms,50 with a prevalence of 4% between 12 and 19 years of age. in addition, ms is present in 30%50% of overweight children.67,75 identified as one of the most common precursors of coronary artery disease, hypertension is usually asymptomatic, and prevention is the most efficient way to fight it and avoid the high social cost of its treatment and complications. therefore, the need to measure hypertension levels and identify those individuals with high bp is mandatory. the worldwide prevalence of hypertension in children is highly variable (2%13%), depending on the methodology employed. in brazil, for example, it is estimated that the prevalence of hypertension in children and adolescents is 4%,76 and the need for bp measurement is considered imperative from 3 years of age. arterial bp commonly rises with age, and its elevation in children is a prediction of hypertension in adulthood that may have started in childhood or adolescence.7,7780 bp should be interpreted as a result of the impact of environmental influences on the expression of several genes that in turn regulate other genes. it is influenced by angiotensin - converting enzyme gene expression and for endothelial no synthase gene expression.81,82 several known factors related to hypertension in adults, such as sex, age, family history, and the presence of increased body weight or obesity, are also observed in children and adolescents.83 high bp contributes to the development of cardiovascular complications. its association with multiple risk factors has a multiplier effect on the risk of cardiovascular events.8486 hypertension is diagnosed when the values of systolic bp and/or diastolic bp are greater than or equal to the 95th percentile for sex, age, and height, plus 5 mmhg, on three separate occasions. a prehypertensive group should also be defined and identified with the purpose of adopting stringent preventive measures. bp values 90th percentile and < 95th percentile characterize prehypertension ; values that are included in this range and exceed the limits of 120/80 mmhg should also be considered as prehypertensive and follow the same recommendations proposed by the seventh report of the joint national committee on prevention, detection, evaluation, and treatment of high blood pressure (jnc 7)85 for adults. table 4 summarizes the classification of bp for children and adolescents.87 it is estimated that 30% of children and adolescents with overweight / obesity have hypertension.88 thus, the presence of overweight / obesity appears to be one of the most important factors related to hypertension in children and adolescents worldwide.85,89,90 several studies have shown that the presence of overweight / obesity is positively correlated with the occurrence of prehypertension in children and adolescents, and this combination increases the risk of developing adult hypertension.9194 certain conditions are strongly associated with hypertension in teens, including smoking and the use of contraceptives, alcohol, cocaine, amphetamines, anabolic steroids, phenylpropanolamine, and pseudoephedrine (nasal decongestants). therefore, changes in lifestyle, such as weight control, reduction in sodium intake, and exercise, are fundamental for the prevention of hypertension. although threshold pressure levels are not yet well defined, bp most likely affects target organs in children, as in adults. dietary intervention, maintaining an ideal weight, and engaging in regular physical activity could be encouraged at this stage as a method of primary prevention.24 in a study on the stiffness of large arterial vessels, which is attributed to aging, the only studied factor that could explain the group with vessels that did not show signs of age was the lowest bp level presented.95 the death rate from cardiovascular disease is lower in individuals who exercise regularly, and there are no doubts about the improvement in quality of life that is achieved through a physical conditioning program. however, this improvement depends on a proper prescription, and intensity, duration, and modality have an important role for a satisfactory result. in adults, the recommended physical conditioning activities lie between the ventilatory threshold and the respiratory compensation point ; that range is most recommended for its beneficial effects on cardiopulmonary capacity.96 in children, the beneficial effects associated with physical activity include weight control, effects on cholesterol levels and insulin resistance, low bp, psychological well - being, and an increased predisposition for physical activity in young adulthood.7,97 adolescents should engage in physical activities of moderate to vigorous intensity for at least 60 minutes a day, 5 days a week ; this activity can be in or outside school and can be structured.97 a major challenge for public health authorities has been to increase the cardiorespiratory fitness of the population. childhood and adolescence appear to be periods for promoting good physical activity habits and preventing sedentary behavior in adulthood. therefore, the prevention of cardiovascular disease is also a pediatric problem.5 in recent decades, children have become less physically active, with energy expenditure approximately 600 kcal / day lower than their contemporaries 50 years ago.98 physical inactivity is recognized as an important determinant of chronic diseases, and an increase in the prevalence of these diseases during childhood has been documented.99 attention has been drawn to the need for physical education programs in schools and for community recreation facilities. however, few empirical studies have been conducted to determine the impact of such facilities and programs on physical activity and the level of inactivity in adolescents.100 among adolescents, there is a trend to engage less in school physical education activities and vigorous activities and to spend more time watching television.101,102 these behaviors can affect future health problems, whereas greater physical fitness has been linked to a lower cardiovascular risk profile in children and adolescents.103 identifying population values of maximal oxygen consumption (vo2max) is important in studies that attempt to relate physical fitness to cardiovascular risk. vo2max is a measurement that is used to guide the prescription of exercise and analyze the effect of training programs.104,105 aerobic capacity measured through vo2max depends on cardiovascular, respiratory, and hematological components, and the oxidative mechanisms of muscle in exercise. this value is determined by means of cardiopulmonary exercise testing, which allows the simultaneous assessment of the cardiovascular and respiratory systems ability to perform their main functions, such as gas exchange.104 measurements of gas exchange are fundamental to understand the limitations of exercise. however, multiple paths (direct or indirect) have been used to determine cardiorespiratory fitness. the differences in the methods used may be responsible for the differences found in the predictive power of this important physiological variable and whether cardiorespiratory fitness can serve as a predictor of blood lipids in children.106 however, the expected increase in bp with age is lower in children with better physical fitness.107 adolescence is the period of transition to adulthood, during which many structural, hormonal, and biochemical changes occur in physiological systems that affect vo2max.108 thus, it is necessary to establish specific vo2max values for this population. the international literature offers benchmarks for healthy children and adolescents.15,104,109 described as a behavior, physical activity includes many types of muscular activity that significantly increase energy expenditure. physical fitness is described as an attribute, and generally refers to the ability to perform physical work ; in addition, physical fitness is considered an adaptive state and is partly genetically determined.110 physical fitness measurements are preferred over physical activity measurements because they are more objective and less error - prone. thus, efforts should be intensified to identify the starting point for daily physical activity to increase physical fitness in youth.110112 however, determining this variable is not yet a global reality, and empirical evaluations have been performed. the use of cardiopulmonary exercise testing makes it possible to assess metabolic and cardiopulmonary capacity accurately through direct measurements of vo2 max. this value is the most important physiological measurement for determining aerobic capacity, the accurate level of physical fitness, and therefore the correct intensity of exercise to obtain the health benefits of a fitness program.96 although the manifestation of coronary heart disease occurs in adulthood, detecting risk factors during childhood is crucial for establishing a prognosis and preventing damage to target organs in adults. thus, detection and prevention should begin during childhood, when changes in lifestyle can reduce the incidence and severity of heart disease. studies of cardiovascular risk factors in a region, city, or country should always report the prevalence and its correlations in childhood as a fundamental step in identifying a population at risk. the studies reviewed here note the gravity of the public health problem represented by coronary heart disease. it is imperative to discuss the issues of health promotion and the prevention of future diseases that arise from the risk factors mentioned in this review. if the risk factors for cardiovascular diseases begin in childhood, they should be addressed at this stage. this timing reinforces the need for rigorous pediatric care in this age - group for an early diagnosis, particularly counseling regarding preventive measures. for example, dyslipidemia, which is the major known risk factor, can be modified by a moderate fat restriction without impairing the growth and development of children older than 2 years of age. thus, it is possible to achieve a great impact on cardiovascular disease through research on evaluation of risk factors in asymptomatic children. therefore, it would be beneficial to identify those children and adolescents with the highest risk as early in life as possible, so that interventions to reduce cardiovascular risk could be targeted. indeed, there are existing guidelines on screening of dyslipidemia, elevated bp, and obesity in childhood ; however, there is a shortage of data on the optimal age for screening of cardiovascular disease risk factors in childhood. it is necessary to raise social awareness at all levels and develop studies to plan programs and actions to control dyslipidemia, obesity, high bp, and a sedentary lifestyle at an early age so that they do not become the epidemics of this new century. | objectivesto correlate cardiovascular risk factors (e.g., hypertension, obesity, hypercholesterolemia, hypertriglyceridemia, hyperglycemia, sedentariness) in childhood and adolescence with the occurrence of cardiovascular disease.sourcesa systematic review of books and selected articles from pubmed, scielo and cochrane from 1992 to 2012.summary of findingsrisk factors for atherosclerosis are present in childhood, although cardiovascular disease arises during adulthood. this article presents the main studies that describe the importance of investigating the risk factors for cardiovascular diseases in childhood and their associations. significant rates of hypertension, obesity, dyslipidemia, and sedentariness occur in children and adolescents. blood pressure needs to be measured in childhood. an increase in arterial blood pressure in young people predicts hypertension in adulthood. the death rate from cardiovascular disease is lowest in children with lower cholesterol levels and in individuals who exercise regularly. in addition, there is a high prevalence of sedentariness in children and adolescents.conclusionsstudies involving the analysis of cardiovascular risk factors should always report the prevalence of these factors and their correlations during childhood because these factors are indispensable for identifying an at - risk population. the identification of risk factors in asymptomatic children could contribute to a decrease in cardiovascular disease, preventing such diseases as hypertension, obesity, and dyslipidemia from becoming the epidemics of this century. |
propofol (2,6-diisopropylphenol), a widely used intravenous (iv) anaesthetic, was developed in the 1970s from phenol derivatives. just as propofol is used for the induction and maintenance of anaesthesia, it is also often used outside operating theatres for sedation. as propofol has a rapid onset time and early recovery, it is close to ideal as an anaesthetic agent. the most frequently seen side - effect of its use is injection pain and associated patient discomfort. the incidence of pain and discomfort during propofol injection has been reported at rates between 28% and 90%. many methods have been used to reduce this pain including the addition of lidocaine to propofol, adjusting the ph of the propofol emulsion, prior administration of alfentanil, remifentanil, ketamine, metoclopramide, nafamostat, granisetron, oral clonidine, cold saline solution, ketorolac, thiopental, magnesium sulfate, ephedrine, or the topical application of nitroglycerine, emla, or 60% lidocaine band [715 ]. although the mechanism of the pain which occurs during propofol injection has not been fully clarified, there are known to be several factors which have an effect. these are the administration of the injection to veins in the dorsal area of the hand, the temperature of the propofol formulation, the rate of administration of the drug, aqueous phase propofol concentration, the buffering effect of the blood and administration together with agents such as opioids and local anaesthetics. lornoxicam (aka chlorotenoxicam) is a non - steroid anti - inflammatory drug (nsaid) of the oxicam family. unlike other known oxicams, elimination half life of lornoxicam is relatively short (circa four hours), which is advantageous with respect to tolerability. although the mechanism responsible for the pain associated with propofol injection is not fully known, it is, however, thought to involve the activation of the kinin cascade system and other pain mediators. our hypothesis is that the anti - inflammatory properties of lornoxicam can reduce propofol injection pain. consequently, we undertook the present study to evaluate the efficacy of lornoxicam in the prevention of propofol pain. to the best of our knowledge the aim of the present study was to investigate the role and effective dose of lornoxicam in preventing the pain associated with the intravenous injection of propofol. approval for the study was granted by the ethics committee of dicle university medical faculty. the study included a total of 120 patients, aged 1865 years, of asa i - ii, who were to undergo elective surgery. the patients had no contraindications for general anaesthesia and had no allergic reactions to the drugs to be used. exclusion criteria were pregnancy, extensive heart and circulatory system impairment, respiratory tract disease, neurological diseases, liver and kidney function impairments, bleeding and clotting problems, a history of gastrointestinal ulcer or non - acceptance of the procedure. using a computer - generated randomisation program, the patients were allocated to one of four groups of 30 patients each. immediately before anaesthesia induction, a syringe injector of 10 ml equivalent was prepared for each patient. the syringe injectors were prepared for group i (control) with 10 ml isotonic 0.9% nacl solution. for groups ii, iii and iv, the same solution contained 2 mg, 4 mg and 8 mg of lornoxicam (xefo, abdi ibrahim, turkey) respectively. the assistant preparing the drugs wrote the group number on the outside of each syringe injector. then the drug amount, colour and group number were covered with a plaster so as not to be visible and the syringe injector was given to another assistant in the operating theatre who was blinded to the study groups. routine monitoring was applied to all patients in the operating theatre with 3-channel electrocardiography (ecg), peripheral oxygen saturation (spo2) and noninvasive arterial pressure monitorisation (nihon kohden / japan). a 20-gauge intravenous cannula was placed in the dorsal area of the hand. also, an infusion of a ringer lactate solution (na : 130 meq / l, k : 4 meq / l, cl 109 meq / l, lactate : 28 meq / l) was started at the rate of 100 ml / hour. to achieve a double - blind study, the syringe injectors were prepared and their contents were masked before an assistant took them to another in the operating theatre. for each patient, the syringe injector to be used was selected at random. to prevent serum circulation in the forearm, a tourniquet was applied for 2 minutes. a 2 mg / kg dose of propofol was calculated for each patient for anaesthesia induction in all groups. the drug (10 mg / ml ampoule) was supplied by fresenius company (bursa / ankara, turkey). in the operating room, first 25% of the calculated dose was injected over 10 seconds. pain was evaluated by a different anaesthetist within the following 20 seconds, then the remainder of the propofol dose was given, and induction of anesthesia continued. pain was evaluated by asking the patient to score the pain felt according to the following scale : 0 = no pain, 1 = mild, 2 = moderate, 3 = severe, as shown in table 1. after completion of the iv anaesthesia agent injection, 0.15 mg / kg vecuronium (norcuron 2 mg / ml, organon, turkey) was used for oral intubation. following intubation, 1 mcg / kg fentanyl (50 mcg / ml fentanyl citrate, abbott, turkey) was added. systemic blood pressure was measured with the non - invasive oscillometric method.table 1. verbal pain painmild painmoderate painsevere pain (the patient stated that they felt pain or burning, without a behavioural response and without grimacing)(the patient stated pain or burning with a grimace ; the pain was reported without asking)(the patient withdrew their arm with pain and crying)0123 after completing the pain evaluation, the plaster covering the details on the syringe injector was removed by another assistant and the group number written on the syringe injector was recorded on the prepared form, together with the patient demographic data and pain scores. all patients were followed up for 24 hours for pain, oedema, inflammation and allergic reactions which might have developed in the injection site. power analysis in the current study was calculated on the assumptions that the incidence of pain associated with the propofol injection without pre - medication would be 65%, and with premedication 35%. based on these assumptions, a total of 48 subjects was necessary to determine a significant difference at 80% power per group (one - way, = 0.05). the current study was planned with a total of 120 subjects 30 cases per group. continuous and categorical data were analysed using the one - way anova and chi - square tests. statistical analysis of the data was made using spss for windows v. 13.0 software (statistical package for social sciences spss inc. differences between the groups in the severity of pain were evaluated using the chi - square test. the mann whitney u - test and the kruskal wallis tests were applied. a value of p < 0.05 was accepted as statistically significant. the study included a total of 120 patients randomly allocated to four equal groups of 30. the demographic data such as age, sex, body weight and additional features were evaluated in each group. due to the randomisation system, the groups were not homogenous and a statistically significant difference was observed between the groups in respect of the number of males and females (p < 0.05). there were more females in groups i and ii, while in groups iii and iv the numbers of males and females were comparable (table 2).table 2. demographic data. group igroup iigroup iiigroup ivp value(n = 30)(n = 30)(n = 30)(n = 30)age (mean1sd), years29.8 9.629.6 8.535.2 11.030.2 8.60.075sex, nmale9 (30%)9 (30%)15 (50%)14 (46%)0.043female21 (70%)21 (70%)15 (50%)16 (54%)body weight (mean1sd), kg65.5 9.263.8 11.370.8 11.967.3 11.10.087asa, ni13 (43%)18 (60%)8 (27%)14 (46%) ii17 (57%)12 (40%)22 (73%)16 (54%) additional features, ndm2041 ht3312 smoking19162120 results given as mean standard deviation (sd). in the comparison of age, sex, bodyweight, the one - way anova test was used. sd : standard deviation ; asa : american society of anesthesiologists ; dm : diabetes mellitus ; ht : hypertension results given as mean standard deviation (sd). in the comparison of age, sex, bodyweight, the one - way anova test was used. sd : standard deviation ; asa : american society of anesthesiologists ; dm : diabetes mellitus ; ht : hypertension to determine an effective dose of lornoxicam, doses of 2 mg, 4 mg, and 8 mg were compared with the control group. pain associated with propofol injection was seen at 93.3% in the control group and the overall incidence of pain was 83.3% (table 3). no difference was observed in the incidence of pain between group i (control) and group ii (2 mg). in group iii (4 mg), a significant reduction in pain was observed (p = 0.015). while the incidence of pain in group ii (2 mg) was not significantly different from that observed in the control group (table 3), none of the patients in group ii experienced severe pain (tables 4).table 3. pain ()pain (+) group i (n = 30)2 (6.7%)28 (93.3%)group ii (n = 30)2 (6.7%)28 (93.3%)group iii (n = 30)10 (33.3%)20 (66.7%)group iv (n = 30)6 (20%)24 (80%)total (n = 120)20 (16.7%)100 (83.3%) table 4. distribution of the severity of pain during propofol injection and according to sex. no painmild painmoderate painsevere paingroupsgroup i (n = 30)2 (6.7%)7 (23.3%)7 (23.3%)14 (46.6%)group ii (n = 30)2 (6.7%)18 (60%)10 (33.3%)nonegroup iii (n = 30)10 (33.3%)15 (50%)4 (13.3%)1 (3.3%)group iv (n = 30)6 (20%)20 (66.7%)3 (10.0%)1 (3.3%)sexfemale (n = 73)10 (13.7%)34 (46.6%)19 (26.0%)10 (13.7%)male (n = 47)10 (21.3%)26 (55.3%)5 (10.6%)6 (12.8%)total (n = 120)20 (16.7%)60 (50%)24 (20%)16 (13.3%) pain incidence during propofol injection. distribution of the severity of pain during propofol injection and according to sex. when the severity of pain during propofol injection was evaluated, a statistically significant reduction in the severity of pain was seen between groups i and ii (p = 0.0002), between groups i and iii (p = 0.0001), between groups i and iv (p = 0.00001) and between groups ii and iii (p = 0.026). no statistically significant difference was determined in the severity of pain between groups iii and iv (p = 0.401) (table 4). statistically significant difference in the severity of pain was observed in all the lornoxicam groups compared with the control group. pretreatment with 4 mg of lornoxicam was as effective in the reduction of propofol pain as the pretreatment with 8 mg. while pretreatment with 2 mg lornoxicam did not affect the incidence of propofol pain, it significantly reduced its severity compared to the control group. the use of 4 mg and 8 mg lornoxicam was found to be effective in the reduction of both the incidence and severity of the pain associated with propofol injection. when the severity of pain during propofol injection was evaluated according to sex, no statistically significant differences were found between the groups (table 4). in this study which investigated the efficacy of lornoxicam in the prevention of pain which occurs as a result of propofol injection, it was concluded that lornoxicam reduced the severity of pain in all the groups. the mechanism of propofol injection pain involves the release of kinins as a result of direct irritation of vascular endothelium (especially tunica media and intima) by propofol. propofol frees bradykinin by activating the kinin - kallikrein system, and thereby causing venous dilation and hyperpermeability. slow administration of the injection causes greater pain by removing the interaction of the propofol active component with the endothelium. the effect of lornoxicam is based on the inhibition of the synthesis of prostaglandins (pgs), which are mediators of inflammation. the selection of lornoxicam in the present study was based on the pg inhibition potential of an nsaid resulting in the inhibition of the kinin cascade. various drugs and methods have been used to reduce the incidence or the severity of propofol injection pain. the most effective method has been reported to be the injection of 0.5 mg / kg lidocaine, which causes venous occlusion, before the administration of propofol. in a study by liley, the addition of lidocaine to the propofol emulsion was shown to reduce pain incidence by destabilising the emulsion. in another study which compared lidocaine, saline and metoprolol in the prevention of propofol pain, metoprolol was found to be as effective as lidocaine. reported that the total injection given at a rate of 1020 seconds could reduce or delay pain. in the current study, the propofol injection was calculated to be given at the rate of 10 seconds. the slow iv injection was set to give 25% of the total dose in 10 seconds and the patient was questioned about the incidence of pain 20 seconds after the injection. the purpose of adjusting the rate in this way was to be able to evaluate the pain effect of delayed propofol effect. this is because the indirect effect of kinin activation caused by the direct irritant effect of propofol is thought to be responsible for injection pain. in a study by canbay. using acetaminophen, which is an anilide group analgesic, the pain incidence was seen to be 64% in the control group, 22% in the acetaminophen group and 8% in the lidocaine group. it was concluded that pretreatment with 50 mg iv acetaminophen was determined to be effective in reducing propofol injection pain. fujii. determined pain incidence as 90% in a control group and reported that pretreatment with 50 mg and 75 mg flurbiprofen axetil was effective in the reduction of severity and prevention of propofol injection pain. in our study, lornoxicam was used as nsaid and comparison with the control group was made of doses of 2 mg, 4 mg and 8 mg. compared a single dose of acetaminophen with lidocaine and a control group. in the present study, our results indicate that pretreatment with 4 mg or 8 mg lornoxicam is effective in reducing both the incidence and the severity of the pain associated with propofol injection. to the best of our knowledge, there is no study in the literature which has investigated lornoxicam pretreatment for reducing propofol pain. there is a need for further studies to compare this efficacy with other pretreatments, especially lidocaine. in the present study we found no statistically significant difference between males and females with respect to incidence or severity of propofol pain however, because gender distribution in our study was uneven, no definitive conclusions can be made with respect to incidence and severity of pain in males vs females. pretreatment with 4 mg and 8 mg of lornoxicam is effective in reducing both the incidence and the severity of the pain associated with propofol injection. | abstract aim : to investigate the efficacy of lornoxicam in the prevention of the pain associated with propofol injection. material and method : approval for this study was granted by the ethics committee of our hospital. using a computer randomisation software, 120 patients undergoing elective surgery were assigned to four equal groups. in group i (control group), immediately before anaesthesia induction, 10 ml of isotonic 0.9% nacl solution (placebo) was administered intravenously (iv). in groups ii, iii and iv, the same injection contained 2 mg, 4 mg and 8 mg of lornoxicam respectively. a tourniquet was then applied to the forearm for two minutes. pain evaluation was made using a verbal pain score. results : differences in pain severity scores were statistically significant between groups i and ii, groups i and iii, groups i and iv and between groups ii and iii (p < 0.05). however, no significant difference was determined between groups iii and iv (p = 0.401). conclusion : in all groups administered with lornoxicam, there was a significant reduction in the severity of pain associated with propofol injection, in comparison with the control group. maximum effect is obtained with a dose of 4 mg. |
for over 300 years, parkinsonism has been associated with a loss of pigmentation from the human brain. termed neuromelanin (nm) to distinguish it from the numerous melanin sources found throughout the body, it is absent at birth and naturally increases throughout a person 's lifetime, accelerating in synthesis and accumulation in adolescence. this pigmentation is most pronounced in catecholaminergic neurons of the substantia nigra pars compacta (snpc) and locus coeruleus, leading to a blackened appearance in these regions of aged brains. loss of nm and subsequent depigmentation of these brain regions is a hallmark feature of parkinson 's disease (pd). there is evidence to suggest that da neurons with high amounts of nm are more susceptible to degeneration. for example, nm - rich snpc neurons undergo cell death compared to non - pigmented ventral tegmental area neurons in pd (zecca., 2003 ; zucca., dopamine is normally thought to be protected from auto - oxidation in secretory vesicles through co - localization of ascorbic acid and other antioxidants. sulzer. (2000) showed that neuromelanin forms in cultured dopaminergic neurons when cytoplasmic concentrations of dopamine are artificially raised. in their experiment, pc-12 cells were exposed to high levels of dopamine through addition of l-3,4-dihydroxyphenylalanine (l - dopa) to the cell culture media, which is rapidly taken up and subsequently converted to dopamine. cells which had been artificially enhanced in their ability to sequester dopamine into vesicles showed significantly less accumulation of pigment. this critical result suggests that under the normal range of living conditions, times exist when a firing neuron becomes over - burdened and is unable to sequester dopamine into vesicles before overloading the neuron 's antioxidant defenses. such antioxidants often take the form of thiols including cysteine and glutathione ; as such, it is perhaps not surprising that natural nm has cysteine in its pheomelanin core, while being surrounded by a eumelanin component lacking cysteine. nm is eventually found sequestered into double membrane granules inside neurons and contains lipids and peptides bound to its structure in vivo (zecca., 2000). the finding that this structure is carefully packaged and retained is evidence in favor of an important function for this molecule, yet we still know little about its implications for the cell. that this pigmentation is not an enzymatically driven process in dopaminergic neurons may be highly relevant given the lack of a central genetic basis for most cases of pd. nm has been historically poorly characterized largely due to the intrinsic nature of this spontaneously occurring polymer. it is structurally similar to non - neural melanins, with a predicted 3-d lattice structure and the ability to chelate and neutralize transition metals, ions and lipids. however, due to the spontaneous nature of the free radical reaction that occurs in neurons, this process is likely to be characterized by a certain degree of lack of control. in contrast, other natural melanins found in humans are enzymatically driven, not spontaneous. as such, the assortment of chemical precursors of ill - defined proportion which can incorporate in addition to dopamine and cysteine during the polymerization cascade could also result in the lack of a consistent, regularly ordered structure, particularly in the case of toxic chemical insult such as that imposed by 6-hydroxydopamine. in addition, catechol polymers are not easily de - polymerized, unlike other macromolecules utilized in biological systems such as polysaccharides, proteins, and nucleic acids which can by analyzed by relatively simple hydrolysis. nevertheless, progress has been made in understanding the subunit makeup of natural nm. in one study, the ratio of hydrogen peroxide (h2o2) degradation products indicated that nm is derived mostly from dopamine, with 25% incorporation of cysteine in the form of a benzothiazine structure. in the same study, hydriodic acid reductive hydrolysis of nm revealed a 21% incorporation of cys - da - derived units into nm, while dopa was found incorporated at a level near 6% for that observed with dopamine (wakamatsu., it is now known that nm isolated from human brain is comprised of granules with a diameter of 30 nm, similar to that observed for sepia cuttlefish, bovine eye, and human eye and hair melanosomes. nm is a mixture of pheomelanin and eumelanin, the two major forms corresponding to the widely known light - haired and dark - haired phenotypes, respectively. kinetic studies suggest that in such mixed pigments, pheomelanin formation occurs first with eumelanin formation occurring only after cysteine levels have been depleted. this leads to a predicted structural motif with pheomelanin at the core and eumelanin at the surface (bush., the major lipid component of neuromelanin pigment derived from human sn was found to be the polyisoprenoid dolichol, accounting for 14% of the mass of the isolated pigment (fedorow., 2005). it has also been known for several decades that a curious feature of natural melanins is their ability to bind and retain organic compounds for long periods of times. not surprisingly, abundant evidence suggests that the massive accumulation of pigment within the aged dopaminergic neuron also corresponds with the accumulation of numerous potentially toxic chemical entities. in particular, organic amines and metal ions such as manganese have been shown to exhibit high binding affinities with melanins (karlsson and lindquist, 2013). mptp (1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine) for example is believed to induce its parkinsonian - inducing effects after first being converted to methyl - phenyl - pyridinium ion (mpp+) by the enzyme monoamine oxidase b in nearby glial cells (singer., 2006). mpp+ appears to accumulate in pigmented neurons due to the chelating nature of the pigmentation itself (damato., 1986). however, it is also thought to eventually kill the cell by disrupting mitochondrial electron transport. sequestration of mpp+ then appears to induce cellular apoptosis leading to cell death and a downstream cascading immune response due to the release of previously unseen antigens (sulzer., 2008). blocking the uptake of mpp+ blocks the toxic effects of mptp administration, yet it is unclear whether mptp is concentrated into pigmented tissue before or after conversion to mpp+. mpp+, apparently binds to nm in a reversible equilibria in order to exert its known toxic effects on mitochondria. many investigators have assumed that the accumulation of nm pigment is simply an unavoidable by - product of aging. merely a form of molecular garbage that the cell is unable to dispose of, they argue, thus dismissing its presence as uninteresting and non - essential in the process. in this view, the binding of toxic chemicals to nm may simply be a by - product of the existence of the garbage itself, eventually leading to the instability and death of melanin - containing neurons due to oxidative stress. another prevailing hypothesis for nm 's protective role in dopaminergic neurons lies in the prevention of neurotoxic pathways of quinones that are formed during dopamine oxidation. when dopamine is oxidized to dopamine o - quinone, aminochrome and 5,6-indolequinone are formed and typically undergo polymerization to form the dark pigment, neuromelanin (munoz.,, aminochrome can form adducts with alpha synuclein generating neurotoxic oligomers that can trigger mitochondrial dysfunction (wang., 2012), and could induce oxidative and endoplasmic reticulum stress thereby affecting protein synthesis and degradation dysfunction. alternatively, it has been proposed that nm serves a dual function, protecting the cell from oxidative stress through iron chelation in the early stages, yet contributing to the autoimmune aggravation of pd through release of novel antigens upon eventual cell death (zecca., 2006). ultrafast laser spectroscopy studies suggest that the integrity of the pigmented granules in tissue may play an important role in the balance between the photo - protective and photo - damaging behaviors attributed to melanins (liu and simon, 2003). what can not be ignored in this discussion however is the oxidative stress necessitated by the handling of high concentrations of catecholamines. in other words, in order to function as an active dopaminergic or adrenergic cell, the cell is necessarily at risk for toxicity from the catechols themselves, molecules known primarily for their high reactivity and redox potential in forming quinones. as has been pointed out, sequestration into secretory vesicles apparently alleviates this toxicity and stress on the cell. what few seem to have suggested to date however is that the accumulation of nm itself could serves as a storage, protection, and re - release mechanism for dopamine (in the substantia nigra) or epinephrine (in the locus coeruleus), possibly acting as a very real molecular memory loop. this seems at first glance counter - intuitive, that the product of oxidative stress (nm) could then function to alleviate the very thing that created itself (excess dopamine), yet in reality would be quite an elegant solution to a problem. since the structure of nm granules has not been established at sub-m resolutions, it is not known exactly how the polymer is arranged. however, modelling studies suggest the granules adopt a layered structure containing a semi - regularly ordered array highly suitable for trapping monoamines (charkoudian and franz, 2006). in the case of such naturally occurring, aromatic organic catecholamines, the coordination of a lone - pair of electrons from the de - protonated amine nitrogen to nm - chelated iron combined with potential pi - stacking interactions through nm indole subunits provides a plausible mechanism for observed binding interactions. the putative ability of pigmented granules to concentrate catecholamines such as dopamine from surrounding tissue could supplant some of the function of vesicular monoamine transporters, which serve to sequester potentially toxic dopamine into vesicles for synaptic transmission. such an extraordinary ability could even supplant the function of tyrosine hydroxylase (th), the enzyme primarily used to locally synthesize dopamine and which is normally used as a marker for dopaminergic neurons. in one intriguing study, the authors compared the number of dopaminergic neurons in young, middle aged, and older squirrel monkeys. the absolute number of these neurons appeared to decrease over the lifespan of the animals when anti - th antibodies were used alone to detect their presence, yet remained constant when pigmented neurons were counted along with th - positive neurons (mccormack., 2004). this suggests that as pigmentation accumulates in a given neuron, th expression is down regulated and dopamine synthesis presumably slowed. though highly speculative in nature at the current time, such a system (illustrated in figure 1) presents an elegant mechanism whereby the very subunits that need protection from oxidation result in a polymer that is capable of protecting and furthering an identical signal. if dopamine that becomes nm is packaged into double - membrane bound vesicles in a reducing environment (as illustrated for example by its susceptibility to fontana - masson silver staining) has the ability to bind, store, protect, and release free dopamine, the chemical loop is complete. it could explain in part the reinforcement of addictive memories and associated behavior that comes with dopamine - releasing drugs, since excess cytoplasmic dopamine creates oxidative stress which leads to self - polymerization up to a certain point. a dopaminergic axon terminal is shown, with dopamine (da) being synthesized and packed into vesicles via vesicular monoamine transporters (vmat) for release into the synapse. excess cytosolic dopamine is thought to co - polymerize with cysteine into a polymer of ill - defined composition which is eventually packaged into a larger double - membrane bound vesicle (nm granule). it is known that this pigmented granule sequesters toxins such as methyl phenyl pyridinium ion. we hypothesize that molecular sequestration is in fact the natural role of this pigmented granule, and that dopamine is the intended beneficiary of this uniquely reducing environment. should a mechanism be discovered (question mark) whereby sequestered dopamine could be re - released upon specific triggering, this seems to provide a complete self - reinforcing molecular memory loop. although such a re - release mechanism is purely speculative at this time, a number of interesting plausible scenarios are apparent, including optical and electrical stimulation of the granule, changes in cellular ph or oxidation state, or displacement of nm - bound dopamine by alternate catecholamines or metal ions. we suggest that interruption of this putative sequestration and release mechanism may underlie the molecular basis of parkinson 's disease initiation. one of the strongest proposals for memory in human brains involves synaptic plasticity, that is, the extensive pattern of connections between the neurons can be altered through strengthening (by repeated stimulation) or weakening (by lack of stimulation) of particular pathways. dopamine - binding nm structures would seem to retain a semi - permanence despite being made of components that are themselves susceptible to turnover. thus it 's possible that pigmentation in neurons could play a significant and as yet unappreciated role in the strengthening of neuronal connections through localized catecholamine sequestration. concentration of neurotransmitter into pigmented granules would localize a pool of transmissible signal in locations that had previously seen high dopamine release and uptake activity. if there is then a mechanism for re - release of bound dopamine to synaptic vesicles or to the synapse itself, the pigmented granule could replace or assist in neurotransmission. therefore, we believe nm represents an obvious, if overlooked, mechanism for implicit (nondeclarative) memory which should be on the radar of many more investigators than it is today. if membrane bound, granular nm indeed proves to bind dopamine in a reversible manner, we can predict that any subsequent disruption of this function would result in symptoms of pd, analogous to what is seen in cases including mpp+, haloperidol (hpp+), and quite possibly, 6-oh dopamine, all potent chemical inducers of parkinson 's disease. given its structure, it is not surprising for example that the 6-hydroxy analogue of dopamine is taken up through dopaminergic transport mechanisms. owing to the extra hydroxyl group on the aromatic ring, it is also much more susceptible to quinone formation than is dopamine itself, a process believed underlying its toxic effects. to our knowledge, the possible interaction between nm and 6-hydroxy dopamine has not been previously explored. manganism, which exhibits symptoms very similar to parkinson 's disease (lucchini., 2009), also displays a clearly plausible mechanism in this scenario through replacement of the iron normally found bound to nm. utilizing such a mechanism appears to have the unfortunate consequence of binding toxic agents that resemble neurotransmitter monoamines. such sequestration could lead to several possible outcomes including abnormal polymerization of nm, abnormal packaging of the resulting nm polymer, or abnormal functioning of nm granules following successful formation. given the commonalities between these agents and the unique environment afforded by pigmented neurons, we believe that chemical binding to and/or incorporation into the nm polymer itself may represent a general mechanism for early stage chemical induction of pd. though most often associated with toxin binding, the uniquely reducing environment of the pigmented granule may instead provide safe harbor for endogenous catecholamines such as dopamine itself which are otherwise highly susceptible to the oxidative stress of the cytoplasm in an actively firing neuron. such stabilization could supplant or assist in the role of synaptic vesicles to form a semi - permanent connection in an elegant form of molecular memory. dopamine and adrenaline should be thoroughly investigated as candidates for an endogenous nm substrate with profound implications. preliminary evidence from our laboratory suggests that dopamine does in fact bind to a synthetic nm polymer in a saturable manner at micromolar concentrations (haining., 2016). at a minimum, the possible influence of catecholamine binding and release by nm must be ruled out as a contributory mechanism to dopamine storage and release if we are to understand this phenomenon fully. following the discovery of the role of dna in heredity, scientific focus has inevitably shifted toward genes and gene products as being the most important players in the process of life. what can not be forgotten during this transition however is that life is driven by biochemistry at its core, not by genes and gene products. in any case, it is becoming abundantly clear that neuromelanin is not a mere spectator in the brain but in fact serves a very important active function. | the loss of pigmented neurons from the human brain has long been the hallmark of parkinson 's disease (pd). neuromelanin (nm) in the pre - synaptic terminal of dopamine neurons is emerging as a primary player in the etiology of neurodegenerative disorders including pd. this mini - review discusses the interactions between neuromelanin and different molecules in the synaptic terminal and describes how these interactions might affect neurodegenerative disorders including pd. neuromelanin can reversibly bind and interact with amine containing neurotoxins, e.g., mptp, to augment their actions in the terminal, eventually leading to the instability and degeneration of melanin - containing neurons due to oxidative stress and mitochondrial dysfunction. in particular, neuromelanin appears to confer susceptibility to chemical toxicity by providing a large sink of iron - bound, heme - like structures in a pi - conjugated system, a system seemingly purposed to allow for stabilizing interactions including pi - stacking as well as ligand binding to iron. given the progressive accumulation of nm with age corresponding with an apparent decrease in dopamine synthetic pathways, the immediate question of whether nm is also capable of binding dopamine, the primary functional monoamine utilized in this cell, should be raised. despite the rather glaring implications of this finding, this idea appears not to have been adequately addressed. as such, we postulate on potential mechanisms by which dopamine might dissociate from neuromelanin and the implications of such a reversible relationship. intriguingly, if neuromelanin is able to sequester and release dopamine in membrane bound vesicles, this intracellular pre - synaptic mechanism could be the basis for a form of chemical memory in dopamine neurons. |
abl2 (v - abl abelson murine leukemia viral oncogene homologue 2), also known as arg (abl related gene), is a member of the abelson family of nonreceptor tyrosine kinases. abl2 and abl1 (c - abl) share a high degree of sequence conservation and have a similar domain organization comprising an n - terminal cap that is important for autoinhibition, followed by an sh3sh2 kinase domain and a large c - terminal domain containing docking sites for sh3 domains, f - actin, and microtubules (figure 1a).(3) the abl kinases are ubiquitously expressed and regulate many cellular functions including reorganization of the cytoskeleton, cell proliferation, adhesion, and migration in response to stimulation of cell surface receptors. knockout mouse studies have revealed that abl1 and abl2 play overlapping roles and are required in development and t cell function. despite their homology, abl2 has a number of distinct cellular functions including an important role in neurulation, and it is required for adhesion - dependent neurite branching, synapse / dendrite stability, as well as fibroblastic and epithelial cell adhesion and migration. (a) domain organization of abl2, showing residue numbering and the percentage sequence identity to abl1 for each domain. (b) ribbon diagram of the structure of abl2 in complex with the type i inhibitor 2 to show the orientation of the molecule underneath the surface depicted in (c). (c) two views of the surface representation of the abl2 structure are shown, separated by a rotation of 180. residues that are conserved with abl1 are shown as gray surface, semiconserved residues as yellow surface, and residue differences as red surface. the residue differences are numbered in black for abl2, and the residue letters in red correspond to their counterparts in abl1. the representation on the left is the same orientation as in (b). oncogenic forms of abl are produced by retroviral transduction (v - abl) or chromosomal translocation events. fusion of the abl1 gene with the breakpoint cluster (bcr) gene gives rise to an active, oncogenic tyrosine kinase bcr - abl and is associated with chronic myeloid leukemia (cml). other chimeric abl fusion gene products between abl1 or abl2 and etv6 (ets translocation variant 6), also known as tel (translocation ets leukemia), are associated with rare cases of cml and acute myelogenous leukemia (aml).(8) activity of abl is regulated by an autoinhibitory mechanism, and cellular activity is normally low. the inhibitory mechanism in abl differs from that found in the closely related src kinase where interactions between a phosphorylated tyrosine residue in the c - terminal tail and the sh2 domain maintain the repressed state of src.(9) abl kinases lack this critical tyrosine residue, and the inactive conformation is maintained by an n - terminal myristoyl group binding to a hydrophobic pocket in the kinase domain which places the sh2sh3 domains on the large and small lobes of the kinase, respectively, preventing its orientation to an active kinase. two splice variants of abl1 exist (1a and 1b) that differ only in their n - terminal region. abl 1b is myristoylated, whereas abl 1a is not, and it has been suggested that hydrophobic residues in the cap domain of abl 1a may functionally substitute for the myristate. the fusion of bcr, or tel, with abl disrupts the autoinhibitory mechanism, and the enhanced tyrosine kinase activity leads to leukemia. several inhibitors have been developed for the abl kinases, and these are currently used for the treatment of leukemia such as cml. the most commonly used inhibitor imatinib mesylate (sti571, cgp 57148b) (chart 1) selectively inhibits bcr - abl, abl1, and abl2, as well as certain other kinases including kit, a receptor tyrosine kinase that is a target of imatinib for treatment of gastrointestinal stromal tumor. clinical trials with imatinib showed that more than 90% of cml patients responded to treatment;(13) however, a high percentage of patients in the advanced phases of the disease developed resistance to the treatment, mainly because of bcr - abl mutants with no, or reduced, sensitivity to imatinib inhibition. this has led to the development of alternative inhibitors such as dasatinib, which is effective against imatinib - resistant bcr - abl mutants.(17) unfortunately, these inhibitors are not effective against the common bcr - abl t315i mutation often found in relapsed cml patients. the aurora kinase inhibitors such as 1 (vx-680)(18) (chart 1) and 3 (pha-739358)(19) have considerable antitumor activity, and 3 inhibits imatinib - resistant bcr - abl mutations including t315i.(20) a new approach involving allosteric inhibitors that bind to the myristate binding pocket has potential : gray and colleagues recently reported the inhibitors gnf-2 and gnf-5 that bind in the myristate binding pocket and, when used together with atp - competitive inhibitors, can be used to overcome resistance to atp - site inhibitors.(21) crystal structures have been solved for abl1 in complex with several inhibitors including imatinib,(22) dasatinib,(23)1,(24) and 3(25) that explain the observed potency profiles of these inhibitors based on the structural conformations of the proteininhibitor complexes. recently, the structure of abl1 with gnf-2 bound was reported.(21) here we present three structures of abl2 kinase domain, in complex with the inhibitors imatinib, 1, and 5-amino-3-((4-(aminosulfonyl)phenyl)amino)-n-(2,6-difluorophenyl)-1h-1,2,4-triazole-1-carbothioamide 2 (jnj-7706621) (chart 1), a 1-acyl-1h - triazole-3,5-diamine analogue that has been reported as a potent antitumor cyclin - dependent kinase inhibitor.(26) the cocrystallized compound 2 bound to an inactive abl2 conformation that can be considered as an intermediate between the canonical active dfg asp in and inactive dfg asp out conformations. this conformation places the dfg phenylanaline into the atp site, providing the potential of aromatic stacking interactions with inhibitors. we initiated structural studies on multiple constructs of abl2 using baculovirus - mediated expression in insect cells. a construct spanning residues 279546 (figure 1a), encompassing the kinase domain, gave high levels of soluble protein expression in hi5 cells, and purification yielded protein of suitable purity for crystallization. three crystal structures of the kinase domain of abl2 in complex with 1, imatinib, and 2 (figure 1b) were determined at 2.05, 1.65, and 2.81 resolution, respectively. the overall structure of the kinase domain in each of the structures is similar, with the typical structural features of a protein kinase : the kinase domain is made up of two lobes. the n - terminal lobe is the smaller subdomain, composed of a five - stranded -sheet and a prominent -helix. connecting the two lobes is a linker that acts as a hinge about which the two lobes can rotate with respect to each other upon atp and substrate binding. abl2 is 93% identical to abl1 over the kinase domain (figure 1a), and the residue differences are all surface - exposed (figure 1c). interestingly, the hinge residue t319 in abl1 is a proline residue (p365) in abl2 which may influence the interaction of atp mimetic inhibitors with the hinge backbone. the structures of the abl2 kinase domain in complex with imatinib and 1 were determined to confirm the anticipated binding arrangement based on the abl1:imatinib or abl1:1 structures. as expected given the sequence similarity between abl2 and abl1, the binding of both molecules in the atp - binding site was essentially identical to the equivalent abl1 structure. compound 1 is bound with the n - methylpiperazine group extending out of the atp pocket, and the cyclopropane group bound just past the gatekeeper residue thr361 to form hydrophobic packing interactions with the methyl of thr361 and the side chain of met336 (figure 2a). as with abl1,(24)1 binds to abl2 such that the activation segment is in an almost active conformation, with the asp of the dfg motif pointing in to the atp binding site. also as in abl1:1 (and abl1:imatinib), the p - loop has a distorted conformation to allow the side chain of tyr299 to form an aromatic -stacking interaction with the inhibitor, although the interaction involves less of tyr299 than is the case in abl1:imatinib where the aromatic ring of tyr299 packs perpendicularly to the pyridineaminopyrimidine rings of imatinib. the abl1:1 complex was of the imatinib - resistant mutant of abl1, h396p, which is a mutation in the activation segment ; however, the conformation of the wild - type abl2:1 (also his at this position) was identical in this region. this observation provides additional conformation that the h396p mutation hinders formation of the inactive (dfg asp out) conformation recognized by imatinib, without altering the active activation segment conformation recognized by 1. (a) imatinib bound in the active sites of abl1 and abl2. the structure of the active site of abl1 with imatinib bound (blue) (pdb code 1iep)(22) is shown superimposed on abl2:imatinib (orange), showing that the inhibitor molecules bind in the same conformation in both structures. the structure of the active site of abl1 with 1 bound (pdb code 2f4j)(24) is shown superimposed on abl2:1. coloring is as for (a) except that 1 is in yellow for abl2 and purple for abl1. while abl2:1 was as anticipated, the structure of abl2:imatinib showed an unexpected result : two imatinib molecules were found bound to abl2, one in the active site (atp binding site) of the kinase (figure 2a) and the other at a remote site equivalent to the myristate binding site (figure 4). isothermal titration calorimetry (itc) with abl2 and imatinib was carried out to determine whether both binding sites are occupied in solution. the itc data support a model with two molecules of imatinib bound to the abl2 construct, with dissociation constants (kd) of 6 nm and 0.5 m (figure 3). (a) surface of the myristate binding pocket of abl2, with imatinib shown as a yellow ball - and - stick representation. (b) overlay of the abl1:myristic acid complex (pdb code 1opl) (orange and black) and abl2:imatinib (blue and yellow) structures at the myristate binding site. phe516 (abl1) and phe543 (abl2) are shown in orange and blue, respectively. residues 516, 521, and 525 of abl1, from the bent i helix, occupy part of the space occupied by imatinib in the abl2 structure. the molecule of imatinib bound to the active site is in the same conformation as reported for the imatinib : abl1 complex (pdb code 1iep) (figure 2a), and the structures were superimposed with an rmsd of 0.61 over 258 c atoms. hydrogen - bonding interactions with the active site residues are conserved (table 1). as in the case of abl1,(27) imatinib recognized the inactive,, conformation of abl2 with the activation segment in a similar inhibitory conformation, although partly disordered. asp381 of the dfg motif (equivalent to asp427 in abl1) is pointing away from the atp binding site, whereas phe382 (abl1:phe428) is pointing toward the atp binding site and forming an aromatic stacking interaction with the inhibitor. the gatekeeper residue thr361 (abl1:thr315) and glu332 (abl1:glu286) from c form hydrogen bonds to imatinib (figure 2a, table 1). the abl2 numbering refers to abl2 isoform b (gi6382062). the second imatinib molecule in abl2 bound in an extended conformation in the myristate binding pocket (figure 4a) and forms a hydrogen bond with the carbonyl group of ala383 on helix e. superimposition of the abl1/myristic acid complex (pdb code 1opl) with abl2:imatinib (figure 4b) shows how imatinib mimics myristic acid binding. the superimposition with the c - terminally extended abl1 structure shows how our shorter abl2 construct (residues 279546, numbering from isoform b) used for crystallization permitted the binding of imatinib at this site ; however, the full length protein (with the abl1 or abl2 c - terminus) would be unlikely to bind imatinib at this position because of a steric clash with the i helix, which was omitted from our construct. with the shorter construct, phe543 points away from the myristic acid binding pocket, also avoiding a steric clash that would occur in the full - length protein, as can be seen from the conformation of abl1 phe516 (figure 4b). if binding did occur between imatinib and full - length abl1 or abl2 at the myristate binding pocket, it would not be accompanied by the bending of helix i that is necessary for inhibition.(28) apart from the shorter construct used for abl2, there are no sequence differences between abl1 and abl2 in the region of the myristic acid binding pocket, and the results here for abl2 presumably would apply also to abl1 given a similar construct. the structure of abl2 kinase domain in complex with 2(26) compound 2 is a potent, atp - competitive type i inhibitor, targeting cdk1/cdk2, which shows significant antitumor activity.(26) the structure of abl2:2 superimposes with abl2:imatinib with an rmsd of 1.05 over 238 c atoms. compound 2 binds to the atp binding site, with the aminothiazole moiety occupying the adenine binding site (figure 5a). the ligand is bound to the protein by hydrogen bonds to the backbone carbonyls of residues glu362 and met364 in the hinge region, in common with many atp - mimetic inhibitors, as well as an aromaticaromatic ring interaction with tyr299 from the p - loop, which is oriented toward the active site (figure 5a). the conformation of 2 is almost identical to that observed in the various other structures of kinases in complex with this ligand in the pdb (discussed below). (a) abl2:2, showing the compound bound to the atp binding site, and the ordered activation loop. the dfg motif is shown in green, and the hydrophobic pocket in which the dfg phe binds is shown in brown. this shows the dichlorophenyl group of pd166325 occupying the same volume as the dfg phe side chain in (a). (d) abl2:2 from a different angle to show clearly the rotation of the dfg motif and the intermediate position of the dfg phe residue relative to (c) and (e). (e) abl1:adp (pdb code 2g2i).(29) in abl2:2 the activation loop is fully ordered in an activated conformation, which can be seen from a comparison with the structure of abl1:adp (pdb code 2g2i)(29) (figure 5d, e) ; the activation segment is well ordered and is stabilized by a salt bridge between arg432 and the c glutamate (glu338) as well as a stacking interaction between the activation segment tyrosine (tyr439) and the catalytic hrd motif arginine (arg408). compared to the structure of abl2:imatinib, the loop region n - terminal to c of abl2:2 is in a significantly different conformation (figure 5c, d), although this may be influenced by crystal packing interactions. helix c itself is correctly oriented as indicated by the presence of the salt bridge between the active site lysine residue lys317 and the c glutamate residue glu332. however, the helix does not bend inward as in the abl1:adp structure (figure 5e), where the lack of a bound inhibitor allows the hydrophobic pocket formed by ile313, thr315, and met290 (abl1 numbering) to shrink, pulling the middle of helix c toward the atp binding site. the most unusual feature of the abl2:2 structure is the arrangement of the dfg motif. typically in an inactive (dfg asp out) conformation such as that in abl2:imatinib (figure 5c), the asp from the dfg motif is out, pointing away from the atp binding site, while the phe points into the binding site. in many complexes of kinases with inhibitors the phe interacts with a hydrophobic part of the inhibitor molecule. in an active conformation the backbone rotates to allow the asp to point in and coordinate the mg. however, in abl2:2, while the backbone conformation of the dfg motif is in the asp out conformation, the phe side chain is rotated 120 up into the hydrophobic pocket adjacent to the atp binding site. a comparison of abl2:2 with the structure of abl1 in complex with pd166326 (pdb code 1opk),(30) an inhibitor of similar chemical structure, shows that in the rotated position phe428 occupies the position of the dichlorophenyl ring of the larger inhibitor in abl1:pd166326 (figure 5a, b). in this position it binds in the hydrophobic pocket formed by ile359, it is presumably for this reason that abl2:2 does not have the bent c conformation observed in abl1:adp (figure 5e), despite also having a smaller molecule bound to the atp binding site. the overall structure and binding mode of the inhibitors imatinib and 1 is conserved between abl1 and abl2 ; however, the discovery that in a truncated construct of abl2, imatinib also binds in the myristate binding pocket represents an important and novel finding in light of the recent interest in developing allosteric modulators of this site such as gnf-2 (3-[6-[[4-trifluoromethoxy)phenyl]amino]-4-pyrimidinyl]benzamide)(31) which binds in the myristate binding pocket, as recently confirmed by a cocrystal structure.(21) it is clear from the abl2:imatinib structure that in the full - length protein imatinib would not bind in the myristate binding pocket in such a way that would cause inhibition by promoting the bending of helix i and the docking of the sh2 and sh3 domains,(28) due to a steric clash with a bent helix i. however, a truncated imatinib molecule presumably would bind in this context and may offer a starting point for the design of alternative allosteric abl inhibitors. the linear region of imatinib (excluding the pyridineaminopyrimidine rings) is colinear with the binding position of myristate (figure 4b) and therefore represents a useful template fragment. such allosteric inhibitors are potentially valuable for overcoming the resistance of various mutant abl proteins to atp - mimetic inhibitors, and it has recently been shown that it is also possible to target this pocket for activation of abl if the molecule binds but does not induce a bending of helix i.(28) therefore, molecules that are developed to bind in this pocket would need characterization of antagonist versus agonist activity. we have previously crystallized the type i inhibitor 2 with a number of other human protein kinases. in all of these other structures a rotated dfg motif phe was not observed, and all showed a typical dfg asp out conformation. the distinguishing feature in abl2 that makes the unusual phe conformation possible is the larger volume between the thr361 gatekeeper residue lys317 (from the salt bridge to c) and the other residues of the hydrophobic pocket (figure 5). all of the other kinases we have crystallized with 2 have a larger, hydrophobic gatekeeper residue, for example, csnk1g3 (casein kinase 1 3, pdb code 2chl, leucine gatekeeper), slk (ste20-like kinase, pdb code 2j51, ile gatekeeper),(32) camk4 (pdb code 2w4o, leucine gatekeeper), and clk3 (cdc - like kinase 3, pdb code 2wu6, phe gatekeeper),(33) and also a generally smaller hydrophobic pocket. for example, abl2 has a distance of 9.2 between its gatekeeper c backbone atom and lys317 c backbone atom, while csnk1g3, slk, camk4, and clk3 have distances of 7.8, 8.1, 7.5, and 8.9, respectively. the combination of the larger side chains and the smaller cc distances means that in these other structures there is not enough space for the dfg phe side chain to bind in the same hydrophobic pocket. compared to these other structures, abl2 and abl1 have more space that allows the rotation of phe428. all of the structures presented here have a hydrophobic entity bound in this position : in the imatinib complex it is an aromatic ring ; in the compound 1 complex it is the cyclopropane ring ; and in the compound 2 complex, it is the side chain of phe428. the abl2:2 structure suggests it is possible that phe428 could exist in this rotated intermediate in / out position even in the presence of the imatinib - resistant gatekeeper mutation t315i (abl1 numbering) (figure 5a and figure 5d), and it may be that this conformation of the kinase could be targeted for second - line treatment following imatinib resistance, especially since it is also compatible with the ordered activation loop seen with the alternative imatinib - resistant activation loop mutation h396p. in the same way that 1 successfully targets gatekeeper mutations by allowing sufficient space around the gatekeeper residue by its y-shape (compare figure 2a and figure 2b) and its small cyclopropane ring bound in the hydrophobic pocket, this phe428 conformation might also be compatible with a mutated gatekeeper residue. indeed a superimposition of abl2:1 and abl2:2 shows that the phe428-bound conformation actually allows more space around the gatekeeper than 1 (data not shown). residues 279546 of the kinase domain of human abl2 (gi|6382062, arg tyrosine kinase isoform b) were cloned into a pfastbac - derived transfer vector in - frame with an n - terminal hexahistidine tag and tev protease cleavage site. the recombinant bacmid dna was isolated and verified by pcr. in order to generate the baculoviruses, the recombinant bacmid dna was used for transfection of sf9 insect cells followed by two rounds of amplification in sf9 cells. for expression of the protein, baculovirus obtained from the sf9 cell culture was used to infect trichoplusia ni (hi5) cells grown in suspension to a density of 2 10 cells / ml. at 48 h postinfection the cells were harvested by centrifugation and cell pellets were stored at 80 c. cells were resuspended in a buffer consisting of 5 mm imidazole, 500 mm nacl, 50 mm hepes, ph 7.4, 5% glycerol, 0.5 mm tris(2-carboxyethyl)phosphine (tcep), supplemented with complete protease inhibitor mixture (roche applied sciences), and lysed by sonication. the supernatant was filtered and loaded onto nickel - chelating resin. after being washed, the protein was eluted with the above buffer plus 50300 mm imidazole and the eluates were combined. the digested abl2 was concentrated to 2.5 ml volume and loaded onto a superdex75 gel filtration column (hiload 16/60, ge healthcare) equilibrated in 10 mm hepes, ph 8.0, 300 mm nacl, and 0.5 mm tcep. the protein identity was verified by electrospray ionization time - of - flight mass spectrometry (agilent lc / msd). prior to removal of the hexahistidine tag, the observed mass was 33 414 da compared to a calculated mass of 33 502 ; it is likely that the difference in mass was due to removal of the n - terminal methionine followed by acetylation. after removal of the hexahistidine tag the observed mass was 30 980 da, matching exactly the calculated mass. the abl2:imatinib complex (pdb code 3gvu, table 2) was crystallized at 4 c in 200 nl drops from a 1:1 ratio of abl2:imatinib (4 mg / ml protein containing 1 mm imatinib) and reservoir solution (20% peg3350, 0.1 m citrate, ph 5.5). the crystals were then cryoprotected in reservoir solution with 20% (v / v) peg300 and flash - frozen in liquid nitrogen. x - ray diffraction data was collected at 100 k on beamline x10sa at the swiss light source (sls). the abl2:2 complex (pdb code 3hmi) was crystallized at 4 c in 200 nl drops from a 3:1 ratio of abl2:2 (8 mg / ml protein containing 1 mm compound 2 (5-amino-3-((4-(aminosulfonyl)phenyl)amino)-n-(2,6-difluorophenyl)-1h-1,2,4-triazole-1-carbothioamide, calbiochem product no. 217714) and reservoir solution (0.1 m lithium sulfate, 0.05 m disodium hydrogen phosphate, 0.05 m citric acid, 19% (v / v) peg1000). the crystals were cryoprotected in reservoir solution with 25% (v / v) ethylene glycol and flash - frozen in liquid nitrogen. x - ray diffraction data was collected at 100 k on beamline i03 at diamond. the abl2:1 complex (pdb code 2xyn) was crystallized at 4 c in 200 nl drops from a 2:1 ratio of abl2:2 (10 mg / ml protein containing 1 mm 1 (gsk487830b)) and reservoir solution (0.8 m sodium succinate). the crystals were cryoprotected in reservoir solution with 25% (v / v) glycerol and flash - frozen in liquid nitrogen. x - ray diffraction data was collected at 100 k on beamline i03 at diamond. the diffraction images were processed using mosflm(34) and scala in the ccp4 suite of programs.(35) structures were solved by molecular replacement using phaser(36) with abl1 as a search model and were refined against maximum likelihood targets using restrained refinement and tls parameters (where appropriate), as implemented in the program refmac.(37) iterative rounds of refinement were interspersed with manual rebuilding of the models using coot.(38) progress of the refinement for each structure was judged throughout by following a reduction in rfree (calculated from a random 5% of the data that was excluded from the refinement). | abl2 (also known as arg (abl related gene)) is closely related to the well - studied abelson kinase cabl. abl2 is involved in human neoplastic diseases and is deregulated in solid tumors. oncogenic gene translocations occur in acute leukemia. so far no structural information for abl2 has been reported. to elucidate structural determinants for inhibitor interaction, we determined the cocrystal structure of abl2 with the oncology drug imatinib. interestingly, imatinib not only interacted with the atp binding site of the inactive kinase but was also bound to the regulatory myristate binding site. this structure may therefore serve as a tool for the development of allosteric abl inhibitors. in addition, we determined the structures of abl2 in complex with vx-680 and with an atp - mimetic type i inhibitor, which revealed an interesting position of the dfg motif intermediate between active and inactive conformations, that may also serve as a template for future inhibitor design. |
altered sensorium in the postoperative period poses diagnostic and therapeutic challenges to the treating physician. fat embolism syndrome (fes) is an important possibility, especially in the setting of orthopedic surgeries. fes is a serious manifestation of fat embolism that involves petechial rash, deteriorating mental status, and progressive respiratory insufficiency. in the perioperative period, an incidence of fat embolism between 3.5% and 5% is noted with the strategy of early fixation of fractures. we discuss the utility of transcranial doppler and mr imaging in the diagnosis of fes in our patient. r, an 84 year - old - lady, with no significant past medical history, presented to the emergency department with a fracture of the left femoral neck following a fall. post - procedure, the patient failed to regain her sensorium for more than 10 h. examination revealed a febrile patient with a pulse rate of 112/min and a blood pressure of 110/80. general physical exam and cardiovascular exams were normal ; she was intermittently tachypneic with a respiratory rate of 40/min and clear lungs. she was stuporous with minimal wincing to pain, but no verbal or motor response, deep tendon reflexes were sluggish and plantars were extensor. the laboratory parameters are shown in table 1. the renal, liver function tests, and the electrolytes were unremarkable. arterial blood gas analysis did not show hypoxemia, pao2 was 102 mm hg ; and pulse oximetry showed an o2 saturation of 99%. in view of deteriorating sensorium, ct scan of her chest did not show evidence of pulmonary embolism, venous doppler of the lower limbs was normal. a transthoracic echo did not reveal a patent foramen ovale, elevated pulmonary artery pressures, or any other abnormality. laboratory parameters mri brain done 2 days later showed a shower of emboli with multiple scattered tiny hyperintense dwi (diffusion - weighted imaging) [figure 1a ] lesions in bilateral cortical areas, deep watershed regions, basal ganglia, and the posterior fossa. some of these lesions were hypointense on apparent diffusion coefficient (adc) [figure 1b ] map and a few of them were isointense. gradient echo (gre) showed hypointense lesions suggestive of petechial hemorrhages [figure 1c ]. mri brain showed restricted diffusion on diffusion - weighted (dwi) sequences (a) in bilateral cortical areas, deep watershed regions, and basal ganglia, hypointense on apparent diffusion coefficient (adc) (b) and gradient - recalled echo (gre) (c) transcranial doppler performed for a duration of 30 min detected emboli in bilateral middle cerebral arteries (mcas). mol / l) was used along with a 2-mhz pulsed - wave transducer to generate simultaneous m - mode and spectral tcd displays. probe fixation using a head frame (marc 500, spencer technologies) was used for monitoring. the insonation depth for spectrogram recording was between 45 and 65 mm for the ipsilateral mca. microembolic signals (mes) were defined as high - amplitude, unidirectional, transient signals lasting less than 300 ms [figure 2 ] and associated with an acoustic resemblance to a characteristic chirp or snap. the intensity of solid mess ranged from 7 to 9 db, and the duration ranged from 40 to 60 ms. the relative energy index of mes (reim) was obtained by multiplication of maximum duration of mes in a 3-mm gate (maxd) with mes maximum intensity adjusted for the intensity of background blood flow (maxi) on power m - mode display. she received conservative management in the form of antiplatelet agents, intravenous fluids, deep vein thrombosis prophylaxis, and ventilatory support. the incidence of symptomatic fat embolism in a single long bone fracture ranges between 0.5 and 3%. the first mechanism suggests that the dislodged marrow fat enters the systemic circulation during long bone fractures due to increased intramedullary pressure as seen in closed fractures or surgical manipulation even in the absence of cardiac or pulmonary shunts, bypassing the filtration mechanisms of the pulmonary capillary bed. the second proposed mechanism is that, during periods of stress, secreted catecholamines trigger metabolism of the body fat stores leading to fat embolism. mes to brain with tcd monitoring have been recorded more commonly during impaction of a cemented component or after relocation of the hip than during impaction of the acetabulum component. the fes may manifest after a latent period of 1248 h. the major diagnostic criteria of fes are hypoxia, deteriorating mental status, and petechiae ; minor signs include tachycardia > 120 beats / min, fever usually 20% of the admission value, sudden drop in platelet counts of > 50% of the admission value, retinal changes, jaundice, oliguria, high erythrocyte sedimentation rate (esr > 71mm / h), and fat macroglobulinemia. however, modern imaging tools such as mr brain and transcranial doppler were not available when these criteria were formulated. the diagnostic features of cerebral fat embolism on mri are multiple small, nonconfluent hyperintense lesions on dwi and t2-weighted images, usually situated in the cerebral white matter and deep gray matter. dwi lesions represent the cytotoxic edema which develops initially, areas of increased signal intensity on t2-weighted scans presumably reflect vasogenic edema, which develops at a later stage. however, some dwi lesions are isointense on adc suggesting a component of vasogenic edema too. tcd monitoring for cerebral emboli was performed in vivo in long bone fractures in patients with fess. mes are high - amplitude, unidirectional, transient signals lasting 25 db above background). however, in the appropriate clinical scenario like ours, in the absence of other sources of embolism such as cardiac or carotid disease or venous thrombosis, the likelihood of the emboli being fat emboli is quite high. early institution of oxygen therapy reduces the effect of hypoxemia and the systemic complications of fes. medications including steroids, heparin, alcohol, and dextran have been tried but with uncertain benefit. the mortality in patients with fes and long bone fractures ranges from 0.9% to 8.7%, but with improvement in supportive therapy, and early stabilization and definitive fixation of fractures, the overall outcomes have improved recently. diagnosis of fes requires a high index of suspicion. diagnosis may not be possible with clinical criteria in all cases. mr imaging of the brain and transcranial doppler monitoring of microembolism to the brain are useful techniques in supporting the diagnosis of fes. transcranial doppler is a useful modality in diagnosing cerebral microembolism especially in situations where mr brain is not feasible due to technical or logistic reasons. | it is important to consider several differential diagnoses in a patient presenting with altered sensorium following surgery. fat embolism syndrome (fes) is a serious condition that needs to be excluded. although criteria for diagnosis of fes are available, all patients may not satisfy them. we discuss a patient who presented with an incomplete triad of the fes, where the diagnosis was supported by transcranial doppler monitoring of microembolic signals and magnetic resonance imaging. |
organisms exposed to different environmental stressors, including temperature changes, trace metals and ultraviolet light, respond by rapidly synthesising a suite of highly conserved proteins called heat shock or stress proteins. under stressful conditions, such as extreme temperature, some proteins lose their higher order structures and related functions, and hsps are synthesized to promote refolding of these denatured proteins. heat shock proteins (hsps) work as molecular chaperones to protect the organism under stressful conditions and repair stress - damaged proteins to enable normal functions to continue. hsp40 and hsp70 function as co - chaperones and are typically involved in folding, assembly and transport of proteins, working together to minimize protein aggregation. memory formation is a vital process that enables an individual to adapt its behavior to current or future conditions. short - term memory (stm), lasting seconds to minutes, is a result of functional changes in pre - existing synapses. whereas, long - term memory (ltm), lasting hours to days, involves gene activation and the synthesis of new proteins. memory formation is dynamic, and environmental stressors can change the way an animal is able to learn and form memory, either by enhancing or blocking memory formation, depending on the nature of the stress and timing relative to the learning period. the great pond snail lymnaea stagnalis is widely used as a model system to study learning and memory because of its relatively simple neuronal system and easily recordable set of behaviors that can be altered through training. a range of environmental stressors have been shown to both enhance and reduce the ability of l. stagnalis to learn and form memories. in particular, stress associated with thermal stimulus has previously been shown to enhance memory formation in l. stagnalis. l. stagnalis lives in shallow, often stagnant, bodies of water that can be exposed to a range of temperature fluctuations depending on weather conditions. the stress associated with sudden 1 h duration exposures to 30c pond water was found to enhance memory formation. here, we investigate time - course gene expression profiles of hsp40 and hsp70 in the central nervous system of l. stagnalis. activation of these heat shock proteins may be involved in the enhancement of ltm formation. to examine whether thermal stress induces expression of hsp40 and hsp70 in l. stagnalis, we subjected a group of snails to a thermally stressful condition (30c for 1 h) and sampled central nervous system tissue for gene expression analysis at 6 time intervals following the termination of thermal stress (0 h, 0.5 h, 1 h, 2 h, 4 h, 8 h). both hsp40 and hsp70 were rapidly induced in the central nervous system within 30 min of the end of thermal stress (fig. 1). hsp40 reached maximum induction before hsp70, between 1 and 2 h following termination of thermal stress (fig. the induction of hsp70 was greater than that of hsp40, with over 4 times the relative fold change (fig. 1). hsp70 expression began to decline approximately 4 h following the end of thermal stress (fig. a critical exponential curve applied to the change in gene expression over time was a good fit to the data for hsp40 (r = 0.99, p = 0.0202 ; fig. figure 1.heat shock protein 40 (hsp40) expression (a) and heat shock protein 70 (hsp70) expression (b) in the central nervous system of lymnaea stagnalis following exposure to thermal stress. critical exponential curve fitted to the data (hsp40, r = 0.99, p = 0.0202 ; hsp70, r = 0.88, p = 0.1767). heat shock protein 40 (hsp40) expression (a) and heat shock protein 70 (hsp70) expression (b) in the central nervous system of lymnaea stagnalis following exposure to thermal stress. critical exponential curve fitted to the data (hsp40, r = 0.99, p = 0.0202 ; hsp70, r = 0.88, p = 0.1767). these results demonstrate that exposure to an acute thermal stress of 30c was sufficient to increase the synthesis of hsps above constitutive levels in l. stagnalis. the temporal changes in expression of hsps observed in the current study were similar to those recorded previously in other organisms. bahrndorff,. observed a peak in the expression of hsp70 in orchesella cincta within 2 h of exposure to thermal stress followed by a sharp decrease after 6 h. here, expression of hsp70 peaked approximately 4 h after the end of thermal stress, followed by a sharp decline (fig. altered gene activity and protein synthesis are known to be required for ltm formation in l. stagnalis. specifically, molluscan insulin - related peptide ii and protein kinase c are thought to play a role in the ltm formation of conditioned taste aversion. the observed increase in the synthesis of hsps in the central nervous system of l. stagnalis, following exposure to thermal stress, suggests that these proteins may play a role in ltm formation in relation to a thermal stimulus. l. stagnalis were subjected to a thermally stressful condition (30c for 1 h) and central nervous system tissue was sampled at 6 time intervals following the end of the thermal stress (0 h, 0.5 h, 1 h, 2 h, 4 h, 8 h). immediately upon sampling, snails were euthanized by placing in ice water for 15 min, the central nervous system was dissected and then completely submerged in rnalater (qiagen) in a 1.5 ml micro - centrifuge tube. central nervous system tissue was pooled from 2 snails for each replicate at each time point, thus, there were 3 replicates per time point. rna was extracted from the samples using the rneasy mini kit (qiagen) following the manufacturer 's protocol, with initial sonication (510 s), additional tissue disruption with a qiashredder column (qiagen), and a 15 min dnase treatment. rna was eluted in 30 l of rnase - free water and the concentration and quality of total rna was determined using a nanodrop 1000 spectrophotometer (nanodrop technologies). only samples that met quality criteria (260/280 ratio > 2.0) were used for further analyses. all samples were diluted to 50 ng l and 400 ng of rna was used to synthesize cdna following the manufacturer 's protocol for the improm - ii reverse transcription system (promega), with hexanucleotide primers and deoxynucleotide mix (sigma - aldrich). cdna was synthesized under the following conditions : annealing at 25c for 5 min, extending at 42c for 60 min, and heat - inactivating transcriptase at 70c for 15 min (geneamp pcr system, 9700, applied biosystems). heat shock protein primers (table 1) were selected using primer blast (ncbi). the amplicons were designed to span 1 intron junction and were checked to avoid secondary structure, self - annealing sites, complementarity, and potential hairpins using oligocalc (northwestern university, usa). elongation factor 1-alpha primers (table 1) were taken from van nierop,. table 1.lymnaea stagnalis gene specific primers for heat shock protein genes (hsp40 and hsp70) and a housekeeping gene (elongation factor 1-, elf-1). num.forward (5-3)reverse (5-3)product (bp)annealing temperature (c)hsp40dq278442.1atgttaaacctggatggaaggcagggcaggcacgttttgcggtgttt7958hsp70dq206432.1tgctggccgaagcggagaagcctcaagctggttcctggccg7860elf-1dq278441.1accacaactggccacttgatcccatctcttgggcctctttct8554 lymnaea stagnalis gene specific primers for heat shock protein genes (hsp40 and hsp70) and a housekeeping gene (elongation factor 1-, elf-1). reference numbers from ncbi, product length in base pairs (bp) to conduct quantitative reverse transcriptase pcr (qrt - pcr), lyophilized primers (eurofins mwg operon) were reconstituted to 100 mol with rnase - free water and mixed with sybr green jumpstart taq readymix (sigma - aldrich) to give a final reaction concentration of 375 nmol in a 20 l total volume. fluorescence was detected (stepone real - time pcr system, applied biosystems) over 40 cycles with cycling conditions of denaturing at 94c for 15 s, annealing at 55c for 1 min and extension at 72c for 1 min. for analysis, a standard curve of cdna template (from a known sample) was run on each plate for each gene to allow for within experiment plate normalization. the efficiency of qrt - pcr was calculated (e = 10 1) from the standard curve for each plate. only efficiencies between 0.85 and 1.2 were used for further analysis, and comparative quantification, using the efficiency corrected method, was used to determine fold - changes in the genes of interest normalized to elf-1. the expression of elf-1 in the central nervous system of l. stagnalis was not affected by thermal stress, thus, the use of elf-1 as a housekeeping gene was justified. this work was funded in part by the faculty of science and technology, plymouth university. | organisms exposed to environmental stressors respond by rapidly synthesising a suite of highly conserved proteins called heat shock proteins (hsps). environmental stress can also enhance and/or block memory formation, with long - term memory formation requiring gene activation and protein synthesis. thermal stress in the pond snail lymnaea stagnalis can enhance memory formation, and, in this study, the effect of thermal stress on hsp gene expression in the nervous system was investigated. time - related expression profiles for hsp40 and hsp70 indicated rapid (100 fold and expression did not return to control levels within 8 h. |
a 16-year - old male was referred with features of right hemi - hypertrophy and severe lymphoedema affecting his scrotum and penis. he had previously undergone scrotal reduction surgery at the age of 13, but had since developed worsening penile oedema. his main concern was that of cosmetic appearance prior to sexual debut, and he also complained of erectile dysfunction. he did not perceive the penis becoming hard or erect, but was able to achieve orgasm and ejaculate. on examination, he had gross lymphoedema of the right leg, minor residual scrotal, and inguinal swelling, but severe chronic penile lymphoedema. an mri confirmed gross oedema of the penile skin, but normal underlying cavernosal structure, and no other anatomical abnormality (see figures 1 and 2). under general anaesthesia, the entire diseased penile skin was excised. two full thickness skin grafts (4.5 cm 8.5 cm) were harvested from the axillae, and grafted onto the dorsal and ventral penile shaft, respectively (see figure 4). followup at 4 months confirmed complete graft take with minimal scarring, and the patient was very satisfised with the cosmetic outcome. he had also noticed a recovery in erectile activity, and feels psychologically and physically more prepared for sexual relations (see figure 5). to our knowledge, penile lymphoedema secondary to proteus syndrome has not previously been reported. a case by clark. in 1987 reported on a 2-year - old boy with proteus syndrome, macro - orchidism, and penile hypertrophy without any other signs of virilisation. proteus syndrome is a hamartomatous disorder characterised by multiple focal overgrowths that can involve any structure of the body. it was named after the greek god of the sea, proteus, who was capable of assuming many forms to escape capture. one aetiological hypothesis is somatic mosaicism, the presence of genetically distinct populations of somatic cells, that can be lethal in the nonmosaic state. it was first described by cohen and hayden in 1979 as a disorder characterized by the overgrowth of various tissues, hyperostoses, epidermal nevi, and connective tissue nevi, where overgrowth is defined as asymmetry that is greater than normal. surgical removal of the diseased skin and replacement with skin grafts is an effective means of restoring cosmetic appearance and functionality. | to our knowledge penile lymphoedema secondary to proteus syndrome has not previously been reported. hence we report a case of a 16-year - old male who was referred with features of right hemi - hypertrophy and severe lymphoedema affecting his scrotum and penis. he had previously undergone scrotal reduction surgery at the age of 13, but had since developed worsening penile oedema. his main concern was that of cosmetic appearance prior to sexual debut, and he also complained of erectile dysfunction. an mri confirmed gross oedema of the penile skin, but normal underlying cavernosal structure, and no other anatomical abnormality. under general anaesthesia, the entire diseased penile skin was excised. two full thickness skin grafts were harvested from the axillae, and grafted onto the dorsal and ventral penile shaft respectively. a compressive dressing and urinary catheter was applied for 7 days. follow - up at 4 months confirmed complete graft take with minimal scarring, and the patient was very satisfied with the cosmetic outcome. he had also noticed a recovery in erectile activity, and feels psychologically and physically more prepared for sexual relations. |
laparoscopic surgery has developed to a standard of care in patients with small (40 kg / m underwent a transperitoneal adrenalectomy ; all others underwent adrenalectomy by a retroperitoneoscopic approach. patients with aldosterone - producing adenomas had been treated preoperatively with 200 - 400 mg / d of spironolactone for 6 weeks. patients with pheochromocytoma had received alpha - receptor inhibitor during the last 10 preoperative days. three trocars are used for left adrenalectomy, an additional trocar is used to retract the liver for right adrenalectomy. for left adrenalectomy, the left colonic flexure is mobilized along the gerota fascia. dissecting through the avascular plain between the pancreatic tail and the kidney, the spleen and the pancreatic tail the liver is mobilized along the lateral border of the inferior vena cava to control potential bleeding. the fat tissue surrounding the adrenal gland is left in place to avoid tumor manipulation. dorsal mobilization of the tumor is performed, and followed by lateral and cranial mobilization. the adrenal gland and the surrounding fat tissue are removed en bloc with a retrieval bag. subsequently, fibers of the quadratus lumborum muscle are spread digitally and the perirenal fascia is opened from dorsal. after reaching the retroperitoneal space, this area is dilated with the forefinger. after blunt preparation of the retroperitoneal space, the operation is continued by dissection of the retrorenal fat tissue from the renal capsule at the upper renal pole. after visualization of the inferior vena cava at the right side and identification of the renal vein at the left side, the adrenal vein is divided. the adrenal gland and the surrounding fat tissue are removed en bloc with a retrieval bag. using the t - test, p - value of 6 cm in 52 cases (group 2). patients and tumor characteristics are shown in [table 1 ]. in group 1, significantly more patients presented with aldosterone - producing adenomas (25% vs. 2%, p = 0.001). the incidence of the adrenocortical carcinoma was higher in group 2 patients (6.3% vs. 0.4%, p = 0.039). patients and tumor characteristics pathological characteristics significantly more patients underwent transperitoneal adrenalectomy in group 2 than in group 1 (71% vs. 32%, p = 0.023, table 3). single - incision laparoscopic adrenalectomies (sils) were performed only in group 1 patients. duration of surgery was significantly longer (105 min vs. 88 min, p = 0.03) and the estimated blood loss was significantly higher (470 ml vs. 150 ml) in group 2 patients. surgical procedures and operative outcomes three intraoperative bleedings occurred in group 2 patients (5.7%) as opposed to two bleedings in group 1 (0.8%, p = 0.041, table 4) leading to one conversion in a group 2 patient. intra- and postoperative complications the conversion rate was significantly higher in group 2 than in group 1 (5.7% vs. 1.3%, p = 0.011, table 4). also, postoperative complication rate was significantly higher in group 2 than in group 1 (11.5% vs. 3.0%, p = 0.022). however, only two major complications occurred : an acute cardiac failure in a group 1 patient and one pancreatic fistula treated conservatively in a group 2 patient. the current study presents a large patient population undergoing laparoscopic adrenalectomy for large (> 6 cm) tumors. as it might have been expected, intra- and postoperative morbidity was slightly higher in patients with larger tumors, however, the complication rate of 11.5% was still acceptable. moreover, morbidity and complication rates of up to 27% were observed following open adrenalectomy and this was accompanied by prolonged hospital stay, more pain at the incision site and an increased risk of postoperative hernias. due to a close anatomical relation to spleen, kidney, liver and inferior caval vein, laparoscopic adrenal surgery for large tumors is technically demanding. injury to the adrenal capsule is associated with increased probability of relevant consequences in patients with larger tumors : 23% of group 2 patients presented with pheochromocytoma and 12% had a malignant disease. therefore, surgeons undertaking laparoscopic adrenalectomy in this particular population should have a large experience in laparoscopic adrenal surgery. experience with other, particularly with gastrointestinal laparoscopic procedures might shorten the learning curve. in the present study, 86.5% of the adrenalectomies for tumors > 6 cm were performed by the first author of the study (a.a.) after an experience of 127 laparoscopic adrenalectomies and already twelve years experience in laparoscopic colorectal surgery. retroperitoneoscopic adrenalectomy in patient with very large tumors might pose serious additional technical difficulties because of a limited operative field. in obese patients, the prone positioning will lead to even more compression of the retroperitoneal space in spite of high insufflation pressure. thus, laparoscopic transperitoneal adrenalectomy by a lateral approach is preferred in case of tumors larger than 8 cm and in patients with bmi > 40 kg / m at our institution. conventional adrenalectomy is reserved for cases with clear radiological signs of malignancy (invasion of surrounding structures, evidence of metastases) and was performed only in 8 cases since 2005. in our study, duration of surgery was longer and blood loss was slightly larger in patients with tumors > 6 cm as compared to patients with smaller adrenal masses. some recent publications indicated that laparoscopic adrenalectomy can be performed safely for tumors up to 15 cm.. tsuru. found no statistically significant difference regarding blood loss, time of surgery and complication rate between patients with tumors 6 cm were performed by the first author of the study (a.a.) after an experience of 127 laparoscopic adrenalectomies and already twelve years experience in laparoscopic colorectal surgery. retroperitoneoscopic adrenalectomy in patient with very large tumors might pose serious additional technical difficulties because of a limited operative field. in obese patients, the prone positioning will lead to even more compression of the retroperitoneal space in spite of high insufflation pressure. thus, laparoscopic transperitoneal adrenalectomy by a lateral approach is preferred in case of tumors larger than 8 cm and in patients with bmi > 40 kg / m at our institution. conventional adrenalectomy is reserved for cases with clear radiological signs of malignancy (invasion of surrounding structures, evidence of metastases) and was performed only in 8 cases since 2005. in our study, duration of surgery was longer and blood loss was slightly larger in patients with tumors > 6 cm as compared to patients with smaller adrenal masses. some recent publications indicated that laparoscopic adrenalectomy can be performed safely for tumors up to 15 cm.. tsuru. found no statistically significant difference regarding blood loss, time of surgery and complication rate between patients with tumors 6 cm), laparoscopic adrenal surgery can be performed by an experienced surgeon at large volume centers with an increased but still acceptable intra- and postoperative morbidity. | background : laparoscopic adrenalectomy for tumors larger than 6 cm is currently a matter of controversial discussion because of difficult mobilization from surrounding organs and a possible risk of capsule rupture.materials and methods : data of consecutive patients undergoing laparoscopic adrenalectomy between 1/1994 and 7/2012 were collected and analysed retrospectively. intra- and postoperative morbidity in patients with tumors 6 cm (group 1, n = 227) were compared to patients with tumors > 6 cm, (group 2, n = 52).results : incidence of adrenocortical carcinoma was significantly higher in group 2 patients (6.3% vs. 0.4%, p = 0.039) whereas the incidence of aldosterone - producing adenoma was lower (2% vs. 25%, p = 0.001). mean duration of surgery was longer (105 min vs. 88 min, p = 0.03) and the estimated blood loss was higher (470 ml vs. 150 ml) in group 2 patients. intraoperative bleeding rate (5.7% vs. 0.8%, p = 0.041), and the conversion rate were significantly higher (5.7% vs. 1.3%, p = 0.011) in group 2. also, postoperative complication rate was significantly higher in group 2 (11.5% vs. 3.0%, p = 0.022). however, only two major complications occurred, one in each group.conclusion:minimally invasive adrenal surgery can be performed by an experienced surgeon even in patients with large tumors (> 6 cm) with an increased but still acceptable intra- and postoperative morbidity. |
lactoferrin (lf) is an iron - binding glycoprotein of the transferrin family that is expressed and secreted by glandular cells, such as milk, saliva, tears, and mucous secretions. it is also found in the neutrophils from which it is released into infected tissues and blood during the inflammatory process. initially described as an iron - binding molecule with bacteriostatic properties, lf is now known to be a multifunctional or multitasking protein. its protective effects range from direct antimicrobial activities against a large panel of microorganisms, including bacteria, viruses, fungi, and parasites, to anti - inflammatory and anticancer activities. lf has multiple activities relying not only on its capacity to bind iron, but also to interact with molecular and cellular components of both host and pathogens. lf can bind and sequester lipopolysaccharide (lps), thus, preventing proinflammatory pathway activation, sepsis, and tissue damage. lactoferrinis thought to cause a therapeutic revolution, because it was proven in the last few years that lf could be used in the treatment of many diseases such as hepatitis c virus, osteoporosis, diabetic foot ulcers, and cancer. a large number of studies prove that oral lactoferrin has therapeutic effect on cancer, but most of these studies were conducted on animals [7, 8 ]. also there were former preclinical studies that approved the chemoprevention effect of lf on colorectal cancer [9, 10 ] and its ability to decrease chemotherapy related side effects. in our clinical trial, we use oral blf as an adjuvant therapy for metastatic colorectal cancer patients who were receiving chemotherapy in order to evaluate the role of lactoferrin on the outcome of colorectal cancer and its role in minimizing chemotherapy induced toxicity to enhance quality of life. colorectal cancer is a cancer of the large intestine (colon) and rectal cancer is a cancer of the last several inches of the colon. many symptoms have been described, with the main ones being rectal bleeding, diarrhea, or constipation (change in bowel habit), loss of weight, abdominal pain, and anemia. however, these symptoms are also common with benign conditions. there is no test available for use in primary care that provides a sufficient discrimination to help in referral decisions although ; primary care investigations sometimes include fecal occult blood testing and estimation of hemoglobin. 5-fluorouracil (5-fu) and leucovorin are the most commonly used regimen in the treatment of colorectal cancer. however, the prognosis is usually poor, so in our study, we aimed to use blf as adjuvant therapy to the previously mentioned chemotherapy regimen in order to evaluate the outcome of blf implication in such cancerous patients. a double - blinded parallel randomized controlled clinical trial was conducted on 30 colorectal cancer patients in the tumor institution of menoufiya university receiving 5-fu and calcium leucovorin every 28 days. patients were divided into two groups ; one of them was the test group in which patients received oral blf 250 mg / day for plus 5-fu and calcium leucovorin for 3 months. the other group was the control group in which patients received chemotherapy only for the same period.(i)the endpoints of this clinical trial are as follows. the primary endpoint is a quantitative endpoint by measuring serum lf levels of all patients in the two groups 3 months after treatment. the secondary end point is enhancing quality of life for patients in test group which appear in improving renal and hepatic functions tests and also appear in relieving mucositis.(ii)parameters measured to determine oral blf efficacy were(1)serum lf(2)serum gst enzyme(3)serum inf-(4)cea(iii) parameters measured to determine oral blf safety were(1) renal functions tests [bun - serum creatinine](2) hepatic functions tests [alt - ast](3) hematological toxicity [cbc ] the endpoints of this clinical trial are as follows. the primary endpoint is a quantitative endpoint by measuring serum lf levels of all patients in the two groups 3 months after treatment. the secondary end point is enhancing quality of life for patients in test group which appear in improving renal and hepatic functions tests and also appear in relieving mucositis. parameters measured to determine oral blf efficacy were (1)serum lf(2)serum gst enzyme(3)serum inf-(4)cea parameters measured to determine oral blf safety were (1) renal functions tests [bun - serum creatinine](2) hepatic functions tests [alt - ast](3) hematological toxicity [cbc ] renal functions tests [bun - serum creatinine ] hepatic functions tests [alt - ast ] hematological toxicity [cbc ] the sample size is the number of patients or other experimental units included in a study. these calculations are particularly of interest in the design of randomized controlled trials (rcts). simplest formula for a continuous outcome and equal sample sizes in both groups, assuming : alpha = 0.05 and power = 0.80 (beta = 0.20) n = the sample size in each of the groups 1 = population mean in treatment group 1 2 = population mean in treatment group 2 1 2 = the difference the investigator wishes to detect 2 = population variance (sd) a = conventional multiplier for alpha = 0.05 b = conventional multiplier for power = 0.80 (1)n=2[(a+b)22](12)2.the significance level alpha is chosen at 0.05 ; one should enter the value 1.96 for a in the formula. similarly, when beta is chosen at 0.20, the value 0.842 should be filled in for b in the formula. n = the sample size in each of the groups 1 = population mean in treatment group 1 2 = population mean in treatment group 2 1 2 = the difference the investigator wishes to detect 2 = population variance (sd) a = conventional multiplier for alpha = 0.05 b = conventional multiplier for power = 0.80 (1)n=2[(a+b)22](12)2. the sample size calculation is based on using the population variance of a given outcome variable that is estimated by means of the standard deviation (sd) in case of a continuous outcome. because the variance is usually an unknown quantity, investigators often use an estimate obtained from a pilot study or use information from a previously performed study. in our study, we use sd information from a previously performed study that investigated the effect of orally administered bovine lactoferrin on the growth of adenomatous colorectal polyps. in this clinical study, results indicated that serum hlf levels mean sd changed by 25.43 19.35 ng / ml in the 3.0 g blf group for 12 months. as our clinical trial was carried out using oral blf 250 mg per day for only 3 months, we calculate sd of lf group from the data of the former clinical study. lf dose in the former clinical study is 3000 mg per day resulted in sd of 19.35. lf dose in our clinical study is 250 mg per day so sd should be 1.6. lf sd in our clinical study is 1.6 in 12 months.so, the calculated sd of lf in our clinical study for 3 months is 0.403 lf dose in the former clinical study is 3000 mg per day resulted in sd of 19.35. lf dose in our clinical study is 250 mg per day so sd should be 1.6. 1 2 : the smallest effect of interest is the minimal difference between the studied groups that the investigator wishes to detect. in our clinical study, we consider a difference in serum lf of 0.45 ng / ml 3 months after treatment between the treated and the control groups. calculate n : (2)n=2[(1.96+.8942)20.4032][0.45]2=12.59. this means that a sample size of 13 subjects per group is needed but 15 patients were participating in each group. blood samples were collected from patients in the two groups at the beginning of the trial period and 3 months after treatment. samples were divided into two parts ; one of them was used as a whole blood sample for cbc and differential blood count testing using advia 120 hematology system (advia kits, siemens, germany). also to measure is cea through enzyme linked fluorescent assay (elfa) using mini vidas (vidas kit, biomrieux, france). the other part was separated in the centrifuge 2000 rps (jouan centrifuge) to obtain serum samples for evaluation of (bun), serum creatinine, aspartate aminotransferase (ast), and alanine aminotransferase (alt), all of which were analyzed spectrophotometry using beckman synchron cx9 pro chemistry analyzer (beckman kits, beckman, california, united states), serum lf by elisa using tecan elisa reader (elisa kit assaypro company, saint charles, united states, catalog number el2011 - 1), serum gst enzyme by elisa using tecan elisa reader (elisa kit cusabio, united states, company catalog number : csb - e09032h), and inf- by elisa using tecan elisa reader (elisa kit assaypro company, saint charles, united states, catalog number : ei1023 - 1). the results were statistically analyzed by dependent sample - t test for each group to compare between patients results in the same group before and after 3 months to determine the effect of blf oral administration on test group. independent sample - t test was also used to compare between results of patients in the test group and results of patients in the control group before and after 3 months. all patients in the trial were informed and, therefore, the trial has been performed in accordance with the ethical standards of the tumor institution of menoufiya university. patients who participated in this clinical trial were metastatic colorectal cancer patients (stage 4). two patients who had hypertension were on an oral drug that is a combination of captopril and hydrochlorothiazide.two patients who had diabetes mellitus type 2 one of them on oral hypoglycemic and the other on insulin.two patients who were on warfarin due to old deep vein thrombosis (dvt). two patients who had hypertension were on an oral drug that is a combination of captopril and hydrochlorothiazide. two patients who had diabetes mellitus type 2 one of them on oral hypoglycemic and the other on insulin. two patients who were on warfarin due to old deep vein thrombosis (dvt). no significant difference was found in bun, serum creatinine, ast, alt, serum lf, gst enzyme, inf-, wbcs count, platelet count, cea, ca19.9, rbcs count, neutrophil count, and hb level of patients in the test and control groups before beginning of the trial at significance level (p 0.05) (table 2). a comparison between patients parameters values in test and control groups 3 months after treatment indicates that no significant difference in mean values of serum creatinine, ast, alt, serum lf, serum gst enzyme, inf-, wbcs count, platelet count, cea, rbcs count, neutrophil count, and hb level of patients in test and control groups except for bun values in test group were significantly decreased (p = 0.048) and inf- values were significantly increased (p = 0.041) at significance level (p 0.05) (table 3). bovine lf administration resulted in significant increase in serum lf (p = 0.003), serum gst enzyme (p = 0.001), inf- (p = 0.001), wbcs count (p = 0.004), platelet count (p = 0.001), rbcs count (p = 0.001), neutrophil count (p = 0.001), and hb level (p = 0.001) ; also blf administration resulted in significant decrease in bun (p = 0.001), creatinine (p = 0.05), alt (p = 0.033), ast (p = 0.003), and cea (p = 0.033) as compared to all parameters values of patients in control group at significance level (p 0.05) (table 4). mean percent of change of main parameters (serum lf, serum gst enzyme, and inf-) after than before treatment among the studied patients indicate significant improvement in patients who received oral blf 3 months after treatment at significance level (p 0.05) (table 5). mean percent of change of the remaining parameters (cea, cbc, renal function tests, and hepatic function tests) after than before treatment among the studied patients indicate significant improvement in patients who received oral blf 3 months after treatment at significance level (p 0.05) (table 6). about 90% of metastatic colorectal cancer patients in the trial underwent a surgery, either partial or total colectomy.(i)ct scan reports for all patients in the test group and the control group before surgery : circumferential soft tissue thickening was seen in different parts of the colon and rectum with the largest bulk of the mass seen measuring from 496130 mm in all various dimensions up to 74.5 cm in its axial dimension.(ii)ct scan reports for all patients in the test group and control group after surgery and before the trial : no significant time interval changes.(iii) ct scan reports for all patients in the test and control groups after the trial period 3 months : no significant time interval changes no de novo changes are noted no recurrent masses. ct scan reports for all patients in the test group and the control group before surgery : circumferential soft tissue thickening was seen in different parts of the colon and rectum with the largest bulk of the mass seen measuring from 496130 mm in all various dimensions up to 74.5 cm in its axial dimension. ct scan reports for all patients in the test group and control group after surgery and before the trial : no significant time interval changes. ct scan reports for all patients in the test and control groups after the trial period 3 months : no significant time interval changes no de novo changes are noted no recurrent masses. no significant time interval changes no de novo changes are noted biopsy reports for all patients in the test and control groups before surgery showed mucinous adenocarcinoma at different stages and grades that differ from patient to another. biopsy reports for all patients in the test and control groups before surgery showed mucinous adenocarcinoma at different stages and grades that differ from patient to another. before receiving blf : patients in the test group and control group had moderate to severe oral mucositis after every chemotherapy cycle.after receiving blf : patients in the test group had less severe mucositis than patients in the control group after every chemotherapy cycle indicated by an enhanced ability to swallow. before receiving blf : patients in the test group and control group had moderate to severe oral mucositis after every chemotherapy cycle. after receiving blf : patients in the test group had less severe mucositis than patients in the control group after every chemotherapy cycle indicated by an enhanced ability to swallow. before receiving blf : patients in the test group and control group hadhigh rate of infection recurrence with high degree of fever.after receiving blf : patients in test group had a lesser rate of infection recurrence and had less incidence of fever than patients in control group. before receiving blf : patients in the test group and control group hadhigh rate of infection recurrence with high degree of fever. after receiving blf : patients in test group had a lesser rate of infection recurrence and had less incidence of fever than patients in control group. this parallel randomized controlled clinical trial aimed to evaluate the role of oral blf on the outcome of colorectal cancer and its role in minimizing chemotherapy induced toxicity to enhance patient 's quality of life. the results of this trial indicate that oral blf made a significant increase in serum lf levels of patients in the test group 3 months after treatment compared to patients in the control group (p 0.05). figure 1 indicates that mean serum lf increased from 0.13 ng / ml before treatment to 0.283 ng / ml after 3 months of treatment in test group compared to mean serum lf of the control group which had very small increase from 0.186 ng / ml before treatment to 0.188 ng / ml after 3 months of treatment. this may be due to the blf - mediated induction of serum human lactoferrin (hlf) levels via activation of neutrophils. lactoferrin is an immunomodulator agent that may support the proliferation, differentiation, and activation of immune cells and strengthen the immune response. it is well known that inflammation initiates sporadic colorectal cancer because most intratumoral immune cells are recruited after the tumor is formed and so, in this case, chronic inflammation does not precede but follows tumor development. however, after a tumor forms, the localized inflammatory microenvironment can promote the accumulation of additional mutations and epigenetic changes. activated inflammatory cells produce reactive oxygen species (ros) and reactive nitrogen intermediates that can induce dna damage and mutation. due to lf iron binding properties and interactions with target cells and molecules lactoferrin acts as an anti - inflammatory factor, due to its antimicrobial activity and capability of binding components of bacterial cell walls (lps) or their receptors ; lactoferrin may prevent the development of inflammation and subsequent tissue damage caused by the release of pro - inflammatory cytokines and reactive oxygen species. the protective effect of lactoferrin manifests in a reduced production of some proinflammatory cytokines and an increased amount of anti - inflammatory cytokines. therefore, lactoferrin can diminish the harmful influence of reactive oxygen species produced by leukocytes at the sites of inflammation. patients in test group 3 months after treatment had significant increase in inf- serum levels compared to patients in the control group (p 0.05). figure 2 indicates that mean serum inf- increased from 32.33 pg / ml before treatment to 33.96 pg / ml after 3 months of treatment in patients in the test group compared to mean serum inf- of patients in the control group which was 32.36 pg / ml before treatment then 32.26 pg / ml after 3 months of treatment. this result may be due to modulation of cytokine production from leukocyte populations by lactoferrin. lactoferrin can increase in vivo and in vitro production of il-12, a cytokine produced by antigen presenting cells (apcs). il-12 functions to enhance production of ifn-, increase proliferation, and augment the cytotoxic activity of lymphocytes of the innate (nk cells) and adaptive (cd4 and cd8 t - cells) immune responses. it is well known that colorectal cancer is like other solid malignancies which are infiltrated by various types of immune cells. cells of the innate immune system, such as neutrophils, mast cells, natural killer (nk) cells, dendritic cells (dc), and tumor - associated macrophages, can be easily detected in these tumors. so we can say that lf has a direct effect on inflammatory cells that participate in colorectal cancer pathogenesis. also, wbcs count and neutrophil count had a significant increase in patients in the test group 3 months after treatment compared to patients in the control group (p 0.05). figure 3 indicates that mean wbcs count increased from 6 (10 cell/l) before treatment to 7 (10 cell/l) after 3 months of treatment in patients in test group compared to mean wbcs count of patients in the control group which decreased from 8 (10 cell/l) before treatment to 7 (10 cell/l) after 3 months of treatment. this result indicates that oral blf enhances the immune system of colorectal cancer patients. as a result of this increase in wbcs and neutrophil count patients disease state may be improved, because the body immune system can fight the disease more efficiently compatible with some previous studies. also, results are nearly matched with those that were obtained in several clinical studies, where statistically significant increases were found between presupplementation levels and levels after 200 mg oral blf supplementation in total t - cell activation, helper t - cell activation, cytotoxic t - cell activation, and hydrophilic antioxidant capacity. these results support the proposal that oral supplements of bovine lactoferrin may be a useful adjunct toward modulation of immune activity, in particular t - cell activation and antioxidant status. lactoferrin is also known to exert changes on leukocytes of the innate immune system, through increasing natural killer (nk) cell activity, promoting function of neutrophils by enhancing phagocytic activity, modifying the production of reactive oxygen species, and activating macrophages through increasing cytokine and no production and limiting intracellular pathogen proliferation. the degranulation of neutrophils in response to inflammatory signals introduces lactoferrin into an environment that is populated with a mix of both innate leukocytes (macrophages, dendritic cells, and nk cells) and adaptive immune cells (t - cells and b - cells). the discovery of lactoferrin receptors on a wide variety of immune cells and their demonstrated capability to bind lactoferrin confirms the potential for this molecule to function in a manner to modulate and affect responses of both the innate and adaptive immune system. a significant increase in serum gst enzyme in patients in the test group 3 months after treatment compared to patients in the control group (p 0.05) figure 1 indicates that the mean serum gst enzyme increased from 0.679 ng / ml before treatment to 0.886 ng / ml after 3 months of treatment in patients in the test group compared to mean serum gst enzyme of patients in the control group which did not change from 0.729 ng / ml before treatment to 0.729 ng / ml after 3 months of treatment. this may be due to regulation of the activities of phase ii enzymes such as glutathione s - transferase. the effect of antioxidants such as lf increase intracellular glutathione (gsh) levels in vascular endothelial cells by modulation of the gsh redox. the serum gst enzyme has a detoxifying effect and so the increase in its serum level may help in colorectal cancer treatment. also there was a significant decrease in one of colorectal cancer tumor markers cea in patients in test group 3 months after treatment in comparison with the patients in the control group (p 0.05). figure 4 indicates that mean serum cea decreased from 30.17 ng / ml before treatment to 10.75 ng / ml after 3 months of treatment in test group compared to mean serum cea of the control group which increased from 16.07 ng / ml before treatment to 24.45 ng / ml after 3 months of treatment. also, this decrease may be resulted from improvement of the disease state as we mention that lf has an immunomodulatory property, which could play a major role in its antitumor activity. many studies showed that lf elevates the number and increases the activity of t and b lymphocytes and nk cells, stimulates the release of a number of cytokines such as inf-, increases phagocytic activity and cytotoxicity of monocytes / macrophages, accelerates the maturation of t and b cells, and elevates the expression of several types of cellular receptors. apart from its immunomodulatory properties, lf exhibits direct antitumor activity, such as lytic, proapoptotic, antiproliferative, antiangiogenic, antioxidant activity, and chelating iron ions. lf also, possesses chemopreventive properties, regulates the activity of phase i and ii enzymes, which participate in the activation and detoxification of carcinogens, and regulates the composition of the intestinal microflora. in this way, it prevents the proliferation of tumors and their development at early stages of carcinogenesis. these results are matched with results obtained in a former clinical trial made by mai abd el - khalik in menoufiya university to study the immunomodulatory and therapeutic effect of dietary lactoferrin in patients with colorectal cancer. now we can say that oral blf may be a good adjuvant therapy for metastatic colorectal cancer patients due to its anti - inflammatory immunomodulatory effect that can reduce the chance of disease recurrence, infections, and inflammations so the oral blf administration can enhance patient quality of life. on the other hand, oral blf administration decreased chemotherapy related side effects as it enhances both renal and hepatic function tests. as mentioned in the results, there were significant decreases in bun and serum creatinine in results of patients in the test group 3 months after treatment compared to patients in the control group (p 0.05). figure 5 indicates that mean serum bun decreased from 16.23 mg / dl before treatment to 11.43 mg / dl after 3 months of treatment in patients in the test group compared to mean serum bun of patients in the control group which changed from 17.5 mg / dl before treatment to 17.8 mg / dl after 3 months of treatment and indicates that mean serum creatinine decreased from 1 mg / dl before treatment to 0.85 mg / dl after 3 months of treatment in patients in the test group compared to mean serum creatinine of patients in the control group which changed from 1.05 mg / dl before treatment to 1.13 mg / dl after 3 months of treatment. this decrease in bun and serum creatinine may be due to the antioxidant effect of lf as mentioned in a former preclinical study on rat model of ferric nitrilotriacetate- (fe - nta-) induced renal tubular oxidative injury. after an intraperitoneal administration of fe - nta for 4 and 24 h, blf pretreatment suppressed elevation of serum creatinine and blood urea nitrogen levels. in addition, protective effects against renal oxidative tubular damage and maintenance of antioxidant enzyme activities in the blf - pretreated group were observed. also, there was a significant decrease in serum alt and ast in patients in test group 3 months after treatment compared to patients in the control group (p 0.05). figure 6 indicates that mean serum ast decreased from 40.59 iu / l before treatment to 28.15 iu / l after 3 months of treatment in test group compared to mean serum ast of patients in control group which changed from 33.25 iu / l after 3 months of treatment and indicates that mean serum alt decreased from 37.47 iu / l before treatment to 30.58 iu / l after 3 months of treatment in patients in test group compared to mean serum alt of patients in control group which decreased from 30.11 oral lactoferrin may increase liver functions and protect it from damage by reactive oxygen species since lf can function as an antioxidant, reducing intracellular levels of ros. apoptosis is a programmed cell death. in a former preclinical study carried on rats that aimed to compare the hepatoprotective effects of native blf in relation to pegylated lactoferrin in a model of acute liver injury induced by d - galactosamine and lipopolysaccharide (galn / lps). native blf pretreatment was shown to suppress any increase in serum level of ast or alt that was induced by galn / lps. preadministration of 40k and 20k - peg - blf significantly suppressed the elevation of serum levels of ast and alt induced by galn / lps. oral blf administration enhanced anemia which is a very common chemotherapy related side effect ; as results have shown, there were significant increases in rbcs count and serum hb in patients in test group 3 months after treatment compared to patients in control group (p 0.05). figure 3 indicates that mean rbcs count increased from 4(10/l) before treatment to 5(10/l) cells after 3 months of treatment in patients in test group compared to mean rbcs count of patients in control group which did not change from 4(10/l) cells before treatment to 4(10/l) cells after 3 months of treatment. these results indicate that oral blf could be used in treating anemia in metastatic colorectal cancer patients to improve their overall health state. these results are supported by a previous clinical trial in advanced cancer patients on chemotherapy ; the results of this study show similar efficacy for oral lactoferrin and for i.v. iron, combined with rhuepo, for the treatment of anemia in advanced cancer patients on chemotherapy. the same results were also reported in another clinical trial on pregnant women 30 days after oral administration of blf ; hemoglobin and total serum iron levels increased to a greater extent than those observed in women treated orally for 30 days with ferrous sulfate, independent of the trimester of pregnancy. unlike ferrous sulfate bovine lf restored both red and white peripheral blood cell numbers depleted by chemotherapy in a preclinical study, which indicate the ability of oral blf in treating anemia. there was a significant increase in platelets count in patients in test group after 3 months compared to control group (p 0.05). clinical parameters follow - up results indicate that oral blf improved most of these parameters which indicates that patients ' disease states became stable without any recurrence of colorectal tumor masses or appearance of any new changes which may be due to several physiological roles of lf : regulation of iron homeostasis, modulation host defense against infection and inflammation, regulation of cellular growth, differentiation, protection against cancer development, and metastasis. these findings have suggested that lf has a great potential therapeutic use in cancer disease since it acts as a chemopreventive agent. oral mucositis is one of the most important clinical parameters that indicate therapeutic efficiency of oral blf. oral mucositis is one of the most common toxicities observed during radiotherapy and chemotherapy treatment for cancers. mucositis results in sore mouth, altered taste sensation, pain, and dysphagia leading to malnutrition. if left untreated, oral mucositis leads to ulceration, orodental infection, bleeding, and discontinuation of effective radiotherapy or chemotherapy. patients in test group had less severed mucositis than patients in control group after every chemotherapy cycle ; this result may be explained on the bases that pathogenesis of mucositis includes oxidative stress and releases reactive oxygen species (ros). the latter could directly damage cells, tissues, and blood vessels with subsequent transcription factor activation. among transcription factors the nuclear factor - kb (nf - kb) appears to be the most prominent. it is activated by both radiation and chemotherapy and could upregulate genes that lead to the production of a group of proinflammatory cytokines, including tumor necrosis factor (tnf-). so anti - inflammatory agents, anti - infective agents, and reactive oxygen species inhibitors, lactoferrin has protective effects that range from direct antimicrobial activities against a large panel of microorganisms, including bacteria, viruses, fungi, and parasites, to anti - inflammatory and anticancer activities and has antioxidant effect that can protect patients with metastatic colorectal cancer from recurrent infections and inflammations. another important parameter is infection recurrence ; patients in test group after 3 months had a lesser rate of infection recurrence than patients in control group and had less severe symptoms of infection and fever, because lactoferrin plays an important role in immune regulation and defense mechanisms against bacteria, fungi, and viruses. lactoferrin 's iron withholding ability is related to inhibition of microbial growth as well as to modulation of motility, aggregation, and biofilm formation of pathogenic bacteria. independent of iron binding capability, lactoferrin interacts with microbial, viral, and cell surfaces, thus, inhibiting microbial and viral adhesion and entry into host cells. lactoferrin can be considered not only a primary defense factor against mucosal infections, but also a polyvalent regulator which interacts in viral infectious processes. results of patients in the test group indicate a significant effect of oral blf 250 mg / day shown by significant improvement in mean percent of change of all parameters values after than before treatment among the studied patients with colorectal cancer receiving chemotherapy after 3 months (tables 5 and 6), but we need to investigate effect of oral blf on colorectal cancer patients for longer period than 3 months. oral blf gave promising results in this clinical trial ; it has the ability to improve symptoms of cancer in metastatic colorectal cancer patients, such as anemia, as it increased both rbcs count and hb concentration. also, lf decreased chemotherapy related side effects by protecting liver and kidney from toxicity and improving their function test values. another very important chemotherapy related side effect is mucositis which improved by oral blf ingestion and gave the chance to patients to swallow better with less pain and suffering. we can say that oral blf has significant therapeutic effect on colorectal cancer patients after using for a long period of time. | a double - blinded parallel randomized controlled clinical trial was conducted on two groups of colorectal cancer patients to study the therapeutic benefit of orally administered bovine lactoferrin (blf) on colorectal cancer patients having age ranges from 20 to 71 years and who received 5-fluorouracil and leucovorin calcium. test group (15 patients) received oral blf 250 mg / day beside chemotherapy for three months. control group (15 patients) received chemotherapy only. serum lactoferrin (lf), serum glutathione - s - transferase enzyme (gst), interferon gamma (inf-), tumor marker carcinoembryonic antigen (cea), renal function tests, hepatic function tests, and complete blood count were measured for both groups before and at the end of the trial. although, there was a significant effect of oral blf (250 mg / day) that indicated a significant improvement in mean percent of change of all parameters 3 months after treatment, there was no significant difference between results of patients in the test group and patients in the control group after treatment. this result suggests that oral blf has significant therapeutic effect on colorectal cancer patients. our study suggests that daily administration of blf showed a clinically beneficial effect to colorectal cancer patients with better disease prognosis but that needs further looking into. |
intrauterine exposure to diabetes (1,2), obesity (3), and excessive maternal gestational weight gain (4,5) are hypothesized to affect fetal growth and development, which is reflected in babies being born small or large for gestational age to women who were obese and/or diabetic during pregnancy. previous studies have shown that maternal glucose is positively associated with infant adiposity at birth and in later childhood, and offspring of obese and type 2 diabetic mothers are also at higher risk of obesity (6) and type 2 diabetes (7) during adulthood. the mechanisms through which intrauterine exposures affect the metabolic outcomes of the offspring are poorly understood ; however, undernutrition (8), overnutrition (9,10), hormone imbalance, and accelerated growth (11,12) of the fetus are thought to be pivotal factors in these processes. in utero, the glucose - stimulated hormone insulin is particularly relevant, owing to its anabolic properties, whereas in the postpartum period, adipocyte - derived hormones involved in insulin signaling and adipogenesis (13,14), such as interleukin-6 (il-6) (15), adiponectin (16) and leptin (17), may be mechanistically relevant for infant growth and metabolism. in diabetic pregnancies, the fetal pancreas is often exposed to excessive glucose and protein levels, which stimulate growth primarily through the overproduction of insulin by the fetal pancreas, sometimes resulting in macrosomia (18). the heavier birth weight of babies born to some diabetic pregnancies is reflective of this process, where the stressed pancreas accelerates growth via the anabolic actions of insulin (18) ; this process is also hypothesized to diminish the capacity of the pancreatic -cells to function adequately across the adult life span, thus raising the trajectory for diabetes even before the baby is born. although the mechanisms through which these processes occur are poorly understood, overweight and obesity in offspring of diabetic pregnancies are well documented (19,20), highlighting a potential mediating role of adipocyte - derived hormones in these relationships. excess adiposity, particularly around the abdomen, causes insulin resistance, a major precursor to diabetes (21). thus, excessive weight gain in pregnancy, when coupled with -cell dysfunction, can cause gestational diabetes. defining the mechanisms that link excessive gestational weight gain with early - life metabolic disturbances may help identify targets for early - life interventions aimed at reducing the risk of chronic cardiometabolic disease in the offspring later in life. the purpose of this study was to determine the relationship between maternal weight gain and infant body composition and plasma glucose and insulin concentrations at 4 months of age. we also sought to establish the role of candidate adipokines (il-6, leptin, and adiponectin) in mediating these relationships, as these hormones have established roles in adult obesity and diabetes (17,22). participants were recruited through local media advertising and contact with midwives at local antenatal clinics. a total of 35 pregnant women from vsterbotten county, a region in the north of sweden, were enrolled in the study. three women withdrew from the study before delivery ; the remaining 32 women successfully delivered. one woman gave birth to dizygotic twins, resulting in a total of 18 female and 15 male newborns. gestational data were collected from the women at between 28 and 32 weeks of gestation during study visits at the clinical research center at ume university hospital. all but one of the women participated in the follow - up study visit, which occurred between 11 and 19 weeks postpartum. written informed consent was provided by the mothers for all aspects of the study protocol. height (to the nearest 0.5 cm) and weight (to the nearest 0.1 kg) were measured at between 28 and 32 gestational weeks using a calibrated wall - mounted stadiometer and a calibrated digital scale (tanita corporation, tokyo, japan), respectively. maternal height and weight were also abstracted from medical records at weeks 816 and 3641. bmi was calculated by dividing weight (kg) by height squared (m) (kg / m). body composition (fat and fat - free mass) was estimated using the doubly labeled water method (25). participants were given a body weight dependent oral dose of stable isotopes (0.07 g h2o and 0.174 g h2o per kg body weight). a predose urine sample was collected prior to the administration of the oral dose, and 10 subsequent urine samples were collected, one for each of the 10 days after the day of dosing. total body water was calculated as the average of the linearly regressed isotope dilution spaces at time 0, correcting by 1.01 and 1.04, respectively, to account for the exchange of isotopes with nonaqueous components within the body. fat - free mass was then calculated by dividing body mass by the hydration factor of 0.747, with the difference between body weight and lean tissue equating to the fat mass (26). infants were assessed at a mean (sd) age of 4.25 (2.0) months. body length and weight were measured using a measuring board (cms weighting equipment ltd., london, u.k.) and a calibrated digital scale (seca ; ergonordic ab, bromma, sweden), respectively. body length was measured to the nearest 0.1 cm, and weight was measured to the nearest 1 g. air displacement plethysmography (peapod ; life measurement inc., concord, ca) was used to estimate (without clothing or diaper) fat mass and fat - free mass standardized by computing a z score by age and sex (mean 0, sd 1). gestational age- and sex - matched averages from the swedish population were used to standardize early infancy weight of the infants (27). a venous blood sample was drawn from the back of the infant s hand after a minimum 2 h without feeding. anesthetic cream was applied to the hand at the area of the blood draw 1 h prior to collection. samples were obtained in edta and serum tubes, immediately placed on ice, processed, and sent to the hospital clinical biochemistry laboratory for analysis or stored at 80c pending subsequent analyses. serum il-6 concentrations were determined using a high - sensitivity elisa kit (r&d systems, abingdon, u.k.). radioimmunoassay, validated against the commercially available linco assay, as previously described (28). serum glucose and insulin levels were measured at the clinical biochemistry laboratory at ume university hospital. serum glucose concentrations were analyzed using vitros 5, 1 fs chemistry system (ortho - clinical diagnostics, raritan, nj), and serum insulin concentrations were measured through a microparticle enzyme immunoassay (abbott imx ; abbott laboratories, abbott park, il). all infant continuous biologic and anthropometric variables were standardized by age and sex (z scores). rate of gestational weight gain in midpregnancy was calculated as the difference in weight from the 816-week prenatal visit prior to the study and the 2832-week study visit divided by the number of weeks between weight measurements. rate of gestational weight gain in late pregnancy was calculated in a similar way using the 2832- and 3641-week visits and dividing by the number of weeks between measurements. relationships between maternal characteristics and infant body composition, growth, and biochemical markers were evaluated using spearman correlations adjusted for maternal age, gestational age at measurement, and parity. correlation analyses, including measurements of midpregnancy rate of gestational weight gain, were additionally adjusted for gestational age at the first weight measurement ; correlations including measurements of late - pregnancy rate of gestational weight gain were additionally adjusted for gestational age at the last weight measurement. differences between infant measures by sex were evaluated using wilcoxon mann - whitney nonparametric tests. all analyses were performed using sas software (v9.2 ; sas institute, cary, nc). height (to the nearest 0.5 cm) and weight (to the nearest 0.1 kg) were measured at between 28 and 32 gestational weeks using a calibrated wall - mounted stadiometer and a calibrated digital scale (tanita corporation, tokyo, japan), respectively. maternal height and weight were also abstracted from medical records at weeks 816 and 3641. bmi was calculated by dividing weight (kg) by height squared (m) (kg / m). body composition (fat and fat - free mass) was estimated using the doubly labeled water method (25). participants were given a body weight dependent oral dose of stable isotopes (0.07 g h2o and 0.174 g h2o per kg body weight). a predose urine sample was collected prior to the administration of the oral dose, and 10 subsequent urine samples were collected, one for each of the 10 days after the day of dosing. total body water was calculated as the average of the linearly regressed isotope dilution spaces at time 0, correcting by 1.01 and 1.04, respectively, to account for the exchange of isotopes with nonaqueous components within the body. fat - free mass was then calculated by dividing body mass by the hydration factor of 0.747, with the difference between body weight and lean tissue equating to the fat mass (26). infants were assessed at a mean (sd) age of 4.25 (2.0) months. body length and weight were measured using a measuring board (cms weighting equipment ltd., london, u.k.) and a calibrated digital scale (seca ; ergonordic ab, bromma, sweden), respectively. body length was measured to the nearest 0.1 cm, and weight was measured to the nearest 1 g. air displacement plethysmography (peapod ; life measurement inc., concord, ca) was used to estimate (without clothing or diaper) fat mass and fat - free mass standardized by computing a z score by age and sex (mean 0, sd 1). gestational age- and sex - matched averages from the swedish population were used to standardize early infancy weight of the infants (27). a venous blood sample was drawn from the back of the infant s hand after a minimum 2 h without feeding. anesthetic cream was applied to the hand at the area of the blood draw 1 h prior to collection. samples were obtained in edta and serum tubes, immediately placed on ice, processed, and sent to the hospital clinical biochemistry laboratory for analysis or stored at 80c pending subsequent analyses. serum il-6 concentrations were determined using a high - sensitivity elisa kit (r&d systems, abingdon, u.k.). radioimmunoassay, validated against the commercially available linco assay, as previously described (28). serum glucose and insulin levels were measured at the clinical biochemistry laboratory at ume university hospital. serum glucose concentrations were analyzed using vitros 5, 1 fs chemistry system (ortho - clinical diagnostics, raritan, nj), and serum insulin concentrations were measured through a microparticle enzyme immunoassay (abbott imx ; abbott laboratories, abbott park, il). all infant continuous biologic and anthropometric variables were standardized by age and sex (z scores). rate of gestational weight gain in midpregnancy was calculated as the difference in weight from the 816-week prenatal visit prior to the study and the 2832-week study visit divided by the number of weeks between weight measurements. rate of gestational weight gain in late pregnancy was calculated in a similar way using the 2832- and 3641-week visits and dividing by the number of weeks between measurements. relationships between maternal characteristics and infant body composition, growth, and biochemical markers were evaluated using spearman correlations adjusted for maternal age, gestational age at measurement, and parity. correlation analyses, including measurements of midpregnancy rate of gestational weight gain, were additionally adjusted for gestational age at the first weight measurement ; correlations including measurements of late - pregnancy rate of gestational weight gain were additionally adjusted for gestational age at the last weight measurement. differences between infant measures by sex were evaluated using wilcoxon mann - whitney nonparametric tests. all analyses were performed using sas software (v9.2 ; sas institute, cary, nc). maternal and infant characteristics associations between rates of maternal weight gain during different periods in pregnancy and infant body composition are shown in fig. a : correlation between midpregnancy rate of maternal weight gain and infant body fat mass z score. b : correlation between midpregnancy rate of maternal weight gain and infant fat - free mass z score. c : correlation between late - pregnancy rate of maternal weight gain and infant body fat mass z score. d : correlation between late - pregnancy rate of maternal weight gain and infant fat - free mass z score. infant birth weight was positively correlated with late pregnancy weight gain (r = 0.40, p value = 0.02). infant birth weight was strongly correlated with infant fat - free mass at 4 months of age (r = 0.63, p value = 0.0002). infant fat - free mass was positively correlated with infant glucose adjusted for insulin (r = 0.42, p value = 0.04). as shown in table 2, maternal adiposity (bmi and fat mass) leptin, il-6, adiponectin, glucose adjusted for insulin, and insulin were weakly correlated with mid- and late pregnancy, although not statistically significant (refer to supplementary table 1). correlations between maternal and infant anthropometry and infant metabolic biomarkers infant birth weight was positively correlated with late pregnancy weight gain (r = 0.40, p value = 0.02). infant birth weight was strongly correlated with infant fat - free mass at 4 months of age (r = 0.63, p value = 0.0002). infant fat - free mass was positively correlated with infant glucose adjusted for insulin (r = 0.42, p value = 0.04). as shown in table 2, maternal adiposity (bmi and fat mass) was strongly inversely correlated with infant il-6 concentrations. leptin, il-6, adiponectin, glucose adjusted for insulin, and insulin were weakly correlated with mid- and late pregnancy, although not statistically significant (refer to supplementary table 1). correlations between maternal and infant anthropometry and infant metabolic biomarkers maternal obesity and elevated glucose concentrations during pregnancy increase the risk of type 2 diabetes in the offspring (19,29). little is known about the biological mechanisms underlying these relationships, although obesity in the offspring is thought to be an important mediating factor (7,19,30). here we aimed to elucidate the early life factors that are relevant to these processes by comparing maternal body composition and rate of weight gain during pregnancy with infant body composition and glucose and insulin concentrations. additionally, we sought to investigate the mediating role of adipokines as a secondary aim of this study. we have previously studied the relationship between maternal body composition during pregnancy and infant body composition at 4 months postpartum (24). to extend those observations, we examined whether infant adipokine (il-6, leptin, or adiponectin) concentrations impact this relationship and showed that maternal adiposity (bmi and fat mass) was strongly inversely related to infant il-6 concentrations at 4 months. infant fat - free mass was also inversely related to infant adiponectin concentrations (an insulin signaling cytokine) and positively related to glucose adjusted for insulin (table 2), suggesting that leaner infants may be less insulin sensitive. no significant associations were noted for leptin. although previous studies report a positive relationship between leptin concentration and maternal adiposity (17), in our study, no significant associations were noted for leptin at 4 months. although one possibility is that these associations disappear in early infancy, it could also be that our study is underpowered to test these associations. a novel finding in our study is that the rate of gestational weight gain at different periods in pregnancy is differentially associated with infant body composition at 4 months of age. the rate of weight gain in midpregnancy was strongly associated with infant fat mass, whereas the rate of weight gain during late pregnancy was strongly associated with infant fat - free mass. the former observation is supported by a study on prenatal fat development in 805 human embryos and fetuses, indicating that the gestational age between 14 and 29 weeks constitutes the critical window determining adipogenesis (32). the study provides histological evidence that adipose tissue differentiation occurs in early gestation between the 14th and 16th weeks of gestation and is then followed by fat - cell proliferation until the 23rd week of gestation, and any growth thereafter may be attributed to an increase in the size, and not in the number, of existing fat lobules (32). thus, it may be that early pregnancy, notably when fat formation occurs, is particularly susceptible to levels of signaling hormones present in the intrauterine milieu. a previous study that examined the rate of gestational weight gain and offspring body composition found that women who gained excessive amounts of weight (33) during pregnancy had offspring with greater adiposity at birth compared with the offspring of women who gained an appropriate amount of gestational weight (5). however, that study did not look at weight gain by trimester and only measured adiposity at birth and not at other time points during infancy. a study by davenport. (34) reported that weight gain in the first half of pregnancy is related to greater adiposity in the infant at birth. our findings add to this by showing that higher adiposity resulting from early pregnancy weight is still evident at 4 months. (30) examined gestational weight gain (per 400 g / week) during trimesters and later adiposity in the offspring at 9 years of age. in their study of 5,154 mother - offspring pairs, there was a positive association between gestational weight gain in early pregnancy (014 weeks) and offspring adiposity, and this association strengthened in mothers who had an average weight gain > 500 g / week. in mid- and late pregnancy (1436 weeks), however, the association between maternal weight gain and offspring adiposity was found only in mothers who gained > 500 g / week. there were also positive and linear associations between maternal weight gain in mid- and late pregnancy and adverse lipid and inflammatory profiles in the offspring at 9 years of age, which were reportedly mediated by offspring adiposity. the relationship of maternal characteristics and infant adipokines and inflammatory markers has previously been studied in fetal cord blood (35,36), but not to our knowledge in early infancy. in a study among 121 predominantly caucasian women, cord blood il-6 concentrations were significantly higher in obese mothers compared with lean mothers (35). by contrast, in a study among 20 mexican women, maternal adiposity was associated with lower cord blood il-6 concentrations (36). in our study, we found strong negative correlations between maternal midpregnancy bmi and adiposity and infant il-6 measured at approximately 4 months of age. in adults, elevated il-6 levels (around four- to fivefold higher than seen in the present study) have been associated with greater diabetes risk (37). yet, il-6 has pleiotropic roles and in muscle can lower glucose levels by promoting fatty acid oxidation and basal- and insulin - stimulated glucose uptake (38). although il-6 is known to induce insulin resistance by activating soc-3, a suppressor of cytokine signaling proteins that has been shown to inhibit insulin signaling, il-6 simultaneously recruits glut4 to the plasma membrane in muscle cells, thereby enhancing glucose uptake via a noninsulin - mediated pathway (39). moreover, the impact of il-6 on glucose regulation depends on the concentration and duration of exposure to il-6, as well as the presence of other molecules such as insulin and il-10, where chronic exposure to low - dose il-6 may result in adverse effects on insulin action (39,40). it may be that in our study of healthy infants, the net effect of il-6, at levels well below those seen in diseased adults, is opposite to its deleterious effect on glucose control previously observed in obese adults, such that il-6 at 4 months of age is associated with lower birth weight, lower glucose adjusted for insulin, and higher levels of insulin. we also found that infant adiponectin was negatively correlated with infant fat - free mass. previous studies have reported negative associations between early infancy growth (16) and infant length (31) and adiponectin. in our study, infant length and infant fat - free mass were strongly positively correlated (data not shown). it is possible that a mechanism similar to the one underlying the associations between infant length, growth, and adiponectin is behind the associations between infant fat - free mass and adiponectin observed here. although state - of - the - art techniques were used here to phenotype the study participants, our study is limited by its relatively small sample size, which makes it difficult to determine if a nonsignificant finding is truly negative. nevertheless, our study was adequately powered to test the primary hypotheses, in part because we used methods that are both precise and accurate. although a number of findings are nominally statistically significant and we tested a priori hypotheses that were informed by existing evidence, some of these findings will be sensitive to type 1 error owing to the multiple tests performed, which should be considered when interpreting the study s results. breast - feeding is well known to influence infant growth. at the time of the infant assessment, only 10% of the women were exclusively formula feeding their infants and 55% were exclusively breast - feeding. there were no significant correlations between infant feeding practice and growth, body composition, or adipokine levels, likely due to the small proportion of women who did not breast - feed their infants in this cohort. although it is likely that even in exclusively breast - fed infants, variation in the amount of milk consumed during feeding influences growth to some extent, we did not collect such detailed information in the current study. a further limitation of our study is that it is not possible using observational data such as ours to determine cause and effect, and the trials that have been published do not address the topics we have examined. additionally, although our data suggest that certain adipokines mediate the relationship of gestational weight gain and infant body composition, our study was underpowered to conduct formal mediation analyses. our findings suggest that timing of gestational weight gain impacts the development of muscle and adipose tissue in infant offspring. we also observed associations between maternal body composition and infant glucose and il-6 concentrations, and between infant fat - free mass and adiponectin levels, which may mediate the relationship of maternal gestational weight gain and infant body composition. | objectiveto investigate associations of maternal gestational weight gain and body composition and their impact on offspring body composition and adipocytokine, glucose, and insulin concentrations at age 4 months.research design and methodsthis was a prospective study including 31 mother - infant pairs (n = 62). maternal body composition was assessed using doubly labeled water. infant body composition was assessed at 4 months using air displacement plethysmography, and venous blood was assayed for glucose, insulin, adiponectin, interleukin-6 (il-6), and leptin concentrations.resultsrate of gestational weight gain in midpregnancy was significantly associated with infant fat mass (r = 0.41, p = 0.03) ; rate of gestational weight in late pregnancy was significantly associated with infant fat - free mass (r = 0.37, p = 0.04). infant birth weight was also strongly correlated with infant fat - free mass at 4 months (r = 0.63, p = 0.0002). maternal bmi and maternal fat mass were strongly inversely associated with infant il-6 concentrations (r = 0.60, p = 0.002 and r = 0.52, p = 0.01, respectively). infant fat - free mass was inversely related to infant adiponectin concentrations (r = 0.48, p = 0.008) and positively correlated with infant blood glucose adjusted for insulin concentrations (r = 0.42, p = 0.04). no significant associations for leptin were observed.conclusionstiming of maternal weight gain differentially impacts body composition of the 4-month - old infant, which in turn appears to affect the infant s glucose and adipokine concentrations. |
synchronization of these brain oscillations is feasible with the application of a novel brain stimulation technique, transcranial alternating current stimulation (tacs), in which alternating current of specified frequency entrains and enhances the brain rhythms to the corresponding frequency. previous studies suggested that working memory and executive function deficits in schizophrenia are associated with reduced low- and high - frequency electroencephalogram (eeg) activity. exogenously synchronizing the dorsolateral prefrontal cortex and posterior parietal cortex in phase with tacs frequency has been shown to enhance the working memory performance in healthy subjects. application of theta frequency (38 hz) stimulation over parietal region can increase the working memory load, and gamma frequency (> 30 hz) stimulation over frontal region can enhance the working memory processing. tacs, given its potential to modulate brain oscillations, is postulated to be useful in enhancing the working memory in patients with schizophrenia. moreover, the effect of tacs is known to be dependent on the state of the brain. application of a brain stimulation with the subject being concurrently engaged in a neuropsychological or a psychophysiological task is called online stimulation. a cognitive task known to activate a specific brain region (e.g., working memory task and prefrontal cortex) has been shown to change its susceptibility to neuromodulation ; hence, application of tacs to this brain region (i.e., prefrontal cortex) while it is engaged in a working memory task can potentially result in resonated effects. thus, further enhancement of neuromodulation in targeted brain region is feasible with online tacs. apart from a recent case report in obsessive compulsive disorder, we are unaware of any other description on the application of tacs in psychiatric population. moreover, there has been no report on the feasibility of online tacs in any psychiatric disorder. given the complexity of online tacs, in this report, we describe the successful application of this neuromodulatory paradigm in a schizophrenia patient who had significant cognitive deficits. p is a right - handed, 35-year - old male with an engineering degree diagnosed with paranoid schizophrenia (diagnostic and statistical manual of mental disorders 4 edition) with illness duration of 8 years. his symptoms were under partial remission with olanzapine 15 mg / day except for occasional auditory hallucinations. however, he reported significant cognitive deficits (digit symbol substitution test 203 s for 100 digits ; animal fluency test 8/min ; computerized n - back test the patient as well as his primary caregiver was provided with adequate information regarding the tacs procedure, and a video of the related procedural implementation was also shown ; following this, the patient agreed to participate in the tacs sessions. we adhered to the ethical principles for medical research involving human subjects as per the world medical association declaration of helsinki (http://www.wma.net/en/30publications/10policies/b3/). the electrodes (35 cm) were placed at the left dorsolateral prefrontal cortex (f3) and the left posterior parietal region (p3) according to 1020 system. two online tacs sessions (first session with theta frequency and second session with gamma frequency) were administered with an inter - session interval of 48 h using standard equipment (neuroconn dc stimulator plus, http://www.neuroconn.de/dc-stimulator_plus_en/) [figure 1a ]. during tacs, the subject performed computerized sternberg 's task that was presented using e - prime software (https://www.pstnet.com/eprime.cfm). in this task, the patient was shown random sequence of numbers (in sets of 2 or 4 consisting of a random combination of numbers from 0 to 9). each display sequence was followed by a blank screen for 2 s, following which a target numerical in red color was presented. (left arrow and right arrows in key board) to indicate whether the target digit has been presented in the preceding sequence set. once the patient responds, feedback will be given with or signs to indicate the correct and incorrect responses, respectively [figure 1b ]. the patient was familiarized with the sternberg 's task before the tacs session ; cognitive task was initiated after 2 min of initiation of tacs session. during the 20 min tacs session, the patient performed the sternberg 's task for 15 min (3 blocks of 5 min each with 1 min gap between each block). (b) schematic representation of sternberg 's task during transcranial alternating current stimulation sessions baseline eeg was acquired, and peak alpha frequency of 11 was noted in the posterior electrodes (o1, o2, p3, p4, pz, po7, and po8). as per the previous description, individual - specific stimulating theta frequency was determined to be 6 hz (stimulating theta frequency = individual peak alpha frequency 5). to determine the threshold of current strength, we applied tacs stimulation starting with 1 ma and increased the current strength stepwise by 0.25 ma up to a maximum of 2 ma. for every level of selected current strength, the stimulation was applied for 1 min (ramping up and down for 100 cycles). since the patient was able to tolerate all the levels of current strength, 20 min of sinusoidal tacs was given at 6 hz frequency at 2 ma current intensity without dc offset, a 0 relative phase, and impedance kept below 15 k. the intensity was gradually ramped up for initial 100 cycles (~16 s) and similarly ramped down during the termination to minimize the adverse effects. side effects were assessed using a structured questionnaire ; except for tolerable mild pricking sensation during the sessions. the second session of tacs was given after 48 h with a stimulation frequency of 40 hz. while determining threshold current intensity as described above, at levels above 1.5 ma, the patient experienced phosphenes left eye > right eye as well pricking sensations at the skin underneath the electrodes. hence, gamma tacs (40 hz frequency) at 1 ma was administered for 20 min ; all other parameters were kept similar to that of theta tacs session. the patient tolerated the session well with flickering sensation during the initiation and only mild pricking sensations during the stimulation. no other side effects such as pressure sensations were noted during or following the gamma tacs session. during both the tacs sessions, the patient was able to perform the sternberg 's task with fair attentiveness and without cognitive fatigue ; this was ascertained using a 10-point likert scale. the effect of tacs was assessed with computerized numerical n - back (0-, 1-, and 2-back) test and dual (position and color) 2-back test before the initiation and 20-min after the termination of each tacs session. we noticed improved accuracy of responses in 1-, 2-, and dual 2-back tests after theta tacs session (pre - tacs accuracy of 86.1%, 80.5%, and 9.5% ; post - tacs accuracy - 94.4%, 86.1%, and 16%, respectively). performances in gamma sessions remained unchanged in 1-, 2-, and dual 2-back tests (pre - tacs accuracy of 93.05%, 81.94%, and 25.5% ; post - tacs accuracy of 91.66%, 77.78%, and 25%, respectively). baseline eeg was acquired, and peak alpha frequency of 11 was noted in the posterior electrodes (o1, o2, p3, p4, pz, po7, and po8). as per the previous description, individual - specific stimulating theta frequency was determined to be 6 hz (stimulating theta frequency = individual peak alpha frequency 5). to determine the threshold of current strength, we applied tacs stimulation starting with 1 ma and increased the current strength stepwise by 0.25 ma up to a maximum of 2 ma. for every level of selected current strength, the stimulation was applied for 1 min (ramping up and down for 100 cycles). since the patient was able to tolerate all the levels of current strength, 20 min of sinusoidal tacs was given at 6 hz frequency at 2 ma current intensity without dc offset, a 0 relative phase, and impedance kept below 15 k. the intensity was gradually ramped up for initial 100 cycles (~16 s) and similarly ramped down during the termination to minimize the adverse effects. side effects were assessed using a structured questionnaire ; except for tolerable mild pricking sensation during the sessions. the second session of tacs was given after 48 h with a stimulation frequency of 40 hz. while determining threshold current intensity as described above, at levels above 1.5 ma, the patient experienced phosphenes left eye > right eye as well pricking sensations at the skin underneath the electrodes. hence, gamma tacs (40 hz frequency) at 1 ma was administered for 20 min ; all other parameters were kept similar to that of theta tacs session. the patient tolerated the session well with flickering sensation during the initiation and only mild pricking sensations during the stimulation. no other side effects such as pressure sensations were noted during or following the gamma tacs session. during both the tacs sessions, the patient was able to perform the sternberg 's task with fair attentiveness and without cognitive fatigue ; this was ascertained using a 10-point likert scale. the effect of tacs was assessed with computerized numerical n - back (0-, 1-, and 2-back) test and dual (position and color) 2-back test before the initiation and 20-min after the termination of each tacs session. we noticed improved accuracy of responses in 1-, 2-, and dual 2-back tests after theta tacs session (pre - tacs accuracy of 86.1%, 80.5%, and 9.5% ; post - tacs accuracy - 94.4%, 86.1%, and 16%, respectively). performances in gamma sessions remained unchanged in 1-, 2-, and dual 2-back tests (pre - tacs accuracy of 93.05%, 81.94%, and 25.5% ; post - tacs accuracy of 91.66%, 77.78%, and 25%, respectively). this case report offers preliminary support to the feasibility of implementing both theta- and gamma - online tacs in schizophrenia. given that tacs has the potential to modulate various perceptual and cognitive abnormalities in psychiatric population, it has promising applications in schizophrenia as well. however, we need systematic studies to optimize several tacs parameters (e.g., montage positions, stimulation frequency, current intensity, stimulation duration, state during the stimulation [resting / performing task / sleeping ], and phase difference across the stimulation sites). importantly, these parameters are also related to tolerance and different side effects associated with tacs. existing literature suggests that like other noninvasive brain stimulation techniques, tacs is safe and well tolerated ; the potential side effects involve skin perceptions, pressure sensations, and phosphenes, which are usually mild and tolerable. this is in tune with the observation that our patient was able to perform the task during the stimulation (online tacs), which encourages further systematic studies in schizophrenia. similarly, we also observed an improvement in accuracy in dual 2-back tasks than in other tasks. though the potential confounding influence of practice effect is a possibility, the task differential improvement (i.e., dual 2-back alone showing the improvement) as well as stimulation frequency - specific change (i.e., improvement occurring with theta, but not gamma frequency) in cognitive performance argues against this ; however, definitive interpretations on such effects can be done with examination of larger number of subjects in a sham - controlled design that involves multiple sessions. in summary, this case report highlights the feasibility and potential utility of online tacs as a new therapeutic tool in schizophrenia and this needs further systematic evaluation. noninvasiveness, safety, and ease of administration of tacs, in addition to this being a relatively less - expensive tool, make it a promising avenue toward targeting different symptom profiles including cognition in several psychiatric disorders including schizophrenia. this work is supported by the department of science and technology (government of india) research grant (sr / csi/158/2012) to gv and indian council of medical research young scientist research grant (dhr / hrd / young scientist / type - vi(2)/2015) to vs. ab is supported by the welcome trust / dbt india alliance. this work is supported by the department of science and technology (government of india) research grant (sr / csi/158/2012) to gv and indian council of medical research young scientist research grant (dhr / hrd / young scientist / type - vi(2)/2015) to vs. ab is supported by the welcome trust / dbt india alliance. | abnormalities in resting and event - related brain oscillations are known to be associated with cognitive deficits in schizophrenia. transcranial alternating current stimulation (tacs) modulates these rhythms across the neuronal circuits and could have a potential therapeutic role in psychiatric disorders. in this report, we describe, for the first time, application of online tacs in a schizophrenia patient with working memory deficits. this case report supports the feasibility and potential utility of online tacs in schizophrenia, which needs further systematic research. |
the paper entitled ' prolonged treatment with n - acetylcysteine delays liver recovery from acetaminophen hepatotoxicity ' by yang and colleagues, published in the previous issue of critical care, demonstrates that prolonged administration of n - acetylcysteine (nac) at 100 mg / kg in acetaminophen (apap)-induced liver failure in mice potentially limits hepatocellular regeneration. activation of a transcription factor, nuclear factor - kappa - b (nf-b), strongly linked to impairment of liver regeneration, is a putative mechanism for this. furthermore, the paper postulates that high doses of nac may interfere with normal metabolic processes of the liver, leading to impairment of its regenerative capacity. nac has been used since the 1970s, and it effectively manages apap poisoning by glutathione repletion if administered within 8 to 10 hours of ingestion of the overdose. in later years, clinical use of nac was extended to patients who present more than 10 hours after ingestion and to those with apap - induced acute liver failure (alf), and patients in such categories are routinely on nac infusions for many days, even weeks. the putative protective mechanisms of nac in late - apap poisoning and apap - induced liver failure remain poorly characterised but include free - radical scavenging, hemodynamic, and cytokine effects. concern has been expressed relating to its extended use in late presenters with apap poisoning and apap - induced liver failure because of the possibility of changed kinetics of nac in liver injury, reduced efficacy, and adverse hemodynamic changes (vasodilatation and increased cardiac index). this new study raises the issue of whether impairment of regeneration is also a clinical concern for extended nac use. a key issue in liver recovery after any acute injury is tissue repair and regeneration. such liver regeneration involves replication of mature parenchyma and non - parenchyma liver cells, which requires multiple cytokine and growth factor signalling pathways, including tumour necrosis factor - alpha, interleukin-6, hepatocyte growth factor (hgf), and transforming growth factor - alpha. inhibition of the transcription factor nf-b was shown to be associated with impaired liver regeneration and apoptosis of hepatocytes. nf-b is also demonstrated to be responsible for regulation of transcription of a cell cycle regulator cyclin d1. this new study in a mouse model demonstrates that nac, in doses similar to those used therapeutically to treat apap poisoning in humans, impairs liver regenerative capacity and that the effect is more pronounced when administered for a longer duration (that is, 72 versus 24 hours). the histopathological evidence of this effect was supported by the reduced nf-b dna binding in liver and decreased expression of cyclin d1. it is noteworthy that nac acting on apap - treated human hepatoma - derived cell hepg2 cell cultures was shown to have a protective effect against apap - induced oxidative damage but not from apoptosis. this evidence does support the findings of yang and colleagues, despite the species differences that could contribute to apap and nac metabolic pathways. the current clinical literature recommends the prolonged administration of nac in patients with apap - induced alf and in those who present late for medical care until evidence of improvement of the international normalised ratio or transplantation takes place. in this backdrop, the evidence by yang and colleagues raises two issues with respect to prolonged use of nac : first, whether prolonged nac use is potentially harmful by reducing liver regeneration in patients presenting late with apap poisoning, especially in those with apap - induced alf, and second, the issue of appropriate dosing and duration of nac treatment. the concept of tailor - making nac therapy to the apap - poisoned patient has been raised recently in the literature, and differing protocols of nac infusion are starting to be evaluated, albeit with study limitations. future research on apap - induced alf patients could be in the direction of monitoring for biomarkers (for example, sfas and hgf) for liver regeneration or apoptosis in order to establish whether there is a ' tipping point ' of risk / benefit after which nac infusion might be stopped. further research is also required to fully evaluate the impact of nac on cytokine systems controlling hepatocellular recovery. in the management of late presenters with apap poisoning and apap - induced liver failure, clinicians may have to consider individual case scenarios in tailor - making duration and dose of nac therapy. alf : acute liver failure ; apap : acetaminophen ; hgf : hepatocyte growth factor ; nac : n - acetylcysteine ; nf-b : nuclear factor - kappa - b. | since the 1970s, n - acetylcysteine (nac) has shown proven efficacy as an antidote for acetaminophen (apap) poisoning and apap - induced liver failure for early presenters. the current evidence of benefits of nac for late presenters is controversial because of the poor understanding of the mechanism of late toxicity. in the previous issue of critical care, yang and colleagues use a mouse model to demonstrate that nac in doses similar to those used therapeutically to treat apap poisoning in humans impairs liver regenerative capacity and that the effect is more pronounced when administered for a longer duration. studies based on cell cultures support this evidence. cytokine and growth factor signalling pathways are recognised to be involved in the process of liver regeneration and apoptosis. this research paper generates several issues related to the future management of apap - induced liver failure and research into the mechanism of toxicity, especially of late toxicity. |
in fact many analytical methods, employing different techniques, are being developed for evaluation of pharmaceutical preparations. vitamins of b group were well separated by rp - hplc. a method for the simultaneous determination of taurine and 10 water - soluble vitamins including vitamin b1 (thiamine), b2 (riboflavine), b5 (pantothenic acid), b6 (pyridoxine and pyridoxal), b8 (biotin), b9 (folic acid), c (ascorbic acid), and b3 (nicotinamide and nicotinic acid) in multivitamin tablets was developed and validated. some water - soluble vitamins of our interest (ascorbic acid, thiamine hydrochloride, riboflavine-5-phosphate sodium, pyridoxine hydrochloride, nicotinamide, and (+) -panthenol) and two preservatives (methylparaben and sodium benzoate) in multivitamin syrup were well - separated on zorbax sb - aq (c18) column. a hplc - uv method was established for the simultaneous determination of eight vitamins, including b1, b2, b3, b6, b9, cyanocobalamin, ascorbic acid in baby milk powder. a validated hplc - uv method for the determination of seven b - complex vitamins (b1, b2, b3, b6, b9, and cyanocobalamin) in pharmaceuticals and biological fluids after solid - phase extraction was performed. simultaneous determination of water- and fat - soluble vitamins in pharmaceutical preparations by hplc was performed in a single run using combined isocratic and linear gradient elution with a mobile phase consisting of trifluoroacetic acid and methanol. vitamins analyzed were b1, b2, b5, b6, b9, b3, and b12 (cyanocobalamin). the rp ion - pair hplc method was applied for determination of some vitamins of our interest in multivitamin with minerals from different authors. for nicotinamide, pyridoxine hydrochloride, thiamine mononitrate and riboflavine a hplc method a sensitive rp - hplc method was developed and validated for the simultaneous determination of b1, b3, b6, and b9 in pentovit coated tablets. the procedures were carried out on a supelcosil abz column with methanol, heptanesulfonic acid sodium salt, and triethylamine as the mobile phase. for the determination of thiamine and riboflavine in duoweiyuansu tablet an hplc - uv method was established. the mobile phase consisted of ion - pairing reagent (containing 1-hexanesulfonate, glacial acetic acid, and triethylamine)/methanol (80 : 20). the method can be used for the quality control of thiamine and riboflavine in duoweiyuansu tablet. there are many papers about vitamins of b group analysed by capillary electrophoresis (ce) and its modifications. some authors studied determination of vitamins in food based on supercritical fluid extraction prior to micellar electrokinetic capillary chromatographic (mekc) analyses of individual components. the method was optimized using sodium cholate as the micellar phase for the separation of 11 b - vitamins, ascorbic acid, and 4 impurities in about 25 min. other authors investigated in capillary zone electrophoresis (cze) analysis the effect of lower organic alcohols as cosurfactants (methanol, ethanol, n - propanol, isopropanol, propanediol, n - butanol and isoamyl alc.) and n - hexane as an organic modifier in phosphate buffer with varying sds concentration using a set of vitamins and p - hydroxybenzoic acid as the test mixture. the cze analyses of three vitamins (b1, b2, and b6 in tablets achieved using phosphate - borate buffer ph 9.0 short time of analysis (5 min). one year later the same authors studied another specific, precise, sensitive, and accurate method for separation of the same vitamins obtaining high separation efficiency and shorter analysis time (3 min). four b vitamins, as b1, b2, pyridoxal, pyridoxine, and pyridoxamine (b6) in a pharmaceutical product were determined simultaneously using cze. an hcl soln. was used for the extraction of the vitamins from a multivitamin - multimineral tablet. mixture of four water - soluble b - group vitamins were analysed both by cze and meck. the quantitative analyses of different pharmaceutical formulations were compared with the lc method of the us pharmacopeia obtaining a good correlation. rapid methods were developed for simultaneously separation of five vitamins : b1, b2, b6, nicotinamide, nicotinic, and ascorbic acid. they were tested on 15 real samples obtaining good resolution by (cze) and (mecc). cze was performed with 0.02 m borate buffer, while mecc in 0.02 m borate / phosphate buffer with 4% acetonitrile containing. some authors studied a method for the analysis of six water - soluble vitamins (thiamine, nicotinamide, riboflavin, pyridoxine, pantothenic, and ascorbic acid) in a pharmaceutical formulation, by cze. a good compromise between resolution, analysis time, and analyte stability this cze method was very useful for the separation of more complex samples, but cyanocobalamin could not be separated from nicotinamide in this cze system. good results with respect to linearity, precision, and accuracy were obtained in the concentration range studied for the 6 vitamins. spectrophotometric determination of ternary mixtures of thiamine, riboflavin, and pyridoxal in pharmaceutical and human plasma by least - squares support vector machines were performed. the partial least squares (pls) modelling and least - squares support vector machines were used for the multivariate calibration of the spectrophotometric data. the same procedure was applied successfully for determination of b1, b2, b3, and b6 in pharmaceuticals by other authors. simultaneous determination of fourteen water - soluble vitamins (13 of b - group and vitamin c) in selected food matrices by lc / ms / ms technique is described in a recent paper. analytes were separated in less than 10 min with recoveries between 30% and 70%. the qc process in pharmaceutical industry needs methods that are able to determine, in a single run, the majority of components. in many cases, to determine all components of a multivitamin pharmaceutical preparation, it is necessary to perform different analyses applying different techniques. capillary electrophoresis (ce) is a powerful analytical technique that is widely used in research, and in quality control of pharmaceuticals. as demonstrated exploring the literature data, the mekc was the only method able to separate up to 11 b - group vitamins. other ce methods offer the possibility to separate only a few (max 5) molecules of this class. there are no publications about simultaneous determination of nine b - group vitamins by cze, the simplest in ce system, which offers several advantages over hplc such as rapid analysis, lower solvent consumption, then lower costs and minor environmental impact, and higher efficiency. for this purpose, the aim of this work is to develop a validated cze method for assay of a multicomponent pharmaceutical and veterinary formulations in routine analysis. the analyses were carried out on a p / ace system from beckman instrument fullerton, ca (usa), with a uv - dad detector. for ruggedness evaluation, electrophoretic separations were carried out on the spectraphoresis 1000 instrument from thermo - quest corporation, ca (usa). the uncoated fused silica capillary i d = 50 m, 59.5 cm total length and 49.5 cm effective length was supplied by sge (melbourne, australia). the sample injections were performed in a hydrodynamic mode (5 s under 0.5 psi). all reagents were of analytical grade purity. borax, disodium hydrogen phosphate dihydrate, sodium dihydrogen phosphate monohydrate, potassium chloride, and ctab (cetyl trimethylammonium bromide) were from fluka (buchs, switzerland). phosphoric acid, sodium hydroxide, chloric acid, and acetonitrile were supplied by carlo erba (milan, italy). sodium bicarbonate, citric acid, oxalic acid, and sodium bitartrate monohydrate were from sigma - aldrich (steinheim, germany). the real samples were commercially available pharmaceutical products : berocca plus (bayer s.p.a), gabbrovital b forte (ceva vetem spa), trinidex (ldb lab.diaco biomedicali spa), and biochetasi (sigma - tau spa). for solution filtering the syringe filters 0.45 m (thiamine hydrochloride (b1), thiamine pyrophosphate chloride (b1a), riboflavine (b2), riboflavine-5monophosphate (b2a), nicotinamide (b3), d - pantothenic acid calcium salt (b5), pyridoxine hydrochloride (b6), biotin (b8), folic acid (b9), b10 (4-aminobenzoic acid), cyanocobalamin (b12), hydroxocobalamin (b12a), and 2 - 3 dihydroxybenzoic acid were purchased from fluka (buchs, switzerland). standard stock solutions of studied analytes (at 1 mg / ml concentration) were prepared in distilled water, riboflavine and folic acid were dissolved in hcl, respectively, 3 m and 2 m. the calibration solutions were obtained by dilution of the stock solution with distilled water to give a desired analyte concentration. the quantity of powder equivalent at one tablet was weighted and dissolved in a 50 ml volumetric flask with distilled water. after sonication for 10 min in an ultrasonic bath, the supernatant solution was centrifuged for 5 min and then filtered through the 0.45 m syringe filter. finally the solution was diluted with distilled water to reach a concentration order inside the calibration range. for trinidex sample, the intravenous injection solution was filtered through the 0.45 m syringe filter without dilution and injected. for gabbrovital preparation, the veterinary intramuscular injection solution was diluted 1 : 1000 because of its high concentration, then filtered and analysed. for biochetasi sample, the powder contained in the vial for the intramuscular injection, was diluted with distilled water to reach a desired concentration and then filtered through the 0.45 m syringe filter. in order to propose a suitable method for routine analysis, it was necessary to evaluate the experimental conditions for the best resolution of studied analytes. first, because of different solubility and stability for each vitamin, many conditions for their dissolution were tested. several parameters for the cze analysis, such as bge composition and concentration, ph, injection conditions, wavelengths, applied voltage, and temperature were explored. the bge buffer composition is one of the most important parameters in capillary electrophoresis. in order to obtain maximum precision level, it is necessary to choose the buffer very carefully. most of vitamins are nitrogen - containing, protonable molecules, so starting point of this work was to explore the low range of ph values for their separation. in the preliminary step of study, the bges tested ph ranging between 1.54.2 and concentration ranging between 20 mm to 50 mm, are hcl / kcl, phosphate, phosphate - oxalate, phosphate with 5% acetonitrile, phosphate with ctab, phosphate - tartrate, and tartrate. only in 20 mm phosphate buffer at ph = 2.3 good separation of eleven analytes was realised in about 23 minutes. in figure 1, analytes from 1 to 7 are cations, the others (810) are in anionic form. in these operating conditions, riboflavine (b2) and cyanocobalamin (b12) are overlaid. since these compounds are often contained in the same pharmaceutical preparation, it is impossible to determinate both of them. long analysis time, high intensity of current, and low repeatability of migration time (rsd% ~ 10%) did not allow to propose this procedure for routinely analyses. bge buffers at ph between 8.5 and 9.3 into the range of concentration 20 mm to 80 mm were explored : tris / hcl, bicarbonate / carbonate, tris / borate, borate, borate with edta, and borate with ctab. best separation of nine vitamins was realized in 20 mm borate buffer at ph 9.2 in about 9 minutes (figure 2). the peaks are symmetric and baseline resolved for individual b vitamins with exception of d - pantothenic acid calcium salt (b5) and riboflavine-5monophosphate (b2a), that are coeluted. since a good compromise between peak symmetry, resolution, and analysis time resulted in 20 mm borate buffer at ph = 9.2, these experimental conditions were chosen as optimal. primarily it was necessary to select the most suitable wavelength for the simultaneous detection of vitamins, since spectral properties of each one differs enough. the uv spectra obtained by uv - dad show three suitable wavelengths for quantitative analysis. 214 nm for all the vitamins, at exception of d - pantothenic acid calcium salt (b5) and riboflavine-5monophosphate (b2a), that are overlaid. then the quantitative analysis of these two analytes was realized at the wavelengths of 190 and 260 nm, because the considered compounds do not interfere themselves. in fact vitamin b5 has only maximum of absorbance at 190 nm, while vitamin b2a presents two maximums at 214 and 260 nm. for the optimization of separation voltage the analyses ranging the applied voltage between 10 and 30 kv were carried out. at low voltage the separation of all the analytes was reached but the analysis time increased to 20 min with the broadening of peaks. increasing the voltage (max 30 kv) the optimal value results in 20 kv producing the current intensity of 25 ua and good repeatability. at 30 the increase of temperature (30c) produced the shortening of analysis time (the viscosity of the bge decrease). it should be advantageous setting high temperature of cartridge but b - complex is thermolabile. the precision was evaluated in terms of rsd% of migration time (t m) and corrected peak area (a c) for intraday and interday analyses. for the intra - day precision evaluation the standard solutions at three concentrations levels (low, intermediate, and high) were injected in the same day. to estimate the interday precision, the standard solutions were analysed for five consecutive days performing five consecutive injections every day. the linearity of detector response was tested in different ranges as reported in table 2. for the quantitative analysis six standard solutions, containing nine analytes of interest and the internal standard, were injected in triplicate. the calibration lines were obtained plotting r (corrected areas ratio) versus the standard solutions concentration using microsoft excel. lod, the lowest concentration of analytes that can be distinguished from the noise, defined as signal to noise ratio s / n of 3 : 1 was ranging between 0.9 g / ml to 9.0 g / ml. loq, the lowest concentration of analytes that can be quantified with good precision, defined as signal to noise ratio s / n of 10 : 1 was ranging between 3.0 g / ml to 30.0 g / ml. rsd% of migration time and corrected peak area values were lower, respectively, than 0.5% and 3.0%. a typical electropherogram of commercial pharmaceutical preparation (berocca plus) is shown in figure 3. after fortification, the real sample undergo the analysis and the resulted concentration were compared with the data obtained without fortification. for this purpose, measurements on the spectraphoresis 1000 apparatus in the optimal experimental conditions were performed. in this instrument the cartridge form is different and the capillary total length is 44 cm, the effective length 36 cm (shorter than optimal length of capillary utilized on the beckman instrument). consequently, on this instrument, it was necessary to apply lower voltage (10 kv). the electropherogram, obtained on this apparatus, injecting the standard mixture in hydrodynamic mode for 1 sec, is shown in figure 4. proposed method was developed for the simultaneous determination of nine water - soluble vitamins (b1, b1a, b2, b2a, b3, b5, b6, b9, and b10) in the multivitamin pharmaceutical formulations by cze. the best resolution was obtained in about 9 min using a simple tetraborate buffer 20 mm, ph = 9.2 at 25c, and constant voltage of 20 kv in uncoated fused silica capillary. the method is suitable for the vitamins b analysis as the validation confirmed : it is precise, accurate, and rugged. the analyses of real samples proved its applicability. since no expensive reagent and no pretreatment of samples are required in this procedure, it offers a valid alternative for quality control analysis in the pharmaceutical industry. | a competitive cze method for quality control analysis of multivitamin preparations and veterinary products containing b - group vitamins was developed. vitamins of interest are thiamine hydrochloride (b1), thiamine monophosphate chloride (b1a), riboflavine (b2), riboflavine-5monophosphate (b2a), nicotinamide (b3), d - pantothenic acid calcium salt (b5), pyridoxine hydrochloride (b6), folic acid (b9), and 4-aminobenzoic acid (b10). these analytes were separated optimizing the experimental conditions in 20 mm tetraborate buffer ph = 9.2 as a bge (background electrolyte), on a beckman p / ace system mdq instrument, using uncoated fused silica capillary. the effective capillary length was of 49.5 cm, i.d. = 50 m, the applied voltage 20 kv and the temperature 25c. detection was performed by a diode array detector at 214 nm for all vitamins except b5 (190 nm) and b2a (260 nm). separation time was about 9 min. after experimental conditions optimization, the proposed method was validated. precision of migration time and corrected peak area, linearity range, lod and loq, accuracy (recovery), robustness, and ruggedness were evaluated for each analyte demonstrating the good reliability of the method. analyses of the pharmaceutical real samples were performed and confirmed the versatility of this method. |
tissue engineering, with significant research inputs over the last decades, has emerged as a potential tool to regenerate damaged and diseased tissues. as one of the key components in tissue engineering approach, growth factors provide chemical cues to stem cells, regulating their biological responses and tissue differentiation. while the basic biological functions of growth factors and their endogenic roles in tissue development and repair process have relatively been well studied, the use of growth factors in tissue engineering regime has recently gained great interest. growth factors are a potential agent to target specific tissue reactions because of their regulatory roles in cellular functions, including adhesion, proliferation, migration, and differentiation in the epithelium, bone, and soft connective tissues and nerves. fibroblast growth factor (fgf) is a representative growth factor which has shown the potential effects on the repair and regeneration of tissues [26 ]. it was originally identified as a protein capable of promoting fibroblast proliferation and is now known to comprise 22 members. fgfs exert multiple functions through the binding into and activation of fibroblast growth factor receptors (fgfrs), and the main signaling through the stimulation of fgfrs is the ras / map kinase pathway. with their potential biological functions, fgfs have been utilized for the regeneration of damaged tissues, including skin, blood vessel, muscle, adipose, tendon / ligament, cartilage, bone, tooth, and nerve. then, the prospective source of fgf for the tissue regeneration is used with recombinant human fgf family. in fact, many previous studies administered the fgfs directly to the wound sites, like other growth factors. however, free - fgfs are readily degradable in vivo, leading to loss of biological activity and functions [79 ]. to gain satisfactory performance, fgfs are adsorbed onto or encapsulated within materials to secure biological activity in a sustained and controllable manner. although many types of materials have been developed to carry fgfs and elicit their therapeutic efficacy in vitro and in vivo, more sustained, controlled, and targeted delivering system still remain a challenge. here, we review the cellular biology of fgfs and their functions in cell proliferation, migration, differentiation, and angiogenesis and address the current development of biomaterials - based delivery systems of fgfs and their applications for tissue regeneration, including skin, blood vessel, muscle, adipose, tendon / ligament, cartilage, bone, tooth, and nerve. fgf, which was first discovered in pituitary extracts in 1973, is widely expressed in cells and tissues. acidic fgf (fgf1) and basic fgf (fgf2) were originally isolated from the brain and pituitary gland as growth factors for fibroblasts. since then, at least 22 distinct fgfs have been identified or isolated. many fgf genes have been identified in vertebrates, including ten fgfs in zebrafish (fgf24, 6, 8, 10, 17a, 17b, 18, 24), six in xenopus (fgf24, 810), 13 in chickens (fgf14, 810, 12, 13, 16, 1820), 22 in mice (fgf118, 2023) and humans (fgf114, 1623), whereas only three drosophila fgf genes and two caenorhabditis elegans fgf genes have been observed in invertebrates. human fgfs contain 22 members : fgf1, fgf2, fgf3 (int2), fgf4, fgf5, fgf6, fgf7 (kgf), fgf8 (aigf), fgf9, fgf10, fgf11, fgf12, fgf13, fgf14, fgf16, fgf17, fgf18, fgf19, fgf20, fgf21, fgf22, and fgf23. four family members do not bind with fgfr as fgf homologous factors (fgf11, fgf12, fgf13, and fgf14) and are more correctly referred to as fgf homologous factors. in addition, there is no human fgf15 gene ; the gene orthologous to mouse fgf15 is fgf19. by phylogenetic analysis, the human fgf gene family can be divided into seven subfamilies : fgf1, fgf4, fgf7, fgf8, fgf9, fgf11, and fgf19 (figure 1). the fgf1, fgf4, fgf7, fgf8, fgf9, fgf11, and fgf19 subfamilies comprise fgf1 and 2, fgf4, 5, and 6, fgf3, 7, 10, and 22, fgf8, 17, and 18, fgf9, 16, and 20, fgf11, 12, 13, and 14, and fgf19, 21, and 23, respectively. in contrast to phylogenetic analysis, gene location analysis indicates that the human fgf gene family can be divided into six subfamilies : fgf1/2/5, fgf3/4/6/19/21/23, fgf7/10/22, fgf8/17/18, fgf9/16/20, and fgf11/12/13/14. members of the fgf8, fgf9, and fgf11 subfamilies are similar to those of the fgf7/10/22, fgf8/17/18, fgf9/16/20, and fgf11/12/13/14 subfamilies in the gene location analysis. the molecular weight of fgfs in vertebrates varies from 17 to 34 kda, while the drosophila fgf is 84 kda. all members of the family share a conserved sequence of 120 amino acids that show 16%65% sequence identity. fgfs have various biological functions both in vivo and in vitro, including roles in mitogenesis, cellular migration, differentiation, angiogenesis, and wound healing. fgfs exert their physiological roles through binding fgfr and regulate developmental pathways, controlling events such as mesoderm patterning in the early embryo through development of multiple organ systems. the mammalian fgf family is composed of 18 ligands that elicit their actions through four highly conserved transmembrane tyrosine kinase receptors (fgfr1, fgfr2, fgfr3, and fgfr4). four fgfrs have been identified in humans and mice and encode receptor tyrosine kinases (ca. 800 amino acids) that contain an extracellular ligand - binding domain with three immunoglobulin domains (i, ii, and iii), a transmembrane domain, and a split intracellular tyrosine kinase domain. fgfrs are expressed on many different cell types and regulate key cell behaviors, such as proliferation, differentiation, and survival, which make fgf signaling susceptible to subversion by cancer cells. unlike other growth factors, fgfs act in concert with heparin or heparan sulfate proteoglycan (hspg) to activate fgfrs and induce the pleiotropic responses that lead to a variety of cellular responses induced by this large family of growth factors. several germline fgf mutations have been identified in human disease, including loss - of - function mutations, and gain - of - function mutations. for instance, loss - of - function in fgf3 is involved with hereditary deafness, leading to total inner ear agenesis in humans. degradation of fgf8 by loss - of - function leads to kallmann 's syndrome (kal1), a developmental disorder characterized by anosmia and hypogonadism. fgf10 loss - of - function causes lacrimo - auditory - dento - digital (ladd) syndrome, which is characterized by hearing loss, dental anomalies, and lacrimal and salivary gland hypoplasia. gain - of - function mutations in fgf23 have been identified in hypophosphataemic rickets. table 1 summarizes the location, receptor, and therapeutic application of the fgf family. activated fgfrs mediate signaling by recruiting specific molecules that bind to phosphorylated tyrosine at the cytosolic part of the receptor, triggering a number of signaling pathways leading to specific cellular responses. these then serve as docking sites for the recruitment of sh2 (src homology-2) or ptb (phosphotyrosine binding) domains of adaptors docking proteins or signaling enzymes. signaling complexes are formed and recruited to the active receptors resulting in a cascade of phosphorylation events. the best understood pathways are the ras / map kinase pathway, pi3 kinase / akt pathway, and plc pathway. figure 2 schematically describes the three pathways of the fgf signal, the ras / map kinase pathway, pi3 kinase / akt pathway, and plc pathway. mitogen - activated protein (map) kinases are serine / threonine - specific protein kinases that respond to extracellular stimuli (mitogens) and regulate various cellular activities such as gene expression, mitosis, differentiation, and cell survival / apoptosis. c - jun n - terminal kinase (jnk), extracellular signal regulated kinase (erk), and p38 mitogen - activated kinase are examples of effectors map kinase. interestingly, the activation of erk 1/2 and p38 in response to fgf has been observed in all cell types, while the activities of other signal transduction pathways vary depending on the cell type. to date, the main pathway of the fgf signal is the ras / map kinase pathway, which contains many signaling proteins. a key event in the fgf signaling pathway is phosphorylation of the tyrosine residues of the docking protein, fibroblast growth factor receptor substrate 2 (frs2), which provides new binding sites for direct or indirect recruitment of proteins that are responsible for both activation and attenuation of signaling [23, 24 ]. frs2 recruits a complex consisting of an adaptor protein, the guanine nucleotide exchange factor 2 (grb2), the son of sevenless (sos), the tyrosine phosphatase (shp2), and the docking protein, grb2-associated binding protein 1 (gab1). formation of the frs2 signaling complex results in activation of ras / map kinase as well as pi3 kinase / akt pathways. the ras - map kinase pathway has been implicated in cell growth and differentiation in many studies. lax. showed that fgf signals induce a map kinase mediated negative feedback loop that causes threonine phosphorylation of frs2a, leading to a reduction of its tyrosine phosphorylation and decreased recruitment of grb2. receptor tyrosine kinases also induce negative signals via activation of the sprouty proteins that inhibit the recruitment of grb2-sos complexes to frs2 and the receptor and attenuate the ras - map kinase pathway. members of the sef and map kinase phosphatase families are other negative modulators of fgf signaling, while xflrt3, a member of a leucine - rich - repeat transmembrane protein family, is a novel positive modulator. expression of xflrt3 is induced by fgf and down - regulated after inhibition of fgf signaling. thus, fgf signaling is modulated by both positive and negative mechanisms, and subtle modulations in the signal are important determinants of the biological response during development. similar to the ras / map kinase pathway, the phosphoinositide 3 (pi3) kinase / akt pathway is initiated by forming an frs2 signaling complex. gab1 consists of a pleckstrin homology domain, a proline - rich region, and multiple tyrosine phosphorylation sites that serve as binding sites for the sh2 domains. the p110 catalytic subunit of pi3 kinase is in a complex with an adaptor protein (p85) that has two sh2 domains ; thus, p85 binds to phosphorylated tyrosine residues in gab1 adaptor protein. phosphoinositide - dependent kinase and the anti - apoptotic protein kinase akt are activated downstream of the pi3 kinase. the pi3 kinase / akt pathway is implicated in cell survival and cell fate determination, as well as the pi3 kinase / apkc signaling cascade in cell polarity control.. showed that gab1 is required for stimulation of the akt pathway by fgf. one of the target molecules for activated fgfr is phospholipase c gamma (plc), which binds to the phosphorylated tyr-766 of the receptor and then becomes tyrosine phosphorylation of plc, resulting in plc activation. activated plc hydrolyzes phosphatidylinositol, generating inositol triphosphate (ip3) and diacylglycerol (dag). ip3 is a cellular second messenger that facilitates the release of calcium from the endoplasmic reticulum. increased levels of calcium in the cytosol and dag together activate protein kinase c (pkc). the physiological relevance of this pathway is not obvious since its disruption does not abolish either mitogenesis or cell differentiation. however, some data indicate that it may be necessary for adhesion, at least in some cell types. as stated above, fgfs exert their physiological roles by binding to high affinity tyrosine kinase fgfrs on the surface of the target cell. therefore, the function of fgfs depends on the fgf signal pathway between the fgf family and fgfrs. many studies have reported that fgfs have functions such as cell proliferation, migration, differentiation, and angiogenesis in various cells and tissues. cell proliferation by fgfs has been reported in many cell types, including endothelial cells, stem cells, and epithelial cells. fgf1 is a proliferative factor for human preadipocytes that may be important to the overall regulation of human adipogenesis. in addition, fgf1 leads to an increase in the proliferation of iec-6, caco-2, and ht-29 cell lines with fgf2 and fgf7. fgf2 induces cell proliferation after flia - specific gene transfer in mice and stimulates the proliferation and survival of neuroepithelial cells isolated from the telencephalon and mesencephelon of e10 mice. fgf4 knockout mouse embryos experience postimplantation lethality owing to the necessity of fgf4 for trophoblast proliferation. fgf10 play a role in the pathogenesis of prostate cancer via facilitation of epithelial cell proliferation. fgf18 has also been shown to stimulate the proliferation of cultured mouse primary osteoblasts, osteoblastic mc3t3-e1 cells, primary chondrocytes, and prechondrocytic atdc5 cells, although it inhibited the differentiation and matrix synthesis of these cells. tissue formation during embryonic development, wound healing, and immune responses all require the orchestrated movement of cells in particular directions to specific locations. cells often migrate in response to and toward specific external signals in a process known as chemotaxis. apparently, both fgf1 and fgf2 play important roles in the migration of cochlear ganglion neurons in mice. fgf2 induces cell migration after flia - specific gene transfer in mice and stimulates cell migration of mouse embryonic limb myogenic cells such as fgf4. fgf7 is known to stimulate migration and plasminogen activity (pa) of normal human keratinocytes. similar to fgf2, fgf8 is a potent chemoattractant in the migration of mesencephalic neural crest cells. in developmental biology, cellular differentiation is the process by which a less specialized cell becomes a more specialized cell type. differentiation occurs numerous times during the development of multicellular organisms as they change from a single zygote to a complex system of tissues and cell types. specifically, adult stem cells divide and create fully - differentiated daughter cells during tissue repair and normal cell turnover. differentiation dramatically changes the size, shape, membrane potential, metabolic activity, and responsiveness of a cell to signals. fgf1 and fgf2 play important roles in the initial differentiation of cochlear ganglion neurons in mice. fgf7 is essential for the morphogenesis of suprabasal keratinocytes and establishment of the normal program of keratinocyte differentiation. exogenous fgf20 stimulates the differentiation of monkey stem cells into dopaminergic neurons after treatment in vitro. angiogenesis is the process of the formation of new blood vessels from pre - existing vessels. this process plays a key role in various physiological and pathological conditions such as embryonic development, wound repair, inflammation, and tumor growth. angiogenesis is a multistep process that begins with the degradation of the basement membrane by activated endothelial cells that migrate and proliferate, leading to the formation of solid endothelial cell sprouts into the stromal space. next, vascular loops are formed and capillary tubes develop with the formation of tight junctions and deposition of new basement membrane. numerous inducers of angiogenesis have been identified, including members of the vascular endothelial growth factor (vegf) family, angiopoietins, transforming growth factor - alpha and -beta (tgf - alpha and beta), platelet - derived growth factor (pdgf), tumor necrosis factor - alpha (tnf - alpha), interleukins, chemokines, and members of the fibroblast growth factor (fgf) family. however, only a limited number of the 22 members of the fgf family have been investigated for their angiogenic potential in vitro and in vivo. specifically, fgf1 and fgf2 induce the promotion of endothelial cell proliferation and the physical organization of endothelial cells into tube - like structures. fgf1 and fgf2 are more potent angiogenic factors than vascular endothelial growth factor (vegf) or platelet - derived growth factor (pdgf). due to their specific biological functions and roles, fgfs have the potential for application to induce the regeneration of a wide spectrum of tissues, including skin, blood vessel, muscle, adipose, tendon / ligament, cartilage, bone, tooth, and nerve tissues. indeed, many previous studies have evaluated the administration of fgfs directly to the sites of wounds, similar to that of other growth factors. however, when free fgf solutions are injected in vivo, they rapidly lose their biological functional activity, primarily due to diffusional loss and/or enzymatic inactivation / degradation [79 ]. therefore, to gain satisfactory performance, a large amount of fgfs with a continuous dose for the determined period is required. conversely, when fgfs are adsorbed onto or encapsulated within materials, their degradation risk can be largely protected while securing the biological activity. therefore, to make full use of the fgfs, it is essential to develop appropriate materials and substrates to contain and deliver them to defective regions, after which allowing their release at a controllable and sustainable rate. a wide range of biomaterials including synthetic and natural polymers and even tissue matrices have been studied as candidate materials to carry fgfs and elicit their therapeutic efficacy in vitro and/or in vivo. while their functional activity has been demonstrated in different types of cells in vitro and/or target tissues in vivo, there have been relatively few, if any, reports addressing the delivery mechanism. in this part, we review the applications of fgfs in concert with medical materials for tissue regeneration. specific targets include skin, cartilage, bone, blood vessel, muscle, tendon / ligament, and nerve. the materials are developed to specifically conjugate with fgfs or encapsulate within the structure and are engineered in the form of hydrogels or porous scaffolds or nano- and microparticulates. generally, the most common scaffold materials range from polymers (synthetic or natural) and ceramics to their composites, which can be chosen depending on the target tissues of concern. many natural polymers such as collagen, alginate, fibrin, silk, chitosan, and glycosaminoglycans (gags) are biologically well defined, tissue compatible, and degradable ; therefore, they are regarded as feasible materials for the intake of growth factors within the structures. such polymers are easily engineered into porous scaffolds by dissolution in water - based solutions and subsequent freeze - drying [63, 64 ]. because they dissolve well in water, when incorporated within the structure, growth factors are released through the scaffold when they come into contact with the fluid. in most cases, bulk diffusion is the dominant method of releasing growth factors, which is led by water permeation and can be accelerated by collapse of the polymer network. due to their comprising a class of proteins or polysaccharides, natural polymers contain a large number of ionic groups. apart from chitosan, which is highly positively charged, all of the other proteins mentioned above preserve a large number of negatively charged groups. therefore, depending on their charge characteristics (basic or acidic), fgfs can form charge - charge interactions with natural polymers. in such cases, the fgf - incorporated scaffolds show sustained and long - term delivery of fgfs if their structure is maintained without collapse [65, 66 ]. more specific biochemical interactions between the fgfs and natural proteins are favored in maintenance of the stability of fgfs, which can be exploited by utilizing some binding sites of fgfs, such as the heparin binding site [8, 67, 68 ]. collagen scaffolds mixed with heparin hold fgf2 within the structure better than scaffolds without heparin, which is beneficial for long - term fgf delivery. hydrogel - type scaffolds that absorb a high level of water within their pore structure and are mechanically meta - stable gel matrices will be discussed separately in the following section. synthetic polymers primarily those that are degradable, such as poly(lactic acid), poly(glycolic acid), poly(caprolactone), and their copolymers have also been well developed into porous scaffolds by many possible processing routes. unlike natural polymers, this class of polymers can be dissolved in nonaqueous organic solvents that would otherwise melt at elevated temperatures, and most growth factors, including fgfs, are very susceptible to degradation when incorporated during the scaffold processing stages. therefore, surface modification of the scaffolds is recommended to carry the growth factors. through chemical treatment of the surface of synthetic polymers such as amination or carboxylation, growth factors can be covalently coupled via the formation of an amide linkage [70, 71 ]. however, in such cases, growth factors are only on the scaffold surface, which limits the continual biological action of fgfs and long - term targeting while influencing the initial adhesive reactions of cells. apart from the polymer groups, bioceramics are promising candidate materials for grafting defects of hard tissues, such as bones and teeth [7279 ]. many publications and clinical trials have already demonstrated the high performance of some bioceramics including calcium phosphates and bioactive glasses / glass ceramics [73, 77, 79 ]. therefore, for hard tissue regeneration, there is a potential need to use bioceramics in concert with growth factors including fgfs, leading to some pioneering studies on the incorporation of fgfs within bone grafts [80, 81 ]. however, most currently applicable bioceramics can only be obtained following heat treatment (generally above a thousand degree), which limits the direct loading of growth factors within the scaffolds. nevertheless, some unique properties such as granular morphology (grain boundaries), surface charges, crystallography, and micropores are known to significantly alter the adsorption of proteins and their release behaviors [8285 ], which suggests the possible manipulation of fgfs on bioceramic scaffolds that is different from the case in polymers. one promising form of bioceramics is self - setting or hardening cements, such as calcium phosphate cements that quickly harden when they come in contact with water - based solutions and are easily moldable and applicable in an injectable type [78, 115 ]. while their applications in hard tissue reconstruction have a long history, the need for using this class of material for drug delivery including growth factors has emerged recently. fgf - incorporating cements that target bones and teeth are considered to hold great promise ; however, additional studies evaluating their use are necessary. natural polymers such as collagen, gelatin, fibrin, and glycosaminoglycans are the most commonly used hydrogels for tissue regeneration and drug delivery. these hydrogels largely mimic the native extracellular matrices (ecms) of tissues, and cells recognize the hydrogel molecules in a manner similar to the recognition that occurs under in vivo conditions. when fgfs are loaded within the hydrogels of natural polymers, they play a role in controlling cell processes, such as cell division, migration, and differentiation. because the growth factors easily bind to ecm components such as heparan sulfate proteoglycans and fibronectin [118, 119 ], these compounds are often combined with hydrogel matrices. the bound growth factors are secured within the hydrogel matrices until released by an enzymatic reaction or hydrolytic cleavage. collagen hydrogels form a fibrillar network, which is also degradable enzymatically through the action of collagenase. however, recent studies have reported the recombinant fusion of growth factors into well - known collagen binding sequences such as the sequence from collagenase, von willerbrand factor, or fibronectin. gelatin is a denatured form of collagen that has been investigated as a good candidate carrier of fgfs. depending on the charge characteristics (acidic or basic) and biodegradability of gelatin, the release profile of fgfs can vary greatly. in the case of fgf2, fibrin hydrogel can be formed through the spontaneous polymerization of fibrinogen in the presence of thrombin protease. the fgf2 noncovalently bound to the fibrin network was able to provide growth factor - specific bioactivity, such as enhancing endothelial cell proliferation. gags are strongly anionic polymer hydrogels that can absorb a large amount of water while preserving good mechanical integrity. similar to collagen, gags bind growth factors noncovalently but very stably and then further release them through the enzymatic cleavage reaction. the structure of gags is often modified to provide sites of covalent binding for biomecules, such as adhesive proteins and growth factors. synthetic hydrogel polymers can be formed with various compositions, including poly(ethylene glycol) (peg), poly(vinyl alcohol) (pva), and poly(hydroxyethyl methacrylate) (phema). during preparation of the synthetic hydrogels, various target binding domains or cleavage domains such as mmp - cleavable sequences and growth factor binding ligands can be introduced, and these ultimately play a role in covalently linking growth factors such as fgfs and further allowing cleavage of the network to release fgfs. when compared to the natural polymer hydrogels, which have limited properties to control, the development of synthetic polymer hydrogels to retain the functional and some cell / tissue responsive properties are now increasing rapidly. indeed, cell responsive functional groups can be tuned to deliver specific molecules including fgfs, and the mechanical and degradation properties can be manipulated to be responsive to surrounding conditions, such as ph, temperature, light, and mechanical load [7, 128 ]. as one example, a peg hydrogel system was engineered to be crosslinked through a photoreaction, during which time physical properties such as the degree of swelling could be modulated. the release of fgf2 from the hydrogel was highly dependent on the crosslinking density, which was mediated by the swelling ability. when compared to the structured porous scaffolds or hydrogels, particulate forms with sizes at the nano- (tens to hundreds of nanometers) and micron - scale (a few micrometers) have gained interest for specialized delivery of growth factors, requiring a system to be delivered through the blood stream and oral administration, and within intracellular compartments [129132 ]. many different formulations of natural and synthetic polymeric materials for this purpose have been reported, and these primarily include liposomes, micelles, dendrimers, microspheres, nanospheres, and nanoshells. the common process in production of those particulates requires the formation of droplets within solutions that were conditioned to disperse individual particles while preserving the morphological (spherical) integrity. the size and composition of the particulates are easily controllable, which ultimately determines the release profile of growth factors. as described in the previous section, natural polymers such as gelatin and collagen are possible candidates for in situ encapsulation of fgfs during the formation of particulates, where the charge interaction of natural polymers with fgfs must be considered. similarly, synthetic polymers can be exploited in the form of nanoshells (or nanocapsules), in which hydrophobic polymers comprise an outer shell that surrounds an inner water - based portion that contains hydrophilic growth factors [89, 133 ]. depending on the polymer composition and outer shell thickness, the release profile of growth factors can be controlled. due to their sizes being far greater or less than one hundred nanometers, dna designed to encode fgfs can be encapsulated within the nanocapsules to form a complex and then further transfected to the target cells to elicit the biological functionality of fgfs. when compared to the polymeric compositions, inorganic particulates for growth factor delivery have been relatively less studied. recent attention has been given to the mesoporous silica nanoparticles, which have a large amount of mesopores with sizes of about 210 nm [136, 137 ]. growth factors can be entrapped within the mesopores of the particles and then delivered into the target tissues or cells. one of the widely available inorganic materials for gene delivery is calcium phosphate (cap) nanoparticles because the calcium ion can easily bind with negatively charged nucleic acids, which then forms a cap - dna complex. intracellular delivery of genes that encode fgfs can be implemented using inorganic nanoparticulate delivery systems [138, 139 ]. while nano- and microparticulates are easily manipulated to take up growth factors and can be safely implemented into defect sites, the scaffolds and hydrogels can provide 3d matrices for cells to adhere, migrate, populate, and differentiate. therefore, particulates carrying growth factors are often embedded within the matrices to act as cell scaffolding and produce therapeutic effects [139, 140 ], which is an effective method of fully utilizing the roles and functions of fgfs in cells and tissues for regenerative therapy and tissue engineering. fgfs have the biological activity of stimulating the proliferation of fibroblasts and angiogenesis, which facilitates potential use in skin wound healing. both fgf1 and fgf2 are known to be highly released by damaged endothelial cells and macrophages at wound sites, and if fgf2 activity is blocked, wound angiogenesis is almost completely impaired. fgf7 and fgf10 play a role in stimulation of the migration and proliferation of keratinocytes. however, owing to the short half - like of free fgfs, the use of delivery systems has been proposed. among the fgfs, application studies of wound healing and skin regeneration have primarily been conducted on fgf2. because acidic gelatin is highly negatively charged, it can hold fgf2 well by forming an ionic complex with gelatin. the 2 mg freeze - dried gelatin microspheres were soaked in 20 l aqueous solution of fgf2 (10 mg / ml with an isoelectric point 9.6). while the free - fgf2 administered in vivo (10, 50, and 100 g) to guinea pigs with full - thickness skin defect could not induce sufficient dermal wound healing, gelatin microspheres incorporated with fgf2 greatly accelerated dermal tissue regeneration. using a synthetic hydrogel of chitosan, which is photocrosslinkable, fgf2-incorporation and sustained release the fgf2-incorporated hydrogel was photocrosslinked and injected into the skin wound of healing - impaired diabetic (db / db) mice. the involvement of fgf2 within chitosan hydrogel was shown to greatly improve wound closure in terms of granulation tissue formation, capillary formation, and epithelialization of the wounds. the angiogenesis and blood vessel formation induced by the treatment of fgfs have been relatively well studied. the most commonly used carrier systems for fgfs are natural polymers including gelatin, which can be prepared to have different charge statuses (negative for acidic and positive for basic gelatin). tabata. prepared gelatin hydrogels with different water contents and charge statuses and then incorporated them with fgf2. when the complex was implanted subcutaneously into mice, the most significant neovascularization was induced in the fgf2-incorporating acidic gelatin with a low water content. this was largely due to the effect of released fgf2, which was manipulated to be sustained and controlled from the gelatin hydrogel. a sustained release of fgf2 and its stimulation of human umbilical vein endothelial cell (huvec) growth were reported using the heparinized collagen matrix, where the heparin was first immobilized to collagen, and fgf2 was then bound to the heparinized collagen because the fgf2 has a heparin - binding domain. the heparin was also immobilized onto synthetic polymer plga scaffold to allow a high affinity to fgf2. the fgf2 loading was greatly enhanced, and the release from the heparinized - plga was controllable. when subcutaneously implanted in vivo, the fgf2-loaded scaffold effectively induced blood vessel formation. synthetic polymer plga microspheres were also used to incorporate fgf2 and its sustained - release, which was then combined with alginate porous scaffold. when implanted in the rat peritoneum, the fgf2-plga administered group showed accelerated vascularization, with a 4-fold increase in penetrating capillaries when compared to the fgf2-free group occurring. muscle regeneration has also been greatly controlled by the fgfs which are abundant in regenerating areas of muscles [144, 145 ]. fgf6 is of particular interest because it is muscle specific and highly upregulated during muscle regeneration. fgf2 was demonstrated to promote the recruitment of skeletal muscle satellite cells using a single myofiber culture model. doukas. used a gene delivery system that encodes fgf2 and fgf6 for the repair of skeletal muscle. specifically, plasmid and adenovirus vectors were immobilized in a collagen - gelatin mixture that was then delivered to muscle wounds. they found early muscle angiogenic response and subsequent arteriogenesis, and muscle repair was also greatly enhanced showing regenerating myotubes with specific markers expressions. although there have been some controversies regarding the critical role of fgfs in muscle repair, it is largely accepted that their roles in muscle regeneration are closely related to the revascularization process. kawaguchi. reported the induction of de novo adipogenesis in mouse subcutis in response to the injection of fgf2-matrigel mixture, which is associated with vascular formation. additionally, matrigel matrix containing gelatin microspheres incorporated with fgf2 was used for the controlled release of fgf2 and induction of adipogenesis. at 6 weeks after subcutaneous implantation in mice, the fgf2-incorporating group showed significantly higher formation of adipose tissue accompanied with angiogenesis when compared to that treated with free fgf2. the adipogenesis was dose dependent (0.01, 0.1, and 1 g fgf2) and the best result was obtained in the 0.1 g fgf2-incorporated group, suggesting that the use of polymer carrier incorporating an appropriate level of fgf2 provides a tool for adipose tissue engineering. gelatin microspheres incorporating fgf2 were also used in other studies of adipose tissue regeneration [93, 94 ]. kimura. showed that fgf2-incorporated gelatin microspheres enabled preadipocytes to differentiate adipose tissue formation. they further showed that collagen scaffold containing gelatin - fgf2 microspheres stimulated adipogenesis in a rabbit fat defect in response to the treatment of fgf2-complex scaffold. following injury (~during one week) of tendons and ligaments, the level of fgf2 and its receptors has been shown to increase in vivo, with fgf2 playing a significant role in the recruitment of progenitor cell differentiation and the repair process [150, 151 ]. for applications of human bone marrow stem cells (hbmscs) in the repair of tendons and ligaments, the effects of fgf2 on their proliferation and differentiation were investigated. specifically, when the fgf2 concentration was low (3 ng / ml), the action was positive in terms of triggering both cell proliferation and expression of genes related to tendon and ligament tissue. however, treatment with a high dose (30 ng / ml) did not show any beneficial effects on the hbmscs. targeting anterior cruciate ligament (acl), fgf2 was incorporated into a gelatin hydrogel and then mixed with pla woven fabric. following implantation of fgf2-combined materials wrapped with a collagen membrane in the tibia and femur of rabbit, acl and bone one recent study showed the possibility of tendon tissue engineering using bmscs and a delivery system encapsulating fgf2 within electrospun nanofiber that was combined with silk microfiber fabric. the behavior of bmscs, including their proliferation and tendogenic differentiation, was significantly promoted upon fgf2-loaded fibrous scaffolds. while the differentiated traits of chondrocytes are generally lost during expansion in monolayer culture, chondrocytes treated with 5 ng / ml fgf2 within the poly(glycolic acid) fibrous scaffold and further expanded (up to 2000 fold) were shown to redifferentiate to recover the chondrocytes phenotypes. when fgf2 was impregnated within collagen sponge (soaked in 80 g / ml pbs for 24 h at 4c) and implanted subcutaneously in nude mice, the cartilage regeneration was remarkably accelerated with cartilage tissues that were immature at 2 weeks and almost mature at 4 weeks. with regard to the mesenchymal stem cells (mscs), fgf2 have been shown to modulate cell growth and maintain the undifferentiated state of stem cells, facilitating the expansion of stem cells. moreover, its regulation of chondrogenic differentiation of bone marrow stem cells (bmscs) has been demonstrated. chiou. also reported that the treatment of fgf2 in either bmscs or adipose stem cells (ascs) significantly enhanced chondrogenesis, where cell proliferation was shown to increase dose dependently. specifically, they found that fgf2 at lower concentration (10 ng / ml) enhanced chondrogenic differentiation, while the effect was negated at higher concentration (50 ng / ml), suggesting that the use of fgf2 at an appropriate dose is beneficial for cartilage repair. to induce slow release of fgf2 from the scaffold, fgf2 while free fgf2 showed a rapid in vivo clearance (~3% remained after 24 h), the level of gelatin - impregnated fgf2 remained approximately 44% and 18% at days 3 and 14, respectively, suggesting that the gelatin held the fgf2 effectively. the fgf2-containing gelatin was preadministrated in an ear - shaped polymer scaffold that also contained chondrocytes for 1 week. when the tissue - engineered construct was implanted subcutaneously in mice, significantly improved chondrogenic and neovascularization traits were observed, suggesting the importance of sustained fgf2 release in cartilage tissue engineering. to augment the repair of tracheal stenosis, an animal study in rabbit the results demonstrated greatly enhanced chondrogenesis with cartilage accumulation in the engineered tracheal wall at three months after implantation. the combinatory approach of fgf2 with polymer scaffold was also conducted by ma., who coated the pla scaffold surface with collagen and fgf2. to accomplish this, the pla surface was first chemically treated to covalently graft collagen molecules and then physically coated with collagen solution containing fgf2. cultured bmscs derived from rats within a hyaluronate - based polymer scaffold with or without fgf2. they found that the presence of fgf2 strongly enhanced the expression of osteogenic markers and mineralization, demonstrating a possible role in bone regeneration. tabata. studied the role of fgf2 in a rabbit skull defect model. gelatin hydrogel was also used to incorporate fgf2 (100 g) to form a polyionic complex and function as an effective carrier. at 12 weeks, the implants showed dramatic improvement in defect closure, bone mineral density, and bone regeneration in groups treated with varying doses (2 to 200 g) of fgf2-gelatin when compared to an untreated group. the improvement of bone cell proliferation and differentiation by the fgf2 was also observed in an experiment using hydroxyapatite (ha) porous granules incorporating fgf2. the fgf2 administrated at 0.25 m to 100 mg of ha granules was shown to remain at approximately 80% after release for 3 days. specifically, the osteoblastic differentiation of cells (mc3t3-e1) such as alkaline phosphatase (alp) activity and mrna levels of bone - related genes (osteocalcin, collagen i and alp) were shown to be significantly up - regulated by the fgf2 treatment, suggesting that ha also may preserve the biological activity of fgf2. a recent study also showed that the in vivo bone formation in rats greatly improved in response to the use of an appropriate carrier of fgf2. collagen was made into a hybrid membrane with nanobioactive glass, which was impregnated with fgf2 (100 g) and then implanted within a rat calvarium defect. the nanobioactive glass - amended hybrid scaffold greatly enhanced the defect closure and bone formation, and the fgf2-treated group displayed further improvements, showing the synergistic effect of fgf2 with a bioactive inorganic component. the use of fgf2 in dental implants has also been shown to influence the formation of bone around ti - based metals. fgf2 suspended in matrigel was administrated to the surface of ti and then implanted in ovariectomized rats. the matrigel used was shown to prolong the life span of fgf2 upon sustained release for up to 21 days in vitro. the implant samples after three months were found to induce great enhancement in new - bone formation (2-fold) and mechanical stability (3-fold) on the matrigel - fgf2-treated group when compared to groups treated with fgf2 or matrigel alone. the treatment of osteochondral complex tissue was also investigated in vivo using a composite scaffold made of ha / collagen incorporating fgf2. either 0.5 g (50 l from 10 g / ml) or 5 g (50 l from 100 g / ml) fgf2 was impregnated within the ha / collagen scaffold and then implanted into the osteochondral defect in a rabbit femoral trochlear groove of the knee. during the periods of implantation through 3 to 24 weeks, the 0.5 g fgf2-treated scaffold group displayed greatly enhanced bone regeneration and satisfactory cartilage regeneration, suggesting that the ha / collagen composite is a good candidate for delivering fgf2 during the regeneration of osteochondral defect. while there has been some consensus regarding improvement of the proliferative potential of osteoblasts, some adverse effects of fgf2 on the osteogenic differentiation and mineralization have also been identified. investigated the influence of different fgfs (fgf2, fgf4, and fgf6) on the behavior of human primary osteoblasts. they demonstrated that all fgfs treated in culture medium at 0.7 m induced osteoblast proliferation but inhibited alp activity and mineralization. however, when vitamin d was co - administrated with fgfs, the alp and mineralization were greatly enhanced, suggesting the combinatory use of fgfs with other mineralizing agents for bone induction and bone tissue engineering. coadministration of fgf2 with melatonin to the ti implants showed promotion of osseointegration during 4 weeks of implantation in rat tibia. apart from the use of fgf2, which has been the most widely studied, fgf1 was also shown to stimulate angiogenesis as well as osteogenesis in vitro. fgf1 was entrapped within the ha - fibrin composite scaffold, which was further implanted in rats subcutaneously. at 2 and 4 weeks postimplantation, the fgf1-containing scaffolds was found to stimulate angiogenesis with blood vessel formation and the expression of osteogenic markers (osteopontin and osteocalcin), suggesting that ha - fibrin scaffold incorporating fgf1 is effective for bone repair. additionally, periodontal ligament tissue has been shown to be regenerated by the action of fgf2 contained in a gelatin carrier. tan. reported that a periodontal defect in dogs could be significantly regenerated by treatment with mscs that were transfected with fgf2. at eight weeks after implantation in nonhuman primates, the fgf2-gelatin group showed significant regeneration of periodontal tissues in a dose - dependent manner. shirakata. demonstrated that treatment with fgf2 induced the promotion of periodontal healing in two - wall intrabony defects in dogs, suggesting that they were a possible candidate for replacement of the established benchmarks enamel matrix derivative or platelet - derived growth factor combined tricalcium phosphate. as one of the neurotrophic factors, fgfs have been shown to enhance the in vitro survival and neurite extension of various types of neurons as well as in vivo wound healing and neuronal functions. fgf2 is known to exist at the blood - brain barrier in matrix - bound and soluble form, and it is produced by astrocytes and has autocrine effects on astrocytes proliferation and stellation. when compared to the soluble form, fgf2 bound to matrices has improved half life, and its effects on astrocytes can be potentiated [160, 161 ]. covalently linked fgf2 onto a nanofiber polymer scaffold and observed significant autocrine expression of fgf2 and the modulation of astrocytes - neuron interactions, suggesting the utility of the system in nerve injury and disease. for the repair of spinal cord injury (sci), marquet. developed a porous pla modified with copolymer and combined with fibrin glue containing fgf2 and found that the scaffold allowed cell migration and angiogenesis in the transected spinal cord of rats, suggesting the potential for the use of the system for sci, although more clear examination and functional studies must be conducted to confirm these findings. due to the difficulty of the proteins in penetrating the blood - spinal cord barrier, a local delivery system consisting of poly(ethylene glycol)-modified fgf2 and using an intrathecal delivery has recently been developed by kang.. also developed a polymer nanocomposite hydrogel fgf1 that has also been shown to have neuroprotective functions in the repair of sci. tsai. demonstrated that rat sci treated with fgf1 showed significant functional recovery. they also used a synthetic polymer and hydrogel of fibrin or collagen to carry growth factors such as fgf1 and nt-3, and showed that fgf1 involvement significantly improved the axonal regeneration of vestibular neurons. for the peripheral nerve regeneration, fgf2 was loaded within a polymer tube channel and implanted in the 15 mm gap of the sciatic nerve. the results revealed the in vitro sustained release of fgf2 with biological activity, and in vivo regeneration of nerve cables bridging nerve stumps. similar to other tissue applications, anionic gelatin was also used to embed fgf2 and induce sustainable delivery to the intratemporal facial nerve. the results at six weeks after implantation demonstrated that facial nerve functions such as facial movements, electrophysiology and histological morphology, were greatly improved. fibroblast growth factors (fgfs) that signal through fgf receptors (fgfrs) regulate a wide range of biological functions, including cell proliferation, survival, migration, and differentiation. among the signal pathways, ras / map kinase is known to be predominant in the case of fgfs. while the biological functions of fgfs are largely implicated in many types of cells in vitro through this signaling pathway biomaterial - based systems, including delivery carriers of fgfs and scaffolds of stem cells regulated by the fgfs functions, have recently been potentially developed and shown to have many good results in vivo. future clinical applications of fgfs in the regeneration of tissues, including skin, muscle, tendon / ligament, bone, tooth, and nerve tissues will be realized when their biological functions are maximized by the appropriate use of biomaterials and stem cells. | fibroblast growth factors (fgfs) that signal through fgf receptors (fgfrs) regulate a broad spectrum of biological functions, including cellular proliferation, survival, migration, and differentiation. the fgf signal pathways are the ras / map kinase pathway, pi3 kinase / akt pathway, and plc pathway, among which the ras / map kinase pathway is known to be predominant. several studies have recently implicated the in vitro biological functions of fgfs for tissue regeneration. however, to obtain optimal outcomes in vivo, it is important to enhance the half - life of fgfs and their biological stability. future applications of fgfs are expected when the biological functions of fgfs are potentiated through the appropriate use of delivery systems and scaffolds. this review will introduce the biology and cellular functions of fgfs and deal with the biomaterials based delivery systems and their current applications for the regeneration of tissues, including skin, blood vessel, muscle, adipose, tendon / ligament, cartilage, bone, tooth, and nerve tissues. |
the incidence of intramedullary tumors of the spinal cord is 2 - 4% of all central nervous system tumors. intraspinal dermoid cysts are less than 1% in incidence, commonly seen in extradural location in lumbar area. we report a case of large intramedullary dermoid cyst of the spinal cord associated with a dermal sinus in mid - dorsal - spine in an 18-months - old female child presenting early with fever due to intermittent sinus discharge and infection. an eighteen - months - old female child presented with history of mild fever and intermittent discharge from a sinus in the mid - dorsal area. on examination, she was febrile with normal power and sensation in all limbs except mild stiffness of left leg. posterior aspect of mid - dorsal spine (d5) shows a skin dimple with no active discharge at presentation [figure 1 ]. magnetic resonance imaging (mri) of whole spine revealed a large intramedullary cystic lesion in the dorsal segment of spinal cord extending from d2 to d7 vertebral level with single posterior sinus tract opening to skin at d5 vertebral level. the cystic lesion shows t1-weighted (t1w) hypointense, t2-weighted (t2w) and short tau inversion recovery (stir) hyperintense signal, restricted diffusion in diffusion - weighted image (dwi) and apparent diffusion coefficient (adc) image. post - contrast mri image shows no enhancement of the lesion [figure 2 ]. intramedullary spinal epidermoid / dermoid with posterior sinus tract was given as possible radiological differential. the child shows dermal sinus tract opening to skin as skin dimple over the posterior aspect of dorsal spine in midline intramedullary cystic lesion of spinal cord extends from d2 to d7 vertebral level and shows t1w hypointense (a), t2w hyperintense (b), stir hyperintense signal (c), non - enhancement in post - contrast image (d and e) and restriction of diffusion in dwi (f) and adc (g) sequence. the dermal sinus track is seen as hypointense linear structure in t2w and stir image (b and c) dorsal d1 to d8 laminectomy was done. injection methyl prednisolone was given as bolus dose (30 mg / kg body weight) during intra operative period and continued for 24 hour in post - operative period with a dose of 5.4 mg / kg body weight. tuft of hair and cheesy material with a thin capsule were removed in piece meal ; portion of the capsule could not be removed as it was densely adhered to the cord. dermal sinus tract was ending within the dermoid capsule [figure 3 ] and was also excised. post operatively she developed mild weakness of left lower limb (grade - iv power) which she recovered by 10 post - operative day. intraoperative picture shows the dermal sinus merging to the intramedullary dermoid the histopathological diagnosis of the lesion confirmed dermoid cyst [figure 4 ]. microphotograph showing the cyst lined by squamous epithelium containing keratinous flakes in the lumen ; and the wall shows dermal appendages, adipocytes and nerve bundles which confirmed it as dermoid cyst dermal sinus is an epithelium - lined track, which extends inward from the skin surface for varying distances and often connects the body surface with the central nervous system or its coverings. it results due to focal area of incomplete disjunction of cutaneous ectoderm from neural ectoderm during the process of neurulation. the patients become symptomatic due to infection or because of compression of neural structures by an associated dermoid or epidermoid tumor. acute worsening of neurological deficit may be seen due to spontaneous rupture of dermoid cyst resulting in ventriculitis and meningitis. dermal sinuses in midline are commonly associated with a dermoid cyst and those in paramedian location with epidermoid cyst. dermoids are most frequently seen in dorsolumbar area (75%) out of which 63% are in intradural extramedullary location and 38% in intramedullary location. dermoid cyst is thought to arise from inclusion of embryological ectodermal rest cell in neural epithelium during neural tube closure in 3 to 5 week of gestational age. intramedullary dermoid cyst usually presents late in 2 or 3 decade of life with significant neurological compromise. in presence of a dermal sinus, presentation becomes early due to sinus discharge and infection. the appearance of dermoid cyst on mri is variable, sometimes showing high signal intensity on t1-weighted images (t1w), but more commonly having low to intermediate signal intensity on t1-weighted images and high signal intensity on t2-weighted images (t2w). the lack of a fatty signal may be a result of secretions from sweat glands within the tumor causing increased water content. dermoid shows diffusion restriction and no post - contrast enhancement unless they are infected like epidermoid. t1-weighted images with wide window settings best show the sub - cutaneous portion of the sinus tracts, whereas t2-weighted images show the sinus tract as a hypointense linear or curvilinear structure. in our case the dermoid shows predominant t1 hypointense, t2w / stir heterogeneously hyperintense signal and diffusion restriction with t2w hypointense sinus track. the arachnoid cyst shows cerebrospinal fluid (csf) signal with no diffusion restriction whereas epidermoid shows hyperintense signal in fluid attenuation recovery sequence and restriction of diffusion. total microsurgical excision of dermoid cyst along with the capsule is the treatment of choice. partial excision of dermoid cyst wall with decompression in case of dense adhesion of lesion with spinal cord also gives good clinical outcome. in our case, the whole of the dermoid cyst along with the sinus tract was excised except small portion of capsule which was attached firmly to the spinal cord. dermal sinus in mid - dorsal spine associated with a large intramedullary dermoid cyst presenting only with intermittent fever, sinus discharge and subtle neurological deficit are rare. patient with dermal sinus should be evaluated early with spinal imaging preferably by mri of spine to rule out underlying spinal cord lesion which will facilitate better treatment at the early stage of disease, thus preventing development of neurological deficit. | intramedullary dermoid cyst is a rare entity. it is usually associated with spinal dysraphism and dermal sinus. our case is an 18-months - old female child who presented with history of fever and mild difficulty in moving left leg. she had a sinus in mid dorsal spine since birth with history of intermittent discharge from it. on magnetic resonance imaging of spine she was diagnosed to have large intramedullary epidermoid / dermoid cyst in the d2 - 7 vertebral level with a sinus tract. a dermoid cyst along with the sinus tract was excised. post - operative follow up period was uneventful with full recovery. |
we also thank sandra hirzberger and alexey shavel for assisting with the powder xrd measurements and chemical syntheses respectively. nm appreciates the financial support provided by german academic exchange service and japan society for the promotion of science. | judicious selection of the amount of surfactant during synthesis enables a drastic increase in the photoluminescence efficiency of aqueous cdte nanocrystals (ncs) stabilized by thioglycolic acid (tga). elemental determination of the ncs was undertaken to identify the origin of this effect. the molar ratio of (te + s) to cd approached unity when the optimum amount of tga was used during synthesis, whereas the number of s atoms originating from tga molecules in one nc (2.6 nm of diameter) remained unchanged at 90 3. this indicates that the core lattice composition at the beginning of synthesis, rather than the surface conditions, affects the photoluminescence efficiency of the ncs even after prolonged refluxing. |
clinically, abdominal obesity is identified by an increase in waist circumference (wc). increased wc it is unclear, however, whether this measure is a correlate of increased risk through its correlation with total abdominal fat (taf) or a specific, metabolically unhealthy depot of adipose tissue. many investigators postulate that the key component of body fat underlying the metabolic syndrome is intraperitoneal fat (ipf) or visceral fat [27 ]. others nonetheless contend that abdominal subcutaneous fat (asf) is a more important pathogenic factor [814 ]. since previous studies have shown that ipf and asf are intercorrelated, the more important adipose - tissue compartment underlying the metabolic syndrome is difficult to identify. the primary aim of this study was to determine the strength of the correlations between wc and taf, and asf and ipf measured by magnetic resonance imaging (mri). these analyses were made for gender in whites, blacks, and hispanics of the dallas heart study. we additionally correlated saf and ipf with plasma triglyceride (tg) and homeostatic model assessment of insulin resistance (homa2-ir), both accompanying the metabolic syndrome. details of dhs study recruitment have been published previously. the current cohort consisted of 1538 women (50% black, 29% white, and 21% hispanic) and 1212 men (50% black, 36% white, and 16% hispanic) that had measurement of asf, ipf, and retroperitoneal fat (rpf). all study volunteers gave written informed consent to participate in an institutional review - board - approved study. body weight was measured with a portable scale (ever weigh, lithium electronic scale no. 34067, health o meter, bridgeview, il, usa) to the nearest 0.1 kg. subjects were in a standing position with arms on side, legs straight, and knees together, with feet flat pointed outward. waist circumference was measured at the midpoint between the lower margin of the last palpable rib and the top of the ileal crest using a stretch - resistant tape with a spring providing constant tension. insulin resistance was estimated with the homa2 computer model (homa calculator version 2.2). three categories of wc were defined for this study : low, intermediate, and high. low wc corresponded to < 90 cm in men and < 80 cm in women ; intermediate wcs were 90101 cm in men and 8089 cm in women ; and high wcs were 102 cm in men and 90 cm in women. these cut points corresponded to dhs body mass index categories of < 25 kg / m, 2529.9 kg / m, and 30 kg / m. zhu. reported essentially the same ranges based on nhanes iii data. measurements of abdominal compartments of body fat were performed using 1.5 tesla mri scanners (intera ; philips medical systems, best, the netherlands). the entire abdomen from the diaphragm to the pelvis was scanned using contiguous axial 10 mm slices, as previously described. a single mri slice at the l2-l3 level was used to quantify total abdominal fat (taf), asf, ipf, and retroperitoneal fat (rpf) as detailed by abate.. briefly, the validation of this method to quantify total abdominal fat subregions involved mri measurements from the 12th thoracic to 1st sacral vertebra calculated from contiguous 10 mm thick slices that covered the entire abdomen. regression functions were derived that predicted total fat masses in the respective compartments and that correlated best with the single slice measurement at l2-l3 level. not normally distributed, results are given as medians (with interquartiles), and data were log - transformed prior to parametric statistical comparisons. comparisons of means of metabolic risk factors among ethnic groups within each gender were done for metabolic parameters using anova with bonferroni adjustments for multiplicity of testing or in selected cases using a posthoc fisher f test. pearson 's correlation coefficients were determined for analyses of linear associations of waist girth to abdominal fat parameters measured by mri. spearman 's and partial correlations were also calculated for relating adipose tissue compartments to triglycerides and homa2-ir. the clinical characteristics of subjects according to ethnicity and gender are shown in table 1. mean wcs ranged from 99 cm to 101 cm for the three groups of men and from 91.4 cm to 100.7 in women ; wcs were higher in black women. in both men and women, blacks had the lowest tg and hispanics had the highest. black men had higher mean hdl - c levels compared to whites and hispanics ; differences among the three groups of women were less. black men had lower non - hdl - c levels than whites and hispanics, but they had higher systolic blood pressures. pearson 's correlations (r) for linear regression analyses between wcs and different abdominal - fat compartments are shown in figure 1. the highest coefficients of correlation were noted for taf with progressively lower correlation coefficient with asf and ipf. ipf was better correlated with wc in men than in women, but still, wc was not a good indicator of ipf. the strength of the correlations was similar within each ethnic group at a p < 0.0001. absolute fat masses in ipf and asf for three categories of wc low, intermediate, and high according to ethnicity and gender are presented in figures 2(a) and 2(b), respectively. women of all ethnicities had much lower ipf masses than men. further, in both men and women, blacks had lower ipf masses than whites and hispanics at all levels of wc (p < 0.02) ; white men with low and intermediate wc had lower ipf than hispanics (p < 0.02) ; and white women at intermediate wc had lower ipf than hispanic women (p < 0.02). in contrast, men and women had similar patterns of asf masses for each waist circumference category. black men had significantly lower asf than white and hispanic for those with a low waist circumference, and they also had the highest asf for those in the highest waist circumference category figure 3 displays the ipf as a percentage of taf. in all ethnicities, higher wcs matched with greater fat masses in each compartment (figures 2(a) and 2(b)). although fat masses rose with increasing wcs, the percentage of ipf relative to taf did not rise for low, intermediate (med), and high wcs for men or women (figure 3). in general, blacks had slightly lower percentages of ipf than both other groups. in figures 4(a) and 4(b), ranges of ipf masses are given for quintiles of taf in men and women, respectively. as taf rose, so did ipf, showing that most of ipf mass was determined by taf content. within each taf category, this range broadened with higher taf masses, suggesting heterogeneity of ipf response to obesity. in the most obese subjects, ipf masses varied over extremes of about 1.5 kg in men and 1.0 kg in women. the means and distributions of the ipf / asf ratio are shown for men and women of the three ethnic groups (table 2). the distributions were skewed so that mean and 50th percentiles (medians) are not identical. although mean percentage ipf was relatively constant with increasing wcs, great individual variation was noted across the span of ipf / asf ratios. to examine whether differences in ipf / asf ratios affect plasma tg or homa2-ir, ratios were split into upper and lower halves and were related to these metabolic measures. on the whole, for the three wc categories, greater ipf / asf ratios associated with higher tg levels. in contrast, differences in ratios had little or no influence on homa2-ir. in women, a similar but less pronounced trend was noted for differences in ipf / asf ratios on tg levels (figure 5(b)). differences in ratios again had little or no effect on homa2-ir. to determine whether a more sensitive analysis might identify an effect of ipf on homa2-ir, spearman 's correlation coefficients were determined on all men and all women, regardless of ethnicity or wc (figure 6). in both men and women after cross - adjustment, asf lost its association with tg levels, whereas ipf did not. in both men and women, asf and ipf after cross - adjustment, the strength of the correlation for each compartment diminished, but ipf remained significantly correlated. first, wc correlated strongly with taf and asf, whereas wc less strongly predicted ipf (figure 1). second, ipf constituted only about one - fourth of taf in men and one - fifth in women (figure 4). third, for all groups, the distributions of ipf / asf ratios showed considerable variability among individuals ; this explains the relatively low correlations between wc and ipf (table 2). fourth, ipf rose progressively with increasing taf, but at each step of increase, ipf masses varied considerably (figures 4(a) and 4(b)). fifth, for all wc categories, persons with higher ipf / asf ratios had higher plasma tg levels than did those with lower ratios ; this relationship was not observed for homa2-ir (figures 5(a) and 5(b)). even so when all ethnic groups were combined, a positive correlation was uncovered between ipf and homa2-ir, which persisted after adjustment for asf (figure 6). ipf, asf, and the distribution of their ratios were compared to blacks, whites, and hispanic men and women. both black men and women had lower median ipf / asf ratios compared to whites and hispanics (table 2). in the three ethnic groups, taf, asf, and ipf were similarly correlated with waist girths (figure 1). in low, intermediate, and high wc categories, both black men and women had lower masses of ipf, compared to whites and hispanics (figure 2(a)). in low and intermediate wc categories of men, hispanics had greater masses of ipf than whites as well as black ; at high wg, only black men were different from the other ethnicities. in women, only blacks were consistently different from whites and hispanics in ifp masses (figure 2(a)). black men and women had relatively low asf mass compared to whites and hispanics ; but in the high wg categories, blacks of both genders had higher asf mass than whites and hispanics (figure 2(b)). a high wc clearly associates with all metabolic risk factors ; and it is commonly believed that wc is a surrogate measurement for visceral adipose tissue [2022 ]. the current study revealed that amounts of ipf increased progressively through each category of increasing wc. in this sense, therefore, it can be said that wc is a surrogate for ipf. the current data, nonetheless, indicate that wc is much more strongly correlated with taf and asf than with ipf. this being the case, it can not be assumed that the relation between increased wc and metabolic syndrome is mediated predominantly through a higher ipf. for all wc categories and in men and women, those with higher ipf / asf ratios had higher plasma tg levels. in addition, partial correlation analysis indicated that ipf independently associates with tg levels. the mechanism for this relationship can be readily visualized. since ipf drains its fatty acids directly into the splanchnic circulation, these fatty acids should add an excess load of lipid on the liver beyond what would be derived from subcutaneous adipose tissue beds. for instance, carr. reported that intra - abdominal fat is independently associated with insulin resistance, and others found a similar relationship [12, 24, 25 ]. it might be expected that if ipf causes insulin resistance, a high level of ipf should be a risk factor for type 2 diabetes. such has been reported [6, 25, 26 ]. in the current study, this relationship could not be found when people with high and low ipf / asf ratios were compared. but partial correlations suggest that higher levels of ipf associate with increased homa2-ir independently of asf. in the light of previous reports, there seems to be little doubt that a positive correlation between ipf and insulin resistance exists. the mechanisms whereby ipf per se could cause skeletal muscle insulin resistance are not readily apparent. an increased release of fatty acids from ipf is one possibility ; but amounts must be relatively small compared to the total adipose tissue output of fatty acids. it is thus unlikely that a relatively small increment in release of fatty acids from ipf could substantially worsen insulin resistance in skeletal muscle [2730 ]. if ipf increases insulin resistance, it is more likely to be hepatic insulin resistance ; this condition is characterized by increased hepatic glucose output. presumably an increased fatty acid influx into the liver suppresses insulin action, stimulates gluconeogenesis, and raises hepatic glucose output [31, 32 ]. a report suggests that homa2-ir reflects hepatic glucose output more than skeletal muscle insulin resistance. the positive correlation between ipf and homa2-ir thus could be mediated through fatty acid stimulation of hepatic glucose output. they found that the contribution of ipf to hepatic fatty acid delivery ranged from < 10% to approximately 50% depending on amounts of ipf. the remainder of fatty acid flux to liver derived from subcutaneous adipose tissue. thus their findings suggest that excess fatty acids from ipf could drive gluconeogenesis and raise homa2-ir. in reference to the association between visceral obesity and metabolic risk factors, it seems important to distinguish between the rise in ipf with total body obesity and the occurrence of excessive amounts of ipf with obesity. the findings of nielsen. suggest that with increasing obesity, a higher percentage of splanchnic flux of fatty acids is derived from ipf. in addition, for any given level of obesity, there is heterogeneity in ipf content ; therefore, obese persons with the greatest ipf masses could have the highest splanchnic flux of fatty acids, worsening liver - associated risk factors. in summary any given wc, ipf can vary greatly. the two factors affecting this variation are ethnicity and gender. black men and women have lower median ipf masses than whites and hispanics. in the high wg category, blacks have both lower ipf and greater asf, which contributes to the overall variability between wc and ipf. ipf was found to correlate with both serum triglyceride levels and homa2-ir, whereas asf correlated only with homa2-ir. | this study examines intercorrelations among waist circumference (wc), intraperitoneal fat (ipf), and subcutaneous abdominal fat (saf) in ethnically diverse dallas heart study consisting of 1538 women and 1212 men (50% black). correlations between fat depots and triglyceride or homa2-ir, biomarkers of metabolic syndrome, are also reported. total abdominal fat (taf), asf, and ipf masses were measured by magnetic resonance imaging. the highest correlations with wc according to ethnicity and gender were noted for taf (r2 = 0.81 0.88) with progressively lower correlations with asf (0.650.82) and ipf (0.290.85). the percentage of ipf relative to taf was not significantly correlated with wc. for all wc categories, higher ipf / asf ratios were associated with higher triglyceride levels. in contrast, differences in ratios had little or no association with homa2-ir. however, when all data were pooled, ipf was positively correlated with both triglyceride (r = 0.358 (men) and 0.363 (women)) and homa2-ir (r = 0.480 (men) and 0.517 (women)) ; after adjustment for asf, ipf was still correlated with triglyceride (r = 0.353 (men) and 0.348 (women)) and homa2-ir (r = 0.290 (men) and 0.221 (women)). wc measures taf reliably, but its association with ipf depends on ipf / asf ratios that vary by gender and ethnicity. |
the national advisory committee on immunizing agents was initially established in 1964 with a mandate to provide advice on immunizing agents to the department of national health and welfare, and to make recommendations on immunizing agents that appeared to warrant special consideration to the dominion council of health. in 1975, the mandate was revised to focus on advice related to the introduction of new vaccines in canada and to assist in the development of immunization programs. in 1978, the name of the committee was changed to the national advisory committee on immunization, reflecting the revised mandate for consideration of procedures related to immunization and immunization coverage. over the years, naci has evolved from providing advice on only a few vaccines to now providing technical guidance for > 50 different authorized vaccine products to prevent 24 different diseases (4). naci is a highly regarded scientific advisory committee that has been recognized globally as one of 15 well - established national immunization technical advisory groups (5) that can be regarded as a resource in establishing similar groups in other countries to enhance the use of evidence - based decision - making processes in the development of immunization programs and policies. in canada, the national advisor on healthy children and youth has recognized the importance of the work of naci, and recommended that the federal government continue to support the work of the national advisory (committee) on immunization (naci) in getting valuable information to health care providers and parents (6). the current mandate of naci is to provide the public health agency of canada (phac) with ongoing and timely medical, scientific and public health advice related to vaccines and certain immunoglobulins for both adult and pediatric populations (7). this is accomplished through the efforts of appointed expert members, liaison representatives from organizations with an interest in immunizations and vaccines, as well as ex officio representatives from relevant areas of the federal government, and secretariat support through the centre for immunization and respiratory infectious diseases (8). the vaccine industry provides valuable information to the committee related to products in development and ongoing clinical trials, but they do not participate in naci s funding, its deliberations or in the development of its recommendations. members are expected to express their personal opinions as informed by their professional expertise, experience and relevant evidence. members are asked to submit conflict of interest declarations annually and provide updates as they arise. these declarations are assessed for impact on naci deliberations and recommendations, with potential management strategies including limited participation on specific agenda items. the intent of the committee is to ensure that unbiased expert advice, based on best practices and evidence, is provided to assist phac in informing the canadian public health community and frontline providers. as the committee has evolved, a scientific methodology and more transparent process have been embraced for making recommendations. a search of relevant published data, along with grey literature, is conducted to understand the currently available information regarding vaccine efficacy, effectiveness, immunogenicity and safety. the literature review is generally guided by a working group chairperson to ensure that all relevant data are reviewed. these data are then synthesized, along with a ranking of the level and quality of evidence. canadian epidemiology, using a variety of published and unpublished sources, is used to understand the burden of disease and the potential for improving health at a population level for a particular disease. the committee then puts it all together by reviewing the benefits and risks, following which the evidence is translated into scientifically grounded recommendations (9). once naci has made its recommendations, several products are developed to ensure that they are available to a variety of stakeholders. naci s recommendations can be found in the canadian immunization guide (4) (the guide), in advisory committee statements and in detailed literature reviews (7). the guide is intended to support the front - line immunizer in providing the right vaccine at the right time to the right person via the right route and at the right dose. it also assists health care professionals in responding to questions from potential vaccine recipients or their caregivers, including providing current knowledge regarding vaccine safety. in 2014, the guide has been moved from its traditional book format to an internet - based ever - green format. this change allows for timely updating of information and improvements in providers ability to obtain the most accurate information. advisory committee statements provide details of the canadian epidemiology related to the disease under consideration, an overview of the efficacy, effectiveness, immunogenicity and safety of a particular vaccine, and a summary of naci s recommendations for the use of that vaccine. more details regarding the literature review that was conducted to support the development of the statement and its recommendations are often published separately. the literature review, the advisory statement or both contain detailed tables summarizing and assessing each individual study that was considered. the number of advisory committee statements written annually has increased over the years, reflecting the increase in the number, complexity and specific indications for use of vaccine products. each year, this statement provides an overview of the epidemiology from the previous year s influenza season and a summary of the vaccines available in canada for the upcoming influenza season, along with their recommended usage. recent updates to the influenza statement have included a change in the recommended pediatric dose for those six to 36 months of age from 0.25 ml to 0.5 ml (10), a preferential recommendation of live attenuated intranasal influenza vaccine for children two to six years of age (11), a recommendation for vaccination of egg - allergic individuals when this had previously been a contraindication (10) and the progressive expansion of the age indications for routine influenza vaccination, which is now recommended for everyone 6 months of age (12,13). current issues being considered include the use of quadrivalent vaccines that provide protection against both lineages of influenza b and the possible preferential use of more efficacious vaccines in certain age groups. as new products, evidence and indications evolve, naci revisits its recommendations to keep them up to date, relevant, and based on the best and most current evidence. vaccine development pipelines contain candidate vaccines targeted not only against infectious diseases, but also to prevent chronic diseases. vaccine technologies are also expanding, with the potential to prevent a range of diseases that have proved to be challenging to address with current technologies. as these new products come to market, there will be an increasing demand for rigorous, unbiased guidance to understand how they can be used to improve the health of canadians. as the vaccine landscape becomes more complex, it may be necessary to expand this mandate to include other elements in the analysis and recommendations ; for example, the feasibility and acceptability of a new vaccine, as well as the cost effectiveness and societal impact. additional attention must also be devoted to vaccine program considerations including vaccine uptake, vaccine hesitancy, and surveillance systems to monitor vaccination programs and vaccine safety. given this possible expanded mandate, it may be necessary to employ a different model of creating vaccine guidance and recommendations ; however, it will continue to be essential to ensure that the processes used by naci are systematic, rigorous, transparent, timely and unbiased. over the past 50 years, naci has contributed to the practice of immunization by providing thoughtful, practical and evidence - based guidance to individual vaccine providers, as well as to provinces and territories for their publically funded programs. naci and phac, which supports naci s work, recognize the importance of this work and are committed to continuing to provide this advice within the rapidly changing landscape of vaccine development and a possible evolving mandate of the committee. as it has been in the past 50 years, the advice of naci will continue to be vital to supporting the future delivery and uptake of the modern miracle of vaccines. | vaccines have saved more lives than any other innovation in modern medicine. national immunization committees play a vital role in the development of evidence - based recommendations for the use of vaccines. the present article describes the evolution and work of the national advisory committee on immunization in canada as the group marks its 50th anniversary. the article also provides insight into the future challenges that the committee is likely to face. |
cardiovascular diseases remain the leading cause of morbidity and mortality worldwide mainly due to their ischemic conditions. moreover, coronary artery disease is the most common reason of heart failure in westernized nations. thus, the continuous search for therapies that are effective in reducing the incidence of these pathologies is still imperative. since its discovery in 1988, the biologically active heptapeptide angiotensin(ang)-(17) has been widely studied. this is mainly due to the observation that its effects are often opposite to those attributed to ang ii, whose actions favor the development of pathologic conditions in the heart [2, 4 ] and in other organs [5, 6 ] by binding to the at1 receptor. in fact, several studies have demonstrated that ang-(17) exerts beneficial effects in various organs [7, 8 ], including the heart. in this organ, it promotes antiarrhythmogenic effects, potentiation of the bradykinin vasodilatory effect, improvement of the cardiac function [1115 ], reduction of the release of norepinephrine, and regulation of the cell growth and cardiac remodeling [4, 1720 ]. many of these effects are mediated by the activation of the mas receptor [4, 9, 10, 14, 18 ] which was identified as an endogenous binding site for ang-(17). in the heart, an increased activity of the classical axis of the renin - angiotensin system (ras) composed by angiotensin - converting enzyme (ace), ang ii, and at1 receptor leads to ventricular hypertrophy, heart failure [22, 23 ], and fibrosis [4, 19 ]. the excessive fibrosis caused by maladaptive remodeling processes contributes to the diastolic and systolic dysfunction by increasing the myocardial stiffness and by reducing the pumping capacity. the locally produced cytokine transforming growth factor (tgf-) is a major mediator of this process. its expression is increased in many cardiac pathologies such as hypertrophic and dilated cardiomyopathy [2628 ] and myocardial infarction [29, 30 ]. in this latter condition, evidences suggest that tgf- has a central role in the inflammatory and fibrotic phase of the healing process and may critically modulate many cellular steps of the postinfarction repair process by mediating cardiomyocyte growth, fibroblast activation, and extracellular matrix deposition. furthermore, tgf- is considered an important marker for the transition course of stable hypertrophy to heart failure. recently, we have demonstrated that the inclusion of ang-(17) into the oligosaccharide hydroxypropyl -cyclodextrin (hpcd) is an effective formulation for oral administration of this heptapeptide. here, we aimed to evaluate the effects of long - term administration of the hpcd / ang-(17) inclusion compound on cardiac dysfunction and fibrosis caused by myocardial infarction (mi) in rats. additionally, the expression levels of collagen type i and tgf- were also analyzed in the hearts. male wistar rats weighing 180 to 210 g (approximately 3 months of age) were used in this study. the animals were provided by the animal facilities of the biological sciences institute (cebio, federal university of minas gerais) and housed in a temperature- and humidity - controlled room maintained on a 12:12-h light - dark schedule with free access to food and water. all animal procedures were performed in accordance with institutional guidelines approved by local authorities. the animals were divided into three groups : sham surgery treated with hpcd (n = 8), vehicle - treated mi (infarction plus hpcd, n = 7), and mi + hpcd / ang-(17) [infarction plus hpcd / ang-(17), n = 7 ]. the treatment with vehicle (hpcd ; 46 g / kg / day in distilled water by gavage) or hpcd / ang-(17) (76 g / kg / day in distilled water by gavage) started in the first day of mi, and the rats were killed, and the hearts were harvested for real - time pcr analysis 60 days after the beginning of the treatment. the final volume of gavage [hpcd and hpcd / ang-(17) ] was approximately 0.5 ml. three rats died within 48 hours after the mi surgery and one sham - operated animal died after one week. additionally, five animals were excluded due to abnormal increases in the right atria detected by the echocardiographic exam at the initial examination or due to marked weight loss during the period of treatment. mi was induced by proximal left anterior descending (lad) coronary artery occlusion and performed under anesthesia with 10% ketamine/2% xylazine (4 : 3, 0.1 ml/100 g, i.p.). the animals were placed in supine position on a surgical table, tracheotomized, intubated, and ventilated with room air using a respirator for small rodents. the chest was opened by a left thoracotomy at the third or fourth intercostal space. after the incision of the pericardium, the heart was quickly removed from the thoracic cavity and moved to the left to allow access to the proximal lad coronary artery. a 4 - 0 silk suture was snared around the lad and carefully ligated to occlude the vessel. the heart was then placed back, and the chest was closed with 4 - 0 silk sutures. sham - operated rats were treated in the same manner, but the coronary artery was not ligated. animals underwent transthoracic echocardiographic examination before the surgery and after 15, 30, and 50 days of lad coronary artery ligation. in vivo cardiac morphology and function were assessed noninvasively using a high - frequency, high - resolution echocardiographic system consisting of a vevo 2100 ultrasound machine equipped with a 1621 mhz bifrequencial transducer (visual sonics, toronto, canada). the rats were anaesthetized with 3.5% isoflurane for induction, the anterior chest was shaved, and the rats were placed in supine position on an imaging stage equipped with built - in electrocardiographic electrodes for continuous heart rate monitoring and a heater to maintain the body temperature at 37c. high - resolution images were obtained in the right and left parasternal long and short axes and apical orientations. standard b - mode images of the heart and pulsed doppler images of the mitral and tricuspid inflow were acquired. left ventricular (lv) dimensions and wall thickness were measured at the level of the papillary muscles in left and right parasternal short axis during the end systole and end diastole. lv ejection fraction (ef), fractional shortening (fs), and mass were measured. all the measurements and calculations were done in accordance with the american society of echocardiography. the following m - mode measurements were performed : lv internal dimensions at diastole and systole (lvidd and lvids, resp.), lv posterior wall dimensions at diastole and systole (lvpwd and lvpws, resp.), and interventricular septal dimensions at diastole and systole (ivsdd and ivsds, resp.). based on these parameters, end diastolic and end systolic lv volumes (edlvv and eslvv, resp.), fs, ef, stroke volume (sv), and cardiac output (co) were calculated. also, the radial strain from the bidimensional long axis view of the left ventricle was performed using the vevostrain software. the following parameters were evaluated : velocity, displacement, strain, and strain rate. blood samples were collected in tubes through a polypropylene funnel after the decapitation of the animals. these tubes contained 1 mmol / l p - hydroxymercuribenzoate, 30 mmol / l 1,10-phenanthroline, 1 mmol / l pmsf, 1 mmol / l pepstatin a, and 7.5% edta (50 l / ml of blood). the columns were preactivated by sequential washes with 10 ml of 99.9% acetonitrile/0.1% heptafluorobutyric acid (hfba), and 10 ml of 0.1% hfba. after sample application, the columns were washed with 20 ml of 0.1% hfba and 3 ml of 20% acetonitrile/0.1% hfba. the adsorbed peptides were eluted with 3 ml of 99.9% acetonitrile/0.1% hfba into polypropylene tubes rinsed with 0.1% fat - free bsa. after evaporation, the ang-(17) levels were measured by radioimmunoassay (ria), as previously described. to perform the real - time pcr analysis, the hearts were cut transversally approximately 1 mm below the suture point and 3 mm above the apex ; thereby, they were divided in 3 parts : basal, middle, and apical. only the middle portion, where the majority of the infarcted tissue was localized, was used for real - time pcr analysis. total mrna isolation was performed following the trizol reagent protocol (invitrogen life technologies). seven hundred nanograms of mrna treated with dnase were used as template for m - mlv reverse transcriptase (arrayscript, ambion) using the following antisense primers : mas (3-ggtggagaaaagcaaggaga-5), tgf- (3-ggttcatgtcatggatggtgc-5), collagen i (3-ccttaggccattgtgtatgc-5), and s26 (3-cgtgcttcccaagctctatgt-5). real - time pcr was carried out immediately after the synthesis of the first strand cdna. the sense primers used were mas (5-actgtcgggcggtcatcatc-3), tgf- (5-tgacgtcactggagttgtacgg-3), collagen i (5-tgttcagctttgtggacctc-3), and s26 (5-cgattcctgacaaccttgctatg-3) and their respective antisense primers as mentioned above. the pcr reactions containing 300 m of each primer (sense and antisense), 50100 ng of cdna, and sybr green pcr master mix (applied biosystems) were run under standard conditions in an abi prism 7000 sequence detector. the threshold cycle (ct) was determined for each sample, and the ct values of the s26 were subtracted from the ct values of the experimental samples to obtain ct values. transcript levels in left ventricles were expressed as fold relative to the s26 values (2-ct). the real - time pcr data, variation of velocity, and displacement of each time in relation to the initial time were analyzed using one - way anova followed by the newman - keuls posttest. the level of significance was set at p < 0.05 (graphpad prism 4.0). plasma levels of ang-(17) in blood samples collected 24 hours after the last dose of hpcd / ang-(17) in mi rats were higher than those observed in vehicle - treated rats ; however, the difference did not reach significant statistical difference (80.16 18.4 plasma levels of ang-(17) in vehicle - treated sham rats averaged 63 11.7 pg / ml. the echocardiographic analysis at the initial time (before the surgery) showed that sv, hr, co, ef, fs, edlvv and eslvv, lv mass, ivsdd, and ivsds were similar in all three groups evaluated (data not shown). the success of the mi procedure was confirmed by the presence of one of the following changes in the myocardial kinetics observed during the echocardiographic analysis : (i) hypokinesia caused by reduction in the thickness or wall motion, (ii) akinesia represented by absence of thickening and/or movement, and (iii) dyskinesia characterized by changes in the movement in one or more segments or regions of the heart. although the body weight gain was less pronounced in mi vehicle - treated animals, no significant differences were detected among the groups during the treatment period (table 1). also, no significant changes were observed in the lv mass, sv, hr, and co during the treatment period. however, the administration of the inclusion compound to infarcted animals allowed them to better recover the sv and co over time (table 1). as expected, mi caused a progressive impairment of the cardiac function evidenced by decreases in the fs (figure 1(a)), ef (figure 1(b)), ivsds (figure 1(e)), and ivsdd (figure 1(f)) and increases in the eslvv (figure 1(c)) and edlvv (figure 1(d)). the administration of hpcd / ang-(17) significantly improved the fs, ef, ivsds, and eslvv of mi animals (figure 1). specifically, after 15 days of surgical procedure, mi induced a significant reduction in the fs (50%), ef (42%), ivsds (44%), and a significant increase in the edlvv (40%) and eslvv (189%) (figure 1). the hpcd / ang-(17) treatment ameliorated the decrease of fs, ef, and eslvv ; that is, fs increased 32% (29 2% versus 22 1% in vehicle - treated mi rats), ef increased 26% (54 3% versus 43 2% in vehicle - treated mi rats), and eslvv decreased 20% (152 19 l versus 191 10 l in vehicle - treated mi rats). thirty days after mi induction, control infarcted animals showed a similar profile as observed at the 15 days of mi. an increase of 52% and 214% in the edlvv and eslvv was observed, respectively. furthermore, an additional reduction in the ivsds of untreated mi rats was observed (36%). again, the treatment with hpcd / ang-(17) induced an improvement in all parameters analyzed, including a significant attenuation of the reduction in the ivsdd (1.2 0.11 mm versus 0.9 0.13 mm in vehicle - treated mi rats). at the end of the 50 days postinfarction period, no further alterations in the cardiac function of the vehicle - treated infarcted rats were observed ; in contrast, the hpcd / ang-(17)-treated rats showed an improvement of all cardiac parameters evaluated, that is, fs (26 2% versus 19 1% in vehicle - treated mi rats), ef (49 3% versus 37 2% in vehicle - treated mi rats), ivsds (2.0 0.21 mm versus 1.5 0.08 mm in vehicle - treated mi rats), ivsdd (1.3 0.1 mm versus 1.1 0.06 mm in vehicle - treated mi rats), edlvv (364 27 l versus 445 27 l in vehicle - treated mi rats), and eslvv (189 23 l versus 282 25 l in vehicle - treated mi rats) (figures 1 and 2). radial strain analysis of the bidimensional long axis view of the lv revealed that mi induced a significant decrease in the velocity and displacement of myocardial fibers at 15, 30, and 50 days after surgery. hpcd / ang-(17) treatment completely reversed the reduction observed in the displacement of the myocardial fibers at all periods of evaluation after infarction (15, 30, and 50 days after surgery figures 3(b), 3(d), and 3(f), resp.) as well as in the velocity of myocardial fibers at 50 days after mi induction (figure 3(e)). in addition, the velocity of myocardial fibers was improved in infarcted rats treated with hpcd / ang-(17) after 15 and 30 days of mi induction (figures 3(a) and 3(b), resp.). three - dimensional representative diagrams of velocity and displacement obtained by radial strain are shown in figures 4 and 5, respectively. at the end of the treatment, real - time pcr assays were performed in order to evaluate the mas, tgf-, and collagen type i gene expression. we found that vehicle - treated infarcted animals presented an increased expression of tgf- (figure 6(a)) and collagen type i (figure 6(b)) in the heart as compared with sham - operated rats. the administration of hpcd / ang-(17) in mi animals abolished the increase of collagen type i mrna expression and reduced the increase in the expression of tgf- mrna. although the expression of mas tended to increase in mi rats, it did not reach statistical significance when compared with sham - operated animals (figure 6(c)). in the present study, we demonstrated that once - a - day chronic oral administration of the inclusion compound hpcd / ang-(17) produced progressive time - dependent cardioprotective effects in mi animals. specifically, we found that chronic oral administration of hpcd / ang-(17) improves the diastolic and systolic function and reduces the expression of fibrosis scar markers (tgf- and collagen type i). mi is a common cause of heart failure in humans [2, 34, 35 ], and the rat model of mi produced by coronary artery ligation has been used extensively to study the pathophysiology of this condition as well as new approaches to its treatment [12, 35, 36 ]. in keeping with a previous study, our results indicate that the progressive increase in diastolic lv volume was the main mechanism underlying the maintenance of the stroke volume in the presence of a prominent decrease in the fs. importantly, the treatment with hpcd / ang-(17) caused a significant time - dependent improvement in lv dilation demonstrated by the attenuation of the changes in eslvv and edlvv. it has been recently proposed that measurement of the myocardial deformation (velocity, displacement, strain, and strain rate) is a powerful technique to measure heart function disturbances [38, 39 ]. in this study, we used this approach to evaluate functional changes induced by mi and the effects of hpcd / ang-(17) on these alterations. a significant improvement in the velocity and displacement of the cardiac fibers in animals treated with this heptapeptide was observed. the increased deposition of collagen in the heart and abnormal extracellular matrix structure result in myocardial stiffness, leading to ventricular systolic and diastolic dysfunction [24, 35, 37 ]. our data are in keeping with these concepts since we observed that chronic treatment with hpcd / ang-(17) attenuated these alterations, evidenced by a smaller fall in ef and fs and by a smaller reduction in the thickness of the cardiac fibers in both systole (ivsds) and diastole (ivsdd), which was accompanied by a decrease expression of tgf- and collagen type i. cardiac fibroblasts are the primary source of tgf- in the heart, and it was demonstrated that this cytokine is absolutely required for the ang ii - induced cardiac hypertrophy in vivo, and regulates the collagen synthesis in cardiac fibroblasts [40, 41 ]. thus, there are evidences supporting a direct functional association between the ras and tgf- pathways. it has been suggested that smad proteins are the main downstream mediators of the cardiac ang ii / tgf-1 pathway in the chronic phase of mi. furthermore, it was observed that tgf-1/tak1/p38mapk - signaling pathway is activated in spared cardiomyocytes following mi and can play an important role in the development of hypertrophy in the remodeling myocardium. on the other hand, it is well documented that ang-(17) acting through the mas receptor counter regulates the ang ii effects [4, 9, 10, 14, 18, 19, 44, 45 ]. although our results did not show statistical differences in the expression of mas among any of the groups, they clearly demonstrated that the administration of hpcd / ang-(17) in infarcted animals induced a reduction in the increase of tgf- mrna expression. these findings can explain, at least partially, the beneficial effects of the inclusion compound in mi. moreover, the improvement in the heart function of mi rats by hpcd / ang-(17) treatment could be related to the reduction of the infarcted area as demonstrated in our previous study which is in keeping with the strain analysis showing an improvement of the ventricular wall displacement in the hpcd / ang-(17)-treated mi rats. one special feature of the ang-(17) is its long - term effectiveness, as demonstrated in this study. indeed, this observation is in keeping with previous studies showing beneficial effects of chronic ang-(17) administration in different models of cardiovascular diseases [4, 11, 13, 14, 20, 44, 46 ]. chronic ang-(17) administration improved lv function of wistar rats and of diabetic spontaneously hypertensive rats (shrs) after global ischemia, attenuated the heart failure induced by mi, prevented the development of severe hypertension and end - organ damage in shr treated with l - name, and reduced the cardiac remodeling in doca - salt and in ang ii - infused rats [4, 20 ]. in addition, an antifibrotic effect was observed in transgenic animals, which chronically present an increased plasma ang-(17) levels. in summary, this study showed that long - term treatment with hpcd / ang-(17) was able to attenuate the maladaptive remodeling events caused by mi, thereby indicating that ang-(17) holds beneficial effects in hearts and that this inclusion compound constitutes an effective strategy to orally administer this heptapeptide. | in this study was evaluated the chronic cardiac effects of a formulation developed by including angiotensin(ang)-(17) in hydroxypropyl -cyclodextrin (hpcd), in infarcted rats. myocardial infarction (mi) was induced by left coronary artery occlusion. hpcd / ang-(17) was administered for 60 days (76 g / kg / once a day / gavage) starting immediately before infarction. echocardiography was utilized to evaluate usual cardiac parameters, and radial strain method was used to analyze the velocity and displacement of myocardial fibers at initial time and 15, 30, and 50 days after surgery. real - time pcr was utilized to evaluate the fibrotic signaling involved in the remodeling process. once - a - day oral hpcd / ang-(17) administration improved the cardiac function and reduced the deleterious effects induced by mi on tgf- and collagen type i expression, as well as on the velocity and displacement of myocardial fibers. these findings confirm cardioprotective effects of ang-(17) and indicate hpcd / ang-(17) as a feasible formulation for long - term oral administration of this heptapeptide. |
mycobacterium tuberculosis is an extraordinarily successful human pathogen with the ability to replicate within the normally hostile environment of host macrophages. after being phagocytosed by the macrophage, m. tuberculosis resides in a membrane - bound vacuole, the phagosome, which normally undergoes maturation into the phagolysosome that is essential for eliminating invading microbes and for antigen presentation.(1) however, m. tuberculosis is able to arrest phagosomal maturation by interfering with ca signaling and trafficking of the rab family of small gtpases, two important processes for organelle membrane fusion. when residing within a phagosome, the live bacilli secrets specific proteins such as tyrosine phosphatases to reduce the phagosomal level of phosphatidylinositol 3-phosphate or inhibit host proteins regulating vacuolar sorting, which all lead to impaired phagolysosomal fusion. arrest of phagosomal maturation (or block of phago - lysosome fusion) is critical for m. tuberculosis persistence in host macrophages.(1) apart from secreted proteins, the exotic cell wall components of pathogenic mycobacteria are thought to be key modulators of host immune processes, but in most cases, their molecular effects on host cells are not well understood.(7) the best characterized are unique mycobacterial lipoglycans termed lipoarabinomannans (lam), which are noncovalently associated with the bacterial plasma membrane and extend to the exterior of the cell wall. notably, pathogenic m. tuberculosis produces mannose - capped lipoarabinomannan (manlam) structures,(10) whereas the fast - growing nonpathogenic species mycobacterium smegmatis synthesizes lam molecules capped with phosphatidyl - myo - inositol (termed pilam)(11) (figure 1). for instance, macrophages show significantly reduced phagosomelysosome fusion after engulfing manlam - coated microbeads.(12) manlam interacts with the mannose receptor and blocks the rise in cytosolic ca that would otherwise accompany mycobacterial entry into macrophages. free manlam can insert into host cell membranes, leading to membrane reorganization and disruption of signaling pathways.(15) by contrast, pilam has none of these effects. instead, it is an agonist of toll - like receptor 2, which results in secretion of various cytokines and activation of apoptotic pathways, though the notion of its proinflammatory activity has been challenged recently.(19) motivated by reports suggesting different effects of manlam and pilam on macrophages, we sought to probe how the two mycobacterial lipoarabinans affect the molecular properties of host phagosomes. previously, we developed a method to purify the membrane fraction from latex bead - containing (lbc) phagosomes in order to profile its proteome using mass spectrometry.(20) here we modified our method by combining tube - gel digestion(21) and itraq labeling(22) to study quantitative changes in the macrophage phagosomal proteome upon exposure of cells to manlam or pilam. escherichia coli - derived lipopolysaccharide (lps) was used as a third stimulus in order to identify lam - specific effects. from a total list of 823 proteins found in the phagosomal membranes, we identified 47 proteins that were significantly up- or down - regulated (> 1.25-fold, p 1.8 ; + 2 > 2.5 ; + 3 > 3.5), deltacn > 0.8 and the requirement of at least two different peptides from a protein. parent and product ion mass errors were set at 1.2 and 0.8 da, respectively. lcms / ms data acquired on a q - tof for itraq - based quantification were searched against a mouse international protein index (ipi) database (mouse, version 3.27, 56 000 entries) using the paragon algorithm within proteinpilot version 2.0 software (applied biosystems). the major parameters in the software were explained by pierce.(24) protein identification was based on a confidence level > 95% and at least two different peptides assigned to the protein. a search performed against a concatenated database containing both forward and reversed sequences allowed estimation of the false discovery level (below 1%). the number of transmembrane helices in each protein was predicted using the tmhmm online program (http://www.cbs.dtu.dk/services/tmhmm/). for relative protein quantification, each protein ratio reported by protein pilot was associated with a p - value (evaluating the statistical difference between the observed ratio and unity) and ef (error factor) for each protein id.(25) the ef term indicates that the actual ratio lies between (reported ratio)/(ef) and (reported ratio) (ef) at a 95% confidence. the following criteria were required to consider a change in protein level significant : the protein i d had a p - value 1.25 or 4% sds) for their solubilization, which poses a problem for in - solution trypsin digestion due to the loss of enzyme activity. additionally, the in - gel digestion method, though compatible with high detergent concentrations, is not amenable to subsequent chemical labeling reactions as required by the itraq method. we attempted to solve these problems using reduced amounts of sds (0.2%) in solution as well as a more detergent - resistant protease, lys - c, prior to trypsin digestion, but neither of these modifications gave satisfactory results. we turned our attention to the recent method of tube - gel digestion, developed by lu and zhu, which has proven effective for proteomic analysis of membrane proteins. an advantage of this method is that detergent can be washed from the protein - impregnated gel prior to trypsinization. furthermore, the resulting peptide products can be released from the gel into aqueous solution prior to chemical labeling. we modified the tube - gel digestion method in three ways to better suit the analysis of phagosomal membrane extracts : (1) nh4hco3 was replaced with teab, a primary amine - free buffer compatible with itraq reagents ; (2) the residual protein solution that was excluded from the gel matrix was subjected to a second gel solidification process, so as to minimize sample loss ; and (3) we performed the cysteine reduction and alkylation steps prior to gel formation. using phagosomal membrane extracts as substrates, we compared the efficiency of this modified tube - gel digestion protocol to in - solution methods and analyzed the peptide products by lcms. the total number of proteins identified using different digestion protocols in three separate experiments are shown in supporting information table 1. the modified tube - gel protocol identified three times as many proteins as the best in - solution procedure (using dual enzymes and 0.2% sds). a recent publication by han. also highlights the robustness of the tube - gel method for processing membrane proteins prior to itraq labeling.(29) the digested peptides derived from untreated, manlam-, pilam-, or lps - treated samples were labeled with itraq114, itraq115, itraq116, or itraq117, respectively. the pooled peptide mixture was subjected to 2d lcms / ms analysis both for protein identification and relative quantitation. biological replicates were analyzed either on a qstar pulsar i or elite mass spectrometer, and the combined data sets produced a total of 823 nonredundant proteins (supporting information table 2a). notably, 540 of these proteins were not found in our earlier phagosome membrane proteomics study.(20) a summary of overlapping and unique protein ids from both data sets is present in supporting information table 3. we attribute the superior performance of the new method to (1) the additional low - salt wash, which depleted more soluble proteins and enriched membrane proteins accordingly (supporting information figure 2b), and (2) the reduced sampling handling required of the tube - gel method, which minimized contamination with keratins. the itraq isotopic labels were used to calculate relative protein levels from lipoglycan - treated or untreated samples. supporting information table 2b provides a list of 658 quantitative ratios (lipoglycan treated : untreated) measured in two experimental replicates. the criteria for selecting ratios that indicate significant changes in protein abundances are described in experimental procedures. applying these filters allowed us to identify four protein subsets that were regulated by (i) manlam alone, (ii) manlam and pilam but not lps, (iii) manlam and lps but not pilam, or (iv) all three lipoglycans. because manlam has been implicated in m. tuberculosis virulence, we focused our studies on the phagosomal proteins that were specifically regulated by this lipoglycan. apart from the p - value filter, we applied a threshold of 1.25-fold difference because : (1) the average technical and biological variations for itraq - based quantitation have been reported to be 11% and 25%, respectively;(30) (2) precedents have established that in some cases changes in protein level as low as 1.2-fold can be biologically relevant ; (3) after applying these criteria, we found 42 proteins specifically regulated by manlam (table 1), with the remaining unchanged proteins covering 94% of all the proteins quantified in this study. this value is higher than the percent of unchanged proteins found in an analysis of biological replicates using itraq.(30) the protein ratios represent the relative abundance of a specific protein in the phagosome bearing latex beads coated with manlam, pilam, or lps vs uncoated beads. macrophage cells were treated by latex beads coated with three different bacterial lipoglycans or uncoated beads, and proteins were extracted from phagosomal membranes for quantitative comparison using itraq isotopic labels. the protein ratios indicate relative changes of protein levels in the phagosomes under a specific lipoglycan treatment in comparison with no treatment. forty - two proteins were found to be significantly changed only by manlam treatment, which were summarized in this table. the ratio with an asterisk is the mean of two replicate measurements. of the 42 proteins found to be regulated by manlam, lysosome - associated membrane protein 1 (lamp1), the late endosome membrane marker cd63, and the late endosome - specific small gtpase rab7 were all in this group, a finding that agrees with previous microscopy studies showing diminished recruitment of these proteins to phagosomes containing manlam - coated beads(13) or live m. tuberculosis.(3) in addition, lysosomal enzymes such as the cysteine protease cathepsin d (catd), and subunits of lysosomal vacuolar atpase (v - atpase) were down - regulated by 3040% (table 1). loss of v - atpase, a proton transporter, could explain the reduced lysotracker staining of phagosomes containing manlam - coated beads reported earlier.(15) interestingly, we noticed that the phagosomes containing manlam - coated beads partially share the features of those harboring live m. tuberculosis. russell group has reported earlier that mycobacterium phagosomes exclude v - atpase to restrict vacuole acidification(33) as well as reduce acquisition of the mature form of catd.(34) in western blot analysis, we also observed reduced production of the mature catd in the manlam - containg phagosome (figure 3a), though to a less extent than that observed in the live mycobacterium phagosome.(34) in summary, our proteomic data are consistent with classical cell - based or biochemical assays and suggest that manlam contributes to phagosome maturation arrest. (a) immunoblot of phagosomal membrane extracts from cells treated with different lipoglycans using antibodies specific for endosomal markers and a lysosomal protease. each ratio represents the changes of a particular protein in the presence of manlam-, pilam-, or lps - coated beads relative to the uncoated beads. (c) immunoblot of syntaxin 6 in phagosome membrane extracts under different lipoglycan treatments. note : this protein was not identified in the proteomic analysis. among the down - regulated species, we were particularly interested in a protein of unknown function containing a zinc finger fyve domain (ipi00554920.5). this domain is known to bind phosphatidylinositol 3-phosphate (pi3p),(35) a regulatory phospholipid that mediates membrane trafficking, endosomal protein sorting, and multisubunit enzyme assembly via multiple effectors. importantly, pi3p plays an essential role in phagosomal acquisition of lysosomal constituents, and it is excluded from phagosomes containing live mycobacteria.(4) early endosome antigen 1 (eea1), a protein that is known to be required for phagolysosome biogenesis and that also contains a fyve domain, was also down - regulated by manlam. by analogy, the uncharacterized protein may be a new pi3p - binding effector involved in phagosome maturation and is possibly modulated by the m. tuberculosis lipoglycan. eighteen proteins increased in abundance when cells were treated with manlam - coated beads (table 1). the small gtpase rab14 is critical for stimulating vesicle fusion specifically between phagosomes and early endosomes rather than late endosomes.(40) overexpression of this regulatory protein is known to prevent phagosomes containing dead mycobacteria from maturing into bactericidal phagolysosomes.(40) manlam - induced upregulation of rab14 in phagosomes may promote phagosome - early endosome fusion thereby stalling the maturation process. another protein in this group, vacuolar protein sorting - associated protein 41 (vam2p homologue), is also known to concentrate in early endosomes.(41) the protein interacts with multiple snare family members, which are important vesicle fusion regulators.(41) the observation that manlam up - regulates at least two known early endosomal proteins suggests that its host phagosome resembles early endosomes, a proposal that been previously put forth for m. tuberculosis - containing phagosomes. we performed immunoblotting to validate quantitative changes of certain phagosomal proteins in response to manlam treatment. lamp1, catd, and eea1 were down - regulated in the presence of manlam - coated beads compared to samples treated pilam - coated, lps - coated or uncoated beads (figure 3a). the observed down - regulation of eea1 concurs with deretic and co - workers report that eea1 is depleted from phagosomes containing live m. tuberculosis.(44) by contrast, transferrin receptor (tfr), an early endosome marker, was found to be up - regulated in phagosomes containing manlam - coated beads. this coincides with a previous report by clemens and horwitz, showing that only the phagosomes harboring live mycobacterium acquire transferrin added exogenously.(43) these trends revealed by immunoblotting matched those observed by quantitative mass spectrometry (figure 3b). the reduced levels of eea1 in phagosomes containing manlam - coated bead may have broad consequences for vesicle fusion and membrane trafficking. eea1 is recruited to organelles via its association with pi3p on organelle membranes(45) and also interacts with syntaxin 6, a snare protein that participates in the vesicular traffic between the tgn and the endocytic system including phagosomes. inhibition of eea1 s function causes reduced accumulation of syntaxin 6 in phagosomes.(12) likewise, we considered the possibility that syntaxin 6 is depleted from phagosomes bearing manlam - coated beads. indeed, western blot analysis showed that syntaxin 6 was down - regulated in the presence of manlam - coated beads (figure 3c) while four other syntaxins (stx3, 7, 8, 12) and two syntaxin - binding proteins (stxbp2, 5) identified by our proteomic analysis did not exhibit reduced levels upon manlam treatment (supporting information table 2b). loss of syntaxin 6 from phagosomal membranes may cause a global reduction in the delivery of lysosomal components, including v - atpase and catd, from the tgn to phagosomes. taken together, the proteomic and biochemical data are consistent with the proposal that manlam undermines trafficking from the tgn to the phagosome, which is reported to depend on the production of pi3p by the kinase vps34.(48) interestingly, we also observed lamp1 down - regulated by manlam treatment, yet this protein is thought to be delivered to phagosomes in a pi3p - independent manner. therefore, manlam may affect multiple trafficking pathways that contribute to maturation of the phagosome and its proteome. a connection was recently revealed between the pathways of phagosome maturation and autophagy activation.(20) autophagy serves as a means for the removal of intracellular bacteria and viruses, apart from its primary function of maintaining cytoplasmic homeostasis.m. tuberculosis survival in infected macrophages is suppressed by artificial induction of the autophagy response.(53) we previously observed that the autophagosomal marker lc3 is enriched on lbc phagosomal membranes upon autophagy activation.(20) lc3 is not only a widely used marker but also an essential component of the autophagy machinery.(54) upon the induction of autophagy, the 18-kda cytosolic precursor lc3-i is cleaved at its c - terminus and conjugated to phosphatidylethanolamine, generating a 16-kda form termed lc3-ii.(55) lipid - modified lc3-ii integrates into the membranes of autophagosomes and undergoes either recycling or degradation when autophagosomes fuse with lysosomes.(56) given the importance of the autophagy pathway in the macrophage response to m. tuberculosis and the role of lc3 in this process, we sought to determine whether manlam affects the cellular distribution of lc3. our proteomic data suggested that lc3 levels were reduced by about 30% in phagosomes containing manlam - coated beads (figure 4a), an observation that was confirmed by western blot analysis of phagosomal membrane extracts prepared in the same manner (figure 4b). by contrast, lc3 was up - regulated in phagosomes containing lps - coated beads and essentially unchanged in phagosomes containing pilam - coated beads (figure 4). (a) proteomic quantitation ; (b) and immunoblot of phagosomal membrane extracts using an anti - lc3 antibody. to determine the effects of manlam treatment on subcellular localization of lc3, we monitored a gfp - lc3 fusion protein in raw264.7 murine macrophages upon treatment with various lipid - coated and uncoated beads (figure 5a). the average number of microbeads bearing bright fluorescence of gfp per cell provided a metric of the relative amount of lc3 in the phagosomes (figure 5b). basal levels of gfp - lc3 were observed in phagosomes containing uncoated beads, reflecting the endogenous low autophagy activity in resting macrophages. additionally, these phagosomes stained with lysotracker, indicating successful fusion with lysosomes to become acidic vacuoles. phagosomes bearing pilam - coated beads showed similar levels of gfp - lc3 fluorescence and lysotracker staining as in the presence of uncoated beads. in contrast, phagosomes containing manlam - coated beads exhibited weaker gfp - lc3 fluorescence than observed with uncoated beads, as well as weaker lysotracker staining. lps - coated beads affected lc3 translocation to phagosomes in an opposite manner compared to manlam - coated beads. in response to lps - coated beads, gfp - lc3 levels were increased in phagosomes, consistent with previous observations that lps activates the autophagy pathway.(57) manlam reduces gfp - lc3 fluorescence in lbc phagosomes. (a) translocation of gfp - lc3 to lbc phagosomes under different lipoglycan treatment. raw cells stably expressing gfp - lc3 were allowed to internalize latex beads (3 m) coated with a lipoglycan for 2 h. control cells were treated with lipid - free beads. (b) quantitation of gfp - lc3 colocalization with phagosomes containing beads coated with different lipoglycans. a total of 200250 cells were sampled in each experiment to find out the average number of lbc phagosomes bearing gfp fluorescence in each cell. next, we investigated the effects of the bacterial lipids on lc3 distribution in the presence of chloroquine, an anti - inflammatory drug that causes accumulation of autophagosomes by preventing their fusion with lysosomes.(58) the drug has been previously employed to facilitate measurements of autophagic flux in vivo.(58) raw264.7 cells stably expressing gfp - lc3 were treated by chloroquine in the absence or presence of a given lipoglycan suspended in medium. trypan blue staining was performed to confirm that the chemical and lipid treatments did not affect cell viability (supporting information figure 3). cells treated with chloroquine alone showed punctate fluorescence derived from gfp - lc3-ii (figure 6a), an indicator of elevated autophagy activity. such punctate fluorescence was barely observed in untreated cells due to lysosomal degradation of autophagosomal lc3 in the absence of chloroquine.(58) cells treated with pilam and chloroquine demonstrated a distribution of gfp - lc3-ii that was similar to that observed with chloroquine treatment alone. however, gfp - lc3ii fluorescence was significantly more diffuse in cells that were treated with manlam (figure 6a). quantitation of the average number of gfp - lc3-ii puncta (> 1 m) per cell in the presence of the various bacterial lipids is shown in figure 6b. similar data were obtained from cells treated with three different doses of manlam, suggesting that the minimal effective concentration could be even lower than the 2 g / ml used in our assay. collectively, these data indicate that manlam, but not pilam or lps, suppresses the accumulation of autophagosomes induced by chloroquine. thus, manlam appears to interfere with the endogenous formation of autophagic vacuoles, an early stage of autophagy activation. (a) macrophages expressing gfp - lc3 were incubated with chloroquine (50 m) in the presence or absence of either manlam or pilam for 2 h. arrows, representative lc3 punctate stains. (b) quantitation of lc3 punctate structures (> 1 m) in cells incubated with chloroquine in the absence or presence of a specific lipoglycan. using a new platform for quantitative comparison of the membrane proteomes of macrophage phagosomes, we identified 823 proteins of which 42 were significantly regulated by manlam from m. tuberculosis but not pilam derived from nonpathogenic mycobacteria or e. coli lps. several manlam - regulated proteins are known to be involved in vesicle trafficking pathways and phagosome maturation. others have unknown function (e.g., fyve domain - containing protein), but their regulation by manlam suggests a role in membrane trafficking events important for endosomal fusion and interaction with phagosomes. we also found that manlam suppresses the accumulation of lc3-ii in both lbc phagosomes and autophagosomes, whereas pilam has no such effects. given the established importance of phagocytosis and autophagy in the macrophage response to m. tuberculosis infection, it is possible that manlam s functions include interference in these critical processes of innate immunity. proposed vps34, the kinase responsible for pi3p production, as a possible target,(44) and indeed phagosomes containing m. tuberculosis show retarded and reduced acquisition of this critical traffic - regulating lipid.(45) delineating the downstream effectors of manlam is likely to reveal new players in phagosome maturation, autophagy activation, and other pathways. as well, understanding the mechanisms by which manlam undermines the macrophage response may reveal new therapeutic avenues. | the mycobacterial cell wall component lipoarabinomannan (lam) has been described as one of the key virulence factors of mycobacterium tuberculosis. modification of the terminal arabinan residues of this lipoglycan with mannose caps in m. tuberculosis or with phosphoinositol caps in mycobacterium smegmatis results in distinct host immune responses. given that m. tuberculosis typically persists in the phagosomal vacuole after being phagocytosed by macrophages, we performed a proteomic analysis of that organelle after treatment of macrophages with lams purified from the two mycobacterial species. the quantitative changes in phagosomal proteins suggested a distinct role for mannose - capped lam in modulating protein trafficking pathways that contribute to the arrest of phagosome maturation. enlightened by our proteomic data, we performed further experiments to show that only the lam from m. tuberculosis inhibits accumulation of autophagic vacuoles in the macrophage, suggesting a new function for this virulence - associated lipid. |
a 56-year - old man was observed in the emergency room (er) 4050 min after the onset of acute de - novo stabbing, pulsating and diffuse headache with subsequent appearance (within few minutes) of dysarthria, postural instability with retropulsion, mild objective vertigo and vomiting, acral paresthesias of upper limbs, minimal confusional state without loss of consciousness or seizures. neurological examination was relevant for reagent anisocoria (left smaller than right), slight speech disorder (dysarthria), retropulsion, moderate bilateral incoordination at the index - nose test, absence of fever and meningeal signs. blood pressure (bp) was unstable with recurrent hypertensive crises (200/120 mmhg) during observation, in the absence of definite previous history of hypertension as well as of diabetes, headache, or cardiovascular problems. electrocardiographic monitoring excluded paroxysmal arrhythmias, while cardiac enzymes and creatine - kinase were negative. in the er, he was started on intravenous (i.v.) nimodipine (2 mg / hour) with progressive normalization of bp values within 4 h. urgent brain computerized tomography (ct) was negative for hemorrhage and focal lesions. considering the unstable bp and the low nihss (national institutes of health stroke scale) score (=3) at presentation, i.v. thrombolysis for possible brainstem ischemia was excluded, and the patient was put on antiplatelet therapy with salicylic acid (i.v. 250 mg for 24 h, followed by oral administration) as for a minor ischemic events. under i.v. salicylic acid, headache severity gradually decreased over the next 3 h, leaving only a slight diffuse, pulsating pain which remitted over the next 6 h. all the neurological signs and symptoms had completely recovered within 12 h. in order to investigate the vertebro - basilar (vb) district, the patient also underwent urgent brain ct - angiography with maximum intensity projection (mip), multiplanar (mp) and three - dimensional (3d) reconstructions, with the detection of left persistent primitive hypoglossal artery (ppha) as a large vessel originating from the internal carotid artery (ica) at the c2 vertebral level, entering the posterior cranial fossa through an enlarged hypoglossal canal and thus joining the lower portion of the basilar artery (fig. 1). the study was then completed through 3d volume - rendering (vr) reconstructions for a better definition of the anatomical details (fig. 1). collateral findings were represented by bilateral vertebral artery hypoplasia together with a small saccular aneurysm (not - surgical) of the anterior communicating artery, confirmed by digital subtraction angiography (dsa) which revealed no additional vascular abnormalities. brain magnetic resonance (mr) with mr - diffusion weighted imaging (mr - dwi) was performed 24 h after onset of symptoms and did not show recent ischemic lesions. the electroencephalogram performed 12 h after admission did not record epileptic / focal abnormalities. uncommon causes of stroke (thrombophilia, patent foramen ovale and other relevant metabolic risk factors for stroke) were excluded during the course of the observation.fig. 1a axial brain ct - angiography, b, c mip and 3d - reconstruction ct - angiography showing left ppha (arrows). d three - dimensional - vr ct - angiography showing ppha (arrow) entering the posterior cranial fossa through an enlarged hypoglossal canal and thus joining the lower portion of the basilar artery, and in e ppha (arrow) as a large vessel originating from the internal carotid artery at the c2 vertebra level a axial brain ct - angiography, b, c mip and 3d - reconstruction ct - angiography showing left ppha (arrows). d three - dimensional - vr ct - angiography showing ppha (arrow) entering the posterior cranial fossa through an enlarged hypoglossal canal and thus joining the lower portion of the basilar artery, and in e ppha (arrow) as a large vessel originating from the internal carotid artery at the c2 vertebra level the patient was then discharged with ramipril (5 mg per day) plus oral salicylic acid (100 mg per day) and at the 6-month control no further episode of headache with or without neurological symptoms was reported. headache associated to vb signs and symptoms, once excluded critical conditions, could suggest at least four possible diagnoses : (1) basilar - type migraine, (2) posterior reversible encephalopathy syndrome (pres), (3) headache attributed to benign (or reversible) angiopathy of the central nervous system, and (4) headache attributed to transient ischemic attack (tia) or minor stroke, whose diagnostic criteria are summarized in table 1.table 1diagnostic criteria for basilar - type migraine, posterior reversible encephalopathy syndrome (pres), headache attributed to benign (or reversible) angiopathy of the central nervous system, and headache attributed to transient ischemic attack (tia)basilar - type migraine migraine with aura symptoms clearly originating from the brainstem and/or from both hemispheres simultaneously affected, but no motor weakness(a) at least 2 attacks fulfilling criteria b d(b) aura consisting of at least two of the following fully reversible symptoms, but no motor weakness : dysarthria, vertigo, tinnitus, hypacusia, diplopia, visual symptoms simultaneously in both temporal and nasal fields of both eyes, ataxia, decreased level of consciousness, simultaneously bilateral paraesthesias(c) at least one of the following : (1) at least one aura symptom develops gradually over 5 min and/or different aura symptoms occur in succession over 5 min (2) each aura symptom lasts 5 and 60 min(d) headache fulfilling criteria b d for 1.1 migraine without aura begins during the aura or follows aura within 60 min(e) not attributed to another disorderposterior reversible encefalophathy syndrome (pres) acute or subacute neurologic presentation of headeache, nausea, vomiting, altered mental function, seizures, stupor, visual disturbancesradiological hallmarks : reversible bilateral subcortical and cortical edema with a predominantly posterior distribution (parieto - occipital) at fluid - attenuated inversion recovery (flair) mri imagingheadache attributed to benign (or reversible) angiopathy of the central nervous system (a) diffuse, severe headache of abrupt or progressive onset, with or without focal neurological deficits and/or seizures and fulfilling criteria c and d(b) strings and beads appearance on angiography and subarachnoid hemorrhage ruled out by appropriate investigations(c) one or both of the following : (1) headache develops simultaneously with neurological deficits and/or seizures (2) headache leads to angiography and discovery of strings and beads appearance(d) headache (and neurological deficits, if present) resolves spontaneously within 2 monthsheadache attributed to transient ischemic attack (tia) (a) any new acute headache fulfilling criteria c and d(b) focal neurological deficit of ischemic origin lasting < 24 h(c) headache develops simultaneously with onset of focal deficit(d) headache resolves within 24 h diagnostic criteria for basilar - type migraine, posterior reversible encephalopathy syndrome (pres), headache attributed to benign (or reversible) angiopathy of the central nervous system, and headache attributed to transient ischemic attack (tia) according to the current criteria of the international classification of headache disorders2nd ed. (ichd - ii), our case potentially fulfills only some of the diagnostic criteria for basilar - type migraine (1.2.6) : headache, dysarthria, vertigo (with onset / worsening in few minutes), ataxia, decreased level of consciousness and simultaneous bilateral paraesthesias. however, the neurological symptoms have lasted over 60 min and were associated with de - novo headache (first episode), thus excluding the above hypothesis (table 1). the second diagnosis we have considered, is pres, a rare and still poorly understood condition characterized by acute or subacute headache (usually thunderclap type), nausea, vomiting, altered mental function, seizures, stupor and/or visual disturbances, with the radiological hallmarks of reversible bilateral subcortical and cortical edema with a predominantly posterior distribution (parieto - occipital) at fluid - attenuated inversion recovery (flair)-mr sequences. pres has been described in association with hypertensive encephalopathy, immunosuppressive and cytotoxic medications, puerperal eclampsia, collagen disease, renal failure, thrombotic thrombocytopenic purpura, human immunodeficiency virus infection, acute intermittent porphyria, and organ transplantation. in our case, the lack of the typical mr findings and the negative electroencephalogram tend to rule out this diagnosis. headache attributed to benign (or reversible) angiopathy of the central nervous system (ichd - ii 6.7.3). in our case, despite the complete reversibility of all neurological signs, the lack of the radiological hallmarks strings and beads and the full headache recovery within 12 h, excludes this nosological entity (table 1). the last possible and more suitable diagnosis is that of headache attributed to transient ischemic attack (tia)ichd - ii 6.1.2 in fact, headache occurs frequently in patients with acute cerebrovascular disorders with a frequency according to different studies ranging from 7 to 65%. several authors have stressed the greater incidence of headache among patients with ischemic events, particularly vb infarcts, due to the anatomical relationship between the posterior circulation and the trigeminal system. although relatively less frequent during tia, sudden and acute headache of unknown cause, associated to dizziness or loss of balance, may represent a warning sign of vb failure. the most common symptoms of extracranial vertebral artery involvement are represented by dizziness, blurred vision and imbalance, while vertigo is more typical of intracranial vertebral artery disease. on the other hand, tia due to basilar artery failure produces, more frequently, dizziness, double vision, dysphagia, slurred speech and unilateral / bilateral weakness. symptoms and signs due to tia (either carotid or vb) must resolve by definition within 24 h but sometimes they may be very brief lasting few minutes probably due to sudden and temporary bp failure. in this perspective, sacco. have suggested to review the ichd - ii diagnostic criteria for 6.1.2 in the agreement with the new definition of tia proposed by the american heart association study group. accordingly, tia is now defined as a transient episode of neurological dysfunction caused by focal brain, spinal cord or retinal ischemia, without acute infarction thus reducing the importance of the traditional temporal criterion for the definition of tia (duration < 24 h). as a consequence, brain - mr imaging becomes now the crucial recommended tool for tia diagnosis. besides the above conditions discussed in the differential diagnosis versus the most probable hypothesis of headache attributed to transient ischemic attack (tia) or minor stroke, we can also exclude ichd - ii 10.3.2 (headache attributed to hypertensive crisis without hypertensive encephalopathy), due to the presence of long - lasting focal neurological signs. in the present case, de - novo acute headache and transient ischemia in the posterior circulation are associated with the evidence of ppha, a rare vascular anomaly of the posterior circulation that ensures a pathological anastomosis between carotid and basilar system. at the intracranial level, four embryonic arteries (trigeminal, otic, hypoglossal and proatlantal) participate to the vb development : once completed, these vessels gradually regress, but in some cases they may persist. the detection is often fortuitous during angiographic examination. the trigeminal artery is generally associated with disorders of the 3rd, 4th, 5th and 6th cranial nerves, while the otic artery may cause acoustic or facial nerves palsy. the hypoglossal artery may lead to 12th nerve palsy, glossopharingeal neuralgia or vascular disorders in the posterior circulation. it originates as a branch of the cervical part of the ica between c1 and c3 levels, passes through the hypoglossal canal and joins the lower portion of the basilar artery after a tortuous course. consequently, any significant alteration of the blood flow in the proximal ica may affect the posterior circulation with possible reversible vb symptoms. less frequent is usually associated to ischemic lesions. from a pathogenetic point of view, it seems therefore reasonable to consider, in our case, the particular vulnerability of the posterior circulation due to the ppha, the associated vascular abnormalities, and its possible secondary, transient, hemodynamic failure during hypertensive phases. our clinical picture may be classified as a real tia of the posterior circulation, also considering the complete clinical recovery within 24 h and the absence of ischemic lesions (including lacunar events) on mr investigations. moreover, the headache presented by the patient, meets the ichd - ii diagnostic criteria for headache attributed to transient ischemic attack (tia)subgroup 6.1.2. in conclusion, the persistence of carotid - basilar anastomoses, although rare entities, must be considered not only in patients with isolated or combined cranial nerve deficit, but also in the presence of cerebrovascular events involving the vb system. their association with other vascular abnormalities (hypoplasia) can confer increased vulnerability to other factors (hypertension) as in the present case. | we report the case of a 56-year - old man with acute onset of de - novo stabbing, pulsating and diffuse headache with subsequent appearance (within few minutes) of posterior fossa symptoms (vomiting, postural instability, anisocoria, incoordination, dysarthria, retropulsion) lasting 912 h. recurrent hypertensive crises were detected during the acute observation in the emergency room, even in the absence of previous history of hypertension. once subarachnoid hemorrhage and focal lesions (vascular and non - vascular) were excluded, brain computerized tomography - angiography and digital subtraction angiography disclosed the presence of left persistent primitive hypoglossal artery with bilateral vertebral artery hypoplasia and a slight aneurysmal dilation of the anterior communicating artery. brain magnetic resonance study performed 24 h after onset of symptoms was negative for recent ischemic lesions. the clinical features of this rare vascular condition are discussed as a possible cause of magnetic resonance (diffusion weighted imaging) negative vertebro - basilar transient ischemic attack. |
metastasis is a stage in which cancerous cells spread to the whole body through the lymphatic system or bloodstream. it is extremely harmful and can lead to death. despite the great efforts in the areas of prevention, diagnosis, and treatment of cancer, this disease continues to grow and is still a global killer. based on the globocan 2008 estimates the standard set of worldwide estimates of cancer incidence and mortality cancer is the leading cause of death in economically developed countries and the second leading cause of death in economically developing countries. the early diagnosis of cancer is very important in order to make the therapies more effective. the comparison between cancerous patients whose diseases were not diagnosed at early stages and those with early cancer detection with the same age, race, and sex shows that the survival rate increased by 85% between 1999 and 2005. such published statistics reflect the fact that more research is needed in the area of cancer early diagnosis. for example, this method does not require any tissue damage for detection and can also be a guide for biopsy. ct, pet, spect, and mri are considered as the most important techniques. the majority of clinical imaging systems are based on the interaction of the electromagnetic radiation with body tissues and fluids. among them, mri (magnetic resonance imaging) is one of the most useful methods. mri uses nuclear magnetic resonance for the visualization of the hydrogen nucleus in fat and water tissue. in cancer, so, mri is widely used in medicine. in this technique, magnets make the external magnetic field so nuclear spin of the protons can be along with the magnetic field. by applying radio frequency waves and removing them, signals will be received based on the different relaxation times and will convert to an image by a computer. mri contrast agents alter relaxation time of the tissue atom nucleus and thus provide a more intense signal. great efforts have been made to create a stronger, safer, and more efficient contrast agent for mri in recent years. according to the received reports of human death due to gadolinium injection and production of poor quality and low contrast images, one of these contrast agents which approved by the us food and drug administration is dimeglumine gadopentetate (commercial name magnevist). this linear ionic chemical with chemical formulations of c28-h54-gd - n5-o20 is composed of gd, dtpa (diethylenetriamine pentaacetate), and meglumine (figure 1). this drug is distributed in the extracellular space and does not cross the blood - brain barrier. this compound is the oldest contrast agent in the market world and is still highly functional in mri. nanomedicine is the application of nanotechnology in medicine. among the wide applications of nanomedicine, since nanosized particles are compatible with biological systems and their large surface area to volume ratio makes them capable of drug loading and conjugation, nanoparticle contrast media in mr imaging have been used to enhance the properties of macroscopic counterparts. so far, they have been enabled to create images with desirable contrast in several cases. dendrimers are repetitively branched nanopolymers. these materials are usually symmetrical around a central core and have often three - dimensional spherical morphology. using dendrimer has recently become an increasingly important part of mri contrast agent in pharmaceutical studies. the properties of dendrimers are distinguished by the functional groups on the surface ; however, there are examples of dendrimers with internal functionality which means that the dendrimers incorporate the functional groups in their inner space. unlike most polymers, dendrimers can be water - soluble. they also have some unique features due to their globular shape and the presence of internal cavities [10, 11 ]. one of the most important difficulties in the usage of dendrimer as a contrast media is its high toxicity in the body. to lessen this problem, the first strategy is performed using biodegradable cores or surface units which are intermediates of the metabolic pathways, and the second one is carried out by pegylation, acetylation, and so forth. in synthesis of dendrimer used in this research (namazi and adeli method), both strategies were applied. peg is used as the core of dendrimer and its surrounding groups are citric acids (the citric acid cycle intermediates). as a result, the dendrimer is probably biodegradable and has no significant toxicity. in this research, for the first time dimeglumine gadopentetate was loaded and/or conjugated to the anionic linear globular nanosized dendrimer (algnd) in order to create a novel mri contrast agent with greater stability, fewer side effects (toxicity), and enhanced tumor image contrast compared to standard drug magnevist. gadolinium(iii) chloride (99.99%), n - hydroxysulfosuccinimide sodium salt (98%), diethylenetriamine pentaacetic acid (97%), and amino salicylic acid (99%) were purchased from aldrich co. phosphate - buffered saline (powder, ph 7.4), adipic acid dihydrazide (98%), meglumine diatrizoate, diclofenac sodium salt, and mefenamic acid were obtained from sigma co. 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide, citric acid (99%), pyridine (98%), and thionyl chloride were obtained from merck co. the dendrimer was of the first generations of anionic linear globular copolymer type. using the method introduced by namazi and adeli, this dendrimer was synthesized in two steps including esterification and combination with citric acid. the monomer units of ester - liked fragment were citric acid and diacyl halide poly(ethylene glycol) was used as the dendrimer core. though most of synthetic triblock polymers are nonbiodegradable and have toxic effects on the body, the synthesized dendrimers produced using citric acid and poly(ethylene glycol) have none of these problems and are suitable to use in contrast media combination. gadopentetate was synthesized using 15 ml water as a solvent, dtpa as the ligand, and gdcl3. hot - plate and magnetic - stirrer machine was used to complete the reaction. finally, in order to increase the stability of the solution, meglumine combination as a coligand was added. all the amounts were measured using an analytical scale with an accuracy of 0.0001 g. the reaction between dtpa, gdcl3, and meglumine produced gadopentetate dimeglumine (gd - dtpa - meglumine complex). following the adding of 5 mg edc powder, 1 ml of algnd with a concentration of 20 g / l was inserted to vial of 15 ml gadopentetate dimeglumine (as mentioned before, this powder was purchased from sigma company). edc is a carboxyl group activator and it was used to activate carboxyl end of the complex (gd - dtpa - meglumine). after that, 5 mg of adh (adipic acid dihydrazide) and n - sulf - hs (n - hydroxysulfo - succinimide) were added to the solution. mechanical severe shake (sonicator machine) was used to increase the level of contact surface. using the ultrasound waves, this method is usually used in nanotechnology in order to disperse the nanoparticles in the solution, evenly. in order to purify the obtained product, dialysis bag with a cut - off point of 1000 da and water as the solvent were use. finally, these two compounds (standard and nanosized magnevist) were changed into powder for greater stability by freeze - dryer machine. quality control tests of this research include measuring the basic characteristics of the drug such as its gadolinium content, chemical structure, and molecular weight. the spectroscopy studies included liquid chromatography mass spectrometry (lc - ms) and fourier transform infrared spectroscopy. for each, lyophilized standard magnevist was applied. to determine and compare the elemental composition of the standard and nanosized magnevist, chn analyzer series ii model manufactured by perkin elmer co., was used. determination of the zeta potential and size of the drugs was performed using zeta sizer nano zs model manufactured by malvern in england which had the measurement range from 6 nm to 0.6 m, zeta potential measurement range from 120 mv to + 120 mv, and molecular weight measurement range from 10 to 2 10 daltons. microscope imaging of this research includes afm (atomic force microscope). in this study for the cellular studies, hepg2 cells (human liver hepatocarcinoma cell line) were used. the culture medium contained 5 ml fbs 10%, 0.5 ml penicillin and streptomycin mixture, 5 ml glutamine amino acid, and 0.5 ml antibiotics. after the proper cells ' growth, they were separated through trypsin enzymes and fbs solution and were centrifuged at 2000 rpm for 5 minutes. having the cells being counted, the required volume for the study was calculated (200 thousand cells). (obtained through calculating) and 4 cc culture medium were added to the wells, 200 of gadopentetate dimeglumine (magnevist) was injected to 3 wells while to the 3 other wells 200 gadopentetate dimeglumine - dendrimer (nanosized magnevist) was injected (repeated 3 times). the plates were put in 37c incubator for 90 minutes until the drug was properly exposed to cells. the content of each well was transferred to a tube and centrifuged at 1500 rpm from 10 to 15 minutes. as much as 2 ml of culture medium was added to the sediments and cells were decomposed using acid. afterwards, the gadolinium concentration of the tubes was measured through icp - aes technique. this time, in order to determine cytotoxicity of the drugs, 96-well plate was used. 20 cells (the calculated amount) and 80 culture medium were added to 21 wells. 3 doses of standard magnevist and nanosized magnevist (25, 50, and 100 l) were injected into 18 wells (repeated for three times) and no drug was added to the other 3 (control group). after 24 hours, 20 l of mtt solution was added to each well. the plate was covered with an aluminum foil (reaction in darkness) and was put in 37c incubator for 3 hours. then, the supernatant was discarded and 100 l of dmso and nacl solution was added to each well. in order to dissolve mtt in the whole solution, the plate was placed on a shaker for a few minutes. finally, their absorption was read by elaisa reader machine at 570 nm. more absorption shows more cell viability. magnetic resonance imaging was performed using 3 t mri machine in in vitro and in vivo environments. 5 doses of synthesized nanosized magnevist (0.1, 0.25, 0.5, 0.75, and 1 molar) were prepared (figure 2). 3 t mr imaging was conducted using the following protocol : standard spin echo, # of echoes = 32, te = 13/26/39/52/66/79/92/105/ 118/145/158/171/184/198/211/237/250/264/ 277/290/303/330/343/356/369/382/396/422 ms, tr = 20/50/100/200/400/2000/3000 ms, matrix = 256 256, slice thickness = 1/5 mm, fov = 18 18 cm, nex = non. standard spin echo, # of echoes = 32, te = 13/26/39/52/66/79/92/105/ 118/145/158/171/184/198/211/237/250/264/ 277/290/303/330/343/356/369/382/396/422 ms, tr = 20/50/100/200/400/2000/3000 ms, slice thickness = 1/5 mm, there are two main mechanisms in magnetic resonance imaging : spin - lattice relaxation and spin - spin relaxation. times characterizing these two mechanisms are called spin - lattice relaxation time (t1) and spin - spin relaxation time (t2). the former time indicates the thermodynamic equilibrium of magnetization, but the latter time shows exponentially signal decay. the signals of the images were obtained using dicomworks software (1.3.0.5 version) in 28 te (echo delay time) and 7 tr (repetition time). finally, computing the relaxation times of t1 and t2 was done using matlab (1.0.0.1 version) and microsoft office excel 2007 software. one adult (8 weeks old) male breast cancer model mouse was used for the study. initially, 0.1 ml of anesthetic drug (mixture of ketamine and xylazine) was given to the mouse. afterwards, 0.2 ml of nanosized magnevist was injected into the mouse (iv injection). a whole body mr imaging (at 3 t) was conducted again to compare the contrast of the image with the previous one. figures 4 and 5 show the chemical reactions between gd, dtpa (diethylene triamine pentaacetic acid), 2 meglumine (n - methyl glucamine), adh (adipic acid dihydrazide), and algnd. then, the coligand (meglumine) is conjugated with the complex for greater stability. the result is an amide compound which is known as gadopentetate dimeglumine (gd - dtpa - meglumine). after that, the algnd is loaded and/or conjugated with the compound by the help of edc (a carboxyl group activator), n - sulf - hs (removal of water effect), and adh (the liker). one of them is conjugated with free carboxyl group of dtpa and the other one is conjugated with carboxyl group of citric acid in algnd. besides the conjugation therefore, the final compound will be the new drug (gd - dtpa - meglumine - dendrimer). the gadolinium content of the gadopentetate is shown as mean sd in table 1. figures 6 and 7 indicate the ft - ir and lc - ms spectrum of standard magnevist. as it can be seen, the ft - ir spectrum of the synthetic magnevist, and standard one is compared. the wide peak in 30004000 cm shows the presence of hydroxyl and carboxyl groups. the observed peak in 27002900 cm is related to the type and nature of aliphatic hydrogen and carbon of the compound. the number reported in lc - ms spectrum (938.10000) shows the molecular weight of the compound and it is the exact number of the reported molecular weight. determining the c%, h%, and n% of the standard and nanosized gadopentetate by chn analyzer confirms the proper synthesis. as it can be observed in tables 2 and 3, the numbers calculated from chn analysis data are in accordance with molecular formula. as it was expected, attaching the drug to dendrimer reduces the charge of final compound (16.5 to 9.56 mv). the algnd has negative charge on its surface, so it can reduce the total drug charge and, as a result, the drug can penetrate a cell (figure 8). the size of the nanodrug is 41.93 nm according to the size measurement of zeta sizer (figure 9). the size differences obtained from zeta sizer and afm can be because of the different conditions of the sample in these 2 methods. in afm, the sample is dry ; however, in zeta sizer, it is a solution, so aggregation is a possibility for this result. the standard magnevist is an extracellular contrast media, so it is not able to enter a cell. attaching the drug to dendrimer makes it an intracellular contrast media. as it can be observed in table 4 and figure 11 the synthetic drug is able to penetrate into the cell probably due to its nanoscale size and total charge reduction (figure 8). table 5 and figure 12 show the cytotoxicity of gadopentetate and table 6 and figure 13 show the cytotoxicity of nanosized gadopentetate. table 7 and figure 14 indicate a total comparison between the results. as it can be seen in figure 14, cytotoxicity (in hepg2 cell line) is reduced in nanosized drug compared to standard drug in 50 and 100 doses significantly (p 0.05). the t1 graph (signal relative to tr) the lines show the different doses compared to water. in table 8, t1 is calculated via (1) and using matlab software. figure 16 also shows the impact of the synthetic drug on reduction of the t1 value in comparison with water. as it can be observed, the drug can reduce t1 by increasing its doses significantly : (1)signal = s0(1etr / t1). the t2 graph (signal relative to te) the lines show the different doses compared to water. in table 9, t2 is calculated via (2) and microsoft excel software. figure 17 also shows the impact of the synthetic drug on reduction of the t2 value in comparison with water. as it can be observed, the drug can reduce t2 by increasing its doses significantly (figure 18). so, probably it is a t1 mri contrast agent type : (2)signal = s0et2te. as it can be noticed, the relaxivity is enhanced by increasing the drug dose (linear relation). obtaining the linear equation from microsoft excel, the r1 and r2 of magnevist were reported to be 1.5 and 2.9 mms, respectively, so the synthetic drug can increase the relaxivity significantly. as it can be seen clearly, the image contrast is enhanced and the tumor is more recognizable after drug injection. the unique characteristics of the anionic linear globular dendrimer - g1 loaded and/or conjugated on magnevist make it a greater contrast media. the new drug is more stable, more soluble, and biodegradable, has the ability to enter the hepg2 cell line, and has low cytotoxicity. generally, one of the main problems with the conjugation of the drug to dendrimer surface is insolubility of the final solution. the dendrimer used in this research can take a large amount of a drug and be still soluble because of peg in its core. so, without any targeting agent, even though weakly, peg can typically play the role of the targeting agent. so, it does not interact with cell surface and does not destroy the cell membrane. besides, citric acid is one of the intermediates of metabolic pathways and is metabolized in body so quickly that it does not have toxic effects in the body and makes the entire drug biodegradable. even though the results obtained from this research are very promising, further studies are required. if a targeting agent such as monoclonal antibodies, peptides, and aptamers is loaded on the dendrimer surface, more specific contrast media will be created. | despite the great efforts in the areas of early diagnosis and treatment of cancer, this disease continues to grow and is still a global killer. cancer treatment efficiency is relatively high in the early stages of the disease. therefore, early diagnosis is a key factor in cancer treatment. among the various diagnostic methods, molecular imaging is one of the fastest and safest ones. because of its unique characteristics, magnetic resonance imaging has a special position in most researches. to increase the contrast of mr images, many pharmaceuticals have been known and used so far. gadopentetate (with commercial name magnevist) is the first magnetic resonance imaging contrast media that has been approved by the us food and drug administration. in this study, gadopentetate was first synthesized and then attached to a tree - like polymer called dendrimer which is formed by polyethylene glycol core and surrounding citric acid groups. stability studies of the drug were carried out to ensure proper synthesis. then, the uptake of the drug into liver hepatocellular cell line and the drug cytotoxicity were evaluated. finally, in vitro and in vivo mr imaging were performed with the new synthetic drug. based on the findings of this research, connecting gadopentetate to dendrimer surface produces a stronger, safer, and more efficient contrast media. gd(iii)-diethylenetriamine pentaacetate - meglumine - dendrimer drug has the ability to enter cells and does not produce significant cytotoxicity. it also increases the relaxivity of tissue and enhances the mr images contrast. the obtained results confirm the hypothesis that the binding of gadopentetate to citric acid dendrimer produces a new, biodegradable, stable, and strong version of the old contrast media. |
characterized by a triad of rapidly progressive glomerulonephritis, hemoptysis and the presence of anti - glomerular basement membrane (anti - gbm) antibodies, goodpasture syndrome is a rare, life - threatening autoimmune disease. the autoantibodies are targeted against the non - collagen domain 1 of the 3 chain of type iv collagen. the 3 chain of type iv collagen is restricted to the basement membranes of the kidney, cochlear tissue, lung, bruch 's membrane of the retina and the testis. the autoantibodies initiate destruction of the basement membranes of the kidney glomeruli, resulting in a focal necrotizing glomerulonephritis, which can be rapidly progressive and cause renal failure. antoantibody - mediated damage of alveolar basement membranes leads to diffuse pulmonary hemorrhage, which if severe enough, can lead to respiratory failure. pulmonary symptoms often precede renal symptoms, and may occur weeks to months earlier. the trigger for this autoantibody formation is unknown ; however, environmental factors are believed to unmask the usually hidden epitopes, eliciting autoantibody formation. postulated environmental factors include viral infection, hydrocarbon solvent exposure and smoking [3, 4 ]. diffuse pulmonary hemorrhage in patients with anti - gbm autoantibodies is seen almost exclusively in active smokers. additionally, this autoimmune disease is associated with certain human leukocyte antigen (hla) subtypes, such as hladrb1 1501 and 1502 and hla - dr4, has a slight male preponderance and is known to occur in two age peaks : the third decade and the fifth and sixth decades [5, 6 ]. here, we report an unusual case of a 40-year - old man with clinical evidence of goodpasture 's syndrome, a negative anti - gbm antibody serum result, eosinophilia and delta granule pool storage deficiency. a 40-year - old caucasian man was admitted to the hospital complaining of a 3-week history of slight cough and increased shortness of breath on exertion and a 2-week history of occasional hemoptysis. the patient 's medical history was scarce as he had not seen a doctor in over 20 years. upon questioning, he reported a 33 pack - year history of smoking, a 27 -kg weight gain over the previous 5 years due to inactivity, no sexual contact or activity, no contact with sick people and no intravenous drug use in the past or present. besides being morbidly obese, he had no other known medical illnesses. chest x - ray imaging revealed bilateral haziness, with extensive involvement of the right lung and the left lower lobe. on physical examination, the patient was afebrile, and he had coarse breath sounds bilaterally with rare rhonci. a complete blood count demonstrated a white blood count of 9.6 10 cells / l (4.411.3 10 cells / l) with 0.96 10 eosinophils / l (00.45 10 eosinophils / l). he was put on nasal oxygen to improve oxygenation ; however, despite this intervention, blood gases worsened. bronchoscopy was performed, which revealed diffuse airway bleeding ; however, an active bleeding site was not identified. a significant amount of blood was seen in the patient 's mouth on intubation, and suctioning through a nasogastric tube yielded 200 ml of coffee ground contents. an extensive workup was done in an attempt to discern the etiology of his hemorrhagic lung disease. tests included those for autoimmune diseases, acquired hemolytic anemias, microbial infection and coagulation disorders. a cold agglutinin titer was reported positive ; however, a coomb 's test was negative. rheumatoid factor and c - reactive protein levels were elevated at 23 u / l (< 20 u / l) and 44.67 mg / dl (03 mg / dl), respectively. he tested negative for anti - neutrophil cytoplasmic antibodies (ancas) and anti - gbm antibodies. one of two blood cultures revealed gram - positive cocci in clusters, later identified as oxacillin - resistant staphylococcus hominis. the patient 's international normalized ratio remained slightly elevated at around 1.4 during his stay, with an unknown etiology. blood was consequently sent for platelet electron microscopy study, which revealed platelets with an average of 2.79 delta granules per platelet (46 delta granules / platelet) consistent with delta granule storage pool deficiency. the patient 's condition continued to deteriorate during his 14-day hospital stay, with worsening anemia requiring receipt of multiple blood products, worsening oxygenation refractory to increased fraction of inspired oxygen (fio2), hypertension, hypernatremia, hypocalcemia, hypermagnesemia, blood urea nitrogen and creatinine reaching as high as 35 mmol / l (2.98.2 mmol / l) and 230 mol / l (831 mol / l), respectively, indicating kidney failure, and alanine amino transferase (alt or serum glutamic pyruvic transaminase) and aspartate amino transferase (ast or serum glutamic oxaloacetic transaminase) of 371 u / l (436 u / l at 37c) and 173 u / l (833 u / l at 37c), respectively, indicating liver failure. still, the patient developed progressive lung consolidation bilaterally, persistent hypoxia and recurrence of a significant output of coffee ground material through his nasogastric tube. eventually, chest x - rays revealed bilateral white out of the lungs and an accumulation of right pleural fluid. a lung biopsy was considered at various points during his decline ; however, the patient was never well enough to undergo such a procedure. by the 14th day in the hospital, the patient was oozing blood from multiple mucosal sites and areas of needle sticks, and the patient was deemed critically ill with a poor prognosis due to worsening kidney failure and anemia. sections of the lungs revealed extensive intra - alveolar hemorrhage, edema, hemosiderin - laden macrophages, focal neutrophilic infiltration, wide - spread chronic inflammation and total disruption of the normal lung architecture (figures 1 and 2). microscopic examination of the kidneys revealed extensive tubular cell nuclei dropout, consistent with acute tubular necrosis, which was caused by his persistent hypoxia secondary to his respiratory failure, and mesangial cell proliferation in the glomeruli, fibrin in the bowman spaces and occasional early crescent formation secondary to inflammatory destruction of the basement membranes in the renal glomeruli. the most significant study involved immunofluorescence, which revealed focal faint linear immunoglobulin g (igg) deposits along the alveolar septa and strong extensive peripheral linear igg deposits in the capillary loops of the renal glomeruli (figures 3 and 4). 3.(a) low - power photomicrograph of linear igg deposits in alveolar septa on immunofluorescence in a lung tissue section. (b) high - power photomicrograph of linear igg deposits in alveolar septa on immunofluorescence in a lung tissue section. 4.photomicrograph of linear igg deposits along the gbm of a kidney tissue section shown via immunofluorescence. (a) low - power photomicrograph of linear igg deposits in alveolar septa on immunofluorescence in a lung tissue section. (b) high - power photomicrograph of linear igg deposits in alveolar septa on immunofluorescence in a lung tissue section. photomicrograph of linear igg deposits along the gbm of a kidney tissue section shown via immunofluorescence. goodpasture syndrome is a rare autoimmune disorder characterized by glomerulonephritis, hemoptysis and autoantibodies directed against a non - collagenous domain of the 3 chain of collagen type iv present in a few tissue basement membranes. if not diagnosed and treated early, patients with goodpasture syndrome may develop respiratory and renal failure and die, or become dependent on dialysis if they survive. many clinicians diagnose this syndrome with a variety of assays used to detect serum anti - gbm antibodies. renal and lung tissue biopsies are also viewed as valuable in making the diagnosis, as the anti - gbm antibodies may be detected in these specimens by immunohistochemistry or immunofluorescence techniques. a linear pattern of immunoglobulin along the basement membrane of renal glomerular capillaries and alveolar septa seen by immunofluorescence or immunohistochemistry is consistent with goodpasture syndrome. the latter diagnostic tests are important in suspected clinical cases in which the serum anti - gbm antibody test is negative, as up to 15% of patients with goodpasture syndrome may have no detectable circulating antibodies. this was the case in our patient, in which his repeated anti - gbm antibody tests came back negative ; however, the presence of these antibodies was confirmed by immunofluorescence in lung and renal tissue sections. further interesting findings in our patient, which to our knowledge have not been reported with any other case of goodpasture syndrome, were those of delta granule pool storage deficiency and eosinophilia. there are at least a few cases of goodpasture syndrome to our knowledge that have been reported to occur in the context of negative anti - gbm serum results. reported a case of a 55-year - old woman who presented with dyspnea and hemoptysis, bronchoscopy revealing diffuse alveolar hemorrhage, negative anti - gbm antibody by enzyme - linked immunosorbant assay, positive perinuclear anca at a dilution of 1:160 and glomerular crescents in renal biopsies under light microscopy. immunofluorescence also demonstrated weak linear staining of the gbms with anti - complement 3 (anti - c3) sera and strong linear staining with anti - igg sera. another case of anti - gbm serum antibody - negative goodpasture syndrome reportedly occurred in a 44-year - old female with a 3 year history of recurrent hemoptysis and shortness of breath, yet clinically normal renal function. initially, she had been treated for klebsiella pneumoniae after a positive sputum culture. on repeat presentation with hemoptysis during this period, her illness had been labeled as recurrent acute respiratory distress syndrome. on her fourth presentation with hemoptysis, other test results included a positive rheumatoid factor, autoantibodies, weakly positive anti - double stranded deoxyribonucleic acid negative cytoplasmic - anca and extensive ground glass appearance on a chest computed tomography scan. lung biopsies showed linear deposition of igg in the alveolar capillary basement membranes using immunoperoxidase staining, and linear igg and c3 were seen along the renal capillary walls with immunofluorescence. finally, a case of a 27-year - old male with goodpasture syndrome and undetectable anti - gbm circulating antibodies was reported by hellmann. this patient, similar to our patient, developed dyspnea and hemoptysis, which eventually led to respiratory failure requiring intubation and mechanical ventilation. also like our patient, he was a heavy smoker and tested negative for ancas, anti - nuclear antibodies and a multitude of other autoantibodies. his disease was confirmed on histological lung section by the presence of a faint but linear deposition of igg antibodies along the alveolar basement membranes. several proposed mechanisms for why serum anti - gbm tests may be negative in some patients with goodpasture syndrome have been offered. one proposed explanation is that the antibodies are of high affinity and are removed from the patient 's plasma by being bound to the kidney and alveolar basement membranes. on the contrary, the circulating serum antibodies may be of lower affinity than those that are tissue bound and thus are more easily washed away during the wash - out step of the assay. finally, the assay 's renal tissue may have a different epitope than that present in the native kidney [1, 7 ]. for patients who present promptly with hemoptysis and subsequently receive steroid therapy early in the disease process, negative anti - gbm serum results along with only focal linear deposits in tissues may be due to steroid - induced immune suppression. two unusual aspects of our patient 's case, unknown to us to have occurred concomitantly in other patients with goodpasture syndrome, include delta granule pool storage deficiency and eosinophilia. delta granule pool storage deficiency is a heterogeneous disorder presenting with abnormalities in the second wave of platelet aggregation, a bleeding tendency and a decreased number of delta granules in platelets. most commonly, patients experience mucocutaneous hemorrhage, excessive bleeding postoperatively and postpartum, epistaxis and easy bruising. no evidence of parasites was found during the autopsy or in microscopic examination of tissues, nor ova or parasites detected in stool samples. also, no vasculitis was observed in tissue samples on histologic examination. in an article published in the cleveland clinic journal of medicine on diffuse alveolar hemorrhage, eosinophilia is said to be rare or mild in goodpasture syndrome ; however, the parameters of mild are not defined. still, it is possible that his eosinophilia was the result of an allergy developed from his reported unsanitary living conditions, which included an abundance of trash, dead mice and black mold. the diffuse pulmonary hemorrhage associated with goodpasture syndrome occurs almost exclusively in active smokers, and is a postulated cause of unmasking the epitope which elicits the formation of the anti - gbm autoantibodies. thus, his 33 pack - year smoking history put him at risk of developing this autoimmune disease, as well as increased his risk of diffuse pulmonary alveolar hemorrhage. additionally, his platelet disorder likely worsened his hemorrhagic lung condition by increasing his likelihood to bleed excessively. finally, his negative anti - gbm antibody serum result and rapidly progressive condition prevented the ability to attain a lung or renal biopsy to establish the etiology of his disease, and thus, the correct treatment could not be determined. this case demonstrates the difficulty in diagnosing goodpasture syndrome in an unusual patient in whom the anti - gbm antibody serum results are negative and a biopsy is unattainable, and the grave consequences in missing such a diagnosis. | goodpasture syndrome is a rare, life - threatening autoimmune disease characterized by a triad of rapidly progressive glomerulonephritis, a hemorrhagic pulmonary condition and the presence of anti - glomerular basement membrane (anti - gbm) antibodies. the antibodies initiate destruction of the kidney glomeruli, resulting in a focal necrotizing glomerulitis, which may progress rapidly to renal failure. autoantibody - mediated damage of alveolar basement membranes leads to diffuse pulmonary hemorrhage, which in some cases may be severe enough to cause respiratory failure. many clinicians use a variety of assays to detect serum anti - gbm antibodies ; however, these tests may be falsely negative in up to 15% of patients with goodpasture syndrome. here, we report an unusual case of a 40-year - old man with clinical evidence of goodpasture syndrome, a negative anti - gbm antibody serum result, eosinophilia and delta granule pool storage deficiency. after a 14-day hospital stay and extensive workup, as well as treatment with antibiotics, steroids and ventilator support for respiratory failure, the patient continued to deteriorate and entered multisystem organ failure. the family decided to withdraw ventilator support, and the patient expired. immunofluorescence testing for anti - gbm autoantibodies on lung and kidney tissues during an autopsy confirmed the diagnosis of goodpasture syndrome. |
echinococcal disease in humans is a parasitic tapeworm infection caused by a larval stage (the metacestode) of echinococcus species (echinococcus granulosus, echinococcus multilocularis, echinococcus oligarthus, or echinococcus vogelis). the infection can be asymptomatic or severe, causing extensive organ damage and even the death of the patient. human hydatidosis is a parasitic infection of the liver and other organs caused by the flatworm echinococcus, most commonly echinococcus granulosus which is a 5 mm long hermaphroditic tapeworm that has dog, foxes or coyotes as the definitive host and sheep, swine, cattle, and zebra as the intermediate host. man is an accidental, intermediate host, and infection of humans represents a terminal event (dead end) for the parasite. once within the man or other intermediate host the ingested eggs hatch in the duodenum to release the true larvae (oncospheres) that penetrate the mucosa of small intestine and enter the portal circulation. liver acts as the first effective filter for most of the larvae and therefore being the most common site of involvement (65 - 75%). if the larvae pass through the first filter, they reach the lungs which are the second most frequently involved site (10 - 25%). if the larvae are not trapped in either liver or lungs, or if they by - pass the liver by traveling via lymphatics, it may lodge itself in any part of the body including the peritoneal cavity (8 - 18%), spleen (2 - 3%), kidneys (1 - 4%), uterus and adnexia (0.5 - 1%), retroperitoneum (0.5 - 1%), pancreas (0.5 - 0.8%), subcutaneous (1 - 2%), mediastinum (0.1 - 0.5%), gall bladder (1%), brain (2%), seminal vesicle, spinal, and others (0.1 - 3%). we present our experience with atypical sites of hydatidosis, including the diagnostic evaluation and surgical treatment. two hundred and forty - four patients with hydatid cysts managed surgically from january 2005 to december 2009 at s.k.i.m.s., soura, srinagar, jammu and kashmir, india, were evaluated retrospectively. of these patients 142 (58.1%) were males and 102 (41.8%) females. liver was involved in 187 patients, of which 161 (65.9%) had had isolated liver disease, 20 (8.1%) had associated lung cysts, and another 6 (2.4%) patients had concomitant echinococcosis at atypical locations. fourteen patients (5.7%) had primary isolated hydatid cysts involving atypical locations. only those patients with hydatid disease at atypical locations (n=20) were included in the study, including the six patients with concomitant disease of the liver. the atypical locations of the disease included the gall bladder, peritoneum, spleen, ovary, subcutaneous, seminal vesicle, spinal, pancreas, right kidney, mediastinal, muscle, and the brain [table 1 ]. atypical localization of hydatid cysts preoperative diagnosis was established by the history, clinical examination, complete blood counts, liver and kidney function tests, serological tests (enzyme linked immunosorbent assay and indirect hemagglutination test), x - ray chest, ultrasound and magnetic resonance imaging (mri) or contrast enhanced computerized tomography (cect). nonspecific abdominal pain and a nontender palpable abdominal lump were the most predominant symptoms ; other symptoms varied according to the localization of the cyst. four patients with atypical locations were asymptomatic, which included two cases with peritoneal hydatid, one case each of isolated splenic and renal hydatid. patients with brain and spinal hydatid presented with neurological symptoms, while the one with seminal vesicle hydatid presented with lower urinary tract symptoms (luts). acute popliteal artery embolism due to a laminated membrane was the presentation in the patient with a primary mediastinal hydatid cyst, which had ruptured into descending thoracic aorta [table 1 ]. diagnosis was confirmed by hydatid serology, ultrasonography, mri / cect figure 1, figure 2, figure 3, figure 4, figure 5, figure 6, figure 7 and figure 8, and histopathological examination of the specimen. another cystic lesion with thick calcified wall was seen in segment - vi of liver measuring 55 cm. a calcified area 2 cm in size was also seen medial to the above - calcified cystic lesion. ihbr and cbd were normal cect abdomen showing cystic lesion of the spleen involving upper half of the organ mri showing multicystic swelling overlying gluteus maximus which is hyperintence on t2wi / stir and hypointence on t1wi images. thick septa seen within and surrounding tissue showing edema axial t2wi (mri) showing hyper intense, multicystic lesion with multiple daughter cysts in relation to the right seminal vesicle axial t2wi (mri) showing hyper intense, multicystic lesion with multiple daughter cysts in the para spinal region with extension into epidural space cect abdomen showing a cystic lesion (unilocular) involving pancreas cect chest documented a primary mediastinal hydatid cyst (cystic laminated structure) eroding into the descending thoracic aorta with contrast leak from aorta into the mediastinal cyst ncct head showing a multicystic lesion, with multiple daughter cysts in left cerebral hemisphere and compressing the ventricles and opposite lobe hydatid disease involving atypical sites was seen in a total of 20 (8.1%) patients. among this study group, primary isolated hydatid cysts involving atypical locations were present in 14 (5.7%) patients. these included solitary cases of seminal vesicle (0.4%), spinal (0.4%), pancreatic (0.4%), renal (0.4%), mediastinal (0.4%), and muscular (0.4%) hydatid cysts, while involvement of subcutaneous tissue and brain was seen in two each (0.8% each) of the patients. atypical locations involved in these included peritoneum in 3 (1.2%) and gall bladder (0.4%), spleen (0.4%), and ovary (0.4%) in one each [table 1 ]. nephrectomy, cholecystectomy, ovarian cystectomy, distal pancreatectomy and splenectomy, were performed whenever cysts invaded these organs. classic manoeuvre by dowling and orlando was used in management of cerebral hydatid cyst. epidural hydatid with paravertebral extension all the patients were given postoperative chemotherapy (albendazole 10 mg / kg / day) for three cycles of 21 days each with a gap of 1 week between each cycle. morbidity was minimal, with a wound infection recorded postoperatively in one case treated with splenectomy. the diagnosis of hydatid cyst was confirmed on histopathological examination of the specimen in all cases. follow - up was performed twice a year with ct scan and antibody titers, with no documented recurrence. the disease still continues to be a serious problem in countries like australia, new zealand, middle east, africa, india, south america, turkey, and southern europe. the disease is attributed to occupational exposure during farming practices (sheep rearing), particularly in rural areas ; ingestion of contaminated vegetables, drinking of egg - contaminated water (containing hexacanth larvae), and traditional intake of mutton and beef. because the practice of close contact with domestic animals such as dogs is rare in kashmir, which is muslim dominated, the sheep - dog association apparently seems to be most commonly implicated in the life cycle of the parasite. buffalo - dog, goat - dog, cow - dog, and horse - dog associations are also possible. although liver and lungs are the most common sites involved, various atypical sites involved by hydatid cysts and reported in literature include those of peritoneal cavity, spleen, kidneys, uterus and adnexia, retroperitoneum, pancreas, subcutaneous, mediastinum, gall bladder, brain, seminal vesicle, para - spinal, and others. in our study, we presented atypical locations of hydatid cysts from a single tertiary care center. although portal blood stream remains the main pathway of parasite spread, normally existing porto - caval shunts, lymphatic invasion by the parasite, and retrograde migration from vena cava to subclavian vein have been documented and explain some of these rare sites. it is well known that specific local or general symptoms and signs of hydatid disease do not exist. the majority of cases are diagnosed following incidental findings at imaging examinations for sometimes unrelated complaints. the uncommon localization frequently causes diagnostic problems and specific diagnostic tests do not have 100% reliability in these cases. hydatid disease in extrahepatic locations usually follows a silent clinical course unless it grows and produces pressure symptoms or develops complications which may include local pressure, rupture, secondary infection, and an allergic reaction. most of these cases are associated with cysts at the primary location, but in our series all except six patients had isolated primary location of hydatid disease at an atypical site. in our series, a lump was the presenting feature in cases with hydatid disease involving subcutaneous tissue and thigh muscle. patient with para spinal disease presented with low back pain, weakness, and paraplegia. pain abdomen and organomegaly / lump was seen in gall bladder, pancreatic, and splenic hydatid. seminal vesicle hydatid presented with lower urinary tract symptoms, while the patient with brain hydatid presented with severe headache, vomiting, drowsiness, and hemiparesis. acute popliteal artery embolism due to a laminated membrane was the presentation in the patient with a primary mediastinal hydatid cyst, which had ruptured into descending thoracic aorta. it is important to think of hydatid disease as a possibility in patients with nonspecific symptoms with a cystic lesion at any location, especially in endemic areas like india. highly sensitive tests include an indirect hemagglutination test (iha), and a latex agglutination test (la). specific tests include double diffusion test (dd), immunoelectrophoresis (iep), enzyme linked immunosorbent assay (elisa), and radioallergosorbant test (rast). abdominal usg, cect, and mri are highly sensitive and specific and can reveal the morphological characteristics of a cyst, its exact site, size, number, its relation with surrounding structures, and can distinguish it from other lesions. it is most effective in alveolar hydatid, less so for liver infection, and essentially ineffective for the diseases of bone, brain, eye, gall bladder and other sites. many authors recommend preoperative use of antihelmenthics to sterilize the cyst, and reduce the chances of spillage, anaphylaxis, and dissemination at surgery. our patients received albendazole (10 mg / kg / day) for 4 weeks preoperatively. surgery still remains the mainstay of treatment for hydatid disease with special attention to avoid any spread of hydatid with subsequent secondary echinococcosis. indications for surgery include large cysts with multiple daughter cysts, superficial location amenable to rupture, cysts exerting pressure on adjacent organs, and cysts in ectopic locations such as seminal vesicle, brain, bones, spleen, kidneys, etc. the type of procedure is selected by taking into consideration the cyst location. in our series of atypical and rare hydatid cyst locations, we performed total cystectomy (cystopericystectomy) in patients with disease involving the muscle, subcutaneous tissue, mediastinum, seminal vesicle and peritoneum. cholecystectomy, nephrectomy, ovarian cystectomy, distal pancreatectomy, and splenectomy was performed in patients with gall bladder, renal, ovarian, pancreas, and spleen hydatidosis respectively to eradicate the disease, avoiding secondary hydatid spread. epidural hydatid with paravertebral extension was dealt by d 10/11 lamnectomy and complete cyst excision. during exploration of hydatid cysts, the operative area was carefully packed with pads immersed in scolicidal agents to avoid local spillage and contamination from the surgical manipulations. late complications which should be kept in mind are the local recurrence of the disease and development of hydatidosis at the primary sites. the patient has to be kept on regular follow - up paying attention to these possibilities. echinococcosis can appear at any site of the human body, and so should always be considered in the differential diagnosis of cystic space - occupying lesions or unidentified tumor formations in patients from endemic areas. proper surgical and medical management to avoid any recurrences, and a regular follow - up, are of utmost importance to detect any late complications such as local recurrence of the disease and development of hydatidosis at the primary sites. | introduction : the hydatid disease most often involves the liver and the lungs. the disease can involve any part of the body except the hair, teeth and nails. primary extrahepatico - pulmonary hydatid cysts are rare and only a few sporadic cases have been reported.materials and methods : two hundred and forty - four patients with hydatid cysts managed surgically from january 2005 to december 2009 were evaluated retrospectively. fourteen (5.7%) patients had isolated involvement of the atypical sites, while six (2.4%) also had a primary involvement of liver.results:the cysts were present in gall bladder (0.4%), peritoneum (1.6%), spleen (1.6%), ovary (0.4%), subcutaneous (0.8%), seminal vesicle (0.4%), spinal (0.4%), pancreas (0.4%), kidney (0.4%), mediastinal (0.4%), muscle (0.4%), and brain (0.8%).discussion and conclusions : involvement of sites other than liver and lungs by hydatid disease is rare. symptoms are related to size, location or possible complication of the cyst. it should be strongly suspected in differential diagnosis of all abdominal cysts especially in an endemic area. proper surgical and medical management to avoid any recurrences, and a regular follow - up, are of utmost importance to detect any late complications such as local recurrence of the disease and development of hydatidosis at the primary sites. |
in this retrospective, single center study, we reviewed charts from 68 patients with ana comprehensive panels. inclusion criteria were patients 18 years old and had an ana cp billing code between may 2015 and october 2015. variables included age, sex, specialty of the ordering physician, test indication, and ana result. our institutional review board determined this study was non - human subjects research ; institutional approval was not required. the mean age of the sample was 54.419.4 years old, and 60.3% were female. internal medicine ordered the majority of ana cps (83.8%) followed by family medicine (7.4%), emergency medicine (2.2%), and psychiatry (2.2%). hypercoagulable work up, transaminasemia and skin rash were the most frequent indications for ordering the ana cp (8.8% for each indication). the remaining indications (73.6%) covered a broad spectrum and combined as an other category. all the ana cps ordered were considered to be inappropriate including the three patients who had previous history of rheumatological disease and did not require re - testing. sixty - three ana comprehensive panels were negative for rheumatological disease (92.6%, fig. multiplex immunoassays have led to a paradigm shift in the methodological testing of autoimmune diseases. high throughput multiplex immunoassays have supplanted the use of traditional methods like indirect immunofluorescence (iif) and elisa. iif testing is subject to poor specificity, has a high false positive rate, lack of standardization in substrate and dilution protocols, and interobserver variability in pattern interpretation (2). enzyme immunoassays (eia) testing removes the subjective variations of iif testing (3) ; however, there exist interlaboratory method variations and heterophile antibody interferences causing false - positive results. the correlation between elisa and mutiplex assays is high, with a 90% concordance (4). ana testing with multiplexed microsphere fluorescence allows for rapid quantification and efficient profiling of multiple clinically significant antibodies in a single run of assay (5). the multiplex ana screen is a composite screen which tests for 11 specific autoantibodies that are known to be associated with autoimmune diseases. if none of the specific antibodies are present, the ana screen is reported as negative. positive screens are reflexed, and the reflexed antibodies are resulted semi - quantitatively as numeric antibody indices (ai) (5). the authors identified that the major reason behind inappropriate ana comprehensive panel ordering could be due to physician unawareness regarding test components performed under the order panel. ana testing by mutiplex assays should be performed in a bi - leveled sequence with an initial screen followed by comprehensive antibody testing only if ana screen returns positive. ana comprehensive panel is not a reflex laboratory test and examines directly for specific antibodies without going through an initial screen. comprehensive antibody testing without an initial screen leads to unnecessary cost burden on the patient and a waste of laboratory resources. in our study, net calculated value of incurred losses resulting from comprehensive lab order (ana cp) testing amounted to $ 66,000 over a 6-month study period. the ana comprehensive panel does not provide any further utility over the ana screen with reflex. hence, the ideal test of choice should be ana screen with reflex. also, the term ana comprehensive panel gives the physicians a sense of it being a more complete test over the ana screen, thus leading to inappropriate use of the second - level testing without going through the initial screen. over the last few years, ana comprehensive panels have emerged as a very convenient test with fewer false positives and the convenience of being completed in a single run, resulting in the ordering physician choosing it over the appropriate ana screen. it is important to recognize that autoantibody testing is fraught with low specificity and false - positive results, leading to potential over - diagnosis and mistreatment. in fact, false positives occur in a significant proportion of healthy population (6). ana testing in the wrong clinical setting, especially in the absence of specific signs and symptoms suggestive of rheumatic diseases can potentially lead to misdiagnosis and unnecessary rheumatology consultations. also, repeat ana testing is not warranted in patients with established rheumatological disease (as noted in 3 of 68 in our study patients) except to monitor disease activity, in which case, repeating specific antibody titers may be considered and not the ana comprehensive panel. a retrospective study on patients who had ana testing suggested that a large proportion (30%) of them had non - specific and unrelated signs and symptoms (7). incorporation of ana testing into initial lab order bundles in an effort to expedite diagnoses ; overestimation of the pretest probabilities ; failure to consider non - rheumatological factors expected to cause false - positive results contribute to ana testing among physicians. one of the limitations of our study was that it was a single institutional experience. we initially conducted this as a pilot study and based on the results in our center, we intend to conduct the study across all advocate healthcare hospitals. ana testing with multiplex immunoassay systems allows for rapid profiling of multiple analytes in a single run of assay and have few false - positive results compared to conventional lab methods. however, it is important to educate physicians on following a sequenced diagnostic algorithm based on the guidelines laid down by american college of rheumatology to avoid unnecessary higher level testing and increase cost burden on their patients. also, inappropriate ana testing without adequate pretest probability estimation after careful history taking and clinical examination can lead to over - diagnosis with unnecessary consultations and should be avoided. the authors have not received any funding or benefits from industry or elsewhere to conduct this study | healthcare providers use antinuclear antibodies (anas) to screen and diagnose patients with autoimmune diseases. in the recent years, commercial multiplex ana kits have emerged as a convenient and fast diagnostic method. diagnostic testing should follow sequenced algorithms : initial screen followed by specific antibody analysis. second - level testing as an initial screen for autoimmune disease is inappropriate. we reviewed 68 patients with ana comprehensive panels over a 6-month period from may 2015 to october 2015. we assessed appropriateness and estimated incurred losses from inappropriate testing. we found 92.6% (63 out of 68) of the ana comprehensive panel results to be negative. incurred losses from inappropriate ana comprehensive panel testing were $ 66,000. physicians should become familiar with ana - sequenced diagnostic algorithms to avoid unnecessary higher level testing. |
we conducted a cross - sectional survey of lprss in lahore (figure), which is the capital of the punjab province in pakistan. in each of 280 lprss, we collected tracheal swab samples from 5 randomly selected chickens and pooled them into 1 composite sample, totaling 280 pooled samples. the samples were characterized at the world organisation for animal health / food and agriculture organization of the united nations national reference laboratory for avian influenza in padua, italy. location of live poultry retail shops (x) in 5 towns in lahore, pakistan, where avian influenza a(h9n2) virus isolates were identified in chickens, 20092010. of the 280 samples, 10 tested positive for h9n2 subtype by real - time reverse transcription pcr (rrt - pcr) (3) and virus isolation test (united nations www.oie.int/fileadmin/home/eng/health_standards/tahm/2.03.04_ai.pdf) (table 1). each of the 10 h9n2 isolates was characterized by sequencing for 6 gene segments (hemagglutinin [ha ] : neuraminidase [na ], nonstructural [ns ], matrix [m ], and polymerase basic 1 and 2 [pb1, pb2 ]) ; 2 isolates (a / chicken / pakistan/10rs3039 - 283 - 11/2010 and a / chicken / pakistan/10rs3039 - 289 - 186/2010) were sequenced for all 8 gene segments (ha, na, ns, m, pb1, pb2, polymerase [pa ], and nucleoprotein [np ]), as described (4). the ns gene sequence of a / chicken / pakistan/10rs3039 - 284 - 11/2010 could not be deposited due to poor data quality. we generated neighbor - joining phylogenetic trees for all gene segments using the distance - based method in mega version 5.2.2 (http://www.megasoftware.net/). we calculated bootstrap values based on 1,000 replicates of alignment (5). ha and na genes of viruses in this study tightly clustered within the g1 lineage along with h9n2 viruses from pakistan, india, iran, israel, saudi arabia, and bangladesh, suggesting derivation from a common ancestor : a / quail / hong kong / g1/97 (technical appendix figure panels a, b). m and np genes clustered within the g1 lineage (technical appendix figure panels c, d) along with an influenza (h7n3) isolate from pakistan (a / chicken / karachi / narc-100/2004 ; nucleotide identity > 96% for m gene and 95% for np gene). two polymerase complex genes, pb1 and pa, and the ns gene did not cluster within g1 lineage or any other established eurasian lineages : these gene sequences made a separate well - supported cluster with highly similar h9n2 viruses that circulated in pakistan (20052008), iran, india, and bangladesh ; these sequences had a high sequence identity (> 95%) with a / chicken / karachi / narc-100/04 (h7n3) (2,6,7) (technical appendix figure panels e, f, g). the pb2 segment clustered separately with h9n2 viruses from the subcontinent and middle east (technical appendix figure panel h), except a / chicken / karachi / narc-100/04. these results indicate a separate indian subcontinental lineage of h9n2 viruses has emerged (2). on the basis of these analyses, we could conclude that internal genes pb1, pa, and ns of these viruses originated by intersubtypic (between different ha subtypes) reassortment events from local h7n3 viruses circulating in pakistan (nucleotide identity > 95%). this suggests that intersubtypic reassortment events continuously result from mixing of aiv subtypes in domestic poultry and wild birds in pakistan (8), and that pb2, m, and np genes were acquired by intrasubtypic reassortment between h9n2 viruses of g1 lineage circulating within pakistan. these results support speculation that the currently circulating h9n2 lineage is a reassortment of g1 lineage from hong kong and the highly pathogenic h7n3 virus that circulated in pakistan and can be assigned to genetic group b (8). we aligned amino acid sequences of current viruses and compared them to representative h9n2 lineages. when compared to the prototype g1 viruses, h9n2 viruses isolated from lprss showed that they have evolved to acquire mammalian host - specific mutations throughout the genome (technical appendix table 1). of these mutations, certain amino acid substitutions throughout the viral genome have become fixed (9). all lprs isolates possessed the k - s - s - r motif at the cleavage site. the presence of lysine at position 4 was observed in h9 isolates from the indian subcontinent (2,9), but it is uncommon elsewhere. amino acid signature changes of human influenza viruses were also observed in internal gene segments (table 2). each of the 10 isolates had the ql substitution (h3 numbering) in the receptor - binding site of ha, correlating to a shift in affinity from avian - type sialic acid receptor to human - type (10). we identified 3 representative substitutions : e / t a in 9 viruses and e / tv in 1 virus, and qi in all 10 viruses (h3 numbering). the outcomes of these substitutions have not been investigated ; further study is needed (2). glycosylation sites at positions 551, 218, and 206 were absent in the study viruses, suggesting a frequent alteration in sequences from this region (2,6,9) and possibly signifying the selected adaptation of h9n2 to poultry (10). we did not find an rk substitution, which is associated with resistance to the sialidase inhibitors oseltamivir and zanamivir, in the na proteins of any of the 10 lprs virus isolates. hb sites were also well conserved with few substitutions (ke in 5 viruses, kg in 1 virus, and sa and wr in all 10 viruses). an additional glycosylation site was present at position 44, which is believed to enhance virulence caused by altered antigenicity or sialidase activity (11) (technical appendix table 1). many residues in nucleoprotein and polymerase are considered determinants of the host range of aivs and increase virulence or replication in the mammalian host (2,10,12). the analyses of internal genes showed that these viruses also contained mammalian host - specific markers (2,8) that have become permanent in m protein (m1, vi, ta ; m2, eg, lf) ; in pb1 protein (lp) ; and in ns1 protein (va) of all lprs isolates and in np (ed) of the 2 isolates we sequenced (technical appendix table 2). in m2 protein, all viruses contained an uncommon k - s - e - i sequence as a pdz ligand motif in the ns protein. residue isoleucine at the c - terminus of pdz ligand motif has been reported as a rare substitution (12). ns also harbored ek mutation in the c - terminal, which has been demonstrated to modulate pathogenicity of aivs (13) and appeared to be a rare amino acid signature, although in this study it was observed in all 10 virus isolates from chickens in lprss. our analysis confirmed that continuous gene reassortment has occurred among influenza a(h9n2) viruses since their emergence in poultry in pakistan. because h9n2 viruses infect multiple species, they may donate genes to emerging human pathogens ; it has been observed that h7n9 acquired internal genes from the avian h9n2 virus (14). in wet markets, availability of freshly slaughtered poultry, live poultry transportation, and mixed trading of domestic animals provide a favorable environment for gene reassortment, mutation, and interspecies transmission of aivs (15). continuous circulation of these viruses in lprss increases the chances of their evolution into new genotypes. close contact of humans and poultry in lprss with no biosecurity barriers increases the risk for emergence of novel influenza viruses with zoonotic or human pandemic potential. continued surveillance in lprss is essential to better understand the public health risk posed by h9n2 aivs. technical appendix. comparisons of structure and pathogenicity determinants of avian influenza isolates and phylogenetic distribution of 10 sequenced viruses from samples from chickens in live poultry retail shops in lahore, pakistan, 20092010. | phylogenetic analysis of influenza viruses collected during december 2009february 2010 from chickens in live poultry retail shops in lahore, pakistan, showed influenza a(h9n2) lineage polymerase and nonstructural genes generate through inter- and intrasubtypic reassortments. many amino acid signatures observed were characteristic of human isolates ; hence, their circulation could enhance inter- or intrasubtypic reassortment. |
squamous cell carcinoma (scc) is the second most common form of skin cancer after basal cell carcinoma. risks for scc include light - coloured skin, long - term sun exposure (uv rays), old age, exposure to certain chemicals, burns, old scars, some types of the human papilloma virus. saree is the indian traditional female costume, which is her lifetime clothing. in 1945, khanolkar and suryabai described this cancer marked by hypopigmented and thickened scars which were more likely to progress into malignant lesion and termed it dhoti cancer (a piece of cotton cloth worn to cover the lower part of the body in most parts of india). the term saree cancer was first used in the bombay hospital journal by dr. patil. from bombay hospital, india, and created quite a furor in indian media recently. saree cancer is a type of scc of the skin that occurs along the waistline in females wearing saree perpetually. continual wearing of the tightly bound saree causes persistent irritation and friction resulting in scaling and changes in pigmentation of the skin and eventually resulting in malignant changes. it is a very rare type of cancer and is geographically distributed in the indian subcontinent akin to kangri cancer in kashmir. medical literature on this poorly presented and understood scc of the skin is sparse, and knowledge of its existence is less even in indian medical fraternity. a 68-year - old woman presented with chronic non - healing ulcers above the waistline on both flanks (lady was tying her saree with petticoat at this level) with duration of 8 months. rapid progression of the ulcer on left flank with growth like lesion had been noticed since past 2 months. both the ulcers were preceded by hypopigmented patches and chronic itching at the site for some years. she has been wearing saree since the age of 13 yrs. on clinical examination, an ulceroproliferative growth measuring 2 cm 2.5 cm, with surrounding well - defined hypopigmented margin, was found on her left loin. on palpation, the ulcerproliferative growth was tender and was not fixed to the underlying structures. an ulcer measuring 2.5 cm 5 cm with everted edge and surrounded by area of hypo and hyperpigmentation with induration was present on the right side of the waist [figure 1 ]. surgery was planned and wide excision of the growth with 2 cm margin and rhomboid transposition flaps on both sides was done [figure 2 ]. on histopathology, the tumour was found to be composed of a hyperplastic epidermis with sheets of keratinocytes (with intercellular bridges) demonstrating intense mitotic activity, pleomorphism, and greatly enlarged hyperchromatic nuclei and scanty cytoplasm, suggestive of a well - differentiated scc with free resection margin of at least 8 mm on all sides. follow - up was done up to 8 months during which the patient remained disease free. bilateral synchronous cancer lesions along the waist line per - operative serial pics post operative day 15 post operative day 30 saree cancer occurs along the waistline in females and is caused by chronic irritation of the skin leading to malignancy. the culprit seems to be petticoat (inner skirt worn underneath to anchor the saree) cord, which, if tied too tight around the same place on the waist day in and day out, can lead to dermatoses (atrophic and keratotic changes in the dermis) eventually leading to ulceration and subsequently malignancy. the persistent irritation of the tight petticoat cord and saree is compounded by the hot and humid tropical climate of the subcontinent and reluctant self hygiene, especially in indian rural hinterland. this results in the accumulation of irritants (sweat, dust) within the cord tying area leading to itching and scratching. the amalgam of all the above reasons along with disinclination toward once health, usually results in these individuals hailing from rural area presenting to the sparse specialists available, late. similar skin changes have also been noted in women wearing churidhars (trousers tied with thread). changes in pigmentation and mild scaling over the waist in indian women have become very common and most women do nt notice it until it gets chronic. in urban area, the health conscious individual is prompt in consulting a specialist and receives timely healthcare thus halting the progression of the disease early. it is postulated that with chronic repeated irritation to the ulcer, there is a continuous mitotic activity, as epidermal cells attempt to resurface the open defect., genetic postulations that involve the human leukocyte antigen (hla) dr4 and mutations in the p53 and/or the fas genes have been proposed. in all known reported cases, the occurrence of the cancer has been at a single site and wide local excision together with skin grafting had been done. in our case, lesions were bilateral in loin (synchronous) and rhomboid transposition flap was done for covering the defect. sccs which develop on chronic skin lesions have a higher incidence of metastasis (9% to 36%) as compared to the carcinomas which arise in previously normal skin (1% to 10%). awareness of the development of dermatoses in the waist area due to tight tying of the cord of the saree or petticoat is important so that. the onus also lies on the treating physician to identify such a lesion and act swiftly with evaluation and subsequent excision. women who wear saree day in and out should be advised : to tie saree around their waist laxly - especially in individuals with early skin changes in the form of pigmentation variation or scalingto wear a petticoat underneath to anchor the sareeto use a broader belt instead of a cord (nada) in petticoats so as to spread the pressure evenly over a larger areato change the level at which sarees are tied intermittentlyto use gown or elastic belt trousers at hometo maintain cleanliness of the part - more aptly applies for those working out and for rural folkto regularly inspect the waistline to tie saree around their waist laxly - especially in individuals with early skin changes in the form of pigmentation variation or scaling to wear a petticoat underneath to anchor the saree to use a broader belt instead of a cord (nada) in petticoats so as to spread the pressure evenly over a larger area to change the level at which sarees are tied intermittently to use gown or elastic belt trousers at home to maintain cleanliness of the part - more aptly applies for those working out and for rural folk to regularly inspect the waistline | skin cancers are rather uncommon malignancies comprising less than 1% of all the cancers in india. saree cancer is a rare type of squamous cell carcinoma (scc). saree and dhoti are traditional male and female costumes respectively, which is unique to the indian subcontinent. constant wear of this clothing tightly around the waist results in changes in pigmentation and scaling of the skin, acanthosis, scar and ulceration and subsequent, gradual malignant changes. the process of repeated trauma over a long time and consequent interference with the healing process may rationalise the reason for malignant transformation. few papers have been published on saree cancer, in main stream medical journals. we are presenting a rare case of saree cancer in a 68-year - old woman, with two distant bilateral ulceroproliferative growths in loin (synchronous), along the waistline, which showed well - differentiated scc on biopsy. wide excision with rhomboid transposition flap was done bilaterally. |
methamphetamine (meth) is a powerful central nervous system (cns) stimulant (1), which is widely distributed in the human and rat brain (2). although meth -dependent individuals often claimed the cognitive and attention - enhancing effect following drug use (3), but meth causes dependence and withdrawal syndrome (4), long - term changes in the brain structure and function, changes in synaptic plasticity (2), cell death via apoptosis (5) and neurotoxicity (3). however, studies existing about the effects of meth on cognitive functioning, learning and memory are rather inconsistent. for example, it has been shown that meth -dependence is associated with neurocognitive impairment, including poor attention, learning and memory, episodic memory, and working memory (6 - 9). while, other studies in humans (10, 11) and animal (12) models have provided some evidence that meth can improve cognition. animal studies have also shown that repeated meth exposure impairs learning in the morris water maze in adulthood ; however, prenatal meth exposure improves performance in the retention memory test (13), while lower doses of drug did not have any effect on cognition in adult offspring (14). it appears that these discrepancies are due to total dose and duration of drug exposure (time- dependent effects of meth). in the present study, enhanced sensitivity to meth occurred in rats but not dependency. given that, short (acute) and long term (chronic) effects of meth exposure (time- dependent effects of meth) on the spatial memory performance are unknown in sensitized rats. thus, we examined the spatial short term (working) and long - term (reference) memory of meth sensitized rats 30 and 120 min after the injection in the morris water maze. also, reference memory was evaluated after a 30-day period of withdrawal in meth sensitized rats in the morris water maze. male wistar rats (22010 g) were housed in a 12 hr light / dark cycle at 22 to 24c, with food and water ad libitum. all of the experimental procedures were conducted in accordance with the national institutes of health s guide for the care and use of laboratory animals. methamphetamine hydrochloride (sigma aldrich, m 8750) was dissolved in 0.9% saline. the rats were chronically treated with subcutaneous injections of meth (2 mg / kg), once a day for 5 days, as described previously (15). this dose of meth shows no neurotoxicity but produces behavioral sensitization after repeated treatment in rats (16). this experiment examined spatial memory performance of meth sensitized rats 30 and 120 min after the injection of drug. in this experiment, 38 male rats were divided into four groups (n=9 - 10 rats per group) and received saline or meth (2 mg / kg, sc, for 5 days). all training and testing were conducted 30 or 120 min after injection of meth. considering the half - life of meth in rats approximately 70 min (17, 18), the experimental groups were divided as follows : group 1 : sal exposed / sal 30 min after injection, group 2 : (sensitive to meth) meth exposed / meth 30 min after injection, group 3 : sal exposed / sal 120 min after injection, group 4 : meth exposed /meth 120 min after injection. a detailed description of the apparatus and the tracking system has been given in our previous reports (19). from day 5 to 10, all rats were trained in spatial learning (4 trials per day for 5 consecutive days). twenty four hours prior to the start of training, rats were allowed to swim 3 min in the pool containing no platform for habituation, as described previously (20, 21). a spatial probe test was performed 24 hr after the last acquisition session, without platform. the rats were allowed to swim for 60 sec, and during this period, we recorded the latency to reach the platform location, the time spent in a zone around the platform (20 cm radius) in each quadrant, and the proximity (the average distance from the center of the platform during the probe test) and velocity of each animal (19). two days after probe test, training on working memory version of the water maze task was started. only two trials per day were given for 5 days to stabilize the performance of the animal in task. final test was performed on day 6. in the first trial (acquisition), the rat had to find the platform in a new position, the second trial (retrieval) was performed 75 min later, as described previously (20). in this period, meth injection was performed 30 or 120 min before the acquisition phase. thus, the total duration of the meth injection was 18 days in experiment 1. timelines of experiments thi s experiment examined the effects of meth withdrawal on the spatial reference memory in meth - sensitized rats. two groups of rats (saline and methamphetamine - sensitized rats from exp1) were exposed to 30 days of spontaneous withdrawal after the end of working memory test. the experimental groups were divided as follows : group 1 : saline (sal), group 2 : a 30 day period of spontaneous withdrawal (meth / withd). rats were trained in spatial learning (2 trials per day for 3 consecutive days). a spatial probe test was performed 24 hr after the last acquisition session, as described above. time line). the data expressed as the meanstandard error of the mean (sem). these data were analyzed using two - way analyses of variance (anova), with repeated measures (day effect, group effect, groupday interaction) and one -way anova as required. a student s t - test was used to compare the data between two groups. male wistar rats (22010 g) were housed in a 12 hr light / dark cycle at 22 to 24c, with food and water ad libitum. all of the experimental procedures were conducted in accordance with the national institutes of health s guide for the care and use of laboratory animals. methamphetamine hydrochloride (sigma aldrich, m 8750) was dissolved in 0.9% saline. the rats were chronically treated with subcutaneous injections of meth (2 mg / kg), once a day for 5 days, as described previously (15). this dose of meth shows no neurotoxicity but produces behavioral sensitization after repeated treatment in rats (16). this experiment examined spatial memory performance of meth sensitized rats 30 and 120 min after the injection of drug. in this experiment, 38 male rats were divided into four groups (n=9 - 10 rats per group) and received saline or meth (2 mg / kg, sc, for 5 days). all training and testing were conducted 30 or 120 min after injection of meth. considering the half - life of meth in rats approximately 70 min (17, 18), the experimental groups were divided as follows : group 1 : sal exposed / sal 30 min after injection, group 2 : (sensitive to meth) meth exposed / meth 30 min after injection, group 3 : sal exposed / sal 120 min after injection, group 4 : meth exposed /meth 120 min after injection. a detailed description of the apparatus and the tracking system has been given in our previous reports (19). from day 5 to 10, all rats were trained in spatial learning (4 trials per day for 5 consecutive days). twenty four hours prior to the start of training, rats were allowed to swim 3 min in the pool containing no platform for habituation, as described previously (20, 21). a spatial probe test was performed 24 hr after the last acquisition session, without platform. the rats were allowed to swim for 60 sec, and during this period, we recorded the latency to reach the platform location, the time spent in a zone around the platform (20 cm radius) in each quadrant, and the proximity (the average distance from the center of the platform during the probe test) and velocity of each animal (19). two days after probe test, training on working memory version of the water maze task was started. only two trials per day were given for 5 days to stabilize the performance of the animal in task. final test was performed on day 6. in the first trial (acquisition), the rat had to find the platform in a new position, the second trial (retrieval) was performed 75 min later, as described previously (20). in this period, thus, the total duration of the meth injection was 18 days in experiment 1. timelines of experiments thi s experiment examined the effects of meth withdrawal on the spatial reference memory in meth - sensitized rats. two groups of rats (saline and methamphetamine - sensitized rats from exp1) were exposed to 30 days of spontaneous withdrawal after the end of working memory test. the experimental groups were divided as follows : group 1 : saline (sal), group 2 : a 30 day period of spontaneous withdrawal (meth / withd). rats were trained in spatial learning (2 trials per day for 3 consecutive days). a spatial probe test was performed 24 hr after the last acquisition session, as described above. this experiment examined spatial memory performance of meth sensitized rats 30 and 120 min after the injection of drug. in this experiment, 38 male rats were divided into four groups (n=9 - 10 rats per group) and received saline or meth (2 mg / kg, sc, for 5 days). all training and testing were conducted 30 or 120 min after injection of meth. considering the half - life of meth in rats approximately 70 min (17, 18), the experimental groups were divided as follows : group 1 : sal exposed / sal 30 min after injection, group 2 : (sensitive to meth) meth exposed / meth 30 min after injection, group 3 : sal exposed / sal 120 min after injection, group 4 : meth exposed /meth 120 min after injection. a detailed description of the apparatus and the tracking system has been given in our previous reports (19). from day 5 to 10, all rats were trained in spatial learning (4 trials per day for 5 consecutive days). twenty four hours prior to the start of training, rats were allowed to swim 3 min in the pool containing no platform for habituation, as described previously (20, 21). a spatial probe test was performed 24 hr after the last acquisition session, without platform. the rats were allowed to swim for 60 sec, and during this period, we recorded the latency to reach the platform location, the time spent in a zone around the platform (20 cm radius) in each quadrant, and the proximity (the average distance from the center of the platform during the probe test) and velocity of each animal (19). two days after probe test, training on working memory version of the water maze task was started. only two trials per day were given for 5 days to stabilize the performance of the animal in task. final test was performed on day 6. in the first trial (acquisition), the rat had to find the platform in a new position, the second trial (retrieval) was performed 75 min later, as described previously (20). in this period, thus, the total duration of the meth injection was 18 days in experiment 1. thi s experiment examined the effects of meth withdrawal on the spatial reference memory in meth - sensitized rats. two groups of rats (saline and methamphetamine - sensitized rats from exp1) were exposed to 30 days of spontaneous withdrawal after the end of working memory test. the experimental groups were divided as follows : group 1 : saline (sal), group 2 : a 30 day period of spontaneous withdrawal (meth / withd). rats were trained in spatial learning (2 trials per day for 3 consecutive days). a spatial probe test was performed 24 hr after the last acquisition session, as described above. these data were analyzed using two - way analyses of variance (anova), with repeated measures (day effect, group effect, groupday interaction) and one -way anova as required. a student s t - test was used to compare the data between two groups. the acquisition data during the 5 days of training in the water maze (wm) are illustrated in figure 2. two - way analyses of variance (anova), with repeated measures were used to analyze the escape latencies during training. all groups learned to locate the platform during 5 days of training, as indicated by decreasing escape latencies as training progressed (f4, 170=62.. statistical analysis showed a significant group effect (f3, 34= 206.8, p= 0.0001) and significant interaction between factors (group day) (f12, 170 = 6.4, p= 0.0001) in the acquisition phase of learning. the meth groups exhibited significantly higher escape latencies in all 5 days training than those of control group (p= 0.0001) 30 min post injection. these findings indicated that exposure to meth decreased the learning rate in sensitized groups 30 min post injection. effect of methamphetamine (meth) in acquisition phase of spatial learning in meth - sensitized rats 30 and 120 min after the injection as measured by the wm task. all groups learned platform location during the 5-day training, except group 30 min after injection of meth. result showed group of 30 min after injection of meth is not able to learning. represents a significant different between 30 min after injection of meth and saline groups (p= 0.0001). represents a significant difference between120 min after injection of meth and saline groups on the first day of training (p= 0.002) data related to the distance swam to reach the platform followed similar to the same pattern as the latency. all groups traveled shorter distances to reach the platform as training progressed (f4, 170=42. 63, p=0.0001), except meth group 30 min after injection (data not shown). one -way analyses of variance (anova) showed significant effects on the platform location latency between groups (f3, 34=410.9, p=0.0001) (figure 3a). comparisons between groups showed that the mean latency to reach the platform location in sensitized groups were significantly more than those of control groups (p=0.0001, p=0.045 ; respectively) 30 and 120 min after injection of meth, representing the impairment of the spatial reference memory in both groups. analysis (figure 3b) indicate significant difference between groups in time spent in the target (f3, 34=35, p=0.0001), opposite (f3, 34=10.34, p=0.0001) and left zones (f3, 34=20.9, p=0.0001). comparisons between groups showed that the meth groups spent significantly less time in the target zone than those of control groups (p=0.0001 and p=0.036, respectively) 30 and 120 min after injection. also, meth group spent significantly more time in the opposite zone than those of control groups (p=0.034) 120 min after injection. effect of methamphetamine (meth) on spatial references memory in meth - sensitized rats using the probe trial during the wm task 30 and 120 min after the injection. (b) the mean percentage of total time spent in within a zone, with a radius of 20 cm in the target zone or in other zone (c) the proximity (d) swimming speed of each rat. results showed that the meth sensitized rats took significantly more time to reach the platform location (a), spent significantly less time in the target zone (b), and had significantly further proximity values (c) and also with increased swimming speed compared to their controls (d). in a : and indicates a significant different between meth groups compared to their controls (p=0.0001, and p=0.045, respectively). in b : and ^^^indicates a significant different between meth groups compared to their controls (p=0.0001, both) in the target zone. and ^ indicates a significant different between meth groups compared to their controls (p=0.024, and p=0.034, respectively) in the opposite zone. indicates a significant different between 30 min after injection than those control (p=0.0001) in the left zone. in c : and indicates a significant different between meth groups compared to their controls (p=0.0001, and p = 0.037, respectively). in d : and indicates a significant different between meth groups compared to their controls (p=0.0001, and p = 0.003, respectively) effect of methamphetamine (meth) on acquisition and retention of spatial (working) memory in meth - sensitized rats 30 and 120 min after the injection. in acquisition and retention : and indicates a significant different between 30 min after injection than those control (p=0.0001, both) figure 3c represents the average proximity to the platform. a one way anova revealed significant difference between groups (f3, 34=78.9, p=0.0001). the meth groups had significantly larger average proximity value than control groups (p=0.0001, p=0.037 ; respectively). figure 3d showed that both groups had significantly more swim speed than of control groups (p=0.0001, p=0.003, respectively). figure 3. illustrates the mean escape latencies on the acquisition and retention trials for control and 30 and 120 min after injection of meth. a one way anova revealed a significant difference between groups in the acquisition (f3, 34=13.76, p=0.0001) and retention trials (f3, 34=7.95, p=0.0001). comparisons between groups showed that the meth groups exhibited significantly higher escape latencies in the acquisition and retention trials than those of control group (p=0.0001, both) 30 min after injection. while, there was not significant difference in the acquisition and retention trials 120 min after injection in the meth groups. this finding indicates that 120 min after the injection of meth has no effect on either acquisition or retention of working memory in meth -sensitized rats in the water maze. the data for the spatial reference memory test after prolonged abstinence are shown in figure 5. student s t - test indicated that meth -withdrawn rats spent significantly less time in the target zone than those of control group (t17=6.48, p=0.0001). effects of methamphetamine (meth) withdrawal on spatial reference memory in meth - sensitized rats using the probe trial during the wm task. the mean percentage of total time spent in within a zone or in other zone. results showed that the meth withdrawn rats spent significantly less time in the target zone. the acquisition data during the 5 days of training in the water maze (wm) are illustrated in figure 2. two - way analyses of variance (anova), with repeated measures were used to analyze the escape latencies during training. all groups learned to locate the platform during 5 days of training, as indicated by decreasing escape latencies as training progressed (f4, 170=62.. statistical analysis showed a significant group effect (f3, 34= 206.8, p= 0.0001) and significant interaction between factors (group day) (f12, 170 = 6.4, p= 0.0001) in the acquisition phase of learning. the meth groups exhibited significantly higher escape latencies in all 5 days training than those of control group (p= 0.0001) 30 min post injection. these findings indicated that exposure to meth decreased the learning rate in sensitized groups 30 min post injection. effect of methamphetamine (meth) in acquisition phase of spatial learning in meth - sensitized rats 30 and 120 min after the injection as measured by the wm task. all groups learned platform location during the 5-day training, except group 30 min after injection of meth. result showed group of 30 min after injection of meth is not able to learning. represents a significant different between 30 min after injection of meth and saline groups (p= 0.0001). represents a significant difference between120 min after injection of meth and saline groups on the first day of training (p= 0.002) data related to the distance swam to reach the platform followed similar to the same pattern as the latency. all groups traveled shorter distances to reach the platform as training progressed (f4, 170=42. 63, p=0.0001), except meth group 30 min after injection (data not shown). one -way analyses of variance (anova) showed significant effects on the platform location latency between groups (f3, 34=410.9, p=0.0001) (figure 3a). comparisons between groups showed that the mean latency to reach the platform location in sensitized groups were significantly more than those of control groups (p=0.0001, p=0.045 ; respectively) 30 and 120 min after injection of meth, representing the impairment of the spatial reference memory in both groups. analysis (figure 3b) indicate significant difference between groups in time spent in the target (f3, 34=35, p=0.0001), opposite (f3, 34=10.34, p=0.0001) and left zones (f3, 34=20.9, p=0.0001). comparisons between groups showed that the meth groups spent significantly less time in the target zone than those of control groups (p=0.0001 and p=0.036, respectively) 30 and 120 min after injection. also, meth group spent significantly more time in the opposite zone than those of control groups (p=0.034) 120 min after injection. effect of methamphetamine (meth) on spatial references memory in meth - sensitized rats using the probe trial during the wm task 30 and 120 min after the injection. (b) the mean percentage of total time spent in within a zone, with a radius of 20 cm in the target zone or in other zone (c) the proximity (d) swimming speed of each rat. results showed that the meth sensitized rats took significantly more time to reach the platform location (a), spent significantly less time in the target zone (b), and had significantly further proximity values (c) and also with increased swimming speed compared to their controls (d). in a : and indicates a significant different between meth groups compared to their controls (p=0.0001, and p=0.045, respectively). in b : and ^^^indicates a significant different between meth groups compared to their controls (p=0.0001, both) in the target zone. and ^ indicates a significant different between meth groups compared to their controls (p=0.024, and p=0.034, respectively) in the opposite zone. indicates a significant different between 30 min after injection than those control (p=0.0001) in the left zone. in c : and indicates a significant different between meth groups compared to their controls (p=0.0001, and p = 0.037, respectively). in d : and indicates a significant different between meth groups compared to their controls (p=0.0001, and p = 0.003, respectively) effect of methamphetamine (meth) on acquisition and retention of spatial (working) memory in meth - sensitized rats 30 and 120 min after the injection. in acquisition and retention : and indicates a significant different between 30 min after injection than those control (p=0.0001, both) figure 3c represents the average proximity to the platform. a one way anova revealed significant difference between groups (f3, 34=78.9, p=0.0001). the meth groups had significantly larger average proximity value than control groups (p=0.0001, p=0.037 ; respectively). figure 3d showed that both groups had significantly more swim speed than of control groups (p=0.0001, p=0.003, respectively). figure 3. illustrates the mean escape latencies on the acquisition and retention trials for control and 30 and 120 min after injection of meth. a one way anova revealed a significant difference between groups in the acquisition (f3, 34=13.76, p=0.0001) and retention trials (f3, 34=7.95, p=0.0001). comparisons between groups showed that the meth groups exhibited significantly higher escape latencies in the acquisition and retention trials than those of control group (p=0.0001, both) 30 min after injection. while, there was not significant difference in the acquisition and retention trials 120 min after injection in the meth groups. this finding indicates that 120 min after the injection of meth has no effect on either acquisition or retention of working memory in meth -sensitized rats in the water maze. the data for the spatial reference memory test after prolonged abstinence are shown in figure 5. student s t - test indicated that meth -withdrawn rats spent significantly less time in the target zone than those of control group (t17=6.48, p=0.0001). effects of methamphetamine (meth) withdrawal on spatial reference memory in meth - sensitized rats using the probe trial during the wm task. the mean percentage of total time spent in within a zone or in other zone. results showed that the meth withdrawn rats spent significantly less time in the target zone. we found that meth - sensitized rats showed spatial working and reference memory impairment 30 min after injection of meth. furthermore, rats did not show impairment of learning ability in reference memory and the acquisition and retention of working memory 120 min after drug injection in meth- sensitized rats, but the retention of spatial reference memory in the wm task is impaired. thus, the spatial learning and memory deficits observed in the sensitized rats 30 min after injection could potentially be interpreted as an acute effect of meth, which is associated with increased levels of anxiety and aggressive behavior (13, 22, 23). in our study, aggressive behavior was evident 30 min after injection, whereas it is clearly decreased 120 min after injection of the drug in the sensitized rats ; probably because of the half - life of meth that is 70 min in rats (17, 18). thus, drug sensitivity -induced anxiety and aggressive behaviors were increased after 30 min of injection in meth- sensitized rats and decreased during 120 min after injection. it seems that stress is reduced 120 min after injection during training of water maze, which facilitated spatial learning. also, we observed that almost all rats spend most of their time during trials training in the peripheral regions of the quadrant 30 min after injection. thus, despite the high swimming speed 30 min after injection, the learning has not occurred and rats failed to find the hidden platform. this finding is consistent with previous results showing that methamphetamine increases locomotor activity (24). the mechanism(s) underlying the spatial learning and memory deficits following meth (30 min after the drug injection) are unknown. although it seems, stress - related pathways, the creatine system and monoamine levels in brain may be involved. since it was shown that acute administration of meth after a single dose increased corticosterone, and hyperthermia and decreased hippocampal 5-ht levels and the brain creatine that affect cognitive function (25). also, we observed that the intensity of impairment is low 120 min after injection compared to 30 min after injection of drug (this was statistically significant). therefore, another explanation is that 120 min after injection may be interpreted as residual drug effects of chronic and rats developed tolerance to the methamphetamine and may have resulted in a reduction in drug efficacy ; so, the intensity of impairment was low ; however, there was statistically significant difference as compared to the saline group. in line with our study, it was shown that neonatal treatment with meth had no effect on working memory (26). another study has shown that prenatal exposure to higher doses of meth (15, 20 mg / kg) induced impairments of spatial memory in the mwm tested in adulthood (14). while, in our study dose of 2 mg / kg induced impairment of spatial long - term memory. this difference may be due to the duration and timing of drug injection during pregnancy (27). also, we found that after prolonged abstinence, rats exhibited a deficit in spatial reference memory. our findings is in accordance with those reported in previous studies (28, 29). although the mechanism that underlies the impairing effects of meth after prolonged abstinence is unknown, it has been suggested that chronic meth may lead to the neurodegeneration (30) apoptosis (5) and reduction of ltp (2) in neurons of the hippocampus. meth administration results in long lasting dopamine depletion in humans and animals (31). it is probable that the degenerative effects of meth have been sustained even after prolonged abstinence in the hippocampus. therefore, we found that rats showed spatial memory deficits after 30 days of withdrawal. our findings indicate that drug sensitivity was increased 30 min after injection in methamphe - tamine -sensitized rats, thus leading to the destruction of learning and memory. so that 120 min after injection of meth in sensitized rats did not impair learning ability and working memory, but partially impaired retention of spatial reference memory, which persisted even after prolonged abstinence of drug. | objective(s):there is controversial evidence about the effect of methamphetamine (meth) on spatial memory. we tested the time- dependent effects of meth on spatial short - term (working) and long - term (reference) memory in meth sensitized and withdrawn rats in the morris water maze.materials and methods : rats were sensitized to meth (2 mg / kg, daily/5 days, sc). rats were trained in water maze (4 trials / day / for 5 days). probe test was performed 24 hr after training. two days after probe test, working memory training (2 trials / day / for 5 days) was conducted. acquisition retention interval was 75 min. the treatment was continued per day 30 and 120 min before the test. two groups of meth sensitized rats were trained in reference memory after a longer period of withdrawal (30 days).results : sensitized rats exhibited significantly longer escape latencies on the training, spent significantly less time in the target zone (all, p<0.05), and their working memory impaired 30 min after injection. while, meth has no effect on the spatial learning process 120 min after injection, and rats spent significantly less time in the target zone (p<0.05), as well it has no effect on working memory. also, impairment of reference memory persisted after prolonged abstinence.conclusion:our findings indicated that meth impaired spatial learning and memory 30 min after injection, but spared spatial learning, either acquisition or retention of spatial working, but partially impaired retention of spatial reference memory following 120 min after injection in sensitized rats, which persisted even after prolonged abstinence. |
carcinoma of the prostate is a common condition, with over 21 000 cases and over 10 000 deaths every year in the united kingdom alone. we describe two patients with known carcinoma of the prostate who presented with visual disturbance and papilloedema on examination. the first patient was a 76-year - old gentleman who presented to the urology service complaining of a poor stream. he re - presented to the urology service 30 months later with a serum psa of 378 g / l with macroscopic haematuria. a trans - rectal biopsy of the prostate was performed and poorly differentiated adenocarcinoma of the prostate was diagnosed. an mri scan was performed, which showed bony metastases in the occipital bone and oedema in the cerebellum (figs 1 and 2). the slightly hyper - intense signal in the superior sagittal sinus indicates that the thrombosis is between 5 and 15 days old and is due to the presence of methaemoglobin. the patient responded well to 20 gy (in five fractions) of radiotherapy, delivered to the occipital region. figure 1 t2w sagittal image of patient 1, showing metastases in the occipital bone and oedema of the cerebellum.figure 2 t2w axial image of patient 1, showing mixed signal in the sagittal sinus compatible with thrombosis. after treatment of the metastases with radiotherapy, follow - up imaging showed a return of a normal signal void. t2w sagittal image of patient 1, showing metastases in the occipital bone and oedema of the cerebellum. t2w axial image of patient 1, showing mixed signal in the sagittal sinus compatible with thrombosis. after treatment of the metastases with radiotherapy, follow - up imaging showed a return of a normal signal void. the second patient was a 62-year - old gentleman who was admitted to hospital with a history of recent onset of headaches, nausea, nocturia and macroscopic haematuria. positive findings on examination included bilateral papilloedema and a markedly ataxic gait with cerebellar ataxia. isotope bone scanning showed bony metastases in the thoracolumbar spine, the pelvis and the base of the skull. computed tomography (ct) of the brain did not demonstrate cerebral metastases but mri scanning did reveal bony metastases in the occiput (fig. venous infarcts in the occipital lobes adjacent to the superior sagittal sinus were also demonstrated (fig. figure 3 t2w axial image of patient 2, showing metastases in the occipital bone and iso - intense signal in the occluded sagittal sinus. note the fluid around both optic nerves.figure 4 mrv (2d tof) of patient 2 showing thrombus in the superior sagittal sinus.figure 5 coronal t1w image of patient 2 demonstrating high signal adjacent to the superior sagittal sinus compatible with haemorrhage. t2w axial image of patient 2, showing metastases in the occipital bone and iso - intense signal in the occluded sagittal sinus. mrv (2d tof) of patient 2 showing thrombus in the superior sagittal sinus. coronal t1w image of patient 2 demonstrating high signal adjacent to the superior sagittal sinus compatible with haemorrhage. the patient was commenced on cyproterone acetate and received 30 gy to the skull in 10 fractions over 14 days. papilloedema has been described in prostate carcinoma due to transverse sinus thrombosis, but this was a result of dural metastases at the torcula and not in the bone of the skull vault. bony metastases in the optic canal have also been described, causing painless visual loss. mri is effective at showing both bony metastases in carcinoma of the prostate and is the imaging modality of choice for cerebral venous sinus thrombosis. intravenous contrast - enhanced ct scanning may show filling defects in the superior sagittal sinus, but mri is more sensitive in the detection of superior sagittal thrombosis and venous oedema and of bone metastases. we would suggest that in a patient with visual disturbance, who is known to be suffering from a malignancy that may spread to bone, mri is the imaging modality of choice and the venous sinuses should be examined with mrv at the time of imaging. | carcinoma of the prostate is a common condition and often spreads to bone. we describe the imaging findings in two patients with known carcinoma of the prostate who presented with visual disturbance (both had papilloedema on examination). mri showed occipital bone metastases and superior sagittal sinus thrombosis. we suggest that mri is the imaging modality of choice in patients suffering from prostate cancer who have visual disturbance and that mrv sequences should be included to detect venous sinus thrombosis. |
acupressure is an alternative medicine methodology that originated in ancient china and is a popular therapy worldwide. acupressure involves application of acute pressure on the acupuncture points to achieve treatment effects that are similar to those of the acupuncture method.13 according to traditional chinese medicine (tcm), stimulating these points can correct imbalance in the flow of qi through channels known as meridians, rebalancing yin and yang and subsequently treating diseases.4 instead of using a thin needle to stimulate the specific points, acupressure uses the fingers, elbow, fist, etc to stimulate the acupuncture points. there are several types of pressure points ; pressure to each is applied differently, and each creates a different effect accordingly.5 acute pressure block of the sciatic nerve is a newly reported analgesic method,610 based on a current neuroscience concept : stimulation of the peripheral nerves increases the pain threshold. the method works well to alleviate various types of clinical pain but not experimental cold pressor pain or intense pain.6,7,9 some physicians, patients, and scientists have interpreted this method as another approach for delivering the previously described analgesic method, acupressure. an understanding of these aspects is important for their application in clinical practice and improvement of their efficacy. acupressure uses pressure to stimulate specific acupuncture points for therapeutic purposes.4 in contrast, acute pressure block of the sciatic nerve method uses pressure to stimulate the sciatic nerve.69 the stimulation site is an area rather than a point, and stimulation of a larger area provides better pain relief. the optimal method for applying acupressure focuses on a point, using, for example, the thumbs, fingers, elbows, or suitable devices ; however, the optimal method for acute pressure block of the sciatic nerve is to apply pressure to a larger area, using, for example, the palms of the hands, the flat surfaces of the fists, or suitable devices. the amount of pressure required is usually approximately 10 kg to 20 kg per hand area for a man of average size.69 therefore, although the thumbs, fingers, or elbows are ideal for stimulating the acupuncture points in the acupressure method, they are not ideal for acute pressure block of the sciatic nerve, because the area required for this method is much larger. these reasons may indicate that the mechanisms involved in the two methods are different. theoretically, each acupuncture point usually is effective for one or a few types of diseases,5 whereas acute pressure block of the sciatic nerve has been shown to work for more general areas of the body. in tcm, a disease is generally perceived as disharmony (or an imbalance) in the functions or interactions of the meridians, such as yin, yang, xue, and zang - fu.11 therefore, the appropriate therapy is recommended on the basis of which pattern of disharmony can be identified.12,13 there are 360 acupuncture points,14 each with its own therapeutic significance. the selection of which point to target is a key step in acupressure practice, and selection of the correct acupuncture point is essential to achieve good treatment outcomes.5 various principles are proposed for selecting these points.15 for example, a common method for choosing acupuncture points is to select nearby points, which means points are selected in a local area that is adjacent to the disease - affected area. although the only target of acute pressure block of the sciatic nerve method is the sciatic nerve, this treatment provides relief from various pains in different areas of the body. according to reports, the acute pressure block method is most effective for dental pain, which originates far from the sciatic nerve, compared with pain resulting from other diseases.6,8 this observation shows that the working mechanisms may be different for the two methods. acupuncture is usually considered to not have a physically verifiable anatomic or histological basis, whereas the acute pressure block method has an associated anatomic structure, the sciatic nerve. acupuncture points are located along meridians that connect acupuncture points across the anatomy and affect a specific organ or other part of the body. tcm recognizes 360 points and twelve regular and eight extraordinary meridians.16 in addition, a number of less customary channels branching off from the regular meridians have been recognized.17 a 1997 national institutes of health consensus4 stated that despite considerable efforts to understand the anatomy and physiology of the acupuncture points, the definition and characterization of these points remains controversial. scientific research has not found any histological or physiological correlates for qi, meridians, or acupuncture points.1820 however, the method of acute pressure block of the sciatic nerve has an associated anatomic structure, the sciatic nerve. the mechanisms underlying the analgesic effect of the acupressure and the acute pressure block of the sciatic nerve methods may be different. traditional chinese acupuncture is a philosophy that focuses more on prevention than treatment of illnesses. in the general theory of tcm, bodily functions are regulated by an energy called qi, which flows through the body. the meridians are believed to connect the various parts of the entire body and to associate with the yin, yang, and qi. yin and yang are opposite motions that are interdependent of each other. disruptions to the flow of qi along the meridians will cause diseases,4,21 and stimulating these points can regulate the meridian system, restore the balance of qi, yin, and yang, and subsequently help the body to recover from diseases.4,21 current scientific studies on the mechanism of action of these acupuncture points have suggested that the insertion of needles involves recruitment of the body s own pain reduction system, possibly accompanied by an increased release of endorphins, serotonin, norepinephrine, or -aminobutyric acid.4,22 however, endogenous opioids and other molecular secretions need time to reach their effective level. although acupressure on some points can generate a faster analgesic effect (within a few minutes),2325 the mechanism for this faster analgesic effect remains unknown. the mechanism for acute pressure block of the sciatic nerve is based in general on current progress in neurobiology : stimulation of peripheral nerves increases the pain threshold.2628 chemical,29 mechanical,3 or electrical31 block of the sciatic nerve has reportedly generated analgesic effects. according to the gate control theory of pain,31 stimulation of large - diameter afferent fibers inhibits second - order neurons in the dorsal horn and prevents the further transmission of impulses carried by small - diameter fibers ; the resulting analgesic effect is considered rapid and short - lived and is thought to involve spinal dorsal horn wide dynamic range neurons.3133 wide dynamic range neurons are the first synaptic relay point for afferent pathways and play an important role in modifying the transmission of noxious input.34,35 a recent study showed that acute pressure on the rat sciatic nerve caused immediate inhibition of wide dynamic range neuron responses.10 thus, the gate control theory of pain may explain the immediate analgesic effect of the acute pressure block of the sciatic nerve method. sensory transduction in nerves is accomplished by ion channel proteins, which are gated pores that allow the exchange of ions across the cell membrane. acid - sensitive ion channel proteins, which were shown to be expressed in the neurons of the mammalian central and peripheral nervous systems, are proposed to constitute mechanoreceptors and to play an important role in responses to mechanical stimuli.3639 to date, four acid - sensitive ion channel proteins have been found to be expressed in the sciatic nerve.40 thus, the molecular mechanism of pain inhibition by acute pressure block of the sciatic nerve may involve pressure activation of acid - sensitive ion channel proteins. the time required to generate the analgesic effect differs between the two methods. the time required to achieve a treatment effect by activation of the acupuncture points varies greatly depending on the nature of the disease being treated. a common course of treatment may initially involve dozens of treatments spaced at approximately weekly intervals that are later extended to monthly intervals.4142 acupressure stimulation of some acupuncture points can also exert acute effects that last several minutes to several hours after a single treatment.43 for example, acupressure on the acupuncture point yao yang guan can provide relief of acute sciatica pain13 and requires long - term treatment for an effect.44,45 however, the time required for acute pressure block of the sciatic nerve to generate an analgesic effect is only a few minutes.610 the marked difference in the time required to generate treatment effects may be attributable to differences in the mechanisms between the two methods. more evidence is needed to clarify the effectiveness of the two methods in other diseases. according to tcm, energy (qi) flow through the body is essential for health, and disruptions of this flow are believed to be responsible for various diseases. stimulating acupuncture points removes blocks in qi and helps it flow back into balance. therapeutic effects on various diseases have been studied, including different pain pathologies, nausea, osteoarthritis, vomiting, rheumatoid arthritis, allergic rhinitis, and insomnia. although consistent data on the positive effects of acupressure therapy have been reported for some conditions, such as low back pain, nausea, and vomiting,4647 the evidence for its positive effects on other pathological conditions is not conclusive. a report from the american academy of pain medicine s 24th annual meeting48 shows that acupressure can work on non - painful discomfort, such as fullness, bloating, nausea, and vomiting ; the method has a smaller effect on non - painful discomfort than it does on pain.48 however, more studies are needed to confirm these results. are these observations attributable to mere coincidence, or does a relationship exist between the two methods ? ya o yang guan (or waist yang guan), is beneficial for acute sciatica pain and low back pain. this acupuncture point is located below the spinous process of the fourth lumbar vertebra, where branches of the sciatic nerve extend from the spinal cord (figure 1). as seen in a few studies, effective pressure on any accessible area along the sciatic nerve will provide rapid pain relief, but the effectiveness is reduced if the pressure is applied distant from the sciatic nerve.6,7,9 is the relief from sciatica pain attributable to stimulation of the acupuncture point or to stimulation of the sciatic nerve ? acupuncture points shown on the tcm map4951 are found in areas close to the nerve. figure 1 displays the sciatic nerve through the low back and leg, as well as the distribution of some acupuncture points on the lower back and leg. of note, the locations of the sciatic nerve path and the acupuncture points are close to each other. this raises the question of whether acupressure exerts its treatment effect via stimulation of adjacent nerves. studies have shown that direct stimulation of peripheral nerve sensory fibers increases the pain threshold in a manner similar to that caused by the standard acupuncture technique.52,53 although current scientific research may explain some aspects of tcm, it is far from understanding of the old theory, which was passed down from generation to generation. the present report compares the major similarities and differences between acupressure and acute pressure block of the sciatic nerve. the acute effect attained with acupressure presents a scope that is very different from that of the chronic effect attained after long - term treatment. this effect appears to have more similarities to that achieved with acute pressure block of the sciatic nerve, both in methodology and mechanism. many aspects of the two methods are unknown, and more evidence is therefore required to determine whether a relationship exists between the two. further studies aimed at clarifying this relationship are important for improvements in the efficacy of these two methods. | acupressure is an alternative medicine methodology that originated in ancient china. treatment effects are achieved by stimulating acupuncture points using acute pressure. acute pressure block of the sciatic nerve is a newly reported analgesic method based on a current neuroscience concept : stimulation of the peripheral nerves increases the pain threshold. both methods use pressure as an intervention method. herein, we compare the methodology and mechanism of these two methods, which exhibit several similarities and differences. acupressure entails variation in the duration of manipulation, and the analgesic effect achieved can be short - or long - term. the acute effect attained with acupressure presents a scope that is very different from that of the chronic effect attained after long - term treatment. this acute effect appears to have some similarities to that achieved with acute pressure block of the sciatic nerve, both in methodology and mechanism. more evidence is needed to determine whether there is a relationship between the two methods. |
cholera case - patients were identified from updated lists from juba county s 5 cholera treatment centers (ctcs), 2 of which were located in camps for internally displaced persons (idps ; i.e., persons who have left their homes but stayed within their country s borders). preventive oral cholera vaccination was conducted in the 2 idp camps before the outbreak began in juba. a case - patient was defined as a juba county resident > 2 years of age who 1) had an acute illness characterized by > 3 loose, watery stools within 24 hours or 2) was confirmed to be positive for v. cholerae infection by rapid diagnostic testing or culture during the cholera outbreak that began in juba county on april 23, 2014. for cholera case - patients enrolled in the study, a control matched by neighborhood, sex, and age was identified and invited to participate in the study. the study team traveled to the case - patient s village and worked with the local village leader or a social mobilization volunteer to identify a matching control from a household within a 100-m radius of the case - patient. a control was a juba county resident > 2 years of age with no history of clinical illness or no laboratory evidence of v. cholerae infection during this cholera outbreak. to match case - patients and controls by age, age groups of 35 years (e.g., 24, 59, and 6569 years of age) were used. a team of 19 trained research assistants administered a pretested, semistructured questionnaire and conducted environmental assessments to evaluate the use of safe drinking water, improved sanitation facilities, personal and food hygiene, and oral cholera vaccination. using epi info (centers for disease control and prevention, atlanta, ga, usa), we calculated matched unadjusted and adjusted odds ratios by using bivariate and multivariate models, respectively, to identify risk factors for cholera. a total of 134 matched pairs of case - patients and controls were enrolled in the study during june 26july 29 in 2014 (figure). of the 134 case - patients enrolled, 9 were confirmed by culture and 104 by a cholera rapid diagnostic test (onsite rapid test ; ctk biotech, san diego, ca, usa) ; the remaining 21 were identified by epidemiologic linkage (i.e., a resident of juba > 2 years of age with > 3 loose stools in 24 hours after the beginning of the cholera outbreak). mean delay between admission to the ctc and interview after enrollment in the study was 21 days (range 055 days) ; most case - patients who were interviewed were admitted during the peak transmission phase of the outbreak (figure). the distribution of age, sex, residence of origin, education level, and occupation were comparable among case - patients and controls (table 1). most (118 [88% ]) case - patients enrolled in the study visited the ctc within 1 day of onset of cholera symptoms. all 134 patients had diarrhea ; 112 (84%) had vomiting ; 45 (34%) had abdominal cramps ; 37 (28%) had some dehydration (i.e., any 2 signs of dehydration, including 1 major sign) ; and 31 (23%) had severe dehydration (23%). timeline showing number of cholera cases (total cases = 2,260), deaths from cholera (total deaths = 43 ; case fatality rate 2.0%), and dates of study for cholera outbreak in juba county, south sudan, epidemiologic weeks 1743 (april 23october 20), 2014. bivariate and multivariate analyses showed that persons who ate food outside their home before illness onset and those who traveled outside their home village (even within the county) before illness onset were significantly more likely to develop cholera (table 2). conversely, treating drinking water at home and receiving > 2 doses of oral cholera vaccine (self - reported) were protective against cholera (table 2). eating outside the home as a risk factor in this cholera outbreak popular eating places in juba county included roadside food vendors and restaurants in markets that did not meet minimum food hygiene standards yet remained open during the outbreak because public health inspection of eating establishments and a ban on roadside food vending were not uniformly enforced. our study identified recent travel to cholera outbreak areas as a risk factor, also a finding consistently associated with cholera spread to new locations during previous cholera outbreaks (10). the first 2 factors increased risk for cholera, whereas the other 2 factors decreased risk. or, odds ratio. travel from home to any area affected by cholera during the 2014 outbreak in south sudan. self - reported. also, as reported in previous cholera outbreaks in south sudan, uganda, haiti, and zimbabwe, household chlorination of drinking water was associated with significantly lower risk for developing cholera in our study (7,8,9,11). in our study, water samples from case - patient households that did not chlorinate their drinking water showed evidence of contamination with fecal coliforms (> 10 counts/100 ml). similarly, water samples from water storage vessels in 2 case - patient households that did not treat their drinking water were contaminated with fecal coliforms (> 10 counts/100 ml). we found that oral cholera vaccination was associated with a significantly reduced risk of cholera infection and a vaccine effectiveness of 90% (table 2). these limitations include underreporting of high - risk behaviors, recall bias, potential misclassification of asymptomatic case - patients, narrow age ranges that caused difficulty in identifying matching controls, shared environmental risk factors (e.g., shared water source) for case - patients and controls, unmeasured variables (i.e., factors not measured in this study, such as being an idp), and loss of oral cholera vaccination cards (i.e., vaccinations were self reported). for this cholera outbreak in south sudan, we found that travel and eating outside the home were risk factors for becoming ill and that treating drinking water at home and getting oral cholera vaccination provided protection against illness. for cholera prevention and control in humanitarian crises, we recommend that global oral cholera vaccine stockpiles be enhanced so that preventive oral cholera vaccination can be used to augment traditional interventions, such as improved access to safe drinking water and public education about risk factors. | we conducted a case control study to identify risk factors for the 2014 cholera outbreak in juba county, south sudan. illness was associated with traveling or eating away from home ; treating drinking water and receiving oral cholera vaccination were protective. oral cholera vaccination should be used to complement cholera prevention efforts. |
benign prostatic hyperplasia (bph) is the most common disorder originating in the lower urinary tract in men over the age of 50. in the last 20 years a number of modern methods of surgical treatment have been developed to treat this common condition. for years the gold standard procedure for treatment of bph has been the transurethral resection of the prostate (turp). however, this method is associated with a variety of complications affecting > 18% of patients. bleeding during and after the procedure, post - turp syndrome, secondary urethral strictures and repeated reoperations resulting from urinary incontinence are a select few, which, along with its steep learning curve, have necessitated the search for and development of alternative methods of therapy. the application of laser for the treatment of bph was first attempted in the 1980s. since then the popularity of this method has grown continuously, along with the advancement of associated interventional devices (from coagulation to cutting and vaporization methods). currently, two different laser systems have come to dominate urological surgery : holmium laser holmium - yttrium - aluminium - garnet (ho : yag) applied primarily in ablation, enucleation and resection of prostatic tissue (including the breakdown of deposits in the urinary tract) and green laser potassium - titanyl - phosphate (ktp) serving exclusively the vaporization of prostate adenoma. the treatment of bph using the 80-w potassium - titanyl - phosphate laser (ktp) was first reported in 1997. the first procedure in poland was carried out in 2013 by professor jeromin in d. in comparison to previous technology (nd : yag laser), the wavelength of the ktp laser (532 nm) has been halved, placing it in the green electromagnetic spectrum (greenlight - laser). the result is a completely different optical and energetic interaction in contrast to other laser types. combing the high average power of a quasi - continuous wave laser (80 w) with the high peak power delivery within each micro - pulse (up to 280 w) offers efficient vaporization of prostate tissue. the short duration of each laser beam pulse (0.25 s) limits the thermal effect on deeper - lying tissue. ktp laser energy is selectively absorbed by hemoglobin (and not by water), which, at this wavelength, has a very high absorption coefficient and therefore penetrates prostate tissue to a maximal depth of 0.7 mm. this leads to immediate vaporization of prostatic tissue [4, 5, 6, 7 ]. though the laser energy penetrates to a tissue depth of only 0.8 mm, the thermal effect spreads within a 510 mm radius from the point of vaporization. thermal damage of the external sphincter is a distinct risk, especially when the prostate adenoma is considerably enlarged beyond the verumontanum, approaching the above - mentioned sphincter. numerous authors have suggested that the degree and frequency of postoperative urinary incontinence is strongly dependent on the age of the patient, but also, and perhaps more significantly, on prostate size, forcing the operator to intervene in the proximity of the external sphincter muscle. the goal of this study was to assess the risk of thermal damage to the external sphincter of the urethra in men undergoing greenlight laser vaporization of bph. 98 consecutive men with lower urinary tract symptoms due to bph were qualified for photoselective ktp laser vaporization of the prostate (pvp). inclusion criteria were as follows : clinical symptoms of boo progressing or refractory to conservative treatment, international prostate symptom score (ipss) of > 10 or urinary retention, prostate volume of 4080 ml measured by transabdominal ultrasound, the presence of enlarged prostate adenoma at the level of verumontanum confirmed at urethroscopy directly before pvp. exclusion criteria were as follows : active urinary tract infection, suspicion of prostate cancer, urethral stricture, previous urethral surgery, neurological disorders, lack of informed consent to participate in the study. local review board approved study protocol. among 98 initially screened men, inclusion criterion of enlarged prostate adenoma at the level of verumontanum eventually 66 consecutive patients were assigned into two study groups, based on consecutive patient numbers. patients with even and odd numbers were assigned to the study group a and the study group b, respectively. in the group a, patients underwent vaporization prostatectomy, seemingly incomplete, with the termination of the procedure at the level of the verumontanum. the remaining fragments of the lateral lobes extending in various degrees beyond the seminal colliculus / veromontanum were left intact. in the group b, the vaporization procedure was also discontinued at the level of the verumontanum, however, the remaining fragments of the lateral lobes of the adenoma were resected by means of the standard turp method (of course after changing endoscopic equipment). all procedures were performed by the same surgeon, using a single 80-w green light laser fiber (american medical systems), water - cooled, emitting a monochromatic light source, operating at a 532 nm wavelength. all patients undergone full urological evaluation before treatment, including transabdominal ultrasound (trus) measurement of prostate volume performed by the same radiologist, accounting for median (iii) prostate lobe and retention, determination of prostate - specific antigen (psa), measurement of maximum flow rate qmax (except in patients with complete urinary retention) and digital rectal examination (dre). all patients were also asked to complete the ipss and ql questionnaire, and gave their informed consent to participate in the study. primary end - points of the study were change in continence status, urinary flow (qmax), post void urine retention (pvr), international prostate symptom score (ipss), including 7-scale (0-delighted, 6-terrible) quality of life assessment (qol). secondary study end - points were surgery time, bleeding rate, catheterization time, storage symptoms in postoperative course and surgical complications. the data, obtained during the course of the study, were analyzed using statistica 10.0. normal distribution of all quantitative variables was confirmed with the use of the shapiro - wilk test, while homogeneity of variance was tested according to levene s formula. the student s t - test was used to compare the results between the groups, when achieving a positive outcome of both afore - mentioned tests. in case of a negative outcome, per protocol analysis was eventually performed in 60 patients, including 32 and 28 patients in group a and b, respectively. from the group of 66 randomized men 5 patients were lost in follow - up (1 patient from group a and 4 patients from group b) and one patient from group b died from cardiac insufficiency not related to urological procedure. mean psa was 2.47 ng / ml and 2.68 ng / ml in group a and b, respectively. in the single case of elevated psa (25 ng / ml), two series of trus - guided prostate biopsies were performed to rule out prostate cancer. prior to the procedure, attention was paid to the presence of an median (iii) lobe protruding into the bladder, posing further difficulties in performing vaporization and thus prolonging the operation time. this was observed in a total of 18 patients (29%) across both groups. general characteristics of patients in groups a and b psa prostate specific antigen ; ipss international prostate symptom score ; qol quality of life ; qmax maximal urinary flow rate during the 8-week follow - up no patient reported urinary incontinence. results in primary end - points of the study are presented in table 2. in postoperative studies of both 24 hours and 68 weeks after treatment, there was a significant symptomatic decline in accordance to the questionnaire results, and a significant increase in urinary flow. postoperative results ipss international prostate symptom score ; qol quality of life ; qmax maximal urinary flow rate surgery time was 80.3 min (60120) in group a and 101.3 min (85150) in group b. the difference in operation times was observable both clinically and statistically (p = 0.00), attributable to the necessary variation of technique in group b (apparatus and irrigation fluid change). only a few patients required general anesthesia, as a result of the presence of concurrent illness. assessment of bleeding during the procedure was carried out by the operator, according to a self - devised scale : 0 represented no bleeding, 1 bleeding requiring coagulation during the procedure (without the need for blood transfusion, with no drop in hemoglobin), 2 persistent bleeding despite coagulation postoperatively (without the need for blood transfusion, but with a 12 unit drop in hemoglobin) and 3 bleeding requiring either plasma extract or re - coagulation and blood transfusion (where the drop in the hemoglobin exceeds 2 units). a, no bleeding (0 on the bleeding scale) was clearly encountered more frequently, whereas group b was evidently more frequently characterized by persistent bleeding despite coagulation attempts, but without the need for further intervention (p = 0.00). after surgery, an 18 ch foley catheter was inserted and left for 24 hours. in 4 patients from group b, a three - way dufour 20 ch catheter was left due to bleeding. the average holding time, of the catheter after surgery, in group a was significantly shorter in comparison to group b (29.1 hours vs. 37.2 hours, p = 0.04). all patients in group a had their catheters removed 24 hours after treatment. however, 4 men required reinsertion of a catheter for another 24 hours due to urine retention. two patients, although urinating independently, required catheter reinsertion due to significant urine retention. a catheter was maintained maximally for 72 hours. 2 patients from group b required re - coagulation due to bleeding within the first 24 hours after surgery. 16 patients had a catheter maintained for a longer period : due to bleeding 9 patients, repeated / significant urine retention 7 patients. all patients who underwent surgery, had urinary flow and retention tests performed before leaving the hospital. maximal urinary flow and retention tests were performed once again, and patients were asked to complete an ipss and ql questionnaire. assessment of bleeding in operated patients the major patient complaints encountered at follow - up (in some even earlier voluntarily) were sudden urge to urinate, groin and urethral pain. 12 patients from group a (36%) and 9 (31%) from group b reported the above - mentioned complaints. patients were prescribed alpha - blockers with or without anti - inflammatory medication, as well as cholinolytics. 4 patients (6.5%) (both groups under further observation) were re - admitted to the ward due to urinary bladder neck and/or urethra narrowing. one patient (from group a) was reoperated after 14 months, performing turp. none of the patients, from either of the groups, complained of problems with urinary incontinence. the frequency of reporting any of these symptoms did not differ between groups (p > 0.05). we performed a prospective randomized trial assessing the risk of functional complications related to pvp in the region of urethral external sphincter. the depth of tissue injury is proven to be much deeper than visible during endoscopy, what makes injury to the urethral external sphincter possible [6, 7 ]. the main problem considered by our study, urinary incontinence, following 80w ktp laser vaporization of the prostate, was not observed in any patient. overall, 100% patients were found to be continent postoperatively, regardless of the methodology used. we are aware that our patients were selected on the basis of prostate volume, though all satisfied the criteria of our trial prostate adenoma reaching or slightly exceeding the level of the verumontanum. some authors highlight the fact that a significantly enlarged prostate, along with the patient s advanced age, are predisposing factors for developing postoperative complications, such as urinary incontinence, associated with the thermal margins accompanying laser vaporization. in group b patients, the significantly prolonged operation time is attributable to the necessary endoscopic apparatus and irrigation fluid change. following classic turp, even partial, problems with hemostasis the average holding time of the catheter after surgery in this group was consequently longer. the supplementary electroresection had no impact on either urinary flow (though worse 24 hours postoperatively than in group a, these may be due to greater tissue swelling) or ipss and qol parameters. these are most likely associated with tissue reactions after laser light exposure and a significant degree of neurological receptor irritation [9, 10 ]. late complications occurred in 5 patients (8%), resulting in further surgical intervention. in other trials, this percentage was slightly higher, reaching even 14%, but it should be noted that we are well aware of the number and specificity of our patients. where the prostate lobes of a large bph extend beyond the verumontanum, the procedure may be interrupted at the level of the verumontanum without compromising urodynamic parameters or patient s well being. additional resection of the lateral lobes of the prostatic hyperplasia using traditional methods is only associated with an elevated risk of bleeding during and after the procedure, prolongation of operation time, increased urinary catheterization times postoperatively, without affecting patients urodynamic and ipps and ql parameters. laser vaporization for treatment of bph is safe and effective, with no significant effect on the risk of urinary incontinence in comparison to traditional methods. | introductionphotoselective laser vaporization of the prostate (pvp) is one of the most popular techniques of treatment of benign prostatic hyperplasia (bph). the aim of this study was to assess the risk of thermal damage to the external urethral sphincter during pvp at distal part of prostatic urethra.material and methods66 men submitted to pvp with 80-w green light laser were randomly assigned to receive standard pvp only (group a) or pvp in proximal part followed by transurethral resection in distal part of prostatic urethra (group b). primary end - points of the study assessed at baseline, 24 hours and 8 weeks after the surgery were : urinary continence, urinary flow (qmax), post void urine retention (pvr), international prostate symptom score (ipss), quality of life (qol).resultsper protocol analysis was eventually performed in 60 patients. study groups did not differ in age, preoperative continence, values of qmax, pvr, ipss, qol, or the rate of complete urinary retention (p > 0.05). during the 8-week follow - up no patient reported urinary incontinence, while decrease in ipss (16.3 vs. 14.9, p > 0.05), qol improvement (4.7 vs. 4.7, p > 0.05), increase in qmax (18.2 vs. 17.4, p > 0.05) were similar in both study groups. patients assigned to group b were more likely to have bleeding complications (85.2% vs. 18.2%), including patients requiring transfusion (14.8% vs. 0%). moreover, postoperative catheterization time was shorter in group a (29.1 hrs vs. 37.2 hrs, p = 0.04).conclusionslaser vaporization for treatment of bph is safe and effective, with no significant effect on the risk of urinary incontinence in comparison to traditional methods. |
acute myeloid leukemia (aml) may occur in a variety of extramedullary (em) tissues, with or without bone marrow disease. two well - known em manifestations of aml are granulocytic sarcoma (gs) and leukemia cutis. gs, also known as myeloid sarcoma or chloroma, is a rare em tumor of immature myeloid cells.1 the high expression of myeloperoxidase (mpo) makes these tumors appear green hence, the name chloroma (from the greek chloros, meaning green).2 gs can develop de novo or concurrently with aml, myeloproliferative neoplasms (mpns) or myelodysplastic syndromes (mdss).1,36 isolated gs defined by the absence of a history of aml, mds, or mpn, and unremarkable blood and bone marrow analyses has been described, albeit sparsely.79 gs, most commonly see in the context of widespread and uncontrolled disease, may also be the first manifestation of aml, antedating it by months or years, or represent the initial manifestation of relapse in a patient previously treated for aml.10,11 the risk factors for gs include specific chromosomal abnormalities, such as translocations between chromosomes 8 and 21 (t[8;21 ]) and inversion of chromosome 16 (inv), the expression of cell - surface markers (cluster of differentiation [cd]56, cd2, cd4, and cd7), and the french american british (fab) classification m2, m4, and m5 leukemia subtypes. additional risk factors include poor nutritional status, cellular immune dysfunction, high presenting leukocyte count, and decreased blast auer rods.12 gs is slightly more common in men than in women (male to female ratio, 1.42:1).13 while various body sites have been associated with gs, the most common locations include soft tissue, bone, periosteum and the lymph nodes.9,12 here, we describe the case of a female with gs manifesting as a nasopharyngeal mass that was treated with radiation therapy, after which aml manifested 12 months later. we also review the literature of previously reported cases of nasopharyngeal gs and focus on the clinical presentation, diagnosis, and the treatment of this disorder. a 63-year - old caucasian female sought evaluation in the otolaryngology clinic (virginia mason medical center, seattle, wa, usa) due to decreased hearing in her left ear and progressive nasal congestion. prior to that visit, she had been treated empirically for several months with various antibiotics and decongestants and briefly with intranasal steroids. her chronic medical problems were notable for nonallergic rhinitis, hypertension, hyperlipidemia, and morbid obesity. her general and cranial nerve exam were unremarkable, but she was identified as having conductive hearing loss due to a left middle ear effusion. on sinonasal endoscopy, an excoriated mass was also identified, involving the posterior nasopharynx and nasal turbinates. a biopsy of the mass revealed intermediate - sized blastic cells that stained positive for mpo, cd68 (dim), cd99, and cd117 (dim), consistent with involvement by gs (figure 1). the results of the laboratory studies included a normal complete blood count (cbc) as well as unremarkable serum chemistry and liver enzyme levels. a flow cytometry study of the circulating white cells was also unremarkable, as were the polymerase chain reaction (pcr) studies of peripheral blood for the breakpoint cluster region (bcr)-abelson (abl) gene rearrangements and janus kinase 2 (jak-2) mutations. a bone marrow biopsy showed no evidence of aml or features of an mpn ; normal trilineage hematopoiesis was present. a chromosome analyses showed an xx karyotype. an integrated whole body positron emission tomography computed tomography (pet - ct) scan showed only modest inflammation in the nasopharynx (figure 2). because of her age and comorbid medical conditions, we elected to treat her gs with involved - field radiation therapy to the nasopharynx, 30 gy delivered in 15 daily fractions. she tolerated the radiation therapy well, with alopecia involving the vertex of her scalp and mild mucositis, fatigue, and dysgeusia. subsequently, she was monitored closely, with exams of her nasopharynx coupled with blood studies every 2 to 3 months. twelve months after her initial diagnosis of isolated gs, the patient presented to clinic with fever and cough of a week s duration and complained of recrudescent fatigue and dyspnea on exertion. on exam, she appeared acutely ill, dehydrated, febrile, and diaphoretic, and with diminished breath sounds and crackles at the left lung base. her cbc consisted of a white blood count (wbc) of 11.8 10/l with 62% myeloid blasts, hematocrit of 23%, and platelets of 117 10/l. the flow cytometric analysis of peripheral blood revealed an abnormal population of blasts (cd45-dim) that expressed cd117 (moderate) and bright uniform cd33 ; this population comprised approximately 80% of the circulating wbcs. the tumor cells were negative for human leukocyte antigen (hla)-dr, cd34, cd13, cd14, cd15, cd16, cd64, cd2, cd3, cd4, cd5, cd7, cd56, cd71, and cd38. the phenotype was similar to the phenotype of the myeloid blasts identified in her prior nasopharyngeal biopsy. band karyotyping of the peripheral blood blasts showed normal (46, xx) cytogenetics. induction chemotherapy was prescribed, consisting of cytarabine (100 mg / m / day, days 17) and idarubicin (13 mg / m / day, days 13).14 her clinical course was notable for mild mucositis, fluctuating blood sugars, and culture - negative neutropenic fever. a bone marrow aspirate and biopsy obtained on day 14 was markedly hypocellular ; a repeat bone marrow biopsy on day 28 was normocellular, with maturing trilineage hematopoiesis and no residual leukemia. she went on to receive an additional three cycles of consolidation therapy, with continuous infusion cytarabine and bolus idarubicin (5 + 2 regimen).14 she remains in remission, with a normal cbc at the 18-month follow - up visit. it is reported in about 2.5%9.1% of patients with aml.1517 while it can be solitary or multifocal, most cases manifest as isolated single lesions.1 the most common sites of em involvement of aml include the skin (leukemia cutis), lymph node, and bone, but other sites, including the female reproductive tract, breast, gut, and testis have been reported. in the head and neck region, gs will usually involve the orbits, and only rarely will it affect the nasopharynx.18 utilizing a medline/pubmed search, with the key words chloroma, nasopharynx, and acute myeloid leukemia and restricting our search to the english language reports between the years 20002013, we identified 13 additional patients between the ages of 1 to 81 years (median age of 37 years) with gs involving the nasopharynx (table 1).4,1930 the male to female ratio within the group was 1:1. sinonasal congestion or the longest reported disease - free interval from diagnosis was 36 months.4,22 among the seven cases where the disease - free interval was reported, the median was 18 months (range, 4 to 36 months). in the absence of circulating myeloblasts, gs is seldom considered in the initial differential diagnosis of a soft tissue mass.10,12 its similarity, both radiographically and histopathologically, to other small round cell tumors, such as lymphoblastic leukemia, melanoma, ewing sarcoma, blastic plasmacytoid dendritic cell neoplasm, as well as certain forms of non - hodgkin lymphoma and benign em hematopoiesis means that there may be a delay in diagnosis while the clinician waits for supportive diagnostic tests from the pathologist.31 gs typically consists of a diffuse and infiltrative population of myeloblasts and granulocytic cell types. infrequently, tumors can occur in the setting of trilineage hematopoiesis or erythroid or megakaryocytic precursors, particularly in cases of transformation from mpn. immunohistochemistry is useful for establishing the diagnosis of gs and can be easier to perform than flow cytometry, which requires fresh tissue.32 immunohistochemical markers, such as cd68, mpo, lysozyme, and cd43, can assist in differentiating between myeloid and nonmyeloid cells.1 myelocytic differentiation may also be confirmed by leder stain (chloroacetate esterase).17 cd117, cd34, and terminal deoxynucleotidyl transferase (tdt) are useful as markers of immaturity. when gs is found in an em location and in the absence of circulating blasts, a bone marrow biopsy is necessary to rule out concurrent marrow involvement. cytogenetic abnormalities are seen in roughly 50% of cases and include monosomy 7, trisomy 8, inv(16), t(9;11), deletion (del)(16q), t(8;16), and t(1;11).1,3237nucleophosmin (npm1) mutations have been reported in 15% and fms - related tyrosine kinase 3 (flt 3) gene mutations in 20%30% of gs cases;38,39 however, the clinical significance of npm1 and flt3 mutation in this clinical context remains uncertain.38,39 a ct scan is best for evaluating soft tissue gs, and magnetic resonance imaging (mri) with gadolinium is preferred when gs involves the central nervous system.40,41 a pet scan may be helpful for detecting additional sites of em aml and also for planning local (eg, radiotherapy) treatment and/or systemic chemotherapy.42 it can also be used for monitoring the response to treatment.32 for patients who achieve a complete remission with treatment, the role of routine monitoring with radiographs has not been established.32 the treatment of gs depends upon patient and disease characteristics. the patient s age, associated medical comorbidities, clinical symptoms, tumor karyotype, stage, and the extent of disease are important factors to be considered before planning treatment. there are no randomized studies to help guide the treatment choices, and the gs location does not appear to impact survival. chemotherapy (both systemic and intrathecal), radiation therapy, surgical extirpation, or any combination of these interventions have all been employed (table 2). remission - induction chemotherapy similar to that used for aml is favored for either isolated gs or gs presenting with concomitant aml.43,44 significantly longer disease - free intervals without leukemia have been achieved in patients with isolated gs who received systemic chemotherapy rather than surgery or radiation therapy, belying the fact that this is inevitably the first manifestation of a systematic disease.45,46 surgery is generally reserved for cases with acute symptoms (eg, pain, acute nerve compression), and at times, to obtain an adequate tissue sample following a nondiagnostic fine - needle aspiration. the role of allogeneic hematopoietic stem cell transplantation (ahsct) in patients with gs has not been studied prospectively, but improved outcomes with ahsct have been reported in repeated retrospective analyses.1,47 in a retrospective study of 51 patients with gs, either isolated or associated with aml, the 5-year overall survival was 48%, with no significant differences in outcomes between the two presentations.48 for those patients with gs and graft - versus - host disease, there was a trend toward improved overall survival. patients with a history of gs are at risk for relapse, and careful assessments at follow - up appointments are needed as early isolated gs can be asymptomatic.49 a biopsy of any new or suspicious soft tissue or skin abnormality should be performed, and if no circulating blasts are present, a bone marrow biopsy is necessary.32 for patients who relapse after chemotherapy, reinduction chemotherapy may be an option if there has been a long disease - free interval after the initial treatment. for those individuals who are deemed hardy enough and who have an identified hla match, ahsct is the preferred consolidative approach. when bone marrow and em relapse occurs synchronously after ahsct, survival is very poor and no standard treatment has proven effective, although donor lymphocyte infusions, tapering of immunosuppression, or investigational agents may be considered.50,51 | granulocytic sarcoma (gs) is a rare extramedullary manifestation of acute myeloid leukemia (aml). it may also represent blastic transformation of myelodysplastic syndromes or myeloproliferative neoplasms. although usually seen in the context of advanced and poorly controlled disease, it may also present as the first manifestation of illness, without concurrent bone marrow or blood involvement. in the medical literature, chloroma and gs are terms that have been used interchangeably with myeloid sarcoma. gs usually manifests as soft tissue or bony masses in several extracranial sites, such as bone, periosteum, and lymph nodes ; involvement of the head and neck region is uncommon. we report a case of a woman with insidious onset of progressive nasal congestion and diminished hearing who was diagnosed with an isolated gs of the nasopharynx. with involved field radiotherapy, she achieved a complete remission of 12-months duration before being diagnosed with overt aml. she has remained disease - free for greater than 18 months following induction and consolidation chemotherapy. through a medline/pubmed search we identified an additional 13 cases of nasopharyngeal gs. the median age was 37 years (range 1 to 81 years). the cases were equally distributed among the sexes. the most common presenting symptoms were conductive hearing loss and sinonasal congestion. isolated gs was identified in six cases, and the median time from diagnosis of gs to aml was 12 months (range 3 to 48 months). the treatment varied, but responses were seen in all the patients who received chemotherapy with or without radiotherapy. |
a 16-year - old previously healthy girl had a fever at the hong kong international airport after her arrival from san francisco, california, usa, on june 11, 2009. physical examination showed a temperature of 38.3c, a blood pressure of 117/66 mm hg, a pulse rate of 94 beats / min, and an oxygen saturation of 99% at room air. she had a leukocyte count of 4.69 10 cells / l, an absolute neutrophil count of 2.36 10 cells / l, and a lymphocyte count of 1.74 10 cells / l. a nasopharyngeal aspirate (npa) was positive for influenza a virus (h1n1) nucleoprotein by immunofluorescence. npa specimens on days 1 and 5 were positive for influenza a virus (h1n1) m gene and swine - specific specific h1 gene by reverse transcription serum and midstream urine specimens obtained on day 2 were negative for influenza a virus (h1n1) m gene by rt - pcr. the patient refused antiviral therapy with oseltamivir because of fear of its potential side effects. subsequent drug susceptibility testing showed that this isolate was resistant to oseltamivir (50% inhibitory concentration 197.5 nm), but susceptible to zanamivir, as determined by enzymatic assay (table). 50% inhibitory concentrations (ic50s) for oseltamivir and zanamivir were determined by using na - star influenza neuraminidase (na) inhibitor resistance detection kits (applied biosystems, foster city, ca, usa) according to the manufacturer s instructions. ratios of 274h and 274y were evaluated by cloning neuraminidase (na) gene pcr products from nasopharyngeal aspirate (npa) samples or mdck cell cultured virus into the ta vector (invitrogen, carlsbad, ca, usa) and sequencing clones containing the na gene. mutations associated with resistance to na inhibitors, na sequences from the day 1 npa specimen and an mdck cell isolate were examined. viral rna was extracted from npa and mdck cell supernatants by using reported procedures (7). rt - pcr was performed by using primers spanning position 274 of the na gene (forward : 5-acacaagagtctgaatgtgcatgt-3 ; reverse : 5-gtctccgaaaatcccactgcatat-3). direct sequencing of pcr products was performed by using a bigdye terminator v3.1 cycle sequencing reaction kit on an abi prism 3730 dna analyzer (applied biosystems, foster city, ca, usa). sequences indicated that the na genes in the npa and mdck cell virus isolates contained an hy mutation at the na 274 (h3 numbering, 275 in h1 numbering) residue (genbank accession no. no other na mutations known to be associated with oseltamivir resistance were observed. further examination of sequences showed mixed populations (t / c) in the na gene from the npa specimen (figure, panel a). neuraminidase (na) 274y (h3 subtype numbering) gene mutation in influenza a pandemic (h1n1) 2009 virus a / hong kong/2369/2009 isolated from a patient who arrived in hong kong, china, from san francisco, california, usa, on june 11, 2009. a) na sequence of virus amplified by reverse transcription pcr and sequenced directly from a day 1 specimen of a nasopharyngeal aspirate from the patient. nucleotide sequence represents identification of nucleotides by the sequencing machine, and the sequence trace represents the signal (peak) of each nucleotide in the sequencing reaction. nucleotide coordinates (812 and 827) refer to the na gene sequence of pandemic (h1n1) 2009 virus. residue 274y encoded by the 3-nucleotide codon is indicated in boxes and the nucleotide substitution (ct for amino acid change hy) is indicated by arrows colors of curves match those of specific nucleotides. estimation of 274h and 274y populations in the npa specimen was performed by cloning and sequencing pcr products. the npa specimen contained approximately equal proportions of 274y and 274h (52.63% and 47.37%, respectively). examination of sequences from the mdck cell isolate showed predominantly the 274y type, although a minor 274h peak was also observed (figure, panel b). cloning and sequencing of pcr products from the mdck virus isolate showed that 97.92% of the na genes were 274y, which suggests that the 274y population overtook the 274h population during mdck cell culture. resistance to na inhibitors among seasonal strains of human influenza viruses (a / h1n1, a / h3n2, and b) has been rare until recently. development of resistance after oseltamivir treatment has occurred in 0.33%5.5% of treated patients (8). oseltamivir resistance associated with the na 274y genotype was also observed in human infections with avian influenza a virus (h5n1) (9,10). low levels of 274y quasi - species in avian influenza a viruses (h5n1) from avian hosts has been reported (11). oseltamivir - resistant human influenza a viruses (h3n2 and h1n1) have been found to replicate less efficiently than oseltamivir - susceptible strains in cell culture and animal models (1214). however, the na 274y resistant mutant in highly pathogenic avian influenza a virus (h5n1) retained the high pathogenicity of wild - type virus in mammalian species (15). in 2007, an na h274y oseltamivir - resistant variant of seasonal influenza a virus (h1n1) was detected in norway (6). this virus has now become the dominant virus population globally, overtaking oseltamivir - susceptible influenza a virus (h1n1). the molecular basis for the 274y variant in seasonal influenza a virus (h1n1) virus and the mechanism by which this resistant variant became the dominant population remain unknown. lack of general immunity to pandemic (h1n1) 2009 virus in the human population, combined with the inherent adamantane resistance of the virus, indicates that na inhibitors constitute the primary treatment regimen for susceptible patient groups and those in whom severe diseases develop during the current pandemic. there is great concern that an oseltamivir - resistant variant of pandemic (h1n1) 2009 virus may emerge and circulate in a manner similar to oseltamivir - resistant seasonal influenza a virus (h1n1). the patient in this study detection of mixed populations of 274y and 274h in the npa specimen before antiviral treatment suggests that the mutation occurs naturally, either before or during infection. although no experimental data exist that show the growth properties of this resistant variant, examination of the quasi - species population in the cell culture propagated virus isolate showed that the 274y variant has become the dominant population. this finding implies that the 274y mutation does not compromise replication of pandemic (h1n1) 2009 virus in vitro. quarantine procedures adopted by the hong kong special administrative region in china during the early containment phase might have limited transmission of this variant virus. knowledge of this virus is still limited, and characterization of transmission properties of this resistant variant in in vitro and in vivo models is needed. moreover, pandemic (h1n1) 2009 virus should be closely monitored for emergence of resistant variants. | resistance to oseltamivir was observed in influenza a pandemic (h1n1) 2009 virus isolated from an untreated person in hong kong, china. investigations showed a resistant virus with the neuraminidase (na) 274y genotype in quasi - species from a nasopharyngeal aspirate. monitoring for the naturally occurring na 274y mutation in this virus is necessary. |
however, this technique imposes the risk of demineralization of enamel adjacent to brackets and requires drying of enamel surface ; which is important in increasing the bond strength of brackets [1, 2 ]. glass ionomer cements (gics) were initially introduced to dentistry by wilson and kent and to orthodontics by white. gics possess many properties such as forming chemical bonds with enamel, dentin, metal and plastic through the affinity of calcium in tooth structure to carboxylate groups in the reacted gic. because of this unique ability, the gics do not require a completely dry bonding field [3, 4 ]. gics release fluoride within the period of at least 12 months and also have the ability of fluoride recharging from fluoride - containing materials such as toothpastes. gics have some drawbacks for orthodontic bonding namely weak bond strength, high rate of bracket detachment and poor early mechanical properties. addition of small amounts of light activated resin was found to be effective for improving the properties of gics. the resultant material is known as resin - modified glass ionomer (rmgi) introduced in 1988. similar to gics, rmgis have fluoride release and rechargability but are less susceptible to moisture and dehydration during setting and demonstrate better physical properties. the bond strength of rmgis to enamel ranges from 5.4 to 18.9 mpa reported in the orthodontic literature [12 14 ]. nowadays, many adults are interested in orthodontic treatments and prefer aesthetic appliances such as ceramic brackets. these brackets are not distortable ; thus, impose a high risk of enamel fracture during debonding. however, most manufacturers have weakened or eliminated the process of chemical bonding of ceramic brackets. regarding metallic brackets, the important question is whether their bond strength to gics is too weak to withstand the applied forces during orthodontic treatment while with ceramic brackets the concern is whether their bond to gics is too strong and problematic for debonding. in a study by haydar, (1999) the shear bond strength of light - cured composite resins, a light - cured glass ionomer cement and a light - cured compomer used with metal and ceramic brackets were compared and ari scores were evaluated. they reported that ceramic brackets bonded with either of the tested materials had significantly higher shear bond strength compared to metal brackets. regarding metal brackets, bonding with light - cured composite leads to higher bond strength in comparison with light - cured glass ionomer cement (lcgic) and compomer. usyal, in their study on the shear bond strength of metal and ceramic brackets bonded by means of self etching primers (seps) concluded that the shear bond strength of transbond plus self etching primer was significantly lower than of conventional acid etch groups. the aim of this in - vitro study was to compare the shear bond strength of rmgi and composite resin for metal and ceramic bracket bonding. in this experimental lab trial study, 88 human premolars extracted for orthodontic purposes without caries, fractures, wears or developmental defects were collected and immersed in 0.5% sodium hypochlorite for disinfection and stored in normal saline before the onset of study. two bonding agents, a composite resin (transbond xt) and a rmgi (fuji ortho lc, japan) and 44 stainless steel as well as 44 ceramic premolar brackets (both 0.018 inch slot size, standard edgewise brackets) were used in this study. the teeth were randomly divided into 4 groups of 22 teeth as follows : group 1 : stainless steel brackets bonded with composite resin.group 2 : ceramic brackets bonded with composite resin.group 3 : stainless steel brackets bonded with rmgi.group 4 : ceramic brackets bonded with rmgi. the procedure for group 1 and 2 included application of 37% phosphoric acid etchant on the labial surface of teeth for 30 seconds followed by rinsing and drying by an oil and moisture free air. the teeth in groups 3 and 4 were conditioned with the application of 10% acrylic acid to the labial surface for 20 seconds, rinsed for 15 seconds and dried with oil and moisture free air. the adhesive coated brackets were placed on the teeth surfaces and light cured for 10 seconds each at the occlusal, gingival, mesial and distal sides by an led (dentin faraz) light source with a light intensity of 500 mw / cm (controlled by a radiometer). the teeth were mounted in a block of self - curing acrylic resin at the level of 1 mm below the cemento - enamel junction, which stabilized specimens in an instron testing machine. the teeth were stored in normal saline and thermocycled in water between 5 and 55 for 500 cycles (30 seconds in 5 water and 15 seconds out of water and again 30 seconds in 55 water and 15 seconds out of water). after a week, the shear bond strength was evaluated by an instron (dartech, england) testing machine with a crosshead speed of one mm / minute until bracket failure. after the debonding procedure, all the teeth and brackets were examined under a stereomicroscope at 10x and 40x magnifications to assess the amount of residual adhesive remaining on the enamel and the sites of bond failure in the enamel, resin and bracket base. the adhesive remnant index (ari) introduced by bishara was used to evaluate the amount of adhesive left on the labial surface of teeth. the criteria for evaluation were : score 1 : all the adhesive remained on teeth.score 2 : more than 90% of the adhesive remained on teeth.score 3 : between 10% to 90% of the adhesive remained on teeth.score 4 : less than 10% of the adhesive remained on teeth.score 5 : no adhesive remained on teeth. the mean value of shear bond strength in groups 1, 2, 3 and 4 was 20.034.44, 22.526.39, 6.633.44 and 8.693.12, respectively.the mean shear bond strength of the four groups is presented in table 1. the bond strength of composite resin was significantly greater than rmgi. additionally, the bond strength of ceramic brackets was higher than stainless steel brackets. the maximum and minimum sbs values were observed in group 2 (22.526.39) and group 3 (6.633.44), respectively. in order to evaluate the main effects and interactions between the bracket type and bonding material, two - way anova was used ; which showed no significant interaction between the variables (table 2). the amount of residual adhesive on the enamel surface evaluated by a stereomicroscope and the frequency of each score are reported in table 4. the results showed a higher frequency of ari score 3 in groups 1 and 2 and score 4 in groups 3 and 4. the mode of failure was mostly adhesive in composite resin bonded groups (1 and 2) and at the enamel- adhesive interface in rmgi bonded groups (2 and 3). gics form ionic bonds between the negatively charged carboxylate groups in the glass ionomer and the positive calcium ions on the tooth surface. the preparation protocol for gics is to clean the enamel surface but not demineralizing it [10, 20 ] by using a weak acid such as polyacrylic acid. phosphoric acid etching is not appropriate for gics due to their demineralizing effect on the bonding surface and subsequent reduction in bond strength. based on the previous data documenting the poor properties of gics as orthodontic cements, they are not completely accepted for use by the orthodontic community [5, 2122 ]. however, some studies have reported that rmgis may be suitable for bonding orthodontic brackets [23, 24 ]. the problem with ceramic brackets is their high bond strength ; which can result in enamel fracture during debonding. additionally, ceramic brackets are very brittle and their dimensional change before fracture is less than 1% ; therefore debonding forces may result in fracture of the ceramic brackets. because of the large amount of bracket material remaining on the teeth, the clean up process requires the use of abrasive burs and may result in enamel surface loss. reynolds suggested that minimum bond strength of 5.97.8 mpa is required for bracket bonding to enamel surfaces ; while lopez. retief in his study revealed that enamel fracture could occur with bond strengths as low as 13.5 mpa. bond strength values of the brackets in groups 1 and 2 in this study were greater than the minimum requirement reported by retief and subsequently can result in enamel fracture during debonding. thus, such high bond strength should be reduced for example by bending bracket wings toward each other to minimize the risk of enamel fracture. the bond strengths of brackets in groups 3 and 4 of the present study are in the range of 5.9 to 7.8 considered by reynolds and therefore the bond strength provided by rmgis is adequate for routine clinical use. the sbs in group 4 was greater than the rate suggested by lopez, and may be associated with higher clinical success ; additionally, fluoride release from rmgis makes them a more suitable material than composite resins for orthodontic bracket bonding. in our study, the sbs of orthodontic brackets bonded with composite resin was higher than that of rmgi ; which is similar to the findings of voss, komori, fajen, and haydar,. the sbs of ceramic brackets was found to be higher than that of stainless steel brackets ; which is in accordance with the results of uysal and haydar. the highest and the lowest values of sbs were displayed in group 2 (22.52 6.39 mpa) and group 3 (6.63 3.44 mpa), respectively. in a study by haydar, the shear bond strengths of light - cured composite resins, a light - cured glass ionomer cement and a light - cured compomer used with metal and ceramic brackets were compared. the shear bond strength of ceramic brackets was significantly higher than that of metal brackets. the highest value of sbs (20.17 mpa) belonged to ceramic brackets bonded with light - cured composite resins and the lowest sbs (4.45 mpa) belonged to metal brackets bonded with light - cured glass ionomer cement. their findings are in accordance with those of the present study. in our study, the sbs of group 1 was 20.034.44 mpa ; which was similar to the findings of rix but higher than the sbs values reported by movahed, and bishara. in analyzing different parameters influencing the results of this study, it should be considered that in studies done by movahed and bishara the light curing time was half the time in our study and they used transbond plus self etching primer. since the application of self etching technique compared to conventional acid etching results in less adhesive penetration into the enamel, the lower sbs is expected in groups bonded with self etching technique. in a study done by khosravanifard, the light - curing time was 55 seconds ; which was greater than the 40 seconds curing time used in the present study according to forughmand. increasing the curing time results in higher sbs ; however the manufacturer s instruction for curing time is 20 to 40 seconds. bond failure and debonding are important problems in fixed orthodontic treatments. in the current study, it was found that brackets bonded by means of fuji ortho lc differed from those bonded using transbond adhesive in the sites of bond failure. the results showed a higher frequency of ari score 3 in brackets bonded with transbond and score 4 in brackets bonded with fuji ortho lc. bond failure for brackets bonded with fuji ortho lc occurred mostly at the enamel - adhesive interface which might be the result of mechanical retention of the bracket base or chemical bonding between the ceramic bracket and rmgi ; while brackets bonded with transbond typically failed at the bracket - adhesive interface. for instance, bond failure at the bracket - adhesive interface is advantageous because it leaves an intact enamel surface ; however removing residual adhesive is time consuming and imposes the risk of enamel damage. on the other hand, bond failure at the enamel - adhesive interface leaves less residual adhesive remnants but the risk of enamel surface damage is increased. bond failure at the enamel - adhesive interface leaves less adhesive remnants on the enamel surface and therefore decreases the risk of enamel damage during adhesive removal but imposes a higher risk of enamel damage during debonding ; although because of lower sbs compared to transbond composite, the risk of enamel damage during debonding is low as well. rmgis can provide sufficiently high shear bond strength for bonding of metal and ceramic brackets. in cases with aesthetic demands and use of ceramic brackets, rmgis are preferred since they provide adequate sbs and are associated with lower risk of enamel damage during debonding. | objective : the aim of this study was to compare the shear bond strength (sbs) of resin modified glass ionomer (rmgi) and composite resin for bonding metal and ceramic brackets.materials and methods : eighty - eight human premolars extracted for orthodontic purposes were divided into 4 groups (n=22). in groups 1 and 2, 22 metal and ceramic brackets were bonded using composite resin (transbond xt), respectively. twenty - two metal and ceramic brackets in groups 3 and 4, respectively were bonded using rmgi (fuji ortho lc, japan). after photo polymerization, the teeth were stored in water and thermocycled (500 cycles between 5 and 55). the sbs value of each sample was determined using a universal testing machine. the amount of residual adhesive remaining on each tooth was evaluated under a stereomicroscope. statistical analyses were done using two - way anova.results:rmgi bonded brackets had significantly lower sbs value compared to composite resin bonded groups. no statistically significant difference was observed between metal and ceramic brackets bonded with either the rmgi or composite resin. the comparison of the adhesive remnant index (ari) scores between the groups indicated that the bracket failure mode was significantly different among groups (p<0.001) with more adhesive remaining on the teeth bonded with composite resin.conclusion:rmgis have significantly lower sbs compared to composite resin for orthodontic bonding purposes ; however the provided sbs is still within the clinically acceptable range. |
the primary aim of surgical oncology is complete removal of the cancer with clear margins. within breast surgery, the realisation that adequate oncological margins could be obtained without full amputation of the breast was first put forward by keynes in 1937. with the addition of irradiation of the breast for control of local recurrence in 1939, a fundamental change was brought about in the approach to the breast cancer. with time breast surgery the halstead radical mastectomy and the patey modified radical mastectomy are now largely confined to the history books and we are without question in an era when the majority of patients can have breast conserving surgery. with the refinement of breast conserving surgical techniques, combined with the development of specialist breast surgeon training in reconstructive and aesthetic breast surgery, the place of cosmesis in the surgical management of breast cancer has gained increasing attention. there is evidence that removal of greater than 1020% of breast volume is associated with unacceptable cosmetic appearance and poor psychological adjustment after surgery. therefore, the role of oncoplastic surgery in breast cancer has progressively increased in importance since a relative infancy in the 1990s, with an evolution in oncoplastic techniques for the breast, especially the use of reduction mammoplasty approaches to breast cancer management. although breast reduction in breast cancer management has been in use since the 1980s, it is only since 1998 with its introduction by audretsch. that therapeutic mammoplasty has been clearly defined [4, 5 ]. therapeutic mammoplasty (tm) aims to overcome some of the problems associated with breast conserving surgery such as long - term asymmetry, deformity, and technically difficult irradiation of large, ptotic breasts. it may even be of functional benefit to women with macromastia who would otherwise be suitable for reduction mammoplasty [57 ]. within the preoperative planning of women suitable for tm, the surgeon must consider breast size, tumour location, and tumour size and how the breast will be reconstituted in terms of its shape and the choice of pedicle. in women with an appropriate starting point for tm, it is worthwhile noting that breast conserving surgery can be considered even for tumours larger than 4 cm using this technique. the role of magnetic resonance imaging (mri) however in the preoperative diagnosis of breast cancer remains contentious. mri has been criticised for increasing mastectomy rates, increasing rates of diagnosis of clinically insignificant tumours, and delaying time from diagnosis to treatment. mri nevertheless has also been shown to have greater sensitivity compared with mammography in high - risk women and in evaluation of the contralateral breast [9, 10 ]. mri is accepted therefore to have a role in the assessment of high - risk women, the characterisation of uncertain lesions and in the evaluation of residual disease after lumpectomy [11, 12 ]. current recommendations support its use in selected roles but the contribution of mri to the preoperative planning of therapeutic mammoplasty remains undefined. to assess the role and contribution of mri to the preoperative planning of women with breast cancer who are considered potentially suitable for therapeutic mammoplasty. all women who underwent tm between 2006 and 2011 were identified from a prospectively collected database at our institution. patients suitable for tm were assessed by the reconstructive breast surgeon at the leeds breast mdt where on an individual case by case basis, the decision for preoperative mri was made. data was reviewed regarding patient age, tumour type, palpability, and findings on mammography and sonography. further data regarding multifocality, final histological size and weight, use of neoadjuvant chemotherapy, need for further surgery, tumour size as determined by mri, and any supplementary mri findings compared with mammography or sonography was collected. finally, the clinical utility of mri as regards preoperative planning was recorded and the impact mri had on the choice of index operation and potential need for further surgery also. statistics were calculated using graphpad prism 5 (graphpad software, la jolla, ca, usa). data was treated as nonparametric and recorded as median and interquartile range (iqr). comparison between groups has been carried out with the mann - whitney u - test for categorical data, with the chi - squared test comparing observed and expected frequencies. thirty - five women underwent tm of whom 15 (43%) had preoperative mri in addition to conventional imaging. preoperative tumour size as measured by mammogram, uss, and mri was generally greater in the conventional imaging only group, as was final histological size and specimen mass (table 2). of the 15 women who underwent preoperative mri, five were noted to have an additional area of malignant enhancement not seen on conventional imaging. the management of four of these patients was altered to take account of the previously unrecognised lesions. the information was specifically used by the surgeon as part of the surgical planning for the tm to incorporate additional volume resection and enable breast reshaping (table 3). results of chi - squared analysis showed that there was no statistical difference in the numbers of palpable tumours (p = 0.67), multifocal tumours (p = 0.67), or those whose tumours contained dcis (p = 0.72) between the two groups (table 4). mann - whitney u analysis did not show a significant difference between the median specimen mass of the conventional imaging + mri group and the conventional imaging alone group (p = 0.84). overall 14% patients (5/35) required further surgery after tm. in the group who had conventional imaging and mri, just one patient (7%, 1/15) required further surgery. by contrast in the conventional imaging group four (20%, 4/20), patients required further surgery although this was not statistically significant (chi - squared test : p = 0.53) ; figures for relative risk and odds ratio were 0.33 and 0.36, respectively. there was no significant difference in final histological size between the resected specimens of patients who had undergone mri planning and those who have had conventional imaging (chi squared) ; however, there was better correlation between the size on mri and the final histologically reported invasive tumour size. the degree of correlation appeared less robust when comparing mri size and the whole tumour size when dcis was taken into consideration. (table 5). at one year, no patient had had recurrence of their disease. to date (october 2012), five patients have had recurrence of their disease and one patient has been lost to followup. of those with recurrence, one patient had liver metastases at 29 months, one patient had bony metastases at 38 months, one patient had axillary recurrence at 38 months, and one patient had a brain metastasis at 21 months who subsequently died at 30 months after surgery. one patient had a local recurrence at 28 months (despite clear margins in shavings). disease - free survival was 80% in the conventional imaging plus mri group and 90% in the conventional imaging alone group (p = 0.81, chi squared). the role of mri in the assessment of patients with breast cancer continues to defined. whilst mri has been shown to be give a better estimation of intraductal spread and therefore estimation of size of disease, it may also overestimate tumour size, or misclassify benign lesions as being malignant [1317 ]. the comice trial gave evidence that the addition of mri to preoperative imaging does not reduce reoperation rates. the comice study, however, had the drawback of lack of experience with preoperative breast mri, especially by surgeons and in the use of mr - guided procedures. additionally, the study design was based on a cohort already selected for breast conservation therapy. in an era when ever larger lesions are beginning to be considered suitable for breast conserving surgery, the additional information gleaned by preoperative mri may allow women with borderline lesions (with respect to size) to be considered, thus reducing the risk of unnecessary mastectomy. a better estimation of the size of a lesion may also reduce the likelihood of larger than necessary volume resections during tm, where cosmetic appearance is a key facet of the operation. our study was therefore important to verify the practical utility of mri in the setting of consideration for tm. our results have shown that mri correlates more closely with the final histological size than mammography in the assessment of invasive carcinoma. whilst this may be useful in reducing the volume of excision, mri was less accurate in its ability to predict whole tumour volume in relation to dcis. there is some limited evidence that mri may be better than mammography alone in predicting size of dcis ; however, no modality is yet capable of giving acceptable sensitivity and specificity as to the size of dcis. of the 15 patients who underwent mri, 30% were found to have additional lesions (5/15) in whom additional cancer was identified in 60% (3/5). management of these patients was altered to take account of these lesions (enlarging the extent of the wide local excision, converting from a proposed wide local excision to quadrantectomy, or extending the resection into adjacent quadrants to ensure negative margins). margin positivity resulted in further surgery in 7% (1 patient) of the conventional imaging plus mri group compared to 20% (4 patients) in the conventional imaging alone group. relative risk and odds ratio figures of 0.33 and 0.36 would infer a potential risk reduction with preoperative mri ; however, given the small numbers in our study, this may simply represent a type 1 error. conversely, the lack of statistical significance may imply a type 2 error, again reflecting the need for greater patient numbers. of importance, we have shown that the mass, and therefore by implication the volume of resected tissue, did not significantly increase in the conventional imaging plus mri group, suggesting that mri is guiding surgical planning, providing a useful road map of the areas of concern to be excised rather than bluntly suggesting that a larger volume excision is required. our reoperation rates were somewhat higher than other published data for therapeutic mammoplasty specifically (14% versus 2%) but lower than the rates for all forms of breast conserving surgery (20% versus 14%) [20, 21 ]. this improvement in accuracy of surgical excision has likely aided our low repeat surgery rates in the mri group. our rates of margin positivity and local recurrence are in line with recent published literature (mcintosh and o'donoghue, meretoja.) the completed follow - up period for all patients was relatively short at twelve months, although we note that the use of mri and therapeutic mammoplasty had no negative impact on surveillance mammography. the cohort of patients who underwent preoperative mri planning in our study had a smaller volume of tissue resected than those who had conventional image planning. whilst some centres have reported excellent rates of margin positivity with conventional imaging, others have reported markedly higher rates [20, 22 ]. it stands to reason that increased volume of excision reduces the likelihood of a positive margin, but volume excised must be balanced against volume required for reconstruction in tm. mri would therefore seem to show promise to provide the operating surgeon with more information to safely reduce the volume of excised tissue. we propose to evaluate this hypothesis with further data collection and a more prolonged period of followup. thus, the role of mri maybe surmised as a useful tool to aid in decreasing the number of women requiring further surgery following therapeutic mammoplasty. it is particularly helpful where the extent of a tumour is difficult to determine such as in cases of lobular breast carcinoma and where additional lesions are found requiring further characterisation. the selective use of mri can therefore aid the multidisciplinary team in assessing suitability for therapeutic mammoplasty, help avoid excessive surgery, achieve negative resection margins, and reduce requirement for reoperation for margin positivity. mri should be used selectively in addition to conventional breast imaging for surgical planning in patients considered for therapeutic mammoplasty. it can assist in reducing unnecessarily large volume resections, help achieve negative margins, and reduce reoperation rates. | background. assessment of the ratio between tumour volume and breast volume in therapeutic mammoplasty is paramount. traditionally based on clinical assessment and conventional breast imaging, the role of breast magnetic resonance imaging (mri) in this context has not been established. methods. data was collected from all women undergoing therapeutic mammoplasty (tm) between 2006 and 2011. each case was discussed at an mdt where mri was considered to facilitate surgical planning. the contribution of mri to disease assessment and surgical outcome was then reviewed. results. 35 women underwent tm, 15 of whom had additional mri. 33% of patients within the mri subgroup had abnormalities not seen on either mammography or uss. of those undergoing mri, 1/15 patients required completion mastectomy versus 3 patients requiring completion mastectomy and 1 patient requiring further wide local excision (4/20) in the conventional imaging group. no statistical difference was seen between size on mri and size on mammography versus final histological size, but a general trend for greater correlation between size on mri and final histological size was seen. conclusion. mri should be considered in selected patients undergoing therapeutic mammoplasty. careful planning can identify those who are most likely to benefit from mri, potentially reducing the need for further surgery. |
horse riding, a popular sport, and hobby worldwide is now gaining popularity in malaysia. injuries sustained as a result of horse riding are common because of the nature of the sport. the athlete 's partner is a nonhuman animal rather than a machine or other human teammates. the horse can act unpredictably and independently of the rider, both when it is being ridden and when it is not. this key aspect of the sport poses unique challenges not found in any other sport. moreover, can travel up to speeds of 40 mph, and can deliver 1000 n of force in a single kick. when mounted, the rider 's head is approximately nine feet off the ground, unrestrained, and in english riding disciplines, tends to lean forward in the saddle while traveling at relatively high speeds. all of these factors contribute to put the rider at the significant risk of being thrown off. carmichael. reported an injury rate of 1 for every 3501000 h spent riding. although horse riding has benefits to health, it can result in several injuries caused by such factors as improper equipment, clothing, and technique. there is ample opportunity for injury to occur in what has been described as the most dangerous sporting activity in terms of frequency and severity of injury. hasler reported that the most common injuries are head injuries with a percentage of 24%, followed by those of the upper extremities (17%) and the lower extremities (15%). according to silver, in contrast to other sporting accidents, there are more lumbar and thoracic injuries than cervical injuries, and more women are injured than men. of all horse riding activities, jumping is the one most likely to cause a spinal injury. despite the dangers posed by equestrian sport and its widespread popularity in malaysia, literature on injury patterns to date remains sparse, and there is no published study that specifically characterizes the injuries among horseback riders in malaysia. the objective of this research was to get baseline information on the prevalence of injuries to horse riders. the findings of this study could pave the way for further research on injuries sustained by horseback riders to develop a better and safer equestrian sport. the survey was developed by a group of clinicians including physical therapists, physicians, recreational riders and licensed instructors. questions were drawn from previous published literature as well as the authors ' experience in the equestrian community and the rehabilitation setting. the four levels of experience as per the long riders guild academic foundation classification on different levels of riding ability were beginner / novice, intermediate, advanced, and professional. the questionnaire consisting of three sections took approximately 10 min to complete. in the first section, basic demographic details about the participants the second section included questions on horse - related injuries sustained by the participants, the area and the mechanism of injuries. participants were also asked whether they had any medical consultation and underwent any physiotherapy for injuries sustained. the last section was for the participants to describe their background in horse riding and the safety measures they took. special consent had to be obtained from the parents for the inclusion of minors in the study, therefore, minors were excluded. the researchers obtained ethical approval from scientific and ethical review committee of universiti tunku abdul rahman, malaysia. one hundred and forty - five (83.8%) of the participants reported having injuries in the past 12 months. the mean age of participants was 25.7, (standard deviation [sd ] = 7.725). out of 169 participants, about 55% were females and 45% were males, as shown in table 1. the mean height of riders was 161.63 cm (sd = 3.50), and the mean weight was 55.12 (sd = 5.76). demographic data of the participants (n=169) most of the participants (47.3%) belonged to the intermediate level, 29.3% were beginners, 21.8% were at the advanced level, and 1.2% were professionals. however, age was not associated with the experience of the riders [table 2 ]. there was no significant correlation between the level of experience and the prevalence of injuries (p = 0.10). the results show that the type of sport practiced by the riders influenced the prevalence of the injuries (p = 0.05). the results showed that 25.3% were involved in show jumping, 11.8% in dressage and 6.5% of the participants were involved in the polo. however, only 1.2% of the participants were involved in events as their main practice. the most common injuries were of the upper extremities (43.5%), followed by lower extremities (40.7%), head (8.3%), and trunk area (3.4%). surprisingly, there were no reported injuries of the neck region. the data in table 3 shows that of the 8.3% total head injuries sustained, 6.9% of the participants sustained nonfacial injuries, and only 1.37% had injuries of the facial area. of the injuries of the upper extremities, 10.34% of the participants had injuries to the shoulders and 13.79% sustained injuries to the arms. the percentages of injury to the elbows and the forearms were the same, at 6.9%, and percentage of injuries to the palm and fingers was 5.52%. no injuries to the chest were reported and none to the abdomen. however, 0.7% had injuries the upper back region and 2.76% to the lower back region. total injuries reported of the lower extremities amounted to 40.7% ; more at the ankle and foot (19.31%), injuries to the thighs and knees reported were 8.28% and 6.90%, respectively. about 70% of the participants had had soft tissue injury in the previous 12 months, 28.3% of the participants had lacerations and 25.2% had contusion. about 15% of the participants had abrasions, 11% had fractures, and only 6.9% of the participants had concussions. injuries in various anatomical areas (n=145) falls were estimated at 42.7% while others accounted for 47.6% of injuries. mechanical problems accounted for 24.1% of injuries ; 19.3% of the participants had injuries in various parts of the body as a result of the mechanism being dragged. however, only 1.4% of the participants reported being trampled on by a horse. all the participants reported that they wore helmets to ride. about 98% of the participants used gloves, and 96.6% of the participants reported that they wore special trousers to ride [table 4 ]. protective clothing used by riders only 16.55% participants reported doing substitute with performed any warm up exercises before riding. sixty percent of the participants did not seek medical help after injuries, and 10.3% received any kind of physical therapy after injury. horse riders are one of the top four groups being targeted by the commonwealth injury prevention department to reduce their injuries in sport and recreation. the majority of the participants (83.8%) reported being injured as a result of horse - related activities. a previous study by christey on equestrian injuries had also reported a high prevalence rate of injuries in equestrian sports and estimated the injury rate as 0.6/1000 riding hours. in the adventure and tourism industry, it is suggested that prevalence rate is as low as 1 per million participation hours. in 2004, petridou. estimated that the incidence of injury from horse riding was 21/100,000 in greece and that the incidence was 160 times higher for horse racing. the present study demonstrated that the prevalence of injury for female participants was higher (55.03%) than males (42.60%). similar results were reported by in a study conducted in us on orthopedic injuries in equestrian sports. our results are in accord with another study that stated that the group most commonly injured was made up of women. the upper limb injuries outnumbered lower limb injuries with 43.4% of the riders reporting injuries of upper extremities. therefore, when there was a fall, the shirt was easily ripped resulting in an injury to the upper extremities. the incidence of upper limb injuries appears to be more in our study compared with other studies. a similar study found that 24.3% of injuries affected the upper limbs, 42.3% of which were fractures. our results are in accord with the findings of a systematic review of common injuries in horseback riding, which states that the most common location of horse - related injuries is the upper extremities (24%61%). fractures and dislocations of the wrist may result from falls from horses riding, perhaps as a result of the lack of protection for this region. the most common injuries of the lower extremities were soft tissues injuries, lacerations, and abrasion of the skin. equestrian clubs should consider the height of the horse in training sessions since the horse 's height from the ground can contribute to the severity of the injuries when there is a fall. the majority of the participants had < 10 years of involvement in equestrian sport or horse riding. this might be one of the reasons for the high prevalence of lower limb injuries. strength of the core and lower body is very important to maintain the stability on the horse as it helps to maintain the grip of the riders ' legs on the body of the horse. they need to perform exercises that help restore the natural biomechanics of the body and enhance their posture and strength. to strengthen the legs, complicated exercises that require the rider to stabilize their own body weight riders are advised to choose a horse of appropriate size, temperament, character and age to their size and skill level, in conjunction with a trained and experienced horseperson as instructor. a study in 2011 stated that the traumatic events cause different types of fractures and ruptures such as lisfranc fractures, dislocation, ankle injuries, and foot fractures. the severity of lisfranc injury can vary from simple to complex, involving many joints and bones of the mid - foot. all participants wore helmets on while riding. indicating that riders were well informed about the need for helmets. the use of helmets or headgear is compulsory for horse riding in malaysia, so the clubs provide helmets or headgear to riders. the last few decades have shown drastic changes in the attitudes of riders toward the use of helmets when riding. in 1993, a survey off 837 horse riders on attitudes to helmet showed that only 20% wore helmets when they rode, and 40% never wore an equestrian helmet. a decreased incidence of head injuries has been demonstrated with the use of approved riding helmets. a study in 1971 noted that 66% of admissions to hospital were attributable to a head injury but 20 years later this figure had fallen to 26%. another study reported that head injury admissions of a mainly professional group of jockeys were 40%. the main reason for the reduction in head injuries is the improved design of the protective helmet. in addition to headgear, the focus should be on protective equipment for the upper extremities because of the high frequency of injuries involving those parts of the body. the use of properly fitted protective equipment will not eliminate all injuries, but should substantially reduce the severity and frequency of injury. the results show that recreational riding is the most popular type of equestrian sport in malaysia. our research did not show a clear link between the experience of the rider and the risk of injury. previous studies reported that riders with less experience were at a higher risk of injury. however, another study reported that there was no correlation between rider 's experience and injury. this study found no significant differences between the number of participants who had injuries and the skill of the riders. the choice of an instructor should be based on the accident rate of his or her students, both those riding under supervision and those who ride unsupervised. it is recommended that riding establishments and schools should keep records of each horse and any incidents that occur. riders need to be examined before they return to the saddle after an injury for their own good. organizers of equestrian events should ensure that adequate first aid and medical services are available. all horse riders should receive basic training in the principles of first - aid as part of their rider education. the use of rules and regulations for the conduct of events, knowledge of horse behaviour, well - conducted lessons, contraindicated medical conditions, public education, rider education, appropriate equipment and clothing, the riding environment, rider experience, safety stirrups, body protectors, and instruction on first aid are some of the measures to be taken to reduce injuries. the effectiveness of public education campaigns to reduce horse - related injuries should also be evaluated. this evaluation of trauma of riders indicates different patterns of injury, contributing to the growing body of literature in this field. a significant reduction in the morbidity of equestrians could be obtained with the use of safety equipment. certified instructors and first aid training at horse riding facilities would also be beneficial but no single measure would be as effective as the use of approved helmets for every ride. younger female riders tend to have more injuries, though all participants are at risk. furthermore, the true prevalence of injuries is likely under - reported with many patients not seeking medical care. | background : equestrian sport carries with it an implicit risk of injury. despite the frequency of injuries in equestrian sports, there is no published study on injuries of equestrian athletes in malaysia.objective:the objective of this study was to determine the prevalence of injuries and its correlates among horseback riders.subjects and methods : a web - based standardized questionnaire was used to collect data for this cross - sectional survey. horseback riders aged 18 years and above were included in the study. out of 169 participants, 93 were females and 76 were males. the correlation of injuries to gender, age, level of experience, exercise habits, use of safety measures, and type of equestrian sport were determined. chi - square test was performed to test for statistical significance.results:the prevalence was high with 85.8% of the participants reporting symptoms and characteristics of injuries in the past 12 months. the most frequently perceived symptoms reported were in the upper extremities (43.4%) followed by lower extremities (40.7%), head injury (8.3%) and injuries of upper and lower back (3.4%). there was a higher prevalence of injury among female participants (55.03%) than males (42.60%). a significant correlation was found between gender and prevalence of injuries. about 70% of the riders sustained soft tissue injuries. fifty - five percent of the injured were involved in recreational riding. the most common mechanism of injury was a fall from a horse. sixty percent of the injured riders did not seek medical attention after being injured, and physiotherapy consultation was even lower with 10.3%.conclusions : the high prevalence of injuries and low rate of medical consultation emphasize the need for education programs on safety in malaysia. sessions should be held to improve coaching for riders and instructors, and their knowledge of the nature of the horse, mechanisms of injuries, horse handling, and riding skills to help them host safe equestrian activities. |
while sex work is global, it is in sub - saharan africa that sex workers are at most risk of human immunodeficiency virus (hiv) infection and acquired immune deficiency syndrome (aids).1 the prevalence of sexually transmitted infections is very high among sex workers in nigeria.2 early hiv seroprevalence studies among sex workers showed that prevalence increased from 13.4% in 19911992 to 36.4% in 1996.3 notwithstanding increased funding for hiv prevention activities among sex workers in nigeria since the 1990s, hiv prevalence among sex workers has remained high over the past decade. hiv prevalence among sex workers in 2007 was still over 30%, and in some cities like kano and abuja, 50% of all brothel - based sex workers are hiv - infected.4 thus, while hiv prevalence among the general population in nigeria has been declining from its peak of 5.8% in 2001 to 4.1% in 2011,5 prevalence among brothel - based sex workers has shown no sign of declining. given this background, a priority for the growing hiv prevention programs in the country is the development and implementation of interventions to address hiv - related risk associated with brothel - based sex work. although the population of brothel - based sex workers is very small in size compared with the general nigeria population, a recent modeling of apportionment of new infections estimated that in some states (such as ogun in south - west nigeria and benue in north - central nigeria), sex workers and their clients account for about 18% of all new infections.6,7 as noted in the literature, interventions that prevent the transmission of hiv among those with the highest rate of partner change will achieve the greatest reduction in new hiv infections.8 therefore, changing behaviors of sex workers and their clients is essential to reducing hiv transmission in nigeria. while sex work in nigeria remains illegal, it is commonplace, occurring in both residential brothels and at street corners in major cities.914 hiv prevalence among sex workers in nigeria is very high, yet surveys report very low levels of hiv - related risk perception among this group. in a recent survey among most - at- risk populations in six states in nigeria, over half of sex workers did not consider themselves at risk of hiv infection.4 in lagos state, with the highest concentration of sex workers in nigeria, only 16% of brothel - based sex workers felt they were at risk, even though each has on average 34 clients per week.4 despite their high - risk sexual activity, many sex workers perceive their risk of hiv infection to be low.15 given the overall high hiv prevalence among sex workers, why do most of them consider themselves not at risk ? one understudied area noted in the literature is the apparent lack of understanding of sex workers own perception of unsafe sex, why they engage in unprotected sex, and how they understand personal sexual risk - taking.12,16 in an attempt to answer some of these questions, we examined the perception of risk among brothel - based sex workers by applying festinger s cognitive dissonance theory17 and its variant, the principle of balance theory.18 cognitive consistency theories have long postulated that disparities between beliefs and perceived behavior are discomforting and hence people strive to reduce dissonance. the balance theory argues that people feel more comfortable when they agree with issues they like and disagree with issues they dislike.17,18 whenever there is a discrepancy between beliefs and behaviors, something must change in order to eliminate or reduce dissonance. variants of this paradigm have been used in studying other most - at - risk populations. bauman and siegel19 investigated defensive coping in a sample of gay men and found that men who denied or underestimated their risk of hiv infection experienced lower anxiety. we will apply this paradigm to explain why most sex workers engage in risky sexual behavior and yet do not consider themselves at risk of hiv infection. the study is intended to fill the gap of incorrect hiv self - appraisal of risk by exploring how sex workers in nigeria perceive the risks of sex work and to understand their personal hiv risk assessment. we also explored the key strategies used by sex workers to reduce or minimize cognitive dissonance. this study is based on a total of 24 focus group discussions held with brothel - based sex workers in four nigerian cities : ibadan, benin city, jos, and port harcourt. selection of brothels was purposive but brothels were stratified into high - class and low - class based on location. six brothels were selected in each city, comprising two from the affluent areas (high - class) and four from the poorer residential areas (low - class). selection of participants was through convenience sampling, whereby any sex worker on site who was willing to participate in the discussion was selected. only four sex workers, two each in jos and port harcourt, refused to participate when contacted. there were 812 participants per group and the discussions were conducted in the bar or any appropriate area within the premises. because sex work is illegal and respondents will not sign any consent form for fear of the law, we obtained verbal consent from each sex worker and also from each brothel management. the medium of communication was mostly pidgin english, except in jos, where it was combined with hausa (a widely spoken local language in northern nigeria). two females moderated the discussions in port harcourt and jos while two men were in charge of benin and ibadan. experience has shown in nigeria that among sex workers, the gender of the moderators and other facilitators made no difference to the focus group discussions in terms of quality and quantity of information obtained.12 a common focus group guide which consisted of a set of topics to be discussed was developed by the research team (coauthors) and used by all moderators to ensure standardization as far as possible. moderators were trained and ensured that every participant contributed to the discussions. during the discussion session, the topics discussed included the following : awareness about hiv, the nature of sex work and sexual risk - taking, risk of hiv infection and personal risk appraisal, hiv risk reduction strategies, hiv prevention including condom negotiation, and hiv stigma and discrimination. to remove any possibility of bias in responses, no monetary incentives were offered. however, participants were given soft drinks and snacks in the course of the discussion as well as complimentary condoms and promotional items of little monetary value (such as keyrings, t - shirts) at the end of the discussion. they were given the opportunity to ask questions at the end of the discussions and many of the misconceptions about hiv they held were addressed. it is important to note that interactions following the focus group discussions were not included as part of the data used in this report. the translated transcript of each focus group was read by at least three of the authors. the codes, made up of keywords and phrases, were developed from the data. the codes were then grouped together under higher order headings.20 consequently, on a higher logical level of abstraction we created codes, subcategories, categories, and themes.21 we employed latent content analysis in the interpretation of data. qualitative analysis may focus on manifest or latent content.21 manifest analysis describes the visible and the obvious, while latent content analysis involves an interpretation of the underlying and inferred meaning of the text.21,22 latent analysis allows for indepth interpretation and a systematic and thorough evaluation to assess for the presence or absence of a particular idea or theory.21,22 the research team met on various occasions to discuss the coding, analysis, and interpretation, and addressed discrepancies which required clarity. representative quotes that best described the categories were agreed upon by the authors and selected, but in some instances contrasting minority opinions were also highlighted. participants in the study were female sex workers resident in brothels in the port harcourt, benin, ibadan, and jos cities of nigeria. the reported age ranged between 18 and 42 years, with the majority being in their twenties. this is in line with surveys that report the mean age of the nigerian sex worker as being 27 years.4 most of them had some secondary education, particularly those from port harcourt and benin. the charge per round of sex varied, and depended on several indicators including level of sophistication, which could be based on whether it was a sex workers who were young, better educated, and spoke good english charged more. similarly, new arrivals to the brothel also charged a premium. in spite of the evidence that nearly all new cases of adult hiv infection in nigeria are sexually transmitted, most of the sex workers chose to emphasize that sex was not the only means of hiv transmission. many of the women played down the sexual transmission aspect and drew attention to the other modes of transmission as a means of ensuring that their behavior was consistent with their beliefs. if you have gonorrhea and syphilis and you do nt treat them, they can lead to something else. you can contract it through mosquito bites... but for me i do nt believe aids is only through sex the participants knew of the severity of aids and mentioned that aids had no cure. a key strategy in reducing dissonance among the sex workers was through risk - leveling, ie, the strong belief that everybody was at risk. it was clear from the discussions that sex workers were offended when they were considered as being at elevated risk of hiv infection. they rejected being treated with suspicion and ostracism as disease vectors or conduits for the spread of aids, especially by health care providers. the sex workers argued that the problem of aids was not confined to them, that it was everybody s problem, that hiv could and does affect ordinary people as well : it is affecting everybody, it does not know rich, or poor ; anybody can catch it. it is a problem of young man, young woman, old man and old woman. another participant who apparently knew someone who had died of aids emphasized : you think that it s only ashawo (local word for prostitute) that get aids. some of them even felt their risk of infection was far lower than the general population, apparently because they have the opportunity to be educated about hiv preventive measures compared with other women who may never have heard about condoms. had it been i am not doing this business (sex work), i would not have known what condom is and how it is used. there are people staying in their private homes who do nt know the meaning of condom and its importance. many of the respondents held negative and stigmatizing views against people living with aids and nearly all wanted nothing to do with hiv and persons living with hiv and aids. they were of the opinion that one should have very little to do with a person living with aids. maybe you have a brother or sister and a family, then you die from aids. they exaggerated the symptoms of aids to support why a person should not be associated with anyone living with aids : the disease will make you become slim. after you contract aids your placenta and your womb will start to disappear. in fact, a few even mentioned that anybody known to be carrying the virus should be quarantined. a respondent stated : the person be hospitalized indefinitely or removed from the community. for many of the sex workers, belief and trust in god were important attributes that offered safety and security from infection. the belief in the transcendental created some form of risk relief among sex workers. while they appreciated the contradiction that their religion may not support their work, many rationalized by drawing attention to the particular personal, familial problems, circumstances, or tragedies that caused them to choose sex work. this dependence on god was observed among sex workers, particularly in ibadan and jos, where most strongly believed that it was only god who can protect them from hiv infection : whether high or low risk, i put my trust in god... it is only god that gives protection. in ibadan, some brothels organize daily morning prayer sessions during which they asked god for divine protection and prayed that god would bless their work and protect them from contracting aids : we pray that god will not allow anything bad, anything terrible to come near us. another mentioned : i will ask for god s protection since these things are from god. there was a case where the husband had aids and i know that god being on my side i can never get infected. one of the dangerous outcomes of relying on god for protection is the strong belief in faith - based invulnerability to hiv infection. many were of the view that they will never get infected because of their faith : i will not catch it in jesus name. there was also the misconception that condoms were irrelevant, since it is only god who can protect an individual from infection : whether you get medicine in your body, or condom, it is only god who protects. whether i use condom or i do nt use condom, it s only god. closely related to the concept of faith - based invulnerability is the belief in fatalism and predestination. to many of the women, those who will die from aids have already been predestined and consequently it made no sense taking preventive action if one s fate had long since been decided. a participant made clear her fatalistic conclusion : if god says it will happen, so it will happen... and will not die unless they reach the time god says they will die. some extended it further by explaining that god has mapped up the cause of death for each individual and that it is futile to attempt to do otherwise. if it s through an accident, so it will happen, if through malaria so it will happen, if through aids so be it. another concluded that you can not change any of this on your own, it s only god. a related observation, albeit contradictory to the concept of predestination, is the strong belief that those who will die from aids are those who think and perceive the possibility that they are at risk of contracting the infection. this idea of positive thinking and confession is a part of the cultural norm which suggests that evil befalls those who think and speak evil about their own situations. so in this sense silence is golden ; do not think or talk about that evil and that evil will not happen to you. consequently, from their viewpoint, avoiding or contracting aids is the battle of the mind rather than behavioral disposition, a point aptly stated by a participant : it is your mind. it is what you say that is how your mind is and that is what you get. another added : why should i stand a chance of catching it (hiv), even if i do nt use condoms all the time. the belief leads to a situation where the women think one can reduce risk of infection by simply refusing to accept or deny the risk, which is a typical coping strategy to reduce dissonance. these may include physical violence from clients, intimidation from older or more experienced sex workers who may feel threatened by the arrival of younger women, bullying and sexual harassment by unscrupulous law enforcement agents, demands for sexual and other favors from brothel managers / landlords, and economic manipulation and outright exploitation by several other go- betweens. within the context of a skewed power imbalance most blamed clients, some of whom, they said, were not interested in using condoms. a woman described the conflicting decision - making process : because of money, maybe you do nt have any money at your room that day and that person come want to give you n20,000 (about ten times the normal rate) and if he said that he will not use condom, and you look you do nt have money, you will just have to collect that money. another mentioned : the thing there is that men might not agree to use condom because they said they are not enjoying it by using condom, then you being a woman you do nt have money to eat. you will agree to do it like that without condom, so that you may even use it to get money to eat. participants in the study were female sex workers resident in brothels in the port harcourt, benin, ibadan, and jos cities of nigeria. the reported age ranged between 18 and 42 years, with the majority being in their twenties. this is in line with surveys that report the mean age of the nigerian sex worker as being 27 years.4 most of them had some secondary education, particularly those from port harcourt and benin. the charge per round of sex varied, and depended on several indicators including level of sophistication, which could be based on whether it was a sex workers who were young, better educated, and spoke good english charged more. in spite of the evidence that nearly all new cases of adult hiv infection in nigeria are sexually transmitted, most of the sex workers chose to emphasize that sex was not the only means of hiv transmission. many of the women played down the sexual transmission aspect and drew attention to the other modes of transmission as a means of ensuring that their behavior was consistent with their beliefs. if you have gonorrhea and syphilis and you do nt treat them, they can lead to something else. you can contract it through mosquito bites... but for me i do nt believe aids is only through sex the participants knew of the severity of aids and mentioned that aids had no cure. a key strategy in reducing dissonance among the sex workers was through risk - leveling, ie, the strong belief that everybody was at risk. it was clear from the discussions that sex workers were offended when they were considered as being at elevated risk of hiv infection. they rejected being treated with suspicion and ostracism as disease vectors or conduits for the spread of aids, especially by health care providers. the sex workers argued that the problem of aids was not confined to them, that it was everybody s problem, that hiv could and does affect ordinary people as well : it is affecting everybody, it does not know rich, or poor ; anybody can catch it. it is a problem of young man, young woman, old man and old woman. you think that it s only ashawo (local word for prostitute) that get aids. some of them even felt their risk of infection was far lower than the general population, apparently because they have the opportunity to be educated about hiv preventive measures compared with other women who may never have heard about condoms. had it been i am not doing this business (sex work), i would not have known what condom is and how it is used. there are people staying in their private homes who do nt know the meaning of condom and its importance. many of the respondents held negative and stigmatizing views against people living with aids and nearly all wanted nothing to do with hiv and persons living with hiv and aids. they were of the opinion that one should have very little to do with a person living with aids. maybe you have a brother or sister and a family, then you die from aids. they exaggerated the symptoms of aids to support why a person should not be associated with anyone living with aids : the disease will make you become slim. after you contract aids your placenta and your womb will start to disappear. in fact, a few even mentioned that anybody known to be carrying the virus should be quarantined. for many of the sex workers, belief and trust in god were important attributes that offered safety and security from infection. the belief in the transcendental created some form of risk relief among sex workers. while they appreciated the contradiction that their religion may not support their work, many rationalized by drawing attention to the particular personal, familial problems, circumstances, or tragedies that caused them to choose sex work. this dependence on god was observed among sex workers, particularly in ibadan and jos, where most strongly believed that it was only god who can protect them from hiv infection : whether high or low risk, i put my trust in god... it is only god that gives protection. in ibadan, some brothels organize daily morning prayer sessions during which they asked god for divine protection and prayed that god would bless their work and protect them from contracting aids : we pray that god will not allow anything bad, anything terrible to come near us. another mentioned : i will ask for god s protection since these things are from god. there was a case where the husband had aids and one of the dangerous outcomes of relying on god for protection is the strong belief in faith - based invulnerability to hiv infection. many were of the view that they will never get infected because of their faith : i will not catch it in jesus name. there was also the misconception that condoms were irrelevant, since it is only god who can protect an individual from infection : whether you get medicine in your body, or condom, it is only god who protects. whether i use condom or i do nt use condom, it s only god. closely related to the concept of faith - based invulnerability is the belief in fatalism and predestination. to many of the women, those who will die from aids have already been predestined and consequently it made no sense taking preventive action if one s fate had long since been decided. a participant made clear her fatalistic conclusion : if god says it will happen, so it will happen... and will not die unless they reach the time god says they will die. some extended it further by explaining that god has mapped up the cause of death for each individual and that it is futile to attempt to do otherwise. if it s through an accident, so it will happen, if through malaria so it will happen, if through aids so be it. another concluded that you can not change any of this on your own, it s only god. a related observation, albeit contradictory to the concept of predestination, is the strong belief that those who will die from aids are those who think and perceive the possibility that they are at risk of contracting the infection. this idea of positive thinking and confession is a part of the cultural norm which suggests that evil befalls those who think and speak evil about their own situations. so in this sense silence is golden ; do not think or talk about that evil and that evil will not happen to you. consequently, from their viewpoint, avoiding or contracting aids is the battle of the mind rather than behavioral disposition, a point aptly stated by a participant : it is your mind. it is what you say that is how your mind is and that is what you get. another added : why should i stand a chance of catching it (hiv), even if i do nt use condoms all the time. the belief leads to a situation where the women think one can reduce risk of infection by simply refusing to accept or deny the risk, which is a typical coping strategy to reduce dissonance. these may include physical violence from clients, intimidation from older or more experienced sex workers who may feel threatened by the arrival of younger women, bullying and sexual harassment by unscrupulous law enforcement agents, demands for sexual and other favors from brothel managers / landlords, and economic manipulation and outright exploitation by several other go- betweens. within the context of a skewed power imbalance most blamed clients, some of whom, they said, were not interested in using condoms. a woman described the conflicting decision - making process : because of money, maybe you do nt have any money at your room that day and that person come want to give you n20,000 (about ten times the normal rate) and if he said that he will not use condom, and you look you do nt have money, you will just have to collect that money. another mentioned : the thing there is that men might not agree to use condom because they said they are not enjoying it by using condom, then you being a woman you do nt have money to eat. you will agree to do it like that without condom, so that you may even use it to get money to eat. the theory of cognitive dissonance has been used extensively in marketing to explain the choices people make and how people explain and justify purchasing decisions, mainly to avoid buyer s remorse following the purchase of expensive items. on the whole, most people want to convince themselves and hold on to the belief that they have made good choices.23 in this study, sex workers kept on emphasizing that in sex work the old adage holds true, ie, the customer is king. as has been found in south africa,24 where insistence upon condom use was responsible for client loss, nonpayment for services, and physical abuse in some cases, sex workers in our study maintained that, more often than not, the customer, backed by his money, dictated the terms of most sexual acts. while the powerlessness of sex workers is real, the women s reliance on blaming men put together with our previous findings, seem to suggest another example of shifting blame to reduce dissonance. because of the perceived hopelessness of their situation, and to reduce worries and anxieties they would charge higher fees from clients rather than worry about aids which may or may not manifest in the future. to reduce dissonance, most sex workers charged higher for sex without condoms, thereby reducing anxieties, perceiving that the transaction had high benefit and was worth the risk. just like advertising is used to reduce dissonance, the efforts of some of the women who asked their clients to use condoms were often stymied by customers who enticed them with even more handsome financial offers in exchange for sex without condoms. the women narrated how they constantly faced the dilemma of choosing between economic survival and unsafe sex, and many were more concerned with economic survival than the possibility of contracting hiv. we also explored some of the defensive coping mechanisms which make sex workers think they are not at risk of hiv infection. defensive coping is a state in which a person repeatedly presents inaccurate positive self - evaluation as a defense against underlying perceived threat.25 defensive coping is often characterized by rationalization of failures and projection of blame and responsibility.25 there was considerable evidence of optimism bias. this is the mistaken belief that one s chances of experiencing a negative event are lower (or a positive event, higher) than that of one s peers.26 the optimism bias, in line with the theory of cognitive dissonance, is a typical psychological response to worry, threat, and anxiety arising from the apparent discrepancies between beliefs and behaviors. optimism bias is often amplified when the risky event is regarded as controllable and can be prevented through caution or effort.27 it could, as in this study, result in egocentric bias. this is the situation where people feel that they are unlikely to be susceptible to negative events. however, these same people do not assume that other individuals are equally non - susceptible. as a consequence, they perceive other individuals, but not themselves, as susceptible to negative events. similarly they feel they are more susceptible to negative uncontrollable events.27,28 many of the sex workers considered their risk of hiv infection lower than their peers who were not sex workers. these focus more on supportive beliefs that outweigh the dissonant behavior, reducing the importance of the conflicting belief, or changing the conflicting beliefs so that it is consistent with behavior. smokers can rationalize supportive beliefs that may outweigh dissonance by believing that smoking is not as harmful as drinking alcohol. smokers can also reduce the importance of the conflicting belief by ignoring or questioning the validity of evidence that links smoking and ill - health. similarly smokers may change the conflicting belief by rating the effects of smoking as being less dangerous than nonsmokers do.29 in our study, many sex workers focused on supportive beliefs that outweighed dissonant behavior by believing strongly that sexual transmission was not the only route of transmission. secondly, the importance of the conflicting belief, ie, engaging in unsafe sex, was reduced in importance by believing that condom use was not very important because one can get infected anyway if one is predestined to die from aids. thirdly, dissonance was reduced by the fact that it was the client but not the sex worker herself who had the final say in condom use, and therefore condom use was an uncontrollable event. it was found that sex workers assessed risk and balanced the potential risk with ineffective risk reduction and avoidance strategies. one of the puzzling findings in aids research has been the inconsistent relationship between perception of personal risk and engagement in unsafe sexual practices.30 in order to ensure that there is congruence between what they believed and how they behaved, many sex workers in the study rationalized their behaviors and substantially played down the risks of hiv infection. this may be explained in line with the principle of balance theory.18 consequently, many sex workers saw hiv / aids as a problem but chose to put forward several strategies, which they thought might lead to risk reduction or avoidance. rather than considering themselves at a risk higher than average, there was evidence of risk - leveling by believing that everybody is at risk. fatalism was also found to be a risk factor and a key hindrance towards safe behavioral practices. to many of the sex workers, the extent of their self - perceived risk might depend on faith in god, belief in predestination, and the power of positive thinking and positive confession. they felt more comfortable placing their trust in the protective power of god and whatever they perceived had been ordained for them by god rather than in objective self - assessment of the risk of contracting hiv. such fatalistic views concerning hiv / aids can reinforce the erroneous belief that contracting hiv is more a matter of fate than an outcome determined by one s sexual behavior. it reduces anxiety on the part of sex workers who think that whether or not one is infected is beyond their control and in so doing reduces dissonance. social and attitudinal research in many health behavior areas has shown that taking steps to initiate risk reduction behavior change requires personalization of risk.31 therefore, one area of intervention might be activities which develop the accuracy of personal vulnerability and risk self - appraisal. however, enhancing risk sensitization among sex workers by helping them to gauge their personal vulnerability is particularly complex. this might lead to defensive coping.25 a direct confrontational approach could have potentially adverse consequences. extensive emphasis on risk factors among persons with excessive risk behaviors may induce fear and psychological distress, which may in turn be a barrier to behaviour change by reinforcing denial, as can be seen from our study. it appears from our research that focusing excessively on the risks associated with sex work may induce fear, which in turn may cause sex workers to ignore, deny, or refuse to seek out hiv - related information. this observation is consistent with the finding that stimulating the fear of aids or raising concerns about the disease leads to avoidance of any discussion related to aids.32,33 it might also lead to fatalism and reliance on god for protection. as noted by kelly,31 there is probably an optimal level of vulnerability sensitization, in that with too little fear, people will not be motivated to change, but with too much fear, they may avoid or deny the threat. hiv denial could even be exacerbated given the sex workers judgment about hiv - positive people. judgment.34 many of them tended to conclude that the risk of hiv infection does not apply to them but only to those who fit the negatively formed stereotypical image. sex workers mentally disassociated themselves from hiv and held highly stigmatizing attitudes to persons living with hiv and aids. on the surface, the hostile attitude to persons living with hiv and aids is surprising because some knew of colleagues who had died from aids. but they kept balanced by being hostile to persons living with hiv, and in so doing believed that it would not happen to them. in a sense by disassociating themselves from the disease, sex workers in some way blocked off the possibility of getting a disease they so despise. the high level of stigmatization held by sex workers for people living with hiv or aids may lead to low levels of disclosure and may limit their willingness to access regular hiv counseling, testing, and care. although the study provides data for understanding the nature and form of personal hiv risk assessment among sex workers, it has potential biases resulting from selection issues, so its results are not representative and therefore not generalizable to all sex workers in nigeria. again the study was limited to brothel - based sex workers and the findings may not be applicable to nonbrothel - based sex workers. the conclusions derived from the use of latent content analysis, which often leads to a higher level of abstraction in data interpretation, could be different if interpretation had been based solely on manifest analysis. many sex workers underestimate the risks associated with sexual risk - taking, particularly the risk of contracting hiv. furthermore, sex workers selectively distorted information in order to minimize feelings of personal vulnerability and avoid confronting the urgent need to change behavior. designing interventions that ensure that sex workers accurately understand their risks and are more prepared to reduce hiv - related risks is indeed a challenge for hiv program managers. this is often compounded by the fact that sex work is survival sex based on commercial transactions in which the feelings, demands, and interests of the customer often take precedence over those of the woman, even if there are apparent risks of contracting hiv. sex work affords women important economic benefits, and programs need to address the benefits versus costs associated with behavior change because it is self - evident that it is much more difficult for condom use to be introduced by the weaker party in any power - imbalanced relationship. at the extreme end of perceived invulnerability was a small group of sex workers who shared feelings of rejection and dejection, and often perceived themselves as powerless to change their conditions. it is known that positive evaluations of self - worth can enhance a person s ability to avoid risk - inherent sexual behaviours.31 within a context of pervasive hopelessness and with very little reason for optimism of better times and personal advancement ahead, it may be very difficult for sex workers to act on standard risk reduction recommendations.35 at the moment, many interventions are unable to make any impact among sex workers because they focus only at the tail end of the behavior change continuum, ie, behavior change through condom use. while this may be effective among persons who may consider themselves at risk of infection, the goal of interventions may initially be focused as suggested by kelly31 on assessing readiness for change and to determine what level of motivational and risk sensitization is needed in the early phase of hiv interventions among sex workers. because most of the sex workers did not consider themselves at risk of hiv infection, this must be of great concern to programmers in a country where hiv prevalence among sex workers has hovered around 30% in the last decade. it is necessary for programs to encourage sex workers to undertake accurate self - appraisal of risk. while knowledge of risky behavior does not necessarily translate to behavior change, ability to identify risky behaviors | backgroundover one - third of sex workers in nigeria are infected with human immunodeficiency virus (hiv), yet there is a lack of understanding of sex workers own perception of sexual risk - taking. applying the theory of cognitive dissonance, this paper examined the personal hiv risk perception of brothel - based sex workers.methodsthe study is based on 24 focus group discussions held among brothel - based sex workers in four geographically and culturally dispersed cities in nigeria.resultsit was found that sex workers underestimated their risk of infection and rationalized, defended, or justified their behaviors, a typical psychological response to worry, threat, and anxiety arising from the apparent discrepancies between beliefs and behaviors. to reduce dissonance, many sex workers had a strong belief in fatalism, predestination, and faith - based invulnerability to hiv infection. many believed that one will not die of acquired immune deficiency syndrome if it is not ordained by god. the sex workers also had a high level of hiv - related stigma.conclusionfrom these findings, most sex workers considered risk reduction and in particular condom use as far beyond their control or even unnecessary, as a result of their strong beliefs in fatalism and predestination. therefore, one critical area of intervention is the need to assist sex workers to develop accurate means of assessing their personal vulnerability and self - appraisal of hiv - related risk. |
originally, glial cells were considered as a sort of glue that filled the space between neurons, which is largely a passive role. in time, this view changed substantially. in the peripheral nervous system (pns), schwann cells (scs) were recognized to regulate a wide variety of ongoing functions of axons (mirsky and jessen, 1999). it is well known that the myelin sheath, by increasing the operational resistance of the axolemma, greatly increases the velocity of the nerve impulse, which is a passive effect (hartline and colman, 2007). a number of observations indicate that the cellular biology of axons is regulated by scs. in the axolemma of unmyelinated fibers, 2003) but in axons surrounded by myelin, the axolemma under the sheath is poor in sodium and rich in potassium channels while the converse occurs at the nodal axolemma, where sodium channels accumulate (salzer., 2008 this indicates that scs regulate at a molecular scale the local organization of axons, thus regulating the axonal phenotype. waller (1850) established that nerve section is followed by degeneration of the distal domain while scs evolve to a dedifferentiated state. nerve repair re - establishes the original condition (jessen and mirsky, 2008). after nerve injury, elongation of axons was shown to be prevented by scs as long as they remained differentiated distal to injury (tapia., 1995 ; court and alvarez, 2000), which strongly suggests that nerve repair proceeds in close interaction with the sc and not commanded by the cell body (bray and aguayo, 1974 ; court and alvarez, 2005). when scs in a segment of an intact nerve are treated with a protease inhibitor, which has been shown to induce sc dedifferentiation (alvarez., 1992, 2000 ; 1995), the associated axon extends sprouts in that segment in spite of being surrounded by scs, i.e., branches arise in an uninterrupted axon. this indicates that the axon has a growth program repressed by the differentiated sc (court and alvarez, 2005). together, these phenomena illustrate that the sc locally affects the underlying axon, from its passive electrical properties, to organization of the axolemma, and even complex cellular programs embodied in the axoplasm. we will consider now the first step of regulatory mechanisms between cells that operate on a local basis. adhesion molecules are an important and well characterized mechanism that allows contact - mediated signaling between cells. another mechanism involves extracellular free ligands that are produced by a cell and operate on a very short range, from its site of release to its receptor in the target cell. these two mechanisms share an important feature, namely, the machinery that produces the response belongs entirely to the target cell. a third regulatory mechanism has emerged in which a cell produces vesicles that are taken up by the target cell and the cargo is incorporated into the recipient cytoplasm (simons and raposo, 2009). this mechanism opens a new dimension to the intercellular interaction in that the recipient cytoplasm may contain an incomplete machinery that is completed by molecules of the donor cell upon their release from the vesicle. our review focuses on the regulation of axons by scs mediated by secreted vesicles and proposes the advantages of this means of communication in supporting neuronal and axonal maintenance and regeneration after nerve damage. that proteins may enter the cytoplasm from the outside is an old notion. about fifty years ago, it was established that some proteins of the oocyte yolk of the mosquito aedes aegypti were synthesized in the gut, moved to the ovary, and were taken up from the extracellular space via pinocytic vesicles to be stored essentially as a reservoir of amino acids for the embryo (roth and porter, 1964). in the nervous system, the giant axon of the squid was incubated with radiolabeled amino acids and labeled proteins were recovered from its axoplasm (lasek., 1974). however, the notion of transcellular transfer emerged under the assumption that axons were unable to synthesize proteins, but since this assumption was wrong as axons do synthesize protein (koenig and giuditta, 1999 ; alvarez., 2000 ; donnelly. 2010), the notion of glia - to - axon transfer of protein awaited further experimental support. around the 1980s, the groups of stahl and johnstone provided evidence to support that vesicles can mediate the release of proteins during reticulocytes maturation (harding., 1983 ; these vesicles named exosomes were contained within multivesicular endosomes whose fusion with the plasma membrane was followed by exosome secretion (johnstone., 1987 ; simons and raposo, 2009 ; thery., 2009). in turn, vesicles originated after the evagination of the plasma membrane were named microvesicles (cocucci., 2009 ; thery., 2009). that was the beginning of a new era in cell communication, based on these antecedents, transfer of macromolecules from sc to axons was reconsidered, this time mediated by vesicles. thus, buchheit and tytell (1992) described transfer of fluorescently labeled vesicles from scs to squid giant axons. they proposed that these vesicles carried the proteins previously thought to be transferred directly from the sc to the axon, such as heat shock protein (hsp) 70 (tytell., 1986) a protein also carried in exosomes secreted by reticulocytes (davis., 1986) but they did neither confirmed these possibilities nor their functional significance. nowadays, exosomes and microvesicles have been described in glial cells from the central nervous system (cns, see table 1), although in the pns the evidence is scarce. hsp70 is present in exosomes secreted from a sc cell line (fevrier., 2004), sc primary cultures (lopez - verrilli m. a. and court f. a., unpublished results) and in exosomes secreted by glial cells from the cns, including astrocytes, oligodendrocytes, and microglia (potolicchio. it remains to be investigated whether vesicular transfer of hsp70 to axons confers neuroprotection to stress stimuli and neurodegenerative disorders. nd, not determined ; cnp, 23-cyclic - nucleotide - phosphodiesterase ; egfrviii, truncated isoform of endothelial growth factor receptor ; escrt, endosomal sorting complex required for transport ; fasl, fas ligand ; fgf-2, fibroblast growth factor 2 ; hsp70, heat shock protein 70 ; huvecs, human umbilical vein endothelial cells ; ide, insulin - degrading enzyme ; il-1, interleukin-1 ; mbp, myelin basic protein ; mmp, matrix metalloproteases ; mog, myelin oligodendrocytes glycoprotein ; mtdna, mitochondrial dna ; ntpdase, nucleoside triphosphate diphosphohydrolase ; plp, proteolipid protein ; prp, prion protein ; prpsc ; prion protein scrapie ; timp2, metallopeptidase inhibitor 2 ; scs, schwann cells ; trail, tumor necrosis factor - related apoptosis - inducing ligand ; vegf, vascular endothelial growth factor. schwann cells are essential during regenerative processes after nerve injury, not only by secreting growth factors (madduri and gander, 2010 ; quintes., (2008, 2011) demonstrated in vivo the transfer of ribosomes from scs to axons after axonal damage as well as during axonal regeneration. electron microscope images showed ribosomes in the axoplasm but also within vesicles surrounded by two or multiple membranes. interestingly, even multimembrane vesicles open to the axoplasm were still partially loaded with ribosomes and abundant free ribosomes seemingly discharged in the vicinity, suggesting that sc - derived vesicles were secreted and internalized in axons by endocytosis. nevertheless, the molecular mechanism for ribosomal transfer after axonal damage and during axonal regeneration has not been disclosed yet. considering that sc exosomes diameter varies between 50 and 120 nm (lopez - verrilli m. a., and court f. a., unpublished results), only a small amount of ribosomes microvesicles are larger vesicles (up to 1 m ; cocucci., 2009) and might even transport polyribosomes. since mrnas can be stored in a dormant state in the distal axon until needed (yoo., 2010), the transfer of mrna - containing ribosomes from sc to axon could supply transcript for storage and translation in response to acute stimuli (e.g., nerve damage) or the transfer be triggered by the stimuli itself. in addition, vesicular transfer from scs would accelerate the arrival of ribosomes to the axon, compared to ribosomes derived from the neuronal cell body (twiss and fainzilber, 2009). in the dark side of vesicular transfer, scs have been shown to secrete exosomes containing pathogenic prions upon cell infection in vitro, therefore prion secretion via sc - derived exosomes may spread these pathogenic proteins from the pns to the cns (fevrier., 2004). prions are misfolded proteins that act as infectious agents and cause neurodegenerative diseases (weissmann., 2011). furthermore, pathological cell cell communication by endogenous vesicular vectors could be one of the mechanistic explanations for non - cell autonomous processes playing critical roles in neurodegenerative diseases (garden and la spada, 2012). summing up, scs might provide by means of secreted vesicles, an efficient, specific, and highly localized support for axons. vesicles interact specifically with the target cell (rana and zoller, 2011) supplying many copies and many kinds of macromolecules, which might allows scs to locally regulate axonal functions without direct involvement of the neuronal cell body. together, the evidence suggests that machineries of a given cytoplasm may be incomplete requiring the contribution of a neighboring cell to become operative (court., 2008, 2011). from another point of view, the phenotype of a cell may require the contribution of an external genome to supply the missing messenger rnas. scs contain mrnas coding for neurofilament proteins, which they barely translate (roberson., 1992), and its transfer within vesicles could be instrumental for protein homeostasis in axons. in brief, the transfer of vesicles and their cargo of protein and rnas open a novel mode for intercellular interaction, and a broad avenue of research. about fifty years ago, it was established that some proteins of the oocyte yolk of the mosquito aedes aegypti were synthesized in the gut, moved to the ovary, and were taken up from the extracellular space via pinocytic vesicles to be stored essentially as a reservoir of amino acids for the embryo (roth and porter, 1964). in the nervous system, the giant axon of the squid was incubated with radiolabeled amino acids and labeled proteins were recovered from its axoplasm (lasek., 1974). however, the notion of transcellular transfer emerged under the assumption that axons were unable to synthesize proteins, but since this assumption was wrong as axons do synthesize protein (koenig and giuditta, 1999 ; alvarez., 2000 ; donnelly. 2010), the notion of glia - to - axon transfer of protein awaited further experimental support. around the 1980s, the groups of stahl and johnstone provided evidence to support that vesicles can mediate the release of proteins during reticulocytes maturation (harding., 1983 ; pan., 1985). these vesicles named exosomes were contained within multivesicular endosomes whose fusion with the plasma membrane was followed by exosome secretion (johnstone., 1987 ; simons and raposo, 2009 ; thery., 2009). in turn, vesicles originated after the evagination of the plasma membrane were named microvesicles (cocucci. 2009). that was the beginning of a new era in cell communication, the release of membrane vesicles. based on these antecedents, transfer of macromolecules from sc to axons was reconsidered, this time mediated by vesicles. thus, buchheit and tytell (1992) described transfer of fluorescently labeled vesicles from scs to squid giant axons. they proposed that these vesicles carried the proteins previously thought to be transferred directly from the sc to the axon, such as heat shock protein (hsp) 70 (tytell., 1986) a protein also carried in exosomes secreted by reticulocytes (davis., 1986) nowadays, exosomes and microvesicles have been described in glial cells from the central nervous system (cns, see table 1), although in the pns the evidence is scarce. hsp70 is present in exosomes secreted from a sc cell line (fevrier., 2004), sc primary cultures (lopez - verrilli m. a. and court f. a., unpublished results) and in exosomes secreted by glial cells from the cns, including astrocytes, oligodendrocytes, and microglia (potolicchio., 2005 ; krmer - albers., 2007 ; it remains to be investigated whether vesicular transfer of hsp70 to axons confers neuroprotection to stress stimuli and neurodegenerative disorders. nd, not determined ; cnp, 23-cyclic - nucleotide - phosphodiesterase ; egfrviii, truncated isoform of endothelial growth factor receptor ; escrt, endosomal sorting complex required for transport ; fasl, fas ligand ; fgf-2, fibroblast growth factor 2 ; hsp70, heat shock protein 70 ; huvecs, human umbilical vein endothelial cells ; ide, insulin - degrading enzyme ; il-1, interleukin-1 ; mbp, myelin basic protein ; mmp, matrix metalloproteases ; mog, myelin oligodendrocytes glycoprotein ; mtdna, mitochondrial dna ; ntpdase, nucleoside triphosphate diphosphohydrolase ; plp, proteolipid protein ; prp, prion protein ; prpsc ; prion protein scrapie ; timp2, metallopeptidase inhibitor 2 ; scs, schwann cells ; trail, tumor necrosis factor - related apoptosis - inducing ligand ; vegf, vascular endothelial growth factor. schwann cells are essential during regenerative processes after nerve injury, not only by secreting growth factors (madduri and gander, 2010 ; quintes., 2010) but also by supplying components of the protein synthesis machinery to axons. (2008, 2011) demonstrated in vivo the transfer of ribosomes from scs to axons after axonal damage as well as during axonal regeneration. electron microscope images showed ribosomes in the axoplasm but also within vesicles surrounded by two or multiple membranes. interestingly, even multimembrane vesicles open to the axoplasm were still partially loaded with ribosomes and abundant free ribosomes seemingly discharged in the vicinity, suggesting that sc - derived vesicles were secreted and internalized in axons by endocytosis. nevertheless, the molecular mechanism for ribosomal transfer after axonal damage and during axonal regeneration has not been disclosed yet. considering that sc exosomes diameter varies between 50 and 120 nm (lopez - verrilli m. a., and court f. a., unpublished results), only a small amount of ribosomes could be transported within each exosome. on the other hand, microvesicles are larger vesicles (up to 1 m ; cocucci., 2009) and might even transport polyribosomes. since mrnas can be stored in a dormant state in the distal axon until needed (yoo., 2010), the transfer of mrna - containing ribosomes from sc to axon could supply transcript for storage and translation in response to acute stimuli (e.g., nerve damage) or the transfer be triggered by the stimuli itself. in addition, vesicular transfer from scs would accelerate the arrival of ribosomes to the axon, compared to ribosomes derived from the neuronal cell body (twiss and fainzilber, 2009). in the dark side of vesicular transfer, scs have been shown to secrete exosomes containing pathogenic prions upon cell infection in vitro, therefore prion secretion via sc - derived exosomes may spread these pathogenic proteins from the pns to the cns (fevrier., 2004). prions are misfolded proteins that act as infectious agents and cause neurodegenerative diseases (weissmann., 2011). furthermore, pathological cell cell communication by endogenous vesicular vectors could be one of the mechanistic explanations for non - cell autonomous processes playing critical roles in neurodegenerative diseases (garden and la spada, 2012). summing up, scs might provide by means of secreted vesicles, an efficient, specific, and highly localized support for axons. vesicles interact specifically with the target cell (rana and zoller, 2011) supplying many copies and many kinds of macromolecules, which might allows scs to locally regulate axonal functions without direct involvement of the neuronal cell body. together, the evidence suggests that machineries of a given cytoplasm may be incomplete requiring the contribution of a neighboring cell to become operative (court., the phenotype of a cell may require the contribution of an external genome to supply the missing messenger rnas. scs contain mrnas coding for neurofilament proteins, which they barely translate (roberson., 1992), and its transfer within vesicles could be instrumental for protein homeostasis in axons. in brief, the transfer of vesicles and their cargo of protein and rnas open a novel mode for intercellular interaction, and a broad avenue of research. vesicle secretion as a means to supply components to a target cell offers a number of advantages considering the sc and axon dynamics, e.g., during myelination and regeneration conditions. in the myelinated nerve fiber (figure 1a), vesicles could be released from microvilli domains to the node of ranvier and transfer scaffolding proteins required for the proper node formation, such as actin, tubulin, cofilin, and ankyrin - g (krmer - albers., 2007 ; vesicles could be secreted along the schmidt - lantermann incisures cytoplasm channels across the myelin sheath or paranodal domains directly to the axoplasm, providing macromolecules in a temporally and spatially regulated fashion. both exosomes and microvesicles deliver not only proteins but also micrornas and mrnas that can be translated into recipient cells (ratajczak., in fact, elongation factors needed for mrna translation have been found in exosomes from oligodendrocytes and microglial cells (potolicchio., 2005 ; krmer - albers., 2007). schematic representation of possible routes of exosomal (red circles) and microvesicle (larger green ovoids) transfer between scs and axons in a myelinated fiber (a) and in an axonal growth cones during axonal regeneration (b). exosomes are contained within multivesicular endosomes (mve) in the secreting cell, and then can move to the axon through cytoplasmic - rich region in scs, including schmidt - lantermann incisures [sli, yellow regions in (a) ] or paranodal domains of myelinating fibers (a) or can be released close to the growth cone by dedifferentiated sc (b). microvesicles, in turn, are generated from the evagination of sc plasma membrane and they can fuse or be internalized by axons. exosomes and microvesicles may actively participate in processes activated after nerve damage, when scs dedifferentiate and begin to proliferate (figure 1b). this scenario is quite complex since axons degenerate distal to the injury, while in the proximal stump, regeneration takes place (coleman, 2005 ; twiss and van minnen, 2006). in these conditions, scs could secrete vesicles containing mrnas and micrornas to negatively regulate myelination and stimulate proliferation, as observed for glial tumor cells (skog., in addition, scs - secreted vesicles could sustain protein synthesis in regenerating axons (court., 2011), independently from axonal mrna synthesized in the neuronal nuclei, which needs to be transported a long way before translation, or even provide guiding clues to regenerating axons, such as the axonal guidance protein wnt, which has been detected in exosomes from motor neurons (zou, 2004 ; korkut., 2009). if sc - derived vesicles are demonstrated to have functional roles in axonal regeneration, sc differentiation, or other processes crucial for neural tissue regeneration, these vesicles can be used for therapeutic purposes by using their endogenous potentials or by loading them with specific transcript or proteins by modifying glial cells, which can be easily manipulated in vitro (schmitte., 2010 ; zhang., 2010 it has been demonstrated that neuronal - targeted exosomes obtained from genetically modified dendritic cells in vitro can be electroporated with specific sirna, and after intravenous injection, they specifically knock - down their target gene in brain neurons (alvarez - erviti., 2011). vesicle - mediated drug delivery promises to overcome important challenges, such as delivery of drugs across impermeable biological barriers and using patient - derived cells to obtain tolerogenic vesicles. in this review we presented evidence for sc to axon communication via secreted vesicles and highlighted the functional role this process may have in the maintenance of peripheral axons and during regeneration. increasing evidence is suggesting that axons have the ability to respond to a challenge autonomously from the cell body albeit under scs regulation (alvarez. since axons are of any length up to several meters, this anatomy clearly poses logistic problems. the evolutionary solution may be that sc packs the requisite components in a vesicle to convey its cargo to the axoplasm. we propose that vesicles secreted by scs and transferred to axons are a major mechanism by which scs locally support axonal maintenance and regeneration after nerve damage. we hope that the study of the processes will enrich our understanding of the cellular biology of the nervous system. the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. | schwann cells (scs) are the glial component of the peripheral nervous system, with essential roles during development and maintenance of axons, as well as during regenerative processes after nerve injury. scs increase conduction velocities by myelinating axons, regulate synaptic activity at presynaptic nerve terminals and are a source of trophic factors to neurons. thus, development and maintenance of peripheral nerves are crucially dependent on local signaling between scs and axons. in addition to the classic mechanisms of intercellular signaling, the possibility of communication through secreted vesicles has been poorly explored to date. interesting recent findings suggest the occurrence of lateral transfer mediated by vesicles from glial cells to axons that could have important roles in axonal growth and axonal regeneration. here, we review the role of vesicular transfer from scs to axons and propose the advantages of this means in supporting neuronal and axonal maintenance and regeneration after nerve damage. |
the dna region encoding a gene must be accessible to proteins such as transcription factors and rna polymerase. as shown in figure 1, a nucleosome is composed of a dna sequence wrapped 1.65 times around a histone octamer. if the dna region is wrapped compactly to prevent proteins from binding to the dna, the corresponding gene is not transcribed. therefore, nucleosomes can regulate gene expression by restricting or facilitating the dna accessibility of proteins. figure 2 shows the profile of typical nucleosomes around the transcription start sites (tsss) of yeast genes. the most prevalent size of nucleosomes is approximately 147 base pairs (bp), and the length of linker dna between nucleosomes is approximately 18 bp. the occupancy of a nucleosome represents the possibility that a nucleosome resides at a particular genomic location. the area downstream of the 1 nucleosome is the nucleosome - free region (nfr) which shows very low nucleosome occupancies over approximately 150 bp on average. the first nucleosome downstream of the nfr is the + 1 nucleosome, followed by the + 2, + 3, and + 4 nucleosomes. while the + 1 nucleosome is stable, its upstream and downstream nucleosomes show declines in occupancy and stability and become fuzzy. for proteins to bind the dna region associated with compact nucleosomes to initiate transcription, the nucleosome structure needs to be changed. interestingly, nucleosomes are dynamic, and their structure can be transformed [6, 7 ]. atp - dependent remodeling can slide histone octamers a short distance along dna or remove them temporarily from dna. additionally, chemical modifications of histones or histone replacement with histone variants can alter the structure of nucleosomes. nucleosome prediction refers to nucleosome positioning in the genome. using mnase - seq or chip - seq, it is possible to identify the genomic locations of nucleosomes [4, 5, 8 ]. micrococcal nuclease (mnase) is a restriction enzyme that digests dna that is not wrapped around histones. by treating cells with mnase, linker dna is removed, and nucleosomes can be extracted (figures 3(a) and 3(b)). immunoprecipitation (chip) with histone antibodies can be further employed to select nucleosomes with regard to specific histone modifications. next - generation sequencing (ngs) technologies generate short sequences (2536 bp), referred to as tags, from the 5 ends of purified dna fragments in a cost - effective manner [9, 10 ] (figure 3(d)). as shown in figure 1, dna is double stranded, with the forward strand oriented in the 5 to 3 direction and the reverse strand in the opposite direction. therefore, the sequence tags from the 5 ends of the forward and reverse strands represent the left and right boundaries of nucleosomes, respectively (figure 3(c)). to determine the genomic locations of nucleosomes, nucleosome locations differ from cell to cell, and mnase digests dna at various levels. therefore, mapping short sequences to a reference genome produces a series of distributions with regard to the frequencies of tags starting at each genomic location (figure 3(e)). a simple algorithm to predict the positions of nucleosomes along the genome smooths the tag distributions and positions nucleosomes with their left and right boundaries at the local maxima of the distributions on the forward and reverse strands, respectively (figure 3(f)). the occupancy of a nucleosome is derived from the frequencies of tags that are used to position the nucleosome. however, the true locations of nucleosomes are unknown because mnase does not digest linker dna precisely. furthermore, tag distributions are not well separated in many genomic regions (figure 3(g)). therefore, nucleosome prediction using next - generation sequencing data is difficult. in the next section, nucleosome positioning methods are introduced, and a novel voting algorithm is proposed for reliable nucleosome prediction. genetrack shifts sequence tags toward the 3 direction by half of the user - defined nucleosome size, smooths the tag distributions using a gaussian smoothing procedure, and then positions nucleosomes by setting the local maxima to the centers of nucleosome. nucleosomes can be defined separately on the forward and reverse strands or on the composite strand derived from the sum of the tag frequencies on the forward and reverse strands. nseq generates probabilistic distributions of nucleosome centers based on sequence tags and determines significant nucleosomes using triangle statistics, n statistics, and false discovery rates. templatefilter identifies the genomic locations where its templates, including a normal - shaped template, correlate with tag distributions. then, the locations of optimal templates correlated with the forward and reverse tag distributions determine the left and right boundaries of nucleosomes, respectively. therefore, templatefilter defines nucleosomes of various sizes differently from genetrack and nseq. in machine learning, one approach for finding a reliable solution to a difficult problem is the ensemble method, which combines the outcomes of different models. the simplest ensemble technique is voting, in which multiple models take votes, and the majority outcome is adopted as the solution. in nucvoter, a nucleosome prediction method is regarded as a voter, and the three voters described above locate nucleosomes across the genome. if two or more of the voters position nucleosomes around a genomic location, nucvoter defines those nucleosomes as consensus nucleosomes and their nucleosomal locations as consensus areas where true nucleosomes are likely to reside (figure 4). then, nucvoter assigns a priority to each voter as described below and chooses the nucleosome predicted by the voter with the highest priority in each consensus area. if only one voter places a nucleosome in a particular genomic location, nucvoter concludes that the site does not contain a nucleosome. in a preliminary process, nucvoter normalizes the occupancies of nucleosomes from each voter so that the values show a zero mean and 1 standard deviation. then, nucvoter further makes the entire occupancies positive by subtracting the global minimum occupancy, which is a negative value, from the normalized occupancies. to establish the priority of each voter then, it is hypothesized that if the consensus nucleosomes in a consensus area are nearer, they display higher occupancies than those in other consensus areas, meaning that if voters predict nucleosomes within a short distance of each other, the possibility that a nucleosome resides in that region is high. the consensus nucleosomes with the consent of all three voters are extracted, and their averaged center distance is computed in each consensus area. then, the correlation between the occupancies of the consensus nucleosomes of each voter and their corresponding averaged center distances is calculated. nucvoter regards the voter showing the higher negative correlation as more accurate and assigns the higher priority to that voter. the distances between the centers of the consensus nucleosomes in a consensus area should be 73 bp (half of the prevalent nucleosome size). the two globally nearest nucleosomes predicted by two different voters create a consensus area, and the third consensus nucleosome predicted by the other voter is added so that the distances between the centers of all consensus nucleosomes are minimized. this process is iterated among the remaining nucleosomes until no more consensus nucleosomes exist. then, nucvoter determines the priority of each voter using the consensus nucleosomes receiving the consent of all three voters, as described above, and chooses the nucleosome predicted by the voter with the highest priority in each consensus area where two or more voters consented. when two or more datasets need to be compared (see section 3.2), nucvoter sets the global voting priorities on the basis of the averaged correlation of each voter across the datasets. because the exact locations of nucleosomes are unknown, synthetic datasets were generated to measure the performance of nucvoter. the data generation procedure was carried out in a manner similar to the function of syntheticnucmap embedded in the r package of nucler. a total of 1000 stable nucleosomes were generated periodically on the basis of a nucleosome size of 146 bp and a linker length of 20 bp, and 50 nucleosomes were randomly removed. the forward / reverse tags for both stable and fuzzy nucleosomes were randomly generated in the range of 1 to the c coverage (i.e., the number of tags) at the starting / ending locations of nucleosomes. then, stable tags were randomly shifted in the range of + /20 bp and fuzzy tags in the range of + /50 bp. finally, 49000 true nucleosomes in 40 synthetic datasets were generated based on the combination of various numbers of fuzzy nucleosomes (f : 50 to 500 with an interval of 50) and different coverage (c : 50 to 200 with an interval of 50). note that most of the parameter values used for this process were the default values of the syntheticnucmap function. genetrack, with a nucleosome size 146 bp on the composite strand, as well as nseq and templatefilter, was initially executed using their default parameter values to predict synthetic nucleosomes. however, nseq and templatefilter positioned too few nucleosomes. therefore, to generate a reasonable number of nucleosomes, the -f 1 option was used for nseq, and the options -overlap 1.0 and -corr_bound 0.3 were used for templatefilter. note that the parameter values were not optimized because the goal of implementation was not to compare the performance of existing methods but to examine how the proposed voting algorithm improves the prediction capability given the outputs of individual methods. table 1 shows the prediction of true nucleosomes in the synthetic datasets. if the distance between the centers of a true nucleosome and the nearest predicted nucleosome is 73 bp, the true nucleosome is regarded as correctly predicted. the true positives indicate the correctly positioned true nucleosomes, and the false positives represent the incorrectly positioned false nucleosomes. although templatefilter predicted the greatest number of true positives, it also positioned many false positives. nucvoter and genetrack showed reasonably good performance. using the true positives, the cumulative frequency ratio was plotted as a function of the distance between the centers of the true and predicted nucleosomes (figure 5(a)). while nucvoter and nseq predicted nucleosomes accurately, genetrack and templatefilter did so less accurately. however, these results might have been produced because different numbers of nucleosomes were used for plotting. thus, the same number of the true positives nearest to the true nucleosomes was extracted from each dataset, and the plot of their cumulative frequency was drawn (figure 5(b)). furthermore, nucvoter outperformed the other methods significantly (p values of the kolmogorov - smirnov test < 2.2e 16). the centers of 90% of the nucvoter nucleosomes were within 5 bp from the centers of true nucleosomes. this result supports the hypothesis that the proposed voting algorithm improves the accuracy of nucleosome prediction. to further analyze the prediction improvement achieved by nucvoter, linker analysis was performed. figure 6 shows the linker length frequencies obtained. as noted above, the length of true linkers in the synthetic data was 20 bp, and the plot therefore displays a particularly high frequency peak at 20 bp (figure 6(a)). additionally, because 5% of nucleosomes were randomly removed, there was a high frequency peak at 186 bp (i.e., 146 bp + 20 bp + 20 bp). although there were various linker lengths of less than 186 bp observed due to the presence of fuzzy nucleosomes, there were no linkers longer than 186 bp. in the region below 200 bp, nucvoter and nseq produced frequencies that were more similar to the real linker frequency compared to genetrack and templatefilter (figures 6(b)to 6(e)), which means that nucvoter and nseq predicted nucleosomes more accurately however, nseq and templatefilter exhibited relatively high frequencies, approximately 352 bp and in the area of 500 bp or longer (figures 6(d) and 6(e)), which indicated missing consecutive true nucleosomes. to measure the overall performance of nucvoter, individual locations in synthetic genomes were scanned, and a confusion matrix of the locations of nucleosomal and linker dna was generated [18, 20 ]. true positives (tp) and true negatives (tn) represent correct predictions of nucleosomal and linker locations, respectively. while a false positive (fp) occurs when a linker location is incorrectly predicted as a nucleosomal location, a false negative (fn) the sensitivity is tp divided by tp + fn and measures the ability to correctly predict true nucleosomal locations. the specificity, which is tn divided by tn + fp, measures the ability to correctly predict true linker locations. the overall accuracy is defined as the number of correct predictions divided by the total number of predictions (i.e., tp + tn over tp + tn + fp + fn). as observed in table 2, nucvoter achieved the best performance in terms of both sensitivity and overall accuracy. regarding specificity, nucvoter displayed a performance similar to that of nseq, which exhibited the best performance. nucvoter was applied to published mnase - seq datasets generated from normal and heat - shocked yeast cells. to achieve consistent voting between the two datasets, the global priorities for nucleosome selection were set in the order of templatefilter, nseq, and genetrack on the basis of the averaged correlation values across the two datasets, as described above. to make the occupancy levels of two datasets comparable, the occupancy values of nucleosomes predicted by nucvoter were further normalized via the quantile method. additionally, genetrack and nseq were executed with the -f 1 option, and templatefilter was run with its default options to generate a reasonable number of nucleosomes. assuming the published nucleosomes to be true nucleosomes, if the distance between the centers of a published nucleosome and the nearest predicted nucleosome was d, the published nucleosome was regarded as correctly predicted. then, the similarity was defined as the number of correctly predicted nucleosomes divided by the total number of predicted nucleosomes (i.e., tp over tp + fp + fn). refer to table 1 description for the definitions of tp, fp, and fn. interestingly the nucleosomes predicted by nucvoter showed the highest similarity to the published nucleosomes overall. figure 8 depicts the averaged frequency of nucleosomes predicted by nucvoter as a function of the distance from tsss. the number of nucleosomes in the heat - shocked cells is greater than the number in normal cells, which indicates that nucleosomes are gained under heat shock. while the frequencies of the nucleosomes downstream of the + 1 nucleosome decrease slightly, the numbers of the nucleosomes upstream of the 1 nucleosome increase to a small degree. figure 9 is the averaged occupancy plot for the nucleosomes predicted by nucvoter as a function of the distance from tsss. it can be observed that the occupancy of nucleosomes in heat - shocked cells is higher than in normal cells. the + 1 nucleosome displays strong occupancy, and its downstream nucleosomes show substantially decreased occupancy. although the 1 nucleosome exhibits a lower frequency than its upstream nucleosomes, as shown in figure 8, its occupancy is higher. additionally, the length of the nfr is slightly shorter in the heat - shocked compared to the normal cells. figures 10(a) and 10(b) provide plots of the frequencies of the lengths of linkers predicted by nucvoter in the range of + /1000 bp from the tsss of genes. the linkers are shorter overall in the heat - shocked cells than in the normal cells, and the small peak observed at approximately 180 bp in the normal cells, which reflects the nfr, disappears following heat shock. to analyze the nfrs predicted by nucvoter, the longest linkers in the range of tss 250 bp to tss + 50 bp were defined as nfrs, and the 264 genes whose nfr lengths were reduced by 150 bp following heat shock were extracted. then, gene ontology (go) analysis of the genes was performed using funspec [21, 22 ]. a total of 29 and 28 genes significantly contribute to translation and metabolic processes, respectively. this result supports the notion that the nfr plays an important role in regulating gene expression. although nucleosomes are critical for regulating gene expression, the prediction of nucleosome locations is difficult. this paper proposed the nucvoter algorithm, which is a novel voting algorithm for reliable nucleosome prediction using next - generation sequencing data. synthetic datasets were generated and employed to demonstrate that nucvoter significantly improved the accuracy of nucleosome prediction because the locations of true nucleosomes were unknown. nucvoter predicted nucleosomes closer to true nucleosomes than any other method examined in this analysis. in addition, nucvoter produced linkers in a manner that was more similar to actual linkers than most of the other methods. furthermore, it was confirmed that nucvoter achieved the best prediction accuracy and significantly improved the performance of nucleosome prediction. using published datasets from normal and heat - shocked yeast cells, it was shown that nucvoter could be applied to various nucleosome analyses. many nucleosomes were observed to be gained under heat shock, and the occupancy of nucleosomes in the heat - shocked cells was higher than in normal cells. additionally, the linkers became shorter in the heat - shocked cells compared to the normal cells. based on go analysis, it was further noted that genes whose nfr lengths were considerably reduced following heat shock contributed to translation and metabolic processes. | nucleosomes, which consist of dna wrapped around histone octamers, are dynamic, and their structure, including their location, size, and occupancy, can be transformed. nucleosomes can regulate gene expression by controlling the dna accessibility of proteins. using next - generation sequencing techniques along with such laboratory methods as micrococcal nuclease digestion, predicting the genomic locations of nucleosomes is possible. however, the true locations of nucleosomes are unknown, and it is difficult to determine their exact locations using next - generation sequencing data. this paper proposes a novel voting algorithm, nucvoter, for the reliable prediction of nucleosome locations. multiple models verify the consensus areas in which nucleosomes are placed by the model with the highest priority. nucvoter significantly improves the performance of nucleosome prediction. |
three thermodynamically stable cr forms, cr(0), cr(iii), and cr(vi), are used commercially and are present in the environment. cr(0) is found almost exclusively in its metallic form, most commonly as a component of iron - based alloys such as stainless steel. only cr(vi), but not cr(0) or cr(iii), has been shown to cause cancers in laboratory animals and occupationally exposed workers. environmental pollution with various forms of cr results from its numerous uses in the chemical industry, production of dyes, wood preservation, leather tanning, chrome plating, manufacturing of various alloys, and many other applications and products. stainless steel contains up to 20% cr by weight and is the highest volume product containing this metal. the magnitude of cr utilization is also evident from the estimated occupational exposure by more than 500,000 workers in the u.s. alone.(3) incineration and emissions from cars create ambient pollution with small cr(vi)- and cr(iii)-containing particles, which leads to low - level inhalation exposures by large segments of the general population and increases cr levels in surface waters. the most serious cases of anthropogenic contamination of drinking water in the u.s. came from the discharges of toxic cr(vi) by cooling towers.(4) other large - scale environmental pollution with cr(vi) involved improper disposal of millions of tons of incompletely processed chromite ore.(5) hundreds of the largest toxic waste sites in the u.s. known as superfund sites contain cr as a major contaminant.(2) the presence of cr(vi) in drinking water can also result from the oxidation of naturally occurring cr(iii) by mn(iii / iv) oxides in birnessite,(6) a common mineral that coats weathered grains and fractures in cr - rich ultramafic rocks and serpentinites that are enriched with chromite [fecr(iii)2o4 ]. in addition to birnessite, the presence of two other mn(iv) oxide - containing minerals, asbolane and lithiophorite, has also been associated with the formation of cr(vi) from natural cr(iii).(7) examination of four minerals made of mn oxides (birnessite, cryptomelane, todorokite, and hausmannite) showed that birnessite had the highest ability to oxidize cr(iii) under laboratory conditions.(8) cr(0)-containing products are generally highly resistant to corrosion ; however, slow oxidation of cr - containing alloys can result in the limited release of soluble cr(iii) into soil and water. mobility of cr(iii) strongly depends on the acidity and cr(iii)-binding properties of soluble and insoluble components at the contamination sites. cr(vi) and cr(iii) have dramatically different toxicological properties, and all public health concerns are centered on the presence of toxic hexavalent cr in drinking water. in 1991, the us - epa set the current standard for cr in drinking water (maximum contaminant level) at 100 g / l,(9) which does not distinguish between the presence of toxic cr(vi) and nontoxic cr(iii). considering long - standing public concerns about cr(vi), it is unclear why there are no requirements for specific monitoring of cr(vi) levels. the analytical technologies for cr speciation and detection were not very sensitive until the mid-1980s, and reliable measurements of cr(vi) at environmental levels typically required preconcentration steps, which were more suitable for specialized academic laboratories than for routine monitoring. however, analytical methodologies for cr(vi) underwent dramatic improvements a long time ago. the epa s own method 218.6 for the detection of hexavalent cr was developed approximately 20 years ago and affords a reliable monitoring of cr(vi) at 1 this methodology is not expensive and is based on a routine hplc column separation of chromate anion followed by a colorimetric detection with diphenylcarbazide. essentially all analytical laboratories are equipped with hplc and should be able to perform this type of cr(vi) measurements at relatively low cost. recent improvements of chromatographic and postcolumn derivatization conditions in the epa s method 218.6 allow the detection of cr(vi) in drinking water at 3 ng / l (application update 179 from dionex, inc.). this sensitivity is more than sufficient to meet the most stringent regulations for cr(vi), including those associated with the public health goal of 20 ng / l in california. for many samples with very low cr levels, cr(vi) analyses by the modified method 218.6 could be even more sensitive than measurements of total cr. although the presence of cr(vi) near municipal water reservoirs is the obvious reason for its monitoring in drinking water supplies, environmental contamination with cr(iii) can also generate cr(vi) through oxidation reactions with water chlorination products,(10) ca and mn oxides, and photoxidation.(13) overall, industrial activities associated with the direct release of cr(vi) into the soil and water is the most important source of cr(vi) contamination in drinking water (figure 1). route 1 is the most important overall source of cr(vi), whereas route 2 describes the most important natural process of cr(vi) formation. hexaaquachromium(iii) [cr(h2o)6 ] is the main cr species in solutions of inorganic cr(iii) salts under strongly acidic ph. at ph 4 and higher, cr(iii)-bound h2o molecules undergo hydrolysis, which leads to the formation of soluble and insoluble oligomeric and polymeric products (figure 2a). the reactions of hydrolysis and polymerization are accelerated by increasing ph > 5, and adjustment of solutions to neutral ph results in a rapid precipitation of multinuclear cr(iii) hydroxides. in addition to ph, the generation of polymeric products is influenced by the cr concentrations, composition, and mild acidity and the absence of significant amounts of organics in drinking water supplies limit the presence of dissolved cr(iii) due to its poor solubility. in contrast to its aqua complexes, cr(iii) compounds with small organic molecules such as organic acids, biological buffers, amino acids, and others are soluble and remain monomeric for a long time.(16) thus, the description of cr(iii) insolubility at neutral ph is only correct for solutions lacking ligands that compete with h2o. formation of stable cr(iii) complexes with small organic molecules at the primary source of emission or contamination sites can increase their environmental mobility and maintain the solubility of cr(iii) even at neutral ph. binding of cr(iii) by fe - oxyhydroxides and immobilized organic matter in the soil or sediments diminishes its soluble pool. interactions between cr(iii) with components of environmental media involve continuous cycles of adsorption / desorption and precipitation / dissolution, which control the extent of its environmental mobility. animal and epidemiological studies have consistently found inorganic cr(iii) to be nontoxic and noncarcinogenic, which has also been confirmed for the dietary supplement chromium picolinate.(17) the absence of toxic effects for cr(iii) complexes results from their poor ability to enter cells, lack of intracellular accumulation, and high stability of coordinated multidentate ligands, which prevents binding to cellular macromolecules.(16) systemic absorption of cr(iii) taken by human volunteers in the form of dissolved inorganic salts is measurable but usually less than 0.5%. no elevation in urinary excretion of cr(iii) was detected from the ingestion of insoluble cr2o3,(19) which raises the question as to why the use of inorganic salts resulted in cr(iii) absorption at all considering the formation of oligomeric products after the dissolution of these compounds in water. a plausible explanation for these results lies in highly acidic conditions of the human gastric environment (ph 13),(20) which is expected to promote dissociation of cr(iii) oligomers. low ph also strongly enhances the exchange of h2o for organic ligands in the cr(iii) coordination sphere,(21) allowing the formation of new cr(iii) complexes that could remain soluble upon reaching neutral ph of the small intestine, where the absorption of metal ions takes place. a short stomach residency time for pure water and other simple liquids, however, is expected to limit the extent of ligand exchange reactions. chromate anion (cro4) is the predominant form of cr(vi) in dilute solutions at neutral ph. chromate exists in equilibrium with its protonated form hcro4 in approximately 3:1 ratio at these conditions.(22) hcro4 becomes the most prevalent species of cr(vi) at ph 95% of cr(vi) reduction in vivo. tissue concentrations of gsh and asc are not usually dramatically different, and the predominant role of asc stems from its very high rate of cr(vi) reduction. at physiological 1 mm concentration, t1/2 for cr(vi) reduction by asc was 1 min vs 60.7 min for gsh and 13.3 min for cys.(32) despite its slower rate of reduction, gsh is more important for cr(vi) metabolism than cys due to its higher cellular concentrations. in contrast, cellular cr(vi) reduction is the activation process, producing redox - active intermediates asc is the dominant reducer of cr(vi) in cells in vivo, whereas gsh is the most prominent reducer in cultured cells due to their asc - deficiency. depending on the nature of the reducing agent, its concentration, and stoichiometry, cr(vi) reduction reactions generate variable amounts of transient products such as cr(v), cr(iv), and sulfur- and carbon - based radicals. as expected for these important biological antioxidants, gsh-, cysteine-, and asc - derived radicals formed in cr(vi) reactions are unreactive toward dna. in the presence of h2o2, intermediate cr forms can catalyze fenton - type reactions, generating highly reactive oh radicals. formation of reactive oxygen species (ros) and direct oxidizing abilities of cr(v) are the two main processes contributing to the induction of oxidative stress in cr(vi)-treated cells. more detailed discussion of properties of intermediate cr forms can be found in other reviews. although all biological reducers convert cr(vi) to cr(iii), their mechanisms of reduction are not the same. kinetic analyses predict that cys acts almost exclusively as a one - electron reducer,(45) which is consistent with the presence of strong cr(v) signal in cys - driven reactions.(46) reduction by gsh can proceed through either one- or two - electron reactions. asc is a highly efficient two - electron donor, yielding cr(iv) as the first reduction intermediate and dehydroascorbic acid as the oxidized product. the presence of cr(v) is only detectable under nonphysiological conditions of equimolar or higher ratio of cr(vi) to asc. insufficient amounts of asc for the completion of cr(vi) reduction in these reactions were responsible for a transient appearance of cr(v), likely resulting from comproportionation of cr(iv) and cr(vi). severe asc deficiency of human and nonhepatic rodent cells in standard cultures raises concerns that studies with cultured cells may not accurately recapitulate genotoxic properties of cr(vi) in vivo. the asc - depleted state of cultured cells results from the absence of this vitamin in the most common types of synthetic growth media, and typical additions of 10% serum to the media theoretically supplies only 10% of normal vitamin c levels. the actual levels of asc in the growth media are lower due to its loss during the preparation and storage of serum. the half - life of asc at 37 c in cell culture media is 67 h.(55) recently fed cells can contain up to 5060 m vitamin c, but in many cases, its levels are dramatically lower or undetectable. even when cells start with 5060 m asc, they become completely depleted of asc after 2448 h in culture.(54) physiological concentrations of vitamin c in white blood cells and epithelial tissues are usually in the 12 mm range. cellular metabolism of cr(vi) can cause both oxidative and nonoxidative forms of dna damage. the most abundant and specific type of dna damage is cr - dna binding (adducts), which has been detected in reduction reactions in vitro, in various cultured cells and in vivo.(16) formation of cr - dna adducts in human cells was already clearly evident after brief exposures to 2 m (current federal standard for cr in water) and even lower concentrations of cr(vi). the rapid loss of cr - dna adducts from normal but not nucleotide excision repair (ner)-deficient human cells(59) firmly demonstrated that cr binding to chromosomal dna occurred in intact cells and did not arise artificially during dna purification. cr - dna adducts are a heterogeneous group that includes binary [cr(iii)-dna ] and several ternary [ligand - cr(iii)-dna ] adducts where the ligand can be asc, gsh, cysteine, or histidine. all four ternary adducts have been detected in cr(vi)-treated cells and are readily formed during in vitro cr(vi) metabolism. dna cross - linking of gsh, cysteine,(21) and asc was observed in their corresponding reactions with cr(vi), while dna attachment of nonreducing amino acid histidine occurred efficiently during the reduction of cr(vi) with asc.(62) cr(vi) also causes the formation of protein - cr(iii)-dna cross - links, which are rare lesions and whose main toxicological significance could lie not necessarily in the contribution to genotoxic responses but rather in the inhibition of gene - specific expression.(65) binary cr - dna adducts are the most frequent dna modifications in the in vitro reductions of cr(vi). in cr(vi) reactions with its two main biological reducers, asc(51) and gsh,(38) binary adducts accounted for 7595% of the total dna - bound cr. when normalized for recovery, asc - cr - dna cross - links have been calculated to comprise 6% of cr - dna adducts in human a549 cells with restored asc levels.(51) cys - cr - dna and gsh - cr - dna accounted for 24 and 17% of all dna adducts in hamster cho cells,(60) although these values have not been adjusted for recovery. protein - cr - dna cross - links constitute only about 0.1% of total adducts immediately after cr(vi) exposures, but their relative amounts are likely higher at later postexposure times due to delayed formation(67) and slower repair(66) relative to those of small cr - dna adducts.(59) all small ternary adducts are formed via the conjugation of preformed ligand - cr(iii) complexes with dna, whereas protein dna cross - linking proceeds through the initial formation of binary cr(iii)-dna adducts followed by a slow reaction of protein capture.(67) binary cr(iii)-dna adducts can result from direct dna binding by cr(iii), but the role of other cr forms in their formation can not be excluded.(16) complex metabolism of cr(vi) and the formation of several types of dna damage make it difficult to assess the importance of specific lesions in cr(vi)-treated cells. these difficulties can be overcome using a shuttle - vector methodology, which allows for the examination of mutagenic and genotoxic properties of in vitro formed dna damage during replication in intact human cells. replication of adduct - carrying shuttle - vectors in human cells showed that the most abundant adduct, the binary cr - dna conjugate, was weakly mutagenic, whereas four ternary adducts containing dna - cross - linked asc,(32) gsh, cysteine, and histidine(68) were strongly mutagenic. asc - cr - dna was the most potent mutagenic and replication - inhibiting adduct. in vitro reduction of cr(vi) by purified asc,(32) gsh,(38) or cysteine(37) also led to the production of mutagenic and replication - blocking dna lesions, as revealed by analyses of replicated progeny of shuttle - vector plasmids propagated in human fibroblasts. asc - driven metabolism of cr(vi) in vitro resulted in the strongest mutagenic responses,(32) while reactions with gsh showed low yields of mutagenic damage and gsh - cr - dna adducts.(38) these findings were corroborated by a strong potentiation of cr(vi) mutagenicity in cells with restored asc levels.(27) blocking of cr - dna binding during the reduction or dissociation of cr - dna adducts eliminated all mutagenic and replication - blocking responses in shuttle - vector plasmids incubated in cr(vi) reactions containing asc, gsh,(38) or cys,(37) demonstrating a key role of cr - dna adducts in the mutagenicity and genotoxicity of cr(vi) when metabolized by its three main biological reducers. in agreement with these results, in vitro reduction reactions employing iron - free reagents failed to generate detectable amounts of single - strand breaks and abasic sites in dna. inhibition of in vitro replication on dna templates damaged in cr(vi)-asc reactions was also dependent on cr - dna binding.(70) involvement of cr - dna adducts in bacterial mutagenesis by cr(vi) is indicated by higher yields of revertants in the ames test using a ner - deficient salmonella uvra strain.(71) cr(vi) mutagenicity in transgenic laci mice was inhibited by gsh depletion,(72) which points to the importance of nonoxidative mechanisms and gsh - cr - dna adducts in mutagenic responses in vivo. cr(vi)-induced fold changes in the number of hprt mutants were reported to be lower in ner - deficient clones of cho cells grown under the standard asc - deficient conditions,(73) which contrasts the positive role of ner in the removal of adducts and survival of cho(74) and human cells.(59) thus, it is possible that ner operates differently on distinct cr - dna adducts. however, interpretation of the results with ner - null cho clones was complicated by their greater background mutation frequencies, and these high denominator values offer an alternative explanation for an appearance of diminished mutagenic responses for cr(vi) when data were expressed as a fold of change.(73) ternary but not binary cr - dna adducts were strong inhibitors of replication in plasmids transfected into human cells. these results were unexpected given weak structural distortions in cr - adducted dna with 12 unwinding angle per cr atom(75) and the inability of cr - dna adducts to block dna replication in vitro.(61,70) the phosphate group is a primary site for cr(iii)-dna binding, although additional coordination to n7-dg is also possible as evidenced by the ability of cr(iii) to bind to dg,(62) g / c - targeted mutagenesis and preferential incisions by a bacterial ner nuclease in cr - adducted dna.(76) replication inhibition by ternary cr - dna adducts required the presence of mismatch repair (mmr) proteins,(77) which were found to recognize these modifications with an affinity that was comparable to that of their natural substrate, g / t mismatch.(78) binary cr - dna adducts were poorly bound by mmr proteins, and their weak effects on vector replication were mmr - independent.(78) in a full agreement with plasmid replication experiments, mmr - null mouse and human cells were resistant to apoptosis and clonogenic toxicity by cr(vi). studies with human cells of different histological origin showed that the high genotoxicity and cytotoxicity of cr - dna adducts resulted from their misprocessing by mmr into dna double - strand breaks (dsb). importantly, dsb were detected by various techniques, including a direct methodology of pulse - field gel electrophoresis.(78) mmr was responsible for all dsb generated in asc - restored normal human cells treated with both high and very low environmentally relevant (0.22 m) concentrations of cr(vi).(27) the asc - cr - dna adduct was very efficiently recognized by mmr proteins in vitro,(78) and restoration of asc levels in cells strongly increased cytotoxicity and dsb formation by cr(vi) via mmr activity. asc - deficiency of human lung beas-2b cells during their chronic exposures to cr(vi) could explain the inability of this cell transformation model(79) to recapitulate a hallmark of cr(vi) carcinogenesis in the lung, microsatellite instability resulting from inactive mmr.(58) formation of dsb by cr - dna adducts occurs in the g2 phase of the cell cycle, although their initial recognition by mmr proteins takes place in the preceding s phase and is dependent on ongoing replication. g2-specific dsb were observed for both soluble and particulate chromates.(80) a progression of g2 cells with incompletely repaired dna breaks through the cell cycle could be responsible for the observed s - phase arrest and dsb during chronic exposures to cr(vi). cr - induced dsb were more persistent in human cells lacking wrn helicase, a protein mutated in the werner syndrome of premature aging. wrn was specifically required for the repair of mmr - generated dsb through its involvement in the activation of the initial steps in homologous recombination, leading to the formation of rad51 foci.(83) cr(vi) treatments of wrn - deficient cells also led to higher levels of telomere damage,(84) although it remains unknown whether cr - dna adducts and aberrant mmr contribute to the observed telomeric abnormalities. occupational exposures to cr(vi) via inhalation have consistently been found to increase the risk of cancers in the respiratory system. a study by zhang and li(88) reported increased mortality from stomach cancers among rural residents in the liaoning province of china where drinking water was heavily contaminated with cr(vi) released by the ore smelting facility. one recent reanalysis of this study confirmed the originally reported association between cr(vi) contamination and cancer mortality,(89) while another study using a smaller control population did not.(90) a meta - analysis of studies among chromate workers did not find a link between inhalation exposures to cr(vi) and cancers outside the respiratory system.(91) neither the ecological report from china nor the meta - study of occupational exposures is strong in addressing the issue of cr(vi) carcinogenicity in the digestive system. inherent to all ecological studies is their inability to control for confounders and other risk factors, which is important for the analysis of stomach tumors in china with its well - known high incidence of this cancer. for human inhalation exposures, cr(vi) ingestion was only assumed, and even if it occurred, ingested doses of cr(vi) would be dramatically lower than doses in the respiratory tissues. therefore, susceptible individuals would be expected to develop lethal lung cancers before the appearance of the late age - arising tumors in the gi system. tobacco smoking is a risk factor for cancers in many tissues, and very high percentages of smokers in the industrial cohorts would further diminish the ability to detect any moderate carcinogenic effects of airborne cr(vi) in the alimentary tract. the national toxicology program (ntp) has recently completed 2-year rodent studies of cr(vi) carcinogenicity via drinking water exposure.(92) both male and female f344/n rats showed significantly increased incidence of tumors in the oral cavity at the highest concentration of cr(vi) (180 mg / l). b6c3f1 mice of both sexes developed tumors in the small intestine (duodenum and jejunum), with statistically significant increases at the two highest doses of cr(vi). plots of mouse tumor rates versus daily ingested doses of cr(vi) showed a linear shape of dose dependence for males and supralinearity for females (figure 4a). the duodenum of all exposed mice had elevated incidences of diffuse epithelial hyperplasia, which was graded from minimal to mild. no overt toxicity (necrosis) was found in the small intestine of any cr(vi)-exposed groups of mice or rats. (a) tumor rates in the small intestine of mice as a function of ingested daily dose of cr(vi). data are from the ntp bioassay.(92) (b) expected shape of tumor dose - dependence for a carcinogenic mechanism based on cytotoxicity - induced regenerative proliferation. cr(vi) ingestion in the ntp study(92) has also led to some pro - inflammatory responses detected by the presence of the infiltrating histiocytes. significant increases in histiocytic cell infiltrations were found in the upper portion of the small intestine (duodenum) and mesenteric lymph nodes in both sexes of mice and rats and in the liver of male and female rats and female mice. the pancreatic lymph nodes of female rats and male and female mice also had elevated amounts of histiocytic infiltrates. it has been recently hypothesized that inflammation and the resulting oxidative dna damage could be important factors in the carcinogenic effects of ingested cr(vi). however, the presence of histiocytic infiltrations at several sites in rats was not associated with cr(vi) carcinogenesis in this species. in mice, the overlap between the appearance of histiocytic cells and tumorigenesis was found only in the small intestine but not in the liver or lymph nodes. the biological significance of histiocytic infiltrations and their ability to cause oxidative dna damage in the host tissue cells are currently unknown. a recent study utilizing 5 and 20 mg / l cr(vi), concentrations that were below carcinogenic doses in the ntp rodent assay, did not find any increases in two forms of dna damage in the duodenum of female skh-1 mice after 9-month long exposure through drinking water.(95) these results were viewed as supportive of the threshold mechanism, questioning the human relevance of the observed carcinogenic effects in the mouse small intestine. however, the employed biomarkers were insensitive for the detection of dna damage in the mouse duodenum. after a massive ex vivo exposure to 1.6 mm cr(vi) (83.2 mg / l), only 2.5- and 3.8-fold increases were measured for protein dna cross - links and 8-oxo - dg, respectfully. such a low responsiveness was clearly insufficient to detect dna damage for exposures with 4.2- and 16.6-times lower cr(vi) levels in the 20 mg / l and 5 mg / l test groups, even in the implausible situation of no reduction and no dilution of cr(vi) in the stomach. the use of 8-oxo - dg as a biomarker of dna damage has one severe limitation : its short lifetime. repair of 50% 8-oxo - dg occurs within 30 min and is complete by 2 h.(96) this short lifetime would make it very difficult to detect 8-oxo - dg even after recently ingested water with a sufficiently high dose producing strong responses ex vivo. the presence of diffuse epithelial hyperplasia in the duodenum of mice could raise the question of whether tumorigenesis in this tissue was a high - dose effect resulting from cr(vi) cytotoxicity and subsequent compensatory proliferation. although the ntp study has not found evidence of necrosis in the small intestine of cr(vi)-exposed mice,(92) it is possible that the diffuse hyperplasia was a result of regenerative responses. this carcinogenic process should exhibit a steep sublinear, threshold - type dose dependence (figure 4b), as it relies on the induction of cell death, and small nontoxic doses would be unable to initiate tumorigenesis. the presence of cr(vi)-induced hyperplasia could also be viewed as a manifestation of cancer - protective responses by the small intestine. elimination of genetically damaged cells by apoptosis or another form of cell death is a firmly established protective mechanism against cancer. thus, there are two opposing interpretations for the carcinogenic significance of the diffuse epithelial hyperplasia : one is pro - tumorigenic ; the other is antitumorigenic. the supralinear shapes of dose tumor responses in the ntp studies for female mice and combined male plus female results (figure 4a) are more consistent with the activation of cancer - protective mechanisms. thus, experimental results do not support the engagement of cytotoxicity - based carcinogenic mechanisms with their expected dose the presence of cr(vi) in drinking water has been found to increase the frequency of skin tumors in uv - irradiated hairless mice. ingestion of cr(vi) alone produced no skin tumors, indicating that synergistic effects resulted from the enhancement of uv - initiated tumorigenesis. cocarcinogenic activity of cr(vi) did not involve oxidative mechanisms, as supplementation with antioxidants vitamin e or selenomethionine showed no effect on its potentiating ability.(98) these two antioxidants effectively suppressed the ability of as(iii) to enhance uv skin carcinogenesis in hairless mice.(99) a possible target for synergism between cr(vi) and uv could be the repair of dna photolesions by ner. since abundant cr - dna adducts are good ner substrates,(59) they would compete with uv - dna damage for ner proteins and consequently increase the persistence of premutagenic pyrimidine dimers in uv - irradiated keratinocytes. the biological plausibility of cr uv cocarcinogenesis through the competition for ner factors is supported by the comutagenicity of cr(vi) and uv.(100) a single ecological study linking the presence of high cr(vi) concentrations in drinking water to elevated mortality from stomach cancers did not include a dose - dependence analysis,(88) making it unsuitable for risk assessment. therefore, calculations of cancer risks from cr(vi) ingestion must rely on the extrapolation of results from high - dose animal studies to low - dose human exposures. this situation is very common, as potential environmental exposures to carcinogens are always much lower than doses in positive epidemiological or animal studies. the use of high carcinogen doses in the ntp bioassay results from the need to obtain statistically robust tumor responses. as an illustration of this problem, the standard size of 50 animals / group was insufficient to reach statistical significance for a 4-fold increase in the tumor rate for female mice receiving 1.2 mg / kg daily cr(vi) dose.(92) a linear extrapolation of cancer risk to low environmental doses is a default regulatory approach for carcinogens with a mutagenic mode of action via dna - reactive mechanisms.(101) a second critical consideration for linear extrapolations is whether environmental levels are sufficient to deliver a parental carcinogen or its reactive metabolite to a target organ. in the case of cr(vi), the question of environmental relevance of the high - dose animal results is centered on the completeness of cr(vi) reductive inactivation in the human stomach prior to reaching the small intestine. the next two sections will review evidence for cr(vi) mutagenicity / genotoxicity and incompleteness of gastric reduction at low doses. cr(vi) compounds have been examined for mutagenicity in a large number of genotoxicity assays, from bacteria to laboratory rodents and human cells. consistently positive results have been found in all standard mutagenicity tests,(102) including a reverse mutation assay in salmonella, hprt mutagenesis in hamster v79 and cho cells,(104)tk mutagenesis in human lymphoma cells,(105) and in vivo assays in transgenic animals. cr(vi) is also known to induce clastogenic micronuclei in primary human cells,(27) chromosomal aberrations in various cell lines, and micronuclei in vivo.(102) mutagenic responses in standard cultures of v79 and cho cells were relatively moderate.(104) however, the mutagenicity of cr(vi) in cho and v79 cells was dramatically increased when their asc levels were restored to physiological levels.(27) slowly dividing kidney and lung cells of laci transgenic mice(72) showed mutagenic responses to cr(vi) that were comparable or even higher than those in rapidly dividing asc - deficient rodent cells,(104) further pointing to the limitations of standard cell cultures to accurately recapitulate genotoxic effects. a high frequency of deletions in plasmids treated with cr(vi) and asc in vitro(32) and a poor recovery of deletion mutants at the hprt gene in cultured cells and laci gene in transgenic mice suggest that current in vivo models and asc - restored cells could still underestimate the true levels of cr(vi) mutagenesis. in vivo and in vitro mutagenicity tests are also incapable of detecting chromosomal translocations, which are expected to arise from a massive formation of cr(vi)-induced dsb in asc - normalized cells. importantly, chromosomal translocations are a major mechanism for the activation of oncogenes in human cancers.(107) predictive values for rodent carcinogenicity are approximately 80% for the ames test (reverse mutagenesis in salmonella)(108) and even higher for mutation assays in transgenic rodents.(109) the micronucleus assay has lower predictive potential but it is complementary to ames and in vivo mutagenesis due to its sensitivity in detecting deletion- and translocation - promoting dsb. a recent analysis of a large database of carcinogenicity and genotoxicity studies concluded that a combination of the ames test and the in vitro micronucleus assay was able to predict all genotoxic rodent carcinogens.(110) thus, the positive findings with cr(vi) in ames, rodent mutation, and clastogenic micronucleus assays discussed above strongly argue for the importance of a mutagenic (genotoxic) mechanism in cr(vi) carcinogenicity. a general property of mutagenic chemicals is their multispecies, trans - sex, and multisite carcinogenesis.(101) cr(vi) clearly fits this description of a mutagenic carcinogen as it is known to induce tumors in humans (unquestionably in the respiratory system), laboratory rodents, both sexes of mice and rats, and at different locations (the muscular system and different sites in the alimentary canal and respiratory tract). mutagenic responses can arise from direct chemical - dna damage (dna - reactive mechanism) or high dose - induced nucleotide misbalances, reactive oxygen species, and other metabolic alterations (indirect mutagenicity). linear low - dose extrapolations in cancer risk assessment are only appropriate for dna - reactive carcinogens.(101) positive results in the ames test are considered as evidence of direct mutagenicity, and they alone would represent a very difficult barrier to overcome during a regulatory process for drug approval.(111) the ames test was consistently positive for cr(vi) but negative for noncarcinogenic cr(iii) compounds. as discussed in section 3.2 and summarized in earlier reviews, cr(vi) causes extensive formation of cr - dna adducts in both in vivo and in a variety of human and rodent cells in culture. ternary cr - dna adducts were the principal mutagenic lesions generated during cr(vi) metabolism by its three main reducers. generation of dsb and chromosomal breaks by cr(vi) was also dependent on ternary cr - dna adducts that are mistakenly recognized by mmr proteins as dna mismatches and are then processed into dna breaks. importantly, cr - dna adducts and mmr - dependent dsb were detected at environmentally relevant doses both at and below the current federal standard for cr in drinking water.(27) collectively, these results demonstrate that dna - reactive processes involving the formation of cr - dna adducts are major causes of cr(vi) mutagenesis and clastogenesis. as argued earlier,(16) dna binding by cr(iii) complexes predicts a linear dose - dependence between cellular cr(vi) and mutagenic cr - dna adducts. any oxidative or other forms of cr - dna damage arising from reactions of cr(iv) should also display linear yields, as this intermediate is formed in all metabolic reactions of cr(vi) (figure 3). cancer is a genetic disease caused by a combination of mutations activating oncogenes and inactivating tumor suppressor genes. recent whole genome sequencing studies have found that human tumors contain between several dozens and several hundreds of cancer - promoting mutations. cancer can also be described as an epigenetic disease since some tumor suppressor genes are silenced epigenetically, and cancer cells display globally different gene expression profiles that require corresponding chromatin remodeling at numerous promoters. mutations in only two cancer genes, the p53 tumor suppressor and the kras oncogene, were sufficient to alter the expression of several hundred genes.(117) mutations and other genomic rearrangements of histone - modifying proteins can convert them into oncogenes with ensuing abnormal chromatin remodeling. tet1 has recently been found to participate in cpg demethylation,(121) and this gene forms a leukemia - inducing fusion product with the mll oncogene.(122) the opposite process of epigenetic changes causing mutations can also take place. for example, biallelic silencing of the mmr gene mlh1 via promoter hypermethylation dramatically increases mutation rates and eventually leads to colon cancer.(123) approximately 80% of lung cancers among chromate workers exhibited microsatellite instability (a hallmark of inactive mmr), which was associated with the loss of expression of key mmr proteins. this mmr - null phenotype was suggested to result from the selection of resistant cells during chronic exposures to cytotoxic doses of cr(vi), as mmr - deficient cells are resistant to killing by cr(vi).(77) epigenetic repression of several genes (mlh1, p16, apc, and mgmt) in human chromate - associated cancers may reflect the presence of mutations in proteins regulating epigenetic stability or a direct ability of cr(vi) to induce stable transcriptional silencing. induction of epigenetic effects by cr(vi) has been demonstrated but only in asc - deficient cells. sun.(129) have found that asc supplementation blocked the induction of epigenetic changes by chromate in human a549 cells. the importance of asc in epigenetic regulation stems from its role as a cofactor for dioxygenases, a group of enzymes that include histone demethylases and the 5mc demethylating protein tet1. depletion of cellular asc during cr(vi) metabolism is expected to impede the removal of repressive dna (methylated cpg) and histone h3 (lys-9 di- and trimethylation) marks with the ensuing negative consequences for gene expression. although dna damage and epigenetic responses are commonly viewed as separate events, dna repair can induce large - scale chromatin remodeling, particularly in the case of dsb processed by homologous recombination.(130) dsb have also been shown to generate a rapid transcriptional repression in the adjacent regions,(131) and it is possible that this repressive chromatin state can sometimes be retained even after the completion of dsb repair. cr(vi) is a potent inducer of dsb even at low doses, which could lead to the formation of transcriptionally repressed sites. the carcinogenic risk of ingested cr(vi) at environmentally relevant doses has been questioned(94) on the basis of the reported high cr(vi)-reducing capacity of gastric juice. high detoxification potential of human stomach and other tissues is also a key element of the threshold model of cr(vi) carcinogenesis.(134) this model would argue that despite a mutagenic mode of action, the complete detoxification of moderate cr(vi) doses in the stomach makes it inappropriate to perform linear extrapolations of cancer risks from animal tumor responses detected at high doses that could have exceeded the capacity for gastric reduction. the ability of gastric juices to reduce / detoxify cr(vi) is generally accepted in the field ; however, studies with human volunteers and kinetic considerations of reduction and stomach emptying time do not support the completeness of the detoxification process. three factors influence the extent of cr(vi) reduction in the stomach : its reduction capacity, reduction rate, and stomach emptying time. on the basis of the reported high reduction capacity of the stomach (> 80 mg / day),(133) the rate of reduction by gastric juice under fasting conditions could exhibit pseudo first - order kinetics in a broad range of low to moderate cr(vi) concentrations. a fundamental property of first - order reactions is independence of the reaction half - time on concentration. this means that the extent of gastric reduction should be the same for both very small and very large amounts of cr(vi). in agreement with first - order kinetics, the initial rates of reduction by human gastric juice were found to be independent of cr(vi) concentrations. reduction of 0.1 mg / l cr(vi) (current epa standard for total chromium) by artificial gastric juice was the first - order reaction.(135) a similar bioavailability of cr(vi) for small and large doses further supports the first - order reaction kinetics of gastric reduction. for example, human subjects excreted 2.1% of the ingested 20 ng of cr(vi) in the 24-h urine(18) and 1.43% of the ingested 5 mg of cr(vi). the latter value is my very conservative estimate calculated as 1/4th of the average 4-day excretion of 5.7% reported in the original study.(136) thus, the bioavailability of 20 ng and 5 mg of cr(vi) (250,000-fold range) appears to be comparable. the approximately 10-fold higher bioavailability of ingested cr(vi) compared to that of cr(vi) reduced with orange juice prior to ingestion(137) suggests that the bulk of absorbed cr from cr(vi) was likely a cell - permeable chromate. a classic study by donaldson and barreras(18) also performed a very important experiment on the bioavailability of 20 ng of cr(vi) that was directly delivered into the duodenum of human subjects. in this case, 10.6% of cr was excreted in the urine versus 2.1% for ingestion. since the duodenal delivery used 100% cr(vi), then the amount of cr(vi) reaching the small intestine in their oral route experiment can be derived from the urinary excretion of 2.1% divided by 0.106 = 19.8%. for the study with the ingestion of 5 mg of cr(vi) by human volunteers,(136) the same type of calculations using the estimated 1.43% urinary excretion predict 13.5% nonreduced cr(vi) reaching the duodenum. a second approach for the estimation of the percentage of cr(vi) escaping stomach detoxification can be based on the considerations of the competing processes of stomach emptying and gastric reduction. incubation with human gastric juice for 30 min at room temperature left 29.6% nonreduced cr(vi) based on the diminished uptake by everted intestinal rings and 29.2% from a chromatographic profile (as determined by image j).(18) the mean value of two measurements gives a rate with t1/2 = 17 min, which should be twice as fast at physiological temperature (t1/2 = 8.5 min) due to a typical increase in the reactions rates by a factor of 2 for each 10 c increase. a review by paustenbach.(138) reported t1/2 = 7 min for the cr(vi) reduction rate by human gastric juice at physiological temperature. a combination of t1/2 = 15.2 min for human stomach emptying (mean value from three studies with water) and a more protective rate of t1/2 = 7 min predicts that 22.2% cr(vi) will reach the duodenum. overall, both bioavailability and gastric reduction rate - based estimations suggest that 1020% cr(vi) ingested with water escapes gastric inactivation and reaches the small intestine, which is a site for its systemic absorption and a target of carcinogenic effects in mice. these estimates do not apply to the consumption of water with food, which is expected to promote cr(vi) reduction through increased stomach residency time and delivery of additional reducers. vitamin c - rich products are particularly beneficial for the enhancement of gastric detoxification of cr(vi). the presence of cr(vi) in drinking water results from both anthropogenic and natural sources. limited epidemiological studies are insufficient to establish carcinogenic risks of cr(vi) ingestion in humans. consumption of cr(vi) through drinking water produced clear carcinogenic effects in both sexes of mice and rats, and cr(vi) has a firmly established potential to cause human respiratory cancers. since cr(vi) is taken up via ubiquitously expressed transporters and metabolized by ubiquitously present cellular reducers, cells of the human digestive system are also expected to form cancer - promoting cr - dna damage. multispecies and multisite carcinogenicity of cr(vi) along with its broad genotoxicity provide a strong basis for a classification of cr(vi) exposures through drinking water as likely to be carcinogenic to humans. diverse lines of evidence demonstrate the importance of a dna - reactive mutagenic mechanism in cr(vi) carcinogenicity, lending mechanistic support for a linear low - dose extrapolation of cancer risks in humans. the bioavailability results and kinetic considerations indicate incomplete gastric detoxification of cr(vi) at environmental levels of exposure, predicting its uptake and genotoxic metabolism in the small intestine (figure 5). dose - independence of gastric detoxification is predicted to be applicable for a broad range of environmental cr(vi) concentrations. a linear yield of cr - dna adducts and chromosomal breaks at environmental cr(vi) doses has been demonstrated experimentally (section 5.2). linearity of cancer risk at low levels of dna damage is a default regulatory assumption for mutagenic carcinogens.(101) at low doses of cr(vi), cr - dna adducts are a principal cause of chromosomal breaks in asc - restored human cells and mutagenic dna damage during cr(vi) metabolism by its three main reducers. sublinearity of direct and ros - mediated dna damage by cr(v) stems from its detectable formation only under conditions of limited (depleted) asc concentrations. | drinking water supplies in many geographic areas contain chromium in the + 3 and + 6 oxidation states. public health concerns are centered on the presence of hexavalent cr that is classified as a known human carcinogen via inhalation. cr(vi) has high environmental mobility and can originate from anthropogenic and natural sources. acidic environments with high organic content promote the reduction of cr(vi) to nontoxic cr(iii). the opposite process of cr(vi) formation from cr(iii) also occurs, particularly in the presence of common minerals containing mn(iv) oxides. limited epidemiological evidence for cr(vi) ingestion is suggestive of elevated risks for stomach cancers. exposure of animals to cr(vi) in drinking water induced tumors in the alimentary tract, with linear and supralinear responses in the mouse small intestine. chromate, the predominant form of cr(vi) at neutral ph, is taken up by all cells through sulfate channels and is activated nonenzymatically by ubiquitously present ascorbate and small thiols. the most abundant form of dna damage induced by cr(vi) is cr - dna adducts, which cause mutations and chromosomal breaks. emerging evidence points to two - way interactions between dna damage and epigenetic changes that collectively determine the spectrum of genomic rearrangements and profiles of gene expression in tumors. extensive formation of dna adducts, clear positivity in genotoxicity assays with high predictive values for carcinogenicity, the shape of tumor dose responses in mice, and a biological signature of mutagenic carcinogens (multispecies, multisite, and trans - sex tumorigenic potency) strongly support the importance of the dna - reactive mutagenic mechanisms in carcinogenic effects of cr(vi). bioavailability results and kinetic considerations suggest that 1020% of ingested low - dose cr(vi) escapes human gastric inactivation. the directly mutagenic mode of action and the incompleteness of gastric detoxification argue against a threshold in low - dose extrapolation of cancer risk for ingested cr(vi). |
efferocytosis is a carefully orchestrated process by which phagocytes are recruited to sites of cell death, recognize and engulf dying cells, and clear them in an immunologically silent ' manner.dying cells have an active role in their own clearance ; via the production of find - me ' signals to attract phagocytes and exposure of eat - me ' signals that engage phagocytic receptors to facilitate engulfment.defects in the efferocytosis machinery are associated with inflammation and autoimmune disorders, such as systemic lupus erythematosus (sle).microtubule - associated protein 1a/1b - light chain 3 (lc3)-associated phagocytosis (lap) is required for the effective clearance of dying cells. efferocytosis is a carefully orchestrated process by which phagocytes are recruited to sites of cell death, recognize and engulf dying cells, and clear them in an immunologically silent ' manner. dying cells have an active role in their own clearance ; via the production of find - me ' signals to attract phagocytes and exposure of eat - me ' signals that engage phagocytic receptors to facilitate engulfment. defects in the efferocytosis machinery are associated with inflammation and autoimmune disorders, such as systemic lupus erythematosus (sle). microtubule - associated protein 1a/1b - light chain 3 (lc3)-associated phagocytosis (lap) is required for the effective clearance of dying cells. given the variety of find - me ' and eat - me ' signals, as well as their cognate receptors, how do these signals coordinate for effective efferocytosis?how does lap promote the anti - inflammatory response to dying cells, and what role does macrophage metabolism have?do defects in lap contribute to inflammatory or autoimmune pathogenesis?what role does lap have in oncogenesis ? what role does lap have in tumor - associated macrophages ? given the variety of find - me ' and eat - me ' signals, as well as their cognate receptors, how do these signals coordinate for effective efferocytosis ? how does lap promote the anti - inflammatory response to dying cells, and what role does macrophage metabolism have ? even from our earliest developmental stages, the process of generating and maintaining a multicellular, functional organism is characterized by the creation and unceremonious destruction of billions of cells. programmed cell death, such as apoptosis, necroptosis, or pyroptosis, are active mechanisms designed to sculpt, control, and aid the body in its development and survival. much of our knowledge on the role of apoptosis in development comes from the study of caenorhabditis elegans, wherein the first wave of cell death occurs ~4 h after fertilization, and of the 1090 cells that are generated, 131 of them are destined for death. in mammalian embryos, it is now well understood that proper apoptosis is fundamental for the proper development of the organism, as deficiencies in mediators of apoptosis result in embryonic lethality or animals with severe malformations. conversely, other forms of cell death, such as necroptosis and pyroptosis, are not required during development, as evidenced by the normal development of mice deficient for receptor interacting protein kinase3 or caspase-1/11, respectively. once formed, the organism 's relationship with cell death is far from over. cellular turnover is a constant, genetically programmed process in the adult animal, and removal of these unwanted and unneeded cellular corpses is vital to prevent unwanted inflammation and immune activation. although damage can certainly cause unwanted cellular death, most cellular death is an active process, and perturbations in the cell death programs can promote cell accumulation, autoimmunity, oncogenesis, attrition, and/or degeneration. within tissues, professional, non - professional, and specialized phagocytes the best - characterized population of professional phagocytes, macrophages, is composed of tissue - specific, differentiated subsets of resident macrophages that clear dying cells and debris. for example, kupffer cells in the liver clear aged red blood cells ; aveolar macrophages of the lung clear apoptotic airway epithelial cells, and microglia in the central nervous system clear dying neurons. other types of resident cells, such as epithelial cells and fibroblasts, have been termed non - professional phagocytes ; though this designation may be a misnomer as these cells have a major role when professional phagocytes are rare, such as in the mammary gland or intestinal epithelium. in addition, airway epithelial cells are critical for the clearance of apoptotic airway epithelial cells, and epithelial cell - specific deletion of rac1 results in increased allergen - induced airway inflammation. still other types of tissue - specific, multifunctional cells exist as specialized phagocytes. in the testes, sertoli cells are responsible for clearing apoptotic germ cells that arise during spermatogenesis. in the eye, retinal pigment epithelial (rpe) cells are critical for the homeostatic, daily removal of the photoreceptor outer segments (poss), and the generation of 11-cis - retinal for the visual cycle. defects in rpe cell - mediated removal of outer segments (or processing of outer segments via lap, discuss below) can lead to a predisposition to conditions, such as age - related macular degeneration or retinitis pigmentosa. like the death process itself, the innate immune system has tolerance systems in place to manage these morbid, yet necessary events. although the generation and subsequent destruction of these cells is necessary for normal cellular homeostasis, wound healing, and immune responses in the adult organism, the ruin left in its wake would be catastrophic if not for the efficient work of the phagocytic system. despite the constant, homeostatic turnover of cells, as well as cell death induced by stress, damage, or infection, it is rare to observe apoptotic cells under normal physiological conditions. considering the average one million adult human cells that undergo apoptosis every second, one can appreciate the magnitude of the job facing phagocytes moreover, as this is a reoccurring and normal event in the lifespan of an organism, this process of dead cell clearance must occur in a quiescent manner, so as to not inappropriately alert the immune system. we now appreciate the critical role that efferocytosis has on modulating immunity, as well as the impact that different types of cell death have on the immune response. in this review, we discuss the process of efferocytosis, chemoattraction of phagocytes, recognition of dying cells, engulfment of cellular corpses, and the processing of engulfed cellular cargo, specifically the role of lap in clearance of dying cells and control of inflammation. as the focus of this review is the aftermath of cell death, we have summarized the four most well - defined modes of cell death (apoptosis, necrosis, necroptosis, and pyroptosis) in table 1, as the roles and mechanisms of cell death have been studied and reviewed extensively. efferocytosis is not merely a passive event, but a carefully orchestrated process designed to efficiently eliminate cellular corpses and limit exposure to their potentially damaging components, with the goal being immunological tolerance. efferocytosis can be generally categorized into 4 steps : 1) the release of find - me ' signals by dying cells to recruit phagocytes, 2) phagocyte recognition and engagement of eat - me ' signals on dying cells, 3) the engulfment of the cellular corpse, and 4) the processing, degradation, and immune response to the engulfed corpse. we now recognize that defects in any of these four steps can contribute to unwanted inflammation and autoimmune disorders, such as systemic lupus erythematosus (table 2). as phagocytes are often not proximal to sites of cell death or even reside in the tissues they must survey, dying cells must recruitment of phagocytes to sites of cell death in c. elegans occurs before the completion of apoptosis, indicating that one of the first acts of a dying cell is to prepare for its own elimination. during this process, apoptotic cells release find - me ' signals, distinct molecules that establish a chemotactic gradient to attract phagocytic cells. nucleotides, such as atp, are released in a caspase - dependent manner via activation of pannexin-1 channels and are perhaps the most well - defined find - me ' signals. these nucleotides are detected by phagocytes via purinergic receptors, like p2y2, and disruption of the nucleotide / p2y2 interaction results in an accumulation of dying cells in vivo. apoptotic cells also release the membrane - associated molecule fractalkine (or cx3cl1), which is sensed by cx3cr1 and mediates the migration of macrophages to the dying cells. mice deficient for cx3cr1, however, do not display a defect in apoptotic cell clearance, suggesting that multiple factors are required to recruit effectively phagocytes. lysophosphatidylcholine is generated and released via caspase-3-dependent activation of phospholipase a, and is sensed by the g - protein - coupled receptor g2a. sphingosine-1-phosphate (s1p), also a lipid find - me ' signal, is released by dying cells and sensed by multiple g - protein - coupled receptors s1p - r1 - 5. there are significant caveats to the ability of find - me ' signals to efficiently act as chemoattractants in physiologically scenarios. the idea of an apoptotic cell 's purposeful release of a find - me ' signal to actively recruit phagocytes is undermined by the relatively low level of signal released by apoptotic cells compared with necrotic cells. find - me ' signals are often released in an active, caspase - dependent manner, yet these molecules are also released (and in greater quantities) during other forms of cell death, such as necrosis or necroptosis. in addition, these released nucleotides must also survive degradation by extracellular nucleotidases, indicating that they most likely act in a short - range capacity. similarly, find - me ' signals of lipid origin are present ubiquitously in the circulation at a concentration higher than that released by apoptotic cells. find - me ' signals, which can be recognized by a wide variety of cells, specifically recruit phagocytes, the majority of which are macrophages, are unknown. the counteractive effect of keep out ' signals has been proposed to aid in the coordinated recruitment of phagocytes. for example, lactoferrin, a glycoprotein released by apoptotic cells, has been shown to actively exclude neutrophils and eosinophils from sites of cell death. further complicating the matter is the dual role that find - me ' signals can have, as danger - associated molecular patterns (damps) or as activating factors to prime phagocytes. cell death does not occur in a vacuum ; sites of cell death are a conglomeration of dying cells, healthy cells, and immune cells. the phagocyte must distinguish living cells from dying cells in order to maintain homeostasis, promote proper development, and prevent unwanted inflammation. just as dying cells must recruit phagocytes, they must also transform themselves into targets for engulfment, displaying distinct signals that differentiate them from viable cells. the extracellularly exposed lipid, phosphatidylserine (ptdser), is the most well - characterized eat - me ' signal and an essential factor in effective efferocytosis. normally confined to the inner leaflet of the plasma membrane lipid bilayer of living cells (and in a relatively minor amount), ptdser is actively and rapidly externalized in a caspase - dependent manner during apoptosis. caspase 3-mediated cleavage of the scramblase xkr8 facilitates exposure of ptdser during apoptosis, an event normally reversed by the activity of the flippase atp11c, which is inactivated by caspase-3 cleavage. extracellularly exposed ptdser is recognized by multiple, bona fide membrane receptors, such as t - cell immunoglobulin mucin receptor 4 (tim4), brain - specific angiogenesis inhibitor 1 (bai1), and stabilin-2, and bridging molecules, such as milk fat globule - egf factor 8 (mfg - e8) and gas6, that recognize ptdser and then engage phagocytic cell surface receptors such as integrin v3, v5, or tryo3-axl - mer (tam) receptors for engulfment. eat - me ' signals have also been identified, which are likely to have a tethering ' function, facilitating the above events. icam3 can bind to membrane - associated cd14, and externalized calreticulin bound to complement c1q can engage cd91 (or lrp1). oxidized ldl - like moieties and glycosylated surface proteins can serve as eat - me ' signals, binding to scavenger receptors and lectins, respectively (figure 1b). similar to the find - me'/'keep out ' signal paradigm, there is evidence of a negative signal to discourage phagocytosis. although ptdser is considered a hallmark of cell death, forced ptdser exposure or physiologically normal exposure on activated, living cells does not mediate recognition or engulfment. thus, the simultaneous presence of do n't eat - me ' signals, such as cd31, cd47, and cd61, on viable cells, may negatively regulate phagocytosis, indicating to the phagocyte that despite the extracellular ptdser, this cell is not intended for clearance. therefore, a coordinated effort between the dying cell and the phagocyte must exist to facilitate efferocytosis. although the majority of work on find - me ' and eat - me ' signals stems from apoptotic cells, these signals also function during other types of cell death, such as necroptosis and pyroptosis. as previously mentioned, find - me ' signals, such as atp, are released (and in greater quantities) during necrosis, necroptosis, and pyropotosis. similarly, necrotic and pyroptotic cells also stain positive for annexin v, although in these cases, externalized ptdser can be attributed to rupture of the plasma membrane rather than an active exposure process. these dead cells can still be recognized and engaged by ptdser receptors ; however, owing to the lytic nature of their demise, damps have already been released into the milieu and can activate inflammatory programs. therefore, although apoptotic cells actively coordinate their own clearance, necrotic and pyroptotic cells passively utilize these systems as well. the tissue specificity of ptdser receptors may help to explain why multiple receptors are required for efficient efferocytosis. stabilin-2 is highly expressed in endothelial cells within atherosclerotic plaques, although defects in bai1, highly expressed in glial and neuronal cells, are associated with neurodegenerative disorders. despite a common ligand and a common goal of engulfment, once engaged by ptdser - bound integrins, bridging molecules, such as v3 or tam, associates with the adapter proteins elmo1 and dock180 (via crkii) at the site of phagoytosis. the ptdser receptor bai1 also requires the activity of the dock180/elmo1 complex for engulfment, but bai1 is able to recruit the complex independently. stabilin-2 and cd91/lrp, however, require the activity of the adapter protein, gulp, to facilitate phagocytosis. one of the most well - known ptdser receptors, tim4, contains a very short cytoplasmic region and currently its signaling components are unknown. dying cell engulfment involves active membrane ruffling by a process similar to macropinocytosis. engagement of ptdser receptors results in cytoskeletal reorganization to facilitate phagocytosis, which is mediated by the rho family of small gtpases, including members rhoa, rock, rac, rab5, and cdc42. these gtpases cycle between the resting, inactive gdp - bound state and the active gtp - bound state, mediated by specific guanine - nucleotide - exchange factors (gefs), such as the bipartite gef formed by dock180 and elmo1. ultimately, signaling during efferocytosis converges on the activation of evolutionarily conserved rac1, acting at the phagocytic cup to promote actin polymerization and cytoskeletal rearrangement via the scar / wave complex. similarly, cdc42 has been linked to the engulfment of apoptotic cells, although its precise role is unclear. once encased within the phagocyte, however, the dying cell is now capable of exerting its effect on critical downstream immunological and metabolic pathways. the mechanisms by which phagocytes handle the burden of processing an engulfed cellular corpse are currently of great interest. not only must a phagocyte interpret its ingested cargo in an immunologically tolerant manner, it must also contend with the excess lipid, cholesterol, and protein that an entire engulfed cell brings. acidic proteases and nucleases in mature phagolysosomal compartments degrade dying cells into their basic cellular components, including fats, sterols, peptides, and nucleotides. for example, dnase ii, a lysosomal enzyme, is required for the degradation of dna, and dnase ii deficiency results in an accumulation of undigested dna fragments within phagocytic cells, capable of activating intracellular nucleic acid sensors. the two ancient systems of phagocytosis and autophagy represent two modes of nutrient acquisition, during abundance and scarcity, respectively. these two evolutionarily conserved pathways converge, however, during the engulfment of pathogens or dead cells. lap is a process that marries the processes of phagocytosis and autophagy into a fundamentally new concept, allowing us to reinterpret the impact of the autophagy machinery on innate host defense mechanisms (table 3). lap is triggered when an extracellular particle, such as a pathogen, immune complex, or dead cell, is sensed by an extracellular receptor, including toll - like receptor1/2 (tlr1/2), tlr2/6, tlr4, fcr, and tim4, and phagocytosed. this engulfment recruits some, but not all, members of the autophagy machinery to the cargo - containing vesicle. it is the activity of these autophagic players that facilitates the rapid processing of the cargo via fusion with the lysosomal pathway, which can have a critical role in the degradation of engulfed cargo, as well as modulate the resulting immune response. despite sharing common molecular machinery, there currently exist several distinctions that differentiate lap from canonical autophagy (figure 2). originally, lap and autophagy were distinguished by the structure of the lc3-decorated phagosome (or laposome) and the rapidity with which lap occurs. em analysis revealed that lap results in single - membrane structures, as opposed to the double - membrane autophagosomes surrounding autophagic cargo. whereas lc3-decorated autophagosomes can take hours to form, lc3-ii can be detected on laposomes in as few as 10 min after phagocytosis, and phosphatidylinositol 3-phosphate (pi(3)p) activity can be seen at the laposome within minutes after phagocytosis. recent studies have elucidated the molecular mechanisms governing lap. although a majority of the core autophagy components are required for lap, there exist some critical differences that can distinguish the two processes. under basal conditions, mtor inhibits the pre - initiation complex, comprised of fip200, autophagy - related gene13 (atg13), and ulk1/2, and hence autophagy. furthermore, canonical autophagy requires the ulk1-dependent release of a beclin1-activating cofactor, ambra1, from the dynein motor complex, and the function of wipi2, whereas lap does not. both lap and canonical autophagy require the class iii pi3k complex, which contains the core components beclin1, vps34, and vps15. atg14 and uvrag are mutually exclusive in their association with the class iii pi3k complex during autophagy, and silencing of either atg14 or uvrag inhibits canonical autophagy. lap, on the other hand, only requires the activity of the uvrag - containing class iii pi3k complex, whereas atg14 is dispensible. rubicon (run domain protein as beclin 1 interacting and cysteine - rich containing) is a protein that associates constitutively with the uvrag - containing class iii pi3k complex. rubicon is a negative regulator of autophagy (via its inhibition of vps34 or by blocking gtpase rab7 activation), and silencing of rubicon results in an increase in the number of autophagosomes. during lap, rubicon is uniquely associated with laposomes (but not conventional phagosomes), and rubicon - deficient cells are completely defective in lap. thus, rubicon is a molecule that is uniquely required for lap, but dispensable for canonical autophagy. first, rubicon promotes the association of the active class iii pi3k complex with the laposome, thereby aiding in the localization of vps34-mediated pi(3)p at the laposome. in both canonical autophagy and lap, pi(3)p is required for the recruitment of the downstream ubiquitin - like conjugation systems, the atg5 - 12 and lc3-pe conjugation systems. in lap, rubicon stabilizes nox2, the predominant nadph oxidase in phagocytes, by interacting with its p22 subunit via its serine - rich domain (aa 567625), a domain separate from the ccd domain (aa 515550) responsible for its interaction with beclin1 and the run domain (aa 49180) responsible for its interaction with vps34. moreover, pi(3)p binds and stabilizes the p40 subunit of nox2. collectively, rubicon promotes the association of the active class iii pi3k complex with the laposome and the production of pi(3)p. rubicon and pi(3)p stabilize the active nox2 complex to promote optimal reactive oxygen species (ros) production, which is also required for successful lap. indeed, nox2-deficeint cells fail to undergo lap and scavenging of ros by antioxidants, such as resveratrol, tiron, or alpha - tocopherol is also an effective way to inhibit lap. there is mounting evidence that lap is a critical regulator of inflammation in vivo and under physiologically relevant conditions. not only is lap critical for the degradation of engulfed organisms, such as intraphagosomal yeast or aspergillus fumigatus, but lap can have a profound effect on the immune response to the engulfed material. upon intranasal challenge with a. fumigatus, a tlr2 ligand, lap - deficient animals fail to efficiently clear the pathogen and display increased levels of pro - inflammatory cytokines both locally (lung) and systemically (serum). thus, many of the autophagic defects associated with control of pathogens could actually be defects in lap. lap can also be triggered in specialized phagocytes, such as the rpe. on a daily basis and regulated by circadian rhythm, rpe cells phagocytose and digest shed poss, a process crucial for supplying nutrients and o2 to the retina and the metabolism of vitamin a for the visual cycle. what is known is the requirement for lap in the proper processing of pos and promotion of the visual cycle, a series of biochemical reactions within the rpe and retina that ultimately results in the production of the chromophore 11-cis - retinal (ral) necessary for the phototransduction signaling cascade. rpe cells deficient for lap (atg5, beclin1), but not canonical autophagy (ulk1, fip200, atg13) displayed defective pos degradation, diminished production of 11-cis - retinal, and decreased visual function with age. thus, lap functions to support chromophore regeneration through the efficient processing of pos by the rpe. lap is also required for establishing specific signaling compartment and is a critical regulator of the type i interferon response in some cases. in plasmacytoid dendritic cells, lap is induced by engagement of the fcr by immune complexes (ic), complexes of self - antigen (such as dna) and autoantibodies commonly found in patients with sle. in cells deficient for lap, failure to lipidate lc3 on the dna - ic - containing laposome results in a failure to acquire a late - endolysosomal phenotype. subsequently, these lap - deficient cells fail to form the specialized interferon regulatory factor 7 (irf7)-signaling compartment required for tlr9-mediated activation of irf7, and therefore fail to produce ifn-. this suggests that lap could affect the functional immune response elicited by autoantigens and have an important role in autoimmunity. unwanted inflammation and autoimmunity it is the responsibility of the phagocytes to first clear the dying cell from circulation and then instigate an anti - inflammatory response. phagocytes that have engulfed apoptotic cells have been shown to secrete anti - inflammatory cytokines, such as tgf and interleukin-10 (il-10), whereas actively suppressing pro - inflammatory cytokines, such as tumor necrosis factor, il-1, and il-12. lap is triggered during efferocytosis, and apoptotic, necrotic, and necroptotic cells can engage the ps receptor, tim4, resulting in a recruitment of the lap machinery to the dead - cell - containing, single - membrane laposome. lap - deficient macrophages fail to recruit lc3 to the laposome, leading to a failure in phagosomal acidification and subsequent corpse degradation. whereas the paradigm of efferocytosis is immunologically silent ', lap - deficient macrophages produce markedly increased levels of il-1 and il-6 when fed dying cells, yet produce significantly less anti - inflammatory cytokines, such as il-10, upon such engulfment. lap is engaged by a variety of receptors and is critical for directing a variety of different immune response, including preventing an unwanted inflammatory response and promoting the formation of the interferon signaling compartment. although these functions may appear contradictory, it suggests that the fundamental role of lap is to shape the appropriate response, and absence of this pathway seems to result in aberrant inflammation and pathogen control. how the lap pathway modulates the immune response to apoptotic cells remains to be elucidated, though clues may lie in the mechanisms by which the phagocyte handles the metabolic stress of doubling its content of cellular components. the sensing of one such component, cholesterol, can have a significant effect on the phagocyte 's response to engulfed dead cells and their increase in basal cholesterol efflux activity. members of the peroxisome proliferator - activated receptor / (ppar/) and liver x receptor (lxr) families, both important regulators of cellular lipid homeostasis, are activated during efferocytosis, and results in a positive feedback signal wherein the phagocytic receptors, such as members of the tam family, are upregulated. furthermore, cholesterol efflux machinery, such as 12-transmembrane protein abca1 (atp - binding cassette sub - family a, member 1), is upregulated to accommodate the increase in cholesterol load. the non - immunogenic nature of efferocytosis of apoptotic cells is one of its key characteristics, and cholesterol homeostasis has a critical role in establishing this tolerance. ppar/ are central players in the polarization of anti - inflammatory (m2 ') macrophages, and agonizts for both ppar and lxr have been shown to inhibit inflammatory responses. the dual functions of ppars and lxrs in both lipid apoptotic cell clearance and lipid homeostasis suggest the interconnectedness between efferocytosis and metabolism. despite all types of dying cells providing excess cholesterol for the engulfing cells, uptake of necrotic cells does not induce enhanced cholesterol efflux in the phagocytes, suggesting that engagement of ligands on apoptotic cells, not extra cholesterol, studies have shown that mere co - culture of macrophages with ptdser liposomes can induce the cholesterol efflux, anti - inflammatory cytokine production, and suppression of pro - inflammatory genes. these data suggest that metabolic sensors, in conjunction with engagement of eat - me ' signals, such as ptdser, contribute to the immunological tolerance associated with efferocytosis. defects at multiple points in the efferocytosis pathway have been reported to result in unchecked inflammation or autoimmunity, and understanding the mechanisms by which dying cells are effectively cleared can pave the way for therapies that target these processes. although many studies have examined inflammatory disorders in the context of defective attraction, recognition, and physical engulfment of dead cells, we now recognize that aberrant processing of dead cells, potentially via deviations in lap, can also result in inflammation. although systemic disorders, such as sle, have been long linked to defects in dying cell clearance and the autophagy machinery, more definitive roles for these pathways in localized ' inflammatory diseases, such as ulcerative colitis, atherosclerosis, neurodegeneration, and rheumatoid arthritis should be described. moreover, the intricate link between inflammation and cancer raises the question of what the role of efferocytosis is during tumor development, metastasis, and chemotherapy - mediated tumor clearance. although clearance of dying cells is a common occurrence in healthy and diseased cells, recent studies describe the process of entosis, wherein living cells are engulfed by phagocytes. although some entotic cells can escape from their engulfment unscathed, most are targeted for destruction by lap. the mechanisms by which entosis occurs, and its similarity to efferocytosis, implies that the burden that lays before the phagocytic system is a daunting one. | phagocytic cells of the immune system must constantly survey for, recognize, and efficiently clear the billions of cellular corpses that arise as a result of development, stress, infection, or normal homeostasis. this process, termed efferocytosis, is critical for the prevention of autoimmune and inflammatory disorders, and persistence of dead cells in tissue is characteristic of many human autoimmune diseases, notably systemic lupus erythematosus. the most notable characteristic of the efferocytosis of apoptotic cells is its immunologically silent ' response. although the mechanisms by which phagocytes facilitate engulfment of dead cells has been a well - studied area, the pathways that coordinate to process the ingested corpse and direct the subsequent immune response is an area of growing interest. the recently described pathway of lc3 (microtubule - associated protein 1a/1b - light chain 3)-associated phagocytosis (lap) has shed some light on this issue. lap is triggered when an extracellular particle, such as a dead cell, engages an extracellular receptor during phagocytosis, induces the translocation of autophagy machinery, and ultimately lc3 to the cargo - containing phagosome, termed the laposome. in this review, we will examine efferocytosis and the impact of lap on efferocytosis, allowing us to reimagine the impact of the autophagy machinery on innate host defense mechanisms. |
although neonatal ovarian cysts (noc) are increasingly diagnosed with routine antenatal ultrasound screening, their management is still controversial. preserving the ovary is the key aim in the management of these apparently benign lesions. we describe a technique of 2-port laparoscopic - assisted transumbilical ovarian cystectomy performed successfully in a neonate with a complex ovarian cyst. this technique aids in the panoramic assessment of the abdomen and the pelvis in addition to accomplishing ovarian cystectomy with ease. a full - term female neonate with a birth weight of 3.08 kg was prenatally diagnosed at 35 weeks gestation as having an abdominal cystic lesion. postnatally, the child was asymptomatic, and the abdominal cystic mass was not palpable. the ultrasound scan of the abdomen revealed a 2.02.63.0-cm cystic structure in the left hemipelvis, probably arising from the left ovary. the computed tomographic scan of the pelvis confirmed the same findings, and the diagnosis of possible left ovarian dermoid cyst was considered. the ultrasound examination performed 2 weeks later revealed that the size of the cyst had declined (2.21.40.9 cm) but still contained the solid nodule measuring 1.01.51.0 cm. in view of the persistent complex nature of the cyst, laparoscopic ovarian cystectomy was contemplated. at surgery, after the insertion of a 5-mm umbilical camera port by the open hasson 's technique and creation of pneumoperitoneum up to 8 mm hg pressures, a yellowish left ovarian cystic lesion measuring 2.52.0 cm was noticed. a second port of 3 mm in size was inserted into the left lumbar region. the ovary with the cystic lesion was grasped with an atraumatic grasper passed through the working port. the umbilical incision was extended vertically in the umbilical cicatrix and joined to a periumbilical smiling incision 4 mm in length on the inferior aspect of the umbilicus. the cyst contained chocolate colored fluid suggestive of a hematoma that resulted in a solid appearance on the computed tomographic (ct) scan and ultrasound examination. the ovary was reconstituted with continuous sutures of 6.0 polydiaxonone and placed back into the pelvic cavity (figure 1). ovarian cysts are the rule, not the exception in the newborn infants. at birth, 98% of female neonates have ovarian cysts on ultrasound examination, about 20% of which measure more than 9 mm in diameter. they occur either due to hormonal stimulation during the intrauterine or perinatal period, or abnormal development of the primitive gonad, probably because of disruption of its vascularization. a simple cyst is anechoic, with an imperceptible wall, no solid components, and no fluid debris level. a complex or complicated cyst contains a fluid level, retracting clot, septa, or is completely filled with echoes producing a solid mass - like appearance. ultrasound is the cornerstone in the diagnosis and delineation of the nature of the noc. ultrasonogram and computed tomographic scans serve in differentiating other abdominal cystic lesions in a neonate, such as intestinal duplication cysts, hydronephrosis, lymphangioma, cystic meconium peritonitis, omental, mesenteric, omphalomesenteric, choledochal, hepatic, urachal, renal, or ureteral cysts, anterior myelomeningocele and hydrometrocolpos. the treatment of noc is highly debated, and no universal consensus exists. a conservative approach with a wait and see policy and serial ultrasonography is advocated because noc is found to resolve with time, and the risk of malignancy is virtually nonexistent. surgical intervention is recommended in cases of complex cysts and simple cysts larger than 4 cm to 5 cm in diameter to avoid the risk of ovarian torsion and other complications, such as compression on the bowel, ureter, or inferior vena cava ; rupture and peritonitis with hemoperitoneum ; or incarceration in the canal of nuck. surgical intervention could theoretically reduce the risk of these complications along with the salvation of the ovary and also obviates long - term follow - up with serial ultrasonograms. the histopathological examination of the ovarian cyst in our neonate revealed hemorrhagic and fibrous tissue along with hemosiderophages, suggesting previous torsion and detorsion or hemorrhage into the cyst. these features may also suggest that although malignancy is virtually nonexistent in noc, smaller cysts are also at risk for torsion and ovarian loss. the management options of noc vary from antenatal transuterine aspiration to postnatal intervention in the form of repeated ultrasound - guided needle aspiration, laparotomy, or laparoscopic oophorectomy or ovarian cystectomy. recent advances in laparoscopy and neonatal anesthesia has opened new avenues for minimally invasive management of noc. neonatal laparoscopy is tenable because neonates can sustain pneumoperitoneum up to the pressures of 8 mm hg. laparoscopy aids in the delineation of the lesion, evaluation of the contralateral ovary, and sometimes management of other cystic lesions that mimic ovarian cysts. laparoscopic oophorectomy for ovarian torsion, laparoscopic 2- or 3-port ovarian cystectomy, laparoscopic - assisted aspiration, and ovarian cystectomy through a suprapubic incision have been described in the literature. minilaparotomy with an exteriorization - aspiration (catch and suck) approach has also been described. however, this technique has limitations, especially in cases of a mistaken diagnosis of abdominal cystic lesions in a neonate. in our patient, we contemplated surgical exploration because the second ultrasound examination revealed the persistence of the solid component within the cyst. to our knowledge, this is the first case report of transumbilical ovary - preserving ovarian cystectomy in a neonate, although a similar technique has been described by mahomed. this technique is also an extrapolation of the procedure utilized for transumbilical extraction of the laparoscopically resected torted ovary. the umbilicus is viewed as a window to the abdominal cavity that serves to safely execute minimal access procedures in children. necessary access into the abdominal cavity can be safely obtained through a cosmetically acceptable and concealable incision. however, umbilical vessels in a neonate may be patent, and hence umbilical port insertions should be through an open hasson 's technique. our technique of vertical umbilical incision with extension to a small infraumbilical smiling incision, allows wide exposure for ligating the patent umbilical vessels and atraumatic extracorpo - real delivery of the ovary with the cyst. the shallow neonatal pelvis and long ovarian pedicle allows transumbilical extraction of the ovary with ease. this obviates spilling of the contents, reduces operative time, in addition to achieving a safe, effective, aesthetic outcome. this procedure, which combines laparoscopy with conventional operative techniques, has the potential to be performed through a single umbilical incision with insertion of 2 coaxial ports or a single port with access for both the telescope and the grasper. the cyst could be drawn up to the umbilical incision and aspirated with a purse - string suture in situ, avoiding spillage and contamination. the decompressed ovary with the cyst wall can be delivered out of the umbilical incision, accomplishing extracorporeal cystectomy. ovary - preserving ovarian cystectomy, although contentious, is indicated for complex cysts and simple cysts larger than 4 cm to 5 cm to avert the potential complications. saving the ovary is the key, and this can be safely accomplished in neonates by laparoscopic - assisted transumbilical ovarian cystectomy. | the occurrence of ovarian cysts in a neonate is common, but the management of the same is contentious. we present a case of a prenatally diagnosed complex ovarian cyst in a neonate, which was successfully treated by a novel laparoscopic technique. the literature was reviewed and the diagnosis, treatment options, and controversies in the management are discussed, highlighting the role of preservation of the ovary via the laparoscopic - assisted transumbilical ovarian cystectomy procedure. |
periodic fever, aphthous stomatitis, pharyngitis, and cervical adenitis (pfapa) syndrome belongs to the spectrum of autoinflammatory diseases characterized by spontaneous episodes of inflammation which are not accompanied by the usual hallmarks of autoimmunity high - titer autoantibodies or autoreactive t - cells. in terms of symptomatology pfapa is considered one of the periodic fever syndromes, but in regard of etiology it is categorized, along with behet 's disease and sjia (systemic - onset juvenile idiopathic arthritis), as idiopathic disease. many possible causative factors have been explored so far including infectious agents, immunological mechanisms, and genetic predisposition. rare occurrence of pfapa in adults and slight male predominance [36 ] absence of known autoreactive antibodies or t - cells [1, 7 ], as well as shortening of intervals between febrile attacks after corticosteroid - treatment [3, 4 ], speak highly against autoimmune - mediated disease. rapid response to steroids [36 ] speaks against infection and for dysregulated inflammatory cytokine production. while the occurrence of the disease in different geographical regions, among various ethnicities, might argue for an infectious vector with worldwide prevalence, studies so far have failed to identify any microbiological agent (or agents) potentially involved in pathogenesis of pfapa [3, 11, 12 ]. due to the lack of evidence of autoimmune or infectious cause, pfapa has been considered an autoinflammatory disease, but the exact pathogenesis or genetic background remains unclear [9, 1315 ]. the purpose of this review is to provide up - to - date information considering etiology of pfapa syndrome, by summarizing what has been explored and established in this area so far. pubmed, web of science, and scopus databases were searched for pertinent reports ; the last search update was performed on june 07, 2015. the terms pfapa and etiology or pathogenesis or pathophysiology were used as the keywords. two authors (bk - g, amk) independently screened all reports by title or abstract for eligibility. the authors excluded comments, letters, reviews, and papers that did not study or report our outcomes of interest. if either of the reviewers considered the abstract potentially relevant, full - text articles were retrieved and then evaluated by both reviewers for their suitability for inclusion. the following information was extracted from each study : the first author 's name, language, country, year of publication and patient 's characteristics (including ethnicity and age), definition and numbers of cases and controls, laboratory methods, and outcomes. the results were classified into three categories regarding three areas of interest : familial occurrence, genetic basis, and immunological mechanisms of pfapa. contrary to the majority of periodic fever syndromes, which are hereditary monogenic disorders, genetic basis has not yet been established for pfapa, and for a long time it was regarded as a sporadic disease [1, 4, 8, 16 ]. familial occurrence was not mentioned in the reported series of pfapa patients [26 ]. however, within the last few years several cases of siblings [1721 ] including a case of siblings and their mother have been reported. in 2010 they interviewed 84 pfapa patients from 8 different countries and found positive family history for recurrent fever in 38 (45%) of them. in 76% (29/38) of the cases, the recurrent fever met pfapa criteria in 12% (10/84) of the reported cases. all 47 healthy children in the control group had negative family history of recurrent fever. the limitations of the study are the following : a retrospective character of the study, a relatively small control group, potential mistakes deriving from relying on the respondent 's subjective knowledge and possibly an incomplete record of the diseases present in the family members. in another large comparative study (130 pfapa patients, mostly italian) positive family history was found only in 13.8% of cases. on the other hand, the result was similar in pfapa and hereditary recurrent fever syndromes such as fmf and mkd (13.8%, 14.3%, and 9.1%, resp.). nevertheless, comparing to pfapa, additionally, in the italian study genetic testing was performed in all pfapa patients to exclude hereditary periodic fever syndromes, while in cochard 's study monogenic autoinflammatory diseases were excluded mainly by clinical presentation (genetic testing only in 20/84 patients). in a lately reported single - center longitudinal study, positive family history (recurrent fever and/or tonsillitis) was found in 78% (50/64) of pfapa patients, which is the highest rate ever reported. however, a recent analysis of a large international web - based multicentre cohort showed lower (26.9%, 81/301) prevalence of positive family history in pfapa patients. in summary, recent findings strongly suggest that there is a familial tendency to pfapa but the level of evidence does not warrant definite conclusions. nevertheless mutation of the gene was reported only in 1 patient with pfapa syndrome and the significance of this finding is still to be established. in the most recent report by di gioia exome sequencing of 11 pfapa patients did not reveal any unique mutation that would be present in all the affected individuals, indicating that pfapa is not a monogenic condition. since the clinical features of pfapa and hereditary periodic fever syndromes (pfss) are often overlapping, pfapa cohorts have been searched for the presence of mutations that are known to cause other pfss. were the first to report heterozygous variants of mefv (a gene associated with familial mediterranean fever) in patients with pfapa ; however all of those patients belonged to ethnicities with high frequency of carriers [4, 8 ]. dagan. found mefv variants (m694v, v726a, or e148q) in 28.1% (16/57) of pfapa patients from israel. there was no control group, but the result is comparable to that of the general population in israel (3040%) [26, 27 ]. in a big prospective israeli study by berkun., mefv variants (mostly m694v) were identified in as much as 55.4% (65/124) of children with pfapa. however, according to the authors, due to a selection of bias reasons, the study should not be used to assess the prevalence of heterozygous mefv mutations in pfapa patients. japanese authors (taniuchi.) reported frequency of mefv variants in pfapa patients of 65% (13/20), which is higher than that in the aforementioned israeli studies [4, 7, 25 ]. this might be due to differences in number of the included patients, their ethnicity, and selection method. in comparison to the control group (62 healthy volunteers) the incidence of two mefv variants (e148q - l110p and p369s - r408q) was significantly higher in pfapa patients. three of those variants (e148q, p369s, and r408q) along with three others (a289v, i591 t, and k695r) were also found in 8% (5/62) of children with pfapa in a recent report from slovenia. in a comprehensive genetic study by di gioia the role of e148q variant is controversial, but it might have a functional effect on inflammasomes, macromolecular il-1-activating complexes, which have recently been associated with pfapa pathophysiology [9, 1315, 28 ]. p369s and k695r are low - penetrant variants [29, 30 ] and the function of the other variants remains unknown. in both taniuchi 's and berkun 's study, shorter duration of pfapa febrile attacks was found in patients with mefv mutations, compared to those without them [7, 28 ]. berkun. also observed lower rates of regular cyclic patterns and oral aphthae among the mefv carriers (especially m694v). in a swiss study from 2013 variants of nlrp3a gene involved in caps pathogenesis were found in as much as 23% (12/57) of pfapa patients, which is a higher proportion than that in the general population [31, 32 ]. nevertheless, a statistical analysis of single nlrp3 variants (v198 m, r488k, and q703k) proved significant difference for only one mutation (r488k) of limited significance. v198 m variant, which is often associated with milder forms of caps, was recently shown not to cosegregate with pfapa. the q703k variant was recently found in 14.5% (9/62) of pfapa patients as well as in 12% (12/100) healthy subjects from slovenia (statistical significance has not been reached) and in one of the 14 families studied by di gioia.. this polymorphism has been recognized as a gain - of - function alteration leading to an overactive nlrp3 inflammasome and might play a role in pfapa pathogenesis. the hitherto published data does not support the involvement of mutations associated with traps (gene tnfrsf1a) or mvd (gene mvk) in pfapa etiology [13, 15, 20, 25, 28 ]. a mild low - penetrance, rather asymptomatic variant of tnfrsf1a (r92q) was found in 1 out of 50 israeli patients and in 1 out of 57 cases from switzerland. in a recent study by di gioia a rare mutation, that is usually associated with a mild form of traps (r121q), was found in one of the families affected with pfapa. recently published results of an exhaustive screening for mutation in genes responsible for hereditary recurrent fever syndromes indicate that their involvement in pfapa etiology is very unlikely. only a few rare variants were found, but their frequency in pfapa patients was similar to those observed in general population and some of these changes did not cosegregate with the phenotype. in summary, the absence of a clear monogenic trait indicates a heterogenous, polygenic, or complex inheritance of pfapa syndrome. currently, there is no strong evidence to support the association between genes confirmative of hereditary pef 's and pfapa etiology. tnfrsf1a or mvk mutations were sporadically reported in patients with pfapa and do not seem to be involved in the disease. most of the identified nlrp3 and mefv variants are low - penetrance mutations or benign polymorphisms and their relevance to pfapa pathogenesis is uncertain. as two mutations with a possible functional effect on the inflammasomes (mefv e148q and nlrp3 q703k) have been found in several pfapa cohorts, the role of inflammasome - related genes in pfapa pathogenesis can not be excluded. it is not improbable that mefv and/or nlrp3 variants are involved in the pathogenesis of pfapa, since they are functionally linked to inflammatory reactions taking place during pfapa flares. protein products of both of these genes regulate activation of caspase-1, which processes proil-1 and proil-18 to mature forms [9, 35 ]. il-1 and il-18 are important mediators of the inflammatory response leading to fever, elevated acute - phase proteins, and neutrophilia. it has been associated with the pathogenesis of the majority of hereditary periodic fever syndromes and recently also with pfapa syndrome, [1, 9, 14, 15, 3640 ]. showed that fever attacks in 6 pfapa patients led to significant increase in serum concentrations of il-1 and other proinflammatory cytokines (il-6, ifn, and tnf-) when compared to healthy controls (11 children). brown. also reported increases in il-6 sera concentrations during pfapa flares, whereas levels of il-1, tnf-, and ifn remain low. similar results were presented in a norwegian study comparing 22 pfapa patients and 14 children with pneumonia. as the time after the onset of fever, in which sera were drawn, was the shortest in stojanov. 's study (612 hours), it was presumed that il-1 and tnf- peak early in the fever period and then quickly approach homeostatic levels. this was not confirmed by kubota., who found increased levels of il-1 and tnf- in blood collected from 9 pfapa patients within 96 hours from fever onset. in a recent study among 33 patients from japan il-1 and tnf- were not elevated, while il-18, il-6, and ifn increased during pfapa febrile attacks. two other studies failed to find elevated levels of il-1 in pfapa patients ; nevertheless, indirect evidence of the increased il-1 production during pfapa fever attacks was discovered [9, 15 ]. reported overexpression of il-1-related and inflammasome - related genes, increased sera concentrations of il-1-induced proinflammatory cytokines (il-6 and g - csf), and, finally, prompt clinical response to il-1 receptor antagonist treatment (anakinra) in 5/5 pfapa patients. kolly. found increased levels of caspase-1 and significantly higher secretion of il-1 by stimulated peripheral blood mononuclear cells during febrile episodes compared to afebrile periods. increase in serum concentrations of il-18 was demonstrated in several studies [9, 36, 42 ]. il-18 stimulates release of ifn that was also elevated in the serum of pfapa patients [9, 36, 40, 42 ] as well as ifn inducible chemokines [9, 15, 40 ]. elevated levels of il-1, il-18, il-6, and ifn point to innate immunity dysregulation as the key pathomechanism of pfapa attacks. the concept is advocated by other immunological aberrations during pfapa flares such as monocytosis, increased count [9, 14, 15, 41, 43 ] and characteristic features of neutrophils, increased secretion of proinflammatory chemokines (ip10/cxcl10, mig / cxcl9) [9, 14, 41 ], and upregulated transcription of complement genes. increased neutrophil and monocyte counts during febrile episodes have been reported in several pfapa cohorts [9, 14, 15, 41, 43 ]. furthermore, stojanov. found significant alteration of neutrophil functions during pfapa flares : diminished rates of spontaneous apoptosis, increased generation of intracellular nadph oxidase - derived ros (reactive oxygen species), and signatures of priming such as granule mobilization and receptor upregulation of the cell surface. chemokines are induced directly by early innate response mechanisms and under the influence of ifn. they are strong chemoattractants of t - cells to the inflammation sites and may act as a link between innate and adaptive immune responses [9, 14, 41 ], which in pfapa is mainly th1-driven [9, 41 ]. th1-induced elevation of ifn and cxcl10 levels [9, 14, 15, 41 ] in the absence of the increased th2- and th17-cytokines weighs heavily in favour of th1-type inflammatory response in pfapa. the suppression of th2 type response is supported by low il-4 levels and low expression of il-4 gene in peripheral blood and in the tonsils. additionally, lack of eosinopenia has been linked to th2-driven inflammation [45, 46 ], whereas several studies reported eosinopenia in pfapa patients during febrile episodes [9, 14, 41, 43 ], which also argues in favour of th1-driven immune response in pfapa syndrome. involvement of adaptive immunity in pfapa pathogenesis is indicated by fluctuations in t lymphocytes and increase in serum ifn levels during the attack periods [9, 14, 15 ]. a decrease in the number of circulating lymphocytes during pfapa flares was found in several studies [9, 14, 15, 41 ], two of which reported a decrease in both cd4 + and cd8 + lymphocyte counts [9, 41 ]. as previously suggested, this may result from activation and recruitment of t - cells to peripheral tissues and is clinically reflected by tonsillitis and cervical adenitis [9, 41, 42, 47 ]. yamazaki. showed, that neutrophils and monocytes of pfapa patients (n = 33) during attacks strongly expressed cd64, an fc receptor, which might be upregulated by ifn, possibly from retention of activated t - cells in the periphery. a study by petra. revealed increased levels of cd8 + t - cells, the transitional b cells, and naive stages of both the cd4 + and cd8 + t - cells in the tonsils from pfapa patients (n = 10), compared to tonsils from children with obstructive sleep apnea syndrome (n = 10). the studies exploring pathophysiology of pfapa [9, 14, 15, 36, 4043, 47 ] differed in terms of characteristics and size of the pfapa cohort, presence and type of control group, examined proteins, and laboratory methods. most of them support the hypothesis of an abnormal, il-1 dependent innate immune response to an environmental trigger that leads to th1-driven inflammation, expressed by recruitment of t - cells to periphery. in summary it shares some clinical and pathogenic features with monogenic recurrent fever syndromes ; however, studies have failed to identify its genetic basis. possible involvement of mefv and nlrp mutations is in line with their functional connection to il-1 dependent innate inflammatory response, which might be involved in pfapa pathogenesis. most autoinflammatory diseases derive from genetic variants of the innate immune system, and except for traps, all monogenic periodic syndromes belong to il-1-regulated autoinflammatory diseases. however, the pathophysiology of pfapa syndrome seems to be more complex. inflammatory response in pfapa is also driven by th1-type adaptive immune response, which also dominates in several autoimmune diseases, for example, hashimoto 's thyroiditis, grave 's disease, crohn 's disease, psoriasis, type 1 diabetes, and rheumatoid arthritis. th1-driven immune response mainly develops following infections by viruses, intracellular bacteria, and parasites, while il-1 activation has been shown to be involved in bacterial, viral, and fungal infections. the role of a viral or other infectious agents in pfapa etiology is unknown, though the hitherto published studies are pointing to collaboration of environmental and immunological factors in a genetically inclined individual. despite recent advances in unravelling the molecular aspects of pfapa pathogenesis, there still seem to be more questions than answers. areas for further research include identifying genes and microbiological factors involved in pfapa etiology, as well as the consequent exploration of immunological mechanisms that could improve diagnostic and treatment regimens for pfapa patients in the future. | background. pfapa syndrome is a chronic disease that is characterized by recurrent episodes of high fever, aphthous stomatitis, pharyngitis, and cervical adenitis. knowledge regarding the etiology of pfapa is limited. objectives. to provide up - to - date information considering etiology of pfapa syndrome, by summarizing what has been explored and established in this area so far. materials and methods. pubmed, web of science, and scopus databases were searched for pertinent reports. eventually 19 articles were selected. the results were classified into categories regarding three areas of interest : familial occurrence, genetic basis, and immunological mechanisms of pfapa. results. recent findings suggest that there is a familial tendency to pfapa but the level of evidence does not warrant definite conclusions. the absence of a clear monogenic trait indicates a heterogenous, polygenic, or complex inheritance of pfapa syndrome. as two mutations with a possible functional effect on the inflammasomes (mefv e148q and nlrp3 q703k) have been found in several pfapa cohorts, the role of inflammasome - related genes in pfapa pathogenesis can not be excluded. immunological mechanisms of pfapa involve an abnormal, il-1 dependent innate immune response to an environmental trigger, which leads to th1-driven inflammation expressed by recruitment of t - cells to the periphery. |
the u937/nef - eyfp and u937/eyfp cells and their culture conditions have been described previously (17). exosomes were prepared from culture supernatants (18) and visualized by electron microscopy as described earlier (17). exosome quantification was done using bradford reagent (biorad, usa) as described elsewhere (18). for flow cytometry, purified exosomes (~35 g protein) were first incubated with 10 l of aldehyde latex beads for 15 minutes at room temperature. then pbs was added to a final volume of 1 ml and incubated on a rotator for 2 hour at room temperature, or overnight at 4c. to this 110 l of 1 m glycine (final concentration, 100 mm) the beads were then centrifuged for 3 minutes at 4,000 rpm at room temperature and washed twice with 1 ml pbs/0.5% bsa with final re - suspension in 0.5 ml pbs - bsa. for staining with antibodies, 10 l of coated beads were incubated with 50 l of the appropriate antibody diluted in pbs - bsa for 30 minutes at 4c. the beads were then washed twice as described above followed by incubation with 50 l secondary antibodies for 30 minutes at 4c. the beads were again washed twice and were acquired on a cyan - adp flow cytometer (beckman coulter). data were analysed using the flow jo software. for the labelling of exosomal membranes with pkh26, a fluorescent lipid dye (sigma) the excess dye was removed by washing exosomes with 3 ml of pbs with ultracentrifugation at 100,000g in a sw60 rotor at 4c. the labelled exosomes were also bound to aldehyde latex beads as described above and beads were observed under 60 magnification in the confocal microscope. total rna was isolated from cells or exosomes using trizol (invitrogen) as per manufacturer 's instructions. approximately 10 million cells or 50100 g exosomes were re - suspended in 500 l of trizol and vortexed thoroughly. this was left for 10 minutes at room temperature and then centrifuged at 13,000 rpm at 4c for 10 minutes. the upper aqueous phase was mixed with 2 volumes of isopropanol and incubated overnight at 20c. the pellet was washed with 70% ethanol, air - dried and dissolved in depc - treated water. rna preparations were treated with dnasei (new england biolabs, usa) according to manufacturer 's instructions before further use. this rna was used for messenger rna analysis and for the taqman mirna array profiling. the mirnas were isolated using the mirneasy kit (qiagen, germany) following the supplier 's protocol. briefly, ~23 million cells or 80100 g exosomes were harvested and lysed in ~750 l qiazol. the mixture was vortexed for a few seconds and centrifuged at 13,000 rpm for 10 minutes at 4c. an equal amount of ethanol was added to the supernatant and loaded on the columns, which were washed with the buffers provided in the kit, and eluted in ~50 l nuclease - free water. the rna amount and quality were estimated by absorbance values at 260 and 280 nm on a nanodrop spectrophotometer. total rna was isolated as above using trizol and the mirna profiling was carried out at labindia (gurgaon, india) using the applied biosystems taqman low density array human microrna array version 2.0, which covered 667 known human micrornas, and included 6 endogenous mirna controls the small rna fraction was purified from total rna pool using the mirvana mirna isolation kit (qiagen), which was converted to cdnas using megaplex rt primers and taqman microrna reverse transcription kit. a pre - amplification step was carried out using megaplex preamp primers and taqman preamp master mix. the cdna was diluted, taqman universal pcr master mix was added and the mixture was loaded on a 384-well format taqman array. data were analysed using data assist software v3.0.1 with the threshold ct value as 35. for all analyses, the levels in control samples were set as 1, and the levels in the test sample were calculated with the software. one g total rna from u937/nef - eyfp and u937/eyfp cells, or 50100 ng from exosomes was reverse transcribed with a specific stem - loop (sl) primer (supplementary file). the reaction mix was prepared as described above and incubated as follows : 70c for 5 minutes followed by 7 cycles of 16c for 5 minutes and 42c for 5 minutes. after heating at 85c for 5 minutes, the mixture was either used immediately for quantitative pcr or stored at 70c. an appropriate amount of cdna was first used to optimize the rnu6b signal in each sample. subsequently, amplifications of specific mature mirnas were carried out using the primers shown in supplementary file. for the quantification of mrnas, total rna was converted to cdna using a kit (promega, usa) according to the manufacturer 's protocol. briefly, a reaction mix was prepared using 1 g total rna, 500 ng oligo(dt)20 and depc water. the reaction mixture was incubated at 65c for 5 minutes and chilled on ice for at least 1 minute. the following components were then added in the given order : 10 l of 5x promega rt buffer, 0.25 l rnasein (recombinant rnase inhibitor ; 40 u/l), 0.5 l of mulv rt enzyme (400 u/l) and 0.5 l of dntps (10 mm). the reaction was incubated at 42c for 60 minutes, followed by heating at 70c for 15 minutes and then chilled on ice. a 20-l reaction mix was prepared using 2x evagreen dye, 12 l of cdna, and 510 pmoles each of forward and reverse primers. the amplification conditions were as follows : 94c for 10 minutes, followed by 40 cycles of 94c for 30 seconds, 6062c for 30 seconds, 72c for 30 seconds, and a final extension at 72c for 2 minutes. the ct values of replicates were analysed to calculate relative fold change by the ct method. the mirwalk database (http://www.umm.uniheidelberg.de/apps/zmf/mirwalk/) (19) was searched to identify validated target genes of the selected mirnas, followed by pathway analysis using the david bioinformatics database (http://david.abcc.ncifcrf.gov/gene2gene.jsp) (20, 21). microinspector (http://bioinfo.uni-plovdiv.bg/microinspector/) (22) and rna hybrid (http://bibiserv.techfak.uni-bielefeld.de/rnahybrid/) (23) algorithms were used to identify mirnas targeting hiv-1 strains indie - c1 (accession no. all of the 2,578 mature human mirnas available in mirbase version 20 were analysed using a free - energy cut - off of 14 kcal / mole. we also compared the list of validated targets of mirnas upregulated or downregulated in u937/nef - eyfp cells with genes that are reported in literature to be upregulated or downregulated by nef ; the latter information is part of the hiv, human protein interaction database and is available at http://www.ncbi.nlm.nih.gov/projects/refseq/hivinteractions/nef.html. cells were washed twice in cold 1x pbs (137 mm nacl, 2.7 mm kcl, 10 mm na2hpo4, 18 mm kh2po4) and lysed in 1x ripa buffer (20 mm tris - hcl (ph 7.5), 150 mm nacl, 1 mm na2edta, 1 mm egta, 1% np-40, 1% sodium deoxycholate, 2.5 mm sodium pyrophosphate, 1 mm -glycerophosphate, 1 mm na3vo4, 1 g / ml leupeptin). cell lysis was carried out for 45 minutes at 4c with gentle vortexing every 10 minutes. the protein concentration of the lysate was estimated using the bradford reagent (bio - rad, usa). for western blotting, 100 microgram of cell lysate was boiled in laemmli buffer, and the proteins were separated by sodium dodecyl sulphate - polyacrylamide gel electrophoresis (sds - page). the separated proteins were transferred to a nitrocellulose membrane (hybond ecl ; amersham biosciences) at constant voltage of 65 v for 60 minutes. the membrane was then blocked with tris - buffered saline (tbs) containing 3% blotto (bio - rad) for 1 hour at room temperature and washed with tbst (tbs containing 0.1% tween 20). the membrane was then incubated overnight at 4c with the primary antibody appropriately diluted in tbst3% blotto, washed 4 times for 10 minutes each with tbst, and incubated with horseradish peroxidase - linked secondary antibodies diluted in tbst5% blotto for 1 hour at room temperature. after the membrane was washed as described above, chemiluminescent detection of proteins was carried out using luminol reagent (santa cruz biotechnology, usa) according to the supplier 's protocol. primary antibodies anti - il6 (sc7920), anti - il1 (sc1250), anti - actin and hrp - linked secondary antibodies were from santa cruz biotechnology (usa). the u937/nef - eyfp and u937/eyfp cells and their culture conditions have been described previously (17). exosomes were prepared from culture supernatants (18) and visualized by electron microscopy as described earlier (17). exosome quantification was done using bradford reagent (biorad, usa) as described elsewhere (18). for flow cytometry, purified exosomes (~35 g protein) were first incubated with 10 l of aldehyde latex beads for 15 minutes at room temperature. then pbs was added to a final volume of 1 ml and incubated on a rotator for 2 hour at room temperature, or overnight at 4c. to this 110 l of 1 m glycine (final concentration, 100 mm) the beads were then centrifuged for 3 minutes at 4,000 rpm at room temperature and washed twice with 1 ml pbs/0.5% bsa with final re - suspension in 0.5 ml pbs - bsa. for staining with antibodies, 10 l of coated beads were incubated with 50 l of the appropriate antibody diluted in pbs - bsa for 30 minutes at 4c. the beads were then washed twice as described above followed by incubation with 50 l secondary antibodies for 30 minutes at 4c. the beads were again washed twice and were acquired on a cyan - adp flow cytometer (beckman coulter). data were analysed using the flow jo software. for the labelling of exosomal membranes with pkh26, a fluorescent lipid dye (sigma) the excess dye was removed by washing exosomes with 3 ml of pbs with ultracentrifugation at 100,000g in a sw60 rotor at 4c. the labelled exosomes were also bound to aldehyde latex beads as described above and beads were observed under 60 magnification in the confocal microscope. total rna was isolated from cells or exosomes using trizol (invitrogen) as per manufacturer 's instructions. approximately 10 million cells or 50100 g exosomes were re - suspended in 500 l of trizol and vortexed thoroughly. this was left for 10 minutes at room temperature and then centrifuged at 13,000 rpm at 4c for 10 minutes. the upper aqueous phase was mixed with 2 volumes of isopropanol and incubated overnight at 20c. the pellet was washed with 70% ethanol, air - dried and dissolved in depc - treated water. rna preparations were treated with dnasei (new england biolabs, usa) according to manufacturer 's instructions before further use. this rna was used for messenger rna analysis and for the taqman mirna array profiling. the mirnas were isolated using the mirneasy kit (qiagen, germany) following the supplier 's protocol. briefly, ~23 million cells or 80100 g exosomes were harvested and lysed in ~750 l qiazol. the mixture was vortexed for a few seconds and centrifuged at 13,000 rpm for 10 minutes at 4c. an equal amount of ethanol was added to the supernatant and loaded on the columns, which were washed with the buffers provided in the kit, and eluted in ~50 l nuclease - free water. the rna amount and quality were estimated by absorbance values at 260 and 280 nm on a nanodrop spectrophotometer. total rna was isolated as above using trizol and the mirna profiling was carried out at labindia (gurgaon, india) using the applied biosystems taqman low density array human microrna array version 2.0, which covered 667 known human micrornas, and included 6 endogenous mirna controls the small rna fraction was purified from total rna pool using the mirvana mirna isolation kit (qiagen), which was converted to cdnas using megaplex rt primers and taqman microrna reverse transcription kit. a pre - amplification step was carried out using megaplex preamp primers and taqman preamp master mix. the cdna was diluted, taqman universal pcr master mix was added and the mixture was loaded on a 384-well format taqman array. data were analysed using data assist software v3.0.1 with the threshold ct value as 35. for all analyses, the levels in control samples were set as 1, and the levels in the test sample were calculated with the software. one g total rna from u937/nef - eyfp and u937/eyfp cells, or 50100 ng from exosomes was reverse transcribed with a specific stem - loop (sl) primer (supplementary file). the reaction mix was prepared as described above and incubated as follows : 70c for 5 minutes followed by 7 cycles of 16c for 5 minutes and 42c for 5 minutes. after heating at 85c for 5 minutes, the mixture was either used immediately for quantitative pcr or stored at 70c. an appropriate amount of cdna was first used to optimize the rnu6b signal in each sample. subsequently, amplifications of specific mature mirnas were carried out using the primers shown in supplementary file. for the quantification of mrnas, total rna was converted to cdna using a kit (promega, usa) according to the manufacturer 's protocol. briefly, a reaction mix was prepared using 1 g total rna, 500 ng oligo(dt)20 and depc water. the reaction mixture was incubated at 65c for 5 minutes and chilled on ice for at least 1 minute. the following components were then added in the given order : 10 l of 5x promega rt buffer, 0.25 l rnasein (recombinant rnase inhibitor ; 40 u/l), 0.5 l of mulv rt enzyme (400 u/l) and 0.5 l of dntps (10 mm). the reaction was incubated at 42c for 60 minutes, followed by heating at 70c for 15 minutes and then chilled on ice. a 20-l reaction mix was prepared using 2x evagreen dye, 12 l of cdna, and 510 pmoles each of forward and reverse primers. the amplification conditions were as follows : 94c for 10 minutes, followed by 40 cycles of 94c for 30 seconds, 6062c for 30 seconds, 72c for 30 seconds, and a final extension at 72c for 2 minutes. the ct values of replicates were analysed to calculate relative fold change by the ct method. the mirwalk database (http://www.umm.uniheidelberg.de/apps/zmf/mirwalk/) (19) was searched to identify validated target genes of the selected mirnas, followed by pathway analysis using the david bioinformatics database (http://david.abcc.ncifcrf.gov/gene2gene.jsp) (20, 21). microinspector (http://bioinfo.uni-plovdiv.bg/microinspector/) (22) and rna hybrid (http://bibiserv.techfak.uni-bielefeld.de/rnahybrid/) (23) algorithms were used to identify mirnas targeting hiv-1 strains indie - c1 (accession no. all of the 2,578 mature human mirnas available in mirbase version 20 were analysed using a free - energy cut - off of 14 kcal / mole. we also compared the list of validated targets of mirnas upregulated or downregulated in u937/nef - eyfp cells with genes that are reported in literature to be upregulated or downregulated by nef ; the latter information is part of the hiv, human protein interaction database and is available at http://www.ncbi.nlm.nih.gov/projects/refseq/hivinteractions/nef.html. cells were washed twice in cold 1x pbs (137 mm nacl, 2.7 mm kcl, 10 mm na2hpo4, 18 mm kh2po4) and lysed in 1x ripa buffer (20 mm tris - hcl (ph 7.5), 150 mm nacl, 1 mm na2edta, 1 mm egta, 1% np-40, 1% sodium deoxycholate, 2.5 mm sodium pyrophosphate, 1 mm -glycerophosphate, 1 mm na3vo4, 1 g / ml leupeptin). cell lysis was carried out for 45 minutes at 4c with gentle vortexing every 10 minutes. the protein concentration of the lysate was estimated using the bradford reagent (bio - rad, usa). for western blotting, 100 microgram of cell lysate was boiled in laemmli buffer, and the proteins were separated by sodium dodecyl sulphate - polyacrylamide gel electrophoresis (sds - page). the separated proteins were transferred to a nitrocellulose membrane (hybond ecl ; amersham biosciences) at constant voltage of 65 v for 60 minutes. the membrane was then blocked with tris - buffered saline (tbs) containing 3% blotto (bio - rad) for 1 hour at room temperature and washed with tbst (tbs containing 0.1% tween 20). the membrane was then incubated overnight at 4c with the primary antibody appropriately diluted in tbst3% blotto, washed 4 times for 10 minutes each with tbst, and incubated with horseradish peroxidase - linked secondary antibodies diluted in tbst5% blotto for 1 hour at room temperature. after the membrane was washed as described above, chemiluminescent detection of proteins was carried out using luminol reagent (santa cruz biotechnology, usa) according to the supplier 's protocol. primary antibodies anti - il6 (sc7920), anti - il1 (sc1250), anti - actin and hrp - linked secondary antibodies were from santa cruz biotechnology (usa). exosomes isolated from u937/eyfp and u937/nef - eyfp cells using a differential centrifugation protocol were found by electron microscopy to be of the expected size of 3090 nm (fig. these were also tested for the exosomal marker proteins alix, tsg101 and cd81, which were present in purified exosomes as well as in both types of cells. however, unlike cell lysates we did not detect voltage - dependent anion channel (vdac), calnexin or cytochrome c in the exosome preparation, indicating that it was not contaminated with mitochondria, endoplasmic reticulum or apoptotic bodies (17). we further detected cd81 on the surface of exosomes prepared from both cell lines by flow cytometry (fig. the exosomes were also labelled with pkh26, a red fluorescent lipid dye, and were visualized by confocal microscopy either directly (fig. 1c, panels a and b) or after binding to aldehyde latex beads (fig. we also quantified exosome secretion from the two cell lines by normalizing total exosomal protein with the number of cells harvested for exosome preparation. the average exosome yields were 0.384 g / million u937/eyfp cells and 0.615 g / million u937/nef - etfp cells (fig. thus, the nef - expressing u937 cells secreted on an average about 60% more exosomes than control cells. (a) electron microscopy of exosomes from u937/nef - eyfp cells ; bar 100 nm. (c) exosomes were labelled with lipid dye pkh26 ; these were (a, b) observed directly at 100x magnification, or (c, d) first bound to 4 m latex beads and then observed at 100x magnification. (d) amount of exosomes secreted by u937/eyfp and u937/nef - eyfp cell lines presented as protein concentration from 110 cells. the rna isolated from both cell lines and their exosomes was analysed on an agilent bioanayzer. the yield for cellular rna was 1.177 g/l for u937/eyfp cells and 2.055 g/l for u937/nef - eyfp cells with rin of 9.4 and 9.1, respectively (supplementary file). the high rin values indicate the extracted rna to be of high quality. the yields for exosomal rnas were 53 and 52 ng/l for control and nef exosomes, respectively. the bioanalyzer profiles showed 2 distinct peaks of ribosomal rnas in the cellular rna pool, which is characteristic of the 18s and 28s species that were absent in the exosomal rna pool (supplementary file). on the contrary, the exosomal rnas showed a major peak around 25 nt demonstrating the enrichment of small rnas in exosomes. the mirna population was then isolated from both cellular and exosomal rna pools using the mirvana mirna isolation kit and profiling was carried out using taqman low density arrays. the mirnas detected in u937/nef - eyfp cellular and exosomal pools were then compared to their respective control pools to determine differential cellular expression and exosomal secretion of mirnas in nef - expressing u937 monocytic cells. the results from cellular and exosomal datasets were then compared to identify the mirnas that were preferentially packaged in or excluded from nef - containing exosomes. in any sample, only ~50% of the 667 profiled mirnas were detected and the rest remained undetected for each pool. this showed that not all mirnas were produced in u937 cells, confirming the cell - specific expression of mirnas. the profiling data also suggested that cellular and exosomal mirna pools of u937/nef - eyfp cells vary considerably from that of control u937/eyfp cells. of the 667 mirnas analysed, 320 mirnas (i.e. 48%) were detected in u937/nef - eyfp and u937/eyfp cells, of which 87 (27%) were expressed at 1.4-fold or higher levels (mincup) and 67 (21%) were expressed at lower than 0.8-fold (mincdown) in u937/nef - eyfp compared to u937/eyfp cells ; the remaining 166 (52%) mirnas were expressed at similar levels in both cell lines (fig. analogous to the cellular pool, ~50% of the profiled mirnas were detected in any of the exosome samples and the rest remained undetected. of the 349 mirnas detected in nef exosomes, 311 (89%) were present at 1.4-fold or higher levels (mineup) and 28 (8%) were present at lower that 0.8 fold (minedown) in exosomes from u937/nef - eyfp compared to u937/eyfp cells ; the remaining 10 (3%) were present at similar levels in exosomes from both cell lines (fig. while the mirna profile of nef - expressing cells showed almost similar percentages of upregulated and downregulated mirnas, the exosomes from these cells contained increased levels of most of the detected mirnas. the mirnas in (a) cells and (b) exosomes were profiled and relative fold - changes calculated as described in methods. (c) the venn diagrams show the intersection of detected mirnas as follows : (i) upregulated mirnas in both u937/nef - eyfp cells and exosomes ; (ii) downregulated mirnas in u937/nef - eyfp cells and upregulated mirnas in u937/nef - eyfp exosomes ; (iii) upregulated mirnas in u937/nef - eyfp cells and downregulated mirnas in u937/nef - eyfp exosomes. we then examined mirnas upregulated in both cellular and exosomal pools of u937/nef - eyfp compared to u937/eyfp cells (mincupmineup). there were 87 and 311 in nef - expressing cells and exosomes, respectively, of which 77 mirnas were common to these groups (fig. these 77 mirnas are likely to be packaged more in nef exosomes because their levels are also higher in nef - expressing cells. to identify mirnas selectively secreted in nef exosomes (minesel) we compared the mirnas down regulated in nef - expressing cells with those that were upregulated in nef exosomes (mincdownnmineup) and found 47 mirnas in this category (fig. 2cii, supplementary file). finally, we analysed mirnas that are selectively retained in nef - expressing cells (mincsel) and are not exported out through exosomes. for this, we compared the group of mirnas upregulated in nef - expressing cells with those that were downregulated in nef exosomes (mincupminedown), and found only 2 such mirnas (fig. thus, nef expression leads to the selective secretion of many more mirnas in exosomes compared to those that are selectively retained in nef - expressing cells. to confirm the profiling data, we selected 13 mirnas for validation by stem - loop quantitative rt - pcr in multiple replicates of cells and exosomes. these include mir-573 and mir-638 (upregulated in nef cells), mir-548d-3p and 564 (same levels in nef and control cells), and mir-16 - 1, mir-146a, mir-125b, mir-146b-3p, mir-181a, mir-27a, mir-570, mir-610 and mir-624 (down regulated in nef cells). all these mirnas, except mir-146a, were upregulated in exosomes in the profiling array data. as there is no well documented control small rna for exosomes, we quantified rnu6 levels in both nef and control exosomes, and found these to be almost similar in multiple replicates of the 2 populations. the average ct values obtained were 23.3 in control exosomes and 23.7 in nef exosomes (supplementary file). the results showed most of the mirna levels to correlate with the profiling data. in the cells we found 4 mirnas to show a trend opposite to the profiling data. these include mir-27a, which is upregulated, and mir-548d-3p, mir-573 and mir-638, which are down regulated in nef - expressing cells based on qrt - pcr analysis (fig. all the analysed mirnas showed higher levels in nef exosomes, which is consistent with the profiling data (fig. total rna isolated from (a) cells and (b) exosomes was used to quantify expression levels of selected mirnas as described in methods. since each mirna can potentially target hundreds of transcripts, changes in their abundance can have significant effects on cellular pathways. the validated targets of mirnas that were selectively secreted from nef - expressing cells were extracted using the mirwalk software. a majority of these mirnas were found to target the expression of cytokines / chemokines (e.g. interleukins), proteins involved in innate immunity (e.g. interferon, nfkb, stats), tumour suppressors (pten, rb1), cell survival factors (bcl2, mcl1) and the hiv restriction factor apobec3 g. in monocytes, nef induces the synthesis of proinflammatory cytokines and chemokines. this effect is observed with nef expressed intracellularly as well as that added exogenously to monocytes (24). il1, il1, il6, tnf, mip1, mip1, which are induced in the presence of nef, and observed that many of the mirnas that target these cytokines, such as mir-146a, mir-146b-3p, mir-125b and mir-181a, are downregulated in nef - expressing cells, but are selectively secreted in exosomes from these cells. these 4 mirnas regulate proinflammatory cytokine levels, antigen processing and presentation pathways (25). we quantified the expression levels of il1, il1, il6, tnf, mip1, mip1, and il10 mrnas in u937/nef - eyfp and u937/eyfp cells. except for tnf, which did not show any significant change, all other mrnas were present at much higher levels in nef - expressing cells (fig. the results showed > 10-fold increase for il1, il6 and mip1 mrnas, and about 5-fold increase for il10 and mip1 mrnas. for 2 of these, il1 and il6, the protein expression levels were also estimated by western blotting ; these were also higher in nef - expressing cells (fig. (a) rna isolated from u937/nef - eyfp and u937/eyfp cells were tested for the expression of selected cytokine genes by qrt - pcr ; relative fold - changes were calculated from raw ct values using the data assist software (abi). error bars represent standard errors from 3 experiments, each with triplicate measurements ; p 10-fold increase for il1, il6 and mip1 mrnas, and about 5-fold increase for il10 and mip1 mrnas. for 2 of these, il1 and il6, the protein expression levels were also estimated by western blotting ; these were also higher in nef - expressing cells (fig. (a) rna isolated from u937/nef - eyfp and u937/eyfp cells were tested for the expression of selected cytokine genes by qrt - pcr ; relative fold - changes were calculated from raw ct values using the data assist software (abi). error bars represent standard errors from 3 experiments, each with triplicate measurements ; p<0.05. (b) western blots of lysates from u937/nef - eyfp and u937/eyfp cells for il1 and il6 levels. host mirnas can also target hiv transcripts leading to a reduced level of viral replication. we then analysed our profiling data to identify the status of mirnas that can potentially target the hiv genome. in silico analysis was performed with the 451 detected mirnas that were matched against 2 hiv-1 genomes nl4 - 3 (clade b) and indiec1 (clade c), using two separate software tools microinspector and rnahybrid. of the 262 potential hiv-1 targeting mirnas identified through this process, 189 were also present in exosomes from the 2 cell lines. interestingly, 170 of these mirnas were upregulated and only 19 were downregulated in exosomes from u937/nef - eyfp compared to u937/eyfp cells (fig. this overwhelming preference for the secretion of potentially hiv - targeting mirnas suggests that nef - induced vesicle secretion might be a unique viral strategy to selectively export virus targeting host mirnas. (a) diagram showing the correlation between hiv targeting mirnas and nef exosomal mirnas. all the detected mirnas were screened for potential binding sites on 2 different hiv-1 genomes (nl4 - 3 and indiec1) using the microinspector algorithm (http://bioinfo.uni-plovdiv.bg/microinspector/) ; the identified mirnas were verified using the rnahybrid algorithm (http://bibiserv.techfak.uni-bielefeld.de/rnahybrid/). (b) mirnas present in exosomes that can potentially target the hiv-1 genome are separated based on whether their levels are higher or lower in nef compared to control exosomes. using mirwalk, we obtained 1,565 validated target genes for the 47 mirnas that were selectively secreted in nef exosomes (minesel ; supplementary file) and 107 validated target genes of the 2 mirnas that were selectively retained in nef - expressing cells (mincsel ; supplementary file). these were then subjected to pathway analysis using the david (database for annotation, visualization and integrated discovery) bioinformatics resources. we identified 63 kegg pathways (p<0.05) corresponding to the 1,565 validated targets of the 47 mirnas in minesel. these include tgf - beta signalling, toll - like receptor signalling, apoptosis, cell cycle, t - cell receptor signalling, p53 signalling, mitogen activated protein kinase (mapk) signalling, cytokine cytokine receptor interaction, janus kinase - signal transducer and activator of transcription (jak - stat) signalling, b - cell receptor signalling, mtor signalling and chemokine signalling (supplementary file). we also identified 26 kegg pathways (p<0.05) corresponding to the 107 validated targets of the mirnas in mincsel. some important pathways here include cell cycle, mapk signalling, p53 signalling, t - cell receptor signalling, toll - like receptor signalling, cytokine cytokine receptor interaction and regulation of actin cytoskeleton (supplementary file). we further compared the entries reported in the hiv, human protein interaction database to be upregulated and downregulated by nef with the mirna targets identified in this study. this identified 19 proteins (genes) reported to be upregulated by nef to also be present in our set of 1,565 upregulated genes ; similarly, 2 proteins (genes) were in common with our set of 107 downregulated genes. the nef protein of hiv is expressed early during viral infection and is associated with cellular membranes, including endosomal membranes (2). in addition to perturbing intracellular membranes and signalling, nef is secreted in exosomes (4). interestingly, nef increases the formation of mvbs (26), which are intracellular sites for exosome biogenesis, the secretion of these vesicles (27), and interacts with the aip1/alix protein that is involved in mvb biogenesis (28). consequently, nef promotes its own export through exosomes from different cell types and can induce apoptosis in bystander cd4 + t cells (3, 4). exosomes contain different proteins, mrnas and mirnas depending on their cell of origin (9). they are taken up by recipient cells, in which the exosomal mrna is translated and the mirna can post - transcriptionally regulate gene expression (10), thus supporting the view that exosomes function as intercellular messengers. modulation of exosomal mirnas is reported in several cancers as well as viral infections (29). we have carried out the first mirnome analysis of nef - expressing human monocytic cells and their exosomes. we show that nef exosomes are enriched in mirnas that can target proinflammatory cytokines and other genes involved in key pathways like jak - stat signalling, mapk signalling and apoptosis. further, an overwhelming percentage of mirnas that can potentially target hiv-1 are secreted out of nef - expressing cells into exosomes. as reported earlier for other cell types, u937 cells expressing nef also showed increased exosome secretion. there was differential expression of about 50% of detected mirnas under the influence of nef. it was shown recently that reducing gw182, which is an important component of glycine - tryptophan (gw) bodies, also reduced mirna secretion through exosomes (30). this agrees with our recent findings that nef - expressing u937 cells have higher levels of gw182 (17) and display increased secretion of exosomes and mirnas reported here. we observed significant changes in the levels of several mirnas that regulate innate immune responses, especially the proinflammatory cytokines. these include mir-16, mir-125b, mir-146a, mir-146b-3p and mir-181a, which are reduced in nef - expressing u937 cells. of these, mir-16 is required for the degradation of transcripts that contain au - rich elements in their 3utr, which includes mrnas for most of the inflammatory mediators. it regulates il6, tnf and il8, and high levels of mir-16 restrict the production of inflammatory mediators under non - stimulated conditions (25). interestingly, mir-16 levels were ~50% lower in the nef cellular pool, suggesting that nef might regulate proinflammatory cytokines through this pathway. our profiling data showed about 3-fold reduction in mir-125b levels in nef - expressing u937 cells and a corresponding increase in their exosomes, suggesting that nef might also render cells more permissive for viral replication through mir-125b modulation. the mir-146 family comprises 2 members mir146a and mir146b, of which the former is also a well - known inhibitor of innate immune responses (32). its levels increase in myeloid cells in response to tlr2, tlr4 or tlr5, and exposure to inflammatory cytokines like tnf or il1 (33, 34) ; in alveolar epithelial cells it reduces il1 levels (33, 34). we found mir-146a levels to be about 5-fold lower in u937/nef - eyfp cells compared to u937/eyfp cells, and observed a corresponding increase in nef exosomes. in thp-1 monocytic cells, mir-146a regulates inflammatory cytokines / chemokines, including il1, il6, tnf, il8, ip10, and mcp-1 (34). high levels of mir-146a correlated with increased numbers of gw bodies in thp-1 cells, suggesting that gw bodies are markers for mirna activity during innate immune signalling (34). our data showing reduced levels of mir-146a in nef - expressing monocytes further, mir-181a levels are also ~50% lower in u937/nef - eyfp cells compared to u937/eyfp cells, and show a corresponding increase in nef exosomes. this mirna regulates t - cell signalling by down regulating multiple phosphatases, and is thought to act as a rheostat that regulates protein phosphorylation levels (25). thus, several mirnas that affect inflammatory cytokines and innate immune responses are present at reduced levels in nef - expressing monocytes and show a corresponding increase in exosomes secreted from these cells. correspondingly, the mrnas and expression of these cytokines / chemokines are at higher levels in nef - expressing cells. naturally then, modulation of host mirnas is emerging as a viral counter - strategy for successful infection (13, 35). hiv-1 infection of jurkat cells downregulates the polycistronic mirna cluster mir-17/92, which includes mir-17/-18/-20a, mir-19a/-19b and mir-92a (16). the downregulation of mir-21, mir-26a, mir-29a, mir-29b and mir-29c was also observed in hiv patients (31). we found mir-18, mir-19a, mir-20a, mir-21 and mir-29b to be downregulated in nef expressing monocytes. a comparison of mirna expression patterns in resting and activated cd4 + t cells and use of specific antagomirs concluded that mir-28, mir-125b, mir-150, mir-223 and mir-382 target the nef/3ltr region and contribute to hiv latency in resting cd4 + t cells ; similar data were also reported for monocytes and macrophages (14, 16). our profiling demonstrated reduced levels of mir-125b and mir-223 in nef - expressing monocytes, whereas mir-382 was not detected. based on in silico analyses, mir-29a, mir-29b, mir-149, mir-324 - 5p and mir-378 were reported to target conserved regions of the hiv-1 genome, including the nef gene (16). of these, we found mir-29b to be downregulated in nef - expressing cells. a majority of mirnas that inhibit hiv replication, including mir-17, mir-19a, mir-19b, mir-20a, mir-26a, mir-28, mir-29a, mir-29b, mir-29c, mir-92a, mir-125b, mir-149, mir-150, mir-223, mir-324 - 5p, mir-378 and mir-382 were present at 1.5-folds or higher levels in nef exosomes. further, when correlated with our in silico analysis of mirna target sites in the hiv genome, an overwhelming majority of mirnas that can potentially target hiv-1 genomes were present at increased levels in exosomes secreted by nef - expressing cells. we also found 47 mirnas to be present at increased levels in nef exosomes despite being present at reduced levels in nef - expressing cells. thus, nef expression reduces the cellular levels of several host mirnas that target innate immune responses and viral transcripts by exosome - mediated export. the increased formation of mvb membranes (26, 28) and enhanced vesicle secretion (4, 27) in the presence of nef can favour virus egress and spread. however, recent reports also show mvbs to be sites for mirna assembly and activity (36, 37). thus, the host can limit hiv replication by targeting viral transcripts to membranes, which it evolved to exploit. we have recently shown that nef attenuates the activity of let-7a, which silences target genes primarily at mvbs (17). this is attributed to the ability of nef to interact with ago2 through 2 highly conserved gw motifs (17). we now show that many mirnas whose levels are reduced in nef - expressing cells accumulate in exosomes secreted from these cells. thus, besides employing endosomal membranes for ago2 interaction, hiv nef further exploits the exosomal pathway to alter the cellular and exosomal distribution of mirnas. based on these findings, we propose that nef has evolved a 2-pronged suppressor function to inhibit mirna - mediated viral silencing and to modulate exosome - mediated cell - to - cell communication. how nef influences the selective expression and export of mirnas, and how the exosomal cargo influences uninfected cells remain important issues to explore in future studies. this work was funded by grants from the department of biotechnology (dbt), government of india and the indian council of medical research (icmr). a senior research fellowship from the council for scientific and industrial research (csir), india, supported ma. | introductionthe hiv nef protein is a multifunctional virulence factor that perturbs intracellular membranes and signalling and is secreted into exosomes. while nef - containing exosomes have a distinct proteomic profile, no comprehensive analysis of their mirna cargo has been carried out. since nef functions as a viral suppressor of rna interference and disturbs the distribution of rna - induced silencing complex proteins between cells and exosomes, we hypothesized that it might also affect the export of mirnas into exosomes.methodexosomes were purified from human monocytic u937 cells that stably expressed hiv-1 nef. the rna from cells and exosomes was profiled for 667 mirnas using a taqman low density array. selected mirnas and their mrna targets were validated by quantitative rt - pcr. bioinformatics analyses were used to identify targets and predict pathways.resultsnef expression affected a significant fraction of mirnas in u937 cells. our analysis showed 47 mirnas to be selectively secreted into nef exosomes and 2 mirnas to be selectively retained in nef - expressing cells. the exosomal mirnas were predicted to target several cellular genes in inflammatory cytokine and other pathways important for hiv pathogenesis, and an overwhelming majority had targets within the hiv genome.conclusionsthis is the first study to report mirnome analysis of hiv nef expressing monocytes and exosomes. our results demonstrate that nef causes large - scale dysregulation of cellular mirnas, including their secretion through exosomes. we suggest this to be a novel viral strategy to affect pathogenesis and to limit the effects of rna interference on viral replication and persistence. |
achalasia is a rare disease with an incidence of 1 per 100,000 patients in adults.1 the disease also occurs in children through all age groups however, it is estimated even less frequent in the pediatric population (0.11 cases per 100,000 patients2). achalasia is a rare esophageal motility disorder characterized by failure of the lower esophageal sphincter (los) to relax and aperistalsis of the tubular esophagus. pneumatic dilation (pd) and laparoscopic heller myotomy (lhm) are well established and currently used as standard treatment for achalasia in children.3 4 peroral endoscopic myotomy (poem) is a new, entirely endoscopic procedure for the treatment of achalasia. myotomy is performed exclusively through the transoral endoscopic route and is therefore a true notes procedure (natural orifice endoscopic surgery). current data regarding poem in adults demonstrate excellent postoperative outcome.5 6 7 data about poem in pediatric patients are still missing. we present here the case of a 10-year - old male patient admitted to our department with an 18-month history of dysphagia, recurrent vomiting, and weight loss. high - resolution manometry (hrm)/esophageal pressure topography (ept) study using sierra (sierra scientific instruments inc., los angeles, california, united states), according to the standards defined in the chicago classification8 was performed to check for esophageal motility disorder. this investigation revealed an increased integrated relaxation pressure (irp) of the los (15.5 mm hg) and aperistalsis of the tubular esophagus, with 100% simultaneous (tertiary) contractions (fig. this result had to be classified as type i (classic) achalasia.8 hrm / ept study shows aperistalsis of the tubular esophagus with 100% of the contractions being simultaneous (tertiary) contractions. additional timed - esophagography (fluoro loop [3/s ; global siemens healthcare, erlangen, germany ] and fluoroscope with last - image - hold - technique) showed a dilated esophagus with slow transit of the contrast medium across the esophagogastric junction (oegj) (fig. the eckardt dysphagia score9 was 8 points (weight loss 1 ; dysphagia 3 ; retrosternal pain 1 ; and regurgitation 3). the different available treatment options were discussed with the parents of the patient. due to the convincing results of poem in adults in our own experience as well as the available literature5 6 7we decided to offer the poem procedure. the poem procedure was performed using the technique suggested by inoue as follows5 : (1) creation of a mucosal entry, (2) creation of a submucosal tunnel using an endoscopic submucosal dissection technique, (3) myotomy, and (4) clip closure of the mucosal entry (fig. (a) mucosal injection ; (b) mucosal incision ; (c) submucosal dissection, using an esd - technique, with repeated injection of indigocarmine - stained solution and dissection using tt knife. (d) endoscopic myotomy of circular muscle fibers, using the tt knife ; (e) clip closure. for this procedure we used the silverscope by karl storz, tuttlingen, germany, type 13821pks, 9.3 mm. the whole procedure was performed using carbon oxide insufflation (ucr, olympus medical systems corp., a cap attachment with straight orifice (dh28gr, fujifilm, tokyo, japan) was used for all steps of the procedure (submucosal tunnel, myotomy). the poem procedure was carried out under general anesthesia with the patient in supine position. submucosal injection of 10 ml indigocarmine - stained saline solution, which was applied with a special injection device (injectorforcemax, nm-401l-0425, olympus) was performed 2 cm below the aortic arch (clearly visible at 30 cm from the incisors). the mucosal entry was created with the triangle tip (tt)-knife (kd-640l ; olympus) and the energy source vio300d (erbe elektromedizin gmbh ; tbingen, germany) in cut mode (80 w ; effect 2). stained saline solution was repeatedly injected into the submucosal space, using a blunt catheter (pw-205v ; olympus) and dissection was performed with the energy source in spray mode (50 w ; effect 2). the submucosal tunnel was created in the tubular esophagus and carried forward across the oegj (35 cm below the dental line). myotomy of the circular muscle fibers was started approximately 3 cm below the mucosal entry and conducted across the oegj until 2 cm at the gastric site (3137 cm below the dental line), whereas the longitudinal muscle layer was preserved to serve as for clip closure of the mucosal entry, we used a cap attachment with oblique orifice (mh-588 ; olympus). seven endoclips (hx-610090l ; olympus) were applied with the standard multiuse clip applicator (hx110qr ; olympus). proton pump inhibitors (ppi) as well as cefuroxime were administered intravenously for 3 days and then switched to per oral. postoperatively, a slightly elevated c - reactive protein levels (3.6 mg / dl) with normal white blood cell were noted. on postoperative day 1 a timed esophagography was performed, which demonstrated prompt delay of the esophagus (fig. after an unremarkable postoperative course, the patient was discharged home on day 3 in good general condition with very good symptom relief, that is, absence of dysphagia, and no clinical reflux symptoms. short - term follow - up (2 months) showed no clinical impairment with complete control of dysphagia (eckardt score 0) and no sign of reflux. poem is a promising new technique for treatment of achalasia, with more than 1,400 cases having been performed in specialized centers worldwide to date.6 10 the procedure is attractive due to the myotomy being performed entirely through the endoscopic route and its excellent results, that is, good control of dysphagia and low reflux rates in the short term. however, little is known about the potential role of poem for treatment of pediatric achalasia patients. only two previous reports have addressed this issue : maselli have reported briefly about a successfully accomplished poem procedure in a 3-year - old achalasia patient with growth retardation and down syndrome.11 familari reported about successful poem procedures in three female achalasia patients (9, 9, and 11 years of age) with no intra- and postoperative complications and complete symptom relief (normalized eckardt score) at 1-year follow - up.12 these reports as well as our experience suggest that poem might be well suited as treatment option for pediatric achalasia patients as well. due to our excellent results with poem in adult achalasia patients, we decided to recommend this well - suited technique for our pediatric patient. at this time we had an experience of altogether 11 poem procedures performed in adults. before introducing poem in clinical practice we had undergone a special training in yokohama / japan and had trained the procedure in a well - suited animal model. therefore, we had discussed the circumstances, a new procedure without long - term experience and rather no experience in children, but excellent short - term results in adults with the parents, who agreed to have poem done on their child. technical aspects as well as the procedure itself did not differ from our experience in adults. anatomical landmarks were identified easily, especially the oegj, which is a crucial landmark for this procedure, and the impression of the aortic arch. to confirm a save intragastric position, we followed the suggestions made by inoue which are also nicely summarized in the ipoem (international per oral endoscopic myotomy) survey by stavropulos : the myotomy has completely addressed the muscle responsible for achalasia, when the endoscope reaches a wide submucosal space with larger vessels. further indicators are detection of indigocarmine stain in retroflexed view, level from the incisors and smooth passage of the endoscope through the previously tight oegj. as a new procedure for the treatment of achalasia poem must exhibit some outstanding characteristics to be a serious alternative to the current procedures pd and lhm in children. the free choice of length and localization of the myotomy may be regarded as a fundamental advantage of the poem procedure. a longer myotomy may be beneficial in patients suffering from chest pain, and perhaps especially in patients with type iii achalasia, where pd and lhm are potentially inferior. poem could also be an option for esophageal motility disorders in which pharmacological treatment has failed.13 as a pure notes procedure the manipulation in the abdominal cavity as well as visible scars are avoided. this could be a weighty argument for this procedure referring to the future body image of adolescents. also, the previous operations in the abdominal cavity are assessed as a reasonable indication for poem.6 14 15 but which side effects should be mentioned particularly in the consultation with patient and the parents ? the focus of interest should be the potential appearance of gastroesophageal reflux after poem. despite all the promising early experiences with poem, some aspects warrant controversial discussion. one of these is the exact rate of postoperative reflux, which is currently not known. one might expect a higher reflux rate after poem compared with lhm, because the myotomy is not combined with a fundoplication, which is standard when performing lhm.16 17 however, an antireflux procedure might on the other hand be unnecessary after poem, because natural antireflux barriers such as the phrenoesophageal membrane and the angle of his remain untouched. the current available literature is controversial regarding reflux rates after poem, ranging from 5.9 to 46%.5 7 the overall reflux rates of 20 to 30% are probably the correct estimate10 and are pretty similar to with reflux rates after lhm and pd.17 18 most reported reflux - associated problems are minor complaints, which are well treatable with ppi. nevertheless, this issue will be of the special interest because of the longer exposition of the (distal) esophagus to reflux in children compared with adults. one other aspect regarding differences between poem and lhm is the type of myotomy : during lhm, all muscle layers (circular and longitudinal) are cut. during poem we cut only the circular muscle fibers, whereas the longitudinal muscle is preserved, following the suggestion by inoue.5 a recent randomized study from china19 has shown, that there is no difference with respect to inclusion or exclusion of longitudinal fibers in the myotomy this supports the current view of protagonists of the poem procedure, that only the circular muscle layer is responsible for achalasia. all currently available publications reported no serious local infections although the setting of this procedure would suggest this. to reduce the potential risk of infection we perform an application of a topical antibiotic (gentamycin) and administer intravenous antibiotics for 1 week postoperatively. if co2 insufflation is used20 our experience as well as reported data revealed predominantly minor complications such as pneumoperitoneum, cutaneous emphysemas, pneumothorax, which are well treatable intraoperative or are mostly self - limitated.5 7 14 20 21 mucosal lesions, which were normally depict and provide at the postoperative endoscopy can not be regularly identified in our described setting.. the risk of major bleeding especially in the submucosal tunnel seems to be low but also difficult to manage.22 one final issue to discuss is the question what to do after a potential treatment failure of poem. again all three options for treatment of achalasia (lhm, pd, and poem) may be considered : (1) lhm might be an option but might well be more difficult, because there might be severe scarring in the submucosal tunnel and at the outer surface of the mucosa, which might show stronger adherence to the muscular layers. however, the risk for esophageal perforation might be higher after poem, when the muscular layer at the esophagogastric junction is already weakened. (3) the best option in this setting might again be a (redo) poem procedure. this could be performed at the posterior esophageal wall, which is untouched at this time. only recently, inoue have reported poem as a redo procedure after failed myotomy.23 pre- and postoperative treatment concepts must be tailored to children conditions and detailed information of the parents is crucial. in an adjusted setting, poem seems to be a suitable alternative for the treatment of achalasia. larger case series and long - term follow - up are required. | peroral endoscopic myotomy (poem) is a new endoscopic treatment for achalasia with very good short - term results in adults. data about poem in pediatric patients are missing. we present the case of a 10-year - old male patient with type i (classic) achalasia, successfully treated with poem. the procedure was accomplished in a similar fashion to the technique used in adults. short - term results were fine, with a complete control of dysphagia and absence of reflux. we suggest that poem is a suitable option in pediatric patients similar to adults but long - term results must be awaited. |
two castrated male cats, aged 8 months old (case 1) and 10 months old (case 2), showed a history of progressive paraparesis, an over - reaching pelvic limb gait, urinary incontinence and a palpable dermoid fistula. in case 1, the fistula was connected to the dural sac on the conus medullaris, and the tethered spinal cord was retracted caudally. in case 2, the tubular structure was connected to the dural sac on the thoracic spinal cord, and the tethered spinal cord was retracted dorsally. a histopathological examination confirmed the diagnosis of a meningomyelocele in case 1 and a meningocele in case 2. this is the first report to describe the imaging characteristics, surgical treatments and outcomes of two different types of tethered cord syndrome with spina bifida aperta in cats. tethered cord syndrome with spina bifida aperta needs to be included in the differential diagnosis of slowly progressive paraparesis in younger cats with or without vesicorectal failure and a palpable dermoid fistula. spina bifida is a congenital malformation of unknown aetiology in which incomplete closure or fusion of the dorsal vertebral arches occurs with or without protrusion or dysplasia of the meninges, spinal cord and cerebrospinal fluid (csf). spina bifida aperta (sba) is a type of spina bifida that is associated with protrusion of the meninges (a meningocele) or the spinal cord, meninges and csf (a meningomyelocele) through a defect in the vertebral arch. tethered cord syndrome (tcs) is a neurological disorder caused by tissue attachments that result in abnormal stretching of the spinal cord. although tcs occurs secondary to sba in humans, it has not been examined in as much detail in veterinary medicine. we herein report two feline cases of tcs with sba for which imaging characteristics, surgical treatments and outcomes are presented. case 1 was an 8-month - old castrated male domestic shorthair cat presented to the veterinary referral hospital with a 2 week history of progressive paraparesis and constipation. the owner also reported progressively worsening urinary incontinence when the cat was adopted at 3 months of age. a neurological examination showed proprioceptive deficits in the hindlimbs and the absence of anal and perineal reflexes. the lesion was neuroanatomically localised to the l4s3 spinal cord segments. a complete blood count and mri (excelart vantage 1.5 tesla ; toshiba) and ct (aquilion 64-slice scanner ; toshiba) were performed. the palpable dermoid fistula was hyperintense on t2-weighted images (t2wi) and hypointense on t1-weighted images (t1wi), and was connected to the dural sac on the conus medullaris. this fistula appeared to have retracted the spinal cord caudally (figure 1a d). ct images revealed the lack of the dorsal arches of s3, cd1 and cd2 vertebrae and ventral displacement of the caudal vertebra (figure 1e). based on these imaging findings and clinical signs, caudally retracted tcs secondary to sba was suspected. (a) t2-weighted sagittal image of the lumbosacral region and (b) transverse image at the level of s3 on mri. (a) the fistula was revealed to be hyperintense (arrowhead) and tethered the conus medullaris up to the caudal aspect of s3 (arrow). (c) t2-weighted sagittal image of the lumbosacral region and (d) transverse image at the level of s1 in a 1.5-year - old male domestic shorthair cat without spinal issues. (c) the conus medullaris is the terminus of the caudal aspect of l7-s1 (arrow). (d) the dural sac does not contain the conus medullaris at the cranial aspect of s1. (e) a three - dimensional reconstruction dorsal image of the lumbosacral region on ct revealed the lack of the dorsal arches of s3, cd1 and cd2 vertebrae. (f) the fistula was connected to the dural sac and caused caudal traction of the conus medullaris after incision of the meninges the excision of caudal sba and caudectomy were performed under general anesthesia to release the tethering of the spinal cord and resolve rectal narrowing secondary to ventral displacement of the caudal vertebra. after premedication with intravenous atropine (atropine ; tanabe) (0.05 mg / kg) and midazolam (midazolam ; astellas) (0.2 mg / kg), general anaesthesia was induced with propofol (propoflo 28 ; ds pharma animal heath) (5 mg / kg, to effect iv) and maintained with isoflurane in oxygen. fentanyl (fentanyl ; daiichi sankyo) (loading dose of 5 g / kg iv followed by continuous rate infusion at 510 g / kg / h dorsal lumbosacral laminectomy from l7 to s3 was then performed. when the vertebral canal was opened, the fistula communicating with the dural sac on the conus medullaris was observed. after the incision of the meninges, the fistula caused caudodorsal displacement and traction of the conus medullaris (figure 1f). dura regeneration matrix (expanded polytetrafluoroethylene [eptfe ] soft tissue patch ; gore - tex) was placed over the defect of the dura prior to standard closure. the vertebra caudal to s3 was resected in order to release rectal narrowing secondary to ventral displacement. a follow - up mri revealed the release of the conus medullaris tethering and an improvement in rectal narrowing (figure 2a). the histopathological examination showed that the resected fistula was consistent with a segment of the spinal cord parenchyma that contained remnants of the central canal lined by cuboidal - to - columnar cells, resembling ependymal cells. multiple small capillaries, glial cells and occasional neurons were observed within the spinal cord parenchyma. based on these findings, the lesion was diagnosed as a meningomyelocele (figure 2b). the conus medullaris is observed to release the tethering and terminates at the caudal aspect of l7 (arrow). (b) histopathology ; excised tissues showed a segment of a neuropil in the dermis. the space within the spinal cord parenchyma (asterisk), including multiple small capillaries, glial cells and occasional neurons, is the central canal lined by ependymal cells. haematoxylin and eosin staining case 2 was a 10-month - old castrated male domestic shorthair cat referred to the veterinary referral hospital for a 6 month history of progressive paraparesis and an over - reaching pelvic limb gait. a neurological examination showed proprioceptive deficits and upper motor neuron signs in the hindlimbs, which suggested a t3l3 spinal cord lesion. the palpable dermoid fistula showed hypointensity on t2wi and t1wi, and was detected as a tubular structure connected to the dural sac on the thoracic spinal cord. ct revealed a dorsal lamina defect between the spinous processes of t5 and t6 (figure 3a, b). the dermoid fistula was hypointense and detected as a tubular structure (arrowheads), which was connected to the dural sac, and the tethered spinal cord was retracted dorsally (arrow). (b) a three - dimensional reconstruction dorsal image on ct revealed a dorsal laminar defect between the spinous processes of t5 and t6. (c) the tubular structure was connected to the dural sac (arrow) the excision of sba was performed to untether the spinal cord under general anaesthesia. the cat was positioned in sternal recumbency and standard dorsal laminectomy of t5 and t6 were performed. after the incision of the meninges, the tubular structure was completely removed and the spinal cord was untethered. a postoperative mri examination confirmed the removal of the tubular structure and untethering of the spinal cord (figure 4a). (a) a postoperative mri examination revealed the removal of the tubular structure and release from tethering of the spinal cord. a histopathological evaluation showed meningeal - like cells surrounded by well - differentiated collagen fibres. (d) immunohistochemically, these meningeal - like cells were positive for anti - e - cadherin in 1 week and 1 month follow - up neurological examinations the cat showed continuous improvements ; however, the over - reaching pelvic limb gait persisted. in the 12 month follow - up, other than pelvic limb ataxia, histologically, the tubular structure revealed spindle cells arranged in interlacing fascicles (meningeal - like cells) surrounded by well - differentiated collagen fibres. sba has rarely been diagnosed in veterinary medicine, and is mainly reported in lumbo - sacral spinal cord segments. teratogenic, nutritional and environmental factors have been suggested to contribute to the occurrence of sba. in cats, the experimental administration of griseofulvin during pregnancy and other toxic compounds, such as methylmercury and ethylenethiourea, induced sba in kittens. manx cats are known for congenital abnormalities in the lower spine and spinal cord. the autosomal dominant trait in manx cats results not only in the absence of a tail, but also in the presence of severe malformations, including sacrocaudal meningocele, meningomyelocele and myelodysplasia. sba in dogs may also have a breed predisposition ; the incidence of spina bifida is higher in english bulldogs than in any other canine breeds. in humans, the aetiology of sba in humans currently remains unclear, but may be related to various factors including maternal nutrition, environment and genetics. for example, folic acid supplementation during pregnancy prevents spina bifida. in avian and mammalian embryos, neurulation occurs along the axis through two consecutive processes involving radically different morphogenetic events and is referred to as primary and secondary neurulation, respectively. the primary neural tube forms rostrally by rolling, folding or bending of the neural plate, which is a flat epithelial sheet. however, the secondary neural tube is generated caudally by elongation, epithelialization and cavitation of the tail bud, a rod - shaped mesenchyme. spina bifida has been classified as sba, in which neural tissue is exposed, and spina bifida occulta (sbo), in which neural tissue is covered by tissue. sbo includes various closed spinal defects such as diplomyelia, dorsal dermal sinus and spinal lipoma, and is caused by defects in secondary neurulation. by contrast, sba such as that in cases 1 and 2 is caused by a failure in primary neurulation. tcs in humans commonly occurs in the growing phase secondary to spina bifida. in veterinary medicine, tcs has been reported in conjunction with intradural lipoma, meningomyeloceles, spina bifida, myeloschisis and split cord malformation. in humans, the early symptoms of tcs include ataxia in the lower extremities, muscle weakness and vesicorectal failure (including urinary urgency and urinary and faecal incontinence). tcs in case 1 occurred in the lumbosacral region and appeared with similar clinical signs as those in humans. urinary incontinence and dyschezia in case 1 were assumed to be caused by damage to the pudendal nerve, which controls the external urethral sphincter and external anal sphincter, and pelvic and/or autonomic nerves, which control rectal wall function. the fasciculus gracilis in the thoracolumbar spine contains neurons that mainly transmit information on general proprioception travelling to the somatosensory cortex. damage to the fasciculus gracilis may have caused the over - reaching pelvic gait observed in case 2. four case reports have documented the surgical treatment of tcs in the lumbar - sacral region in a cat and dogs. all four cases had a history of paraparesis, and 2/4 cases had dysuria and dyschezia. all cases with a history of paraparesis only improved postoperatively, whereas none with dysuria and dyschezia improved completely. the outcomes in these reports were similar to that of case 1. in humans, garcs - ambrossi reported that the symptoms of tcs that improved after surgical treatment were painful dysesthesias (79%), lower extremity weakness (69%) and urinary symptoms (47%). this study concluded that the rates of improvements in pain resolution and motor symptoms were greater than that in urinary symptoms. kondo found that patients with sensory motor paralysis of the bladder or symptoms with a duration of more than 3 years did not benefit from surgery. in cats, as with the symptoms reported in humans, improvements in sensory motor paralysis of the bladder may be more difficult to achieve than those in paraparesis. only one surgical case of tcs in the thoracic region in a cat was reported prior to our case 2. we suggest that paraparesis caused by tcs improves regardless of the location of the lesion or direction of cord traction if the spinal cord is properly released surgically. this case report presents the imaging characteristics, surgical treatments and outcomes of two different types of tcs with sba in cats. there have been few reports of tcs with sba in cats, and it needs to be included in the differential diagnosis of slowly progressive paraparesis in younger cats with or without vesicorectal failure and a palpable dermoid fistula. its diagnosis is challenging ; however, proper surgical treatment is key for an optimal outcome. tcs with sba in cats may be successfully treated surgically if paraparesis is the only neurological sign. | case summarytwo castrated male cats, aged 8 months old (case 1) and 10 months old (case 2), showed a history of progressive paraparesis, an over - reaching pelvic limb gait, urinary incontinence and a palpable dermoid fistula. in case 1, the fistula was connected to the dural sac on the conus medullaris, and the tethered spinal cord was retracted caudally. in case 2, the tubular structure was connected to the dural sac on the thoracic spinal cord, and the tethered spinal cord was retracted dorsally. tethered cord syndrome secondary to spina bifida aperta was suspected in both cats. excision of the fistula and release of the tethered spinal cord was performed. a histopathological examination confirmed the diagnosis of a meningomyelocele in case 1 and a meningocele in case 2. paraparesis improved postoperatively in both cats. however, urinary incontinence in case 1 remained partially unresolved.relevance and novel informationthis is the first report to describe the imaging characteristics, surgical treatments and outcomes of two different types of tethered cord syndrome with spina bifida aperta in cats. tethered cord syndrome with spina bifida aperta needs to be included in the differential diagnosis of slowly progressive paraparesis in younger cats with or without vesicorectal failure and a palpable dermoid fistula. |
it is a complex function resulting from the interaction of several physiological systems, which changes with age. the loss of physiological reserves caused by aging and chronic diseases leads to a frail state. frailty is a significant geriatric syndrome characterized by age - associated severely reduced strength,1 mobility, balance, and endurance.2 this decrease in physiological reserves may result in falls, disability, hospitalization, or even death.24 sarcopenia, a common syndrome in older adults, is considered to play a crucial role in the frailty process. it is characterized by a progressive loss of muscle mass and muscle power.5 its causes are multifactorial and can include hormonal factors and nutritional deficiencies.6 sarcopenia can lead to poor outcomes, including fatigue, falls, physical disabilities, and functional decline,7,8 exacerbating a vicious circle involving physical inactivity and deconditioning and decreased energy expenditure.9 however, the decrease in physical capacities is not only a consequence of muscle weakness. their finding supported the hypothesis of a decline in action planning with aging.10 indeed, the results showed that older adults were impaired in their ability to mentally simulate the rising from the floor sequence, at least through an image - sequencing task : they made significantly more sequencing errors than did their younger counterparts. the work of allain showed that aged patients with cognitive disorders have problems with mentally developing logical strategies and executing complex predetermined plans, which are partially related to behavioral changes.11 from a functional point of view, these problems of planning abilities may affect the quality of the sit - to - stand (sts) and back - to - sit (bts) transfers. in the study by mourey the effects of aging on kinematic features of body motion during sts and bts were explored. seven healthy young subjects and five healthy older people (mean age 73.25.5 years) participated in this study, and were compared., the trunk control allows subjects to adjust weight shifts, and to perform selective movements in order to maintain the center of mass within the base of support during dynamic postural adjustments.13 considering the sts, for instance, the trunk flexion allows the subject to shift his center of mass toward the future basis of support. indeed, this trunk movement corresponds to a postural anticipation needed to perform the transfer, and is allowed by the motor planning process.14 the results showed that trunk angles were not impaired in these normal aged adults, neither in sts nor in bts. however, there was an age - related deceleration when performing both transfers. in addition, the healthy older people had more difficulties with curbing the movements accelerated by the force of gravity during the bts. these planning problems seem greater in older adults with mild - to - moderate alzheimer s disease (ad) : the study by manckoundia showed that higher level motor processes of whole body motions are affected by ad, while lower level motor features remain intact.15 the work involved a comparison of the kinematics of sts and bts motions between six healthy older adults (mean age 793.5 years) and six older adults with ad (mean age 813.5 years). the results showed that the duration of sts and bts was shorter in the ad group than in the healthy older people group. moreover, the kinematic analysis revealed that for both sts and bts, ad subjects performed the task with significantly smaller shoulder displacements than healthy subjects, ie, ad subjects tilted the trunk less than healthy subjects. this is due to the fact that during both sts and bts, ad subjects reduced their motion in the horizontal plane, especially during sts. thus, the authors concluded that the ad subjects did not have intact motor planning processes. the implication of the outcomes of the ad group is interesting because various studies have reported that physical frailty is significantly linked to the incidence of dementia.16,17 in addition, cognitive impairment is considered to be a component of frailty.18 however, there is a lack of literature about the sts and bts transfers in the frail population. the studies cited above showed light impairment in normal aged adults, mainly in terms of their temporal characteristics, and a more severe impairment in ad patients. thus, we investigated the planning impairment in the frail older adults both at the level of their temporal characteristics and the changes in their motor strategies. finally, we will try to link these motor organization deficiencies to functional capacity using the timed up and go (tug) test,19 a clinical test that has been extensively used to assess functional balance and mobility mainly in frail older people.20 the tug consists of standing up from a chair, walking a distance of 3 m, turning, walking back to the chair, and sitting down again. the time taken to complete the test is usually used as the main outcome of analysis and allows, according to some authors, the prediction of the risk of falling.21,22 a score of 13.5 seconds is considered as the upper limit of normal mobility, with a sensitivity and a specificity of 0.8.22 in this way, we will be able to measure the influence of frailty effects on motor planning during sts and bts, and to determine the most functional - related kinematic parameter. data were obtained from ten healthy young subjects (young group [yg ], two females and eight males) aged 2130 years (mean age 26.62.95 years) and ten frail aged adults (frail group [fg ], six females and four males) aged 8395 years (mean age 87.94.2 years). fg was composed of patients who were following a functional rehabilitation program managed by only one physiotherapist. these patients were suffering from different pathologies, involving loss of functional independence such as chronic obstructive pulmonary disease (copd) (2), shoulder, hip (2), and thoracolumbar (3) deficiency (see table 1 for a description of these patients). they were included in this group according to the fried criteria of the frailty syndrome (unintentional weight loss, self - reported exhaustion, weakness, slow walking speed, and low physical activity).2 the elderly subjects were selected according to various inclusion and exclusion criteria. the inclusion criteria required subjects to be aged 65 years or more, capable of performing the sts and bts, maintaining standing, walking, and making u - turns without human assistance, and had cognitive and behavioral skills adapted to comply with instructions. the exclusion criterion for participation in this study was to have a diagnosis of cognitive impairments as evaluated by the mini subjects were seated on a chair with armrests (chair width : 47 cm, seating depth : 40 cm, backrest height : 38 cm, armrest height : 60 cm, and total chair height : 76 cm). their feet were placed flat, and their shanks were flexed (10 with respect to the vertical axis). the chair was placed at knee height and its backrest allowed the subjects to maintain their trunk in a vertical position. from this initial position, they were given verbal instructions to rise from the chair, walk 3 m, cross a mark on the floor, turn around, walk back, and sit down. kinematic trajectories during tug were recorded by means of a wearable system for real - time balance assessment in the aged subjects. the instrument used a kinect sensor that allowed us to detect the subjects tug movements. this sensor produces accurate results, especially for when tracking shoulder movements (segment lengths and angle estimation).23 the sensor can reach a frame rate of 30 images per second at a resolution of 640480 with 8 bits per channel. the field of view for the system is 58 horizontal, 45 vertical, 70 diagonal, and the operational range is between 0.8 m and 3.5 m. the kinect does not require any calibration. it was placed at a distance of 2.5 m from the chair with a tilt angle of 20. no markers or wearable sensors were attached to the body. seven spatiotemporal parameters were computed from the gathered data.24 the trunk angle refers to the angle, measured in degrees, between the trunk and the vertical plane passing through the center of mass of the body (see figure 1). the ratio is computed as follows : ratio = dvphdhph(1)where dvph and dhph are, respectively, the vertical and the horizontal movement duration. the total movement duration of the shoulder, during sts, corresponds to the time interval between the moment when the shoulder depth component (anterior posterior axis) exceeds 8.5% of its initial position, corresponding to the lift - off of the buttocks from the seat, and the moment when the head vertical component reaches or exceeds 94% of the size of the person (ie, when maximum hip, trunk, and knee extension and maximum head flexion velocity are reached). the thresholds were experimentally determined. in bts, it is defined as the time interval between the moment when the shoulder vertical component drops its peak value, and the moment when the vertical components of the hips reach their minimum values and the trunk angle reaches its limit. the tug duration, measured in seconds, means the total time taken to perform all tug tasks. it corresponds to the time interval between the moment when the forward phase starts and the moment when the backward phase ends. we verified the normality of the distributions (shapiro wilk test) and the homogeneity of the variances (levene s test). a one - way analysis of variance (anova) was performed with the factor group that included young and older adults. to quantify the difference between groups for discriminating parameters (that show group effect), we calculated the effect size by means of cohen s d parameter. cohen s d is defined as follows:25 d = xfxyspooled(2)where x is the mean (average of treatment or comparison conditions) and spooled represents the standard deviation of both groups and is given by : spooled=(nf1)sf2+(ny1)sy2nf+ny(3)where n and s represent the number of subjects and the standard deviation of each group, respectively. f and y correspond to fg and yg, respectively. to test the relationship between the parameters and the functional capacities, we applied multiple regression analysis in order to determine which of the ratio, trunk angle, and transfer duration parameters, during the sts and bts, have a greater link to the functional capacities, as assessed by the tug duration. data were obtained from ten healthy young subjects (young group [yg ], two females and eight males) aged 2130 years (mean age 26.62.95 years) and ten frail aged adults (frail group [fg ], six females and four males) aged 8395 years (mean age 87.94.2 years). fg was composed of patients who were following a functional rehabilitation program managed by only one physiotherapist. these patients were suffering from different pathologies, involving loss of functional independence such as chronic obstructive pulmonary disease (copd) (2), shoulder, hip (2), and thoracolumbar (3) deficiency (see table 1 for a description of these patients). they were included in this group according to the fried criteria of the frailty syndrome (unintentional weight loss, self - reported exhaustion, weakness, slow walking speed, and low physical activity).2 the elderly subjects were selected according to various inclusion and exclusion criteria. the inclusion criteria required subjects to be aged 65 years or more, capable of performing the sts and bts, maintaining standing, walking, and making u - turns without human assistance, and had cognitive and behavioral skills adapted to comply with instructions. the exclusion criterion for participation in this study was to have a diagnosis of cognitive impairments as evaluated by the mini subjects were seated on a chair with armrests (chair width : 47 cm, seating depth : 40 cm, backrest height : 38 cm, armrest height : 60 cm, and total chair height : 76 cm). their feet were placed flat, and their shanks were flexed (10 with respect to the vertical axis). the chair was placed at knee height and its backrest allowed the subjects to maintain their trunk in a vertical position. from this initial position, they were given verbal instructions to rise from the chair, walk 3 m, cross a mark on the floor, turn around, walk back, and sit down. kinematic trajectories during tug were recorded by means of a wearable system for real - time balance assessment in the aged subjects. the instrument used a kinect sensor that allowed us to detect the subjects tug movements. this sensor produces accurate results, especially for when tracking shoulder movements (segment lengths and angle estimation).23 the sensor can reach a frame rate of 30 images per second at a resolution of 640480 with 8 bits per channel. the field of view for the system is 58 horizontal, 45 vertical, 70 diagonal, and the operational range is between 0.8 m and 3.5 m. the kinect does not require any calibration. it was placed at a distance of 2.5 m from the chair with a tilt angle of 20. no markers or wearable sensors were attached to the body. seven spatiotemporal parameters were computed from the gathered data.24 the trunk angle refers to the angle, measured in degrees, between the trunk and the vertical plane passing through the center of mass of the body (see figure 1). the ratio is computed as follows : ratio = dvphdhph(1)where dvph and dhph are, respectively, the vertical and the horizontal movement duration. the total movement duration of the shoulder, during sts, corresponds to the time interval between the moment when the shoulder depth component (anterior posterior axis) exceeds 8.5% of its initial position, corresponding to the lift - off of the buttocks from the seat, and the moment when the head vertical component reaches or exceeds 94% of the size of the person (ie, when maximum hip, trunk, and knee extension and maximum head flexion velocity are reached). the thresholds were experimentally determined. in bts, it is defined as the time interval between the moment when the shoulder vertical component drops its peak value, and the moment when the vertical components of the hips reach their minimum values and the trunk angle reaches its limit. the tug duration, measured in seconds, means the total time taken to perform all tug tasks. it corresponds to the time interval between the moment when the forward phase starts and the moment when the backward phase ends. the trunk angle refers to the angle, measured in degrees, between the trunk and the vertical plane passing through the center of mass of the body (see figure 1). the ratio is computed as follows : ratio = dvphdhph(1)where dvph and dhph are, respectively, the vertical and the horizontal movement duration. the total movement duration of the shoulder, during sts, corresponds to the time interval between the moment when the shoulder depth component (anterior posterior axis) exceeds 8.5% of its initial position, corresponding to the lift - off of the buttocks from the seat, and the moment when the head vertical component reaches or exceeds 94% of the size of the person (ie, when maximum hip, trunk, and knee extension and maximum head flexion velocity are reached)., it is defined as the time interval between the moment when the shoulder vertical component drops its peak value, and the moment when the vertical components of the hips reach their minimum values and the trunk angle reaches its limit. the tug duration, measured in seconds, means the total time taken to perform all tug tasks. it corresponds to the time interval between the moment when the forward phase starts and the moment when the backward phase ends. we verified the normality of the distributions (shapiro wilk test) and the homogeneity of the variances (levene s test). a one - way analysis of variance (anova) was performed with the factor group that included young and older adults. to quantify the difference between groups for discriminating parameters (that show group effect), we calculated the effect size by means of cohen s d parameter. cohen s d is defined as follows:25 d = xfxyspooled(2)where x is the mean (average of treatment or comparison conditions) and spooled represents the standard deviation of both groups and is given by : spooled=(nf1)sf2+(ny1)sy2nf+ny(3)where n and s represent the number of subjects and the standard deviation of each group, respectively. f and y correspond to fg and yg, respectively. to test the relationship between the parameters and the functional capacities, we applied multiple regression analysis in order to determine which of the ratio, trunk angle, and transfer duration parameters, during the sts and bts, have a greater link to the functional capacities, as assessed by the tug duration. figure 2 illustrates the results of trunk angle and ratio during sts and bts for both fg and yg subjects. the average trunk angles during sts for fg and yg were 16.769.44 and 35.819.18, respectively. during bts, they were 19.0115.74 and 40.3310.23 for fg and yg, respectively. results from the one - way anova showed that there was a statistically significant difference between groups for the sts trunk angle [f(1,18)=23.12, p0.05 during both sts and bts). second, one may wonder if the kinematic changes we noted are in fact due to the biomechanical constraints linked to aging processes and sedentary behavior of frail patients (stiffness increases, impacting lumbopelvic mobility). however, we emphasize that all the subjects included in the fg were able to move in their houses independently, and to climb up several steps on a staircase. significant differences between fg and yg subjects were found in trunk angles and tug duration. in addition, the bts trunk angle and sts ratio could allow us to identify motor frailty. these results indicate that there was a relationship between various kinematic changes, representing changes in the motor planning processes, and physical frailty in older people. | objectivethe purpose of this work was to analyze and compare the movement kinematics of sit - to - stand (sts) and back - to - sit (bts) transfers between frail aged adults and young subjects, as well as to determine the relationship between kinematic changes and functional capacities.methodswe analyzed the timed up and go (tug) movements by using a 3d movement analysis system for real - time balance assessment in frail elderly. ten frail aged adults (frail group [fg ]) and ten young subjects (young group [yg ]) performed the tug. seven spatiotemporal parameters were extracted and compared between the two groups. moreover, these parameters were plotted with tug test duration.resultsthe experiments revealed that there were significant differences between fg and yg in trunk angle during both sts and bts, and in tug duration. the trunk angle of the young subjects was more than two times higher than that of the fg. as expected, the tug duration was higher in the fg than in yg. trunk angles during both transfers were the most different parameters between the groups. however, the bts trunk angle and sts ratio were more linked to functional capacities.conclusionthere was a relationship between kinematic changes, representing the motor planning strategies, and physical frailty in these aged adults. these changes should be taken into account in clinical practice. |
dry eye syndrome is a multifactorial disease of the tears and ocular surface that results in symptoms of discomfort, burning, itching, foreign body sensation, dryness, pain, photophobia, hyperemia, visual disturbance, and tear film instability, with potential damage to the ocular surface.1 a number of contributory factors affect the degree of dry eye syndrome, including autoimmune disease, environmental surroundings, contact lens use, hormonal changes, vitamin deficiencies, anatomical features, corneal dystrophies, chronic inflammation, infections, and iatrogenic factors, such as medications, radiation, and surgery.1,2 dry eye can be classified into five types, ie, aqueous - deficient, mucodeficient, lipodeficient, epitheliopathic, and eyelid - eye incongruent.3 the international dry eye workshop has classified dry eye etiology as either aqueous - deficient or evaporative.1 aqueous deficiency is further classified as sjogren - related or non - sjogren - related dry eye, and evaporative is divided into intrinsic causes, including meibomian oil deficiency or lid disorders, and extrinsic causes, such as vitamin a deficiency, contact lens wear, or topical preservatives. diagnosis of dry eye syndrome include subjective symptoms, as well as clinical signs, including punctate epithelial staining, tear film appearance and volume, tear film breakup time, tear film normalization test, and schirmer tear test.13 it has been found that dry eye patients have reduced tear meniscus dynamics and smaller meniscus volume.4 symptoms can be further classified by using one of a number of questionnaires, including the ocular surface disease index, a validated standardized instrument that measures disease severity and patient quality of life on a numerical scale in patients with dry eye syndrome. the severity of dry eye syndrome can range from very mild disease to extremely severe cases with vision - threatening consequences, such as ocular infections, perforations, endophthalmitis, and blindness. the severity of subjective symptoms does not necessarily correlate with the findings on clinical examination.5 dry eye symptoms are one of the most common complaints seen in clinical ophthalmology settings. population - based surveys have indicated that dry eye disease affects millions of people worldwide.6 a multitude of dry eye treatment modalities exist to address the different causes, symptoms, and consequences of ocular surface disease, including artificial tears, lubricating gels, anti - inflammatory or immunosuppressant drops, steroids, autologous serum or platelet - rich plasma drops, and punctal plugs. less common treatments include hormonal therapy, vitamin a, botulinum toxin, acupuncture, and antiviral agents.7 there are also surgical procedures to improve the quality of severe ocular surface disease, including repair of lid abnormalities, lid tarsorrhaphy, submandibular gland transplantation, and canalicular occlusion, which can include canalicular excision, punctal tarsorrhaphy, punctal patch, or punctal cautery, all of which preserve the natural tears, which to date are irreplaceable and remain better than artificial tears.8 studies have shown that after punctal occlusion, patients have symptomatic improvement, as well as improvement in clinical signs of dry eye, tear film stability, and ocular surface retention.810 hydroxypropyl cellulose ophthalmic inserts are another treatment available for moderate - to - severe dry eye syndrome. the chemical name for hydroxypropyl cellulose is cellulose, 2-hydroxypropyl ether. it is a tasteless, odorless, and physiologically inert substance, and is soluble in water below 38c. the ophthalmic inserts are sterile and translucent rods measuring 1.27 mm in diameter and 3.5 mm long. each insert contains 5 mg of hydroxypropyl cellulose, with no preservatives or any other ingredients. the medication is administered by placing a single insert into the inferior cul de sac of the eye beneath the base of the tarsus, not in opposition to the cornea, nor beneath the eyelid at the level of the tarsal plate.11 hydroxypropyl cellulose ophthalmic inserts act by stabilizing and thickening the tear film and prolonging tear film breakup time, as well as lubricating and protecting the eye. the inserts are indicated especially for patients who continue to have dry eye symptoms after an adequate trial of therapy with artificial tears.11 they are also indicated for patients with keratoconjunctivitis sicca, exposure keratitis, decreased corneal sensitivity, and recurrent corneal erosions.11 the only contraindication to using this medication is hypersensitivity to hydroxypropyl cellulose.11 several studies have been performed to evaluate the efficacy of hydroxypropyl cellulose ophthalmic inserts. in one study, 418 patients were evaluated with questionnaires after four weeks of treatment on hydroxypropyl cellulose ophthalmic inserts.12 the patient questionnaires were completed prior to initiation of treatment, and again after four weeks of treatment to assess the difference in severity of symptoms, ability to perform activities of daily living, quality of life, and frequency of discomfort in various environmental conditions. all participating patients were required to have a diagnosis of dry eye syndrome in both eyes, and a history of intermittent or regular artificial tear use. the patients were subdivided into patients without comorbid conditions and five groups of patients with comorbid conditions, including contact lens wearers, patients with cataracts, patients with glaucoma, patients who have undergone cataract surgery, and patients who have undergone prior laser - assisted in situ keratomileusis. patients were excluded if they have clinically significant blepharitis, meibomian gland dysfunction, lid margin or ocular inflammation, ocular infection, laser keratorefractive surgery within 12 months, or any other ocular surgery within three months. the patients were prohibited from starting any new dry eye therapy that they were not previously using throughout the trial. the results of the study demonstrated that both patients with and without comorbidities had statistically significant improvements in symptoms of discomfort, burning, dryness, grittiness, stinging, and light sensitivity, as well as improvements in ability to perform activities of daily living and in quality of life. the three groups that showed the most improvement occurred in contact lens wearers, patients with prior cataract surgery, and patients with prior laser - assisted in situ keratomileusis. although patients with only glaucoma or cataracts did not show as much improvement as the three previously mentioned groups, they still showed a statistically significant improvement. a prospective study was published in which enrolled patients diagnosed with bilateral dry eye and a history of artificial tear use completed questionnaires at two visits, ie, at the beginning and at the end of a four - week registry.13 most of the patients were women and over the age of 50 years, and age did correlate with a difference in response. there was more than 25% improvement in severity of discomfort, burning, dryness, grittiness, stinging, and sensitivity to light. fifty - eight percent of the patients noted a statistically significant improvement in at least one symptom of the ocular surface disease index. another study revealed similar findings, in which mean ocular surface disease index total scores improved by 21.3%.14 the study reported fairly good compliance, and the main adverse event that led to discontinuation was blurred vision. a retrospective case series study was performed to determine whether patients experienced improvement in dry eye symptoms after use of hydroxypropyl cellulose ophthalmic inserts.15 data from the study were obtained from medical records of patients who has been given a prescription for hydroxypropyl cellulose ophthalmic inserts within two years prior to the study. this included patients who were newly started on the inserts, as well as patients who were already being treated with the inserts prior to the two years. of the 80 participating patients, 73 were still currently using the insert, and most were using the inserts at least once a day (93.2%). some of the patients were using concomitant dry eye therapies, including topical antibiotics, artificial tears, and immunomodulators. the study reported a very low rate of adverse effects, which included blurred vision and foreign body sensation, and was only 2.5%. the median duration of therapy with the insert was 5.3 years, and almost two - thirds of the patients continued to use the insert for more than two years. the long duration of use suggests that the medication is relatively safe, well tolerated, effective for long - term therapy, and successful in patients over the age of 60 years. a more recent study evaluated whether subjective patient - reported improvement in symptoms after treatment with hydroxypropyl cellulose ophthalmic inserts correlated with physician assessment of clinical signs.16 the study reported that over 75% of patients had an overall improvement in their symptoms after being treated for one month with hydroxypropyl cellulose ophthalmic inserts. it also reported that patient - reported improvements strongly correlated with and significantly predicted physician assessment of the condition, effectiveness of therapy, and willingness to use the inserts as adjunctive therapy. a crossover study was performed in 22 patients with rheumatoid arthritis and moderate - to - severe keratoconjunctivits sicca, who were treated with slow - release artificial tear inserts.17 half of the participants used one insert daily, and the other group used methylcellulose artificial tears four times a day. after two weeks, the participants were evaluated for subjective symptomatic changes and clinical staining. the groups were then switched to the opposite treatment and reassessed after a further two weeks. the study reported that 86% of the patients approved of the insert as therapy, and 64% of the patients preferred the inserts to the artificial tears. these results are similar to those of another study reporting that 75% of their patients with keratitis sicca preferred the slow - release artificial tear inserts as the main form of treatment.18 despite having varying degrees of hand deformities and loss of dexterity because of rheumatoid arthritis, most patients reported no difficulty with insertion of the medication. although rheumatoid arthritis is not a contraindication to use of hydroxypropyl cellulose ophthalmic inserts, there are some drawbacks to the medication. possible side effects were reported in approximately 2.5% of patients, and these side effects included blurring of vision, foreign body sensation, ocular irritation or hyperemia, hypersensitivity, photophobia, eyelid edema, and caking or drying of viscous material on eyelashes.12,15 one study reported a corneal abrasion, but this was reportedly unrelated to ophthalmic insert usage.12 there are no reports of worsening of vision or dry eye symptoms, and most reported side effects have been mild and had no long - term or permanent adverse outcomes. it has been reported that irregularities in the tear film can cause optical aberrations, fundus image degradation, decrease in contrast sensitivity, neural sharpness, and retinal vessel contrast.19,20 it has been observed that, as time increases after a blink, wavefront contours become more irregular and numerous, reflecting an increase in corneal wavefront aberrations, leading to perceptible degradation in vision.21,22 the effect of improving the tear film may be used as a diagnostic tool in detecting ocular surface disease in symptomatic and asymptomatic patients.23 while dry eye patients have blurred vision due to irregular corneal surface, the cause of blurred vision after insert application is most likely due to the viscous nature of the medication, not an insufficient tear film. in addition, although blurred vision was one of the most common side effects, most patients reported significant improvements in their ability to perform daily activities and visual tasks, particularly activities such as reading, watching television, working on the computer, and driving at night.12 this suggests that the blurred vision was not severe or visually impairing, and did not reduce quality of life. blurred vision was also transient, and there were no reported cases of long - term decrease in vision. in conclusion, there are various treatment modalities for dry eye syndrome available to eye care professionals, which can be used as monotherapy or in combination. there is evidence to suggest that with proper use and adequate patient education, hydroxypropyl cellulose ophthalmic inserts are an effective and safe treatment choice for dry eye syndrome. most patients showed significant improvement in ocular symptoms and clinical signs, and many patients continued using hydroxypropyl cellulose ophthalmic inserts for several years alone or in conjunction with other dry eye therapies. there was no significant worsening in symptoms or any major long - term side effects of the medication. the inserts may be particularly helpful in patients who can not tolerate preservatives or immunosuppressant drops, do not want to instill multiple artificial tears throughout the day, or still have an insufficient tear film despite other therapies. however, it is worth noting that several of the studies excluded patients with meibomian gland disease or blepharitis. it remains to be seen if the inserts help patients with evaporative aqueous tear loss due to meibomian gland dysfunction or blepharitis. one would think that both of these disease groups would benefit from using the inserts because there is often overlap of patients who also have dry eye syndrome. nonetheless, hydroxypropyl cellulose ophthalmic inserts can be used effectively as monotherapy, or in conjunction with other therapies, and should be considered in the treatment of dry eye syndrome. | dry eye syndrome is a prevalent disease that affects visual acuity, activities of daily living, and quality of life. a number of contributory factors affect the severity of dry eye syndrome, including autoimmune disease, environmental surroundings, contact lens use, hormonal changes, anatomical features, chronic inflammation, infections, and iatrogenic factors, such as medications or surgery. symptoms may include intermittent or constant blurry vision, discomfort, burning, foreign body sensation, hyperemia, dryness, and photophobia. the severity of dry eye syndrome can range from very mild disease to extremely severe cases with vision - threatening consequences. a variety of dry eye treatment modalities exist to address the different causes, symptoms, and consequences of ocular surface disease, including artificial tears, lubricating gels, ophthalmic inserts, anti - inflammatory drops, and surgical procedures. in this paper, an assortment of literature pertaining to the treatment of dry eye syndrome, in particular hydroxypropyl cellulose ophthalmic inserts, is reviewed. these inserts can be used effectively as monotherapy, or in conjunction with other therapies, and should be considered in the treatment of dry eye syndrome. |
intestines play a major role in maintaining our health. beyond nutrient and liquid absorption, the intestines serve as a barrier between us, our intestinal microbiome, and foreign organisms / toxins. it is therefore expected that significant morbidity and mortality result from intestinal disorders like those associated with abnormal immune function (e.g., inflammatory bowel disease) and infectious diseases (e.g., various foodborne illnesses) [1, 2 ]. hiv-1 is an infectious disease that has a major negative impact on the intestines. viral infiltration and replication in early hiv-1 infection result in rapid and profound intestinal cd4 t cell depletion [310 ] the preferential loss of intestinal t helper 17 (th17) cells in hiv disease is a driver of the damage within the mucosal barrier and this damage is not reversed during antiretroviral therapy (art). a key effector molecule produced by th17 cells (as well as t cells and a subset of innate lymphoid cells) is il-17a. il-17a is a multifunctional cytokine with proinflammatory properties (e.g., neutrophil recruitment) along with a role in orchestrating mucosal barrier functions [1315 ]. given the pathogenesis of hiv-1 in the intestines, understanding the effects of new therapeutic strategies within this organ is a priority. recently, we conducted a single - arm, phase i / ii clinical trial designed to evaluate the therapeutic effect of the hdac inhibitor panobinostat on hiv-1 persistence despite successful art. panobinostat is a potent hydroxamic acid hdac inhibitor with inhibitory effects in the low nanomolar range against class i hdac. it was approved in 2015 by the us food and drug administration for the treatment of multiple myeloma. hdac inhibitors, like panobinostat, are actively under investigation as potential latency reversing agents because hiv-1 proviruses that are integrated into deacetylated, condensed chromatin lead to virus recrudescence when art is interrupted. accordingly, hdac inhibitors have been extensively studied in vitro [1820 ] and in vivo [16, 2123 ] for their latency reversing potential and the results have been very promising. furthermore, many hdac inhibitors have robust anti - inflammatory properties. these effects were observed in our trial cohort where panobinostat treatment was associated with reduced levels of peripheral blood (pb) inflammatory biomarkers (e.g., high - sensitivity c - reactive protein, interleukin-6, matrix metalloproteinase 9, e - selectin, and soluble cd40 ligand) as well as reduced expression of genes related to inflammation. because of the importance of understanding the varied intestinal effects of hdac inhibitors as hiv-1 therapeutics, the study design included the collection of intestinal biopsies from consenting participants. these paired biopsies are the source material for this study to quantitate the biological impact of panobinostat in the intestines of individuals during suppressive art. between september 2012 and february 2014 we conducted an investigator - initiated, single - arm, phase i / ii clinical trial as previously described (clinicaltrials.gov i d number nct01680094). in accordance with the principles of the helsinki declaration, the regional ethics committee for region midtjylland and the danish data protection agency approved the study design prior to patient enrollment and each patient provided written informed consent before any study procedures. these individuals exhibited virological suppression (95%). however, the total cell yields from these four isolations were low and therefore cd4 t cell enrichment was not performed with biopsies from the remaining five patients (identified as,,,, and in figures). to compare anatomical compartments, pb cd4 t cells collected on the nearest date to the time of biopsy isolated lpmcs, lp cd4 t cells, and pb cd4 t cells to be used for nucleic acid quantification were lysed in rlt plus buffer immediately following isolation and the lysates were stored at 80c until dna was extracted (allprep isolation kit, qiagen # 80204). just prior to extraction, the lysates were subjected to shredding (qiashredder, qiagen # 79656) and then nucleic acids were extracted according to manufacturer 's instructions with each nucleic acid sample being eluted with three repeated applications of the same 50 l elution buffer aliquot to their respective columns. hiv-1 dna was quantified in samples obtained from both the intestinal biopsies and pb cells at baseline and on panobinostat essentially as described [26, 27 ]. briefly, extracted dna was used directly for hiv-1 dna quantifications using the qx100 droplet digital pcr system (biorad) (~100 ng total dna per pcr replicate) to determine the absolute levels of total hiv-1 dna per 10 lpmcs, lp cd4 t cells, or pb cd4 t cells. the pcr reaction mixture was loaded into the biorad qx100 emulsification device fractionating each sample into ~20,000 nanoliter - sized droplets according to the manufacturer 's instructions. after cycling, droplet data were collected using qx100 droplet reader (biorad) and then analyzed with the quantasoft analysis software (biorad). no panobinostat - associated cohort - wide changes in hiv-1 dna levels were observed in intestinal cells (p = 0.91) (similar to) or in time - matched pb cd4 t cells (p = 0.57) (consistent with our previous report). briefly, within one hour of the isolation, cells were incubated with heat - inactivated mouse serum (invitrogen, cat. number 10410) for 10 min and then stained with cd3 percp (bd biosciences, cat. number 310910), and hla - dr apc - cy7 (biolegend, cat. following staining, the cells were fixed in 250 l pbs containing 1% formaldehyde. briefly, freshly isolated cells were incubated unstimulated overnight at 37c in flat - bottomed wells (nunc, denmark, cat. number 140675) at a concentration of 2 10 lpmcs / ml in 2 ml of culture medium (rpmi 1640 with 10% pooled heat - inactivated human ab serum, 100 u / ml penicillin, and 100 g / ml streptomycin). following this incubation, the cells were stimulated for 4 hours at 37c with 1 g / ml ionomycin (sigma - aldrich, denmark, cat. number i0634) and 50 g / ml phorbol-12-myristate-13-acetate (pma) (sigma - aldrich, denmark, cat. number p1585) in the presence of 10 g / ml brefeldin a (sigma - aldrich, denmark, cat. next, cells were incubated with antibodies to detect surface expression of cd3 fitc (bd biosciences, cat. following surface staining, the cells were fixed with 1.5 ml bd facs lysing solution (bd biosciences, cat. number 349202) and then the cells were permeabilized with 0.5 ml facs permeabilizing solution 2 (bd biosciences, cat. number 340973). following intracellular staining, the cells were fixed in 250 l pbs containing 1% formaldehyde. for all samples, data were collected using a facscanto analyzer (bd biosciences) within 24 hours of staining. a total of 10 events in the forward - side scatter lymphocyte gate were recorded. single cells (according to forward - scatter - height and forward - scatter - area) were gated for cd3 expression. cd3 cells were next gated for cd4, cd8, or cd8, as indicated in the figures. the cell populations were then assessed for expression of cellular activation markers and intracellular cytokines. gates for cd69-, hla - dr-, ifn--, and il-17a - positive events were based upon isotype or fluorescence - minus - one controls. data from each patient from both time points were batch analyzed using flowjo v.10 (treestar). in situ hybridization for ifn-, il-1, il-8, and il-17a mrna as well as for hiv-1 rna was performed in formalin - fixed paraffin - embedded (ffpe) tissues using the rnascope 2.0 red assay (cat. number 310036) according to the manufacturer 's instructions (advanced cell diagnostics, inc., first, 4 m sections were cut from ffpe blocks and mounted on superfrost plus microscope slides. consecutive sections were mounted and a minimum separation distance of 12 m was ensured for the sections hybridized with a given probe (2 sections per probe). mounted sections were deparaffinized in xylene, dehydrated in 100% ethanol, and then treated serially with acd pretreatment 1 (endogenous hydrogen peroxidase block) for 10 minutes at room temperature ; acd pretreatment 2 (boiling in citrate buffer) for 812 minutes at 98100c ; and acd pretreatment 3 (protease digestion) for 1230 minutes at 40c. note that pretreatment 2 and 3 conditions for each paraffin block were optimized to maximize the signal - to - noise ratio using positive (hs - ppib cat. next, hybridization between the target rna and the selected acd probe set (hs - il-17a cat. number 416111) took place at 40c during a 2-hour incubation in a hybez oven (advanced cell diagnostics, hayward, ca). two 2 min washes with acd wash buffer were followed by signal amplification via the serial application of amplifications 16 with two 2 min wash buffer washes after each step. chromogenic detection of the target rna was performed using fast red (10 min) followed by counterstaining with hematoxylin and mounting with ecomount. all of the sections were blinded before quantification and all counts were performed by the same individual via visual inspection with compound light microscopy with a robotic stage that randomly selected areas for quantification (visiopharm newcast, version 5.0.3.1247). in a minimum of 35 systematic random selected, nonoverlaying 25.600 m (160 m 160 m) counting frames the number of positive cell profiles was counted. test points were used to determine the area of examined tissue and the nature of the tissues within the counting frame (e.g., epithelial region, lamina propria) was recorded to allow for stratification of the data by anatomical region. in accordance with a recommendation from acd, a cell profile was defined as rna positive if it had at least one red spot visible at 20x magnification. after all sections were counted, 25 sections that covered all probe sets were assigned for recount prior to unblinding of the individual performing the quantification. these two count values for the same section (c1 and c2) were first plotted in a c1/c2 plot and a linear regression was performed (r = 0.36). next, the c1 and c2 values were compared using an unpaired t - test (p = 0.31). finally, a bland - altman plot was generated using the average of the two counts versus the difference between the two counts (bias = 19.1 ; sd = 59.5). together these values demonstrate that consistency in performing the quantification was maintained throughout the entire counting process. note that the area measurements reported will not be the same as the true parameters present in vivo given that paraffin embedding and preparation caused an unavoidable, 3050% shrinkage of tissue [29, 30 ]. one goal in this project was to quantify the number of cell profiles exhibiting productive hiv-1 infection via ish in the intestinal tissues collected from these patients. unfortunately, the low number of cell profiles with productive infection identified in the examined tissue sections precluded drawing conclusions regarding the ability of panobinostat treatment to induce viral rna production in the intestines. wilcoxon matched - pairs signed rank tests were utilized to assess whether there was a significant difference between the baseline and on - treatment measures. given our previous findings regarding the general anti - inflammatory activity of panobinostat in blood obtained from these patients [25, 31 ], we examined the activation status of freshly isolated lpmcs at baseline and during panobinostat treatment for surface expression of early (i.e., cd69) and late (i.e., hla - dr) t cell activation molecules. we observed a decrease in the proportion of cd69 intestinal cd4 and cd8 t cells (p = 0.004, figure 2(a) ; p = 0.020, figure 2(c), resp.). although we were unable to definitely determine whether this change resulted from decreased activation of resident cells versus an influx of naive cells, we did observe a significant decrease in the expression levels of cd69 on the intestinal cd4 t cells (p = 0.008, figure 2(b)) and a trend towards reduced cd69 expression on intestinal cd8 t cells (p = 0.055, figure 2(d)). in contrast to our findings regarding cd69 expression on intestinal t cells, we did not observe changes with panobinostat dosing in the proportions of hla - dr expressing intestinal t cells or in the expression levels of hla - dr on intestinal t cells (figures 2(e) and 2(f)). it should be noted that these results from intestinal cells differ from pb outcomes from these patients. notable distinctions are that the baseline proportion of cd69 t cells in the intestines is considerably higher than in the pb, as expected, and that the greatest increase in the proportion of activated cd4 t cells was observed in pb during the first dosing week, while the observations made in the intestines are from the last dosing week. thus, the differences between the observations in the intestines and pb regarding t cell activation may reflect differential stimulatory environments between these two anatomical compartments and the differential in the timing of the observations relative to the course of panobinostat treatment. next, we performed an ex vivo mitogenic stimulation of lpmcs that were rested overnight following isolation. we examined cd8 and cd8 t cells for intracellular expression of two proinflammatory cytokines (i.e., ifn- and il-17a). we did not observe changes in the proportions of ifn--producing intestinal t cells (figures 3(a) and 3(c)). however, we did observe decreases in the expression levels of ifn- in both intestinal cd8 and cd8 t cells (p = 0.016, figure 3(b) ; p = 0.031, figure 3(d), resp.). overexpression of ifn- and other type 1 interferons in t lymphocytes has been observed both in experimental animal models of colitis and in patients with ulcerative colitis. thus, the detected reduction in ifn- expression could reflect a general pleiotropic anti - inflammatory effect of panobinostat on lamina propria - resident t lymphocytes. this reduction in expression does not readily conform to our observation that panobinostat treatment generally did not affect ifn- secretion by pb cd8 t cell memory subsets from this patient cohort. however, direct comparisons between these pb and intestinal cell analyses are challenging. the main reasons are the difference in timing of sample selection as noted above and the fact that the ex vivo stimulations were performed with staphylococcal enterotoxin b (seb) antigen for the pb cells and pma / ionomycin for the intestinal cells. il-17a production was not examined in the pb cells, but it was characterized for the intestinal cd8 t cells in response to mitogen stimulation. in this analysis, we did not observe cohort - wide changes in the proportion of cells expressing il-17a or in the per cell expression (p = 0.22, figure 3(e) ; p = 0.94, figure 3(f), resp.). in accordance with the anticipated anti - inflammatory activity of panobinostat, these analyses demonstrate that panobinostat dosing generally reduced expression of the activation marker cd69 on intestinal t cells and reduced the capacity of intestinal t cells to produce ifn- in response to ex vivo stimulation. to gain insights into changes in the numbers of individual cells producing cytokine mrna in the intestine during panobinostat therapy, we performed quantitative rna in situ hybridization using limited amounts of biopsy material with the assumptions that these tissue samples were representative for the whole intestine and that two - dimensional profile counts correlate with total cell counts. analyses were stratified according to the anatomical region harboring the rna expressing cells (i.e., lamina propria and epithelial regions). we found that panobinostat treatment was associated with a significant increase in the number of cell profiles (p = 0.04) exhibiting il-17a production within the epithelial region but not the lamina propria (p = 0.13) (figures 4, 5(a), and 5(b)). in contrast, we did not observe cohort - wide differences in the number of cell profiles exhibiting inf-, il-8, or il1 production in either the lamina propria or the epithelial regions of the intestine (figures 5(c)5(h)). the results for intracellular and in situ il-17a expression (figures 3(e), 3(f), 4, 5(a), and 5(b)) may appear to be contradictory at first glance. the likely explanation is that these observations highlight key methodological differences in the two assays. the in situ hybridization technique allowed quantitation throughout both the lamina propria and epithelial regions. using this method and taking the stated assumptions into account, we were able to determine that the epithelial regions were the anatomical location of the increased il-17a expression (figure 5(b)). il-17a expression in the intestines is frequently associated with inflammatory processes, such as in inflammatory bowel disease [15, 3741 ]. however, il-17a also induces robust production of antimicrobial peptides important for maintaining the intestinal epithelial barrier. il-17a is produced by intestinal innate lymphoid cells to orchestrate mucosal barrier function, exhibits anti - inflammatory behavior in the context of cultured human colonic epithelial cells, and ameliorates inflammation in rodent colitis models [43, 44 ]. thus the data presented here lead us to hypothesize that the panobinostat - induced upregulation in il-17a mrna observed in the intestinal epithelium is associated with mucosal barrier restoration. such activity would be consistent with the general anti - inflammatory activity of panobinostat in these same patients, reduced lpmc t cell activation (figures 2(a)2(d)), reduced levels of ifn- production following ex vivo stimulation (figures 3(a)3(d)), and the unchanged intestinal ifn-, il-8, and il1 mrna levels (figures 5(c)5(h)). future studies are necessary to confirm that the panobinostat - induced il-17a expression in the intestinal epithelium is indicative of mucosal barrier restoration and a reduction of chronic immune activation in hiv patients during suppressive art. with such confirmation, perhaps panobinostat (or similarly acting compounds) it is essential that conclusions are cautiously drawn from these data as they are derived from a single - arm phase i / ii clinical study with increased peripheral blood cell - associated unspliced - hiv-1 rna during panobinostat treatment as the primary endpoint. panobinostat has a clear biological impact in the intestines of hiv-1 patients as shown by the decreased cd69 intestinal t cell frequency and increased il-17a expression in the intestinal epithelium associated with panobinostat treatment. the significance of this last finding could be profound if future studies confirm that panobinostat dosing leads to improved mucosal barrier function in the intestines of hiv patients during suppressive art. | intestinal cd4 + t cell depletion is rapid and profound during early hiv-1 infection. this leads to a compromised mucosal barrier that prompts chronic systemic inflammation. the preferential loss of intestinal t helper 17 (th17) cells in hiv-1 disease is a driver of the damage within the mucosal barrier and of disease progression. thus, understanding the effects of new therapeutic strategies in the intestines has high priority. histone deacetylase (hdac) inhibitors (e.g., panobinostat) are actively under investigation as potential latency reversing agents in hiv eradication studies. these drugs have broad effects that go beyond reactivating virus, including modulation of immune pathways. we examined colonic biopsies from art suppressed hiv-1 infected individuals (clinicaltrials.gov : nct01680094) for the effects of panobinostat on intestinal t cell activation and on inflammatory cytokine production. we compared biopsy samples that were collected before and during oral panobinostat treatment and observed that panobinostat had a clear biological impact in this anatomical compartment. specifically, we observed a decrease in cd69 + intestinal lamina propria t cell frequency and increased il-17a mrna expression in the intestinal epithelium. these results suggest that panobinostat therapy may influence the restoration of mucosal barrier function in these patients. |
bacteria of the genus proteus are gram - negative rods belonging to the family enterobacteriaceae (1). proteus spp. currently include four named species : proteus mirabilis, p. vulgaris, p. hauseri, and p. penneri, all of which are pathogenic for humans (1). a characteristic feature of proteus spp. rods is the presence of cilia, which increases their virulence, the phenomenon of swarming growth, and the ability to produce urease (2). bacteria mainly are found in water, soil, and natural fertilizers, as well as in food products. these microorganisms also may be present in humans and animals, mainly in the gastrointestinal tract (2). urinary tract infections (uti) are one of the most common infectious diseases, especially in a hospital environment (3). one of the consequences of uti caused by proteus spp. may be the formation of kidney stones (2). the microorganisms of the genus proteus also can cause skin and subcutaneous tissue infections as well as infections arising in the case of hernia plastic surgery or acute otitis media, and the microorganisms of the genus p. mirabilis can cause purulent meningitis in newborns (2, 4, 5). proteus mirabilis and p. vulgaris rods have a number of virulence factors, for example, lipopolysaccharide (lps), flagella, fimbriae, glycocalyx, and the phenomenon of adhesion and hydrophobicity of bacteria surface (2). an important adaptation of the bacteria proteus spp., to cause infections in the urinary system, is the ability to form a biofilm. a biofilm is a formation of communicating microorganisms that adhere to certain surfaces and to neighboring cells and are covered with an extracellural matrix (6). the structure of a biofilm provides protection for bacterial cells against adverse environmental factors, including trade disinfectants and antibiotics (7). the aim of this study was to assess the degree of a biofilm formation by strains of p. mirabilis and p. vulgaris and to determine the effect of ciprofloxacin on planktonic cells and on biofilm of studied microorganisms. the material for this study consisted of 20 strains of p. mirabilis and 20 strains of p. vulgaris from the collection of the department of microbiology of the ludwik rydygier medical college in bydgoszcz, poland, nicolaus copernicus university. the strains were isolated from patients treated in the clinics of the antoni jurasz university hospital in bydgoszcz in 2010 - 2014. most strains (28 ; 70.0%) were isolated from patients of the department of general surgery and endocrinology (figure 1). in the case of p. mirabilis and p. vulgaris, 25.0% (n = 5) were from urine and 75.0% (n = 15) from a wound swab. the strains were examined by the disk diffusion method to piperacillin, amoxicillin with clavulonic acid, piperacillin with tazobactam, cefotaxime, ceftazidime, cefepime, imipenem, amikacin, ciprofloxacin, norfloxacin, and trimethoprim - sulfamethoxazole (emapol). the results were interpreted according to the european committee on antimicrobial susceptibility testing (eucast) recommendation (8). in order to determine the minimal inhibition concentration (mic) of the tested bacteria, the microdilution method in a microtiter plate was used in accordance with the recommendations of the clinical and laboratory standards institute (clsi) (9). the growth of bacteria in the presence of ciprofloxacin at concentrations ranging from 0.01 - 128.0 g / ml was evaluated in the studies. the mic value was read visually by the presence of turbidity of the suspension in the wells of microtiter plates at a given concentration of antibiotic. the results were interpreted on the basis of recommendations introduced by the eucast (8). the limit for the minimum inhibitory concentration of ciprofloxacin is 0.5 g / ml for susceptible strains. for intermediately susceptible microorganisms, mic breakpoints fall within the range of 0.5 - 1.0 g / ml. in the case of strains that have resistance to ciprofloxacin, the limit of mic is > 1 g / ml. mic50 and mic90 values were calculated on the basis of the obtained values of mic. to be more precise, the values include ciprofloxacin concentration, at which the growth of 50% and 90% of strains was inhibited. a biofilm formation by the strains of p. mirabilis and p. vulgaris was evaluated based on the method described previously (10) using a 0.1% ttc (2, 3, 5-triphenyl - tetrazolium chloride solution, avantortm) with modifications. after a 24-hour incubation, the planktonic, nonadsorbed cells were removed from the wells of the microtiter plates. 100 l of tryptic soy medium (tsb, becton dickinson) and 100 l of sterile 0.1% ttc solution were added to each cell and incubated. after two hours, the contents of the wells were removed and washed again with distilled water. an absorbance measurement was made using a bio - tek spectrophotometer at a wavelength of 470 nm. the results were interpreted in accordance with the criteria described in the previous publication (10). the obtained results were compared by the mann - whitney u test, with differences at p 0.05 considered as statistically significant using the statsoft inc. the study evaluated the influence of ciprofloxacin on the 24-hour biofilm of p. mirabilis and p. vulgaris by the microdilution method in microtiter plates in accordance with the methodology described in the work of kwiecinska - pirog. (10). as part of the experiment, the minimum biofilm eradication (mbe) values of mbe50 and mbe90 were rated. those values denote the concentration of antibiotic that leads to an inhibition of biofilm formation by p. vulgaris and p. mirabilis, respectively, 50.0% and 90.0% of the tested strains. the reduction of the biofilm was determined by a calculation that uses the absorbance values of the tested strains. the absorbance values of the positive control sample and the average value of the results of the absorbance of the tested strains were used for calculation. the degree of reduction was calculated using the following equation : x, absorbance value of positive control ; y, absorbance value of the examined strain. the material for this study consisted of 20 strains of p. mirabilis and 20 strains of p. vulgaris from the collection of the department of microbiology of the ludwik rydygier medical college in bydgoszcz, poland, nicolaus copernicus university. the strains were isolated from patients treated in the clinics of the antoni jurasz university hospital in bydgoszcz in 2010 - 2014. most strains (28 ; 70.0%) were isolated from patients of the department of general surgery and endocrinology (figure 1). in the case of p. mirabilis and p. vulgaris, 25.0% (n = 5) were from urine and 75.0% (n = 15) from a wound swab. the strains were examined by the disk diffusion method to piperacillin, amoxicillin with clavulonic acid, piperacillin with tazobactam, cefotaxime, ceftazidime, cefepime, imipenem, amikacin, ciprofloxacin, norfloxacin, and trimethoprim - sulfamethoxazole (emapol). the results were interpreted according to the european committee on antimicrobial susceptibility testing (eucast) recommendation (8). in order to determine the minimal inhibition concentration (mic) of the tested bacteria, the microdilution method in a microtiter plate was used in accordance with the recommendations of the clinical and laboratory standards institute (clsi) (9). the growth of bacteria in the presence of ciprofloxacin at concentrations ranging from 0.01 - 128.0 g / ml was evaluated in the studies. the mic value was read visually by the presence of turbidity of the suspension in the wells of microtiter plates at a given concentration of antibiotic. the results were interpreted on the basis of recommendations introduced by the eucast (8). the limit for the minimum inhibitory concentration of ciprofloxacin is 0.5 g / ml for susceptible strains. for intermediately susceptible microorganisms, mic breakpoints fall within the range of 0.5 - 1.0 g / ml. in the case of strains that have resistance to ciprofloxacin, the limit of mic is > 1 g / ml. mic50 and mic90 values were calculated on the basis of the obtained values of mic. to be more precise, the values include ciprofloxacin concentration, at which the growth of 50% and 90% of strains was inhibited. a biofilm formation by the strains of p. mirabilis and p. vulgaris was evaluated based on the method described previously (10) using a 0.1% ttc (2, 3, 5-triphenyl - tetrazolium chloride solution, avantortm) with modifications. after a 24-hour incubation, the planktonic, nonadsorbed cells were removed from the wells of the microtiter plates. 100 l of tryptic soy medium (tsb, becton dickinson) and 100 l of sterile 0.1% ttc solution were added to each cell and incubated. after two hours, the contents of the wells were removed and washed again with distilled water. an absorbance measurement was made using a bio - tek spectrophotometer at a wavelength of 470 nm. the results were interpreted in accordance with the criteria described in the previous publication (10). the obtained results were compared by the mann - whitney u test, with differences at p 0.05 considered as statistically significant using the statsoft inc. the study evaluated the influence of ciprofloxacin on the 24-hour biofilm of p. mirabilis and p. vulgaris by the microdilution method in microtiter plates in accordance with the methodology described in the work of kwiecinska - pirog. (10). as part of the experiment, the minimum biofilm eradication (mbe) values of mbe50 and mbe90 were rated. those values denote the concentration of antibiotic that leads to an inhibition of biofilm formation by p. vulgaris and p. mirabilis, respectively, 50.0% and 90.0% of the tested strains. the reduction of the biofilm was determined by a calculation that uses the absorbance values of the tested strains. the absorbance values of the positive control sample and the average value of the results of the absorbance of the tested strains were used for calculation. the degree of reduction was calculated using the following equation : x, absorbance value of positive control ; y, absorbance value of the examined strain. all examined strains were susceptible to piperacillin with tazobactam, cephalosporines, imipenem, ciprofloxacin, and norfloxacin. strains (12.5%) were resistant to amoxicillin with clavulonic acid (4, 20.0% of p. mirabilis, and 1, 5.0% of p. vulgaris). five strains of p. mirabilis (25.0%) and one of p. vulgaris (5.0%) were resistant to trimethoprim - sulfamethoxazole. the mic90 value of ciprofloxacin in the case of strains of p. mirabilis and p. vulgaris isolated from a wound swab was 0.5 g / ml. the value of the isolates from the urine was equal to 1.0 g / ml and 0.25g / ml, respectively, for p. mirabilis and p. vulgaris (table 2). all tested strains of p. mirabilis and p. vulgaris were susceptible to ciprofloxacin. however, among the 20 strains of p. mirabilis three (15.0%) were classified as the intermediate group. the mic values of ciprofloxacin for planktonic bacteria cells of both tested species are presented in table 1. the mic50 ciprofloxacin values for planktonic cells of p. mirabilis and p. vulgaris strains were 0.06 g / ml for both isolates from the wound swabs and those from urine (table 2). the absorbance value measured for the strains of p. mirabilis was in the range of 0.656 - 2.319, while p. vulgaris was within the range of 0.708 - 1.800. according to the criteria (10), none of the strains formed a biofilm in a weak degree. in the case of two tested species, most strains formed a biofilm of medium intensity 12 (60.0%) isolates of p. mirabilis and 11 (55.0%) of p. vulgaris. strong biofilm formation was observed for eight (40.0%) strains of p. mirabilis and nine strains (45.0%) of p. vulgaris (table 3). the mbe50 value of ciprofloxacin was 1.0 g / ml for the strains of both examined species (table 4). the mbe90 value of ciprofloxacin for isolates of p. vulgaris was 64 g / mll, and 512 g / ml for p. mirabilis strains (table 2). the mbe90 value was 512 and 128 times higher than mic90, respectively, for p. mirabilis and for p. vulgaris. mbe90 and mbe50 values of ciprofloxacin, depending on clinical material as well as the tested species, are presented in table 2. no statistically significant difference was observed in resistance of the biofilm formed by p. mirabilis and p. vulgaris strains (p = 0.2315) and by strains isolated from urine and from wound swabs (p = 0.6335). the degree of the reduction of the biofilm of both tested strains was determined (tables 5 - 6). only one out of five (20.0%) p. mirabilis strains isolated from urine had a biofilm reduction ratio of over 50% at the lowest tested concentration of ciprofloxacin (0.06 g / ml). among the strains of the species isolated from the wound swabs, a degree of reduction above 50% for the concentration of 0.06 g / ml of the tested antibiotic was observed in the case of eight strains (53.3%). for strains of p. vulgaris, there was no difference in the degree of reduction of the biofilm at the lowest tested concentrations of ciprofloxacin, depending on the isolation of the strain. the concentration of 0.06 g / ml resulted in a reduction of more than 50% of the p. vulgaris biofilm among as many as 60% of the tested strains. all examined strains were susceptible to piperacillin with tazobactam, cephalosporines, imipenem, ciprofloxacin, and norfloxacin. strains (12.5%) were resistant to amoxicillin with clavulonic acid (4, 20.0% of p. mirabilis, and 1, 5.0% of p. vulgaris). five strains of p. mirabilis (25.0%) and one of p. vulgaris (5.0%) were resistant to trimethoprim - sulfamethoxazole. the mic90 value of ciprofloxacin in the case of strains of p. mirabilis and p. vulgaris isolated from a wound swab was 0.5 g / ml. the value of the isolates from the urine was equal to 1.0 g / ml and 0.25g / ml, respectively, for p. mirabilis and p. vulgaris (table 2). however, among the 20 strains of p. mirabilis three (15.0%) were classified as the intermediate group. the mic values of ciprofloxacin for planktonic bacteria cells of both tested species are presented in table 1. the mic50 ciprofloxacin values for planktonic cells of p. mirabilis and p. vulgaris strains were 0.06 g / ml for both isolates from the wound swabs and those from urine (table 2). the absorbance value measured for the strains of p. mirabilis was in the range of 0.656 - 2.319, while p. vulgaris was within the range of 0.708 - 1.800. according to the criteria (10), none of the strains formed a biofilm in a weak degree. in the case of two tested species, most strains formed a biofilm of medium intensity 12 (60.0%) isolates of p. mirabilis and 11 (55.0%) of p. vulgaris. strong biofilm formation was observed for eight (40.0%) strains of p. mirabilis and nine strains (45.0%) of p. vulgaris (table 3). the mbe50 value of ciprofloxacin was 1.0 g / ml for the strains of both examined species (table 4). the mbe90 value of ciprofloxacin for isolates of p. vulgaris was 64 g / mll, and 512 g / ml for p. mirabilis strains (table 2). the mbe90 value was 512 and 128 times higher than mic90, respectively, for p. mirabilis and for p. vulgaris. mbe90 and mbe50 values of ciprofloxacin, depending on clinical material as well as the tested species, are presented in table 2. no statistically significant difference was observed in resistance of the biofilm formed by p. mirabilis and p. vulgaris strains (p = 0.2315) and by strains isolated from urine and from wound swabs (p = 0.6335). (%). based on the results of spectrophotometric study, the degree of the reduction of the biofilm of both tested strains was determined (tables 5 - 6). only one out of five (20.0%) p. mirabilis strains isolated from urine had a biofilm reduction ratio of over 50% at the lowest tested concentration of ciprofloxacin (0.06 g / ml). among the strains of the species isolated from the wound swabs, a degree of reduction above 50% for the concentration of 0.06 g / ml of the tested antibiotic was observed in the case of eight strains (53.3%). for strains of p. vulgaris, there was no difference in the degree of reduction of the biofilm at the lowest tested concentrations of ciprofloxacin, depending on the isolation of the strain. the concentration of 0.06 g / ml resulted in a reduction of more than 50% of the p. vulgaris biofilm among as many as 60% of the tested strains. it was shown that all tested strains of two species of proteus spp., except three isolates (15.0%) of p. mirabilis coming from urine, were sensitive to this chemotherapeutic agent. this is consistent with results obtained by other researchers (11 - 18). among the 80 strains of p. mirabilis analyzed by saito isolated from urine, 13 (16.0%) (14), who indicated that 16.2% and 13.6%, respectively, of strains were resistant to ciprofloxacin. the presented studies determined that some strains intermediate to ciprofloxacin were among the strains isolated from urine, and all strains isolated from the wound swabs were susceptible to this antibiotic. according to guggenheim. (12), 100% of wound - swab - derived strains of proteus spp. were susceptible to ciprofloxacin. (18) obtained a lower percentage (5.2%) of p. mirabilis strains from wound swabs that were resistant to that antibiotic. according to gales. (11), 18.5% of p. mirabilis strains isolated from urine were resistant to ciprofloxacin. in contrast, abdi - ali. (19) found that acinetobacter baumannii isolated from urinary catheters were less resistant to the ciprofloxacin than those isolated from wounds. saito. (16) also drew attention to a clear increase in the incidence of p. mirabilis infections resistance to broad - spectrum fluoroquinolones and cephalosporins. (20), 74.2% esbl - positive strains were nonsusceptible to ciprofloxacin, whereas only 17.7% of the esbl - negative strains were. the presence of esbl among these strains can be explained by previous usage of fluoroquinolones. saito. (16) also note that seven (9.0%) resistant strains were isolated from patients previously treated with antibiotics. in this study, the presence of strains intermediate to ciprofloxacin among strains delivered from urine can be caused by earlier treatment of uti with fluoroquinolones, recommended in poland. a very important factor that reduces the effectiveness of antibiotics on bacterial cells is the formation of a biofilm. the strains able to form a strong biofilm can have a high level of resistance to antibiotics related to the presence of genes involved in resistance mechanisms (21). studies have shown that all strains of p. vulgaris and p. mirabilis, regardless of the clinical material from which they were isolated, form a biofilm. jacobsen. (3) proved that all 50 strains of proteus spp. incubation of the tested strains, as in the case of our research, lasted 12 - 24 hours. in our experiment, it was established that 12 (60.0%) strains belonging to p. mirabilis formed a medium biofilm, and eight (40.0%) strains formed a strong biofilm. among p. vulgaris rods were respectively 11 (55.0%) and nine (45.0%) strains. (21) received comparable results of their own research. from the 50 strains of p. vulgaris, only five (10.0%) were characterized by a poor production of a biofilm, and the remaining 45 (90.0%) formed a strong biofilm (22). in our study, it was found that the mic50 and mic90 values of proteus spp. relatively small differences in mbe and mic values of ciprofloxacin can be explained by a good penetration of the antibiotic into the biofilm (25). this is confirmed by the results of drug susceptibility of planktonic cells and biofilm strains of klebsiella pneumoniae obtained by bellifa. (27). ciprofloxacin compared to cefotaxime and gentamicin has the lowest coefficient values of mbe to mic (27). singh also observed no difference in the zones of growth inhibition of biofilm cells and planktonic cells of s. aureus and s. epidermidis under the influence of ciprofloxacin (28). (29) indicated that the reduction of p. mirabilis and p. vulgaris biofilm increased with the increase of the concentration of ciprofloxacin. the concentration of 0.5 mic resulted in the reduction of the biofilm of p. mirabilis of 64.0% - 93.0% and a concentration of 0.25 mic by 28.0% - 91.0%, depending on the strain (29). similar results for p. aeruginosa strains were obtained by odak and trafny (30). single application (concerning a 24-hour biofilm) or several times (once every 24 hours from 1 - 4 nights) at subinhibitory concentrations of ciprofloxacin reduced the biofilm mass. also, application of ciprofloxacin at a concentration of 0.5 mic on 24-, 48-, and 72-hour biofilms of escherichia coli effectively reduces its weight and metabolic activity (31). in summary, the biofilm of p. mirabilis strains isolated from urine is more resistant to ciprofloxacin than the biofilm created by strains isolated from wound swabs ; however, the differences are not statistically important. | backgroundproteus spp. bacilli belong to opportunistic human pathogens, which are primarily responsible for urinary tract and wound infections. an important virulence factor is their ability to form biofilms that greatly reduce the effectiveness of antibiotics in the site of infection.objectivesthe aim of this study was to determine the value of the minimum concentration of ciprofloxacin that eradicates a biofilm of proteus spp. strains.materials and methodsa biofilm formation of 20 strains of p. mirabilis and 20 strains of p. vulgaris were evaluated by a spectrophotometric method using 0.1% 2, 3, 5-triphenyl - tetrazolium chloride solution (ttc, avantortm). on the basis of the results of the absorbance of the formazan, a degree of reduction of biofilm and minimum biofilm eradication (mbe) values of mbe50 and mbe90 were determined.resultsall tested strains formed a biofilm. a value of 1.0 g / ml ciprofloxacin is mbe50 for the strains of both tested species. an mbe90 value of ciprofloxacin for isolates of p. vulgaris was 2 g / ml and for p. mirabilis was 512 g / ml.conclusionsminimum biofilm eradication values of ciprofloxacin obtained in the study are close to the values of the minimal inhibition concentration (mic). |
stroke patients should be medically treated in specially designed facilities, so - called stroke units, because of the high efficacy of the care provided there and recommended by the german stroke society (dsg). in germany, a total of 195 stroke units has been set up so far, enough to provide care for approximately half of all stroke patients in germany. an increase in the number of stroke units to 250 has been planned in order to bring this effective care to almost 85% of stroke patients on the long - term. however, acute care will continue to be provided in hospitals without stroke units in the future, especially in rural areas, where economic and staff limitations prevent the establishment of specialized neurological stroke units. the question then arises, whether the use of modern teleneuromedicine methods could contribute to reducing the deficit in stroke patient care, particularly in less populated regions. in these areas, which lack neurological expertise, acute medical treatment of stroke patients usually occurs in the internal medicine department [5, 6 ]. within the context of teleneuroconsultation, discussion and deliberation between two or more doctors regarding the best diagnostic and therapeutic approach for the acute stroke patient can take place. in teleneuromedical settings, the stroke expert is connected by video and sound transmission, observing the examination of the patient, which is carried out by the doctor at the regional hospital. in addition, the radiological image data (ct or mri) collected in the regional hospital is electronically transmitted to a server platform that can be accessed by the stroke expert. on the basis of this information as well as the clinical impressions that the stroke expert receives during the video conference, the remote diagnosis and related therapeutic instructions or recommendations are determined and communicated to the doctor with a datasafe consultation sheet (see figure 1). the study considers to what extent hospitals in germany have already fulfilled the requirements for participation in a telehealth care network and to what extent these methods are already in use in germany. finally, the findings of the investigation are discussed in relation to existing teleneuromedical networks and questions are answered as to what demands these special networks can meet in the future. the study included a multicentered, completely standardized survey of physicians in hospitals by means of a computerized online questionnaire. those selected for the investigation received an e - mail letter inviting them to participate. it also included a link to an internet site where participants could fill out the questionnaire. in the analysis of the data, bar graphs and pie charts) and bivariate (crosstabulation) methods were used in the analysis according to gcp guidelines (ek 255102007). of a total of 2,104 hospitals in germany, university hospitals, specialized hospitals and facilities with stroke units in a neurology department this selection reduced the total by 845 to be 1,259 hospitals, constituting the basic population of the survey. however, not all of them could be reached on - line, since in 494 cases the hospital e - mail address was not available. therefore, a total of 765 hospitals were surveyed (61%) and 346 (45%) hospitals could be directly reached with a general address in the hospital (i.e., info@...). out of the 765 hospitals that fulfilled the inclusion criteria, 134 hospitals entered the website and completed the survey, amounting to a return rate of 18%. out of the 134 participating hospitals, 15 had in addition to an internal medicine also a newly opened neurology department. these facilities also did not meet the inclusion criteria for the empirical analysis and were not included in the final analysis. the following descriptions and evaluations thus refer to 119 acute hospitals without any neurology department. as shown in figure 2 predominantly hospitals with less than 200 beds (48%) or between 200400 beds (45%) in small towns (5,000100,000 inhabitants) took part in the survey (80%). (> 100,000 inhabitants) and 5% to rural regions (1 gb / s in 8%, and answer not sure but > 100 mb / s in 39%. in case of complications (e.g., malignant brain edema or intracerebral bleeding) associated with thrombolytic therapy, the transfer of a stroke patient to a neurosurgery department may be necessary. moreover, for bridging concepts in individual cases it is expedient to transfer the patient to an comprehensive stroke unit center for specialized neuroradiology interventions. according to the code other complex neurological treatments of acute stroke (g - drg ops 8 - 98b) such concerning early rehabilitation measures, 117 participants (98%) responded that they have the capacity to carry out early physiotherapy. speech and language therapy is available to only 71% of the hospitals, and occupational therapy to 59%. the most important reason for participating in a teleneuromedical network is the improvement in treatment quality (82%) and the ability to avoid unnecessary patient transport (76%). easier and faster access to expertise (72%) and the related improvement in establishing a final diagnosis (66%) constitute further medical arguments. furthermore, participants had to assess whether the use of teleneuromedicine increased the competitiveness of their hospital, to which 67% responded in the affirmative. table 2 shows that mainly small hospitals with 200 beds do not have a clear tendency. the ability to carry out systemic (i.v.) thrombolysis within their own hospitals was considered by 59% of participants and the improved professional training of doctors within the hospital was also seen as a possible motive. the reduction of length of hospital stay (los) in stroke patients was not associated with a main incentive for the cooperating hospitals (see figure 4). the most significant problem area for the hospitals seems to be the financing system of telemedicine with regard to the acquisition costs of the technical equipment. this aspect represents the main factor in the modal value of the answers (43%). in addition to this the compensation for the stroke - unit center with the specialist 's consultation service (31%) as well as the legal aspects of teleneuromedicine (27%) present a risk. however, data security reasons (18%), potential conflict between different specialties with competency boundaries (15%) as well as operating costs (12%) are deemed much less significant. the least problematic aspect according to the hospitals is the acceptance of teleneuromedicine among doctors (10%). 90% of the participating hospitals accept teleneuromedicine as a good supplement to the well established stroke care (see figure 5). with stroke becoming increasingly even more important and neurological stroke units lacking in rural areas, teleneuromedicine emerges as a promising technique in stroke care. the present work focuses on quality improvement with the help of a teleneuromedical network system. the advantages of teleneuromedicine in acute stroke include faster and more accurate diagnoses in participating hospitals, since they have easier access to neurological expertise. to reach this goal it is, however, also necessary that such a health care configuration be accepted by participating doctors and that these doctors in turn be accurately advised. it is possible that doctors in cooperating hospitals may not always be prepared to submit to the competencies of colleagues in the treatment of their stroke patients. a negative attitude toward the use of teleneuromedicine might be related to this aspect. however, most participants showed a ready acceptance of teleneuromedicine and ranked possible conflicts arising from competency boundaries very low. interestingly, improved competitiveness was cited as a predominant argument for teleneuromedicine by hospitals with less than 200 beds. for example, changes in the hospital system could also affect a facility 's catchment area. if a neighboring hospital expands, its attractiveness increases and consequently its catchment area as well, to the detriment of other hospitals, which must adjust to a reduced load. thus, adjustments to the range of services and capacity are necessary, the more so as with reduced patient numbers high fixed costs can no longer be covered. the result will be a decline in the attractiveness of the facility, bringing with it a further reduction of the catchment area. this process is already ongoing in germany at present, and will continue into the next few years. such adjustment mechanisms or focusing on just a few care providers may even be a political aspiration. conversely, when a hospital, especially a small one, connects to a teleneuromedicine network, thereby improving stroke care and treatment results, its attractiveness among regional care providers will be increased. this hospital would thus have a good argument for justifying its health care mandate and for securing its existence. on the other hand, the competitive advantage can become a direct competition. assuming each of two neighboring general hospitals, a and b, with very similar services and equipment, care for stroke patients in their respective catchment areas. hospital a connects to a teleneuromedicine network and can then possibly attract additional stroke patients from the catchment area of hospital b, as a result of the advantages of teleneuromedicine. the precondition is that the rescue service is informed about the teleneuromedical capabilities of hospital a and delivers stroke patients primarily to this facility. however, at the same time further direct treatment costs arise from the expansion of diagnostics and treatments for the additional patients. furthermore, one might ask if hospital a has sufficient capacity for the increased patient numbers ; although if, as described, the length of in - hospital stay is reduced by the use of teleneuromedicine, it may be possible to care for more patients without increasing the hospital 's capacity [7, 12 ]. it must be noted, however, that the reduction of length of stay was largely not confirmed by the data provided by participating hospitals in this study. as was to be expected, however, this aspect is not very prominent in hospitals already active in teleneuromedicine (14%). these hospitals are mainly located in bavaria, where they are often financially supported by the state or health insurances (e.g., tempis or steno). but facilities which are in negotiations with network partners or plan to become active in teleneuromedicine might see a substantial, negotiable factor between the involved parties. especially in those facilities for which a connection to a teleneuromedicine network is out of the question the problem of financing is quite prominent. considering the necessary investments (hardware, software, it support, broadband etc.), lack of sufficient financial resources can be a significant reason for the failure of teleneuromedicine in a cooperating hospital. this problem can be discussed with health insurers and the state since both can profit from the use of teleneuromedicine. as a result of quality improvement in stroke care throughout the state this sort of health care configuration in less developed regions can reduce the number of those needing long - term care and the direct and indirect costs associated with it. besides this the problem is that, these effects are not immediately evident and are only noticed by the cooperating hospitals in the long term. which operating network costs or savings result concretely are not as easily enumerated on basic acquisition. the consequence of this lack of internalization and the associated lack of incentive could be a reason that the use of teleneuromedicine is still partly out of the question for a given facility. if a list of advantages and problems is composed, however, the advantages will prevail. it should therefore be mentioned that the opportunities provided by teleneuromedicine are ranked higher by the hospitals taking part in the survey than the risks connected with it. a generalization of this statement, however, can not be made offhand. in the discussion of the survey results, it must be kept in mind that only a certain percentage of the total population of all acute hospitals in germany responded and that those hospitals are particularly interested in teleneuromedicine. hospitals for which the use of telemedicine in stroke care is out of the question tend, perhaps, not to answer. moreover, aspects related to the implementation of thrombolysis therapy are important. a large portion of the facilities can in principle envision performing thrombolysis with the help of a teleneuromedically connected stroke expert. doctors in cooperating hospitals are prepared to trust their colleagues from the connected stroke unit and to rely on their evaluation. while the doctors in the cooperating hospitals bear the entire responsibility for thrombolysis treatment, for most of them the medical advantages and the associated benefits to the stroke patients are certainly in the foreground, so that when weighing the options, the arguments in favor of a thrombolysis treatment or bridging concept win out. the economic aspect of reducing unnecessary transfers, which are often very time consuming, can be largely confirmed by participating hospitals. if a stroke patient does not reach the cooperating hospital within 4.5 hours, after onset of symptoms, intravenous thrombolysis is no longer justified. therefore, time should be used as effectively as possible, since up to the point of administration of the medication, appropriate examinations as well as the teleconsultation must be completed, and the success rate of thrombolysis decreases with each passing minute. the brevity of this time period and especially the lengthy pre - hospital time periods are the most significant reasons for low thrombolysis rates in cooperating hospitals. given the logical and literature - supported supposition that time - to - recanalization is crucial, rapid and safe recanalization is a primary goal. the initial teleconsultation with ct and ct angiographic findings can quickly determine whether the patient is a suitable candidate for an interventional neuroradiological procedure, although up to now the ideal method by which a rapid and safe recanalization is achieved is not clear. in addition to limited recanalization rates, current ia therapies, particularly ia thrombolytics and mechanical devices, can take hours to achieve recanalization. in this case a so - called bridging procedure with initially intravenous thrombolysis can first be begun, and the patient can then be transferred to a specialized interventional neuroradiology while undergoing treatment without time delay [9, 1719 ]. in acute basilar artery occlusion, m1 occlusion of the middle cerebral artery and occlusion of the internal carotid artery, intra - arterial thrombolysis or / and endovascular mechanical recanalization may result in higher recanalization rates than intravenous thrombolysis alone. bridging iv / ia thrombolytic therapy for such acute stroke patients appears to be safe and yields higher recanalization and improved survival rates, as well as an overall improved chance for a better outcome. however many patients are admitted to community hospitals, where endovascular therapy is usually not readily available. in this setting a teleneuromedical supported proper selection of stroke patients is mandatory, who will benefit from an initialization of thrombolysis within a community hospital with simultaneous referral to a comprehensive stroke center, thus leading to a better functional outcome of stroke patients. however randomized controlled trials will have to confirm the expected benefit of bridging iv / ia thrombolysis with subsequent on - demand mechanical recanalization on clinical outcome [2022 ]. the recommendation of the german stroke society, that stroke patients undergo a ct scan within 25 minutes at most, was fulfilled with an average of 14.42 minutes of all responses. even with a standard deviation of approx. it can be concluded that the internal structures and procedures within most of the participating hospitals seem to be efficient enough to guarantee quick access to a ct scan. in addition, the response patterns show that the technical requirements do not stand in the way of becoming active in teleneuromedical care. the question arises whether in those hospitals which do not meet this requirement, inefficient internal organization could be the culprit. another reason might be that these hospitals share the use of a ct with other facilities, for example, an external radiology service, and therefore delays may occur. because of limited availability and the resulting longer time to mri, it can be deduced that in hospitals having both imaging methods at their disposal, ct will often be primarily used for initial diagnosis in the treatment of stroke patients. both methods may be used later in the course of the treatment to strengthen the validity of the diagnostics [24, 25 ]. failure to meet the 4.5 hour deadline, after which intravenous thrombolysis can not be initiated for some, the symptoms of stroke are not known, at least not sufficiently so that calling the ambulance is often too late. for this reason there is a continuous necessity to educate the population to the importance of seeking stroke treatment as quickly as possible. it remains questionable to what extent a cooperating hospital can contribute to this, particularly as only one third of the facilities consider this a way to raise the thrombolysis rate. the cooperating hospitals consider the medical exclusion criteria much more significant for the low thrombolysis rate [4, 6, 26 ]. telemedicine technologies have been shown to be useful and effective in the remote neurological evaluation and treatment of acute stroke patients and is now used at several hospitals in europe and the united states as an option for stroke patients to have access to cerebrovascular expertise. the effect of this concept was evaluated in the tempis project, where five regional hospitals with a telestroke concept were matched with five regional hospitals without a telenetworking system. during two years stroke patients were monitored and the three - month outcome was studied. in an multivariate analysis the stroke treatment in the tempis project showed a significantly better result compared with the nonnetworking hospitals and the thrombolysis rate was ten times higher. many physicians, especially nonneurologists, remain hesitant to use rt - pa in acute stroke patients, suggesting that additional training methods and tools are desperately needed in many communities. since the ninds - sponsored trial of rt - pa in acute stroke was conducted at a relatively small number of experienced stroke centers, one commonly expressed concern is that similar results might not be obtained when rt - pa is used in a variety of clinical settings. after publication of the ninds trial results more than a dozen reports of experience with rt - pa in open - label, routine clinical use have been published. in 2639 treated patients, the symptomatic intracerebral hemorrhage rate was 5.2% (95% confidence interval 4.36.0) slightly lower than 6.4% rate of the ninds trial (national institute of neurological disorders and stroke). the mean total death rate (13.4%) and proportion of subjects achieving a very favorable outcome (37.1%) were comparable to the ninds trial results. as a result community hospitals will increasingly face medicolegal risks both for treating and for not treating patients with newly available agents. with a back up of stroke experts in a professional telenetworking system patients and family members can be assured that they speak with the expert online in the emergency unit and that all treatment options are standardized and discussed. this will release a huge burden from the less stroke experienced doctors in the local hospitals in rural areas since a major problem confronting all community hospital stroke programs is one that has been called the frequency factor. since a small number of stroke patients will qualify for acute interventions such as tpa thrombolysis, a stroke team could have difficulties in running effective. a study investigating the routine use of systemic tpa thrombolysis reports an increase in in - hospital mortality after administration of tpa in hospitals with < 5 thrombolytic therapies within 1 year. these findings underline the need to have an experienced stroke expert involved in the management of an acute stroke patient since urgent therapeutic decisions in emergency stroke care have to be made on the basis of brain imaging and a structured clinical examination. with a good knowledge of functional and vascular cerebral anatomy the stroke expert can quickly determine the neuroanatomic localization of the brain lesion and can guide special treatment options. since such experience and resources are available mainly in stroke centers of teaching hospitals a networking system can allow each hospital to have access to the experience of all programs in the network. for example, the neuronet constitutes an implementation of teleneuromedicine in clinical practice and represents an intraregional teleneuromedicine network of hospitals, wherein only hospitals belonging to the helios hospital group take part. this project has been in operation since 2006 [9, 31 ] counting among its hospitals five certified stroke unit centers, who serve as providers of teleneuromedical expertise including neurologist, neurosurgeons and neuroradiologists. these stroke unit centers rotate their on - call services weekly whereas the cooperating hospitals make up the regional facilities or the consumers of teleneuromedical expertise [32, 33 ]. in neuronet (http://www.helios-neuronet.de) the implementation costs were covered by the hospital group and every cooperating hospital has a mobile workstation (vimed teledoc 2) with a video conferencing system, and the consult is processed by a central server that can send and receive digital radiological images in dicom format. a great advantage is that the mobility of this workstation allows for its use regardless of the location of the consulting physician. since every minute lost when dealing with acute stroke implies a loss of viable brain tissue, the network system strives to carry out thrombolysis on site or, with a bridging concept, to start it on site followed by transport to a comprehensive stroke unit center after the diagnosis and initiation of therapy. part of the whole concept is also supervision and quality management with standard operation procedures (sop) to further develop the network. adjusted to suit available regional configurations, these networks are intended to lead to a uniform optimization of care for stroke patients. therefore training of stroke doctors, stroke nurses and therapists are continued and training equipment like the stroke lysis box (ipc : a61f-17/00, patent number 200 09 172.7) and a nihss training dvd (http://www.physiothek.com) were indroduced. within a systematic peer review process quality data from all hospitals are continuously evaluated and routine data with mortality rates are observed over the years to monitor the improvements in quality of stroke care. furthermore, the society of hospitals in saxony (kgs), together with the regional association of health care providers (lvsk) and the saxon ministry of social welfare (sms), have after almost two years of negotiations with all involved parties agreed on a financial framework for improving telestroke care uniformely throughout saxony, especially in rural areas, through the establishment of teleneuromedicine networks. the comprehensive stroke unit centers are the university hospital dresden for eastern saxony (sos - net, http://www.neuro.med.tu-dresden.de/sos-net/) and for southwestern saxony a trio of comprehensive stroke unit centers with aue, chemnitz and zwickau (tns - net). the criteria for the participation of hospitals is clearly defined and a team from the stroke unit centers visits the potential cooperating hospital in order to check the quality criteria. it also instructs doctors, nurses and therapists particulary in operating the equipment and evaluating stroke patients with certain stroke scales. in these networks advanced and professional training is ongoing, and especially nursing staff is educated in a stroke nurse training program lasting six months (http://www.dsg-info.de/pdf/pflegefortbildung_helios_akademie.pdf). the german stroke society (dsg) and the german neurological society (dgn) recently published standards for telestroke services that will now lead to a general certification of these networks. but this safe and effective telestroke and tele - thrombolysis service with experienced stroke experts for stroke management requires a 24 hour on demand teleconsultation service that needs to be reimbursed. in tempis, the expenses for this service account 300,000 per year. based on the calculated savings of subsequent costs by each thrombolysis between 3300 to 4200 the absolute increase of systemic thrombolysis of 75 tpa treatments within one year would result in a total saving between 250,800 and 319,200. therefore the teleconsultation service results to be cost - efficient regarding only the consultations of possible thrombolyses. in denmark the budgetary impact and cost - effectiveness of the national use of thrombolysis for stroke administered via telemedicine was estimated. the incremental cost - effectiveness ratio was calculated to be approximately 50.000 $ when taking a short time perspective (1 year) but thrombolysis was both cheaper and more effective after 2 years and cost effectiveness improved over longer time scales. however studies conducted from a societal perspective compared with those conducted from an institutional perspective have a tendency to overestimate the total revenue. in the absence of ongoing government grant support, any telestroke sponsoring institution must devise a business model that produces a self - sustaining profitable break - even program. the health economic model computations suggest that the macroeconomics costs may balance with savings in care and rehabilitation after as little as 2 years and that potentially large long - term savings are associated with thrombolysis devilered by teleneuromedicine. in the united states several telestroke projects are established mostly by governmental grants and published in journals (partners telestroke center ; starr ; stroke doc ; reach ; run - stroke ; clinicaltrials.gov). interestingly the specialist on call (soc, http://www.specialistoncall.com) project is a privat business model that operates with 15 neurologists covering 65 hospitals in six states dealing with 3.600 teleconsultations per year. the soc offers flat rates for hospitals where the hospital pays one time 30.000 for the technical equipment and a monthly fee that is adjusted to the size of the hospital. the stroke neurologists are hired by soc and monthly payed for their stroke expert teleneuromedicine service. however in germany the teleprojects are always connected to comprehensive stroke unit centers and mostly supported by the state system. in saxony the costs for the technical equipment of a stroke unit center and a cooperating hospital are covered by the saxon ministery of social welfare so that the implementation of the network infrastructure was possible for each hospital that could fulfill the standardized inclusion criteria for the statewide telestroke network configuration (30.000 one time payment for each hospital). together with the health insurance companies in saxony it was possible to discuss a model, where each teleconsultation can be billed with 1/3 receiving the cooperating hospital and 2/3 receiving the stroke unit center. with this billing model per teleconsult all costs have to be covered including broadband costs, it specialists, savings for new equipment, and of course payments for the stroke experts and teaching costs. the state concept allows a stable routine teleconsultation service with incentives to use the system and possibilities for growth in order to improve the quality of the telenetworking system. since an european consensus statement has set the goal of having all persons with acute stroke admitted to specialized treatment facilities establishing such a teleneuromedicine networking system in nonurban areas might be the solution to the difficult reimbursement situation of insurance companies and the problems in finding enough stroke neurologists. in summary, broad implementation of thrombolysis in stroke is supported by the expanding telestroke networks. with the use of modern teleneuromedicine network systems especially the fact that comprehensive coverage by stroke units throughout germany does not appear to be feasible at present, teleneuromedicine represents a valueable supplement to the existing system of stroke care. however, the use of teleneuromedicine alone can not replace optimal care provided by comprehensive stroke units. overall, the hospitals in a network must upgrade and optimize their internal structures in a holistic operational process to improve stroke care but project data show that telestroke and telethrombolysis are practicable and can contribute to the improvement of stroke care in rural hospitals that are too distant from a specialized stroke unit. this investigation shows that there is good acceptance for teleneuromedicine among networking hospitals and that doctors see the opportunities offered by this sort of health care configuration. technical and organizational requirements must be fulfilled in the hospitals and medical product guidelines should be followed along with a stable financing system and the possibility for deductions by the insurers so that even small hospitals can participate in this health care configuration. from a socio - economic point of view it is precisely these facilities in rural areas far away from stroke unit centers that can profit most, in terms of telestroke care. patient benefits and resulting potentials for cost savings have to be addressed in the teleprojects and in discussion with health care structures as can be seen in saxony. | indroduction. at present, modern telemedicine methods are being introduced, that may contribute to reducing lack of qualified stroke patient care, particularly in less populated regions. with the help of video conferencing systems, a so - called neuromedical teleconsultation is carried out. methods. the study included a multicentered, completely standardized survey of physicians in hospitals by means of a computerized on - line questionnaire. descriptive statistical methods were used for data analysis. results. 119 acute hospitals without neurology departments were included in the study. the most important reasons for participating in a teleneuromedical network is seen as the improvement in the quality of treatment (82%), the ability to avoid unnecessary patient transport (76%), easier and faster access to stroke expertise (72%) as well as better competitiveness among medical services (67%). the most significant problem areas are the financing system of teleneuromedicine with regard to the acquisition costs of the technical equipment (43%) and the compensation for the stroke - unit center with the specialists ' consultation service (31%) as well as legal aspects of teleneuromedicine (27%). conclusions. this investigation showed that there is a high acceptance for teleneuromedicine among co - operating hospitals. however these facilities have goals in addition to improved quality in stroke treatment. therefore the use of teleneuromedicine must be also associated with long term incentives for the overall health care system, particularly since the implementation of a teleneuromedicine network system is time consuming and associated with high implementation costs. |
breast cancer is the most common form of cancer and a leading cause of death for women in the west, where about one in ten women will develop it during her life. it is obvious that the chance for cure is highest if the breast cancer is identified at an early stage before the tumor has spread. x - ray mammography is currently the most effective imaging modality used in breast screening systems. often, two mammogram views are taken of each breast in a screening session. the two mammographic views are craniocaudal (cc), in which the x - ray projects from head to toe, and mediolateral oblique (mlo), in which the x - ray direction is from one shoulder to the opposite hip. after the mammograms are taken, the radiologist attempts to detect the abnormalities in the mammographic views. if there is any suspicion of malignancy, a biopsy is carried out to confirm the diagnosis. breast abnormalities in x - ray mammograms include microcalcifications, masses, architectural distortion, and asymmetry. these abnormalities may be associated with either benign or malignant conditions, depending on their shapes and structures. microcalcification clusters have more chance of being malignant and are deemed as one of the most important mammographic signs of early breast cancer. there are three categories of mammographic appearance of a mass : circumscribed, irregular - shaped, and spiculated. most circumscribed masses are benign, although there are rare instances in which a well - defined mass is malignant. an irregular - shaped mass represents one with a poorly defined margin, which indicates possible infiltration of cancer into surrounding tissue. spiculated masses have a very high risk of being malignant. in computer - aided diagnosis (cad), a manually or automatically detected mass has to be segmented before it can be classified as benign or malignant. after segmentation, the classification step is applied based on mass features, including shape, compactness, texture, etc. shao and brady1 proposed an iterative method for reconstructing the 3d masses. however, the 2d mass shapes are segmented manually and the reconstructed 3d mass shapes are rather coarse in their algorithm. in the following sections, we will present an approach based on automated mass segmentation and partial volume compensated mass shape reconstruction from the two mammographic views. it is believed that an accurate 3d reconstruction contains more information for classification of masses into benign or malignant, or at least is valuable to the clinician by visualization. section introduces the segmentation of the 2d mass shapes in the two mammographic views based on a region growing approach. the mass segmentation step is crucial because the 3d mass reconstruction is highly dependent on the accuracy of the segmented mass shapes. mammograms have very low contrast, which makes it impossible to use a pure thresholding method to segment the mass regions in the cc and mlo views. region growing begins by locating a set of seeds and attempts to merge neighboring pixels into this growing region until no more pixels can be added to it.2 this method first defines a homogeneity criterion. if the neighboring pixels satisfy the homogeneity criterion, they are merged into the target object region. adams and bischof 3 proposed a seeded region growing algorithm, which takes an intensity image and a set of seeds as input. unfortunately, this method is dependent on the order of the pixels being processed, which means the region growing result is different if the pixels are processed in different orders. muller.4 proposed an automated 3d region - growing algorithm, which is based on an assessment function. the principle of this algorithm is to build a region - growing sequence by increasing the maximal homogeneity threshold from a very small value to a large one. on each segmented region, a 3d parameter that has been validated on a test image assesses the segmentation quality. this set of values called assessment function is used to determine the optimal homogeneity criterion. the main advantages of this algorithm are its capability of eliminating isolated points due to the noise and preserving connectivity of the target object structure. revol and jourlin2 developed a region - growing technique, which reconsiders the assignment of pixels at each step by a process minimizing variance through special dilations. therefore, the region created by an initial seed can be nonconnected and possibly does not contain this seed. the homogeneity criterion of this method is based on an adequate tuning between spatial neighborhood and histogram neighborhood. the drawback of the above methods is that they are rather time - consuming computationally and not effective for our mass segmentation problem. the seed is estimated from the manually segmented mass regions as used in the work of shao and brady.1 assume that r is the manually segmented mass region, the seed is computed as : 1\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ x_{s } = \frac{1 } { k}{\sum\limits_{x_{i } \in r } { x_{i } } } \quad y_{s } = \frac{1 } { k}{\sum\limits_{y_{i } \in r } { y_{i } } } $ $ \end{document}where (xi, yi) represents the location of a pixel belonging to r and k is the number of pixels in r. a dilation operation of neighborhood n is applied to the seed (xs, ys). n is obtained as follows : 2\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ n = \min { \left ({ x_{{\max } } - x_{s }, x_{s } - x_{{\min } }, y_{{\max } } - y_{s }, y_{s } - y_{{\min } } } \right) } $ $ \end{document}where xmax, xmin are the maximal and minimal values of xi, and ymax, ymin are the maximal and minimal values of yi, respectively. the foreground measure if is estimated from the intensity values within the dilated seed region sd as follows : 3\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ i_{{\text{f } } } = \frac{1 } { m}{\sum\limits_{{\left ({ x_{i }, y_{i } } \right) } \in s_{{\text{d } } } } { i{\left ({ x_{i }, y_{i } } \right) } } } $ $ \end{document}where m is the number of pixels belonging to the dilated seed region sd. the background measure ib is estimated from the dilation of the manually segmented mass region r. a dilation operation of neighborhood l is applied to r, which results in a region rd. typically, we set l to be 5 in our experiments. the background measure is computed as follows : 4\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ i_{{\text{b } } } = \frac{1 } { n}{\sum\limits_{{\left ({ x_{i }, y_{i } } \right) } \in r_{{\text{d } } } - r } { i{\left ({ x_{i }, y_{i } } \right) } } } $ $ \end{document}where i(xi, yi) is the intensity value of the region rdr, n is the number of pixels in the region rdr. the local signal dependent threshold can be defined as : 5\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ t = i_{{\text{b } } } + \alpha { \left ({ i_{{\text{f } } } - i_{{\text{b } } } } \right) } = \alpha i_{{\text{f } } } + { \left ({ 1 - \alpha } \right)}i_{{\text{b } } } $ $ \end{document}where is a constant with values between zero and one. we set as 0.5, i.e., t = 0.5(if + ib), in our experiments. si belonging to sd and its neighboring pixels, the standard deviation of gray levels si is calculated. let mean be the mean value of si : 6\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ \sigma _ { { { \text{mean } } } } = \frac{1 } { { n_{{\text{s } } } } } { \sum\limits_{s_{i } \in s_{{\text{d } } } } { \sigma _ { { { \text{si } } } } } } $ $ \end{document}where ns is the number of pixels within the region of sd. the region growing process is applied recursively. at each step, a homogeneity region rn(r0=sd) is dilated by a neighborhood 1, yielding a region dn+1. for each pixel (xi, yi)dn+1rn, if the standard deviation (i) of gray levels of (xi, yi) and its neighbors is less than mean, and the gray levels of ii exceeds t, it is marked as belonging to rn+1. that is, if i t, (xi, yi)rn+1 ; otherwise, (xi, yi)rn+1. the region growing procedure is iterated until the region rn can no longer be increased. we set as 1.2 in our experiments. to eliminate the possible holes in the segmented regions, any pixel with at least six of its eight neighboring pixels belonging to the segmented region is included to be part of the segmented region. the initial 3d mass shape, which is represented by a binary volume image, is reconstructed based on an algebraic reconstruction technique5,6, similar to that of shao and brady.1 let v(i, j, k) be the 3-d reconstructed object image, i = 1,..., n, j = 1,..., n, k = 1,..., n, which is a discrete three - dimensional image that represents a binary object. in this study, we assume that the mass lesion to be reconstructed is incompressible and that the attenuation coefficient within a mass is constant. for this reason, we represent the reconstructed object as a binary three - dimensional image. let pcc(r, c), pmlo(r, c)/plm(r, c) represent the mass regions in the cc and mlo / lm views and the background, r = 1,..., n, c = 1,..., n. pcc(r, c), pmlo(r, c)/plm(r, c) is equal to hm (hm is the background compensated intensity of a mass region), if (r, c) belongs to the mass region ; and is equal to 0, if (r, c) belongs to the background. then, we convert v(i, j, k) into vj, j = 1, 2,..., n. we also convert pcc(r, c) into p1i, i = 1,..., n, pmlo(r, c) into p2i, i = 1,..., n, respectively. we can write the linear equations as follows : \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ w_{{11 } } v_{1 } + w_{{12 } } v_{2 } + w_{{13 } } v_{3 } + \cdots + w_{{1n } } v_{n } = p1_{1 } $ $ \end{document}\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ w_{{21 } } v_{1 } + w_{{22 } } v_{2 } + w_{{23 } } v_{3 } + \cdots + w_{{2n } } v_{n } = p1_{2 } $ $ \end{document}\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ w_{{n^{{\text{2 } } } 1 } } v_{1 } + w_{{n^{{\text{2 } } } { \text{2 } } } } v_{{\text{2 } } } + w_{{n^{{\text{2 } } } { \text{3 } } } } v_{3 } + \cdots w_{{n^{{\text{2 } } } n } } v_{n } = p1_{{n^{{\text{2 } } } } } $ $ \end{document}\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ w_{{{\left ({ n^{{\text{2 } } } + 1 } \right)}1 } } v_{1 } + w_{{{\left ({ n^{{\text{2 } } } + 1 } \right)}2 } } v_{2 } + w_{{{\left ({ n^{{\text{2 } } } + 1 } \right)}3 } } v_{3 } + \cdots w_{{{\left ({ n^{2 } + 1 } \right)}n } } v_{n } = p2_{1 } $ $ \end{document}\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ w_{{{\left ({ 2n^{{\text{2 } } } } \right)}1 } } v_{1 } + w_{{{\left ({ 2n^{{\text{2 } } } } \right)}2 } } v_{2 } + w_{{{\left ({ 2n^{2 } } \right)}3 } } v_{3 } + \cdots w_{{{\left ({ 2n^{2 } } \right)}n } } v_{n } = p2_{{n^{2 } } } $ $ \end{document}wij represents the influence of a voxel vj on a ray ri passing through pixel pi and it is determined by the length of ray ri in voxel vj. we start by guessing the initial value of the voxel vector, v = v. currently, we do that using the shape from silhouette method. at each iteration, we use a correction procedure to update the volume vector v. at iteration step k, the value of pi is measured as projected from the present state of the volume vector v. the difference between pi and pi is then back - projected to the 3-d volume object which generates v to make sure that if pi were computed from v, it would be closer to pi than pi. the correction procedure is only applied to the boundary voxels because our initially reconstructed object is a binary volume image and solid. let b(v), b(\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ \overline{v } $ $ \end{document }) be the boundary voxels. when vj = 1, and its neighboring voxels have both 0s and 1s, vj b(v). on the other hand, when vj = 0, and its neighboring voxels have both 0s and 1s, vj b(\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ \overline{v } $ $ \end{document }). the correction procedure can be expressed as follows : if vj b(v), and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\frac{{{\sum\nolimits_{i = 1}^{2n^{2 } } { { \left ({ p_{i } - { \sum\nolimits_{n = 1}^n { \omega _ { { in } } \upsilon _ { n } } } } \right) } } } { \left ({ \omega _ { { ij } } > 0?1:0 } \right)}}}{{{\sum\nolimits_{i = 1}^{2n^{2 } } { \omega _ { { ij } } } } } } 0?1:0 } \right) } } } } } { { { \sum\limits_{i = 1}^{2n^{2 } } { w_{{ij } } } } } } > { \text{threshold } } $ $ \end{document }, change vjfrom 0 to 1. if vj b(v), and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\frac{{{\sum\nolimits_{i = 1}^{2n^{2 } } { { \left ({ p_{i } - { \sum\nolimits_{n = 1}^n { \omega _ { { in } } \upsilon _ { n } } } } \right) } } } { \left ({ \omega _ { { ij } } > 0?1:0 } \right)}}}{{{\sum\nolimits_{i = 1}^{2n^{2 } } { \omega _ { { ij } } } } } } 0?1:0 } \right) } } } } } { { { \sum\limits_{i = 1}^{2n^{2 } } { w_{{ij } } } } } } > { \text{threshold } } $ $ \end{document }, change vjfrom 0 to 1. the above procedure is applied recursively, until the reconstruction converges to a particular shape. the above reconstructed binary 3d mass shape is rather coarse and is affected by the partial volume effect (pve). the intensity value of the partial volume pixel (or voxel) is a combination of the intensity values of each tissue type present. the accuracy of assigning these partial volume pixels (or voxels) to one single tissue type is inherently limited, especially when the image resolution is low. to obtain a more accurate 3d mass shape, partial volume estimation is applied on the initial binary boundary as follows: if vj b(v), and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\frac{{{\sum\nolimits_{i = 1}^{2n^{2 } } { \left ({ p_{i } - } \right. } } { \sum\nolimits_{n = 1}^n { \left. { \omega _ { { in } } \upsilon _ { n } } \right){\left ({ \omega _ { { ij } } > 0?1:0 } \right) } } } } } { { { \sum\nolimits_{i = 1}^{2n^{2 } } { \omega _ { { ij } } } } } } 0?1:0 } \right) } } } } } } } { { { \sum\nolimits_{i = 1}^{2n^{2 } } { \omega _ { { ij } } } } } } ; $ $ \end{document}if vj b(\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ \overline{v } $ $ \end{document }), and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ \frac{{{\sum\nolimits_{i = 1}^{2n^{2 } } { \left ({ p_{i } - } \right. } } { \sum\nolimits_{n = 1}^n { \left. { w_{{in } } v_{n } } \right){\left ({ w_{{ij } } > 0?1:0 } \right) } } } } } { { { \sum\nolimits_{i = 1}^{2n^{2 } } { w_{{ij } } } } } } > 0 $ $ \end{document }, \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ v_{j } = \frac{{{\sum\nolimits_{i = 1}^{2n^{2 } } { \left ({ p_{i } - } \right. } } { \sum\nolimits_{n = 1}^n { \left. { w_{{in } } v_{n } } \right){\left ({ w_{{ij } } > 0?1:0 } \right) } } } } } { { { \sum\nolimits_{i = 1}^{2n^{2 } } { w_{{ij } } } } } } $ $ \end{document}. if vj b(v), and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\frac{{{\sum\nolimits_{i = 1}^{2n^{2 } } { \left ({ p_{i } - } \right. } } { \sum\nolimits_{n = 1}^n { \left. { \omega _ { { in } } \upsilon _ { n } } \right){\left ({ \omega _ { { ij } } > 0?1:0 } \right) } } } } } { { { \sum\nolimits_{i = 1}^{2n^{2 } } { \omega _ { { ij } } } } } } 0?1:0 } \right) } } } } } } } { { { \sum\nolimits_{i = 1}^{2n^{2 } } { \omega _ { { ij } } } } } } ; $ $ \end{document } if vj b(\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ \overline{v } $ $ \end{document }), and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ \frac{{{\sum\nolimits_{i = 1}^{2n^{2 } } { \left ({ p_{i } - } \right. } } { \sum\nolimits_{n = 1}^n { \left. { w_{{in } } v_{n } } \right){\left ({ w_{{ij } } > 0?1:0 } \right) } } } } } { { { \sum\nolimits_{i = 1}^{2n^{2 } } { w_{{ij } } } } } } > 0 $ $ \end{document }, \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ v_{j } = \frac{{{\sum\nolimits_{i = 1}^{2n^{2 } } { \left ({ p_{i } - } \right. } } { \sum\nolimits_{n = 1}^n { \left. { w_{{in } } v_{n } } \right){\left ({ w_{{ij } } > 0?1:0 } \right) } } } } } { { { \sum\nolimits_{i = 1}^{2n^{2 } } { w_{{ij } } } } } } $ $ \end{document}. the above procedure is applied recursively until the difference between the current reconstruction and the previous one is smaller than a threshold. therefore, we have obtained a three - dimensional reconstruction with the inner voxels as 1 and the boundary voxels having the values between 0 and 1. figure 1 shows the results of mass segmentation and reconstruction of a pair of cc and mlo views. fig 1(a) cc and mlo views ; (b) results of automated mass segmentation ; (c) results of reconstruction viewed at two different angles. (a) cc and mlo views ; (b) results of automated mass segmentation ; (c) results of reconstruction viewed at two different angles. to evaluate the accuracy of the reconstructed algorithm, we project the reconstructed objects to two planes, which are parallel to the cc and mlo views. the mean deviation rate of the projections of the reconstructed masses from the original 2d mass regions is used as the error measure of the algorithm. the mean deviation rates of our proposed algorithm in comparison to the method in1 are shown in table 1. the results are the average of reconstructions of 28 pairs of cc and mlo views. table 1average mean deviation rates of reconstructions of 28 pairs of cc and mlo viewsalgorithmreference proposedmean deviation rate9.47%5.82% average mean deviation rates of reconstructions of 28 pairs of cc and mlo views the 2d mass shapes are first segmented using an efficient region growing technique in cc and mlo views. partial volume estimation is applied on the boundary voxels to get a more accurate 3d representation of the mass. radiologists can use the reconstructed three - dimensional mass coupled with the two - dimensional masses in the cc and mlo views to classify the lesion into malignant or benign. the reconstructed mass shapes can be also used as a visualization tool for medical education. | accurately reconstructing the three - dimensional mass shapes in mammographic images is important for classifying the abnormality into malignant or benign. in this paper, a partial volume compensated reconstruction technique for mass shapes is presented. the two - dimensional shapes of the masses are first automatically segmented using a region growing approach. the 3d mass shapes are then iteratively refined according to an algebraic reconstruction technique. partial volume estimation is applied on the boundary to get a smoother 3d shape. evaluation results show that the proposed algorithm improves the accuracy of the mass reconstruction. |
hypertension commonly accompanies other cardiovascular disease (cvd) risk factors and comorbidities such as obesity, chronic kidney disease, diabetes mellitus (dm), and heart disease. in these high cvd risk patients, early treatment of hypertension to attain blood pressure (bp) goals may be particularly important in order to help reduce cvd risk. around three quarters of patients with hypertension will require combination therapy in order to reach guideline - recommended bp goals [2, 3 ]. in high - risk hypertensive patients, the initial use of combination therapy may facilitate the achievement of bp goals and help to lower the risk of target organ damage [2, 58 ]. this supports a strategy aimed at combining antihypertensive agents with complementary mechanisms of action [3, 9 ]. the combination of an angiotensin ii receptor blocker (arb) plus a thiazide diuretic is endorsed by international hypertension guidelines [4, 5 ]. as a result of evidence from the ongoing telmisartan alone and in combination with ramipril global endpoint trial (ontarget) [10, 11 ], telmisartan is the only arb currently approved for the reduction of cvd morbidity in patients with manifest atherothrombotic cvd (history of coronary heart disease (chd), stroke, or peripheral arterial disease) or type 2 dm with documented target organ damage. a prior multinational, double - blind, and double - dummy study demonstrated that initial treatment with the single - pill combination (spc) of telmisartan 80 mg (t80) plus hydrochlorothiazide (hctz) 25 mg (h25) therapy in patients with grade 2 or 3 hypertension significantly reduced bp and produced higher bp goal attainment compared with t80 alone. the large patient population in that study provided an opportunity for analysis of the response to telmisartan / hctz spc compared with t80 monotherapy treatment within different subpopulations of patients with grade 2 or 3 hypertension. this current analysis evaluated the efficacy and tolerability of spc t80/h25 compared with t80 monotherapy in patients with cvd risk factors : presence of dm, renal impairment, increased body mass index (bmi), and 10-year risk score for chd (based on tertiles), with additional post hoc analyses according to alternative guideline - recommended 10-year chd risk groups. the trial was performed as a 7-week, multinational, phase iv, randomized, double - blind, active - controlled, parallel - group, and forced - titration study in patients with grade 2 or 3 hypertension. the trial was conducted between june 2009 and april 2010 (clinicaltrials.gov identifier : nct00926289). the study design was described in detail elsewhere. in brief, after an open - label, placebo run - in treatment period of 114 days, patients were randomized 2 : 1 to double - blind treatment with spc telmisartan 40 mg (t40)/hctz 12.5 mg or t40 monotherapy for 1 week before uptitration to the target dose of spc t80/h25 or t80 monotherapy, respectively, for the remaining 6 weeks. the trial was conducted under the guidelines specified by the declaration of helsinki and international conference on harmonisation tripartite harmonised guidelines for good clinical practice. the study protocol was approved by the health authority in each country and by the institutional review board or ethics committee of each center. patients were recruited at 102 participating centers in eight countries (bulgaria, china, france, georgia, romania, russia, south korea, and the united states). eligible patients were men or women age 18 years with grade 2 or 3 hypertension (mean seated in - clinic trough cuff systolic bp (sbp) 160 mm hg and diastolic bp (dbp) 100 mm hg) who met the inclusion criteria (described in detail elsewhere). study exclusion criteria included mean sbp 200 mm hg and/or dbp 120 mm hg ; severe renal impairment (serum creatinine > 3.0 mg / dl and/or creatinine clearance 30 mm hg, and the proportion of patients with mean seated trough cuff sbp reduction of > 40 mm hg. the assessment of adverse events (aes) by risk group was not prespecified but is included here and included serious aes and those leading to treatment discontinuation, with intensity and causal relationship to the study treatment determined by the investigator. the objective of these analyses was to investigate whether spc t80/h25 provided greater bp reductions compared with t80 monotherapy among patient subgroups of dm, renal impairment, and at specific cut - off values for bmi and 10-year risk score for chd. efficacy analyses were performed on data from the full analysis set (fas), defined as randomized patients who received at least one dose of double - blind trial medication, and for whom a baseline measurement and at least one postdose trough efficacy measurement during the high - dose double - blind treatment period were available. safety analyses were performed on all randomized patients who received at least one dose of the allocated treatment. the sample size of the trial was calculated to ensure sufficient statistical power to show superiority of spc t80/h25 over t80 monotherapy with respect to the primary and key secondary endpoints within the overall study population. the subgroup analyses were not powered per se to determine the efficacy of sbp h25/t80 versus t80 according to the different patient subpopulations reported here or to test for treatment - by - subgroup interactions. because this was an exploratory, proof of concept analysis and because no adjustments were made to correct for multiplicity, the statistical models were not applied for the purpose of providing statistical significance. p values were calculated for the interaction of subgroup and treatment and are considered statistically significant with a p value of 30 or > 40 mm hg), were evaluated using logistic regression with fixed effects for treatment, country, subgroup, treatment - by - subgroup interaction, and the respective baseline value (dbp or sbp) as a covariate. last trough observation carried forward was employed to account for missing data in the analysis of binary endpoints of bp goal achievement and bp reductions. odds ratios (ors) with 95% cis were calculated and reported for the effect of spc t80/h25 versus t80 monotherapy in different patient subpopulations. the baseline characteristics of the entire cohort of 888 patients randomized and treated in the study were previously described. the efficacy analyses were performed on data from 285 patients in the t80 group and 573 patients in the spc t80/h25 group (fas total, 858). compliance with trial medication was high in both treatment groups (at least 96.6% of patients in either treatment group took 80% to 120% of their trial medication at each visit). the baseline bp characteristics of different patient subpopulations according to treatment group are shown in table 1. more patients did not have a diagnosis of dm than those who had a diagnosis with dm (treated set, n = 779 and n = 109, resp.). more patients had egfr 60 ml / min/1.73 m (n = 824) compared with those with egfr 30 or > 40 mm hg, for treatment with spc t80/h25 versus t80, in the different patient subpopulations, are displayed in figures 2 and 3, respectively. no significant treatment by subgroup interactions were found between patients with dm and those without dm with respect to treatment differences in bp reductions and control rates (table 3 and figures 1, 2, and 3). at week 7, t80/h25 produced greater sbp and dbp reductions compared with t80 monotherapy in patients with or without dm (table 3 and figure 1). the proportion of patients with dm who achieved the guideline - based bp goal (sbp / dbp 30 or > 40 mm hg from baseline to week 7 with spc t80/h25 therapy compared with t80 monotherapy (> 30 mm hg : 68.7% versus 46.6% ; > 40 mm hg : 41.3% versus 23.1%). in patients with dm, these sbp reductions were also achieved in a higher proportion of patients receiving combination therapy versus t80 monotherapy (> 30 mm hg : 62.5% versus 47.1% ; > 40 mm hg : 34.7% versus 29.4%) (figure 3). no significant treatment - by - subgroup interactions were found between patients within different egfr categories with respect to treatment differences in bp reductions and control rates (table 3 and figures 1, 2, and 3). the large cis for patients with low egfr may be related to the low sample size. egfr is expressed in ml / min/1.73 m. at week 7, t80/h25 produced larger sbp and dbp reductions compared with t80 monotherapy in patients within both egfr categories (table 3 and figure 1). spc t80/h25 therapy also allowed higher rates of bp goal attainment (30 and > 40 mm hg were attained in more of the patients who received spc t80/h25 compared with t80 monotherapy, regardless of baseline egfr (> 30 mm hg : 68.7% versus 47.3% in patients with egfr 60 ; 55.6% versus 33.3% in patients with egfr 40 mm hg : 40.9% versus 24.4% in patients with egfr 60 ; 33.3% versus 9.5% in patients with egfr 30 mm hg, which were achieved in a greater proportion of patients receiving spc t80/h25 across all three bmi categories (figure 3). the responses of patients within different 10-year chd risk categories with regard to treatment differences in sbp and dbp reductions are shown in table 3 for the post hoc guideline - driven chd risk categories and also for the prespecified subgroups of chd risk divided by tertiles. ors for treatment differences in sbp / dbp reductions and control rates are displayed in figures 1, 2, and 3 for the guideline - driven chd risk categories. no significant treatment - by - subgroup interactions were found. at week 7, reductions in mean sbp and dbp were greater in patients receiving spc t80/h25 compared with t80 monotherapy across all three chd risk categories (table 3 and figure 1). at week 7, spc t80/h25 produced higher rates of bp goal attainment (30 mm hg, which were achieved in a greater proportion of patients receiving spc t80/h25 across all three chd categories (figure 3). a summary of aes reported during the study according to patient subpopulations is provided in table 4. the proportion of patients experiencing treatment - related aes in spc t80/h25 and t80 monotherapy groups was low across most of the patient subpopulations. the proportion of patients with aes leading to treatment discontinuation was low and comparable across almost all investigated patient subpopulations except the subpopulation of patients with chd3 (two patients (6.7%) had an ae that resulted in discontinuation within this group). only one patient experienced a serious ae during the treatment period and that was in the t40 group prior to uptitration. the overall proportion of patients reporting any ae during treatment with spc t80/h25 was 16.0%. an increase in the rate of aes was not observed with the presence of dm, increasing bmi, or increasing chd risk. the frequency of any ae was similar across many of the assessed subpopulations ; however, in the subpopulation of patients with dm, the rate was 6.9%, in patients with a low bmi < 25 kg / m, the rate was 22.7%, and in patients with a low egfr < 60 ml / min/1.73 m, the rate was 33.3%. in the overall study population, and irrespective of cause, the five aes most frequently occurring under treatment with spc t80/h25, as determined by number of patients receiving spc t80/h25 with this ae, were dizziness (1.9% of patients), nasopharyngitis (1.4%), pollakiuria (0.9%), vertigo (0.7%), and cough (0.7%). among patients with dm receiving spc t80/h25, the most frequently reported aes, as determined by number of patients with this ae, each occurring in one patient (1.4%), were anal abscess, hypotension, elevated blood uric acid, cough, hypertriglyceridemia, and proctalgia. in patients with egfr < 60 ml / min/1.73 m who received treatment with spc t80/h25, the most frequently reported ae was dizziness (n = 2 patients, 5.6%). other aes occurring in this subpopulation with a frequency of 2.8% (n = 1 patient) were upper respiratory tract infection (rti), nasopharyngitis, ear infection, headache, syncope, hypotension, cough, oropharyngeal pain, abdominal pain, irritable bowel syndrome, myalgia, osteoarthritis, asthenia, and polyp. in patients with bmi 30 kg / m who received spc t80/h25, the most frequent ae was nasopharyngitis (n = 4 patients, 1.7%), followed by viral rti and constipation (each n = 3 patients, 1.2%). in high chd risk patients (chd3, 20%), the most frequent aes, each with two patients (2.6%), were upper rti, headache, hiccups, pollakiuria, asthenia, and blood alkaline phosphatase increase. the overall rate of aes deemed by the study investigator to be treatment related was 4.6% in the spc t80/h25 group. a difference in the frequency of treatment - related aes compared with the overall study population was observed in patients with dm (2.8%), patients with egfr < 60 ml / min/1.73 m (16.7%), patients with bmi < 25 kg / m (7.8%), and patients in the middle chd risk category chd2 (6.5%). the most frequent drug - related aes in the t80/h25 treatment arm were dizziness and pollakiuria (each 0.7%), syncope, and blood uric acid increase (each 0.5%). a breakdown of the frequencies of these four aes within each subpopulation is provided in table 5. the presented results reflect prespecified and post hoc subgroup analyses of efficacy and safety data obtained during a 7-week, multinational, phase iv, randomized, double - blind, active - controlled, parallel - group, and forced - titration study in patients with grade 2 or 3 hypertension. in this analysis, spc t80/h25 similarly reduced sbp and dbp across specific subgroups of patients with cvd risk factors of dm, being overweight / obese, renal impairment, and chd risk, and those without these cvd risk factors. additionally, spc t80/h25 consistently provided greater reductions in sbp and dbp over 7 weeks compared with t80 monotherapy, irrespective of the presence or absence of these cvd risk factors. spc t80/h25 increased rates of bp goal attainment in all cvd risk groups, including patients with renal impairment, and in overweight to obese patients. patients with dm were approximately twice as likely to reach a guideline - based bp goal (sbp / dbp < 130/80 mm hg) over 7 weeks with spc t80/h25 than with t80 monotherapy (16.7% versus 8.8%), although the sample size of patients with dm was small. a limitation of this study is that it was designed with a relatively short duration of treatment (7 weeks). due to the aforementioned reasons, the results obtained from these subgroup analyses should be interpreted under consideration of their exploratory character. however, this is the first report on the efficacy of spc t80/h25 in specific patient subpopulations according to the presence or absence of cvd risk factors (dm, being overweight / obese, renal impairment, and high chd risk). bp control is important in all hypertensive patients but is especially pertinent in those with additional cvd risk factors, since elevated bp is associated with significant increases in cv risk. it is recognized that combination therapy can reduce bp to a greater extent and achieve bp goals more promptly, so high - risk individuals are likely to benefit from protective interventions without any delay. initial combination therapy is increasingly recommended by guidelines, particularly for patients with cvd risk factors, and well - tolerated combinations can facilitate improved treatment adherence, a key factor in achieving successful bp control. outcome studies have demonstrated that for every 20 mm hg reduction in sbp, there is a 4050% reduction in cvd. the degree of bp reductions observed with spc t80/h25 during this study would be expected to reduce cvd morbidity and mortality among patients at high risk for cvd [5, 6 ]. these analyses indicate that spc t80/h25 is an effective and generally well - tolerated antihypertensive combination that is suitable for treating a wide range of patients with grade 2 or 3 hypertension, in the presence or absence of additional cvd risk factors. these analyses indicate that in patients with grade 2 or 3 hypertension, spc t80/h25 consistently provided greater bp reductions and increased attainment of bp goals compared with t80 monotherapy among patient subgroups with cvd risk factors. the majority of patients with hypertension will require combination therapy to reach bp goals [5, 18 ]. the results of this trial indicate that treatment with spc t80/h25 in patients with grade 2 or 3 hypertension provides greater bp reductions and higher rates of goal attainment compared with t80 monotherapy. antihypertensive treatment with the t80/h25 single - pill combination is effective and generally well tolerated, irrespective of the presence of additional cvd risk factors. | objective. report of prespecified and post hoc subgroup analyses of a randomized, controlled trial comparing telmisartan 80 mg / hydrochlorothiazide 25 mg (t80/h25) combination therapy with t80 monotherapy, according to the presence of cardiovascular disease (cvd) risk factors. methods. hypertensive patients were randomized (2 : 1) to receive t80/h25 or t80 for 6 weeks, following a 1-week, low - dose, and run - in period. systolic blood pressure (sbp) and diastolic bp reductions and bp goal achievement were evaluated in patients with cvd risk factors : presence of diabetes mellitus (dm), renal impairment, increased body mass index (bmi), and 10-year estimated risk for coronary heart disease (chd). results. in total, 888 patients received treatment. overall, t80/h25 therapy significantly reduced sbp more than t80 monotherapy, irrespective of patient subgroup. in patients with dm, renal impairment, high bmi, and high chd risk, bp goal achievement rates (< 140/90 mm hg) at week 7, among those treated with t80/h25, were 52.8%, 52.8%, 50.6%, and 38.5%, respectively. more patients with dm reached a guideline - based bp goal (< 130/80 mm hg) at 7 weeks with t80/h25 than with t80 monotherapy (16.7% versus 8.8%). rates of treatment - related adverse events were low and comparable across patient subgroups. conclusions. antihypertensive treatment with t80/h25 single - pill combination is effective and generally well tolerated, irrespective of the presence of cvd risk factors. |
the crispr / cas system is one of several defense systems that prokaryotes can use to prevent invasion by foreign genetic elements (for a more detailed description see recent reviews). the function and significance of this system was only recently discovered, and it differs from other known defense systems because it is heritable, can adapt to new invaders and it is sequence specific. the system uses a set of proteins and short rna molecules, termed cas proteins and crrna, respectively. the crrnas are processed from a longer pre - crrna that is encoded in the crispr locus, a peculiar series of short, directly repeated sequences between which are unique spacer sequences (fig. 1). the latter sequences originate from previous (and unsuccessful) invading elements, which were degraded. thus the crispr locus is a memory of previously encountered invaders to which the cell has adapted and is immune. the pre - crrna is encoded in the crispr locus, which consists of repeat (in black) and spacer sequences (colored). in some cases the repeat sequences are able to fold into stem loop structures. crispr locus transcription starts from the leader region (black arrow) yielding the pre - crrna, which is subsequently processed to generate the crrnas. immune defense proceeds in three stages : (1) adaptation, (2) expression and (3) interference. in the first stage, the nucleic acid of the invading element enters the cell, and is immediately recognized as a foreign element. a piece of the invader dna, termed protospacer, is selected and then integrated into the crispr locus as a new spacer (fig. 2). note that the sequence is called protospacer as long as it is still part of the invader. selection as a new spacer depends on the presence of a certain neighboring sequence, the protospacer adjacent motif (pam). the invading foreign nucleic acid is recognized by cas proteins and a piece of the invader dna (termed the protospacer, shown in red) is selected to be integrated as a new spacer into the crispr locus. a prerequisite to be selected as a new spacer is the presence of the pam sequence (shown in light blue) adjacent to the protospacer. in haloferax the pam sequence has to be located upstream of the protospacer sequence (directly 5 to it). this motif is not only important for spacer selection but also for accurately targeting the defense reaction. in the second stage of the defense reaction, the crispr locus is expressed, generating a pre - crrna which is subsequently processed to short crrnas, each of which is specific for a single invader (fig. 1). together with the cas proteins, this crrna recognizes the invader in the third stage of the defense reaction. the spacer sequence of the crrna base pairs with the invader sequence from which it was derived, rendering the defense sequence specific. the crispr / cas system of haloferax consists of eight cas proteins and three crispr rnas, and phylogenetically they belong to the type i - b group of crispr / cas systems. we could show that all three crispr rnas are constitutively expressed and processed, indicating that although the strain has been in the laboratory for more than 30 y and probably did not encounter any invaders during that time, the defense system has remained active. comparison of the spacer sequences of the three haloferax crispr loci to sequences deposited in the public sequence databases showed only two matches. one spacer matched to the haloferax genome within an annotated open - reading frame (hvo_0372) encoding a protein of unknown function. the 5 part of the spacer was identical to the genomic sequence, but the 3 part showed nine mismatches, which is probably sufficient to prevent autoimmune targeting by the crispr / cas system. the second spacer was similar to an environmental sequence recovered from a salt lake in australia (lake tyrrell) and differed at only four positions, distributed along the sequence. the 5 part of the sequence matches perfectly, and in e. coli it has been shown that a perfect match in the 5 sequence (termed the seed sequence) is essential for recognition and target degradation. it is likely then, that invading elements containing this sequence would be targeted by the crispr / cas system. the low number of spacer matches to known sequences probably reflects that relatively few haloarchaeal viruses have been isolated and sequenced. another factor is that the ds2 strain was isolated from the dead sea in 1974. viral populations would have changed in the 40 y since, making it unlikely that the original matching sequences would now be common enough to have been recovered and sequenced. to investigate the haloferax defense system, we developed a plasmid invader system similar to the one described for sulfolobus. the invader plasmid contained a piece of invader dna, and an adjacent motif marking the dna as invader the so - called pam sequence. as invader dna, we chose a spacer sequence included in the haloferax crispr loci, and this was cloned into a haloferax shuttle vector (fig. the pam sequences used by haloferax (or by other haloarchaea) were not known before this study, and it was also unknown if they are located upstream or downstream of the protospacer. so we tested all possible di- and trinucleotide combinations (pam sequences are generally 25 nucleotides long) (fig. in addition, the plasmid contained a marker gene allowing growth without uracil, so only cells carrying the plasmid are able to grow on selective media. if the defense mechanism is active against the plasmid, then it is destroyed (together with the selection marker) and such cells can not grow on selective medium, which results in a severe (about 100-fold) reduction of transformation efficiency. using this approach six different trinucleotide sequences were identified that were active in triggering the defense response, which is currently the highest number of pams identified for a single crispr repeat group. in addition, we could show that this motif has to be located upstream of the protospacer sequence to activate the defense reaction (fig. figure 3. an artificial invader for haloferax. to challenge the haloferax defense system, we generated an artificial invader consisting of a spacer sequence (from one of the haloferax crispr loci, shown in red) and an adjacent sequence with all possible two- and three - nucleotide combinations as potential pam sequences (shown in light blue). these were cloned into a haloferax plasmid vector that also carried a selection marker pyre2 (which makes growth of the pyre2-haloferax recipient strain independent of supplied uracil). (a) initial experiments were performed with potential pam sequences up- and downstream of the spacer sequence. (b) pam localization experiments showed that the pam sequence is only required upstream of the spacer sequence and thus we positioned pam sequences upstream only. while the majority of cells challenged with these six types of invader plasmids were unable to grow without uracil, a low level of background colonies were observed. when examples of these were analyzed, the majority was found to have mutations in, or complete deletions of the cas gene cluster, thereby inactivating the defense system and allowing the cell to maintain the plasmid. to gain more insight into the pam sequences used for adaptation, we searched for other haloarchaea for which recent metagenomic data were available. we used the spacer sequences encoded in the haloquadratum walsbyi crispr loci to look for matches in the databases. eight matches were found and the pam sequences obtained for them were in seven cases ttc, which is identical to one of the six pam sequences we found experimentally for haloferax. walsbyi contains a crispr / cas type i - b system, with crispr repeat sequences that are very similar to those of haloferax (fig. further comparison with other haloarchaea showed that those that are available in the crispr database (crispr.u-psud.fr/crispr/, july 2012) and which encode cas proteins all belong to the type i - b crispr / cas group. blast searches with the haloferax repeat sequence show that in 20 of the 32 haloarchaeal genomes currently deposited in the nbci database (www.ncbi.nlm.nih.gov/sutils/genom_table.cgi, august 2012) and in the jgi img database (http://www.jgi.doe.gov/), the repeat sequence is well conserved, with only one to five mismatches between the repeats from the different haloarchaeal organisms (fig. 4). have been reported to be connected to the repeat sequence and to the crispr / cas type it is reasonable to expect that these haloarchaeal sequences require the same pam sequence. volcanii chromosomally encoded crispr locus c differs from the other two crispr loci (p1 and p2) by one nucleotide. the repeat sequence of the chromosomally encoded crispr locus (locus c) from hfx. volcanii was compared (blastn) with the haloarchaeal genomes deposited in the ncbi database (www.ncbi.nlm.nih.gov/sutils/genom_table.cgi, august 2012) and to the jgi img database (http://www.jgi.doe.gov/). in 20 of the 32 additionally available genomes at least one crispr locus was found where the repeat was conserved, with only one to five mismatches. all of the repeat sequences shown are part of putative crispr loci that contained multiple repeats, and were positively identified as crispr loci by the crispr finder algorithm at (http://crispr.u-psud.fr/). whether all of these loci represent intact and functional crispr / cas systems is yet to be determined. distant, a cas gene cluster is only found elsewhere in the genome, and is adjacent to another crispr locus with a different repeat sequence. unknown, the genome sequence remains in numerous contigs, and it is not known if a cas gene cluster is nearby to the crispr locus containing this repeat sequence. after the identification of cas gene clusters their proximity to the crispr locus was determined by homology searches (e.g., the cas gene finder option at crispr finder), followed by manual inspection of the annotated genome sequence. classification of cas gene clusters was done according to makarova.cas gene clusters are considered near when they are adjacent to the crispr locus and distant if found elsewhere in the genome (where they were usually adjacent to another crispr locus with a different repeat sequence). sulfurifontis remains in numerous contigs, so the proximity of cas genes to this locus is currently unknown. in our study we analyzed the requirements for the crispr / cas defense reaction and identified six different pam sequences that were able to trigger this reaction. such a high number of permissible pam sequences could be advantageous when defending against related invading elements, as it tolerates individual mutations as well as clonal divergence, making the system more broadly effective. this makes sense because the prokaryotic defense mechanism will remain active against virus mutants that otherwise could avoid immune recognition. in contrast, the few data we collected in silico concerning pam motifs for haloquadratum walsbyi revealed only two pam motifs. since hqr. volcanii have very similar repeat sequences and belong to the same crispr / cas type they might have similar pam requirements. taken together, the evidence suggests that the adaptation step is more restrictive in terms of its pam requirements compared with the interference step. in streptococcus thermophilus (crispr / cas type ii), a similar recognition of several different pam sequences on invader plasmids was observed. the pam requirements of crispr / cas type iii systems have not yet been reported, but it has been shown in staphylococcus epidermidis, that the protospacer adjacent sequence of this system must be different from the repeat sequence located upstream of the spacer in the crispr locus, so ensuring differentiation between self dna (crispr locus) and the foreign genetic element. a clearer picture of how this immune reaction operates will be revealed as more data are collected, from all of the known crispr / cas systems. | prokaryotes have developed several strategies to defend themselves against foreign genetic elements. one of those defense mechanisms is the recently identified crispr / cas system, which is used by approximately half of all bacterial and almost all archaeal organisms. the crispr / cas system differs from the other defense strategies because it is adaptive, hereditary and it recognizes the invader by a sequence specific mechanism. to identify the invading foreign nucleic acid, a crrna that matches the invader dna is required, as well as a short sequence motif called protospacer adjacent motif (pam). we recently identified the pam sequences for the halophilic archaeon haloferax volcanii, and found that several motifs were active in triggering the defense reaction. in contrast, selection of protospacers from the invader seems to be based on fewer pam sequences, as evidenced by comparative sequence data. this suggests that the selection of protospacers has stricter requirements than the defense reaction. comparison of crispr - repeat sequences carried by sequenced haloarchaea revealed that in more than half of the species, the repeat sequence is conserved and that they have the same crispr / cas type. |
between 1996 and 2010, the number of emergency department (ed) visits in the united states (us) increased by 44% [1, 2 ]. while some patients seek ed care because of convenience, many use emergency services due to lack of access to nonemergency providers. access to timely, ambulatory care services outside the ed depends on numerous factors, including insurance coverage and having a usual source of care (usc). as fewer physicians accept medicaid, it is increasingly difficult for some enrollees to find a usc, leading to an increased number of nonurgent ed visits [5, 6 ]. simultaneously, medicaid expansion as outlined in the affordable care act (aca) is driving fears that access for the publicly insured will suffer. patients treated in the ed for nonurgent issues are often unable to receive primary care outside the ed [7, 8 ]. consequently, addressing those barriers can facilitate timely treatment and improve overall allocation of scarce emergency resources. while the relationship between patients with nonurgent complaints and crowding is unclear, increased ed volume has been associated with increased mortality, delays in treatment, and increased rates of patient elopement. moreover, rising uninsured utilization may contribute to the increasing reluctance of specialists to provide on - call emergency coverage [1012 ]. policymakers need to understand the relationship among insurance coverage, emergency care, and non - ed ambulatory care services in order to appreciate which barriers exist and which populations are affected. we agree with prior research demonstrating that those with uscs are more likely to visit eds compared to those without uscs but contend that the existing data do not account for baseline health. many point to this research as evidence that having a usc does not decrease ed use without acknowledging that those with uscs also have poorer health and are more likely to visit all ambulatory care settings. this analysis adds to the existing literature by adjusting for baseline health in two ways. first, we limit our sample to those with at least one ambulatory care visit. because we are interested in where patients are receiving care, we exclude patients who do not seek care typically patients with excellent health and who lack uscs. second, we use a different outcome measure whether a person had half or more of their ambulatory care visits to an ed (i.e., the number of ed visits divided by the total number of ambulatory care visits is equal to or greater than 0.50). studies have documented that having a usc is associated with an increased likelihood of having 1 or more ed visits during a year without controlling for baseline health. to determine whether having a usc affects the setting in which care is received for a patient in poor health, calculating the likelihood of an ed visit is less revealing because their poor health increases the odds that they will seek care. instead, our approach provides a more valid assessment of whether having a usc affects the setting in which care is received. prior research has demonstrated that having a usc decreases the percentage of ambulatory care visits to eds compared to those without a usc. in this trend analysis, we assess the impact of insurance type and having a usc on where patients receive care. the specific objectives of this analysis are todetermine whether having a usc decreases the percentage of persons relying mainly on eds for ambulatory care among the uninsured, privately insured, and those with medicaid, determine whether that percentage has changed over time for each insurance group. determine whether having a usc decreases the percentage of persons relying mainly on eds for ambulatory care among the uninsured, privately insured, and those with medicaid, determine whether that percentage has changed over time for each insurance group. we conducted a trend analysis of factors influencing the settings in which patients seek care from 2000 to 2011. for each year we used cross - sectional data from the medical expenditure panel survey (meps), a us survey that estimates health services use, medical expenditures, and sources of payment, including insurance coverage. this anonymous, publicly available data set is weighted, allowing estimation of national results. institutional review board approval was neither required nor obtained. because of our interest in care seeking patterns among uninsured and medicaid patients and desire to limit income 's confounding effect, we only included respondents with household incomes less than 200% of the federal poverty level (fpl). because medicare ensures near universal coverage for most elderly adults in the us, we further restricted our analysis to persons aged 1864. furthermore, we were interested in the health behaviors of respondents using health care services ; therefore, we only included those with at least one ambulatory care visit. our outcome measure is a dichotomous measure equal to one if half or more of a person 's ambulatory care was obtained from an ed. in the meps, ambulatory care visits are self- or proxy - reported visits to an outpatient, office - based, or ed setting (which included ed visits resulting in hospitalizations). health insurance status was classified into three categories : privately insured, medicaid, and uninsured. medicaid is a us insurance program for persons of all ages aimed to provide health insurance to those with insufficient resources and is jointly funded by states and the federal government. individuals were considered privately insured if at any point in a year they were covered by private insurance. persons were classified as covered by medicaid if at some point in a year they had medicaid but never private insurance. the uninsured were individuals that at no point in a year were covered by private or public insurance. usc was ascertained by the question : is there a particular doctor 's office, clinic, health center, or other place that you usually go to if you are sick or need advice about your health ? respondents can indicate that the ed is their usc, but the percentage of people in this cohort is small (0.46%). in multivariate models, we included controls for gender, region, age, and self - reported health. for the baseline year (2000) and final year (2011), we reported the mean number of ed visits, mean number of ambulatory care visits, the mean percentage of ambulatory visits to an ed, and the percentage of persons with half or more of their visits to an ed. the results are stratified by insurance type and usc. in order to determine changes in our outcome measure, for each usc - insurance combination, we calculated year estimates and logistic regression models adjusting for age, race / ethnicity, gender, region, and self - reported health. we opted to use a dichotomous measure instead of the continuous measure capturing the proportion of visits to eds because of the skewness of this latter measure, with a large number of zeroes and ones. in addition to logistic regression models, we estimated ordinary least squares regression models and multinomial logistic regression models. for all subgroups, we estimated models treating survey year as a continuous measure and a series of dichotomous year indicators. using coefficients from these models, we obtained adjusted rates for the percentage relying on eds. while separate models were estimates by insurance status, we used means from the sample as a whole to calculate adjusted rates. with either approach, when comparing differences between groups, we used the independent sample t - test for continuous variables. in the 20002011 meps data, there were 231,683 1864-year - old respondents. restricting this sample to persons with income below 200% fpl excluded 145,953 respondents. additional 32,425 respondents were excluded because they had no ambulatory care visits during the year and further 4,680 were excluded because they were covered by medicare. after these restrictions, our sample size was 48,653. excluding cases with missing values for the covariates, 47,565 survey respondents from 2000 to 2011 remained. regardless of insurance type, patients with uscs report more ambulatory care visits compared to patients without uscs, and in 2000, for patients with medicaid, those with uscs had more visits to eds compared to those without uscs (table 1). however, having a usc is associated with a smaller percentage of ambulatory care visits to an ed and a lower likelihood of having most ambulatory care visits to an ed. the results from the logistic regression analyses reveal other factors associated with a greater reliance on eds. compared to non - hispanic white medicaid patients, black medicaid patients are more likely to rely mainly on eds (or = 1.44 (95% ci 1.241.68), p < 0.01). we obtained a similar estimate of this race difference for the subset of uninsured and privately insured adults. women, older persons, and non - southerners are generally less likely to have half or more of their ambulatory care visits to eds, across all types of insurance statuses. in 2011, after adjusting for the aforementioned variables in addition to ethnicity and region of the country, 17.6% of medicaid beneficiaries without uscs had half or more of their ambulatory care visits to eds compared to only 7.8% among those with uscs (figure 1). between 2000 and 2011, the percentage of medicaid beneficiaries without uscs relying mainly on an ed increased from an estimated 13.0% to 17.6%. because of the relatively small number of medicaid patients without a usc, this increase is not quite significant (p = 0.06). the difference in reliance on ed between those with and without a usc is greatest among the uninsured (figure 2). after adjustments, in 2011, 22.4% of the uninsured without a usc had half or more of their visits to an ed, compared to 8.2% for those with a usc. in 2011, 9.3% of the privately insured without a usc had half or more of their visits to an ed, compared to 4.5% for those with a usc (figure 3). the percentage of the uninsured and privately insured without uscs relying mainly on eds did not significantly change between 2000 and 2011. our results indicate that, for all insurance groups, lacking a usc is associated with a greater reliance on eds but that the percentage lacking a usc and relying on eds has not increased significantly over time. moreover, the utility of having a usc differs for medicaid patients compared to the privately insured. although the percentage with a usc is comparable for the privately insured and those with medicaid, medicaid enrollees are more likely to seek care from eds. others have found that patients without a usc are less likely to make healthcare visits. before excluding persons without a visit, we were able to replicate this finding but note that those without uscs are also less likely to seek any care as many are healthy. we limited the analysis to patients who have at least one ambulatory care visit since only patients using health care services decide which sites are accessed. furthermore, when we restricted the sample to patients with at least one ambulatory care visit, we found that medicaid patients lacking uscs were more likely to rely on eds compared to those with uscs. in light of insurance expansion, policymakers can learn from the events unfolding in massachusetts where the newly insured initially experienced difficulty accessing uscs. in 2006, reform in massachusetts dramatically decreased the uninsured through an individual mandate, medicaid expansion, availability of publicly subsidized insurance obtained through a health insurance connector, and a provision requiring employers to contribute to employee premiums. following implementation, studies indicated ed utilization did not decrease, causing some to question the legislation 's effectiveness. in 2008, those of low income were more likely to report barriers as ed users were more likely than nonusers to be on public or nonemployer sponsored insurance and have been told that providers were not accepting their insurance or new patients. concurrently, primary care physician (pcp) panels are full statewide. while 70% of massachusetts family physicians were accepting new patients in 2007, that figure decreased to 60% in 2008. of those accepting new patients, the average wait time was 44 days, which increased from 34 days in 2007. the percentage of internists accepting new patients the massachusetts experience shows that reform can decrease the uninsured, but our analysis suggests that those of low income particularly if on medicaid may have difficulty accessing non - ed ambulatory care as they become newly insured under reform. furthermore, the trend towards increasing use of eds by medicaid patients, who will account for some 11 to 16 million of the 40 million newly insured, suggests ed demand will continue to be a problem. we hypothesize that increasing access to primary care may free up scarce emergency resources though our analysis did not specifically address this question. the supply of pcps and provider maldistribution will increase the likelihood that providers in any given area will accept new patients and be available to meet community needs. practices will need to expand availability to accommodate patients wanting to see their physicians after work. embracing principles of the medical home (a primary care model that is patientcentered, comprehensive, teambased, coordinated, accessible, and focused on quality and safety) will allow patients and physicians to jointly determine the appropriate setting and timing of care. studies indicate higher medicaid acceptance is associated with higher medicaid reimbursement, lower medicaid managed care penetration, and less perceived paperwork burden. our analysis suggests that medicaid expansion without medicaid reform may create a large insured population that may experience barriers to access. several limitations affect the internal and external validity of our study. as with any survey data, our findings are subject to recall bias, and these self - reported data do not provide means of validation. furthermore, the meps does not allow us to comment on whether ed visits were necessary. therefore, this analysis can not determine whether having a usc or insurance type affects the appropriateness of emergency utilization. the survey participants are between the ages of 18 and 64 and earn less than 200% of the fpl, limiting the generalizability of our findings. further research is needed to determine why lacking a usc is associated with a greater reliance on eds. if inadequate access to primary care is the primary mechanism, then we need to understand how workforce adequacy as well as state medicaid policy, particularly around physician payment, may impact the likelihood of medicaid recipients having a usc. studies are also needed to explore the relationship between new delivery models (such as medical homes which promote comprehensive continuous relationships) and ed utilization. geographic analyses are needed to identify variation in ed utilization and differential access to uscs, with qualitative explorations of causes. finally, more studies are needed on the influence of insurance coverage and usc on the urgency of ed visits. those who lack uscs, particularly the uninsured and medicaid enrollees, are more likely to rely on eds. health systems should support policies that expand access to uscs for low - income patients. | background. finding a usual source of care (usc) is difficult for certain populations. this analysis determines how insurance type and having a usc affect the settings in which patients seek care. methods. in this cross - sectional study of the 20002011 medical expenditure panel surveys, we assessed the percentage of low - income persons with half or more of their ambulatory visits to the emergency department (ed). respondents were stratified based on insurance type and presence of a usc. results. in 2011, among medicaid enrollees without uscs, 21.6% had half or more of their ambulatory visits to eds compared to 8.1% for those with uscs. among the uninsured without uscs, 24.1% went to an ed for half or more of their ambulatory visits compared to 8.8% for those with uscs in 2011. among the privately insured without uscs, 7.8% went to an ed for half or more of their ambulatory visits compared to 5.0% for those with uscs in 2011. these differences remained in multivariate analyses. conclusions. those who lack uscs, particularly the uninsured and medicaid enrollees, are more likely to rely on eds. |
intrathecal chemotherapy combined with systemic chemotherapy has been used for both the prophylactic and therapeutic treatment of hematologic malignancies in the central nervous system. however, intrathecal chemotherapy has been associated with neurotoxic adverse effects, including myelopathy, encephalopathy, seizure, and cauda equina syndrome. although myelopathy is the most common adverse effect associated with intrathecal chemotherapy, magnetic resonance imaging (mri) has rarely been reported in the literature. here, we report a case of a 35-year - old female presenting with paraparesis, sensory ataxia, and loss of position sense in her lower limbs after systemic high - dose methotrexate and cytosine arabinoside (hd - mtx / ara - c) therapy and intrathecal ara - c therapy. spinal t2-weighted (t2-wi) mri demonstrated abnormal intensity lesions in the dorsolateral column, mimicking subacute combined degeneration (scd). in addition, we assessed diffusion tensor / kurtosis imaging (dti / dki) and q - space imaging (qsi) metrics in this myelopathy. a 35-year - old female underwent partial tumor resection and postoperative steroid therapy for a cerebellopontine angle tumor. cranial mri revealed a lesion with abnormal intensity in the third ventricle, and transventricular endoscopic biopsy and ventriculostomy were performed. histological examination revealed the characteristic findings of a diffuse, large b - cell lymphoma. a course of systemic hd - mtx / ara - c treatment diminished the tumor on brain mri and improved the clinical symptoms. the patient received an additional 3 courses of hd - mtx / ara - c and repetitive lumbar intrathecal ara - c (100 mg) and dexamethasone (4 mg). one month after the first round of intrathecal chemotherapy, the patient complained of bilateral numbness in her lower legs despite normal spinal mri. she received a repetitive course of intrathecal ara - c (40 mg) and prednisolone (4 mg) with or without intrathecal mtx (15 mg) for 6 months, along with whole - brain radiotherapy for 1 month. nine months after the first round of intrathecal chemotherapy, the patient gradually developed an unstable gait. neurological examination revealed a mild lower - limb weakness and a sensory ataxic gait with a positive romberg 's sign. pinprick, light touch, vibration sensation, and proprioception were impaired below the level of the th10 dermatome. deep tendon reflexes were normal in all limbs, but diminished abdominal reflexes and bilateral extensor planter responses were noted. macrocytic anemia was present : red blood cells 2.64 10 l, hemoglobin 9.7 g / dl, mean corpuscular volume 112.5 fl, with a reduced thrombocyte count. the results of routine biochemistry, autoantibodies, and a thyroid function test were unremarkable. her serum vitamin b12 level was in the lower limits of normal [286 pg / ml (normal range 180914) ], and her serum levels of folate and copper were slightly reduced [2.8 ng / ml (normal range > 3.1) and 65 mg / dl (normal range 68128), respectively ]. cerebrospinal fluid (csf) studies revealed a white blood cell count of 1/l, a protein level of 24 mg / dl, and increased levels of myelin basic protein (mbp ; 502 pg / ml). nerve conduction velocities and compound muscle action potentials were normal, while somatosensory evoked potentials demonstrated a normal n 20 latent time (19.50 ms) but prolonged p 40 responses (44.1 ms). the patient 's spinal t2-wi mri demonstrated abnormal signal intensity in the bilateral and dorsal columns in the thoracic cord, extending from th3 to th10 (fig. we performed dti, dki, and qsi and calculated each parameter (as described previously [2, 3, 4 ]), in the regions of interest on the dorsal column at th79 and c35 of the patient, along with 4 control subjects. the results at th79 of the patient and control subjects (mean standard deviation) were as follows : apparent diffusion coefficient (adc) (10 mm / s) : 0.55 and 1.16 0.10 ; fractional anisotropy (fa) : 0.41 and 0.61 0.14 ; lambda (1) (10 mm / s) : 0.78 and 2.11 0.19 ; (2 + 3)/2 (10 mm / s) : 0.45 and 0.69 0.19 ; full width half maximum (m) : 17.45 and 20.32 0.34 ; mean diffusional kurtosis (mdk) : 1.65 and 0.85 0.15. we also obtained mdk at c35:1.72, 1.21, 0.78 and 1.00 0.11 (fig. 1, fig. the disease course, hematological findings, and mri suggested a diagnosis of demyelinating myelopathy due to the combined effect of intrathecal chemotherapy and vitamin and mineral deficiencies. the patient 's condition did not deteriorate, but also did not improve despite therapy with intravenous administration of vitamin b12 and folic acid. seventeen months after the first round of chemotherapy, the patient died of recurrent brain lymphoma. myelopathy has been reported as a significant adverse effect of combination therapy with intrathecal ara - c and systemic hd - mtx [5, 6 ]. risk factors for the development of intrathecal chemotherapy - related myelopathy include a high - dose and/or frequent exposure to central nervous system - directed therapy. in most patients, paraplegia with bowel and urinary disability is commonly prominent, developing within a few days to several months after intrathecal chemotherapy. mri findings of intrathecal chemotherapy - related myelopathy include high signal intensity in t2-wi within the central and posterior columns, cord swelling, gadolinium enhancement restricted to the lateral columns, and the features of arachnoiditis. our patient presented with a slowly developing weakness and an impairment of position sense in the lower limbs during repetitive intrathecal ara - c combined with hd - mtx therapy. her csf cell count was unremarkable with increased mbp levels, as previously seen in myelopathy due to intrathecal chemotherapy. conventional mri findings consisted of abnormal signal intensity in the bilateral and dorsal columns in the thoracic cord, extending from th3 to th10, mimicking scd of the spinal cord. however, our patient did not present with any other clinical features of scd, such as peripheral neuropathy and dementia. reported 2 cases of intrathecal mtx - related myelopathy that mimicked the mri findings of scd, as seen in our patient. in both patients, described the pathological findings of intrathecal myelopathy as microvacuolization, axonal swelling, and the loss of myelin within the white matter of the spinal cord. the mechanisms underlying chemotherapy - related myelopathy mimicking scd are still unknown. in a rabbit model, intrathecally injected ara - c penetrated the peripheral white matter and geniculate body in the spinal cord, suggesting that ara - c may have toxic demyelinating effects on the dorsolateral columns. it is well known that although vitamin b12 and folate acid levels are in the lower limits, measuring homocysteine and methylmalonic acid levels can be useful in diagnosing patients with scd who have not received treatment. we could not confirm homocysteine and methylmalonic acid levels in our patient without vitamin treatment ; therefore, the possibility that a deficiency in several vitamins and minerals may have been associated with the development of scd should be considered in our patient [13, 14, 15, 16 ]. furthermore, mtx is a folic acid antagonist and causes chemotherapy - related myelopathy [1, 17 ]. therefore, a deficiency in vitamins and minerals may have worsened the spinal toxicity of chemotherapy in our patient. our patient showed a decreased adc and fa at the th79 levels due to markedly decreased 1, which indicated the preferential restriction of water diffusion along the long tracts such as the corticospinal tract and dorsal column. increased mdk indicated increased microstructural complexity. these results showed that normal and well - organized white matter structures were damaged predominantly in the long tracts. the patient also showed an increased or decreased mdk at levels c35, in spite of the absence of substantial intensity abnormalities on conventional and advanced diffusion mri. taken together, conventional and advanced mri findings in our patient suggested that cytotoxic demyelination had occurred along the lateral and posterior columns from the lower cervical down to the middle thoracic cord. in conclusion vitamin and mineral deficiencies may have played a role, in part, in the pathomechanisms of myelopathy in this patient. spinal diffusion mri revealed cytotoxic demyelination along the posterior columns, which assisted in the diagnosis of demyelinated myelopathy. our findings suggest that spinal dti, qsi, and dki are useful tools in the diagnosis of chemotherapy - related myelopathy. | chemotherapy - related myelopathy mimicking subacute combined degeneration (scd) has rarely been reported. we encountered a 35-year - old female with sensory ataxia after intrathecal chemotherapy. spinal magnetic resonance imaging showed localized abnormal signal areas in the lateral and dorsal white matter, mimicking scd. diffusion imaging showed restricted water diffusion and increased microstructural complexity, and cerebrospinal fluid analysis showed increased levels of myelin basic proteins, indicating demyelinating myelopathy. advanced diffusion imaging can provide more information on the microstructure of chemotherapy - related myelopathy. |
closure of large left to right cardiac shunts with preexisting significant pulmonary arterial hypertension (pah) is usually accompanied by the hazards of post - operative residual pah, pulmonary hypertensive crisis and right ventricular dysfunction. different pulmonary vasodilators have been used to treat high postoperative pulmonary artery (pa) pressure and minimize related adverse consequences. sildenafil, an oral selective phosphodiesterase inhibitor (pdei) type 5, is proven to have pulmonary vasodilatory effect in various types of pulmonary hypertension (ph) in children and adults[15 ]. another potential therapeutic option, intravenous or nebulized milrinone, is a selective type 3 pdei, which has successfully been used in children with high pa pressure[68 ]. few studies have compared the isolated use of either of the medications on post - operative pah in children. the aim of this prospectively designed study was to compare the efficacy of monotherapy with either of the drugs and the combination therapy on pa pressure regulation after pediatric cardiac surgery. we hypothesized that combination of sildenafil and milrinone provides superior vasodilatory and consequent anti - pulmonary hypertensive effects in patients with congenital defects. patients and study design : the institutional review board approved this study. prospectively, from pediatric patients with preoperative echocardiographic diagnosis of pah [tricuspid regurgitation (tr) gradient > 30mmhg ] due to large left to right cardiac shunts who had surgical closure of their shunts those with significant pah, defined as intraoperative directly measured pa to aortic pressure ratio equal or greater than 0.6, were included in the study. thirty - two patients with intraoperative pulmonary artery to aortic (pa / ao) pressure between 0.60 - 0.84 were randomly assigned into 2 groups (n = 16) to receive either milrinone or sildenafil. the third group consisted of higher risk patients with near systemic pa pressure defined as intraoperative pa / ao pressure equal or greater than 0.85, received a combination therapy with both milrinone and sildenafil. the three groups were compared on the basis of preoperative general characteristics, intra- and postoperative pa to aortic pressure ratio, pa and systemic pressures, duration of icu and hospital stay and postoperative complications including pulmonary hypertensive crisis and mortality. preoperative transthoracic echocardiography (tte) was used for confirming diagnoses, and direct intraoperative pa and aortic pressure measurements for assessment of the severity of pulmonary arterial hypertension. demographic and preoperative variables in three groups all parameter were presented as mean (standard deviation) group p. value : 1, 2 : 0.5 ; 1, 3 : 0.002 ; 2, 3 : 0.001 vsd : ventricular septal defect ; tr : tricuspid regurgitation ; pa / ao : pulmonary artery to aortic drug administration : patients in milrinone group received intravenous milrinone, 50 g / kg stat before initiation of cardiopulmonary bypass, followed by 0.75 g / kg / min for 36 hours after entry into the intensive care unit (icu). the drug was then tapered and discontinued within 4 hours. patients in sildenafil group were administered sildenafil, 0.3 mg / kg every three hours by nasogastric or oral route started before the initiation of cardiopulmonary bypass and continued throughout the hospital stay. combination group, consisting of sixteen patients with near systemic intraoperative pah, received a combination of the drugs. postoperative assessment of pulmonary arterial hypertension : monitoring of pa pressure (pap) through intraoperatively placed pa lines were the mainstay of pressure monitoring in this study. pap was continuously measured for the first 48 hours of icu stay and monitoring lines were removed thereafter. daily monitoring of pap was then performed with tte until patients were discharged from the hospital. quantitative values were expressed as meanstandard deviation and range and qualitative values as number and percent. forty - eight patients, 19 (39.6%) males, were included in this study with mean age of 17.0426.73 mo (range 3 - 144 mo) and mean weight of 7.424.64 kg (range 3.8 - 29 kg). out of a total of 48 patients, there were 40 with ventricular septal defect (vsd), 6 with atrioventricular septal defect (avsd), and 2 with aortopulmonary window (apw). the mean gradient across vsd or aortopulmonary window was 17.110.4 mmhg and mean tr gradient was64.215.7 mmhg. mean intraoperative pa to aortic pressure ratio was 0.820.16 (range 0.60 - 1.25). group 1 (sildenafil group) consisted of 16 patients, 3 (18.8%) males, with mean age of 12.311.6 mo (range 5 - 48 mo) and mean weight of 7.13.1 kg (range 3.8 - 15 kg). the chd diagnosis was vsd, asd or pda in 13 patients and three patients had avsd. group 2 (milrinone group) included 16 patients, 8 (50%) males, with mean age of 13.512.9 mo (range 4 - 48 mo) and mean weight of 7.13.1 kg (range 3.8 - 15 kg). group 3 (combination group) consisted of 16 patients, 8 (50%) males, with mean age of 25.442.7 mo (range 3 - 144 mo) and mean weight of 8.97.0 kg (range 4.4 - 29 kg). 11 patients in this group had vsd, asd or pda and 2 patients had apw. intraoperative pa / ao pressure ratio in this group was 0.940.13 (range 0.85 - 1.25).. there were no significant differences between the three groups on the basis of age, weight, body surface area, sex, vsd and tricuspid regurgitation gradients. intraoperative pa / ao pressure in combination group, who received both medications, was near systemic (0.920.13) and significantly higher than in milrinone and sildenafil groups (p=0.001). postoperative pressure measurements in three groups pa : pulmonary artery ; ao : aortic as shown in table 2, postoperative continuous pa pressure monitoring showed significant difference in systolic pa and pa / ao pressures between the three groups with lower values in milrinone group, and similar values in the other two groups, despite significantly higher preoperative pah in combination group (figs. 1 and 2). there were no significant differences in diastolic and mean pa pressures among the three groups. neither the occurrence of systemic hypotension, nor the aortic pressure showed significant difference among the three groups (aortic pressures, 93.4 vs. 92.0 vs. 94.5, respectively). systolic pulmonary artery pressure in 3 groups in the first 24 hours after surgery systolic pulmonary artery to aortic pressure in 3 groups in the first 24 hours after surgery pulmonary artery pressures after discontinuation of milrinone a significant systolic pap rise was noticed upon discontinuation of the drug in milrinone group (27 vs. 22 mmhg, p=0.001), which was not seen in the patients of the combination therapy group. pulmonary hypertensive crisis was not demonstrated in any of milrinone group patients but six (37.5%) patients in sildenafil group and 3 (18.8%) patients in combination group developed crises (p=0.02). the crisis was transient in 3 patients of the sildenafil group, but milrinone had to be administered with the same maintenance dosage in the other 3. in combination group, episodes of crisis occured during tracheal suctioning of secretions with no need to administration of medications. postoperative course in three groups icu : intensive care unit ; ph : pulmonary hypertension length of icu stay was significantly shorter in milrinone group compared to sildenafil and combination group (p=0.04, table 4). however, there was no statistically significant difference in the total hospital stay among the 3 groups. pulmonary hypertension has been defined as a resting mean pulmonary arterial pressure (mpap) more than 25 mmhg, or an mpap with exercise more than 30 mmhg in cardiac catheterization. the subgroup of ph known as pulmonary arterial hypertension, adds the criterion that the pulmonary arterial wedge pressure must be equal to or less than 15 mmhg. some definitions have also included pulmonary vascular resistance (pvr), requiring that it be 2 or 3 wood units. with the introduction of doppler echocardio - graphy, approximate evaluation of pap became feasible. in the presence of a tricuspid insufficiency peak gradient (tipg) 30 mmhg, some investigators have used arbitrary criteria for noninvasive diagnosis of ph. during a meeting on ph held in evian, france, in 1998, mild ph was arbitrarily defined as a tricuspid jet velocity (tjv) 2.8 to 3.4 m / s, which corresponds to tipg 31 to 46 mmhg and to pap 36 to 51 mmhg, if a fixed right atrial pressure (rap) estimate of 5 mmhg is used. it seems reasonable to consider tjv > 2.8 m / s and tipg 31 mmhg at rest as elevated, except in elderly and/or very obese patients. in this study preoperative diagnosis of pah post - operative residual pah is accompanied by the risk of pulmonary hypertensive crisis and right ventricular dysfunction. pdei 's, like sildenafil and milrinone, are among the most common studied pulmonary vasodilators, but there are little studies about using a combination of two pdei drugs in patients with the risk of postoperative ph crisis. in this study, we have shown that both intravenous milrinone and oral sildenafil are effective pulmonary vasodilators. we demonstrated that intravenous milrinone was superior to oral sildenafil to control postoperative pa pressure and successfully decreased the risk of pulmonary hypertensive crisis. in addition, patients with very high preoperative pa pressure incurred to benefit the most from combination of both drugs. furthermore, our data suggest that occurrence of rebound pah after discontinuation of milrinone, can be prevented by addition of sildenafil during tapering period of milrinone. residual pah following the surgical closure of large left to right shunts may cause significant postoperative hemodynamic instability, and in occasions death, if uncontrolled pah crisis occurs. since right ventricle is more sensitive to afterload changes than left ventricle, right ventricular dysfunction in such patients is another potential postoperative hazard, particularly when pump time is prolonged or acute increase in pa pressure has occurred. therefore, controlling pap is extremely important to minimize morbidity and mortality after such congenital cardiac operations. suggested treatment algorithm for pah following cardiac surgery includes inhaled nitric oxide (ino), milrinone, sildenafil, and short term use of inhaled or intravenous prostanoids[9, 10 ]. the need for special equipments to administer the drug and the risk of occurrence of rebound pah following discontinuation limits the regular use of this therapeutic option[10, 12 ]. combination of ino with other agents such as sildenafil[13, 14 ], milrinone[15, 16 ] or dobutamine has been reportedly more efficient to control postoperative ph. however, systemic hypotension has been reported to limit the use of this drug[67, 10 ]. sildenafil, a selective pdei type 5, is effective for the treatment of acute and chronic pah with minimal systemic vasodilatory effect. it is favored for the use in pediatric patients because of its rapid onset of action, good absorption after oral intake and minimal side effects[2, 5, 10 ]. factors limiting its use are its availability in only oral form and the risk of severe systemic hypotension when used concomitantly with nitrates. in an animal study by matot, intravenous zaprinast, another pdei type 5, is shown to have greater pulmonary vasodilatory effect than intravenous milrinone. urdaneta and colleagues, in another animal study compared pulmonary vasodilatory effect of uk 343 - 664, an intravenous sildenafil analogue, with intravenous milrinone. the two drugs had the same efficacy with higher pulmonary selectivity of uk 343 - 644. in the current study, pediatric patients who received intravenous milrinone were shown to have significantly lower postoperative systolic pa and pa / ao pressures than those who received oral sildenafil. furthermore, ph crisis occurred in 6 patients in the sildenafil group, whereas those who received milrinone remained free of crisis. in the study by lobato and associates, independent action and additive effect of sildenafil and milrinone during thromboxane - induced acute pulmonary arterial hypertension were shown in a porcine model. the combination of drugs achieved a better hemodynamic profile with greater pulmonary vasodilatation and increased contractility without additional systemic vasodilatation. in our study, combination of milrinone and sildenafil in combination group, who had significantly higher preoperative pah, resulted in postoperative pa pressures comparable to those who were on sildenafil and had lower preoperative pah. in addition, incidence of ph crisis was lower in the combination group compared to those who received sildenafil, despite near - systemic preoperative pah. therefore, combination of the two drugs may have additive effects on the control of postoperative pa pressure. in this study, patients in the milrinone - only group, developed significant rise of pa pressure upon tapering and discontinuation of the drug - an event not seen in the combination group. the rebound pah phenomenon and the protective effect seen with concomitant administration of sildenafil, may be a strong evidence of the benefit gained by addition of sildenafil in cases of severe pah. our finding is consistent with those of trachte, which showed sustained pulmonary vasodilatory effect of sildenafil, facilitating weaning of ino, and milrinone, nitroglycerine and sodium nitroprusside when used as adjunctive therapy. in another study by namachivayam et prophylactic sildenafil administration during weaning from ino was suggested as an effective strategy in that study. lee, have also shown facilitated withdrawal of ino and prevention of rebound pulmonary arterial hypertension with concomitant use of oral sildenafil after congenital cardiac surgery in children. continuous monitoring of systemic pressure in the milrinine group, or the combination group failed to reveal significant drop in aortic pressure. this finding was consistent with the study by lobato and coworkers, who showed that combination of the drugs was not accompanied by additional systemic vasodilatation. in contrary, there are available reports that consider systemic hypotension as a limiting factor for administration of milrinone[67, 10 ]. in the current study, low cardiac output state and the need for inotropes were similar in the three groups. lobato showed improved cardiac output and right ventricular function with combined use of milrinone and sildenafil. in that study sildenafil alone had no effect on right ventricular function. however, madden describe two postoperative cases with significant reduction in pulmonary vascular resistance and rise in systemic blood pressure after administration of oral sildenafil. authors suggested that sildenafil should be considered for the management of selected patients with pulmonary arterial hypertension who develop right ventricular dysfunction at induction or during cardiac surgery. gan also showed that sildenafil alone can improve right ventricular diastolic and systolic function by reducing right ventricular afterload. the icu stay was demonstrated to be lower in milrinone group in this study, but it was the same in combination group and sildenafil group, despite more severe pah in combination group. patients in the current study did not develop any drug related complications and there was no mortality, both findings point at the proposed effective role of milrinone and sildenafil in decreasing mortality and morbidity after closure of large left to right shunts with preexisting pah, even in near systemic levels. the main limitation to this study was the non - randomized assignment of patients in the third group to receive the combination therapy. this was based on ethical considerations, and the fact that patients with exceedingly high, near - systemic pa pressures were considered for combination therapy. however, this did not affect random assignment of patients into milrinone - only or sildenafil - only groups. in addition, preoperative cardiac catheterization was not performed in this study and echocardiography and direct intraoperative measurements of pressure were the mainstays for estimation of severity of pah. in conclusion, this study shows that both intravenous milrinone and oral sildenafil are effective pulmonary vasodilators and can improve surgical outcome and decrease mortality after closure of large left to right shunts in children. intravenous milrinone was shown to have superiority to oral sildenafil in the control of postoperative high pa pressure and the decrease of pulmonary hypertensive crisis occurrence. in patients with very high preoperative pah, combination of both drugs incurred to have additive effects. for prevention of rebound pah after discontinuation of milrinone, administration of sildenafil during the tapering period of milrinone may be helpful. | objectivecontrol of residual pulmonary arterial hypertension (pah) after closure of left to right shunts in children is still a challenging issue. the purpose of this study was to compare the effect of two phosphodiesterase inhibitors in pediatric cardiac surgical patients.methodsa total of 48 postoperative children were enrolled in the study between 2008 and 2010. patients were stratified based upon choice of pulmonary vasodilator into three equal groups (n = 16) ; milrinone group received intravenous milrinone (0.75 /kg / min), sildenafil group received oral sildenafil (0.3 mg / kg every 3 hours) and the combination group received both medications.findingsdemographic variables and types of congenital anomalies were not different among the 3 groups. patients in the combination group had higher preoperative pulmonary artery to aortic (pa / ao) pressure ratios compared to other two groups (p=0.001). postoperatively, patients in milrinone group incurred lower systolic pa and pa / ao pressures compared to sildenafil group (p=0.014, 0.003), but it was the same in sildenafil and combination group (p=0.2 ; 0.330 respectively). pulmonary hypertensive crisis was noted in 6 patients in sildenafil group, and 3 patients in combination group (p=0.02). significant rise in pa pressure was noticed after discontinuation of drug in milrinone group (p=0.001), which was not observed in the combination group (p= 0.6). no mortality was noticed in any of the groups.conclusionintravenous milrinone is more effective than oral sildenafil in control of postoperative pah and elimination of pulmonary hypertensive crisis. combination of two drugs reduces the risk of rebound pulmonary arterial hypertension after discontinuation of milrinone. |
the double - step paradigm is an established method for evaluating the adaptive plasticity of the sensorimotor system : visual targets are presented in one location first, and are displaced in a consistent fashion shortly thereafter. subjects initially aim their responses toward the first target location and correct them thereafter ; with ongoing practice, however, responses are adaptively modified and the need for corrections decreases. adaptive changes have been documented with the double - step paradigm both for the amplitude (mclaughlin 1967 ; deubel 1987 ; alahyane. 2004) and the direction of ocular saccades (deubel 1987 ; chen. 2008), as well as for the amplitude (magescas and prablanc 2006) and the direction of aimed hand movements (bock. 2008). several studies have evaluated the transfer of double - step adaptation between the oculomotor and the arm motor system. a substantial transfer was observed from the direction of reactive saccades to that of hand movements and vice versa (bock. 2008), from the amplitude of volitional saccades to that of hand movements (cotti. 2007), but not from the amplitude of reactive saccades to that of hand movements (krller. 1999 ; cotti. 2007), nor from the amplitude of reactive saccades to that of volitional saccades or vice versa (deubel 1995). it has therefore been concluded that the two motor systems can access a common adaptive mechanism under some but not under all experimental conditions. the present study was designed to provide more insight into the mechanism for double - step adaptation of eye and arm directions. in previous work, steps of target direction did not exceed 8 of visual angle, and thus required only a small adaptive change. one purpose of the present study was to find out if adaptation remains equally efficient for larger target displacements. the second purpose was to determine whether adaptation is cumulative, in that subjects exposed to a given step size benefit from a previous adaptation to smaller steps. this was shown to be the case for adaptation to distorted visual feedback (abeele and bock 2001 ; bock. they were 2046 years old, right - handed, and exhibited no overt sensory or motor deficits except for vision corrected by contact lenses. all subjects were inexperienced with sensorimotor research, and all signed their informed consent to this study, which was pre - approved by the authors institutional ethics committees. experimental procedures were generally the same as in our previous study (bock. a visual target was presented in the center of a computer screen for 7601500 ms, and then jumped onto an imagined circle of 11 cm radius around the center. there it appeared in one of eight randomly selected directions (0, 45, 90,, 315, where 0 denotes rightwards and 90 upwards on the screen). in single - step trials, the target remained steady on the circle for 760 ms. in double - step trials, the target jumped 200 ms later1 along the circle by 10, 30, or 60, depending on subject group, and then remained steady for 640 ms. each experimental session consisted of episodes with 20 trials each, separated by rest breaks of several seconds to avoid fatigue. subjects sat at a distance of 40 cm from the screen, and were instructed to follow the target quickly and accurately, either with their eyes while keeping their hands still, or with their right hand while fixating straight ahead. in the latter case, subjects saw a cursor on the screen which moved congruently with their hand. the experiment started with a baseline phase of two single - step episodes, continued with an adaptation phase of 30 double - step episodes, and concluded with an aftereffect phase of two single - step episodes. groups e-10, e-30, and e-60 responded with their eyes, and experienced during the adaptation phase target jumps of 10, 30, or 60, respectively. for group e-10 - 30 - 60, target jumps were 10 during the first ten adaptation episodes, 30 during the next, and 60 during the last ten adaptation episodes., h-30, h-60, and h-10 - 30 - 60 underwent the corresponding regimes while responding with their hand. eye movements were registered by dc - electrooculography (eog), calibrating the signal after each five episodes ; the signal was digitized with 100 hz for storage and later analysis. hand movements were recorded with a computer mouse, bypassing commercial mouse drivers because of their delays, averaging, and dynamic distortions. in the other laboratory, eye movements were registered by an infrared - light sensitive oculometer (iscan inc. with rk-426pc pupil corneal reflection tracking system) with a resolution of 1, and hand movements by a digitizing tablet (calcomp drawing board iii) with a resolution of 0.25 mm ; both signals were sampled at the rate of 50 hz, and were smoothed twice by three - point central averaging. the collected data were analyzed by an interactive computer program which determined saccade direction as the difference between non - displaced target direction and the direction of the primary saccade, initial hand direction as the difference between non - displaced target direction and hand direction 100 ms after movement onset, as well as hand and arm reaction time as the interval between appearance of the non - displaced target and movement onset. movements were disregarded when hand or eye reaction times exceeded 400 or 270 ms, respectively, since previous work documented that initial hand direction (van sonderen. 1988) and primary saccade direction (becker and jrgens 1979) would begin to show an influence of the second step with longer reaction times. for subsequent statistical testing, we calculated the median response direction and the median reaction time for each subject and episode. subjects from a given group that were tested in different laboratories yielded similar results, and statistical comparisons of key episodes confirmed this similarity ; we therefore combined the data from both laboratories for statistical testing. the baseline - corrected values were submitted to two - way analyses of variances (anovas) with the between - factor group and the within - factor episode. data collected in groups e-10, e-30 and e-60 have also been analyzed as part of another study, which compares saccadic adaptation with fixed and with saccade - triggered interstep intervals (grigorova. figure 1 depicts the across - subject means of movement direction for groups responding with their hand (left part) or eyes (right part). all groups gradually changed their response direction during the adaptation phase, and a part of this change was preserved during the aftereffect phase. conspicuous differences between groups emerged toward the end of the adaptation phase but did not persist afterward. in accordance with these observations, anova of the adaptation phase yielded a significant effect of episode (f(29,203) = 33.28, p 0.05), nor between e-60, e-30, and e-10 (all p > 0.05). thus, we found no consistent effect of step size, but an effect of abrupt versus incremental step regimes. post hoc analysis further revealed that response direction in the first adaptation episode with 30 steps differed between groups with abrupt and incremental step regime (h-30 versus h-10 - 30 - 60 : p 0.05), suggesting that iem had little effect on hand adaptation. anova of the aftereffect phase was significant for episode only (f(1,56) = 5.71, p 0.05).fig. 2relative magnitude of aftereffects in subject groups adapting their hand (filled circles) or eyes (filled squares) to target steps which were introduced abruptly (black) or incrementally (gray). also plotted is the magnitude of adaptation transfer to untrained directions (solid line : adopted from noto. 1999), and the tuning of deeper collicular activity by saccade direction (dashed line : adopted from ottes. the latter data were scaled such that the firing rate 10 off the neuron s optimal direction became numerically equivalent to the mean of relative eye and arm aftereffects with 10 target steps relative magnitude of aftereffects in subject groups adapting their hand (filled circles) or eyes (filled squares) to target steps which were introduced abruptly (black) or incrementally (gray). also plotted is the magnitude of adaptation transfer to untrained directions (solid line : adopted from noto. 1999), and the tuning of deeper collicular activity by saccade direction (dashed line : adopted from ottes. 1986). the latter data were scaled such that the firing rate 10 off the neuron s optimal direction became numerically equivalent to the mean of relative eye and arm aftereffects with 10 target steps the reaction time during the baseline phase was 205.20 16.90 ms for saccades and 283.94 25.02 ms for hand movements. it decreased in all groups at the onset of adaptation by 11.38 19.11 ms, and then increased again toward the baseline level. accordingly, anova led to a significant effect of episode only (f(29,1595) = 4,58, p < 0.001). the reaction time increased in all groups during the aftereffect phase by 5.01 15.60 ms, yielding again a significant effect of episode only (f(1,56) = 6.47, p < 0.05). in accordance with previous work (deubel 1987 ; chen. 2006 ; bock. 2008), we found that the direction of eye and of hand movements can be adaptively modified in a double - step paradigm. two observations indicate that this result is not an artifact of subjects waiting for the second target step before planning a response : first, the reaction time did not increase during the adaptation phase but even slightly decreased, and second, the interval between second step and response onset was shorter than the minimum time required for the reprogramming of saccades (becker and jrgens 1979) and hand movements (van sonderen. 1988, 1989). we further found that eye and hand directions adapted not only to small target steps, as used in previous work, but also too much larger target steps. when expressed as gaze angle rather than as angle on the screen, our smallest step was about 5 and thus was comparable to earlier studies, while our largest step was as big as 28. however, eye and hand adaptations to large steps was much less efficient than that to smaller ones, since the relative magnitude of adaptation decreased from about 67% with 10 steps to as little as 15% with 60 steps. accordingly, the relative magnitude of aftereffects decreased from about 37% with 10 steps to about 6% with 60 steps. the adaptive improvement with 60 steps was substantially larger under an incremental regime (h-10 - 30 - 60 and e-10 - 30 - 60) than under an abrupt regime (h-60 and e-60). however, the difference between regimes vanished during the aftereffect phase. since adaptive improvement is thought to reflect sensorimotor recalibration as well as workaround strategies, while aftereffects are thought to reflect recalibration alone (redding and wallace 1996 ; mcnay and willingham 1998 ; clower and boussaoud 2000 ; pisella. 2004 ; bock 2005), it would appear that the incremental regime facilitated strategies but not recalibration. this is in contrast to earlier work on adaptation to distorted visual and to force fields, where incremental regimes were found to reduce rather than encourage strategies (kagerer. it is therefore conceivable that strategies play a different role in double - step adaptation and in other adaptation types. it has been observed in the past that saccadic adaptation is directionally tuned : it shows transfer to untrained saccade directions, but the magnitude of this transfer decreases as the difference between trained and untrained saccade directions increases (frens and van opstal 1994 ; noto. this phenomenon has been attributed to the directional tuning of deep - layer collicular neurons (ottes. those neurons discharge most vigorously before saccades of a given direction, and the magnitude of their discharge decreases as the difference between actual and preferred saccade direction increases. it has therefore been argued that an adaptive recalibration of those neurons should transfer only within the range of their directional tuning curve. our present data could be interpreted in an analogous way, i.e., adaptive recalibration could be limited by the size of collicular tuning curves, and the relative magnitude of adaptation should therefore decrease when target steps exceed that limit. indeed, when the previous data on adaptation transfer and collicular activity are replotted in the same format as our own data in fig. 2, the emerging similarity is consistent with the notion of a common neural substrate for all three data sets. the above considerations suggest that double - step adaptation may reside in neural circuits which include directionally selective collicular cells. the similar circuits may be involved in the double - step adaptation of eyes and arm, since the directional tuning of both motor systems is comparable in fig. 2. indeed, arm movement related activity has been registered in the superior colliculi (werner. however, this is not to say that the colliculi play a predominant role, the exclusive role in double - step adaptation. rather, other brain areas are likely to contribute as well, notably the cerebellum, whose involvement in adaptation has been documented by a number of neuroimaging and lesion studies (desmurget. ; thach. 1992 ; alahyane. 2008 ; werner. 2009 ; xu - wilson. 2009). | previous work has documented that the direction of eye and hand movements can be adaptively modified using the double - step paradigm. here we report that both motor systems adapt not only to small direction steps (5 gaze angle) but also to large ones (28 gaze angle). however, the magnitude of adaptation did not increase with step size, and the relative magnitude of adaptation therefore decreased from 67% with small steps to 15% with large steps. this decreasing efficiency of adaptation may reflect the participation of directionally selective neural circuits in double - step adaptation. |
esophagogastroduodenoscopy (egd) has become an important examination for screening and diagnosis of diseases of the upper gastrointestinal tract. improved endoscopic screening was accomplished by the incorporation of a thinner caliber endoscope with the capacity to capture high definition images. however, the ability to visualize vater s papilla with front viewing endoscopes is less than satisfactory 1. the duodenum has a narrow lumen ; therefore, endoscopes with a side view are preferred for visualization of vater s papilla, although current side viewing scopes are not suitable for screening in egd. in addition, switching to a side viewing endoscope may not be a viable option when considering a patient s comfort and the availability of endoscopic equipment. alpharetta, ga, united states) egd is a newly developed video - endoscope that provides a 245-degree field of view with double imagers on the front and side of the endoscope tip. a wider view for endoscopic examinations, such as ultra - wide viewing scopes, has been reported to enhance diagnostic yield in the field of colonoscopy 2 3 4. in the upper gastrointestine, locations with a steep curve such as the squamo - columnar junction (scj) and the anal side of the pyloric ring theoretically, the incorporation of double imagers in different directions has a possibility to produce a better view in these locations. however, there are no available data to determine whether a wider endoscopic view is efficient for upper gastrointestinal screening. the aim of this study was to evaluate the feasibility, usability, and safety of fuse - egd in human subjects. feasibility was defined by the completion of taking images according to a standardized protocol within an acceptable time. the study included 21 healthy individuals (15 males and 6 females) with a median age of 35 years (range, 29 55 years) who underwent upper gastrointestinal screening using fuse - egd. each subject received a full explanation with regard to the purpose of this open - label study and gave informed consent for participation in the study. after fasting for more than 12 h, each subject drank 100 ml of water containing pronase, sodium bicarbonate, and simethicone. the examination was performed under oral anesthesia with 1 5 sprays of 8 % lidocaine, with no sedation. five endoscopists who were board certified members of the japanese gastroenterological endoscopy society performed screening of the upper gastrointestine according to a standardized protocol while capturing sequential images from the esophagus to the duodenum. the primary end point of this pilot and feasibility study was the rate of successful visualization of vater s papilla. additional end points included the duration of the procedure, successful visualization of the anal side of the pyloric ring and the scj, adverse events, and the endoscopists subjective evaluation of the usability of the fuse - egd procedure. the endoscopists subjective evaluation of the usability, field of view, and maneuverability of fuse was assessed using a five - point likert scale with the following answer options : unacceptable, difficult, acceptable, good, and excellent. in addition, the endoscopists subjective evaluation compared to the standard endoscope used in our hospital (9.8-mm, high definition, front viewing, video endoscope) was also evaluated. the fuse - egd (fsg-2500-st) system is a 9.6-mm, flexible endoscope for repeated clinical use (diagnostic visualization and therapeutic intervention). the endoscope is equipped with a working channel (2.8 mm), air or co2 insufflation options, suction, and forward waterjet irrigators. a wide 245-degree field of view is achieved using two lenses and groups of light - emitting diodes positioned on the front and side of the endoscope tip. this retrospective study was approved by the institutional review board of our hospital (no. 27-j69 - 27 - 1 - 3). the fuse - egd (fsg-2500-st) system is a 9.6-mm, flexible endoscope for repeated clinical use (diagnostic visualization and therapeutic intervention). the endoscope is equipped with a working channel (2.8 mm), air or co2 insufflation options, suction, and forward waterjet irrigators. a wide 245-degree field of view is achieved using two lenses and groups of light - emitting diodes positioned on the front and side of the endoscope tip. this retrospective study was approved by the institutional review board of our hospital (no. 27-j69 - 27 - 1 - 3). gastrointestinal screening using the fuse - egd system was successfully completed for all 21 subjects with a median procedure time (sd) of 6.5 1.6 min. successful visualization of vater s papilla was obtained in 90 % (19/21) of the subjects (fig. 1). the duodenal side of the pyloric ring (anterior wall only) was observed in 29 % (6/21) of the subjects. the whole circumference of the scj was observed on the two video monitors in all cases (fig. 2). the main finding detected among the subjects was esophageal hernia (100 %, 21/21). visualization of the 2nd portion of the duodenum on two video monitors with a clear view of vater s papilla. visualization of the squamo - columnar junction on the two video monitors of the fuse - egd system. subjective evaluation of the usability of fuse - egd was assessed by the five endoscopists, who reported that fuse - egd was inferior compared with the standard front viewing endoscope for all participants (table 1). however, 80 % of the participants answered that the fuse - egd system platform was feasible as a whole. this is the first study on humans utilizing the newly developed fuse - egd for upper gastrointestinal screening. the main end point of this study was to evaluate the feasibility of the new fuse - egd system. successful visualization of vater s papilla was achieved in 90 % of the study participants. the duodenum has a narrow lumen and vater s papilla is not routinely identified during screening by egd 1 or by capsule endoscopy 5. a previous study reported that the detection rate of vater s papilla in whole or in part was only 57 % using a routine imaging method, but it increased to 89 % using a straightening endoscopic technique 1. for surveillance of patients with duodenal polyposis, the use of a side viewing endoscope 6 or side and front viewing endoscopes at the same time under general anesthesia has been reported 7. the fuse - egd system is equipped with a side view imager on a front viewing endoscope that enables easier detection of vater s papilla with normal manipulation of the endoscope. the fuse - egd system allowed easier visualization of vater s papilla than the conventional endoscope. although barrett s esophagus is rare among the japanese population, a clear view of the entire scj is greatly beneficial for the detection of early scj and barrett s adenocarcinoma. vater s papilla is an excellent marker to assess this system ; however, the real clinical benefit could be at the scj. the anal side of the pyloric ring was observed in 29 % of the subjects. we expected that the side lens would visualize the anal side of the pyloric ring. in most cases, the mucosa contacted the side lens, and therefore it was difficult to keep a distance between the mucosa and the lens in the narrow duodenal bulb. the ability to visualize the anal side of the pyloric ring may be beneficial for gastric antral lesions extending to the duodenal bulb ; however, these lesions are quite rare. all of the endoscopists participating in this study reported that the usability of fuse - egd was inferior to that of the conventional endoscope. since none of the endoscopists had previous experience using fuse - egd, it may just be a matter of getting used to the maneuverability of the scope. the image quality and brightness of the view field are expected to be further improved in the near future. a limitation to this study was the small sample size and limited number of participating endoscopists. however, the results of this first pilot and feasibility human study of fuse - egd are promising. in conclusion, although its usability requires further modification, fuse - egd provided excellent results for imaging vater s papilla and the scj. | the feasibility of full - spectrum endoscopy (fuse) esophagogastroduodenoscopy (egd), providing a 245-degree field of view with double imagers on the front and left side of the endoscope was evaluated. twenty - one healthy individuals (15 male, median age, 35 years) underwent upper gastrointestinal screening using fuse - egd. the primary end point was the rate of successful visualization of vater s papilla. secondary end points were visualization of the squamo - columnar junction (scj) and the anal side of the pyloric ring, and the endoscopists subjective evaluation of usability based on maneuverability and imaging of fuse - egd. the mean procedure time was 6.5 min, with a median of 91 images captured. the rate of successful visualization of vater s papilla was 90 % (19/21). the whole circumference of the scj was observed with two video monitors in all cases. the anterior anal side of the pyloric ring was observed in 29 % (6/21) of cases. however, the general impression of the usability of fuse - egd was that it was rather inferior to that of a standard front viewing endoscope. although the usability requires further modification, fuse - egd provided excellent results for imaging vater s papilla and the scj. |
mineral trioxide aggregate (mta) is a useful material for vital pulp therapy, such as pulp capping and pulpotomy. in these clinical situations, mta is used in a coronal position ; therefore, the color of mta is considered key to the final esthetic result. in the 1990s, torabinejad. introduced gray mta (gmta), which has a similar chemical constitution to that of portland cement except for the addition of bismuth oxide (bi2o3) (1718 wt%) to improve radioopacity. despite its favorable biological features, gmta causes tooth discoloration as well as discoloration of the adjacent gingiva. because of this aesthetic problem, white mta (wmta) was developed through the exclusion of iron compounds rather than by the addition of other elements (proroot (pr) ; dentsply, tulsa, ok, usa). recently, belobrov and parashos reported a case of tooth discoloration after use of wmta as a pulp - capping material. in response to these issues, a pozzolan - based mta - derived material (endocem (ec) ; maruchi, wonju, korea) was introduced into the endodontic market. furthermore, the biocompatibility and osteogenicity / odontogenicity of ec are similar to those of pr. however, there is still the possibility of tooth discoloration when using this material. recent studies of color stability of wmta have suggested that the formation of metallic bismuth under light irradiation can lead to color change. thus, the use of an alternative radiopacifier to replace bismuth in wmta is needed. recently, the manufacturer that produces ec released another fast - setting pozzolan cement that contains zirconium oxide (zro2) as a radiopacifier (endocemzr [ecz ] ; maruchi) to overcome the gray color of original ec. it has been reported that zro2 has acceptable radiopacity and does not participate in the hydration reaction of portland cement. recently, the addition of 30% zro2 to pc exhibited physical and antimicrobial properties comparable to those of pc. however, there is little information about the effect of ecz on tooth discoloration. in various clinical situations, such as pulp capping and perforation repair, mta or mta - derived materials furthermore, even blood in the root canal adjacent to the wmta has been shown to influence discoloration. therefore, the aim of this study was to evaluate tooth discoloration induced by contact with various calcium silicate - based pulp - capping materials in the presence or absence of blood in vitro. exclusion criteria were the presence of caries, visible structural defects, coronal staining, and narrow crown width (labial surface area > 10 10 mm). the samples were formed with reference to a new model introduced by a previous study, as shown in figure 1. briefly, the teeth were disinfected in 1% chloramine - t solution (sigma - aldrich, st. louis, mo, usa) and stored in normal saline at room temperature for 1-month. the roots were resected using a diamond - coated disc, and extrinsic stains and calculus on the labial surface were removed with an ultrasonic scaler. a cuboid enamel - dentin block (10 mm 10 mm 3.5 mm) was prepared from the middle third of each crown using a low - speed microtome (isomet, buehler, il, usa). the labial enamel surface was finished and polished with 220, 600, 1200, and 2000-grit abrasive papers (cc261 ; deerfos, seoul, korea). then, a box - form cavity (6 mm 6 mm 1.5 mm) was prepared with a # 330 carbide bur in the middle of each specimen, leaving 2 mm of the labial tooth structure (1 mm each of enamel and dentin). sodium hypochlorite (1.5% naocl) irrigation solution was placed in the cavity for 30 min, and 17% ethylene diamine tetraacetic acid (edta ; prevestdentpro, jammu, india) was applied for 2 min to remove the smear layer and to expose the dentinal tubules. a standardized cuboid enamel - dentin block (10 mm 10 mm 3.5 mm), which was prepared by removing the middle third of a bovine incisor human blood was used to simulate the clinical situation of vital pulp therapy. in this study, the blood collection tubes (vacuette ; greiner bio - one, kremsmnster, austria) were sterile and spray - coated with the anticoagulant k2edta to prevent clotting. the three materials included in this study were pr, ec, and ecz [table 1 ]. the specimens were randomly divided into six experimental groups and two control groups according to the material used and the presence or absence of contamination with blood [table 2 ]. each material was mixed according to the manufacturer 's instructions and was placed into the cavity. in the blood - contaminated groups, 5 l of blood was placed on top of the material. a negative control (nc) was filled with a cotton pellet moistened with normal saline, and a positive control was filled with a cotton pellet moistened with blood. then, the cavities were sealed with a self - adhesive resin material (u - cem universal ; vericom, chuncheon, korea). an led curing light (elipar s10 ; 3 m espe, munich, germany) was used to irradiate the specimens for 20 s. all specimens were stored at room temperature and 100% relative humidity. composition of tested materials teeth and materials in experimental and control groups as shown in figure 2, a standardized acrylic resin mold was developed to allow measurement of the same position in each sample and to increase reproducibility. the tooth color was recorded at baseline (d0 ; after tooth preparation and placement of materials) and at 1-week (d7), 2 weeks (d14), 4 weeks (d28), and 8 weeks (d56) using a spectrophotometer (nf999 ; nippon denshoku, tokyo, japan). the color differences (e) between the baseline and the d7, d14, d28, d56 measurements were calculated using the following formula : e = ([l 2 l 1]+ [a 2 a 1 ] + [b 2 b 1 ] ]. the value of the luminosity (l) represents the lightness values, a represents the values of red - green, and b represents the values of yellow - blue. standardized acrylic resin mold used to repeatedly measure the same position in each sample in each group, a representative sample was selected and sectioned in the center by using a low - speed microtome (isomet). the sectioned surface was examined under a stereomicroscope (leica mz16fa ; leica, wezler, germany). the data were evaluated using spss software (pasw statistics 20 ; spss inc., statistical analysis was performed using repeated measures analysis of variance to examine the e values as the dependent variables and time as a factor. tukey 's post hoc test was used to assess significant differences between the tested materials. exclusion criteria were the presence of caries, visible structural defects, coronal staining, and narrow crown width (labial surface area > 10 10 mm). the samples were formed with reference to a new model introduced by a previous study, as shown in figure 1. briefly, the teeth were disinfected in 1% chloramine - t solution (sigma - aldrich, st. louis, mo, usa) and stored in normal saline at room temperature for 1-month. the roots were resected using a diamond - coated disc, and extrinsic stains and calculus on the labial surface were removed with an ultrasonic scaler. a cuboid enamel - dentin block (10 mm 10 mm 3.5 mm) was prepared from the middle third of each crown using a low - speed microtome (isomet, buehler, il, usa). the labial enamel surface was finished and polished with 220, 600, 1200, and 2000-grit abrasive papers (cc261 ; deerfos, seoul, korea). then, a box - form cavity (6 mm 6 mm 1.5 mm) was prepared with a # 330 carbide bur in the middle of each specimen, leaving 2 mm of the labial tooth structure (1 mm each of enamel and dentin). sodium hypochlorite (1.5% naocl) irrigation solution was placed in the cavity for 30 min, and 17% ethylene diamine tetraacetic acid (edta ; prevestdentpro, jammu, india) was applied for 2 min to remove the smear layer and to expose the dentinal tubules. a standardized cuboid enamel - dentin block (10 mm 10 mm 3.5 mm), which was prepared by removing the middle third of a bovine incisor human blood was used to simulate the clinical situation of vital pulp therapy. in this study, the blood collection tubes (vacuette ; greiner bio - one, kremsmnster, austria) were sterile and spray - coated with the anticoagulant k2edta to prevent clotting. the three materials included in this study were pr, ec, and ecz [table 1 ]. the specimens were randomly divided into six experimental groups and two control groups according to the material used and the presence or absence of contamination with blood [table 2 ]. each material was mixed according to the manufacturer 's instructions and was placed into the cavity. in the blood - contaminated groups, 5 l of blood was placed on top of the material. a negative control (nc) was filled with a cotton pellet moistened with normal saline, and a positive control was filled with a cotton pellet moistened with blood. then, the cavities were sealed with a self - adhesive resin material (u - cem universal ; vericom, chuncheon, korea). an led curing light (elipar s10 ; 3 m espe, munich, germany) was used to irradiate the specimens for 20 s. all specimens were stored at room temperature and 100% relative humidity. composition of tested materials teeth and materials in experimental and control groups as shown in figure 2, a standardized acrylic resin mold was developed to allow measurement of the same position in each sample and to increase reproducibility. the tooth color was recorded at baseline (d0 ; after tooth preparation and placement of materials) and at 1-week (d7), 2 weeks (d14), 4 weeks (d28), and 8 weeks (d56) using a spectrophotometer (nf999 ; nippon denshoku, tokyo, japan). the color differences (e) between the baseline and the d7, d14, d28, d56 measurements were calculated using the following formula : e = ([l 2 l 1]+ [a 2 a 1 ] + [b 2 b 1 ] ]. the value of the luminosity (l) represents the lightness values, a represents the values of red - green, and b represents the values of yellow - blue. in each group, a representative sample was selected and sectioned in the center by using a low - speed microtome (isomet). the sectioned surface was examined under a stereomicroscope (leica mz16fa ; leica, wezler, germany). the data were evaluated using spss software (pasw statistics 20 ; spss inc., chicago, il, usa). statistical analysis was performed using repeated measures analysis of variance to examine the e values as the dependent variables and time as a factor. tukey 's post hoc test was used to assess significant differences between the tested materials. the mean, standard deviation, and significance of the color differences are shown in figure 3. when the e value is higher than 3.3, it is possible to distinguish the color difference of the tooth. after 1 week, the e value was higher than 3.3 in all experimental groups. the pr group and ec group showed significantly higher mean values than the nc group after 2 weeks and 1 week, respectively (p 0.05). e values for the different groups at the different time points (group 14). the same letters indicate statistically similar groups (p = 0.05) there were larger color differences (e value) when in contact with blood irrespective of time or type of material [figure 4 ]. in comparison with the positive control, the color changes of all experimental groups were not significantly different at most time points (p > 0.05). after 2 weeks, the pr / b group showed a higher e value than the ecz / b group ; however, a significant difference was only observed at d56 (p 0.05). e values for the different groups at the different time points (group 14). there were larger color differences (e value) when in contact with blood irrespective of time or type of material [figure 4 ]. in comparison with the positive control, the color changes of all experimental groups were not significantly different at most time points (p > 0.05). after 2 weeks, the pr / b group showed a higher e value than the ecz / b group ; however, a significant difference was only observed at d56 (p < 0.05). furthermore, the ec / b group (g7) showed a larger color difference than the ecz / b group, but the difference was only significant at d28 (p < 0.05). e values for the different blood contaminated groups at the different time points (group 58). several case reports have revealed discoloration produced by mta when the material was used as a pulp - capping or pulpotomy agent. however, few studies have evaluated the discoloration of various mta - derived materials, especially zro2-containing materials. in the present study, the e value was higher than 3.3 in all experimental groups after 1-week [figure 3 ]. we observed all teeth to have experienced color alteration after contact with mta materials, which is consistent with findings of previous studies. the present study showed that the pr and ec groups experienced significantly more discoloration than the nc group after 2 weeks. however, there were no significant color changes between the ecz group and the nc. a possible explanation for these results is that the bi2o3 included in pr and ec causes discoloration. one possible mechanism of this change is that the bi2o3 interacts with collagen in dentin and is converted to a black precipitate in the material - dentin interface. a recent investigation showed that collagen, which is present in organic dentin matrix, reacts with bi2o3, resulting in grayish discoloration. another hypothesis to explain the discoloration is the formation of metallic bismuth under specific conditions. irradiated bi2o3 under oxygen - free conditions is excited and changed to dark grayish metallic bismuth. a recent study also reported that contact of wmta and other bismuth - containing materials with naocl produces a change to a darker color because the oxide is converted to bismuth metal in contact with sodium hypochlorite and oxygen is lost. our stereomicroscopic examination of the pr group revealed grayish discoloration in the interfacial dentin and the material itself [figure 5a ]. however, the color of the ec changed the color of the specimen to dark gray [figure 5b ]. a recent in vitro study supported our results that significant discoloration occurs in the cervical area in the presence of pr, mta angelus, and ec. one possibility is that the organic matrix in the dentin surface reacts with bi2o3, a possible major factor contributing to discoloration, and the remaining naocl solution in the cavities of the specimens might exacerbate the change in color through reaction with the bi2o3 included in the pr and ec. on the other hand, in the present study, the color of the ecz group remained relatively stable according to spectrophotometric [figure 3 ] and stereomicroscopic analyses [figure 5c ]. these results might be explained by the inclusion of zro2 as a radiopacifier instead of bi2o3, as well as the light color of the material itself. in other words, aside from the original dark color of the material, calcium silicate - based materials containing bi2o3 undergo discoloration under conditions that simultaneously include contact with an organic dentin matrix, an oxygen - free environment, and irradiation with a curing light. therefore, when selecting pulp - capping materials for areas of aesthetic concern, ecz, which includes zro2 rather than bi2o3, might be a better option. stereomicroscopic appearance of a representative sample from each group after 8 weeks ; (a) pr, (b) ec, (c) ecz, (d) negative control, (e) proroot with blood, (f) ec with blood, (g) ecz with blood, and (h) positive control. (i) samples show the initial color of each material ; pr : proroot, ec : endocem, ecz : endocemzr the sequential color change (e) of teeth in contact with materials and blood is presented in figure 4. the specimens showed an increased e value after contamination with blood at each time point. however, a significant difference was observed in the pr / b and ec / b groups only after 8 weeks. on stereomicroscopic examination, the pr / b specimen [figure 5e ] showed greater discoloration of the material itself, demonstrating a dark orange to gray color change. this result is in agreement with the findings of a previous study that reported greater discoloration of the wmta / blood group compared to the wmta / saline group. therefore, we conclude that the presence of blood within the cavity exacerbates tooth discoloration induced by mta - based pulp capping materials. one possible mechanism may be the interaction between erythrocytes in the blood and the unset mta - based pulp - capping materials. incompletely set materials may allow absorption of blood and hemolysis of erythrocytes from the vital pulp tissue. however, ec is known as a fast setting material, eliminating the possibility of this explanation here. another hypothesis is that the material includes bi2o3 as a radiopacifier, which might result in progressive mass darkening due to interaction with the organic matrix in blood. however, after 8 weeks, the discoloration value of the ecz group was not significant regardless of the presence or absence of blood. we speculated that, because ecz is a fast setting material, it does not allow for absorption of blood, and it does not include bi2o3, which might explain the absence of progressive discoloration of the specimens. consequently, the pr / b and ec / b groups showed greater discoloration compared with the ecz group, and contamination with blood adversely affected the color stability of the tooth. however, the exact mechanism remains unknown, indicating the need for additional research. in this study, bovine incisors were used to evaluate tooth discoloration because they have many advantages compared with human teeth. second, the number of tubules per mm and the tubule diameter of bovine incisors are not significantly different than those of the coronal dentin of human teeth. furthermore, bovine incisors have wide and flat surfaces ; therefore, a standardized sample can be easily obtained. although bovine incisors have been widely used as specimens for in vitro studies of discoloration, there is a need for additional research using human incisors. within the limitations of the present study, we concluded that the largest color alteration was observed in the presence of pr and ec compared to ecz. furthermore, the presence of blood within the cavity adjacent to the materials exacerbated tooth discoloration induced by mta - based pulp - capping materials. however, the type and compounds of the mta - based pulp - capping material play the most significant role in the discoloration. therefore, ecz induces less discoloration and has the potential as an alternative pulp - dressing material for use in aesthetically sensitive areas. however, more research is required to evaluate the color stability of mta - based materials in clinical settings. | objectives : the aim of this study was to evaluate tooth discoloration induced by contact with various calcium silicate - based pulp capping materials in the presence or absence of blood in vitro.materials and methods : eighty bovine samples were divided into six experimental groups and two control groups according to the type of material used (proroot [pr ], endocem [ec ], or endocemzr [ecz ]) and the presence or absence of contamination with blood. a spectrophotometer was used to calculate the color difference (e) between the baseline measurement (after placement of materials) and measurements taken 1, 2, 4, and 8 weeks. the results were analyzed with repeated measures analysis of variance, tukey 's post - hoc tests and independent t - tests (p = 0.05).results : the pr group and ec group showed significantly higher mean values of e than the negative control group after 2 weeks (p < 0.05), whereas ecz did not. there were larger e values when there was contact with blood, especially in pr and ec group (p < 0.05).conclusions : ecz which contains zirconium oxide as a radiopacifier showed less discoloration irrespective of blood contamination compared to pr and ec. |
carotid body tumors (cbt) are rare chemical receptor tumors which accounts for 0.6% of the head and neck tumors in human. although surgical resection is a reliable therapeutic method for cbt, the procedure is technically challenge for surgeons due to the tumor 's adjacent to great vessels and cranial nerve. we report nine cases of cbt who were treated at our center during 2004 to 2008 with a literature review. from 2004 to 2008, nine patients were diagnosed as cbt at the department of vascular surgery, xuanwu hospital, capital medical university. among them, five were male, the mean age was 43 years (range from 26 to 84 years). low echo - level chunks were detected in external carotid arteries and internal carotid arteries. seven patients underwent transcranial doppler (tcd) sonography before the surgery (figure 2). in all of these patients, the carotid artery compression test showed that blood flow in cerebral arteries decreased by 60% or more. three patients had ct examination with angiography plus three - dimensional reconstruction, which showed that soft tissues encased the posterior lateral side of the left common carotid artery bulb. all patients had digital subtraction angiography (dsa), which showed abnormal accumulation of contrast medium at the crotch of common carotid artery. four patients were classified as type i, two as type ii and three as type iii. four of them underwent simple carotid body tumor resection, two underwent carotid body tumor resection and ligation of external carotid artery and two had common carotid artery - internal carotid artery artificial vascular reconstruction. no perioperative mortality and stroke occurred. during a mean follow - up of 2.2 years (3 months to 6 years), the patient who refused surgery died three years after the diagnosis due to complications from bone fracture. the patient with malignant tumor died two years after the surgery due to multiple metastases. cbt is the most frequently diagnosed carotid body disease and is also termed as chemodectoma. it is originated from nervous crest and belongs to nonchromaffin paraganglioma, which is similar to chromaffin suprarenal medulla tumors (such as chromaffin tumors) with the same origin in histology. cbt can be found at any age and is frequently seen in those between 50 and 70 years old, which slightly higher prevalence in women than men. bilateral disease is significantly more frequent in familial (31.8% of cases) than in non - familial cbt (4.4%). the blood supply of cbt is abundant, which is mainly from external carotid artery and branches. blood supplies from internal carotid artery, vertebral artery, ascending pharyngeal artery and superior thyroid artery have also been reported. in addition to external carotid artery, multiple blood supply from internal carotid artery, thyrocervical trunk, vertebral artery and ascending pharyngeal artery were also found in two patients in our case series. color doppler ultrasound, a simple and non - invasive examination, has relatively high specificity and sensitivity for cbt. other diagnostic methods include aspiration - needle biopsy, ct and mri. the accuracy of mri is higher in comparison to that of ct. furthermore, mri is not radioactive, and the diagnostic rate for multiple lesions is particularly important for the patients with family history. shamblin research group classified cbt into type i (localized type), type ii (partially wrapped type) and type iii (wrapped type). with the higher shamblin grading, the possibilities for injuries in cranial nerves, fragility of cervical great vessels are higher during or after operations. recent advance in vascular imaging techniques have enabled preoperative grading for tumor size, which can be completely consistent with the shamblin grading during operations., we have divided the surgery into four types according to shamblin grading and tumor blood supply. simple resection of carotid body tumor is the most ideal operation form, which would not damage the shape and distribution of cervical arteries. thus, it is suitable for shamblin type i / ii cases without abundant blood supply. carotid body tumor resection and reconstructive vascular operation (including simple vascular anastomosis, internal carotid artery - common carotid artery artificial and autologous reconstructive vascular operation) are suitable for shamblin type iii cases with enormous tumors and malignant tumors involving important peripheral vessels. in the carotid body tumor resection and ligation of common carotid artery, cerebral ischemia is a relatively common complication and now is only used for emergent treatments. medullary chromaffinoma is always benign and the incidence of malignant tumors is lower than 10%. one case of malignant cbt in our patients had vertebral body metastasis two years after resection and finally died of the disease. hu. summarized 967 patients in 36 centers from 1962 to 2001 and reported that radiotherapy can be used as the adjunctive therapy for primary and metastatic foci. the efficacy for local control was equal to that for operations and the incidence of complications was significantly reduced in comparison to that for operations. however, results from prospective studies of radiotherapy for malignant cbt are still unavailable and it is not routinely. color doppler ultrasound, a simple and non - invasive examination, has relatively high specificity and sensitivity for cbt. other diagnostic methods include aspiration - needle biopsy, ct and mri. the accuracy of mri is higher in comparison to that of ct. furthermore, mri is not radioactive, and the diagnostic rate for multiple lesions is particularly important for the patients with family history. shamblin research group classified cbt into type i (localized type), type ii (partially wrapped type) and type iii (wrapped type). with the higher shamblin grading, the possibilities for injuries in cranial nerves, fragility of cervical great vessels are higher during or after operations. recent advance in vascular imaging techniques have enabled preoperative grading for tumor size, which can be completely consistent with the shamblin grading during operations., we have divided the surgery into four types according to shamblin grading and tumor blood supply. simple resection of carotid body tumor is the most ideal operation form, which would not damage the shape and distribution of cervical arteries. thus, it is suitable for shamblin type i / ii cases without abundant blood supply. carotid body tumor resection and reconstructive vascular operation (including simple vascular anastomosis, internal carotid artery - common carotid artery artificial and autologous reconstructive vascular operation) are suitable for shamblin type iii cases with enormous tumors and malignant tumors involving important peripheral vessels. in the carotid body tumor resection and ligation of common carotid artery, cerebral ischemia is a relatively common complication and now is only used for emergent treatments. medullary chromaffinoma is always benign and the incidence of malignant tumors is lower than 10%. one case of malignant cbt in our patients had vertebral body metastasis two years after resection and finally died of the disease. hu. summarized 967 patients in 36 centers from 1962 to 2001 and reported that radiotherapy can be used as the adjunctive therapy for primary and metastatic foci. the efficacy for local control was equal to that for operations and the incidence of complications was significantly reduced in comparison to that for operations. however, results from prospective studies of radiotherapy for malignant cbt are still unavailable and it is not routinely. | carotid body tumors (cbt) are rare chemical receptor tumors. we report nine cases of cbt who were diagnosed at our center during 2004 to 2008 with a literature review. of these nine patients, eight underwent complete resection, one received palliative resection due to the malignant nature of the tumor, and the other one refused surgery. no perioperative mortality and stroke occurred. during a mean follow up of 2.2 years, no deaths related to cbt occurred. surgical treatment for cbt is relatively safe. the surgeon should be careful to maintain the integrity of carotid artery, and prevent cerebral ischemia and cranial nerve injuries in order to improve outcome. |
according to 2012 data, geir crops were grown on approximately 170 million hectares globally, in 28 countries. as a part of the larger environmental risk assessment (era) process, these countries require that developers evaluate the potential for geir crops to have adverse impacts on valued ntos. for regulators in countries considering the commercial planting of a geir crop, the analysis of nto impact data and the application of that analysis to their particular circumstances, can be daunting. at the same time, conducting nto testing poses numerous scientific, logistical and financial challenges for researchers, and these challenges are compounded when regulatory authorities require the generation of duplicative data generated in - country or data using local species, particularly when appropriate existing data from relevant geographies may be sufficient for an era of a geir crop. unfortunately, these challenges are likely to intensify as geir crops are considered for commercial planting in new countries. surrogate species selection for assessing potential adverse environmental impacts of genetically engineered plants on non - target organisms convened by the center for environmental risk assessment (cera), ilsi research foundation, june 2628, 2012, in washington, dc. the conference was one in an ongoing series that cera has hosted on nto issues. the objectives of the conference were to identify key criteria for surrogate species selection for laboratory, semi - field and field nto testing and to identify best practices for surrogate testing, with a particular focus on facilitating data transportability. although the production of insect - resistant crops through genetic engineering is a relatively new technology, existing testing methods are available to assess the potential impacts of these crops on ntos and to ensure their environmental safety. in essence, these crops bear transgenes that enable the plant to produce one or more pesticidal chemicals, for example, insecticidal bt proteins, and researchers have decades of experience using tier - based testing to assess the effects of chemical pesticides on ntos. four fundamental principles, developed and validated in the tier - based testing of chemical pesticides, have direct applicability to the testing of nto impacts from geir plants : not all taxa with potential exposure to the pesticide need to be tested testing a small fraction of representative taxa can effectively assess nto impacts. tiered testing is an efficient approach to generate statistically robust data that accurately predict potential impacts from pesticides on ntos. appropriately selected surrogate species can effectively represent ntos when assessing potential impacts from chemical pesticides. data generated using surrogates can be more consistent, of higher quality and of greater transferability than data generated using the nto species themselves. results of tests using surrogate species can be extrapolated to predict and assess changes at the population, community and ecosystem levels. in a tier - based system for assessing chemical pesticide impacts, tier 1 testing occurs under contained conditions in the laboratory or greenhouse and typically involves the exposure of a select group of representative species to levels of the pesticide many times higher than levels expected from environmental exposure, to ensure a sufficient margin of safety. provided there is an adequate margin of safety with lower tiers, testing at higher tiers, e.g., semi - field or field scale, is not required. while semi - field and field scale assays are performed under more realistic conditions than laboratory tests, they are typically more complex, more difficult to standardize and have less statistical power than tests performed in the laboratory. for both chemical pesticides and insecticidal substances produced by geir crops, a fundamental challenge for the researcher is the selection of test species that will be used. it is obvious that not all species present in the receiving environment and potentially exposed to the geir crop - produced insecticidal substance can be tested. conducting tests with actual ntos expected to be exposed to the pesticide or geir crop may not be practical, economically feasible, or even legal, as in the case of endangered or protected species. (it has also been suggested that, in the context of risk assessment for biological control agents, the use of surrogates may be useful when a potentially impacted species is very rare.) tests are thus commonly conducted with relevant surrogate species that are most likely to be sensitive to the insecticidal protein, available in large numbers of consistent individuals and amenable to testing under confined conditions. the selection of appropriate surrogate species for geir crops needs to result in the use of surrogate species that are predictive of potential impacts of the geir crop on ntos in the field and thus will be protective of ecosystem structure and function. as a result of decades of nto testing with chemical pesticides, numerous surrogate species have been identified that meet these criteria. test results using these species have effectively assessed the environmental safety of chemical pesticides and informed regulatory decision making. many of these same species have also been used effectively in the assessment of potential impacts from geir crops. however, while there is considerable international harmonization regarding test guidelines for assessing impacts of chemical pesticides on ntos, guidelines for assessing geir crops vary from country to country. for example, table 1 summarizes key features of the regulatory schema related to nto assessments in six jurisdictions that have approved the use of geir crops. lack of consistency among regulatory jurisdictions can result in duplication of work and the inability to compare nto test data developed in one country with those of another. in addition, requirements for field tests, regardless of the results of lower tier testing or the requirement that a specific local species be included in nto impact assessment studies can quickly escalate development costs for commercial production approvals. this disharmony could have a chilling effect on public sector scientists with limited research funding, who may be forced to collect nto assessment data to meet the requirements of only a single regulatory program and forego a broader deployment of new ge varieties. as more and more nations, representing a wider variety of agro - ecosystems, consider the adoption of geir crops, it is timely to re - evaluate the selection criteria for appropriate surrogate species for nto testing. first, the establishment of an internationally harmonized approach to the identification and use of surrogate species would result in the recognition of numerous surrogates to serve as a toolbox from which researchers can select species as needed. second, a harmonized approach would address the growing need for nto test data to be transportable across national borders so as to reduce duplication of effort and associated costs both for regulators and for developers of new geir crops. although surrogate species for lower tier testing should be selected on a case - by - case basis for geirs, certain primary ecological functional groups should be considered when assessing geir crops, namely herbivores, pollinators, predators and parasitoids and decomposers. probable routes of exposure should also be evaluated, and emphasis should be placed on species that either feed directly on the crop (one degree of separation) and on species that are predators or parasitoids of direct feeders (two degrees of separation). testing species with more attenuated exposure to the crop is unnecessary from a risk assessment standpoint. the selection process for appropriate surrogates can be informed by existing databases of arthropod communities associated with major field crops. herbivores comprise lepidoptera, coleoptera, hemiptera and diptera species ; predators consist of coleoptera, diptera and hemiptera species ; parasitoids include the hymenoptera, diptera and coleoptera ; and decomposers are represented by collembola, acarina, diptera and coleoptera. these taxa are most likely to be exposed to arthropod - active substances produced by the crop, and surrogates representing these taxa should be considered for nto testing. ideally, taxa chosen should be those commonly occurring in that crop, regardless of the geographic location, to enhance the transportability of the data collected. once the potentially impacted taxa are identified, surrogates for tier 1 testing should be selected based on phylogenetic relatedness to the potentially impacted species, rather than on shared ecological function, e.g., if a crop pollinator may be negatively impacted by the crop, an appropriate surrogate would be a species closely related to the pollinator, regardless of the surrogate s ecological function. when there is incomplete information regarding which species may be impacted by a particular pesticidal substance, surrogates should be selected to provide adequate taxonomic coverage to enable a confident prediction of no unacceptable adverse effects on ntos. in addition to choosing surrogates for lower tier testing that accurately represent ntos in the cropping system where the crop is going to be introduced, there are important practical considerations. surrogates must be easily reared under controlled, standardized conditions to provide large numbers of consistent individuals having a high level of fitness ; they must perform well on an artificial diet and be amenable to manipulation under laboratory conditions ; and validated test protocols must be available that produce consistent, statistically robust data. the utility of surrogates decreases as one moves from semi - field to field scale testing. in these contexts, the emphasis should be on identifying representative taxa, a process that will also be informed by the arthropod community databases mentioned above. factors to consider in the selection process include results from lower - tier testing, routes of exposure, types and duration of exposure, the perceived importance of the organisms in the agro - ecosystem and their presence in sufficient numbers. at the conclusion of the conference, participants advanced the following points of consensus : surrogate species are the appropriate test organisms for laboratory and semi - field studies. representative taxonomic groups are the appropriate level of resolution (test unit) for census field studies. measures of surrogate processes representative of ecological function in the field can be a valuable tool. field studies should focus on the taxa that are one or two degrees of separation away from the crop. provided adequate margins of safety, hazard testing that is used to inform the in - field assessment informs the off - field assessment. moving forward, the development and validation of test protocols for new surrogate species will enlarge the toolbox, facilitating the selection of the most appropriate surrogates on a case - by - case basis. the identification of surrogate species that may be useful in the assessment of potential impacts on arthropod communities associated with major field crops in different geographies will contribute to the transportability of nto assessment data collected in different regulatory jurisdictions. opinions and views expressed in the present article are strictly those of the authors and do not represent those of the organizations where the authors are currently employed. | most regulatory authorities require that developers of genetically engineered insect - resistant (geir) crops evaluate the potential for these crops to have adverse impacts on valued non - target organisms (ntos), i.e., organisms not intended to be controlled by the trait. in many cases, impacts to ntos are assessed using surrogate species, and it is critical that the data derived from surrogates accurately predict any adverse impacts likely to be observed from the use of the crop in the agricultural context. the key is to select surrogate species that best represent the valued ntos in the location where the crop is going to be introduced, but this selection process poses numerous challenges for the developers of ge crops who will perform the tests, as well as for the ecologists and regulators who will interpret the test results. these issues were the subject of a conference surrogate species selection for assessing potential adverse environmental impacts of genetically engineered plants on non - target organisms convened by the center for environmental risk assessment, ilsi research foundation. this report summarizes the proceedings of the conference, including the presentations, discussions and the points of consensus agreed to by the participants. |
science is rarely tidy. we ultimately seek a unified explanatory framework characterized by elegance and simplicity ; along the way, however, our aesthetic impulses must occasionally be sacrificed to the desire to encompass the largest possible range of phenomena (i.e., to fit the data). it is often the case that an otherwise compelling theory, in order to be brought into agreement with observation, requires some apparently unnatural modification. some such modifications may eventually be discarded as unnecessary once the phenomena are better understood ; at other times, advances in our theoretical understanding will reveal that a certain theoretical compromise is only superficially distasteful, when in fact it arises as the consequence of a beautiful underlying structure. general relativity is a paradigmatic example of a scientific theory of impressive power and simplicity. the cosmological constant, meanwhile, is a paradigmatic example of a modification, originally introduced to help fit the data, which appears at least on the surface to be superfluous and unattractive. its original role, to allow static homogeneous solutions to einstein s equations in the presence of matter, turned out to be unnecessary when the expansion of the universe was discovered, and there have been a number of subsequent episodes in which a nonzero cosmological constant was put forward as an explanation for a set of observations and later withdrawn when the observational case evaporated. meanwhile, particle theorists have realized that the cosmological constant can be interpreted as a measure of the energy density of the vacuum. this energy density is the sum of a number of apparently unrelated contributions, each of magnitude much larger than the upper limits on the cosmological constant today ; the question of why the observed vacuum energy is so small in comparison to the scales of particle physics has become a celebrated puzzle, although it is usually thought to be easier to imagine an unknown mechanism which would set it precisely to zero than one which would suppress it by just the right amount to yield an observationally accessible cosmological constant. this checkered history has led to a certain reluctance to consider further invocations of a nonzero cosmological constant ; however, recent years have provided the best evidence yet that this elusive quantity does play an important dynamical role in the universe. this possibility, although still far from a certainty, makes it worthwhile to review the physics and astrophysics of the cosmological constant (and its modern equivalent, the energy of the vacuum). there are a number of other reviews of various aspects of the cosmological constant ; in the present article i will outline the most relevant issues, but not try to be completely comprehensive, focusing instead on providing a pedagogical introduction and explaining recent advances. for astrophysical aspects, i did not try to duplicate much of the material in carroll, press and turner, which should be consulted for numerous useful formulae and a discussion of several kinds of observational tests not covered here. some earlier discussions include [85, 50, 221 ], and subsequent reviews include [58, 218, 246 ]. the classic discussion of the physics of the cosmological constant is by weinberg, with more recent work discussed by [58, 218 ]. for introductions to cosmology, see [149, 160, 189 ]. einstein s original field equations are : (1)\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$${r_{\mu \nu } } - \frac{1}{2}r{g_{\mu \nu } } = 8\pi g{t_{\mu \nu } }.$$\end{document } (i use conventions in which c = 1, and will also set = 1 in most of the formulae to follow, but newton s constant will be kept explicit.) on very large scales the universe is spatially homogeneous and isotropic to an excellent approximation, which implies that its metric takes the robertson - walker form, (2)\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$${\rm{d}}{s^2 } = - { \rm{d}}{t^2 } + { a^2}(t)r_0 ^ 2\left [{ \frac{{{\rm{d}}{r^2}}}{{1 - k{r^2 } } } + { r^2}{\rm{d}}{\omega ^2 } } \right],$$\end{document } where d = d + sind is the metric on a two - sphere. the curvature parameter k takes on values + 1, 0, or -1 for positively curved, flat, and negatively curved spatial sections, respectively. the scale factor characterizes the relative size of the spatial sections as a function of time ; we have written it in a normalized form a(t) = r(t)/r0, where the subscript 0 will always refer to a quantity evaluated at the present time. the redshift z undergone by radiation from a comoving object as it travels to us today is related to the scale factor at which it was emitted by (3)\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$a = \frac{1}{{(1 + z)}}.$$\end{document } the energy - momentum sources may be modeled as a perfect fluid, specified by an energy density and isotropic pressure p in its rest frame. the energy - momentum tensor of such a fluid is (4)\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$${t_{\mu \nu } } = (\rho + p){u_\mu } { u_\nu } + p{g_{\mu \nu } }, $ $ \end{document } where u is the fluid four - velocity. to obtain a robertson - walker solution to einstein s equations, the rest frame of the fluid must be that of a comoving observer in the metric (2) ; in that case, einstein s equations reduce to the two friedmann equations, (5)\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$${h^2 } \equiv { \left ({ \frac{{\dot a}}{a } } \right)^2 } = \frac{{8\pi g}}{3}\rho - \frac{k}{{{a^2}r_0 ^ 2}},$$\end{document } where we have introduced the hubble parameter h / a, and (6)\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\frac{{\ddot a}}{a } = - \frac{{4\pi g}}{3}(\rho + 3p).$$\end{document } einstein was interested in finding static (= 0) solutions, both due to his hope that general relativity would embody mach s principle that matter determines inertia, and simply to account for the astronomical data as they were understood at the time. (this account gives short shrift to the details of what actually happened ; for historical background see.) a static universe with a positive energy density is compatible with (5) if the spatial curvature is positive (k = + 1) and the density is appropriately tuned ; however, (6) implies that a will never vanish in such a spacetime if the pressure p is also nonnegative (which is true for most forms of matter, and certainly for ordinary sources such as stars and gas). einstein therefore proposed a modification of his equations, to (7)\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$${r_{\mu \nu } } - \frac{1}{2}r{g_{\mu \nu } } + \lambda { g_{\mu \nu } } = 8\pi g{t_{\mu \nu } }, $ $ \end{document } where is a new free parameter, the cosmological constant. indeed, the left - hand side of (7) is the most general local, coordinate - invariant, divergenceless, symmetric, two - index tensor we can construct solely from the metric and its first and second derivatives. with this modification, the friedmann equations become (8)\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$${h^2 } = \frac{{8\pi g}}{3}\rho + \frac{\lambda } { 3 } - \frac{k}{{{a^2}r_0 ^ 2}},$$\end{document } and (9)\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\frac{{\ddot a}}{a } = - \frac{{4\pi g}}{3}(\rho + 3p) + \frac{\lambda } { 3}.$$\end{document } these equations admit a static solution with positive spatial curvature and all the parameters, p, and nonnegative. the discovery by hubble that the universe is expanding eliminated the empirical need for a static world model (although the einstein static universe continues to thrive in the toolboxes of theorists, as a crucial step in the construction of conformal diagrams). it has also been criticized on the grounds that any small deviation from a perfect balance between the terms in (9) will rapidly grow into a runaway departure from the static solution. the disappearance of the original motivation for introducing the cosmological constant did not change its status as a legitimate addition to the gravitational field equations, or as a parameter to be constrained by observation. the only way to purge from cosmological discourse would be to measure all of the other terms in (8) to sufficient precision to be able to conclude that the /3 term is negligibly small in comparison, a feat which has to date been out of reach. as discussed below, there is better reason than ever before to believe that is actually nonzero, and einstein may not have blundered after all. from the point of view of classical general relativity, there is no preferred choice for what the length scale defined by might be. the cosmological constant turns out to be a measure of the energy density of the vacuum the state of lowest energy and although we can not calculate the vacuum energy with any confidence, this identification allows us to consider the scales of various contributions to the cosmological constant [277, 33 ]. consider a single scalar field, with potential energy v(). the action can be written (10)\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$s = \int { { d^4 } } x\sqrt { - g } \left [{ \frac{1}{2}{g^{\mu \nu } } { \partial _ \mu } \phi { \partial _ \nu } \phi - v(\phi) } \right]$$\end{document } (where g is the determinant of the metric tensor g), and the corresponding energy - momentum tensor is (11)\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$${t_{\mu \nu } } = \frac{1}{2}{\partial _ \mu } \phi { \partial _ \nu } \phi + \frac{1}{2}({g^{\rho \sigma } } { \partial _ \rho } \phi { \partial _ \sigma } \phi) { g_{\mu \nu } } - v(\phi) { g_{\mu \nu } }.$$\end{document } in this theory, the configuration with the lowest energy density (if it exists) will be one in which there is no contribution from kinetic or gradient energy, implying = 0, for which t = -v(0)g, where 0 is the value of which minimizes v(). the vacuum energy - momentum tensor can thus be written (12)\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$t_{\mu \nu } ^{{\rm{vac } } } = - { \rho _ { { \rm{vac}}}}{g_{\mu \nu } }, $ $ \end{document } with vac in this example given by v(0). (this form for the vacuum energy - momentum tensor can also be argued for on the more general grounds that it is the only lorentz - invariant form for tvac.) the vacuum can therefore be thought of as a perfect fluid as in (4), with (13)\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$${p_{{\rm{vac } } } } = - { \rho _ { { \rm{vac}}}}.$$\end{document } the effect of an energy - momentum tensor of the form (12) is equivalent to that of a cosmological constant, as can be seen by moving the g term in (7) to the right - hand side and setting (14)\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$${\rho _ { { \rm{vac } } } } = { \rho _ \lambda } \equiv \frac{\lambda } { { 8\pi g}}.$$\end{document } this equivalence is the origin of the identification of the cosmological constant with the energy of the vacuum. in what follows, i will use the terms vacuum energy and cosmological constant essentially interchangeably. cosmological constant 0 is (15)\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$s = \frac{1}{{16\pi g}}\int { { d^4 } } x\sqrt { - g } (r - 2{\lambda _ 0}),$$\end{document } where r is the ricci scalar. extremizing this action (augmented by suitable matter terms) leads to the equations (7). thus, the cosmological constant can be thought of as simply a constant term in the lagrange density of the theory. indeed, (15) is the most general covariant action we can construct out of the metric and its first and second derivatives, and is therefore a natural starting point for a theory of gravity. classically, then, the effective cosmological constant is the sum of a bare term 0 and the potential energy v(), where the latter may change with time as the universe passes through different phases. uantum mechanics adds another contribution, from the zero - point energies associated with vacuum fluctuations. consider a simple harmonic oscillator, i.e. a particle moving in a one - dimensional potential of the form \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$v(x) = { \textstyle{1 \over 2}}{\omega ^2}{x^2}$$\end{document}. classically, the vacuum for this system is the state in which the particle is motionless and at the minimum of the potential (x = 0), for which the energy in this case vanishes. quantum - mechanically, however, the uncertainty principle forbids us from isolating the particle both in position and momentum, and we find that the lowest energy state has an energy \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$${e_0 } = { \textstyle{1 \over 2}}\hbar \omega $ $ \end{document } (where i have temporarily re - introduced explicit factors of for clarity). of course, in the absence of gravity either system actually has a vacuum energy which is completely arbitrary ; we could add any constant to the potential (including, for example, \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ - \frac{1}{2}\hbar \omega $ $ \end{document }) without changing the theory. it is important, however, that the zero - point energy depends on the system, in this case on the frequency. a precisely analogous situation holds in field theory. a (free) quantum field can be thought of as a collection of an infinite number of harmonic oscillators in momentum space. formally, the zero - point energy of such an infinite collection will be infinite. if, however, we discard the very high - momentum modes on the grounds that we trust our theory only up to a certain ultraviolet momentum cutoff kmax, we find that the resulting energy density is of the form (16)\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$${\rho _ \lambda } \sim \hbar k_{\max } ^4.$$\end{document } this answer could have been guessed by dimensional analysis ; the numerical constants which have been neglected will depend on the precise theory under consideration. again, in the absence of gravity this energy has no effect, and is traditionally discarded (by a process known as normal - ordering). however, gravity does exist, and the actual value of the vacuum energy has important consequences. (and the vacuum fluctuations themselves are very real, as evidenced by the casimir effect.) the net cosmological constant, from this point of view, is the sum of a number of apparently disparate contributions, including potential energies from scalar fields and zero - point fluctuations of each field theory degree of freedom, as well as a bare cosmological constant 0. unlike the last of these, in the first two cases we can at least make educated guesses at the magnitudes. in the weinberg - salam electroweak model, the phases of broken and unbroken symmetry are distinguished by a potential energy difference of approximately mew 200 gev (where 1 gev = 1.610 erg) ; the universe is in the broken - symmetry phase during our current low - temperature epoch, and is believed to have been in the symmetric phase at sufficiently high temperatures at early times. the effective cosmological constant is therefore different in the two epochs ; absent some form of prearrangement, we would naturally expect a contribution to the vacuum energy today of order (17)\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\rho _ \lambda ^{{\rm{ew } } } \sim { (200{\rm{gev}})^4 } \sim 3 \times { 10^{47}}\;{\rm{erg}}/{\rm{c}}{{\rm{m}}^3}.$$\end{document } similar contributions can arise even without invoking fundamental scalar fields. in the strong interactions, chiral symmetry is believed to be broken by a nonzero expectation value of the quark bilinear qq (which is itself a scalar, although constructed from fermions). in this case the energy difference between the symmetric and broken phases is of order the qcd scale mqcd 0.3 gev, and we would expect a corresponding contribution to the vacuum energy of order (18)\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\rho _ \lambda ^{{\rm{qcd } } } \sim { (0.3\;{\rm{gev}})^4 } \sim 1.6 \times { 10^{36}}\;{\rm{erg}}/{\rm{c}}{{\rm{m}}^3}.$$\end{document } these contributions are joined by those from any number of unknown phase transitions in the early universe, such as a possible contribution from grand unification of order mgut 10 gev. in the case of vacuum fluctuations, we should choose our cutoff at the energy past which we no longer trust our field theory. if we are confident that we can use ordinary quantum field theory all the way up to the planck scale mpl = (8g) 10 gev, we expect a contribution of order (19)\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\rho _ \lambda ^{{\rm{p}}1 } \sim { ({ 10^{18}}\;{\rm{gev}})^4 } \sim 2 \times { 10^{110}}\;{\rm{erg}}/{\rm{c}}{{\rm{m}}^3}.$$\end{document } field theory may fail earlier, although quantum gravity is the only reason we have to believe it will fail at any specific scale. as we will discuss later, cosmological observations imply (20)\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$|\rho _ \lambda ^{({\rm{obs}})}|\ ; \le { ({ 10^ { - 12}}\;{\rm{gev}})^4 } \sim 2 \times { 10^ { - 10}}\;{\rm{erg / cm^3}},$$\end{document } much smaller than any of the individual effects listed above. the ratio of (19) to (20) is the origin of the famous discrepancy of 120 orders of magnitude between the theoretical and observational values of the cosmological constant. there is no obstacle to imagining that all of the large and apparently unrelated contributions listed add together, with different signs, to produce a net cosmological constant consistent with the limit (20), other than the fact that it seems ridiculous. we know of no special symmetry which could enforce a vanishing vacuum energy while remaining consistent with the known laws of physics ; this conundrum is the cosmological constant problem. in section 4 we will discuss a number of issues related to this puzzle, which at this point remains one of the most significant unsolved problems in fundamental physics. from the friedmann equation (5) (where henceforth we take the effects of a cosmological constant into account by including the vacuum energy density into the total density), for any value of the hubble parameter h there is a critical value of the energy density such that the spatial geometry is flat (k = 0) : (21)\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$${\rho _ { { \rm{crit } } } } \equiv \frac{{3{h^2}}}{{8\pi g}}.$$\end{document } it is often most convenient to measure the total energy density in terms of the critical density, by introducing the density parameter (22)\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\omega \equiv \frac{\rho } { { { \rho _ { { \rm{crit } } } } } } = \left ({ \frac{{8\pi g}}{{3{h^2 } } } } \right)\rho.$$\end{document } one useful feature of this parameterization is a direct connection between the value of and the spatial geometry : (23)\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$k = { \rm{sgn}}(\omega - 1).$$\end{document } [keep in mind that some references still use to refer strictly to the density parameter in matter, even in the presence of a cosmological constant ; with this definition (23) no longer holds. ] in general, the energy density will include contributions from various distinct components. from the point of view of cosmology, the relevant feature of each component is how its energy density evolves as the universe expands. fortunately, it is often (although not always) the case that individual components i have very simple equations of state of the form (24)\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$${p_i } = { w_i}{\rho _ i},$$\end{document } with wi a constant. plugging this equation of state into the energy - momentum conservation equation t = 0, we find that the energy density has a power - law dependence on the scale factor, (25)\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$${\rho _ i } \propto { a^ { - { n_i}}},$$\end{document } where the exponent is related to the equation of state parameter by (26)\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$${n_i}{\rm { = 3(1 + } } { w_i}{\rm{)}}{\rm{.}}$$\end{document } the density parameter in each component is defined in the obvious way, (27)\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$${\omega _ i } \equiv \frac{{{\rho _ i}}}{{{\rho _ { { \rm{crit } } } } } } = \left ({ \frac{{8\pi g}}{{3{h^2 } } } } \right){\rho _ i},$$\end{document } which has the useful property that (28)\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\frac{{{\omega _ i}}}{{{\omega _ j } } } \propto { a^ { - ({ n_i } - { n_j})}}.$$\end{document } the simplest example of a component of this form is a set of massive particles with negligible relative velocities, known in cosmology as dust or simply matter. the energy density of such particles is given by their number density times their rest mass ; as the universe expands, the number density is inversely proportional to the volume while the rest masses are constant, yielding m a. for relativistic particles, known in cosmology as radiation (although any relativistic species counts, not only photons or even strictly massless particles), the energy density is the number density times the particle energy, and the latter is proportional to a (redshifting as the universe expands) ; the radiation energy density therefore scales as r a. vacuum energy does not change as the universe expands, so a ; from (26) this implies a negative pressure, or positive tension, when the vacuum energy is positive. finally, for some purposes it is useful to pretend that the -kar0 - 2 term in (5) represents an effective energy density in curvature, and define k = -(3k/8gr02)a. we can define a corresponding density parameter (29)\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$${\omega _ k } = 1 - \omega ; $ $ \end{document } this relation is simply (5) divided by h. note that the contribution from k is (for obvious reasons) not included in the definition of. the usefulness of k is that it contributes to the expansion rate analogously to the honest density parameters i we can write (30)\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$h(a) = { h_0}{\left ({ \sum\limits_{i(k) } { { \omega _ { i0 } } } { a^ { - { n_i } } } } \right)^{1/2}},$$\end{document } where the notation i(k) reflects the fact that the sum includes k in addition to the various components of = ii. the most popular equations of state for cosmological energy sources can thus be summarized as follows : (31) the ranges of values of the i s which are allowed in principle (as opposed to constrained by observation) will depend on a complete theory of the matter fields, but lacking that we may still invoke energy conditions to get a handle on what constitutes sensible values. the most appropriate condition is the dominant energy condition (dec), which states that tll 0, and tl is non - spacelike, for any null vector l ; this implies that energy does not flow faster than the speed of light. for a perfect - fluid energy - momentum tensor of the form (4), these two requirements imply that + p 0 and || |p|, respectively. thus, either the density is positive and greater in magnitude than the pressure, or the density is negative and equal in magnitude to a compensating positive pressure ; in terms of the equation - of - state parameter w, we have either positive and |w| 1 or negative and w = -1. that is, a negative energy density is allowed only if it is in the form of vacuum energy. (we have actually modified the conventional dec somewhat, by using only null vectors l rather than null or timelike vectors ; the traditional condition would rule out a negative cosmological constant, which there is no physical reason to do.) there are good reasons to believe that the energy density in radiation today is much less than that in matter. photons, which are readily detectable, contribute 5 10, mostly in the 2.73 k cosmic microwave background [211, 87, 225 ]. if neutrinos are sufficiently low mass as to be relativistic today, conventional scenarios predict that they contribute approximately the same amount. in the absence of sources which are even more exotic, it is therefore useful to parameterize the universe today by the values of m and, with k = 1 - m -, keeping the possibility of surprises always in mind. one way to characterize a specific friedmann - robertson - walker model is by the values of the hubble parameter and the various energy densities i. (of course, reconstructing the history of such a universe also requires an understanding of the microphysical processes which can exchange energy between the different states.) it may be difficult, however, to directly measure the different contributions to, and it is therefore useful to consider extracting these quantities from the behavior of the scale factor as a function of time. a traditional measure of the evolution of the expansion rate is the deceleration parameter (32)\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\begin{array}{{20}{l } } { q \equiv - \frac{{\ddot aa}}{{{{\dot a}^2}}}}\\ { \;\:\ : = \sum\limits_i { \frac{{{n_i } - 2}}{2 } } { \omega _ i}}\\ { \:\:\:\, = \frac{1}{2}{\omega _ { \rm{m } } } - { \omega _ \lambda }, } \end{array}$$\end{document } where in the last line we have assumed that the universe is dominated by matter and the cosmological constant. under the assumption that = 0, measuring q0 provides a direct measurement of the current density parameter m0 ; however, once is admitted as a possibility there is no single parameter which characterizes various universes, and for most purposes it is more convenient to simply quote experimental results directly in terms of m and. [even this parameterization, of course, bears a certain theoretical bias which may not be justified ; ultimately, the only unbiased method is to directly quote limits on a(t). ] notice that positive - energy - density sources with n > 2 cause the universe to decelerate while n 0 the universe will expand forever unless there is sufficient matter to cause recollapse before becomes dynamically important. for = 0 we have the familiar situation in which m 1 universes expand forever and m > 1 universes recollapse ; notice, however, that in the presence of a cosmological constant there is no necessary relationship between spatial curvature and the fate of the universe. (furthermore, we can not reliably determine that the universe will expand forever by any set of measurements of and m ; even if we seem to live in a parameter space that predicts eternal expansion, there is always the possibility of a future phase transition which could change the equation of state of one or more of the components.) given m, the value of for which the universe will expand forever is given by (34)\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$${\omega _ \lambda } \ge \left\ { { \begin{array}{{20}{l } } 0&{\quad { \rm{for}}\:0 \le { \omega _ { \rm{m } } } \le 1,}\\ { 4{\omega _ { \rm{m}}}\cos 3\left [{ \frac{1}{3}{{\cos } ^ { - 1}}\left ({ \frac{{1 - { \omega _ { \rm{m}}}}}{{{\omega _ { \rm{m } } } } } } \right) + \frac{{4\pi } } { 3 } } \right]}&{\quad { \rm{for}}\:{\omega _ { \rm{m } } } \end{array } } \right.$$\end{document } conversely, if the cosmological constant is sufficiently large compared to the matter density, the universe has always been accelerating, and rather than a big bang its early history consisted of a period of gradually slowing contraction to a minimum radius before beginning its current expansion. the criterion for there to have been no singularity in the past is (35)\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$${\omega _ \lambda } \ge 4{\omega _ { \rm{m}}}{\rm{cos}}{{\rm{s}}^{\rm{3}}}\left [{ \frac{1}{3}{\rm{cos}}{{\rm{s}}^{{\rm { - 1}}}}\left ({ \frac{{1 - { \omega _ { \rm{m}}}}}{{{\omega _ { \rm{m } } } } } } \right) } \right],$$\end{document } where coss represents cosh when m 1/2. the dynamics of universes with = m + are summarized in figure 1, in which the arrows indicate the evolution of these parameters in an expanding universe. one important difference is that a universe passing through one point can pass through the same point again but moving backwards along its trajectory, by first going to infinity and then turning around (recollapse). figure 1dynamics for = m +. the arrows indicate the direction of evolution of the parameters in an expanding universe. dynamics for = m +. the arrows indicate the direction of evolution of the parameters in an expanding universe. figure 1 includes three fixed points, at (m,) equal to (0,0), (0,1), and (1, 0). the attractor among these at (0,1) is known as de sitter space a universe with no matter density, dominated by a cosmological constant, and with scale factor growing exponentially with time. the fact that this point is an attractor on the diagram is another way of understanding the cosmological constant problem. a universe with initial conditions located at a generic point on the diagram will, after several expansion times, flow to de sitter space if it began above the recollapse line, and flow to infinity and back to recollapse if it began below that line. since our universe has expanded by many orders of magnitude since early times, it must have begun at a non - generic point in order not to have evolved either to de sitter space or to a big crunch. the only other two fixed points on the diagram are the saddle point at (m,) = (0, 0), corresponding to an empty universe, and the repulsive fixed point at (m,) = (1, 0), known as the einstein - de sitter solution. since our universe is not empty, the favored solution from this combination of theoretical and empirical arguments is the einstein - de sitter universe. the inflationary scenario [113, 159, 6 ] provides a mechanism whereby the universe can be driven to the line m + = 1 (spatial flatness), so einstein - de sitter is a natural expectation if we imagine that some unknown mechanism sets = 0. as discussed below, the observationally favored universe is located on this line but away from the fixed points, near (m,) = (0.3,0.7). it is fair to conclude that naturalness arguments have a somewhat spotty track record at predicting cosmological parameters. the lookback time from the present day to an object at redshift z is given by (36)\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\begin{array}{l } { t_0 } - { t _ } = \int_{{t_}}^{{t_0 } } d t\\ \quad \quad \quad = \int_{1/(1 + { z_})}^1 { \frac{{da}}{{ah(a) } } }, \end{array}$$\end{document } with h(a) given by (30). the age of the universe is obtained by taking the z (t 0) limit. for = m = 1, this yields the familiar answer t0 = (2/3)h0 - 1 ; the age decreases as m is increased, and increases as is increased. figure 2 shows the expansion history of the universe for different values of these parameters and h0 fixed ; it is clear how the acceleration caused by leads to an older universe. there are analytic approximation formulas which estimate (36) in various regimes [264, 149, 48 ], but generally the integral is straightforward to perform numerically. figure 2expansion histories for different values of m and. from top to bottom, the curves describe (m,) = (0.3, 0.7), (0.3, 0.0), (1.0, 0.0), and (4.0, 0.0). expansion histories for different values of m and. from top to bottom, the curves describe (m,) = (0.3, 0.7), (0.3, 0.0), (1.0, 0.0), and (4.0, 0.0). in a generic curved spacetime, there is no preferred notion of the distance between two objects. robertson - walker spacetimes have preferred foliations, so it is possible to define sensible notions of the distance between comoving objects those whose worldlines are normal to the preferred slices. placing ourselves at r = 0 in the coordinates defined by (2), the coordinate distance r to another comoving object is independent of time. it can be converted to a physical distance at any specified time t by multiplying by the scale factor r0a(t), yielding a number which will of course change as the universe expands. however, intervals along spacelike slices are not accessible to observation, so it is typically more convenient to use distance measures which can be extracted from observable quantities. these include the luminosity distance, (37)\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$${d_{\rm{l } } } \equiv \sqrt { \frac{l}{{4\pi f } } }, $ $ \end{document } where l is the intrinsic luminosity and f the measured flux ; the proper - motion distance, (38)\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$${d_{\rm{m } } } \equiv \frac{u}{{\dot \theta } }, $ $ \end{document } where u is the transverse proper velocity and the observed angular velocity ; and the angular - diameter distance, (39)\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$${d_{\rm{a } } } \equiv \frac{d}{\theta }, $ $ \end{document } where d is the proper size of the object and its apparent angular size. all of these definitions reduce to the usual notion of distance in a euclidean space. in a robertson - walker universe, the proper - motion distance turns out to equal the physical distance along a spacelike slice at t = t0 : (40)\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$${d_{\rm{m } } } = { r_0}r.$$\end{document } the three measures are related by (41)\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$${d_{\rm{l } } } = (1 + z){d_{\rm{m } } } = { (1 + z)^2}{d_{\rm{a}}},$$\end{document } so any one can be converted to any other for sources of known redshift. the proper - motion distance between sources at redshift z1 and z2 can be computed by using ds = 0 along a light ray, where ds is given by (2). we have (42)\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\begin{array}{l } { d_{\rm{m}}}({z_1},\:{z_2 }) = { r_0}({r_2 } - { r_1})\\ \quad \quad \quad \quad \, = { r_0}\;{\rm{sinn}}\;\left [{ \int_{{t_1}}^{{t_2 } } { \frac{{dt}}{{{r_0}a(t) } } } } \right]\\ \quad \quad \quad \quad \, = \frac{1}{{{h_0}\sqrt { |{\omega _ { k0}}| } } } \;{\rm{sinn}}\;\left [{ { h_0}\sqrt { |{\omega _ { k0}}| } \int_{1/(1 + { z_1})}^{1/(1 + { z_2 }) } { \frac{{da}}{{{a^2}h(a) } } } } \right ], \end{array}$$\end{document } where we have used (5) to solve for \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$${r_0 } = 1/({h_0}\sqrt { |{\omega _ { k0}}| }) $ $ \end{document }, h(a) is again given by (30), and sinn(x) denotes (x) when k0 > 0, sin(x) when k0 0 redshift away more rapidly than ordinary matter (and therefore cause extra deceleration), while wx \;\sqrt { v''(\phi) } $ $ \end{document }, and underdamped (and thus free to roll) when \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$h\ ; < \;\sqrt { v''(\phi) } $ $ \end{document}. the energy density is \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$${\rho _ \phi } = { \textstyle{1 \over 2}}{\dot \phi ^2 } + v(\phi) $ $ \end{document }, and the pressure is \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$${p_\phi } = \frac{1}{2}{{\dot \phi } ^2 } + v(\phi) $ $ \end{document }, implying an equation of state parameter (63)\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$w = \frac{p}{\rho } = \frac{{\frac{1}{2}{{\dot \phi } ^2 } - v(\phi) } } { { \frac{1}{2}{{\dot \phi } ^2 } + v(\phi) } }, $ $ \end{document } which will generally vary with time. thus, when the field is slowly - varying and v(), we have w -1, and the scalar field potential acts like a cosmological constant. there are many reasons to consider dynamical dark energy as an alternative to a cosmolog - ical constant. first and foremost, it is a logical possibility which might be correct, and can be constrained by observation. secondly, it is consistent with the hope that the ultimate vacuum energy might actually be zero, and that we simply havent relaxed all the way to the vacuum as yet. but most interestingly, one might wonder whether replacing a constant parameter a with a dynamical field could allow us to relieve some of the burden of fine - tuning that inevitably accompanies the cosmological constant. to date, investigations have focused on scaling or tracker models of quintessence, in which the scalar field energy density can parallel that of matter or radiation, at least for part of its history [86, 62, 279, 158, 232, 278, 219 ]. (of course, we do not want the dark energy density to redshift away as rapidly as that in matter during the current epoch, or the universe would not be accelerating.) tracker models can be constructed in which the vacuum energy density at late times is robust, in the sense that it does not depend sensitively on the initial conditions for the field. however, the ultimate value vac (10 ev) still depends sensitively on the parameters in the potential. indeed, it is hard to imagine how this could help but be the case ; unlike the case of the axion solution to the strong - cp problem, we have no symmetry to appeal to that would enforce a small vacuum energy, much less a particular small nonzero number. quintessence models also introduce new naturalness problems in addition to those of a cosmological constant. these can be traced to the fact that, in order for the field to be slowly - rolling today, we require \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\sqrt { v''({\phi _ 0 }) } \sim { h_0}$$\end{document } ; but this expression is the effective mass of fluctuations in, so we have (64)\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$${m_\phi } \sim { h_0 } \sim { 10^ { - 33}}\;{\rm{ev}}{\rm{.}}$$\end{document } by particle - physics standards, this is an incredibly small number ; masses of scalar fields tend to be large in the absence of a symmetry to protect them. scalars of such a low mass give rise to long - range forces if they couple to ordinary matter ; since does couple to gravity, we expect at the very least to have non - renormalizable interactions suppressed by powers of the planck scale. such interactions are potentially observable, both via fifth - force experiments and searches for time - dependence of the constants of nature, and current limits imply that there must be suppression of the quintessence couplings by several orders of magnitude over what would be expected [47, 53, 125 ]. the only known way to obtain such a suppression is through the imposition of an approximate global symmetry (which would also help explain the low mass of the field), of the type characteristic of pseudo - goldstone boson models of quintessence, which have been actively explored [92, 91, 144, 55, 145, 179 ]. (cosmological pseudo - goldstone bosons are potentially detectable through their tendency to rotate polarized radiation from galaxies and the cmb [47, 165 ].) see for a discussion of further fine - tuning problems in the context of supersymmetric models. nevertheless, these naturalness arguments are by no means airtight, and it is worth considering specific particle - physics models for the quintessence field. in addition to the pseudo - goldstone boson models just mentioned, these include models based on supersymmetric gauge theories [31, 170 ], supergravity [37, 5 ], small extra dimensions [29, 24 ], large extra dimensions [28, 22 ], quantum field theory effects in curved spacetime [185, 186 ], and non - minimal couplings to the curvature scalar [217, 253, 8, 198, 199, 64, 30 ]. finally, the possibility has been raised that the scalar field responsible for driving inflation may also serve as quintessence [90, 191, 192, 106 ], although this proposal has been criticized for producing unwanted relics and isocurvature fluctuations. there are other models of dark energy besides those based on nearly - massless scalar fields. one scenario is solid dark matter, typically based on networks of tangled cosmic strings or domain walls [255, 229, 39, 27 ]. strings give an effective equation - of - state parameter wstring = -1/3, and walls have wwall = -2/3, so walls are a better fit to the data at present. there is also the idea of dark matter particles whose masses increase as the universe expands, their energy thus redshifting away more slowly than that of ordinary matter [99, 9 ] (see also). the cosmological consequences of this kind of scenario turn out to be difficult to analyze analytically, and work is still ongoing. observational evidence from a variety of sources currently points to a universe which is (at least approximately) spatially flat, with (m,) (0.3,0.7). the nucleosynthesis constraint implies that b 0.04, so the majority of the matter content must be in an unknown non - baryonic form. figure 11 is a plot of as a function of the scale factor a for this cosmology. at early times, the cosmological constant would have been negligible, while at later times the density of matter will be essentially zero and the universe will be empty. we happen to live in that brief era, cosmologically speaking, when both matter and vacuum are of comparable magnitude. within the matter component, there are apparently contributions from baryons and from a non - baryonic source, both of which are also comparable (although at least their ratio is independent of time). this scenario staggers under the burden of its unnaturalness, but nevertheless crosses the finish line well ahead of any competitors by agreeing so well with the data. figure 11 as a function of the scale factor a, for a universe in which m0 = 0.3, 0 = 0.7. indicated are the scale factors corresponding to the planck era, the electroweak phase transition, and big bang nucleosynthesis. as a function of the scale factor a, for a universe in which m0 = 0.3, 0 = 0.7. indicated are the scale factors corresponding to the planck era, the electroweak phase transition, and big bang nucleosynthesis. apart from confirming (or disproving) this picture, a major challenge to cosmologists and physicists in the years to come will be to understand whether these apparently distasteful aspects of our universe are simply surprising coincidences, or actually reflect a beautiful underlying structure we do not as yet comprehend. if we are fortunate, what appears unnatural at present will serve as a clue to a deeper understanding of fundamental physics. | this is a review of the physics and cosmology of the cosmological constant. focusing on recent developments, i present a pedagogical overview of cosmology in the presence of a cosmological constant, observational constraints on its magnitude, and the physics of a small (and potentially nonzero) vacuum energy. |
bacillus anthracis, the causative agent of the disease anthrax, has two major virulence factors, one in the form of exotoxins and the other in the form of unique capsule, which are encoded by the plasmids pxo1 and pxo2, respectively [1, 2 ]. the capsule is made up of poly - d--glutamic acid, a unique virulent structure that helps the bacterium to escape phagocytosis by macrophages inside the host. the exotoxins consist of three proteins, namely, protective antigen (pa), lethal factor (lf), and edema factor (ef) which together constitute the active anthrax toxins (antx). basically, antx belongs to a - b toxin superfamily where the b moiety binds to the cell surface (in this case, pa) and assists in translocating the catalytic a moiety (lf or ef) inside the cell. individually, none of the proteins are toxic, but if pa combines with lf or ef, it results in the formation of lethal toxin (letx) or edema toxin (edtx), respectively [5, 6 ]. pa is a four - domain protein and can bind to either of the host cell receptors, capillary morphogenesis gene 2 (cmg2) or tumor endothelial marker 8 (tem8), through its c - terminal domain [7, 8 ]. once bound to the receptor, pa is cleaved at the sequence -rkkr- by host furin - like proteases to generate receptor bound 63 kda fragment (pa63) and a free 20 kda fragment (pa20). the cleaved pa63 in its active state is oligomerized to form a pore like structure into which lf and ef can competitively bind with high affinity. once bound, lf / ef is translocated into the cell through receptor mediated endocytosis [10, 11 ]. ef is calmodulin dependent adenylate cyclases which can increase the camp level inside the cell disturbing the water homeostasis resulting in characteristic edema observed during cutaneous anthrax. lf is a highly specific zinc metalloproteases that can cleave the members of map kinase kinases (mapkk) family at their n - terminus resulting in altered cell signalling, increased production of cytokines tumor necrosis factor-, interleukin-1, and nitric oxide. lf is also known to activate inflammasome complex and caspases-1 mediated cellular apoptosis [1316 ]. in us, the fda approved anthrax vaccine adsorbed (ava) as the only vaccine commercially available for use against anthrax. it is prepared by adsorbing the cell free culture supernatant of acapsular strain of b. anthracis v770-np1-r on aluminium hydroxide gel [17, 18 ]. in uk, anthrax vaccine precipitate (avp) is in use which is alum precipitated cell free culture supernatant of sterne strain 34f2 [19, 20 ]. both ava and avp contain pa as major immunogen with trace amounts of lf and ef. although ava and avp are effective, their undefined composition, batch to batch variation, extensive dosing regimen, and adverse immunological side effects have made way for the search of second - generation anthrax vaccine containing recombinant pa that is under developmental stage [21, 22 ]. these recombinant vaccines differ from their predecessors in that their composition will be defined, amenable to large scale production, and will be free from any adverse side effects. in case of large scale immunization of human population, huge quantities of biologically active recombinant pa will be required. for this purpose, a scalable purification process has been developed to generate recombinant pa in multigram quantities from recombinant e. coli. apart from e. coli, numerous other attempts to develop expression systems are based on variety of organisms including attenuated strains of b. anthracis, b. subtilis, b. brevis, and salmonella typhimurium [21, 2426 ]. however, these approaches are not simpler and often require multiple harsh purification steps which may result in reduced yield and stability [27, 28 ]. it is therefore always better to express a protein in a soluble form, as it can result in functionally active and biologically stable protein. moreover, soluble proteins are easy to purify and reduce the extra downstream processing that is involved in purifying the denatured proteins and refolding them to make functionally active form. in addition to this, most of the denatured proteins are susceptible to precipitation and protease degradation [29, 30 ] during downstream processing. in the present study, we have expressed recombinant soluble pa in e. coli expression system using three different expression vectors, namely, pproexhta, pqe30, and pet32c, bearing trc, t5, and t7 promoters, respectively. further, each vector construct was transformed into different e. coli expression hosts and the growth conditions of the transformants were optimized so as to obtain the maximum yield in soluble form. purification was carried out using simple chromatographic techniques and the yield of protein was compared. further, the soluble pa from maximum producing clone pa - pet32c - de3-plyss was characterized by trypsin digestion and lf binding assay to confirm its functionality. the biological activity was confirmed through macrophage cell protection assay using the pa immunized sera. this study highlights the straightforward production of large quantity of recombinant pa in its biologically active soluble form using an optimized e. coli vector - host combination system. the expression vector pproexhta was purchased from invitogen (usa), pqe30 from qiagen (germany), and pet32c from novagen (germany). luria - bertani broth / agar for maintaining the expression hosts was obtained from himedia (india). all the primers (table 2) used in this study were custom synthesized from sigma aldrich, india. the genomic dna was isolated from the b. anthracis clinical isolate by conventional method and was used as a template for pcr reaction. the pcr reaction was carried out in a 25 l reaction containing 50 ng of template dna, 0.1 mol l primers, 1x supertaq complete buffer (2 mmol l mgso4), 0.2 mmol l dntps, and 2.5 units of super taq dna polymerase (ambion, usa). the pcr condition was as follows : initial denaturation of 94c for 5 minutes, 30 rounds of 1 minute denaturation at 94c, 1 minute annealing at 50c, and 2 minutes of extension at 72c followed by 10 minutes of final extension at 72c. the pcr product was electrophoresed on 0.8% agarose gel and was extracted using qiagen gel extraction kit. the pcr product along with expression vectors pproexhta, pqe30, and pet32c was restriction digested with bamhi / xhoi, bamhi / kpni, and bamhi / sali (fermentas, usa) combination, respectively, and was followed by ligation to obtain pa - pproexhta, pa - pqe30, and pa - pet32c recombinant plasmids. the recombinant plasmid pa - pproexhta was transformed into e. coli dh5, bl21-de3, and de3-plyss, pa - pqe30 in e. coli m15 and xl-1 blue, and pa - pet32c plasmid in e. coli bl21-de3 and de3-plyss, respectively. after transformation, the positive clones were confirmed by restriction digestion of the isolated plasmid with the following enzymes : pa - pproexhta with bamhi / xhoi, pa - pqe30 with bamhi / kpni, and pa - pet32c with bamhi / sali combination. to determine the maximum expression of pa from individual clones, preliminary expression was carried out at different temperatures and time periods. all the e. coli cells carrying the recombinant plasmids were grown in 5 ml luria - bertani broth tubes at 37c till the od600 reached 0.6. isopropyl -d-1-thiogalactopyranoside (iptg) was added at the final concentration of 1 mmol l and the clones were further grown at 37c and 22c temperature for 3 hours, for 5 hours, and overnight. the cells were harvested at 8000 g for 5 minutes and were analyzed on 10% sodium dodecyl sulphate polyacrylamide gel electrophoresis (sds - page). the temperature and time period at which particular clone showed maximum expression of pa were noted and the same conditions were applied for bulk production of pa. for purification, purification under native condition was performed by immobilized metal ion affinity chromatography (imac) using nickel trinitriloacetic acid (ni - nta) resin followed by anion exchange chromatography using diethylaminoethanol (deae). briefly, the harvested cells were suspended in lysis buffer (300 mmol l sodium chloride, 50 mmol l sodium dihydrogen phosphate, and 1 mg ml lysozyme, ph 8.0). following sonication on ice bath (300 watt, 50% burst/50% cooling), the lysate was centrifuged at 10,000 g for 10 minutes. the supernatant was collected and passed through a preequilibrated ni - nta agarose column. the matrix was washed with wash buffer (300 mmol l sodium chloride, 50 mmol l sodium dihydrogen phosphate, and 20 mmol l imidazole, ph 8.0) and finally protein was eluted with 250 mmol l imidazole. all the eluted fractions were pooled and dialyzed against 10 mmol l tris, ph 8, and further loaded onto deae sepharose column. gradients of elutions from 10 mmol l to 500 mmol l sodium chloride were carried out and the fractions showing the maximum peak absorbance at 280 nm were pooled, dialyzed in pbs, concentrated to 1 ml volume, quantified by nanodrop (thermo fisher 2000c), and stored at 20c until further use. for purification under denatured condition, the harvested cells were washed twice with lysis buffer before dissolving in urea buffer (8 mol l urea, 100 mmol l sodium dihydrogen phosphate, and 10 mmol l tris, ph 8). the lysate was centrifuged at 10,000 g and the supernatant was loaded onto the urea buffer preequilibrated ni - nta agarose column. elution was carried out at ph 4.5 and the pooled elutes were dialyzed against two changes of pbs. the protein was concentrated to 1 ml volume, quantified by nanodrop, and stored at 20c until further use. to see the recombinant pa expression and purification profile of different clones, sds page was performed. briefly, all the seven clones after iptg induction were harvested and lysed in 2x sds sample lysis buffer. for purified proteins, 5 l of each sample was mixed with equal volume of 2x sds sample lysis buffer before loading onto 10% sds page. after electrophoresis, the gel was stained with coomassie brilliant blue and image was captured through gel doc xr+ imager system (biorad, usa). for western blotting, the soluble cell lysate from all the clones was electrophoresed on 10% sds page and the gel was transferred to nitrocellulose membrane using te70xp semidry blot system (hoefer inc, usa). following transfer, the membrane was blocked with 5% skim milk for 1 hour at room temperature and then probed with anti - pa monoclonal antibody at 1 : 1000 dilutions for 1 hour. after washing thrice with pbs - tween and pbs, the membrane was incubated with anti - mouse igg - hrp conjugate at 1 : 5000 dilutions and was finally developed with 3,3-diaminobenzidine tetrahydrochloride (dab) substrate. the soluble pa purified from pa - pet32c - de3plyss clones was tested for its proper conformation and functionality by incubating 5 g of pa with 5 ng of trypsin (pa : trypsin at 1000 : 1 ratio) for 30 minutes at room temperature following which the samples were electrophoresed on 12% sds - page and stained with coomassie brilliant blue. for the confirmation of functional activity of the expressed pa, 2 g of trypsin digested pa was incubated with 2 g of lf at room temperature for 30 minutes. the samples were run on 4% native polyacrylamide gel at 4c and visualized by staining the gel with coomassie brilliant blue. six female balb / c mice were procured from institutional animal care center, drde, and were provided with food and water ad libitum. each mouse was immunized subcutaneously with 10 g pa adsorbed on aluminium hydroxide adjuvant on days 0, 14, and 28. all mice were bled prior to first immunization on day 0 and on 35th day. serum was separated and stored at 20c until further use. to test the reactivity of pa immunized sera, indirect elisa was performed by coating 1 g ml pa in elisa plate overnight at 4c. after blocking with 5% skim milk for one hour, serial twofold dilution of pa immunized sera starting from 1 : anti - mouse igg hrp was added and further incubated for one more hour and finally developed using orthophenylenediamine dihydrochloride (opd) as substrate. the reaction was stopped using 2 n h2so4 and the absorbance was recorded at 490 nm. the test was performed in triplicate and the data was represented as mean sd. cut - off value for the assays was calculated as the mean absorbance (+ 2 sd) from sera of control group assayed at 1 : 100 dilutions. the endpoint igg titers were calculated as reciprocal of the highest serum dilution giving an absorbance more than the cut - off. mouse macrophage cell line j774.1 was procured from national centre for cell sciences, pune, india and was maintained in high glucose dulbecco 's modified eagle 's medium (dmem) containing 10% fetal bovine serum (fbs) and 100 u ml penicillin and streptomycin as antibiotics. one day before the experiment 4 10 cells were seeded in a 96 well plate and incubated at 37c in presence of 5% humidified co2. the next day spent media was replaced by a fresh medium containing gradient concentration of soluble pa and native pa of b. anthracis from list biologicals (0.005 g ml to 5 g ml) and was incubated at 37c along with 0.125 g ml lf. after 4 hours, 20 l of 5 mg ml mtt (3-(4,5 dimethylthiazol-2 yl)-2,5 diphenyl tetrazolium bromide) was added to each well and further incubated for 30 minutes. the formazan crystals developed were dissolved in 100 l acidified isopropanol (25 l of concentrated hcl and 500 l 10% sds in 10 ml 90% isopropanol) and the absorbance was measured using uv - vis microplate reader (biotek, winooski, vt) at 570 nm. all the experiments were performed in triplicate and repeated at least three times. for toxin neutralization assay, the next day, spent media were replaced with the medium containing 0.3 g ml of pa and 0.125 g ml of lf with twofold serial dilution of pa antiserum starting from 1 : 100. after incubating the plate for 5 hours, 20 l of 5 mg ml mtt was added to each well and further incubated for 30 minutes. the formazan crystals developed were dissolved in 100 l acidified isopropanol and the absorbance was measured from uv - vis microplate reader (biotek, winooski, vt) at 540 nm with reference wavelength at 640 nm. wells containing only medium but no cells were taken as blank while the wells containing the cells with medium only were taken as positive control. percentage viability was calculated as follows:(1)asampleablankapcablank100,where asample is absorbance of test samples, ablank is absorbance of blank, and apc is absorbance of positive control. the neutralization titer was defined as the lowest serum dilution that kills 50% of the macrophage cells. a 2.23-kilo base pair structural gene for pa was pcr amplified (figure 1) and was successfully inserted into the plasmids pproexhta, pqe30, and pet32c by restriction digestion and ligation. the recombinant plasmid pa - pproexhta was transformed into e. coli hosts dh5, bl21-de3, and de3-plyss, pa - pqe30 into m15 and xl-1 blue e. coli host, and pa - pet32c into bl21-de3 and de3-plyss. the clones were confirmed by dna sequencing and restriction digestion analysis of the isolated plasmid which released a 2.2 kb insert from all the three expression vectors (figure 2). since no differences were observed by changing the iptg concentration, the expression studies were carried out with 1 mm iptg. after induction, the clones were incubated for 3 hours, for 5 hours, and overnight at 37c and 22c. for each vector construct and host combination, optimal expression conditions were selected at which recombinant pa production was maximum. for pa - pqe30 in m15, pa - pproexhta in dh5, and bl21-de3, the growth condition was maintained at 37c for 5 hours after induction. the pa - pet32c construct in de3-plyss was grown at 22c for 5 hours while pa - pqe30 in xl-1 blue and pa - pet32c in bl21-de3 were grown at 22c overnight after iptg induction. the purification was carried out under both native and denaturing condition. among the seven clones, the highest yield of soluble pa, 15 mg l, was observed for pet32c construct in de3-plyss host. a pqe30 construct in xl-1 blue and m15 host produced 12 mg l and 7.5 mg the pproexhta harboring clone pa - pproexhta in bl21-de3 also yielded high amount of soluble recombinant pa at the range of 5.1 mg l. comparatively, all the other clones produced less amount of soluble recombinant pa. the pa - pproexhta construct in dh5 and de3-plyss produced 1.2 and 3 mg l of soluble protein while the pa - pet32c construct in bl21-de3 produced 1.5 mg apart from the soluble fractions, all the clones except pa - pqe30 in xl-1 blue yielded high amount of recombinant pa in denatured form. the purified proteins were dialyzed against pbs, concentrated to 1 ml volume, and stored in 20c until further use. the total yields of soluble and denatured recombinant pa from all the seven clones are outlined in table 3. expression profile of the induced samples and purified recombinant pa was analyzed on 10% sds page. all the seven clones expressed at different growth parameters and time intervals were loaded onto the gel (figure 3). to determine the optimal growth conditions (temperatures and time periods) of each of the seven clones for maximum yield of soluble recombinant pa, western blotting with densitometric analysis was performed. following sds - page, the soluble cell lysate of each clone was transferred onto nitrocellulose membrane and incubated with anti - pa monoclonal antibody. all the pa producing clones reacted to anti - pa monoclonal antibody (figure 4). after purifying the proteins in soluble and denatured form, 5 l of the purified protein sample from each of the vector host combinations was electrophoresed on sds - page (figure 5). the relative molecular weights of pa expressed along with their respective tags were 83 kda in pqe30, 86 kda in pproexhta, and 100 kda in pet32c. the total yield of recombinant pa in both soluble and denatured form has been depicted in graph (figure 6). since pa from pet32c - de3-plyss was produced in soluble form in large quantity, the same was considered for further characterization. trypsin digestion of pa resulted in the formation of two fragments of 20 kda and 63 kda (figure 7(a)). for binding assay, trypsin digested pa was incubated with lf for 30 minutes at room temperature and electrophoresed on 4% native - page. binding of lf to pa was confirmed by the shift in mobility as compared to pa and lf alone (figure 7(b)). the reciprocal serum dilution was found to be 1.35 10 for 35th day, explaining the high immunogenicity of immunized sera against recombinant pa (figure 8). to determine the biological activity of soluble pa, mtt based cytotoxicity and toxin neutralization assay was performed. recombinant soluble pa protein was found to be lethal for the growth of macrophage cell lines with 50% viability around 0.3 g ml (figure 9(a)). native pa also showed the similar cytotoxicity at the concentration 0.25 g ml, thereby confirming that the recombinant pa works equivalent to that of native pa. the toxin neutralization titer was found to be 6.4 10 (figure 9(b)). pa, the major component of b. anthracis tripartite toxin, is produced and secreted by the vegetative form of bacterium inside the host and recently it was reported to be present in trace amounts on its spore surfaces. eventually, the pa protein is the main component of commercial anthrax vaccine formulation and also the targeted molecule of various anthrax diagnostic assays. due to the risk associated with the handling of b. anthracis culture for production and purification of native pa from bacterial culture supernatant, various laboratories have opted for the production of recombinant pa expressed conveniently in e. coli host. although production of recombinant antigen as a heterologous protein in e. coli system is a well opted strategy, the suitable vector - host combination and the optimal growth condition to obtain maximal yield of functionally active protein are always empirical. in the present study, we have optimized the growth parameters for e. coli to obtain a maximum production of recombinant pa in soluble form from three different expression vectors. initially, the gene sequence coding for matured pa protein was amplified from b. anthracis and cloned into three different expression vectors pproexhta, pqe30, and pet32c. these constructs were transformed to their respective hosts and were grown at optimized temperature and time period after iptg induction. owing to the hurdles experienced during the downstream processing of the inclusion bodies like solubilization and proper refolding of denatured proteins, we focused our interest solely on the soluble expression of pa. the pa - pet32c construct produced higher recombinant pa in soluble form (15 mg ml) when expressed in e. coli de3-plyss. pa - pqe30 construct in m15 and xl-1 blue produced 7.5 and 12 mg ml of soluble recombinant pa. clones in pproexhta were initially expected to yield lower level of the recombinant protein owing to the trc promoters as compared to the stronger t7 and t5 promoters. however, when transformed with bl21-de3 e. coli strains as host, the expression of soluble pa was 5.1 mg ml. in comparison to the high expressing clones mentioned above, the pa - pet32c construct in bl21-de3 and pa - pproexhta construct in dh5 and bl21-de3 resulted in low level of soluble expression at 1.5 mg ml, 1.2 mg ml, and 3 mg ml, respectively. the low levels of soluble pa expression in these clones were accompanied by high expression of pa as inclusion bodies. although t7 promoter has been known as a very strong promoter occasionally, very high level of expression inside a bacterial host leads to the formation of cytoplasmic inclusion bodies which are insoluble and nonfunctional [33, 34 ]. proper folding and biological activity of the recombinant proteins was confirmed by digestion with trypsin which produced a 63 kda active protein followed by binding assay with lf. pa from pet32c - bl21-de3-plyss clone resulted in two fragments after trypsin digestion and could bind to lf as determined by native - page. these functional activities were not observed with any of the resolubilized and refolded inclusion bodies from any of the constructs, as trypsin digestion resulted in the complete degradation which highlights the need for a functionally active pa protein (data not provided). further trypsin digested pa could bind to lf in solution and resulted in anthrax lethal toxin complex as determined by the shift in mobility in native - page. these experiments proved that the expressed pa was functionally active. to determine the biological activity of purified recombinant pa, cytotoxicity and toxin cytotoxicity of the pa protein on macrophage cells was found to be 0.3 g ml which was almost equivalent to that of the native protein. toxin neutralization of pa immunized sera was robust with the neutralization titer of 6.4 10. thus, the present study describes the production of biologically active soluble recombinant pa from e. coli expression system by simple purification steps without need for complicated downstream processing as reported by earlier studies [3537 ]. multigram quantities of soluble recombinant pa can be obtained by further employing scale - up facilities for the above procedure. therefore, these expression systems can be exploited for the production of cost - effective recombinant vaccine molecule against the deadly disease anthrax. | bacillus anthracis secretory protein protective antigen (pa) is primary candidate for subunit vaccine against anthrax. attempts to obtain large quantity of pa from escherichia coli expression system often result in the formation of insoluble inclusion bodies. therefore, it is always better to produce recombinant proteins in a soluble form. in the present study, we have obtained biologically active recombinant pa in small scale e. coli shake culture system using three different expression constructs. the pa gene was cloned in expression vectors bearing trc, t5, and t7 promoters and transformed into their respective e. coli hosts. the growth conditions were optimized to obtain maximum expression of pa in soluble form. the expression construct pa - pet32c in de3-plyss e. coli host resulted in a maximum production of soluble pa (15 mg l1) compared to other combinations. purified pa was subjected to trypsin digestion and binding assay with lethal factor to confirm the protein 's functionality. biological activity was confirmed by cytotoxicity assay on j774.1 cells. balb / c mice were immunized with pa and the immunogenicity was tested by elisa and toxin neutralization assay. this study highlights the expression of soluble and biologically active recombinant pa in larger quantity using simpler e. coli production platform. |
to explore the integration of health and social care in the uk through policy and clinical guidelines and to examine how partnership working and case management enables policy to be embedded into local practice. the uk department of health policy document (white paper 2006) our health, our care, our say : a new direction for community services focused on a new direction for the whole health and social care system. the paper and subsequent action plans targeted the way services are provided, placing greater choice and control in the hands of people who use them. health and social care services were tasked with becoming better integrated to meet the needs and wishes of individuals with chronic illness and long - term needs. the uk 's national service frameworks and nice guidelines are being implemented at local level to achieve management of chronic illness through effective case management and roles are being evaluated to show the effect of interventions. the government report our nhs, our future encourages a response to the needs of local communities through integrating care to ensure that services are shaped around the user not the organisation. we know that people with chronic illness are intensive users of services ; that repeat admissions to hospital cause untold distress and that this vulnerable group is increasing as our population ages. we also know that inappropriate and increased use of services causes a financial burden in both primary and secondary care. managed care through effective case management, if adopted flexibly, presents an opportunity to focus on reducing costs whilst appropriately managing the health needs of the target population. | purposeto explore the integration of health and social care in the uk through policy and clinical guidelines and to examine how partnership working and case management enables policy to be embedded into local practice.contextthe uk department of health policy document (white paper 2006) our health, our care, our say : a new direction for community services [1 ] focused on a new direction for the whole health and social care system.descriptionthe paper and subsequent action plans targeted the way services are provided, placing greater choice and control in the hands of people who use them. health and social care services were tasked with becoming better integrated to meet the needs and wishes of individuals with chronic illness and long - term needs. the uk 's national service frameworks and nice guidelines are being implemented at local level to achieve management of chronic illness through effective case management and roles are being evaluated to show the effect of interventions [2 ]. the government report our nhs, our future [3 ] encourages a response to the needs of local communities through integrating care to ensure that services are shaped around the user not the organisation.discussionwe know that people with chronic illness are intensive users of services ; that repeat admissions to hospital cause untold distress and that this vulnerable group is increasing as our population ages. we also know that inappropriate and increased use of services causes a financial burden in both primary and secondary care. managed care through effective case management, if adopted flexibly, presents an opportunity to focus on reducing costs whilst appropriately managing the health needs of the target population. |
as a method, transcranial magnetic stimulation (tms) enables direct rhythmic stimulation of the human brain at frequencies that characterize electro- or magnetoencephalographic (eeg / meg) signals [1, 2 ]. likewise, the alternative method of transcranial alternating current stimulation (tacs) allows stimulation of the human brain at frequencies of biologically relevant brain rhythms [1, 2 ]. there is now accumulating experimental support that both rhythmic tms and tacs interact with natural brain oscillations in a frequency - specific manner [38 ]. this is based on findings that rhythmic stimulation of occipital or parietal areas results in specific (and immediate) perceptual consequences, when the stimulation frequency is tuned to the preferred oscillation frequency of the target area [38 ]. the above research provides new clues on two long - standing questions : (1) how does tms (or tacs) interact with ongoing, here oscillatory brain activity to give rise to behavioral effects, and (2), what is the functional relevance of brain oscillations ? it does so by pointing toward immediate and specific behavioral consequences depending on tms (or tacs) frequency. however, these studies [38 ] have one main limitation : they manipulated stimulation frequency (tms or tacs) and reported behavioral outcome, but they did not study changes in brain activity, i.e., the underlying mechanisms. here, we present the missing piece to the puzzle of how these immediate, frequency - dependent effects on perception could come about during rhythmic tms. our study builds from the evidence that the behavioral effects of rhythmic tms (or tacs) are confined to stimulation frequencies that were identified as perceptually relevant in prior eeg / meg research [38 ]. from this 1:1 frequency locking between the most effective tms frequency and the perceptually relevant eeg / meg frequency this entrainment hypothesis therefore posits that frequency - tuned rhythmic tms causes entrainment in direct interactions with the underlying brain oscillation. as a consequence, one of the mechanisms by which rhythmic tms exerts its action on behavior could be the reproduction of a natural oscillatory signature of brain activity (that is also functionally relevant). entrainment supposes (1) the induction of a distinct entrainment signature, which emerges during rhythmic tms and whose topography and frequency reproduce the natural oscillation of the targeted generator. entrainment also supposes that there is (2) progressive enhancement of the target oscillation in the course of the tms train as a result of progressive synchronization by each successive tms pulse. finally, entrainment should (3) depend on ongoing activity of the target generator, because it is supposedly driving existing brain oscillations, as opposed to generating new artificial rhythms. we tested the entrainment hypothesis using neuronavigated rhythmic tms of meg - localized brain oscillators and concurrent multichannel eeg. we first identified a parietal -oscillator (i.e., showing oscillatory activity at -frequency, 814 hz), whose eeg / meg amplitude is regulated by visual attention [1013 ] and correlates with visual perception [1316 ]. we then tested in a passive condition whether rhythmic tms of this parietal area at its preferred frequency entrains the underlying -generator during tms, explaining immediate and frequency - specific consequences of parietal -tms on performance in visual tasks [35 ]. for each participant, we first conducted a parietal -source localizer experiment using meg [1013 ]. on the basis of individual source estimates in structural magnetic resonance (mr) images and using tms neuronavigation, we then targeted the most prominent (individual) -source and tuned tms to its preferred (individual) -frequency. accurate placement and 1:1 frequency locking served to create ideal conditions for entrainment (for modeled interaction between stimulus parameters and oscillators, see e.g. [17, 18 ]). we then ran four tms conditions per participant while recording 62-channel eeg. in all conditions, we stimulated the same cortical -generator with short tms bursts (five pulses). in the main condition, we stimulated at individual -frequency (-tms). during -tms, we oriented the tms coil to induce currents perpendicular to the target gyrus, to maximize tms efficacy (effect strength is enhanced with this coil orientation [1922 ]). in addition to -tms, we ran three control conditions. in one control (called arrhythmic tms or ar - tms), we applied the same number of tms pulses as in -tms within the same time window (same mean frequency), but with randomly jittered interpulse intervals, holding all other tms parameters constant. this control was meant to establish that the eeg signature to -tms does arise from rhythmic stimulation per se, and not from a basic response of -generators to rapid - rate tms bursts. in -tms90, we rotated the coil by 90 relative to -tms while holding the stimulation site constant (coil handle perpendicular versus parallel to the stimulated gyrus in -tms versus -tms90). based on the dependence of tms efficacy on coil alignment (and hence orienting of induced current) relative to the underlying gyral folding pattern [1922 ], we expected strongest entrainment for -tms relative to -tms90, whereas unspecific effects should be identical in the two conditions. comparing -tms with -tms90 therefore allowed us to distinguish entrainment effects on neural tissue under the coil (the stimulated -generator) from any unspecific effect that could be associated with rhythmic tms (e.g., monitoring, tms discomfort, rhythmic auditory clicks). finally, we oriented the tms coil in a sham position (-tmssham) to emulate the sound clicks associated with tms without direct transcranial stimulation, to control for entrainment through rhythmic sounds. for further discussion on the choice of control conditions, see note s1 in the supplemental discussion available online). to rule out that eeg results could be of artifactual origin (note the use of a tms - compatible eeg system and artifact removal procedures ; see experimental procedures), we also performed control tms - eeg recordings in a phantom head using the same tms, eeg, and postprocessing parameters as in the volunteers. below, we first describe localization of the parietal -generator and how we placed the coil for the different conditions of tms - eeg testing. we then describe the three key findings supporting tms entrainment in the simultaneously recorded eeg : entrainment signature, progressive enhancement, and dependence on ongoing oscillations. the meg -localizer task involved attention orienting to the left or right in anticipation of a lateralized target. behaviorally, this led to better performance at cued versus uncued positions (main effect of cueing validity : f1,7 = 12.53 ; p = 0.009), independent of target side (cueing validity side : f1,7 = 2.99 ; p = 0.127). participants responded significantly faster at attended (mean = 738.19 ms) than unattended locations (mean = 911.68 ms). on the meg sensor level, comparison between the two conditions (leftward versus rightward covert attention shifts) revealed in each participant the known -signature of attention orienting (see figure 1a for the grand average, comparable to e.g.): a left - right mirror - imaged topography of -power suppression (in blue) versus enhancement (in red) over parieto - occipital sensors when the two conditions are subtracted (attending rightward minus leftward). anatomically, the underlying -generators were localized in parietal areas of the attention network bilaterally (as revealed by maxima of t statistics in individual source space). tms was then neuronavigated per participant to the right - sided, individual -source. on average, this site was located at 31.3 2.3, 63.5 3.5, 60.3 3.0 in talairach space (x, y, z, standard error of the mean [sem ]) (see also figures 1b and 1c). this location is near (1.5 cm euclidian distance) a previous parietal target site (x = 17, y = 65, z = 54) measured in a functional magnetic resonance imaging (fmri) study on attention orienting, and whose stimulation by -tms modulated perception. note that tms of this site did not evoke phosphenes in any of our participants, which corroborates its location in higher - order attention areas (as opposed to low - level visual areas). the average individual -frequency across all participants was 10.1 0.31 hz (sem) (range 911 hz). for -tms, we oriented the coil for each participant such that its handle pointed along the sagittal plane (upward), and currents were induced in anterior - posterior (y axis) and inferior - superior directions (z axis). in contrast, during -tms90, we oriented the coil such that its handle was pointing along the axial plane (sideways) and currents were induced in the left - right direction (x axis). these coil orientations were perpendicular (-tms) versus parallel to the target gyrus (-tms90), as indicated by figure 1b (inset, see gyral folding pattern near the average -source in the mni brain) and were confirmed by analysis of individual mri scans (see note s2 in supplemental discussion). tms entrainment supposes that frequency - tuned rhythmic tms triggers a local oscillation at the target site, which cycles at the natural frequency of the targeted generator. in agreement with entrainment, time - frequency (tf) analysis of eeg during -tms (tms - locked averages) shows prominent -power boosting in a narrow -band centered on the stimulation frequency, which was emerging over pulses 35 following an initial broadband response (shown for cp4 in figure 2a, -tms) and was topographically restricted to the target site (figure 2c, -tms). this narrow -power boosting was absent in all three control conditions (figures 2a and 2c, -tms90, ar - tms, and -tmssham) and was not observed in recordings in a phantom head (see note s3 in supplemental discussion and supplemental results). the latter result indicates that -boosting during -tms was of neuronal origin, and not of artifactual nature. at the beginning of the train, tms bursts evoked brain activity over a large spectrum of frequency bands, including in a broad -band (814 hz) and in the - (4 hz) and upper -bands (2530 hz). these responses were transient, i.e., only present for the initial 12 pulses of the train (see figure 2a, window 1 [w1 ]), and were condition unspecific because they were observed not only during -tms but also in the control conditions (figure 2a, left panels ; compare -tms with -tms90, ar - tms, and -tmssham). in terms of topography (see figure 2b, left scalp topographies representing -layer activity), these early condition - unspecific responses were widespread, including frontocentral and bilateral occipital activity (see active tms conditions : -tms, -tms90, and ar - tms). correspondence between conditions in window w1 is further illustrated in figures 2a and 2b by only weak differences between -tms and control conditions in time - frequency representations (figure 2a, right panels, difference plots) and in topography plots (figure 2b, middle scalp topographies, difference maps [diff maps ]). these differences were all insignificant (figure 2b, right scalp topographies, stats) except, as expected, for the comparison with inactive tms (-tmssham), where the differences reached significance for many electrodes (t statistics). critically, widespread broadband responses were absent in the second half of the train, where condition - specific responses emerged over pulses 35 in a narrow -band and over the right parietal target site (figures 2a and 2c, window 2 [w2 ]). these condition - specific responses were confined to -tms bursts, because no such -power enhancement existed in the control conditions (-tms90, ar - tms, and -tmssham). in addition, they were centered on a narrow -band corresponding to the preferred oscillation of the targeted generator and hence the tms frequency (average of 10 hz ; figure 2a, upper left panel). comparisons between conditions (subtraction and t statistics) confirmed strongest -enhancement in w2 during -tms relative to all control conditions (figure 2a, right panels), which localized over the right parietal target site (figure 2c, middle scalp topographies for difference maps, right topographies for stats). note in figure 2a (upper panel) that the narrow -band activity evoked by -tms is short - term, disappearing shortly after discontinuation of the train (100150 ms later). although the time - frequency analysis above reveals that -tms evokes a response in the -band, it does not show whether this response is a true -oscillation (i.e., a wave evolving over one full -cycle or more). an alternative response could be an evoked component that simply repeats at -rate but does not constitute a full -wave. if tms triggers -oscillations, tms - induced responses should show a cyclic pattern. with the addition of other phase - aligned tms pulses (such as with -tms), this -oscillation should then become progressively enhanced (synchronizing the activity of the underlying generator). to understand the nature of the evoked responses (-waves versus components occurring at -rate), we filtered the eeg signal to isolate the -band and calculated an evoked -response to each of the five successive tms pulses of each condition. in agreement with entrainment, the results revealed that -tms (but none of the control conditions) triggered -waves with a progressive time course over the right parietal target site (figure 3). figure 3a (upper panel) represents -responses to each single pulse of the main condition (-tms). the five waveform plots depict responses to each of the five successive tms pulses tms1tms5 (see boxes ; electrodes cp4 [in red ] and po4 [in black ] are superimposed). each one of the five waveform plots reveals a clear cyclic pattern, with -peak topographies at 90 -phase angle (above waveforms) and 270 -phase angle (below waveforms) showing inverted polarity but otherwise identical topography. corroborating the time - frequency results of -tms above, topographies showed widespread -responses to the initial 12 pulses (tms1 and 2) (frontocentral and occipital maxima), followed over pulses 35 (tms35) by more local -responses close to the stimulation site (right parietal maxima) (figure 3a, upper panel). for statistical comparisons, we then fitted the -maps evoked by the initial (tms1 : map 190&270) and last tms pulse (tms5 : map 590&270) to individual data using spatial map fitting procedures (the fitting results are depicted in figure 3a, lower panel). the results were analyzed via three - way analysis of variance (anova) on goodness of fit (factors : map [map 1 versus 5 ], consecutive tms pulses [tms15 ], and phase angle [90 versus 270 ]). we found that -maps at 90 versus 270 phase angle fitted the data equally well (no effect of phase angle or interactions ; all p = nonsignificant), indicating cyclic activity. we found significant differences between initial and end maps (map 190&270 versus map 590&270) in terms of their time courses over the train [figure 3a, fitting results ; interaction map tms pulse : f(4,28) = 4.87, p = 0.004 ]. the occipitocentral -maps (initial map 190&270) vanished after pulses 12 [figure 3a, fitting results, gray lines, simple effect of tms pulses : f(4,28) = 5.93, p = 0.0014 ]. in contrast, the right parietal -maps (end map 590&270) progressively appeared over the successive pulses of the train [figure 3a, fitting results, red lines, simple effect of tms pulses : f(4,28) = 3.12, p = 0.03 ; polynomial linear contrast : 7.44, p = 0.029 ]. comparing all conditions in terms of waves and topographies evoked by the end of the train (last pulse : tms5, end map 590&270) (figure 3b, upper panel) revealed that only -tms evoked a clear -wave (left box, red line) and a right parietal -map (right maps, compare -tms with -tms90, ar - tms, and -tmssham ; see figure s2 for information across all pulses). map fitting to individual data (fitting results depicted in figure 3b, lower panel) statistically confirmed condition specificity. the right parietal (entrainment) maps (map 590&270 to -tms) showed a progressive time course during -tms, which was absent in all other conditions (figure 3b, fitting results), as revealed by a significant interaction of condition tms pulses [f(12,84) = 2.02, p = 0.033 ] and follow - up polynomial linear contrasts. the latter were significant for -tms [f(1,7) = 7.44, p = 0.03 ], but not for any control condition [-tms90 : f(1,7) = 2.97, p = 0.12 ; ar - tms : f(1,7) = 0.43, p = 0.53 ; -tmssham : f(1,7) = 0.003, p = 0.95 ]. this should not only show in progressive synchronization of the stimulated generator to the tms pulses (see above), but critically, this should depend on the momentary, ongoing oscillatory cycle of the underlying generator. this arises because tms pulses will catch the stimulated generator at different stages of its cycle and therefore differentially amplify this endogenous oscillation. specifically, entrainment performance should show a cosine - shaped function, with strong entrainment when tms catches the ongoing oscillation at 0 and 360 of phase angle and weak entrainment at 180. to fully detail the effect of our main condition (-tms) in terms of phase alignment and dependence on pre - tms -phase (and possibly -amplitude), we computed the hilbert transform of the band - pass - filtered (812 hz) signal to obtain instantaneous phase and amplitude time series. to explore phase (figures 4a4d), we then calculated the phase - locking factor (plf). plf quantifies the consistency of the instantaneous phase across trials (with high values corresponding to high consistency). figure 4a shows topographies of plf differences in the -band (-plf) during the second part of the tms train (w2) between -tms and each control condition (left, -tms minus -tms90 ; middle, -tms minus ar - tms ; right, -tms minus -tmssham). significant phase - locking increases in the vicinity of the stimulation site are evident (figure 4a). the temporal evolution of -plf at significant electrodes (figure 4b) shows an initial condition - unspecific increase in all conditions in window w1, followed by enhanced phase locking in window w2 during -tms (red line) as compared to the control conditions (green, blue, and yellow lines). this extends the results on evoked activity (figure 2 ; figure 3) by revealing that much of the condition - specific -enhancement during -tms is due to increased phase locking in the course of the train. this is evidence for -activity becoming more synchronized to the train, as opposed to unsynchronized activity increasing in power over the train. finally, we examined whether tms - induced enhancement of plf in w2 depends on pre - tms -phase (figures 4c and 4d). we sorted pre - tms -phase (100 ms prior to tms onset) into six equidistant bins. we computed mean -plfs for window w2 for each bin, condition, and participant and compared them in a two - way anova. this revealed a significant main effect of condition [f(3,7) = 10.42, p = 0.001 ] and, importantly, a significant bin condition interaction [f(5,3) = 1.85, p = 0.036 ]. population marginal means illustrate the stronger phase locking during -tms compared to all other conditions (effect of condition, figure 4c, left panel), but no main effect for bin (figure 4c, right panel). further analysis of the interaction revealed a significant dependence of plf on pre - tms phase only for -tms (high correlation with a cosine function, red versus black line, figure 4d) (r = 0.92, p = 0.009 checked by bootstrap procedure). analysis of amplitude based on the hilbert transforms reproduced the condition - specific differences in -amplitude in the vicinity of the target site in w2 obtained above (-tms > all three control conditions ; see figure s3), but this -enhancement in w2 did not depend on pre - tms -amplitude in a condition - specific way (no significant interaction between pre - tms -bin and condition ; data not shown). hence, condition - specific entrainment performance (during -tms) was dependent only on prestimulus -phase, but not on prestimulus -amplitude. we then ran four tms conditions per participant while recording 62-channel eeg. in all conditions, we stimulated the same cortical -generator with short tms bursts (five pulses). in the main condition, we stimulated at individual -frequency (-tms). during -tms, we oriented the tms coil to induce currents perpendicular to the target gyrus, to maximize tms efficacy (effect strength is enhanced with this coil orientation [1922 ]). in addition to -tms, we ran three control conditions. in one control (called arrhythmic tms or ar - tms), we applied the same number of tms pulses as in -tms within the same time window (same mean frequency), but with randomly jittered interpulse intervals, holding all other tms parameters constant. this control was meant to establish that the eeg signature to -tms does arise from rhythmic stimulation per se, and not from a basic response of -generators to rapid - rate tms bursts. in -tms90, we rotated the coil by 90 relative to -tms while holding the stimulation site constant (coil handle perpendicular versus parallel to the stimulated gyrus in -tms versus -tms90). based on the dependence of tms efficacy on coil alignment (and hence orienting of induced current) relative to the underlying gyral folding pattern [1922 ], we expected strongest entrainment for -tms relative to -tms90, whereas unspecific effects should be identical in the two conditions. comparing -tms with -tms90 therefore allowed us to distinguish entrainment effects on neural tissue under the coil (the stimulated -generator) from any unspecific effect that could be associated with rhythmic tms (e.g., monitoring, tms discomfort, rhythmic auditory clicks). finally, we oriented the tms coil in a sham position (-tmssham) to emulate the sound clicks associated with tms without direct transcranial stimulation, to control for entrainment through rhythmic sounds. for further discussion on the choice of control conditions, see note s1 in the supplemental discussion available online). to rule out that eeg results could be of artifactual origin (note the use of a tms - compatible eeg system and artifact removal procedures ; see experimental procedures), we also performed control tms - eeg recordings in a phantom head using the same tms, eeg, and postprocessing parameters as in the volunteers. below, we first describe localization of the parietal -generator and how we placed the coil for the different conditions of tms - eeg testing. we then describe the three key findings supporting tms entrainment in the simultaneously recorded eeg : entrainment signature, progressive enhancement, and dependence on ongoing oscillations. the meg -localizer task involved attention orienting to the left or right in anticipation of a lateralized target. behaviorally, this led to better performance at cued versus uncued positions (main effect of cueing validity : f1,7 = 12.53 ; p = 0.009), independent of target side (cueing validity side : f1,7 = 2.99 ; p = 0.127). participants responded significantly faster at attended (mean = 738.19 ms) than unattended locations (mean = 911.68 ms). on the meg sensor level, comparison between the two conditions (leftward versus rightward covert attention shifts) revealed in each participant the known -signature of attention orienting (see figure 1a for the grand average, comparable to e.g.): a left - right mirror - imaged topography of -power suppression (in blue) versus enhancement (in red) over parieto - occipital sensors when the two conditions are subtracted (attending rightward minus leftward). anatomically, the underlying -generators were localized in parietal areas of the attention network bilaterally (as revealed by maxima of t statistics in individual source space). tms was then neuronavigated per participant to the right - sided, individual -source. on average, this site was located at 31.3 2.3, 63.5 3.5, 60.3 3.0 in talairach space (x, y, z, standard error of the mean [sem ]) (see also figures 1b and 1c). this location is near (1.5 cm euclidian distance) a previous parietal target site (x = 17, y = 65, z = 54) measured in a functional magnetic resonance imaging (fmri) study on attention orienting, and whose stimulation by -tms modulated perception. note that tms of this site did not evoke phosphenes in any of our participants, which corroborates its location in higher - order attention areas (as opposed to low - level visual areas). the average individual -frequency across all participants was 10.1 0.31 hz (sem) (range 911 hz). for -tms, we oriented the coil for each participant such that its handle pointed along the sagittal plane (upward), and currents were induced in anterior - posterior (y axis) and inferior - superior directions (z axis). in contrast, during -tms90, we oriented the coil such that its handle was pointing along the axial plane (sideways) and currents were induced in the left - right direction (x axis). these coil orientations were perpendicular (-tms) versus parallel to the target gyrus (-tms90), as indicated by figure 1b (inset, see gyral folding pattern near the average -source in the mni brain) and were confirmed by analysis of individual mri scans (see note s2 in supplemental discussion). tms entrainment supposes that frequency - tuned rhythmic tms triggers a local oscillation at the target site, which cycles at the natural frequency of the targeted generator. in agreement with entrainment, time - frequency (tf) analysis of eeg during -tms (tms - locked averages) shows prominent -power boosting in a narrow -band centered on the stimulation frequency, which was emerging over pulses 35 following an initial broadband response (shown for cp4 in figure 2a, -tms) and was topographically restricted to the target site (figure 2c, -tms). this narrow -power boosting was absent in all three control conditions (figures 2a and 2c, -tms90, ar - tms, and -tmssham) and was not observed in recordings in a phantom head (see note s3 in supplemental discussion and supplemental results). the latter result indicates that -boosting during -tms was of neuronal origin, and not of artifactual nature. at the beginning of the train, tms bursts evoked brain activity over a large spectrum of frequency bands, including in a broad -band (814 hz) and in the - (4 hz) and upper -bands (2530 hz). these responses were transient, i.e., only present for the initial 12 pulses of the train (see figure 2a, window 1 [w1 ]), and were condition unspecific because they were observed not only during -tms but also in the control conditions (figure 2a, left panels ; compare -tms with -tms90, ar - tms, and -tmssham). in terms of topography (see figure 2b, left scalp topographies representing -layer activity), these early condition - unspecific responses were widespread, including frontocentral and bilateral occipital activity (see active tms conditions : -tms, -tms90, and ar - tms). correspondence between conditions in window w1 is further illustrated in figures 2a and 2b by only weak differences between -tms and control conditions in time - frequency representations (figure 2a, right panels, difference plots) and in topography plots (figure 2b, middle scalp topographies, difference maps [diff maps ]). these differences were all insignificant (figure 2b, right scalp topographies, stats) except, as expected, for the comparison with inactive tms (-tmssham), where the differences reached significance for many electrodes (t statistics). critically, widespread broadband responses were absent in the second half of the train, where condition - specific responses emerged over pulses 35 in a narrow -band and over the right parietal target site (figures 2a and 2c, window 2 [w2 ]). these condition - specific responses were confined to -tms bursts, because no such -power enhancement existed in the control conditions (-tms90, ar - tms, and -tmssham). in addition, they were centered on a narrow -band corresponding to the preferred oscillation of the targeted generator and hence the tms frequency (average of 10 hz ; figure 2a, upper left panel). comparisons between conditions (subtraction and t statistics) confirmed strongest -enhancement in w2 during -tms relative to all control conditions (figure 2a, right panels), which localized over the right parietal target site (figure 2c, middle scalp topographies for difference maps, right topographies for stats). note in figure 2a (upper panel) that the narrow -band activity evoked by -tms is short - term, disappearing shortly after discontinuation of the train (100150 ms later). although the time - frequency analysis above reveals that -tms evokes a response in the -band, it does not show whether this response is a true -oscillation (i.e., a wave evolving over one full -cycle or more). an alternative response could be an evoked component that simply repeats at -rate but does not constitute a full -wave. if tms triggers -oscillations, tms - induced responses should show a cyclic pattern. with the addition of other phase - aligned tms pulses (such as with -tms), this -oscillation should then become progressively enhanced (synchronizing the activity of the underlying generator). to understand the nature of the evoked responses (-waves versus components occurring at -rate), we filtered the eeg signal to isolate the -band and calculated an evoked -response to each of the five successive tms pulses of each condition. in agreement with entrainment, the results revealed that -tms (but none of the control conditions) triggered -waves with a progressive time course over the right parietal target site (figure 3). figure 3a (upper panel) represents -responses to each single pulse of the main condition (-tms). the five waveform plots depict responses to each of the five successive tms pulses tms1tms5 (see boxes ; electrodes cp4 [in red ] and po4 [in black ] are superimposed). each one of the five waveform plots reveals a clear cyclic pattern, with -peak topographies at 90 -phase angle (above waveforms) and 270 -phase angle (below waveforms) showing inverted polarity but otherwise identical topography. corroborating the time - frequency results of -tms above, topographies showed widespread -responses to the initial 12 pulses (tms1 and 2) (frontocentral and occipital maxima), followed over pulses 35 (tms35) by more local -responses close to the stimulation site (right parietal maxima) (figure 3a, upper panel). for statistical comparisons, we then fitted the -maps evoked by the initial (tms1 : map 190&270) and last tms pulse (tms5 : map 590&270) to individual data using spatial map fitting procedures (the fitting results are depicted in figure 3a, lower panel). the results were analyzed via three - way analysis of variance (anova) on goodness of fit (factors : map [map 1 versus 5 ], consecutive tms pulses [tms15 ], and phase angle [90 versus 270 ]). we found that -maps at 90 versus 270 phase angle fitted the data equally well (no effect of phase angle or interactions ; all p = nonsignificant), indicating cyclic activity. we found significant differences between initial and end maps (map 190&270 versus map 590&270) in terms of their time courses over the train [figure 3a, fitting results ; interaction map tms pulse : f(4,28) = 4.87, p = 0.004 ]. the occipitocentral -maps (initial map 190&270) vanished after pulses 12 [figure 3a, fitting results, gray lines, simple effect of tms pulses : f(4,28) = 5.93, p = 0.0014 ]. in contrast, the right parietal -maps (end map 590&270) progressively appeared over the successive pulses of the train [figure 3a, fitting results, red lines, simple effect of tms pulses : f(4,28) = 3.12, p = 0.03 ; polynomial linear contrast : 7.44, p = 0.029 ]. comparing all conditions in terms of waves and topographies evoked by the end of the train (last pulse : tms5, end map 590&270) (figure 3b, upper panel) revealed that only -tms evoked a clear -wave (left box, red line) and a right parietal -map (right maps, compare -tms with -tms90, ar - tms, and -tmssham ; see figure s2 for information across all pulses). map fitting to individual data (fitting results depicted in figure 3b, lower panel) statistically confirmed condition specificity. the right parietal (entrainment) maps (map 590&270 to -tms) showed a progressive time course during -tms, which was absent in all other conditions (figure 3b, fitting results), as revealed by a significant interaction of condition tms pulses [f(12,84) = 2.02, p = 0.033 ] and follow - up polynomial linear contrasts. the latter were significant for -tms [f(1,7) = 7.44, p = 0.03 ], but not for any control condition [-tms90 : f(1,7) = 2.97, p = 0.12 ; ar - tms : f(1,7) = 0.43, p = 0.53 ; -tmssham : f(1,7) = 0.003, p = 0.95 ]. this should not only show in progressive synchronization of the stimulated generator to the tms pulses (see above), but critically, this should depend on the momentary, ongoing oscillatory cycle of the underlying generator. this arises because tms pulses will catch the stimulated generator at different stages of its cycle and therefore differentially amplify this endogenous oscillation. specifically, entrainment performance should show a cosine - shaped function, with strong entrainment when tms catches the ongoing oscillation at 0 and 360 of phase angle and weak entrainment at 180. to fully detail the effect of our main condition (-tms) in terms of phase alignment and dependence on pre - tms -phase (and possibly -amplitude), we computed the hilbert transform of the band - pass - filtered (812 hz) signal to obtain instantaneous phase and amplitude time series. to explore phase (figures 4a4d), we then calculated the phase - locking factor (plf). plf quantifies the consistency of the instantaneous phase across trials (with high values corresponding to high consistency). figure 4a shows topographies of plf differences in the -band (-plf) during the second part of the tms train (w2) between -tms and each control condition (left, -tms minus -tms90 ; middle, -tms minus ar - tms ; right, -tms minus -tmssham). significant phase - locking increases in the vicinity of the stimulation site are evident (figure 4a). the temporal evolution of -plf at significant electrodes (figure 4b) shows an initial condition - unspecific increase in all conditions in window w1, followed by enhanced phase locking in window w2 during -tms (red line) as compared to the control conditions (green, blue, and yellow lines). this extends the results on evoked activity (figure 2 ; figure 3) by revealing that much of the condition - specific -enhancement during -tms is due to increased phase locking in the course of the train. this is evidence for -activity becoming more synchronized to the train, as opposed to unsynchronized activity increasing in power over the train. finally, we examined whether tms - induced enhancement of plf in w2 depends on pre - tms -phase (figures 4c and 4d). we sorted pre - tms -phase (100 ms prior to tms onset) into six equidistant bins. we computed mean -plfs for window w2 for each bin, condition, and participant and compared them in a two - way anova. this revealed a significant main effect of condition [f(3,7) = 10.42, p = 0.001 ] and, importantly, a significant bin condition interaction [f(5,3) = 1.85, p = 0.036 ]. population marginal means illustrate the stronger phase locking during -tms compared to all other conditions (effect of condition, figure 4c, left panel), but no main effect for bin (figure 4c, right panel). further analysis of the interaction revealed a significant dependence of plf on pre - tms phase only for -tms (high correlation with a cosine function, red versus black line, figure 4d) (r = 0.92, p = 0.009 checked by bootstrap procedure). analysis of amplitude based on the hilbert transforms reproduced the condition - specific differences in -amplitude in the vicinity of the target site in w2 obtained above (-tms > all three control conditions ; see figure s3), but this -enhancement in w2 did not depend on pre - tms -amplitude in a condition - specific way (no significant interaction between pre - tms -bin and condition ; data not shown). hence, condition - specific entrainment performance (during -tms) was dependent only on prestimulus -phase, but not on prestimulus -amplitude. to understand the immediate effects of rhythmic tms on perception, action, or behavior, it is necessary to identify the actions of tms on brain activity. here we show local synchronization of parietal -activity when targeting the underlying -generator with tms bursts at individual -frequency (parietal entrainment signature). we demonstrate that this results from progressive synchronization of the underlying -oscillator in the course of the tms burst. finally, we reveal enhanced synchronization (-phase locking) to depend on the (pre - tms) phase of the natural, ongoing activity of the stimulated generator. this suggests enhancement of a naturally occurring oscillation instead of the imposition of an artificial rhythm. in sum, our results show that short tms bursts can drive natural brain oscillations by entrainment, one plausible mechanism via which tms can act on the brain to modulate perception and performance. importantly, none of the three control conditions showed evidence of progressive -synchronization, nor did recordings in a phantom head. first, there was no progressive -synchronization with arrhythmic tms bursts of the same duration and mean -frequency (evidence against nonrhythmic -generation by rapid - rate bursts). second, there was no -synchronization with sham tms bursts that emulate the associated rhythmic auditory events (evidence against -entrainment through auditory input, e.g., of multisensory neurons in parietal cortex). third, there was no -synchronization with rhythmic tms bursts at suboptimal coil orientations inducing currents parallel to the gyrus (evidence against other unspecific tms - effects, such as rhythmic somatosensory input). fourth, it is important to emphasize that the stimulated -generator was localized in a higher - order area of the attention network, whose stimulation by tms did not evoke any visual light sensation (phosphene), to rule out potential visual entrainment through a tms - induced, flickering visual percept (e.g.,). this therefore discounts explanations other than entrainment in direct interaction with underlying neurons. our eeg data reveal that short bursts of -tms can upregulate the targeted -oscillations in higher - order parietal areas of the attention network, reminiscent of the -amplitude regulation by voluntary attention orienting [10, 11 ], but without the need to engage the participant in an active task. could this tms - entrained -signature that emulates the natural oscillations in origin and frequency also be of functional relevance ? previous eeg research revealed that the occipitoparietal -band activity, which is amenable to attention control, also scales with visual perception [1316 ] and visual cortex excitability. specifically, occipitoparietal -power shows an inverse relationship with contralateral visual performance [1316, 29 ]. subsequent behavioral tms research showed that parietal tms bursts at this -frequency (but not at control flanker frequencies) suppress visual perception, or visual representation in contralateral space [4, 5 ]. the present study therefore provides the missing link between a perceptually effective tms protocol (parietal -tms) [4, 5 ] and functional eeg activity (parietal -oscillations) [1316, 29 ]. the tms - induced parietal -signature that we observed is therefore likely also of functional relevance. creating oscillatory brain signatures by tms can open novel avenues to study not only oscillatory network interactions by means of concurrent eeg but also their functional role in perception and cognition, the latter by exploring behavioral consequences of entrainment. as to a mechanistic account, our finding of progressive -phase locking to tms as a function of ongoing -activity strongly supports phase resetting of ongoing oscillations, akin to the model of generation of sensory evoked potentials [3032 ]. as a consequence of phase resetting, each tms pulse should trigger waves that cycle at the frequency of the targeted area (approximating an oscillation kernel of entrainment). because frequency - tuned tms is phase aligned to these waves notably, tms - aligned waves at the beginning of the train not only cycled at -frequency but also involved oscillatory activity in the - and -bands. one explanation is that the initial tms pulses might have phase reset a multitude of parallel generators located within the same stimulated network but each cycling at a distinct frequency. this would be in keeping with evidence that single tms pulses can probe into the natural rhythms of the stimulated area [3335 ] and that parietal - and -tms leads to frequency - specific perceptual consequences, albeit ones distinct from the outcome of -tms. alternatively, parts of the initial responses may reflect an unspecific effect of tms that is not necessarily of oscillatory nature (such as emotional or cognitive appraisal of tms at the start of the bursts) rather than a genuine tms impact on underlying neurons (see also). this may be supported by our finding that the responses to the initial tms pulses spread over several areas (including frontocentral sites). importantly, however, over the course of the tms train and in accord with tms entrainment, only -oscillations became progressively enhanced, whereas none of the other initial responses were promoted by further pulses. importantly, also, stimulation in an arrhythmic mode did not lead to entrainment. in this condition, tms pulses were randomly jittered around a mean -frequency (about 10 hz) to cover nonharmonic frequencies of 713 hz (table 1), which is likely to disrupt or even interrupt entrainment as a result of pulses being out of phase. tms entrainment can therefore be construed as a progressive recruitment of neuronal elements cycling at the target frequency to phase align their activity to tms. note that the duration of entrainment that we report is in full agreement with findings that the oscillatory eeg response to one single pulse (the approximated oscillation kernel) lasts for only about one to two cycles [33, 35 ], the decay constant of the entrainment effect that we observe. note also that there is no evidence for entrainment in the literature on long - term eeg aftereffects of clinical repetitive tms protocols, given the lack of a consistent match between affected eeg and applied tms frequency. in light of our positive findings, it is of interest that previous attempts to entrain eeg oscillations to a rhythmic tms train were unsuccessful. it is unlikely that this discrepancy is simply explained by our selection of individual parameters for careful targeting of the generators. although individual source estimation and 1:1 frequency matching between applied and preferred -frequency is likely ideal for obtaining entrainment, parietal -tms leads to frequency - specific perceptual consequences also with fixed, not strictly individualized (10 hz) frequency [4, 5 ]. physiologically, this may be explained by trial - by - trial fluctuations around the average individual -frequency. in addition, computational work shows that the tight relationship between effective stimulation frequency and preferred frequency loosens up as stimulus intensity increases, meaning that with increasing stimulus intensity, entrainment may occur from a progressively larger bandwidth, albeit one centered on the natural frequencies of the stimulated cortex (giving rise to the so - called arnold tongues) (e.g., [17, 18 ]). this suggests that entrainment should also work when tms frequency is slightly off the individual -frequency. one explanation of previous null results of entrainment may be the use of overly conservative artifact - removal procedures (e.g., independent component analysis, as in), as may be required in certain eeg devices with slow recovery times after tms. alternatively, entrainment may have been complicated by the choice of a suboptimal coil orientation. further research will need to study in detail the parameter space within which a natural oscillatory signature can be entrained. this sheds new light on the direct interaction of rhythmic tms with brain oscillations and significantly adds to an emerging literature on entrainment via alternative transcranial stimulation protocols, such as tacs [79, 3942 ]. our data show that tms entrainment can evoke spatially specific and frequency - specific signatures. the evoked signatures mimic naturally occurring, task - related modulations that are of functional significance. this sheds new light on the direct interaction of rhythmic tms with brain oscillations and significantly adds to an emerging literature on entrainment via alternative transcranial stimulation protocols, such as tacs [79, 3942 ]. our data show that tms entrainment can evoke spatially specific and frequency - specific signatures. the evoked signatures mimic naturally occurring, task - related modulations that are of functional significance. ten healthy adult volunteers participated, of whom two had to be excluded from eeg analysis because of excessive eye blinks (artifacts) triggered by tms. the remaining participants (five females, three males) had a mean age of 27.1 years (2133 years) and were predominantly right handed by self report (one left handed). all gave written informed consent prior to the study, which was approved by the ethics committee of the faculty of information & mathematical sciences of the university of glasgow. the tms protocol used accords with current safety guidelines and is of widespread use in studies on cognition. participants performed in a symbolically cued visual - spatial attention - orienting paradigm, in anticipation of an upcoming, lateralized visual target. in short, a central visual cue of 0.2 s duration (randomly pointing either to the lower left or right visual field) prompted covert shifts of visual attention to the indicated position. after 1.7 s, the target appeared more often at cued than noncued locations (80% versus 20% of trials). the targets consisted of either an x or a +, whose luminance contrast with the background was chosen to give rise to perithreshold performance per participant. the participants were required to discriminate the two targets (giving left index responses for x and right index responses for +). there was a 3 s delay between the manual response and the next cue. participants were asked to keep central fixation, to covertly direct and maintain attention to the cued position, and to respond to targets at cued and noncued locations. meg data of 100 trials were collected for each of the two attention conditions (randomly intermixed within five blocks of approximately 4 min duration each) using a 248-channel magnetometer whole - head meg system (magnes 3600 wh, 4-d neuroimaging). data were collected at 508 hz sampling rate and online high - pass filtered at 0.1 hz. meg data analysis focused on attention - related signals in the cue - target interval, normalized to baseline before cue onset. to this end, we epoched meg signals time locked to cue onset (1 to 2.5 s) and linearly detrended them prior to regression - based denoising using the signals from the reference sensors. spectral analysis was performed on two 1 s data segments (1 s to 0 s and 0.5 s to 1.5 s) after applying hanning tapers. spectra for left - cue and right - cue trials were averaged separately and subtracted. the difference spectral plot was used to identify the individual -generator (in the 515 hz range) that showed strongest modulation by visual spatial attention. source localization was performed using dynamic imaging of coherent sources (dics ;) on a 6 mm grid at individual -frequency to localize the strongest generators of the -modulation associated with the shift of spatial attention. to this end, a t statistic was computed for the single - trial difference between precue and postcue -power. the 3d map of t values was visualized on the standardized structural mri, and the coordinates of the global maximum were identified. to control for adequate task performance, reaction times to targets were subjected to anova with factors cueing validity (for targets appearing at cued versus noncued positions) and target side (left versus right). participants were comfortably seated with their chin positioned in a chin rest, their eyes open, and their gaze centered on a continuously displayed fixation cross (black on a gray background, rgb 192). participants were asked to maintain central fixation and to minimize eye blinks and other movements during the recording blocks. short tms bursts were delivered under the main (-tms) and three control conditions (-tms90, ar - tms, and -tmssham). we neuronavigated the tms coil (70 mm figure - of - eight coil connected to a magstim rapid2 stimulator) in all conditions to the talairach coordinates of the most prominent posterior -generator of the right hemisphere (obtained from the meg localizer task) via brainsight (rogue research). under blindfolding, occipital stimulation at experimental tms intensity therefore evoked weak phosphenes in 50% of trials. with tms over the -generators that were localized in parietal cortex for all participants, no phosphene perceptions could be evoked (replicating). the four tms conditions were tested in a block design. in each block, 18 five - pulse tms trains were given with an intertrain interval of 20 s, leading to 90 pulses per block over a block duration of about 6 min. all four conditions were tested in a series of four blocks (order of conditions randomized). this was repeated three times, leading to a total of 810 active tms pulses with 54 trials per condition. the duration of the experiment was 1.52 hr of recording, plus 1 hr for mounting the 64 eeg electrodes. using tms - compatible equipment (brainamp 64 mrplus, brainproducts), eeg was continuously acquired from 62 channels (plus ground and reference electrodes). the signal was band - pass filtered at dc to 1000 hz and digitized at a sampling rate of 5 khz. skin / electrode impedance was maintained below 5 k. analysis was performed using the fieldtrip software package (http://fieldtrip.fcdonders.nl), custom - made matlab code, brainvision analyzer 1 (brainproducts), and cartool software (http://sites.google.com/site/fbmlab/cartool). preprocessing epochs were of 4 s duration (2 s to + 2 s from tms train onset). epochs with excessively noisy eeg, eye movement artifacts (blinks or saccades), or muscle artifacts were excluded (mean acceptance rate 68%). the 50 hz artifact was removed from remaining trials by fitting and subtracting a 50 hz sine / cosine function. after these steps, the remaining artifacts associated with the tms pulses consisted of brief high - voltage peaks. these artifacts, which were generally of about 58 ms duration (replicating e.g. using the same eeg equipment), were then removed using cubic interpolation for a conservative 15 ms interval following the tms pulse. the same procedure was applied to remove the shorter and smaller rtms recharge artifact, interpolating a 3 ms interval after 20 ms from each magnetic pulse (latencies varied across subjects according to tms intensity). wavelet analysis across the entire epoch. to analyze the oscillatory activity evoked by the tms train, we calculated the average responses for an epoch of 0.5 s pre to + 1 s post train onset and processed them with complex morlet wavelets (240 hz, 20 frequency steps, c = 5). based on the results and in order to evaluate the entrainment of -oscillations, we extracted the frequency range between 8 and 12 hz for each subject from the wavelet dataset. their spatial map topographies were plotted and compared across conditions (-tms versus controls) using subtraction plots (subtraction maps) and electrode - wise t statistics (t / p maps). the analysis revealed a biphasic response pattern (broadband response in an early time window, narrow -band response in a later time window). analyses were therefore performed on two windows (window w1 and w2), each centered on these responses. the early window (40190 ms into the train) covered pulses 12, the later window (240540 ms) pulses 35. analysis of -waves to each successive tms pulse. to analyze the spatiotemporal characteristics of -waves, we band - pass filtered artifact - free data 812 hz (butterworth zero - phase filters, slope 48 db / oct) and rearranged them to five epochs locked to the onset of each single pulse (epoch duration depending on individual -frequency [iaf ] and condition, minimum 090 ms post - tms for iaf of 11 hz, minimum 0.7 90 ms = 63 ms for ar - tms). the average -wave was then analyzed in terms of evolution of its topographies over the five pulses and in terms of differences across conditions. to this end, we performed spatial map fitting between the grand - average scalp topographies at the two -peaks within an -cycle (90 and 270) and the corresponding individual -peaks of the same or corresponding control conditions (intercorrelation between peak topographies). the fitting results were then analyzed to evaluate goodness of fit of grand - average maps (gmmap) in individual data to statistically secure their condition specificity (see e.g. for application ; see for review). to this end, we computed anovas on the fitting results (goodness of fit). to evaluate the evolution of -waves across tms pulses in the main condition (-tms), we conducted a 2 5 2 anova with evoked map (start versus end), tms pulse (tms15) and phase (90 versus 270) as within - subject factors. to compare -waves across all conditions, we conducted a 4 5 2 anova on fitting of map 5 with condition (-tms, -tms90, ar - tms, and -tmssham), tms pulse (tms15) and phase (90 versus 270) as within - subject factors. artifact - free data were band - pass filtered 812 hz and subjected to hilbert transform for computation of instantaneous phase and amplitude. intertrial phase locking was computed from the instantaneous phase as the absolute value of the mean of exp(i) across trials, also called phase - locking factor (plf). plf and amplitudes were individually averaged across trials (amplitudes were normalized by computing change relative to baseline [500 ms to 100 ms ]). differences between conditions were tested for all electrodes in window w2. as a conservative significance estimate, we only considered electrodes with p < 0.05 (t tests) in all three comparisons (-tms minus -tms90, -tms minus ar - tms, and -tms minus -tmssham) to be significant. in a next step, trials were sorted into six bins of increasing pre - tms -phase (spanning from 0 to 2) or pre - tms -amplitude (spanning from min to max) (100 ms before tms onset). ongoing -activity prior to tms showed a widespread distribution over occipital and parietal sites bilaterally (data not shown), in contrast to -phase locking during tms, which was spatially restricted to electrodes over the right parietal target site (figure 4a), indicating local entrainment. the ongoing right parietal signal was therefore likely distorted by volume conductance from adjacent posterior sites (right occipital and left parietal). to decrease contributions from (possibly stronger) more distant -sources prior to tms and to thereby obtain a more reliable estimate of the ongoing -phase and -amplitude of the right parietal source (to be related to entrainment measures over right parietal sites), we computed pre - tms phase and amplitude calculations for sorting on a bipolar montage (c4 cp4) (cp4 p4). -phase locking and -amplitudes were averaged across window w2 and significant electrodes for each participant, condition, and bin separately before being subjected to 6 4 anovas with factors bin and condition. population marginal means of main factors were computed using the multcompare function in matlab (mathworks). to analyze whether the strength of phase locking was consistently modulated by pre - tms phase, we computed the maximum cross - correlation between the six plf values (one for each phase bin) and a cosine function for all four conditions (-tms, -tms90, ar - tms, and -tmssham) and compared them to the 95th percentile of the null distribution for each condition separately. the null distribution was created by computing the maximum cross - correlation (across all lags) for 500 random permutations of the six plf values. ten healthy adult volunteers participated, of whom two had to be excluded from eeg analysis because of excessive eye blinks (artifacts) triggered by tms. the remaining participants (five females, three males) had a mean age of 27.1 years (2133 years) and were predominantly right handed by self report (one left handed). all gave written informed consent prior to the study, which was approved by the ethics committee of the faculty of information & mathematical sciences of the university of glasgow. the tms protocol used accords with current safety guidelines and is of widespread use in studies on cognition. participants performed in a symbolically cued visual - spatial attention - orienting paradigm, in anticipation of an upcoming, lateralized visual target. in short, a central visual cue of 0.2 s duration (randomly pointing either to the lower left or right visual field) prompted covert shifts of visual attention to the indicated position. after 1.7 s, the target appeared more often at cued than noncued locations (80% versus 20% of trials). the targets consisted of either an x or a +, whose luminance contrast with the background was chosen to give rise to perithreshold performance per participant. the participants were required to discriminate the two targets (giving left index responses for x and right index responses for +). there was a 3 s delay between the manual response and the next cue. participants were asked to keep central fixation, to covertly direct and maintain attention to the cued position, and to respond to targets at cued and noncued locations. meg data of 100 trials were collected for each of the two attention conditions (randomly intermixed within five blocks of approximately 4 min duration each) using a 248-channel magnetometer whole - head meg system (magnes 3600 wh, 4-d neuroimaging). data were collected at 508 hz sampling rate and online high - pass filtered at 0.1 hz. meg data analysis focused on attention - related signals in the cue - target interval, normalized to baseline before cue onset. to this end, we epoched meg signals time locked to cue onset (1 to 2.5 s) and linearly detrended them prior to regression - based denoising using the signals from the reference sensors. spectral analysis was performed on two 1 s data segments (1 s to 0 s and 0.5 s to 1.5 s) after applying hanning tapers. spectra for left - cue and right - cue trials were averaged separately and subtracted. the difference spectral plot was used to identify the individual -generator (in the 515 hz range) that showed strongest modulation by visual spatial attention. source localization was performed using dynamic imaging of coherent sources (dics ;) on a 6 mm grid at individual -frequency to localize the strongest generators of the -modulation associated with the shift of spatial attention. to this end, a t statistic was computed for the single - trial difference between precue and postcue -power. the 3d map of t values was visualized on the standardized structural mri, and the coordinates of the global maximum were identified. to control for adequate task performance, reaction times to targets were subjected to anova with factors cueing validity (for targets appearing at cued versus noncued positions) and target side (left versus right). participants were comfortably seated with their chin positioned in a chin rest, their eyes open, and their gaze centered on a continuously displayed fixation cross (black on a gray background, rgb 192). participants were asked to maintain central fixation and to minimize eye blinks and other movements during the recording blocks. short tms bursts were delivered under the main (-tms) and three control conditions (-tms90, ar - tms, and -tmssham). we neuronavigated the tms coil (70 mm figure - of - eight coil connected to a magstim rapid2 stimulator) in all conditions to the talairach coordinates of the most prominent posterior -generator of the right hemisphere (obtained from the meg localizer task) via brainsight (rogue research). tms intensity was at 100% phosphene threshold, determined in blindfolded participants. under blindfolding, with tms over the -generators that were localized in parietal cortex for all participants, no phosphene perceptions could be evoked (replicating). the four tms conditions were tested in a block design. in each block, 18 five - pulse tms trains were given with an intertrain interval of 20 s, leading to 90 pulses per block over a block duration of about 6 min. all four conditions were tested in a series of four blocks (order of conditions randomized). this was repeated three times, leading to a total of 810 active tms pulses with 54 trials per condition. the duration of the experiment was 1.52 hr of recording, plus 1 hr for mounting the 64 eeg electrodes. using tms - compatible equipment (brainamp 64 mrplus, brainproducts), eeg was continuously acquired from 62 channels (plus ground and reference electrodes). the signal was band - pass filtered at dc to 1000 hz and digitized at a sampling rate of 5 khz. skin / electrode impedance was maintained below 5 k. analysis was performed using the fieldtrip software package (http://fieldtrip.fcdonders.nl), custom - made matlab code, brainvision analyzer 1 (brainproducts), and cartool software (http://sites.google.com/site/fbmlab/cartool). preprocessing epochs were of 4 s duration (2 s to + 2 s from tms train onset). epochs with excessively noisy eeg, eye movement artifacts (blinks or saccades), or muscle artifacts were excluded (mean acceptance rate 68%). the 50 hz artifact was removed from remaining trials by fitting and subtracting a 50 hz sine / cosine function. after these steps, the remaining artifacts associated with the tms pulses consisted of brief high - voltage peaks. these artifacts, which were generally of about 58 ms duration (replicating e.g. using the same eeg equipment), were then removed using cubic interpolation for a conservative 15 ms interval following the tms pulse. the same procedure was applied to remove the shorter and smaller rtms recharge artifact, interpolating a 3 ms interval after 20 ms from each magnetic pulse (latencies varied across subjects according to tms intensity). wavelet analysis across the entire epoch. to analyze the oscillatory activity evoked by the tms train, we calculated the average responses for an epoch of 0.5 s pre to + 1 s post train onset and processed them with complex morlet wavelets (240 hz, 20 frequency steps, c = 5). based on the results and in order to evaluate the entrainment of -oscillations, we extracted the frequency range between 8 and 12 hz for each subject from the wavelet dataset. their spatial map topographies were plotted and compared across conditions (-tms versus controls) using subtraction plots (subtraction maps) and electrode - wise t statistics (t / p maps). the analysis revealed a biphasic response pattern (broadband response in an early time window, narrow -band response in a later time window). analyses were therefore performed on two windows (window w1 and w2), each centered on these responses. the early window (40190 ms into the train) covered pulses 12, the later window (240540 ms) pulses 35. analysis of -waves to each successive tms pulse. to analyze the spatiotemporal characteristics of -waves, we band - pass filtered artifact - free data 812 hz (butterworth zero - phase filters, slope 48 db / oct) and rearranged them to five epochs locked to the onset of each single pulse (epoch duration depending on individual -frequency [iaf ] and condition, minimum 090 ms post - tms for iaf of 11 hz, minimum 0.7 90 ms = 63 ms for ar - tms). the average -wave was then analyzed in terms of evolution of its topographies over the five pulses and in terms of differences across conditions. to this end, we performed spatial map fitting between the grand - average scalp topographies at the two -peaks within an -cycle (90 and 270) and the corresponding individual -peaks of the same or corresponding control conditions (intercorrelation between peak topographies). the fitting results were then analyzed to evaluate goodness of fit of grand - average maps (gmmap) in individual data to statistically secure their condition specificity (see e.g. for application ; see for review). to this end, we computed anovas on the fitting results (goodness of fit). to evaluate the evolution of -waves across tms pulses in the main condition (-tms), we conducted a 2 5 2 anova with evoked map (start versus end), tms pulse (tms15) and phase (90 versus 270) as within - subject factors. to compare -waves across all conditions, we conducted a 4 5 2 anova on fitting of map 5 with condition (-tms, -tms90, ar - tms, and -tmssham), tms pulse (tms15) and phase (90 versus 270) as within - subject factors. artifact - free data were band - pass filtered 812 hz and subjected to hilbert transform for computation of instantaneous phase and amplitude. intertrial phase locking was computed from the instantaneous phase as the absolute value of the mean of exp(i) across trials, also called phase - locking factor (plf). plf and amplitudes were individually averaged across trials (amplitudes were normalized by computing change relative to baseline [500 ms to 100 ms ]). differences between conditions were tested for all electrodes in window w2. as a conservative significance estimate, we only considered electrodes with p < 0.05 (t tests) in all three comparisons (-tms minus -tms90, -tms minus ar - tms, and -tms minus -tmssham) to be significant. in a next step, trials were sorted into six bins of increasing pre - tms -phase (spanning from 0 to 2) or pre - tms -amplitude (spanning from min to max) (100 ms before tms onset). ongoing -activity prior to tms showed a widespread distribution over occipital and parietal sites bilaterally (data not shown), in contrast to -phase locking during tms, which was spatially restricted to electrodes over the right parietal target site (figure 4a), indicating local entrainment. the ongoing right parietal signal was therefore likely distorted by volume conductance from adjacent posterior sites (right occipital and left parietal). to decrease contributions from (possibly stronger) more distant -sources prior to tms and to thereby obtain a more reliable estimate of the ongoing -phase and -amplitude of the right parietal source (to be related to entrainment measures over right parietal sites), we computed pre - tms phase and amplitude calculations for sorting on a bipolar montage (c4 cp4) (cp4 p4). -phase locking and -amplitudes were averaged across window w2 and significant electrodes for each participant, condition, and bin separately before being subjected to 6 4 anovas with factors bin and condition. population marginal means of main factors were computed using the multcompare function in matlab (mathworks). to analyze whether the strength of phase locking was consistently modulated by pre - tms phase, we computed the maximum cross - correlation between the six plf values (one for each phase bin) and a cosine function for all four conditions (-tms, -tms90, ar - tms, and -tmssham) and compared them to the 95th percentile of the null distribution for each condition separately. the null distribution was created by computing the maximum cross - correlation (across all lags) for 500 random permutations of the six plf values. participants were comfortably seated with their chin positioned in a chin rest, their eyes open, and their gaze centered on a continuously displayed fixation cross (black on a gray background, rgb 192). participants were asked to maintain central fixation and to minimize eye blinks and other movements during the recording blocks. short tms bursts were delivered under the main (-tms) and three control conditions (-tms90, ar - tms, and -tmssham). we neuronavigated the tms coil (70 mm figure - of - eight coil connected to a magstim rapid2 stimulator) in all conditions to the talairach coordinates of the most prominent posterior -generator of the right hemisphere (obtained from the meg localizer task) via brainsight (rogue research). tms intensity was at 100% phosphene threshold, determined in blindfolded participants. under blindfolding, with tms over the -generators that were localized in parietal cortex for all participants, no phosphene perceptions could be evoked (replicating). the four tms conditions were tested in a block design. in each block, 18 five - pulse tms trains were given with an intertrain interval of 20 s, leading to 90 pulses per block over a block duration of about 6 min. all four conditions were tested in a series of four blocks (order of conditions randomized). this was repeated three times, leading to a total of 810 active tms pulses with 54 trials per condition. the duration of the experiment was 1.52 hr of recording, plus 1 hr for mounting the 64 eeg electrodes. using tms - compatible equipment (brainamp 64 mrplus, brainproducts), eeg was continuously acquired from 62 channels (plus ground and reference electrodes). the signal was band - pass filtered at dc to 1000 hz and digitized at a sampling rate of 5 khz. analysis was performed using the fieldtrip software package (http://fieldtrip.fcdonders.nl), custom - made matlab code, brainvision analyzer 1 (brainproducts), and cartool software (http://sites.google.com/site/fbmlab/cartool). preprocessing epochs were of 4 s duration (2 s to + 2 s from tms train onset). epochs with excessively noisy eeg, eye movement artifacts (blinks or saccades), or muscle artifacts were excluded (mean acceptance rate 68%). the 50 hz artifact was removed from remaining trials by fitting and subtracting a 50 hz sine / cosine function. after these steps, the remaining artifacts associated with the tms pulses consisted of brief high - voltage peaks. these artifacts, which were generally of about 58 ms duration (replicating e.g. using the same eeg equipment), were then removed using cubic interpolation for a conservative 15 ms interval following the tms pulse. the same procedure was applied to remove the shorter and smaller rtms recharge artifact, interpolating a 3 ms interval after 20 ms from each magnetic pulse (latencies varied across subjects according to tms intensity). wavelet analysis across the entire epoch. to analyze the oscillatory activity evoked by the tms train, we calculated the average responses for an epoch of 0.5 s pre to + 1 s post train onset and processed them with complex morlet wavelets (240 hz, 20 frequency steps, c = 5). based on the results and in order to evaluate the entrainment of -oscillations, we extracted the frequency range between 8 and 12 hz for each subject from the wavelet dataset. their spatial map topographies were plotted and compared across conditions (-tms versus controls) using subtraction plots (subtraction maps) and electrode - wise t statistics (t / p maps). the analysis revealed a biphasic response pattern (broadband response in an early time window, narrow -band response in a later time window). analyses were therefore performed on two windows (window w1 and w2), each centered on these responses. the early window (40190 ms into the train) covered pulses 12, the later window (240540 ms) pulses 35. analysis of -waves to each successive tms pulse. to analyze the spatiotemporal characteristics of -waves, we band - pass filtered artifact - free data 812 hz (butterworth zero - phase filters, slope 48 db / oct) and rearranged them to five epochs locked to the onset of each single pulse (epoch duration depending on individual -frequency [iaf ] and condition, minimum 090 ms post - tms for iaf of 11 hz, minimum 0.7 90 ms = 63 ms for ar - tms). the average -wave was then analyzed in terms of evolution of its topographies over the five pulses and in terms of differences across conditions. to this end, we performed spatial map fitting between the grand - average scalp topographies at the two -peaks within an -cycle (90 and 270) and the corresponding individual -peaks of the same or corresponding control conditions (intercorrelation between peak topographies). the fitting results were then analyzed to evaluate goodness of fit of grand - average maps (gmmap) in individual data to statistically secure their condition specificity (see e.g. for application ; see for review). to this end, we computed anovas on the fitting results (goodness of fit). to evaluate the evolution of -waves across tms pulses in the main condition (-tms), we conducted a 2 5 2 anova with evoked map (start versus end), tms pulse (tms15) and phase (90 versus 270) as within - subject factors. to compare -waves across all conditions, we conducted a 4 5 2 anova on fitting of map 5 with condition (-tms, -tms90, ar - tms, and -tmssham), tms pulse (tms15) and phase (90 versus 270) as within - subject factors. artifact - free data were band - pass filtered 812 hz and subjected to hilbert transform for computation of instantaneous phase and amplitude. intertrial phase locking was computed from the instantaneous phase as the absolute value of the mean of exp(i) across trials, also called phase - locking factor (plf). plf and amplitudes were individually averaged across trials (amplitudes were normalized by computing change relative to baseline [500 ms to 100 ms ]). differences between conditions were tested for all electrodes in window w2. as a conservative significance estimate, we only considered electrodes with p < 0.05 (t tests) in all three comparisons (-tms minus -tms90, -tms minus ar - tms, and -tms minus -tmssham) to be significant. in a next step, trials were sorted into six bins of increasing pre - tms -phase (spanning from 0 to 2) or pre - tms -amplitude (spanning from min to max) (100 ms before tms onset). ongoing -activity prior to tms showed a widespread distribution over occipital and parietal sites bilaterally (data not shown), in contrast to -phase locking during tms, which was spatially restricted to electrodes over the right parietal target site (figure 4a), indicating local entrainment. the ongoing right parietal signal was therefore likely distorted by volume conductance from adjacent posterior sites (right occipital and left parietal). to decrease contributions from (possibly stronger) more distant -sources prior to tms and to thereby obtain a more reliable estimate of the ongoing -phase and -amplitude of the right parietal source (to be related to entrainment measures over right parietal sites), we computed pre - tms phase and amplitude calculations for sorting on a bipolar montage (c4 cp4) (cp4 p4). -phase locking and -amplitudes were averaged across window w2 and significant electrodes for each participant, condition, and bin separately before being subjected to 6 4 anovas with factors bin and condition. population marginal means of main factors were computed using the multcompare function in matlab (mathworks). to analyze whether the strength of phase locking was consistently modulated by pre - tms phase, we computed the maximum cross - correlation between the six plf values (one for each phase bin) and a cosine function for all four conditions (-tms, -tms90, ar - tms, and -tmssham) and compared them to the 95th percentile of the null distribution for each condition separately. the null distribution was created by computing the maximum cross - correlation (across all lags) for 500 random permutations of the six plf values. document s1. supplemental results, supplemental discussion, three figures, and supplemental experimental procedures | summarybackgroundneuronal elements underlying perception, cognition, and action exhibit distinct oscillatory phenomena, measured in humans by electro- or magnetoencephalography (eeg / meg). so far, the correlative or causal nature of the link between brain oscillations and functions has remained elusive. a compelling demonstration of causality would primarily generate oscillatory signatures that are known to correlate with particular cognitive functions and then assess the behavioral consequences. here, we provide the first direct evidence for causal entrainment of brain oscillations by transcranial magnetic stimulation (tms) using concurrent eeg.resultswe used rhythmic tms bursts to directly interact with an meg - identified parietal -oscillator, activated by attention and linked to perception. with tms bursts tuned to its preferred -frequency (-tms), we confirmed the three main predictions of entrainment of a natural oscillator : (1) that -oscillations are induced during -tms (reproducing an oscillatory signature of the stimulated parietal cortex), (2) that there is progressive enhancement of this -activity (synchronizing the targeted, -generator to the -tms train), and (3) that this depends on the pre - tms phase of the background -rhythm (entrainment of natural, ongoing -oscillations). control conditions testing different tms burst profiles and tms - eeg in a phantom head confirmed specificity of -boosting to the case of synchronization between tms train and neural oscillator.conclusionsthe periodic electromagnetic force that is generated during rhythmic tms can cause local entrainment of natural brain oscillations, emulating oscillatory signatures activated by cognitive tasks. this reveals a new mechanism of online tms action on brain activity and can account for frequency - specific behavioral tms effects at the level of biologically relevant rhythms. |
intestinal pseudomelanosis is a condition characterized by dark pigmentation of the intestinal mucosa, such as colon, small bowel, and stomach. among intestinal pseudomelanosis, melanosis coli is the most common and a well known condition, which occurs with the laxative use, especially anthraquinone containing laxatives. the dark brown pigmentation of melanosis coli is actually lipofuscin in macrophages and not melanin (1). interestingly, extracolonic pseudomelanosis has also been rarely reported in the literature (2, 3) and several etiologies have been suggested for the development of extracolonic pseudomelanosis. most commonly reported location of extracolonic pseudomelanosis is the duodenum, although it can also be found on the mucosa of the stomach, jejum or ileum (2 - 4). in addition, few reports on pseudomelanosis ilei have attributed its cause to chronic oral iron therapy, but the association is still unclear (2, 5). few reports showed that there are considerable association with end stage renal disease and hypertension (3). herein, we describe 6 cases of the small bowel pseudomelanosis with possible etiology being chronic iron intake. the cases included one man and 5 women, with a mean age of 62 yr (median 69.5, range 34 - 73). summary on endoscopic findings, associated medical conditions, and concurrent medications of the subjects are shown in table 1. five (83%) patients had chronic kidney disease, 2 of whom were undergoing peritoneal dialysis, 5 (83%) patients had hypertension, and 3 (50%) patients had diabetes mellitus. various classes of antihypertensive medication including beta blockers, thiazides, angiotensin receptor blockers, and calcium channel blockers were being taken by the hypertensive patients. other common medications included statin (hmg - coa reductase inhibitor) and potassium binder. all patients had been taking iron sulfate for an average of 32.8 months (13 - 66 months). four patients underwent both upper and lower endoscopy, and the remaining two underwent upper endoscopy or colonoscopy. numerous brown spots were observed on the mucosa of terminal ileum in 3 patients, duodenum in 1 patient, jejunum in 1 patient, and both duodenum and terminal ileum in 1 patient (fig. the patient had undergone subtotal gastrectomy with billroth ii reconstruction due to early gastric cancer. biopsies were taken during endoscopy and specimens were stained with hematoxylin and eosin and also stained for iron. histology revealed pigment deposition within macrophages of the lamina propria and a positive prussian blue stain indicated hemosiderin deposition (fig. the cases included one man and 5 women, with a mean age of 62 yr (median 69.5, range 34 - 73). summary on endoscopic findings, associated medical conditions, and concurrent medications of the subjects are shown in table 1. five (83%) patients had chronic kidney disease, 2 of whom were undergoing peritoneal dialysis, 5 (83%) patients had hypertension, and 3 (50%) patients had diabetes mellitus. various classes of antihypertensive medication including beta blockers, thiazides, angiotensin receptor blockers, and calcium channel blockers were being taken by the hypertensive patients. other common medications included statin (hmg - coa reductase inhibitor) and potassium binder. all patients had been taking iron sulfate for an average of 32.8 months (13 - 66 months). four patients underwent both upper and lower endoscopy, and the remaining two underwent upper endoscopy or colonoscopy. numerous brown spots were observed on the mucosa of terminal ileum in 3 patients, duodenum in 1 patient, jejunum in 1 patient, and both duodenum and terminal ileum in 1 patient (fig. the patient had undergone subtotal gastrectomy with billroth ii reconstruction due to early gastric cancer. biopsies were taken during endoscopy and specimens were stained with hematoxylin and eosin and also stained for iron. histology revealed pigment deposition within macrophages of the lamina propria and a positive prussian blue stain indicated hemosiderin deposition (fig. small bowel pseudomelanosis is a finding that is rarely encountered during endoscopy and its etiology is still not fully understood (3, 5). whereas melanosis coli is relatively common condition occurring in more than 70% of persons who use anthraquinone containing laxatives, pseudomelanosis of although examination of the small bowel has been facilitated with the introduction of capsule endoscopy (ce) or double balloon endoscopy (dbe), pseudomelanosis of the small bowel is still a rare finding. a portuguese center with experience of more than 600 ce and 100 dbe reported only two cases of small bowel pseudomelanosis (2) ; one case showed pigmentation in the entire small bowel and the other case in the ileum (6). in korea, pseudomelanosis duodeni or ilei has been reported sporadically in 7 cases in patients taking oral iron (7 - 9). interestingly, 6 cases of pseudomelanosis ilei associated with charcoal ingestion have been reported only in korea (10 - 14). in our case series, all patients had been taking oral iron at the time of upper or lower endoscopy. of the 6 cases, 3 had undergone upper and lower endoscopy before initiating iron therapy, which revealed normal mucosa without pigmentation on duodenum and terminal ileum. therefore, the cause of pseudomelanosis of small bowel in these patients could be attributed to oral iron therapy. apart from oral iron therapy, other possible causes of small bowel pseudomelanosis include chronic kidney disease, hypertension, and certain medications like antihypertensive drugs (3, 15). it has been hypothesized that coupling of absorbed iron with a sulfur moiety from antihypertensive medications could be the underlying mechanism for pigment accumulation in macrophages of small bowel mucosa (2). fernando (16) demonstrated that absorbed iron coupled with sulfur in pseudomelanosis duodeni, using electron probe x - ray analysis of epithelial cells and macrophages at different levels of the intestine. he proposed that this coupling results in impaired iron transport that leads to the accumulation of ferrous sulfates. as for the source of sulfur, antihypertensive medications such as furosemide and hydrochlorothiazide which contain sulfur moiety have been implicated (17, 18). typically, the biopsy specimen shows dark brown to black granular deposits in the lamina propria of the tips of intestinal villi, and the deposits often contain iron as hemosiderin in ferric or ferrous form (19). a recent retrospective study showed that pigment - laden macrophages were sometimes observed even when it was not apparent during endoscopy (3). in another case of pseudomelanosis in which there were pigmentations from stomach to jejunum, review of previous histopathology slides from antral ulcer two years earlier revealed granular pigment in the lamina propria with positive stain for iron ; however, pigmentation was not evident endoscopically at that time (20). it could be postulated that duration of iron therapy is associated with the development of pseudomelanosis in the small bowel and determines its extent, but this association could not be validated possibly due to the small sample size. although the causes of pseudomelanosis of the small bowel and its underlying mechanism are still unknown, our case series with a relatively large number of patients suggests that there could be a likely association between pseudomelanosis of the small bowel and chronic oral iron therapy. | an accumulation of pigment deposits on mucosa, called melanosis or pseudomelanosis, of the small bowel is observed infrequently during endoscopic examination. we describe 6 cases of small bowel pseudomelanosis ; the possible etiology of which was chronic iron intake. we observed numerous brown spots in duodenum, jejunum, and terminal ileum during upper and lower endoscopy. interestingly, all patients have been taking oral iron for several years. histology showed pigment depositions within macrophages of the lamina propria and a positive prussian blue stain indicating hemosiderin deposition. herein, we demonstrate that long term iron therapy may result in pseudomelanosis of small bowel, such as duodenum, jejunum, and ileum. |
hydrocephalus is not a single clinical entity but a complex pathophysiology with disturbed cerebrospinal fluid (csf) circulation.24) normal pressure hydrocephalus (nph) is a syndrome that is characterized by gait disturbance, memory impairment and urinary incontinence, and is associated with ventriculomegaly in the absence of elevated csf pressure. diagnosis of nph is challenging due to the absence of pathognomonic features and the broad differential for the clinical presentation.23) various supplemental preoperative tests, including lumbar csf tap test or csf outflow resistance determination, were proposed to improve the accuracy of predicting a response to surgical intervention. however, the value of supplementary tests to predict which patients would benefit from placement of a shunt has not been established.22) cisternographic studies have been in use for at least 50 years for the evaluation of abnormalities of the intracranial csf - filled spaces.3) the isotope cisternography (icg) was previously accepted as a convenient tool to evaluate csf dynamics,9) even for a classification of hydrocephalus.12) it has lost its importance in the diagnosis of nph because of its low accuracy at predicting the outcome of shunt surgery, the radiation risk and invasiveness.119) there were several reports on the complications after icg, such as post - puncture headache, aseptic meningitis, and conus medullaris syndrome (cms).71425) however, we still use the icg as a useful diagnostic complement. we tried to evaluate the safety and value of the icg in consecutive 175 patients with suspected hydrocephalus. we retrospectively collected data on the medical records and icg of 175 consecutive patients with a suspected hydrocephalus, which was diagnosed by computed tomography (ct) scans with or without magnetic resonance imaging (mri) from january 2006 to march 2013. we excluded 6 patients in whom the icg was done for the diagnosis of csf leakage. as the complications of the icg, we included unwanted results directly related to the icg procedure such as subdural injections or meningitis. we classified the findings of icg into four types according to the ventricular reflux and circulation time ; type 1 for normal migration without ventricular reflex, type 2 for delayed migration without ventricular reflex, type 3 for transient ventricular activity, and type 4 for persistent ventricular activity (figure 1).13) the size of the ventricles were measured by evans index (ei) and the width of the third ventricle (wtv). ventriculoperitoneal (vp) shunt was performed in 94 patients including 6 cases of revision surgery. shunt surgery was performed when the symptoms of the hydrocephalus was improved after the lumbar puncture. the outcome of the shunt surgery was divided into either improved or not - improved. we evaluated the outcome and preoperative state by the glasgow outcome scale (gos). when the outcome was at least moderate disability (md) or the patient became mobile after surgery, we graded the outcome as improved. when the outcome was severe disability (sd) or lower even after surgery, we graded the outcome as not - improved, even though there were some improvement in any symptoms. statistical analysis was performed using the chi - square test or fisher 's exact test. for the statistical significance, we divided the etiology into either known or unknown groups. an 83-year - old female patient became paraplegic due to adhesive arachnoiditis, on the 4th day after icg (type 4) without fever. there were 2 cases of subdural injection ; in one patient a ct cisternography (ctc) revealed delayed clearance of contrast media without ventricular reflex (type 2), in the other patient, vp shunt revision was performed based on the previous icg findings (type 4). type 4 was the most common type, observed in 92 patients (53%). type 3 was observed in 57 patients (33%), and type 1 and 2 were observed in 12 patients (7%) in each (table 1). type 4 was more common in patients with high (over 3.0) ei (p<0.05), or wide (over 10 mm) wtv (p<0.001). types of icg were not related to the causes of hydrocephalus, gender, or age of the patients. the rate of shunt surgery was 17% in type 1, 17% in type 2, 46% in type 3, and 71% in type 4. the methods of treatment were not related to the gender, wtv, or age of the patients. there was a tendency that patients with high ei underwent surgery more often, however, this difference was statistically not significant. after the shunt surgery, 23 patients (33.0%) were graded as the improved. although in more than a half of the not - improved patients, there were some improvements, such as improved eye opening, eye contact, or cognitive responses, they were unable to walk. preoperatively, the gos of the patients was md in 11 patients, sd in 83 patients, and even vegetative state in 3 patients. the improvement rate after shunt surgery was related to the preoperative state (table 3). although the improvement rate of type 4 was slightly higher than that of type 3, this difference was statistically not significant. many tests have been employed in the diagnosis of nph, such as icg, ctc, and mri with or without intrathecal enhancement. however, there is no test that can establish a definitive diagnosis or predict shunt response.2) ct or mri is superior to get cross - sectional images or higher spatial resolution.3) however, ctc did not provide additional diagnostic value for predicting the shunt response.15) although mri may provide useful data, it can not always be conclusive for diagnosis and treatment planning.123) furthermore, ct or mri is more expensive than icg. there are numerous dynamic test such as tap test,2132) csf outflow resistance measures,5) external lumbar drainage,21) and intracranial pressure recording.827) however, their efficacy and reliability is not fully established.20) there was one serious complication in 187 cisternograms (0.53%) in this series. although icg is generally considered to carry virtually no risk for the evaluation of nph,22) there were some reports,1420) including four cases of cms in 472 patients (0.85%) over the five - year period.25) cms may result from a direct spinal needle injury or neurotoxicity of the radioisotope around the conus medullaris, however, the cause and mechanism of this serious complication remains unclear.25) even though the safety of icg is questionable, it is still used as a key diagnostic investigation for intracranial hypotension or csf leakage.172630) serious complications brought legal suits in korea. a damage suit on the cms after icg (case number 99gahap72342) judged partial violation of liability for explanation in korea. in another suit (case number 2002gadan67479), the local court sentenced a partial financial responsibility of the hospital, despite of the fact that the occurrence of this exceptional complication is unpredictable. icg might become a reluctant diagnostic procedure, even though there was a sentence that there was no illegal act on the unpredictable arachnoiditis after icg (case number 2011da100138). hydrocephalus is not a single clinical entity but a pathophysiological complex with various aspects.24) nph may present a final common pathway for a number of different priming events.19) there may be an undiagnosed co - existing structural dementia, such as alzheimer 's disease or vascular dementia.1129) although there is an effort to make more contemporary classification schemes,24) there has been no consensus as to a more contemporary classification scheme, yet.28) abnormal csf dynamics are key elements of the hydrocephalus. icg is useful to study csf dynamics and can be a suitable diagnostic complement to help proper classification. type 4 was more common in patients with severe hydrocephalus ; i.e., high ei, or wide wtv. patient selection for the shunt surgery remains challenging.10) in some patients, shunting was performed based on the opinion that " they have nothing to lose,"6) although the chance of success was very low. the rate of shunting was not related to the gender, ei, wtv, or age of the patients. the success rate of the shunt surgery was 33% in this study. in nph, success rates of shunt vary from 33% to more than 90%.31) this wide range in outcome probably reflects variations in patient selection.10) another reason of relatively poor success rate was related to the evaluating tool, the gos. since the majority of the patients had gait disturbance, urinary incontinence, and memory impairment, preoperative gos of the patients was usually sd or worse. even though there were some improvements, such as increased eye opening, they still needed many helps in usual adl. the more sensitive scale may increase the improvement rate higher.18) although the gos is too crude to evaluate the outcome of the shunt surgery, it is rather practical to reveal the actual adl. significant improvement was reported as approximately 29% in a review.10) the improvement rate after shunt surgery was related to the preoperative state. early diagnosis of nph seems to be important by the fact that hydrocephalus is the second most common potentially reversible cause of dementia and lengthy delays to diagnosis are associated with an increased rate of treatment complications and even death.4) it has been estimated that only 10% to 20% of patients with nph get the appropriate specialized treatment.16) the early recognition of nph before requiring a help of someone else in adl may increase the improvement rate. although it may cause a serious complication, the incidence was quite low. to avoid complications, lumbar puncture should be placed at the lowest lumbar spinal level possible with calcium - containing diethylentriamene pentaacetate and administer no more than 1 mg.25) although icg could not accurately predict the shunt responders, it provided important information on the csf dynamics. icg may bring a serious complication, such as paraplegia, however the incidence is very low. although the predictability of response rate on the shunting is relatively low, icg is a cheap and useful tool for evaluation of the hydrocephalus. | objectivenormal pressure hydrocephalus (nph) is a syndrome characterized by gait disturbance, memory impairment and urinary incontinence. the isotope cisternography (icg) became less useful because of low accuracy and complications. we tried to evaluate the safety and value of the icg.methodswe retrospectively collected data on icg of 175 consecutive patients with a suspected hydrocephalus. we classified the icg into four types by the ventricular reflux and circulation time. the ventricular size was measured by evans index and the width of the third ventricle.resultsthere were three complications including one case of paraplegia. type 4 was the most common type, observed in 53%. type 3 (33%), type 2 (7%), and type 1 (7%) were observed less often. type 4 was more common in patients with large ventricles. types of the icg were not related to the causes of hydrocephalus, gender, or age of the patients. shunting was more frequently performed in type 4 (71%), compared to type 1 (17%), type 2 (33%), and type 3 (46%). surgery was more common when the cause was vascular. after the shunt surgery, 33.0% were graded as the improved. although there were some improvements even in the not - improved patients, they still needed many helps. the improvement was related to the preoperative state.conclusionicg may bring a serious complication, however the incidence is very low. although the predictability of response rate on the shunting is doubtful, icg is a cheap and useful tool to select surgical candidates in nph. |
a 1-year - old, female spayed, domestic shorthair, indoor cat on the island of st kitts was diagnosed with platynosomiasis, infection with a feline - specific liver fluke, and treated with praziquantel at the marketed dose for tapeworms (5 mg / kg ; actual calculated dose 5.75 mg / kg). serial fecal analyses showed that egg counts decreased to zero within 10 days of treatment but re - emerged at day 17 and persisted at low levels until a second treatment was administered on day 78. after the second treatment, all fecal samples (n = 15) from day 85 to day 350 post - initial treatment were negative for platynosomum ova. treatment of platynosomiasis is poorly documented ; no drugs are labeled for use against platynosomum and the efficacy of suggested treatments is unknown. using 5.75 mg / kg once, a dose that is significantly lower than published recommended doses for platynosomiasis, egg counts initially disappeared but re - emerged and persisted at low levels until a second treatment was administered. we hypothesize that immature forms may not have been killed and subsequently matured to produce eggs, or that the one - time dose may not have been completely effective at eliminating all adult flukes. however, administering praziquantel at 5.75 mg / kg twice, several weeks apart, appeared to be effective in treating this cat with platynosomiasis, as evidenced by monitoring of fecal egg counts over the course of 350 days. a female domestic shorthair indoor cat, estimated to be 1 year of age, presented to the ross university school of veterinary medicine (rusvm) veterinary clinic for a routine examination. the cat had been a stray 6 months previously and had been kept strictly indoors since then. ovariohysterectomy had been performed 5 months earlier, at which time feline leukemia virus and feline immunodeficiency test results were negative. four months prior to this examination (2 months after becoming an indoor cat), a short bout of diarrhea prompted a fecal flotation, which was positive for eucoleus species, psoroptic mites and mite eggs. the presence of mites and mite eggs were considered spurious, and no further investigations were made. while none of the fecal examination findings explained the diarrhea, oral fenbendazole (panacur 10% oral suspension ; intervet) was administered at 50 mg / kg bodyweight (bw) daily for 3 days and the diarrhea resolved until 2 weeks prior to this appointment, when another episode was noted and abated without treatment. the history of recent diarrhea prompted submission of a fecal sample. using a double centrifugation method (2 g feces ; sheather s sugar flotation solution), platynosomum species eggs were found and reported as number of eggs per gram of feces (epg) (table 1). client consent was obtained to perform a hemogram, chemistry profile and an abdominal ultrasound examination. abnormalities found on a chemical profile were slight elevations in alanine transaminase (alt ; 104 u / l ; normal range 20100) and total protein (8.5 g / dl ; normal range 5.48.2). ultrasonographic examination of the liver showed dilation of the entire bile duct system, an enlarged duodenal papilla (0.5 0.36 cm), and an enlarged gallbladder with slightly thickened and hyperechoic walls. the presence of an enlarged duodenal papilla without clinical or laboratory signs of obstruction or concurrent pancreatitis in conjunction with the history and fecal examination findings led to an ultrasonographic diagnosis of cholecystitis, most likely from a platynosomum infection. praziquantel was administered once orally at the label dose for tapeworms in cats (23 mg droncit for cats [bayer ] ; 5.75 mg / kg), and serial fecal and ultrasound examinations were performed to determine if this dose of praziquantel would have an effect on the infection (table 1). institutional animal care and use committee approval a formalin - ether technique has been described as the best method to detect eggs. however, owing to the prevalence of platynosomum species on st kitts, our diagnostic laboratory had previously determined that double centrifugation with sheather s sugar was a reliable and consistent method to detect platynosomum species, and this method was used for fecal analysis. platynosomum species ova increased on day 3 post - treatment but gradually decreased thereafter until ova were absent at day 10 post - treatment. however, low numbers of ova were detected on days 17, 57, 63 and 65 post - treatment, which prompted a second treatment with praziquantel (23 mg droncit for cats ; 5.75 mg / kg once orally) on day 78. one egg was detected on days 79 and 83 (days 1 and 4 post - second treatment) and subsequent fecal samples, up to day 350 post - initial treatment, were negative for platynosomum ova. over the initial 6 months of treatment, ultrasonographic findings remained largely unchanged : dilated bile ducts and a hyperechoic, thickened gallbladder wall persisted. the previously elevated alt (78 u / l) and total protein (8 g / dl) results were normal when re - checked on day 177 post - initial treatment. platynosomum fastosum (syn platynosomum concinnum) is a feline - specific liver fluke that resides in hepatic bile ducts and the gallbladder. it is commonly found in tropical and subtropical regions of the world (eg, southern usa, south america). platynosomum flukes use mollusks or terrestrial isopods as intermediate hosts, lizards as paratenic hosts and cats as the final host. once a cat ingests a host with metacercariae, infective stages of the fluke migrate to the common bile duct and into the gallbladder and smaller bile ducts where they mature into adult flukes (2 16 mm, depending on maturity) within 812 weeks. embryonated eggs are passed in bile into the alimentary system and can be detected in the feces as early as 8 weeks after infection. lizard poisoning syndrome, which is characterized by diarrhea, vomiting, anorexia and icterus, and can result in death. historically, this cat had two episodes of diarrhea but lacked other clinical signs. a previous report on the ultrasonographic findings in cats infected by platynosomum species described hepatomegaly, tortuous bile ducts, echogenic gallbladder walls and accentuated distension of the gallbladder. with the exception of hepatomegaly, to our knowledge, no one has investigated how ultrasound results may change following treatment for platynosomum. numerous histopathological reports describe periductal fibrosis in platynosomum cases ; fibrosis would imply that ultrasound improvement may not occur with treatment. ultrasound changes did not improve in this case over the course of a year, yet the cat did not develop any clinical signs of cholestatic disease. we assume that the persistent ultrasound changes were due to chronic damage to the biliary system associated with bile duct fibrosis following sexual maturation of the flukes. treatment of platynosomiasis is poorly documented ; no drugs are labeled for use against platynosomum and the efficacy of suggested treatments is unknown. based on the extensive number of studies conducted with another liver fluke, fasciola hepatica, evaluation of treatment efficacy can be difficult in the live animal. serial fecal examinations are often used because of intermittent excretion of a low numbers of eggs. because eggs can be found in feces for several weeks after adult fluke death, treatment efficacy based on epg however, if the product is not effective against early or late immature adults, positive fecal results > 3 weeks post - treatment are less indicative of efficacy against adult flukes and more related to immature flukes reaching full maturity and producing eggs. while it is unclear if a similar situation occurs with platynosomum infections, the re - emergence of eggs post - treatment in a prior study and in this case report are evidence that it could occur. currently, most treatments for platynosomum infections are based upon a 1978 study in which praziquantel (20 mg / kg bw) was administered to five cats. negative fecal egg counts were achieved by 2 weeks post - treatment but thereafter positive fecal egg counts were found at irregular intervals. other recommended doses of praziquantel have varied from 5 mg / kg q12h for 3 days to 20 mg / kg bw orally for 3 days. in this case study, praziquantel, at the marketed dose for tapeworms (5 mg / kg), was used. the results suggest that this dose could be effective, as evidenced by steadily decreasing fecal egg counts that dropped to zero within 10 days of treatment. the increase in epg on day 3 post - initial treatment could have been due to natural fluctuation of egg shedding or an increase in egg release by dying adult flukes. the reappearance of eggs 17 days post - initial treatment is similar to the data presented by evans and green, where a higher dose (20 mg / kg) of praziquantel was used. several explanations can be suggested for the reappearance of eggs on days 57, 63 and 65 post - initial treatment. first, the dose of 5 mg / kg praziquantel may have killed the adult flukes but may not have affected immature forms, which subsequently matured and started to produce eggs in low numbers. praziquantel, depending on the fluke species and host animal, has limited efficacy against immature flukes. second, the cat could have continued to ingest infected lizards that are commonly found inside homes on st kitts. indoor - only cats have previously been found, via fecal examinations, to be positive for platynosomum species (ketzis and shell, unpublished data). upon their subsequent recovery, egg production might have recommenced. if this was the case, it is difficult to evaluate the exact efficacy of the single treatment of praziquantel, as the direct relation of epg to adult platynosomum has not been well documented. a second treatment of praziquantel at 5 mg / kg was administered on day 78, and 6 days after this no further eggs were found on numerous fecal examinations over the next 3 months. in addition, follow - up fecal examinations at 6, 10 and 12 months post - diagnosis showed no platynosomum eggs and the cat has remained asymptomatic. based upon repeat ultrasound evaluations, which showed no worsening of the initial changes, multiple repeat fecal examinations that were negative for platynosomum eggs after the second praziquantel treatment, and the absence of any clinical and laboratory signs of cholestasis, we propose that 5 mg / kg praziquantel administered twice several weeks apart may be effective in eliminating platynosomum. while any use of praziquantel to treat platynosomum is off label, this treatment has the advantage that the dose (5 mg / kg) is within the recommended dose range for praziquantel. the length between two treatments is unclear without controlled studies ; however, we suggest an interval of 34 weeks. | case summarya 1-year - old, female spayed, domestic shorthair, indoor cat on the island of st kitts was diagnosed with platynosomiasis, infection with a feline - specific liver fluke, and treated with praziquantel at the marketed dose for tapeworms (5 mg / kg ; actual calculated dose 5.75 mg / kg). serial fecal analyses showed that egg counts decreased to zero within 10 days of treatment but re - emerged at day 17 and persisted at low levels until a second treatment was administered on day 78. after the second treatment, all fecal samples (n = 15) from day 85 to day 350 post - initial treatment were negative for platynosomum ova.relevance and novel informationtreatment of platynosomiasis is poorly documented ; no drugs are labeled for use against platynosomum and the efficacy of suggested treatments is unknown. using 5.75 mg / kg once, a dose that is significantly lower than published recommended doses for platynosomiasis, egg counts initially disappeared but re - emerged and persisted at low levels until a second treatment was administered. we hypothesize that immature forms may not have been killed and subsequently matured to produce eggs, or that the one - time dose may not have been completely effective at eliminating all adult flukes. however, administering praziquantel at 5.75 mg / kg twice, several weeks apart, appeared to be effective in treating this cat with platynosomiasis, as evidenced by monitoring of fecal egg counts over the course of 350 days. |
to achieve the imaging speed and localization precision required to fully characterize the transient mobilities of membrane constituents, we optimized interferometric scattering microscopy for high - speed imaging. the apparatus used here for high - speed iscat imaging is remarkably simple : a linearly polarized illumination beam passes through a polarizing beamsplitter and a quarter waveplate before entering a microscope objective. light scattered by the sample interferes with the weak reflection at the membrane water interface, and this light is collected by the same objective before being imaged onto a cmos camera (figure 1a). in previous applications of iscat, imaging speeds of up to 1 khz were achieved by scanning the incident light over a large sample area (tens of m) using acousto - optic deflectors. here, by simply underfilling the objective to create a field of view of a few m, we are able to record trajectories containing tens of thousands of data points with a 50-fold increase in temporal resolution. in this experimental arrangement, 20 nm aunps appear as a clear drop of 9% in the reflected beam intensity relative to that of the incident light (figure 1b). pbs, polarizing beamsplitter ; qwp, quarter waveplate ; o, oil - immersion microscope objective with a numerical aperture of 1.42. (b) representative interferometric scattering image of a single 20 nm gold nanoparticle after subtraction of a median background. (c) time traces of the positions of two immobilized 20 nm gold nanoparticles acquired with 10 s exposure time at 50 khz frame rate (black and red, upper panel). subtracting these two traces removes the nanometer motion due to vibrations and drift to yield the true localization error of the measurement (blue, lower panel). (d) histogram of the interparticle distance from the time traces in c (n = 5 10). the single - particle localization precision equates to /2 = 1.9 nm, where is the full width at half - maximum. in contrast to fluorescence imaging, where the localization precision scales with the number of photons detected from the emitter, the precision of iscat is governed by the ratio of the shot - noise - induced fluctuations in the background light intensity to the size of the iscat signal and can be tuned by adjusting the incident power and magnification of the imaging system. to avoid difficulties arising from nonstandard point spread functions common to interferometric imaging techniques with coherent light sources, we determined the localization precision by recording the relative motion of two 20 nm particles immobilized on a cover glass (figure 1c). assuming that the particles are completely immobile, the fluctuations in the interparticle distance return a single - particle localization precision of 1.9 nm at an exposure time of only 10 s with heating of the particle surface of less than 1.5 k at the incident power density used. while state - of - the - art fluorescence microscopy can also achieve 1 nm precision, this comes at the expense of acquisition speed due to the limited achievable photon flux. likewise, dark - field microscopy has been used to track light scattered from gold nanoparticle labels at 40 khz frame rate (25 s exposure time), although with a localization precision of only 17 nm. thus, iscat achieves an unprecedented combination of localization precision and speed with nanoscopic probes. we first examined the diffusion of 20 nm aunp / ctxb bound to gm1 in a slb made from dopc doped with 0.03 mol % gm1 on a plasma - cleaned glass substrate. streptavidin linker, and we estimate that a 20 nm aunp has approximately 25 bound ctxb. although a 20 nm aunp is much larger (50 mda) than the single - molecule fluorescent probes more typically used in tracking measurements, such as gfp (27 kda), its size does not significantly affect receptor diffusion as the viscous forces of the membrane dominate the movement of the aunp / ctxb complex. smaller nanoparticle labels on the order of 10 nm or below could also be imaged and tracked, although in this case we used larger particles to ensure confident differentiation from residual vesicles that are sometimes encountered on the bilayer surface. tracking the aunp at 50 khz with 10 s exposure time, we acquired trajectories that reveal circular nanoscopic regions of confinement, suggesting anomalous behavior (figure 2a). to examine the time dependence of particle mobility quantitatively, we calculated the mean - square displacement (msd) as a function of the time interval. using the relationship msd t, we can classify the motion of the particle based on the value of the anomalous diffusion coefficient, with = 1 indicating brownian diffusion and 1 suggesting anomalous diffusion. a logarithmic plot of the diffusion coefficient versus time has the slope (1) and thus provides a convenient representation of the nature of the motion : a slope of zero indicates brownian diffusion, while negative and positive slopes represent sub- and superdiffusion, respectively. according to this analysis, ctxb bound to gm1 in a slb formed on plasma - cleaned glass exhibits subdiffusive lateral motion on the 20 s to 10 ms time scale and brownian diffusion at longer times (figure 2a). in contrast to previous reports where such data showing the transition from anomalous to brownian diffusion had to be generated from separate measurements at different acquisition speeds, these plots were constructed from single events using a maximum time lag equal to 20% of the trajectory length, thus spanning almost 5 orders of magnitude in time. the circle markers show the mean time - dependent diffusion coefficient of 35 trajectories, while the red lines indicate the range of observed behaviors (one standard deviation). this diffusion analysis demonstrates that ctxb - bound gm1 diffusion is confined on short (100 s (figure 3a). for delays 100 s as well. upon examination of individual trajectories for do - gm1 on glass, we found only extremely rare and short - lived binding events that under a macroscopic diffusion analysis were representative of brownian motion (figure 3b). this switch from anomalous to brownian diffusion was observed although the interaction between the headgroup and the plasma - cleaned glass substrate remained unchanged from the nt - gm1 measurements. the comparison of nt - gm1 and do - gm1 on plasma - cleaned glass demonstrates that surface roughness is unlikely to be the cause of anomalous diffusion, which is further supported by afm measurements of the plasma - treated glass surface that show the rms roughness to be only 0.6 nm. brownian motion of gm1 in supported lipid bilayers on mica substrates and with modified lipid tail groups. sample trajectories and time - dependent mobilities of (a) 40 nm aunp / ctxb / nt - gm1 on mica and (b) 40 nm aunp / ctxb / do - gm1 on glass. the change in lipid tail structure upon modification of nt - gm1 is indicated by the molecular structures. total number of data points used for constructing log log plots : (a) 3.1 10, (b) 1.07 10. we next examined the dependence of confinement on gm1 concentration by determining the fraction of time the particle was confined relative to the total length of each trajectory. for nt - gm1 on plasma - treated glass, the mean confined fraction for all gm1 concentrations measured (0.031 mol %) was 0.72 0.03 with zero representing no confinement and one completely immobilized (figure 4a). ctxb was considered to be confined when the label traveled less than 50 nm in 10 ms, as inferred from d = 1 m / s of free diffusion, that is, an average travel of 200 nm in 10 ms. in contrast, all control experiments exhibited negligible confinement events and zero slope at t > 100 s in the corresponding log log plots of diffusion coefficient versus time. the control experiments included the following : tracking biotinylated 1,2-dihexadecanoyl - sn - glycero-3-phosphoethanolamine (dppe) in dopc bilayers with streptavidin - functionalized aunps on plasma - cleaned glass substrates in the absence and presence of nt - gm1 (1.0% dppe, 1.0% gm1) ; do - gm1/ctxb at various receptor concentrations on plasma - cleaned glass (0.03 and 1% do - gm1) ; and nt - gm1/ctxb on freshly cleaved mica (0.03% gm1) (figure 4a). from this we follow that interleaflet coupling between gm1 in the lower and upper leaflets, combined with membrane substrate interactions, is the reason for transient molecular confinement and thus anomalous diffusion. as mentioned, the hydroxyl - containing headgroups of gm1 lipids in the lower leaflet couple efficiently with hydroxyl groups on the plasma - cleaned surface. while dppe has saturated chains that could potentially lead to interleaflet interactions, its headgroup does not contain hydroxyl groups for direct substrate interaction. do - gm1 can interact with the substrate through its hydroxyl - containing headgroup, but its unsaturated tails do not exhibit strong interleaflet coupling. nt - gm1 has saturated tails and a hydroxyl - containing headgroup but can not interact directly with the chemically inert mica surface. on the basis of the weak dependence of confinement on gm1 concentration, we conclude that although both substrate interactions and interleaflet coupling are required for anomalous diffusion, the number of confinement events is essentially independent of gm1 concentration and likely determined by the density of hydroxyl pinning sites on the surface. this conclusion is further supported by experiments showing that transient binding of nt - gm1-bound ctxb can be induced on mica by plasma cleaning the surface (figure 4a, pc - mica), indeed suggesting that surface functionalization plays a critical role. (a) confined fraction for different nt - gm1 concentrations in dopc slbs on glass, synthetically modified gm1 (do - gm1) on glass, dppe with a biotin / streptavidin linker in the presence of nt - gm1 on glass, and nt - gm1 on freshly cleaved and plasma - cleaned mica. the minimum usable concentration (0.03%) was defined as the lowest where specific binding of ctxb - labeled nanoparticles was still observed. (b) gaussian - like (upper panel) and ring - like (lower panel) spatial distributions of confinement events at 0.03% gm1 on glass obtained by averaging 228 and 93 confinement events, respectively. for classification, each confinement site was fit to a rayleigh distribution and the coefficient of determination, r, was calculated. all confinement events with r > 0.95 as the sites with low r values contain both ring - like confinement events and other non - gaussian shapes, the ring - like sites were selected by thresholding the standard deviation of distances from the confinement center of mass over the overall confinement to be smaller than 0.45. the optimum ratio was determined visually by inspecting the resulting averaged spatial distributions. (c) individual ring - like confinement events exhibiting 35 distinct binding sites. the black lines represent trajectories after averaging 25 consecutive frames, equivalent to 0.5 ms time averaging, and help visualize the stepping motion between gm1 receptor sites. (d, e) radial probability density plots and corresponding fits to a rayleigh distribution for all confinement events recorded at 0.03% and 1.0% nt - gm1 concentrations. the distribution histograms were computed from 2 10 data points in each case. (f) residuals from the fits of d and e as well as similar plots for 0.1 and 0.3% nt - gm1 concentration. (g) change in the fwhm of gaussian - like events as a function of nt - gm1 concentration. error bars are the standard deviation of the mean confinement size. to examine the transient immobilization events in more detail we superimposed all confinement events for 0.03% gm1 on plasma - cleaned glass. we identified two different populations consisting of gaussian - like and ring - like spatial distributions (figure 4b) with confinement sizes 0.95) (figure 4d, e). upon increasing the receptor concentration 30-fold, however, the immediate presence of gm1 becomes more likely and transient binding to individual receptors occurs more often. as a consequence, the deviation between the radial probability density histogram and the rayleigh fit increases with gm1 concentration. even for gaussian - like confinement events, an increase in nearby gm1 concentration should lead to an increase in the apparent confined area because nanoscopic rocking will result in the particle on average spending more time near the membrane surface due to transient binding with additional gm1 (figure 4 g), even if it does not lead to cross - linking and long - term multiple binding. the tight lateral confinement on the < 20 nm scale and the observation of ring - like confinement events are both consistent with transient immobilization of a single membrane - bound ctxb subunit on the nanometer scale. given that transient binding requires both native gm1 lipid tail domains and a plasma - cleaned substrate as evidenced by the studies on mica and with do - gm1, we propose that the most likely origin is clustering of gm1 on the lower leaflet by hydrogen bonding to nanoscopic patches of surface hydroxyl groups from the plasma cleaning process. although in principle one could envision that a single pinned gm1 molecule is responsible for immobilization of five ctxb - bound gm1 molecules in the upper leaflet, such a prospect appears energetically unlikely. we conclude that the lower leaflet is likely scattered with numerous < 10 nm patches of high gm1 density with higher viscosity that communicate with the upper leaflet through transbilayer interactions, leading to transient (< 10 ms) nanoscopic confinement. this interpretation is further supported by the weak dependence of the observed confinement events on label size. both 20 and 40 nm labels produce similarly sized confinement events in line with expectations based on the schematic in figure 5b, a consequence largely of the ratio between the radius of curvature and the separation between adjacent ctxb subunits. the proposal of nanoscopic aggregates of gm1 on plasma - cleaned glass also agrees with afm measurements of comparable assays, although these do not provide direct information regarding whether the aggregation occurs in the lower or upper leaflet of the bilayer. our general mechanism agrees with early observations of interleaflet coupling, although these required the presence of macroscopic domains. taken together, our work suggests that transient binding can occur for nanoscopic domains and change the mobility of single proteins bound to multiple receptors across a bilayer membrane. the compounds 1,2-dioleoyl - sn - glycero-3-phosphocholine (dopc), 1,2-dihexadecanoyl - sn - glycero-3-phosphoethanolamine - n-(cap biotinyl) (dppe), and gm1 bovine brain ganglioside (gm1) were purchased from avanti polar lipids (alabaster, al). do - gm1 was prepared as described before. biotin - labeled cholera toxin b (ctxb) subunits from vibrio cholera were purchased from sigma - aldrich (milwaukee, wi) and reconstituted with water to give a solution containing 0.05 m tris buffer, ph 7.5, 0.2 m nacl, 3 mm nan3, and 1 mm sodium edta. gold nanoparticles (aunps) functionalized with streptavidin were purchased from british biocell international (cardiff, u.k.), diluted to a concentration of 9 10 particles / ml and incubated with a 10-fold excess of biotin - ctxb at room temperature for 1 h. excess ctxb was removed by centrifuging the aunp / ctxb sample for 2 min at 14000 g and resuspending the pellet in bilayer buffer (10 mm hepes, ph 6.8, 200 mm nacl and 2 mm cacl2). on the basis of a streptavidin contact area of 25 nm, and assuming that streptavidin covers 50% of the surface area of an aunp, we estimate that there are 25 ctxb per 20 nm aunp and 100 ctxb per 40 nm aunp. for dppe tracking experiments, streptavidin - functionalized aunps were added directly to the bilayer. lipids in organic solvent were mixed in a glass vial and the solvent evaporated first under a gentle stream of nitrogen for 5 min and then under vacuum for 30 min. the dried lipid film was resuspended to a lipid concentration of 1 mg / ml in bilayer buffer. lipid suspensions were vortexed for 1 min, hydrated at room temperature for 30 min and then passed 21 times through a 100 nm polycarbonate membrane using a mini extruder (avanti polar lipids), resulting in clear suspensions of suvs. 1.5 borosilicate cover glass (menzel - glser, braunschweig, germany) was etched in 2:1 h2o2:hcl for 10 min, followed by thorough rinsing with ultrapure water (merck millipore, billerica, ma). the clean substrates were dried with a gentle stream of nitrogen and etched with oxygen plasma for 8 min at 50 w power immediately prior to vesicle deposition (diener electronic, plasma system femto). mica substrates were prepared by bonding a 22 mm square sheet of mica (agar scientific, essex, u.k.) to a clean cover glass using optical adhesive (norland optical adhesive 61). immediately prior to vesicle deposition, the mica was cleaved leaving a thin, optically transparent layer adhered to the cover glass. sample chambers were assembled by placing a culturewell silicon gasket (grace bio - laboratories, bend, or) onto the glass or mica substrate. slbs were formed by adding 20 l bilayer buffer followed by 10 l of the 1 mg / ml suv suspension to the 30 l sample well and incubating for 5 min. excess suvs were rinsed away with 3 ml bilayer buffer and then 2.5 l of aunp / ctxb or aunp / streptavidin solution was deposited and allowed to incubate for 5 min. a collimated beam from a solid - state diode laser (= 532 nm) was focused through an under - filled 60, 1.42 na oil immersion microscope objective (olympus) onto a small region of the sample. a portion of the light scattered from the aunp together with the incident light reflected at the membrane / water interface was collected by the objective and focused onto a fast cmos camera (photon focus mv - d1024 - 160-cl-8, lachen, switzerland) for imaging with 100 magnification for an effective pixel size of 106 nm. the incident power density was between 20 and 30 kw / cm, which corresponds to focusing approximately 3 mw onto a 2 2 m spot size at the sample. for a 20 nm aunp, this incident intensity at a wavelength of 532 nm leads to a local heating effect that amounts to a < 1.5 k rise in temperature at the particle surface. we remark that any trapping forces exerted by this beam are on the order of few femtonewtons, much too small to affect the diffusion on the length scales studied in this work. for all trajectories, the two - dimensional msd for each time interval was calculated according towhere t = 20 s (frame time), is the particle displacement during time interval tn = nt, n is the total number of frames in the trajectory, and n is a positive integer that determines the time interval. the log log plots of the diffusion coefficient versus time (figures 2, 3) were generated using intervals up to 20% of the trajectory length. particle detection was performed by combining the nonmaximum suppression algorithm with a threshold based on the median absolute deviation. briefly, the standard deviation of the image in the absence of particles was estimated by the median absolute deviation. pixel values exceeding three times this standard deviation were classified as candidate pixels for particles. the candidate pixels from the median absolute deviation threshold were intersected with the candidate pixels from the nonmaximum suppression algorithm to obtain to the nearest integer pixel value the position of any candidate particle. candidate particles were then segmented into regions of interest corresponding to 954 954 nm, which for a magnification of 100 corresponded to 9 9 pixels (effective pixel size of 106 nm). a two - dimensional gaussian function was then fit to each segmented region and candidate particles satisfying the contrast upper and lower bounds were used as input parameters for the consecutive frame. particle trajectories were reconstructed using a greedy algorithm that minimized the distance between detected particle positions in consecutive frames. given the density of less than one aunp / ctxb complex per square micrometer, any artifacts arising due to this greedy algorithm were minimized. | the biological functions of the cell membrane are influenced by the mobility of its constituents, which are thought to be strongly affected by nanoscale structure and organization. interactions with the actin cytoskeleton have been proposed as a potential mechanism with the control of mobility imparted through transmembrane pickets or gpi - anchored lipid nanodomains. this hypothesis is based on observations of molecular mobility using various methods, although many of these lack the spatiotemporal resolution required to fully capture all the details of the interaction dynamics. in addition, the validity of certain experimental approaches, particularly single - particle tracking, has been questioned due to a number of potential experimental artifacts. here, we use interferometric scattering microscopy to track molecules labeled with 2040 nm scattering gold beads with simultaneous < 2 nm spatial and 20 s temporal precision to investigate the existence and mechanistic origin of anomalous diffusion in bilayer membranes. we use supported lipid bilayers as a model system and demonstrate that the label does not influence time - dependent diffusion in the small particle limit (40 nm). by tracking the motion of the ganglioside lipid gm1 bound to the cholera toxin b subunit for different substrates and lipid tail properties, we show that molecular pinning and interleaflet coupling between lipid tail domains on a nanoscopic scale suffice to induce transient immobilization and thereby anomalous subdiffusion on the millisecond time scale. |
preeclampsia is a pregnancy - related hypertensive disorder occurring usually after 20 weeks of gestation. preeclampsia and eclampsia are not distinct disorders but the manifestation of the spectrum of clinical symptoms of the same condition. hypertension and proteinuria are present, and when convulsions occur in addition to these signs, the condition is referred to as eclampsia. preeclampsia has remained a significant public health threat in both developed and developing countries contributing to maternal and perinatal morbidity and mortality globally [36 ]. however, the impact of the disease is felt more severely in developing countries [7, 8 ], where, unlike other more prevalent causes of maternal mortality (such as haemorrhage and sepsis), medical interventions may be ineffective due to late presentation of cases [911 ]. the problem is confounded by the continued mystery of the aetiology and the unpredictable nature of the disease. thus, the aim of this paper is to highlight the challenges militating against effective control of preeclampsia in developing countries and suggest measures which could be used to address them within the local context. literature providing evidence on the diagnosis, prevention, treatment, and overcoming challenges to the control of preeclampsia published between 2000 and 2010 were reviewed. preeclampsia, eclampsia, developing countries, and control. these literatures were accessed from pubmed (medline), ajol, google scholar, and cochrane database of systematic reviews. searches were also supplemented with recommendations from outside experts and reviews of bibliographies of other relevant articles and systematic reviews. the incidence of preeclampsia, the precursor to eclampsia, varies greatly worldwide. who estimates the incidence of preeclampsia to be seven times higher in developing countries (2.8% of live births) than in developed countries (0.4%). the incidence of eclampsia in the developed countries of north america and europe is similar and estimated to be about 57 cases per 10,000 deliveries. on the other hand, incidence of eclampsia in developing nations varies widely, ranging from 1 case per 100 pregnancies to 1 case per 1700 pregnancies [2, 14 ]. rates from african countries such as south africa, egypt, tanzania, and ethiopia vary from 1.8% to 7.1% [1518 ]. in nigeria prevention of any disease process requires the availability of methods for prediction of those at high risk for the disorder. although numerous clinical and biochemical tests have been proposed for prediction or early detection of preeclampsia, most remain unrealistic for general use in most developing countries. at present, there is not a single reliable and cost - effective screening test for preeclampsia which can be recommended for use in most developing countries. although some studies on uterine artery doppler studies and first - trimester maternal serum markers for early detection of preeclampsia have shown promise [2325 ]. there is not enough evidence to suggest their routine use in clinical practice, more so in resource poor settings. in terms of prophylaxis, aspirin therapy has been shown to be beneficial in decreasing the occurrence of preeclampsia in specific populations, for example, those with abnormal second trimester uterine doppler flow [2730 ]. however, to recommend its widespread use in all patients is not judicious or evidence based. in the same vein, even though the cochrane review has stated some benefit in calcium supplementation, particularly for those at greatest risk and those with low baseline calcium intake [31, 32 ], the problem of selecting appropriate patients to be started on the therapy can be burdensome from a public health perspective. similarly, findings of earlier studies which had indicated the benefits of vitamin supplementation [3339 ] have been refuted by a recent study by the who particularly for vitamins c and e. it is evident that to tackle preeclampsia effectively in any population, functional health systems are imperative and so is access to health care. however, in the vast majority of developing countries particularly in africa, health care access is limited due to a number of factors resulting in three levels of delay. delay in the decision to seek caredelayed responses at the household level to obstetric emergencies often arise as a result of inadequate information on when to seek help and sometimes on where to seek help [4143 ]. this is worsened by lack of decision - making power, poverty, and the rising cost of health care [44, 45 ]. the consideration of user fees and the resultant catastrophic expenditure often result in fatal delays in care seeking. some sociodemographic (e.g., level of education and marital status) and cultural underpinnings of maternal health - seeking behaviour have also been documented. delayed responses at the household level to obstetric emergencies often arise as a result of inadequate information on when to seek help and sometimes on where to seek help [4143 ]. this is worsened by lack of decision - making power, poverty, and the rising cost of health care [44, 45 ]. the consideration of user fees and the resultant catastrophic expenditure often result in fatal delays in care seeking. some sociodemographic (e.g., level of education and marital status) and cultural underpinnings of maternal health - seeking behaviour have also been documented. delay in reaching the health facilitylack of access to quality care has been said to be the main obstacle to reducing maternal mortality in low - income countries. these are due to the location, distance, and lack of transport to health facilities. in nigeria, for example, up to 50% of rural women live more than 5 km from the nearest hospital, and many have no way to get to health facilities except by walking even when in labour. the inequitable distribution of health facilities which is in favour of urban communities is also contributory. furthermore, the referral delays arising from the trajectory of visits to other orthodox and alternative medical practitioners have been documented to account for 46.4% of all cases of eclampsia [49, 50 ]. lack of access to quality care has been said to be the main obstacle to reducing maternal mortality in low - income countries. these are due to the location, distance, and lack of transport to health facilities. in nigeria, for example, up to 50% of rural women live more than 5 km from the nearest hospital, and many have no way to get to health facilities except by walking even when in labour. the inequitable distribution of health facilities which is in favour of urban communities is also contributory. furthermore, the referral delays arising from the trajectory of visits to other orthodox and alternative medical practitioners have been documented to account for 46.4% of all cases of eclampsia [49, 50 ]. delays in health service provisiondelays which arise in health facilities have also been shown to prevent women from receiving the care they need before, during, and after childbirth. for instance, in many countries where the health insurance scheme is still in the teething stage, getting care in emergencies may be impossible for the poor or insured. the attitudes of health service providers and perceived poor quality of care are also identified barriers [4, 52 ]. this is made worse by the lack of trained personnel and lack of equipment and supplies. for instance, even though the efficacy of magnesium sulphate has been documented by several researchers [21, 53 ], studies have shown that magnesium sulphate was not routinely administered [41, 54 ], and use is often limited to teaching hospitals. lack of availability of the drug and appropriate health personnel required for its administration as well as cost were the frequently raised obstacles. delays which arise in health facilities have also been shown to prevent women from receiving the care they need before, during, and after childbirth. for instance, in many countries where the health insurance scheme is still in the teething stage, getting care in emergencies may be impossible for the poor or insured. the attitudes of health service providers and perceived poor quality of care are also identified barriers [4, 52 ]. this is made worse by the lack of trained personnel and lack of equipment and supplies. for instance, even though the efficacy of magnesium sulphate has been documented by several researchers [21, 53 ], studies have shown that magnesium sulphate was not routinely administered [41, 54 ], and use is often limited to teaching hospitals. lack of availability of the drug and appropriate health personnel required for its administration as well as cost were the frequently raised obstacles. at macro- and microhealth system levels, there are deficient policy guidelines and implementation. for example, reliable statistics about women dying due to eclampsia are difficult to obtain because of the poor quality of vital statistics registration systems and hospital records in many developing countries. in addition, a sizable number of deliveries take place at home, and thus, there are no records at all for these births or their sequelae. in addition, health policy development is usually not evidence based. this is because policy makers are often poorly informed of, and insufficiently involved in the use of research in policy development. the who focused antenatal care strategy recommends screening for preeclampsia during the third antenatal visit at 32 weeks. in developing countries, strategies for risk assessment pregnant women should be assessed at their first antenatal clinic for risk factors of preeclampsia such as young age, nulliparity, first pregnancy after age of 35 years, obesity prior to the current pregnancy, multiple gestation, prior history of preeclampsia, diabetes mellitus, and hypertension [1, 6062 ]. it is, however, important to note that the presence of these factors is not a surety to developing preeclampsia. it has been shown that screening for preeclampsia using maternal history was accurate in only 45.3% of cases. routine screening for preeclampsia based on measurement of blood pressure among all pregnant women should be practised as recommended by the world health organization [64, 65 ]. where resources are available it is best to measure blood pressure using a mercury sphygmomanometer. urinalysis for protein should also be routinely done at every antenatal visit for pregnant women in developing countries as a complement to routine blood pressure measurement. the diagnostic criteria for preeclampsia developed by the national blood pressure education program working group which are still traditionally used in clinical practice are systolic blood pressure of 140 mm hg or higher or a diastolic blood pressure of 90 mm hg or higher on at least two occasions at least 46 hours apart occurring after 20 weeks of gestation in a woman whose blood pressure had previously been normal. in addition to this, the presence of proteinuria with excretion of 0.3 g or more of protein in a 24-hour urine specimen or 1 + or greater on two random urine samples collected four or more hours apart [67, 68 ]. once recognised, depending on the severity, options of care include continued foetal and maternal evaluation, antihypertensive therapy, and timely delivery (the only definitive cure). there is significant evidence which supports the use of magnesium sulphate to prevent seizures in women with severe preeclampsia and eclampsia [1, 67, 69 ]. magnesium sulphate has been compared with diazepam, phenytoin, and lytic cocktail in randomized trials and results revealed that it produced a greater reduction in the risk of maternal death and recurrence of convulsions than other agents. furthermore, a continuum of care must be ensured. for women to benefit from the existing cost - effective interventions, they must have antenatal care in pregnancy, skilled care during delivery and postnatal care. while antenatal care and skilled delivery could prevent seizures, postnatal visits are important to assess the recovery of the woman and to discuss what might happen in the future. so, raising awareness of the need for women to reach emergency care without delay if complications arise during delivery is particularly critical. this is to ensure quick and effective medical intervention and to increase the chance of therapeutic success [1, 44 ]. since many women deliver alone or with a relative, community members must also be trained to recognize danger signs and develop plans for emergencies, including transport to hospitals or health centre. prompt health seeking behaviour is essential because reduction of the risk of death becomes more difficult when complications have developed. the majority of intrapartum maternal deaths have been shown to occur in poorly performing health systems. the evidence provided by some developing countries who have shown remarkable reduction in maternal mortality [75, 77, 78 ] shows that maternal safety must be made a priority health issue by the government and health workers. an increased focus on quality and accountability is also needed to secure the trust of consumers. political commitment to mobilize necessary resources to the health sector to improve the quality of emergency obstetric service must be shown by ensuring the availability of trained personnel, drugs, and equipment at every level of care. referral services to emergency obstetric care must be prompt and affordable to limit delays when skills or facilities are lacking. improvements in service delivery can be achieved through the use of case management protocols for obstetric emergencies at each level of care and by monitoring standards of practice. magnesium sulphate should be part of every developing country 's list of essential drugs and national protocols on magnesium sulphate as the preferred treatment for preeclampsia and eclampsia should be developed and/or reinforced. to improve maternal health, barriers to accessing health services must be identified and addressed at all levels, with intensified efforts at community mobilization and engagement. the use of data to improve quality of care is also important especially improving reporting systems and record - keeping practices to estimate disease burden to aid service planning and delivery. maternal death audits would aid the understanding of the pathways to survival and death and help in local efforts at improvement. it would also aid in identifying substandard care and avoidable factors in eclampsia - related maternal deaths [56, 82 ]. with the target of the millennium development goals in sight, preeclampsia / eclampsia needs to be identified as a priority area in reducing maternal mortality in developing countries. since the mainstay of control remains health care based strategies, national governments and supporting agencies should channel efforts at strengthening the public health systems and improving access to trained health care providers. further research is needed to understand the causes and the best preventive strategies for preeclampsia specific to geographic areas. however, based on current data, better access to appropriate obstetric care, particularly during labour and delivery and better screening and treatment of identified cases should reduce preeclampsia rates in developing countries. | objectives. review of public health perspectives of preeclampsia in developing countries and implications for health system strengthening. methods. literature from pubmed (medline), ajol, google scholar, and cochrane database were reviewed. results. the prevalence of preeclampsia in developing countries ranges from 1.8% to 16.7%. many challenges exist in the prediction, prevention, and management of preeclampsia. promising prophylactic measures like low - dose aspirin and calcium supplementation need further evidence before recommendation for use in developing countries. treatment remains prenatal care, timely diagnosis, proper management, and timely delivery. prevailing household, community, and health system factors limiting effective control of preeclampsia in these countries were identified, and strategies to strengthen health systems were highlighted. conclusion. overcoming the prevailing challenges in the control of preeclampsia in developing countries hinges on the ability of health care systems to identify and manage women at high risk. |
x (re = rare - earth metal, t = transition metal, x = b, si, al, ga, ge, sn) systems. these compounds are extremely diverse in their structural and physical properties. among them are the following : (i) phases that form by stacking of binary cacu5-type fragments and slabs of laves phases with mgzn2 and mgcu2 type (and/or their ternary ordered derivatives) and play an important role for improvement of technological characteristics of re ni - based negative electrode material in ni metal hydride batteries ; (ii) compounds that can yield magnets appropriate for high - temperature application, namely, reco7 of tbcu7 type, where part of the atoms in the ca site of the cacu5 structure are substituted by the dumbbells of the transition metal and the third element like ti, zr, hf, cu, ga, si, and ag is required to stabilize the structure and increase the magnetoanisotropy ; (iii) magnetic materials re2co17 revealing the intergrown cacu5- and zr4al3-type slabs structures where the interstitial sites can be occupied by elements of iiia, iva, or via groups, thus leading to the increase in curie temperature, uniaxial anisotropy, and spontaneous magnetization. the small atomic radius of boron imposes replacement of the cu atom at the wyckoff position 2c in the cacu5 structure (space group p6/mmm ; ca in 1a (0,0,0), cu1 in 2c (1/3,2/3,0), cu2 in 3 g (1/2,0, 1/2)) and formation of the ordered ternary substitution derivative ceco3b2 (ce in 1a, co in 3 g, and b in 2c). as relevant to the study presented herein, the ceco3b2 structural unit intergrown with fragments of different structures reveals a variety of borides exhibiting different degrees of structural complexity. for example, the family of structures where the slabs of ceco3b2 are stacked with slabs of the binary cacu5 type or laves phases are frequently encountered among ternary rare - earth borides with co and ni. formation of these structures in unexplored yet multinary systems may result in unpredicted changes of expected properties, and their investigation is necessary to understand and control the behavior of alloys. the diversity of cacu5-derivative structures is enhanced if the ternary rare - earth boride phases with noble metals are considered. for example, (i) the series of compounds formed by stacking blocks of ceco3b2 and carh2b2 (thcr2si2) type were observed in eu rh b, y os b, and la ru b systems ; (ii) prrh4.8b2 revealed ceco3b2-type slabs and hexagon - mesh rhodium nets. in this respect, systems containing pt and re metals were not investigated ; the only information available on cacu5-type derivatives concerns the crystal structure and physical properties studies for the rept4b series (ceco4b type, p6/mmm, re = la, ce, pr, sm). in this article b system focused on the pt - rich concentration range where we observed a series of new cacu5-related structures. our interest in this investigation was driven not only by the structural flexibility and diversity of cacu5-type derivative phases but also by the interesting physical properties which europium compounds may exhibit, such as, for example, mixed - valence states or magnetic ordering at comparatively high ordering temperatures, observed in eu - based binary laves phases. results presented herein expand knowledge on a family of cacu5 derivative structures to (i) the eu5pt18b6x phase showing a new structural arrangement formed by stacking of inverse thcr2si2-type slabs with cacu5- and ceco3b2-type fragments along the c - axis direction, (ii) a new member of rather simple structural series exhibiting the combination of cacu5- and ceco3b2-type slabs, namely, eupt4b where a mixed - valence state of eu has been observed, and (iii) a new compound eu3pt7b2, composed of ceco3b2- and laves phase- (mgcu2-) type fragments showing interesting transport properties accompanied by a relatively large sommerfeld coefficient. 0.52 g, were prepared by argon arc - melting elemental pieces of europium (99.99%, metal rare earth ltd., china), platinum foil (99.9%, gussa, a), and crystalline boron (98%, alfa aesar, d). due to the low boiling point and high vaporization of europium, eu weight losses were compensated by adding carefully assigned extra amounts of eu before melting. for homogeneity, samples were remelted several times. part of each alloy was wrapped in mo foil, sealed in an evacuated silica tube, and heat treated for 10 days at 1020 k prior to quench by submerging the capsules in cold water. single crystals suitable for x - ray diffraction studies were isolated from a fragmented annealed alloy of eu3pt7b2 ; however, for eupt4b and eu5pt18b6x crystals of good quality were obtained from as cast samples. crystal quality, unit cell dimensions, and laue symmetry of the specimens were inspected on an axs - gadds texture goniometer prior to x - ray intensity data collections at room temperature on a four - circle nonius kappa diffractometer equipped with a ccd area detector employing graphite - monochromated mo k radiation (= 0.071069 nm). no absorption corrections were performed because of the rather regular crystal shapes and small dimensions of the investigated specimens. space groups were determined from analysis of systematic absences performed with the help of the absen program. structures were solved and refined with the aid of the wingx-1.70.00 software package applying shelxs-97 and shelxl-97 programs. reduced cell calculations and noncrystallographic symmetry tests were performed applying the program platon2003 in order to check for higher lattice symmetry. data collection and refinement parameters for the three structures are listed in tables 1 and 2. isotropic (uiso) and anisotropic atomic displacement parameters (uij) are given in [10 nm ]. isotropic (uiso) and anisotropic atomic displacement parameters (uij) are given in [10 nm ]. x - ray powder diffraction patterns collected from the eupt4b and eu3pt7b2 alloys annealed at 1020 k for 10 days employing a guinier huber image plate system with monochromatic cu k1 radiation (8 0.4 nm) and preclude formation of pt2pt2 and pt4pt4 bonds. the coordination sphere of eu3 includes also six pt6 atoms located around the waist of an imaginary hexagonal prism ; thus, those 18 platinum atoms form a cage elongated in the direction of the c axis (pseudo - frank kasper polyhedron, which can also be described as two face - connected hexagonal antiprisms) with the hexagonal faces capped by eu2 atoms. in the case of eu2, 6 boron atoms centering the rectangular faces of the hexagonal prism are located too far from the central atom to infer strong bonding (eu2b2 distances are 0.316 and 0.322 nm). (c) coordination polyhedron of pt3 as representative of the atom environment for pt2, pt4, and pt5. (d g) coordination polyhedra of pt6 (d), b2 (e), pt11 (f), and pt55 (g). pt1 has 10 atoms at coordination distances, and its polyhedron is derived from a tetragonal antiprism (figure 2b). pt2, pt3, pt4, and pt5 (figure 2c) are surrounded by distorted icosahedra with one additional platinum atom ; for all four atoms the icosahedra are formed by three almost interperpendicular rectangles made of (i) 4 pt, (ii) 2 pt and 2 b, and (iii) 4 europium atoms. the coordination sphere of pt6 resembles the coordination polyhedron of cu (2c (1/3, 2/3, 0)) in cacu5 and includes only platinum and europium atoms (in total 13, 2 of them are at a rather long distance pt62pt6, 0.3256 nm) (figure 2d). b1 is coordinated by 6 pt atoms forming a trigonal prism ; three eu atoms are located against the triangular faces of the trigonal prism (b1eu2 0.316 nm and b12eu2 0.322 nm) (figures 1b and 2a). b2 centers the tetrahedron made of near - neighboring platinum atoms ; four eu atoms complete the coordination sphere, forming a tetragonal antiprism (figure 2e). the short distances between split positions (pt1pt11 0.03682 nm and pt5pt55 0.03021 nm) and their occupancies (0.80/0.20 for both pt1/pt11 and pt5/pt55) allow us to assume that on average the pt1 and pt5 atoms are present in four of five unit cells while one is filled with pt11 and pt55. coordination spheres for the atoms when the split sites pt11 and pt55 are considered replicate the shape of those with (or for) pt1 and pt5 differentiating slightly in coordinating distances due to small shifts of atom positions, with the exception of pt11 which has one more pt11 in contact distance (figure 2f and 2 g). unit cell dimensions of the eupt4b single crystal and x - ray powder diffraction spectra recorded from both the annealed and the as - cast alloys suggested isotypism with ceco4b - type structure. accordingly, the positions of eu and pt atoms obtained from structure solution in the space group p6/mmm from the x - ray single - crystal data were consistent with the ceco4b type. refinement of the structure with anisotropic displacement parameters converged to r = 0.0259 with residual electron densities smaller than 4940 e / nm and revealed full occupancy of all atom sites (table 2). the structure of eupt4b consists of ceco3b2- and cacu5-type slabs alternating along the c axis. in the coordination sphere of boron (ceco3b2-type fragment), six pt2 atoms are located at equal distance from the central atom, forming a regular triangular prism [bpt26 ] (figure 3a). three europium atoms are located against the rectangular faces of the trigonal prism, revealing a b eu1 distance 0.32428(1) nm which is larger that the sum of atomic radii of the elements. thus, eu1 is surrounded by 12 pt2 arranged in the shape of a hexagonal prism ; two eu2 atoms cap the hexagonal prisms of eu1 at a distance of 0.3720 nm from the central atom (figure 3b). similar to the prototype structure and to eu5pt18b6x, eu2 is located inside a rather large cage elongated along z (deu2pt2 = 0.3611 nm) and built of 18 platinum atoms, forming two face - connected hexagonal antiprisms ; two eu1 atoms cap the hexagonal faces. both atoms in the cacu5 block (eu2 and pt1) reveal unusual thermal displacements : eu2 exhibits a rather large thermal motion along the hexagonal axis with u33:u11(u22) of ca. 4:1, while pt1 shows enlarged values u11 and u22 (u11(u22):u33 of about 13). no fractional or partial occupancies for atom positions were observed from single - crystal data, and refinement of atoms on split positions was not successful. trial refinements in the space group types with lower symmetry (p62 m, p6m2, p6 mm, p622, p6/m, p6, p6) yielded inferior results. comparable features of thermal ellipsoids of atoms located in the channels formed by transition - metal atoms were hitherto also observed for the boride structures related to the ceco3b2 type, such as in5ir9b4 (p62 m, a = 0.5590 nm, c = 1.0326 nm) and lani3b (imma, a = 0.4970 nm, b = 0.7134 nm, c = 0.8300 nm) ; for the latter structure, the pronounced anisotropy of the atom thermal displacements prelude the symmetry change upon hydrogenation. in the case of eupt4b, a possible reason may be that in order to optimize the distance to its pt2 neighboring atoms eu2 is delocalized between the layers of pt2, consequently affecting (since pt1 and eu2 are at the same height) the thermal displacements of pt1. enlarged displacement parameters of eu1 are probably indicative of a weak rattling of the europium atom within the 14-atom cage. (a) perspective view of the eupt4b structure along the c - axis direction emphasizing the boron - centered pt2 triangular prisms. (b d) coordination spheres of eu1 and eu2 (b), pt2 (c), and pt1 (d). the pt1pt2 bonds are omitted in b. for eu3pt7b2, systematic extinctions characteristic for the trigonal space group r3m and unit cell dimensions proposed isotypism with the ca3al7cu2-type structure. structure solution by direct methods confirmed the arrangement of the heavy atoms analogous to that observed for ca3ni7b2 (table 2). the structure is composed of ceco3b2- and mgcu2-type fragments alternating along z. each successive block is shifted with respect to the former one in the (110) plane by a half unit cell. the perspective view of the eu3pt7b2 unit cell along the c axis is presented in figure 4a, showing triangular prisms formed by 6 pt1 around b. the ceco3b2-type slabs are formed by 12 pt1 and 2 eu1 atoms surrounding eu2 (eu2pt1 0.31525 nm, eu2eu1 0.32982 nm) to form the bicapped hexagonal prism (figure 4c). six boron atoms are located in front of the rectangular faces of the hexagonal prism at the distance 0.3203 nm, which is too long to assume bonding interaction (compare, for example, with ca3ni7b2, where dca the coordination polyhedron of pt2 exhibits a shape analogous to those of transition atoms in the binary mgcu2-type laves phase : an icosahedron formed by 6pt1 and 6eu1 reveals interatomic distances (table 2) which are comparable with distances in eupt2 (mgcu2 type, pt6pt 0.2727 nm, pt6eu 0.3198 nm). kasper polyhedron [pt12eu4 ] of eu1 is slightly distorted in comparison with that of eu in eupt2 (figure 4b). (a) perspective view of the eu3pt7b2 structure along the c - axis direction emphasizing the boron - centered pt1 triangular prisms. (b e) coordination spheres of eu1 (b), eu2 (c), pt2 (d), and pt1 (e). (f) twenty - membered cage capturing ca2 in the ca3al7cu2 structure. as compared to the prototype ca3al7cu2 structure, significant changes in the coordination sphere of atoms are observed for the ceco3b2-type block : (i) the distance between the 3636 kagom net formed by al atoms is long (about 0.400 nm) in contrast to the corresponding distance between platinum atoms in eu3pt7b2 (dpt1pt1 = 0.29959 nm), thus delivering a different shape of the coordination polyhedron of ca ; (ii) due to the larger atomic radius of copper with respect to b, the distance ca cu of 0.324 nm is sufficient to indicate bonding interaction, thus increasing the coordination number of ca to cn = 20 (figure 4f) as compared to cn eu2 = 14 in eu3pt7b2. in contrast to eupt4b, in the present structure none of the atoms show significant anisotropy in their thermal vibration (table 2). the investigated structures represent three families of structures revealing the cacu5-type block in conjunction with other structural fragments. in the discussion below, the structures are arranged in order according to increasing complexity of structural arrangements. the eupt4b structure (ceco4b type) (figure 5f) consists of alternating slabs of cacu5 type (a) (figure 5a) and slabs of its ternary derivative ceco3b2 type (b) (figure 5b). it is a simplest representative of the structural series described in typix under the general formula rm+nt5m+3nm2n, with m = 1, n = 1 (m and n correspond to number of cacu5-type and ceco3b2-type blocks, respectively). similar to the prototype structure, the hexagonal channels filled with eu are formed by edge - connected trigonal prisms [bpt6 ] in eupt4b and alternate with 18-membered platinum cages, capturing europium atoms along the c axis. while in the ceco4b structure the b atoms are located at 0.2889 nm from the central ce atom and assume bonding, this distance is rather long in the europium isotype with platinum. (a) cacu5- and (b) ceco3b2-type structures (for both structures the origin is shifted by 0,0,1/2). (c) eupt2 structure (mgcu2 type, space group fd3m, origin shift 1/4, 0, 3/4). (e g) structural relationships for (e) eu3pt7b2, (f) eupt4b, and (g) eu5pt18b6x structures. relative arrangements of structural blocks are indicated with symbols a, b, c, and d. in contrast to the relatively small unit cell and simple structure of eupt4b, the two remaining structures, eu3pt7b2 and eu5pt18b6x, exhibit rather large unit cells and nontrivial stoichiometries. this binary compound belongs to the rhombohedral branch of a structural series formed within composition range rm2rm5 by stacking the fragments of cacu5 type and laves phase and can be described by the formula r2m+nm4m+5n, where m accounts for the number of laves - type slabs (r2m4) and n is a number of cacu5-type slabs. since only the structures with m = 1 have been observed for binary structures, the ternary representatives of this series which are built by combining ceco3b2- and laves - type structural slabs (ca3ni7b2, ce2ir5b2) follow the formula r2+nm4 + 3nx2n : 2mgcu2 + nceco3b2. cu system. in ca3al7cu2-type structures with boron (ca3ni7b2, eu3pt7b2), the transition - metal atoms adopt the sites of aluminum in the mgcu2-type block and boron atoms replace copper in the cacu5-type block. figure 5e shows the arrangement of ceco3b2-type slabs (b) and mgcu2-type slabs (c) in the eu3pt7b2 structure. it can be considered as an intergrowth of three kinds of structure blocks (figure 5 g) : one is a cacu5 type (a), the second having the atom arrangement of its ordered ternary derivative ceco3b2 (b), and the third reveals the slab of the site - exchange variant of the thcr2si2 structure with b atoms adopting the sites of cr (d). the body - centered structure of thcr2si2 (space group i4/mmm, th in 2a : 0, 0, 0 ; cr in 4d : 0, 1/2, 1/4, si in 4e : 0, 0, z), an ordered variant of baal4, is widely distributed among ret2x2 compounds (t = transition metal, x = p element). the unit cell of thcr2si2 can be described as a stacking of infinite layers of interconnected tetragonal [cr4 ] pyramids around the si atom (wyckoff position 4e, commonly named as pyramidal site) running perpendicular to the c axis with a layer of thorium atoms between these pyramids. cr atoms are tetrahedrally surrounded by four si atoms (wyckoff position 4d, tetrahedral site). chemical bonding, atomic site preferences as a function of electronegativity of the constituent elements, size effect with respect to the structural stability, phase widths, and physical properties have been studied for different combinations of the elements and particularly developed recently for pnictides due to discovery of superconductivity in the series of iron arsenides with thcr2si2 type. ternary rare - earth borides with a thcr2si2-type structure are quite rare except for few representatives, such as reco2b2 (re = y, la, pr, nd, sm, gd er), refe2b2 (re = y, gd these structures the transition metal occupies the atom site of cr and boron is placed in the position of si. accordingly, each t atom is coordinated by four b atoms ; a recent reinvestigation of the thcr2si2 type laco2b2 (a = 0.36108 nm, c = 1.02052 nm, z = 0.3324(5)) revealed a relatively short co b bond (e.g., 0.20 nm), indicating certain compression of the cob layer along the c axis and an elongated la there are two baal4-type derivative structures encountered for composition ret2x2 : the structures of thcr2si2 (described above) and cabe2ge2, which is built by intergrowth of thcr2si2-type slabs and slabs of its site - exchange variant along the direction (and thereby one - half of t and x atoms occupy the tetrahedral and pyramidal sites and vice versa, respectively). as reported by parthe., formation of compounds revealing only inverse thcr2si2-type arrangement is rare ; however, this arrangement occurs as slabs in intergrown structures (for example, in cenisi2, bacusn2, la3co2sn7). among borides, formation of inverse thcr2b2-type structure was found for znir2b2 where layers of edge - connected [bir4 ] tetrahedra (ir in 4e (0, 0, z, z = 0.37347), b in 4d (0, 1/2, 1/4)) are separated by 4 networks of zinc atoms (zn in 2a (0, 0, 0)). similarly, in eu5pt18b6x, four atoms of platinum form tetrahedra around boron atoms, however exhibiting a higher degree of compression along the b axis : the pt1b distance in the eu5pt18b6x is 0.1978(1) nm (and 0.2239(8) nm for pt11 in split position) as compared to the length of the ir b bond of 0.2150 nm in znir2b2 showing the tetrahedral angles 2 137.07, 2 105.25, 2 90.27 in eu5pt18b6x (2 126.09, 2 100.79, 2 102.91 for pt11) and 4 121.68, 2 87.11 in znir2b2. because of limited spatial dimension of the thcr2si2 slab in the eu5pt18b6x structure (i.e., one - half a unit cell cut along (111)), the tetrahedra do not form infinite layers but are arranged in one - dimensionally linked chains running infinitely along the a axis. previous theoretical studies based on mlliken overlap population analysis suggested that the element with greater electronegativity is more strongly bound in the 4e site. the atoms site preferences in the structures of three discussed borides (i.e., laco2b2, znir2b2, and thcr2si2 block in the eu5pt18b6x) are consistent with the electronegativity on the pauling scale of boron, relative to those of transition elements co, ir, and pt. among a large family of reported ternary rare - earth transition - metal borides, the eu phases are usually missing. for only a few cacu5-type derivative ternary borides with europium have the precise structural parameters and physical properties been investigated. these are (i) the eu2rh5b4 and eu3rh8b6 structures composed of the ceco3b2- and carh2b2-type fragments, (ii) eu3ni7b2 of ceco4b type exhibiting one nickel site partially occupied by a mixture of europium and nickel atoms. in both eu2rh5b4 and eu3rh8b6 compounds, the eu atoms have been found in the divalent state, revealing magnetic moments only slightly smaller than the theoretical value of 7.94 b. euir2b2 of carh2b2 type can be considered as a metal - deficient derivative structure of ceco3b2 ; according to a plot of the unit cell volumes vs lanthanide atomic number, eu was found to be divalent. comparing the interatomic distances and relating them to the magnetic properties, one can see that in both eu2rh5b4 and eu3rh8b6 (eu 4f) the eu eu distances are 0.3207, 0.3654 nm and 0.3113, 0.3614 nm respectively, while eu rh distances vary between 0.3079 and 0.3256 and 0.3054 and 0.3279 nm. euir2b2 shows similar distance variations : the eu eu bond is 0.3852 nm, and the distances eu ir are 0.3058 and 0.3313 nm. the differences in bond length analogous to eu2rh5b4, eu3rh8b6, and euir2b2 can be found in eupt4b, where one eu atom, namely, eu1 (ceco3b2-type block) exhibits rather short contacts with pt2 of 0.31605 nm, whereas eu2 (cacu5-type block) exhibits pt neighbors at 0.32428 and 0.36113 nm. there is one rather long bond between europium atoms eu1eu2 0.3720 nm in eupt4b. the deviations of the lattice parameters of the europium compound from the lanthanoid contraction in the rept4b series also confirm the assumption that eu is not trivalent in eupt4b (figure 6). similarly, in eu5pt18b6x the eu eu contacts are long and the distances between eu and pt atoms are rather heterogeneous, ranging within 0.3128 and 0.3611 nm. for the europium compound, lattice parameters were obtained from rietveld refinement of single - phase eupt4b alloy used for physical properties measurements. in order to obtain the electronic configuration (ec) of the eu ions and thus the magnetic state, the magnetization of eupt4b and eu3pt7b2 was measured and analyzed in detail. the temperature dependence of the magnetization and susceptibility for various fields is presented in figures 7 and 8, respectively. magnetic susceptibility data = m / h scale pretty well for 0.1, 1, and 3 t above the ordering temperature being indicative that the samples are free from magnetic impurities and other magnetic secondary phases ; data are displayed in figure 7 as vs t for the 3 t run, only. temperature - dependent magnetization of eupt4b (a) and eu3pt7b2 (b). both eupt4b and eu3pt7b2 eu3pt7b2 shows a transition at 57 k, while eupt4b orders below 36 k as determined from low - field magnetization measurements and corresponding arrott plots (see below). the magnetic susceptibility in the paramagnetic region is accounted for by the modified curie weiss law = 0 + c/(t p). the paramagnetic curie temperatures p = 60 and 40 k together with effective magnetic moments eff = 8.0 and 7.1 b per eu atom (derived from the curie constant, c), were obtained as a result of least - squares fits to the susceptibility data of eu3pt7b2 and eupt4b, respectively (solid lines, figure 7), with a temperature - independent susceptibility 0 of about 3 10 cm / g for both compounds. while the paramagnetic moment of eu3pt7b2 recounted per one europium atom is almost that expected for the theoretical value of the free eu ion (eff = 7.94 b) the effective moment obtained for eupt4b is significantly smaller, pointing to a mixed- or -intermediate valence state of eu. the fact that eu in eupt4b possesses two inequivalent lattice sites suggests that the more static case (i.e., mixed valence) might account. in such a case, the system can be treated as a mixture of eu and eu atoms located either at the 1(a) or the 1(b) site. following this approach, the paramagnetic moment of eu in eupt4b we use a mean literature value for the effective moment of eu with eu = 3.5 b rather than the theoretically vanishing effective magnetic moment of a pure eu state. the fraction x of eu atoms in the 2 + state is thus estimated to be x = 0.75, whereas a vanishing effective moment for the eu state gives a fraction of 80% in the eu state. although the latter is presumably an overestimate, analysis of the saturation magnetization and heat capacity (see below) supports these assumptions. the temperature - dependent magnetization, displayed in figure 8 for various fields, exhibits for eupt4b significant irreversibilities of the magnetization for zero - field cooling (zfc) and field cooling (fc) which disappear only for fields larger than 1 t. these irreversibilities can be attributed to domain wall pinning associated with a remarkable hysteresis and a coercivity of 0.32 t at 2.8 k (see figure 9) as a consequence of the magnetocrystalline anisotropy due to the cacu5 building blocks. on the contrary, there is hardly any difference for zfc and field cooling detectable even in the low - field regime for eu3pt7b2 yielding also reversible magnetic isotherms without a significant hysteresis, which means the coercivity is 3 orders of magnitude smaller than for eupt4b. a comparison of the magnetic isotherms of both compounds is shown in figure 10, where the isotherms are displayed as m versus h / m plots (arrott plots). it should be noted that in the case of eupt4b with the pronounced hysteresis only the demagnetization data, where the rotation of the magnetization plays the dominant role, are used for the arrott plots. deviations from the expected linear behavior of the arrott plots are observed frequently, see, e.g., ref (59) and references therein, in particular with a curvature symmetrical with respect to tc, i.e., a negative curvature at t tc. this is indeed observed for eupt4b (figure 10a), and such symmetrical deviations about tc can be attributed to spatial variations of the magnetization and/or spin fluctuations. as we have a stoichiometric compound these deviations may arise from fluctuating moments associated with significant thermal motions of eu2 along the hexagonal axis and/or with the proposed weak rattling of the eu1 atoms within the 14-atoms cage rather than from a heterogeneous magnetization. on the other hand, it was shown that a substantial uniaxial magnetocrystalline anisotropy causes a remarkable downturn of the arrott plots below tc. in this model, the negative curvature of the arrott plots below tc can be accounted for as a result of domain rotations in the nonoriented crystallites and against the random but uniaxial anisotropy fields ha. a rather simple way to estimate ha in terms of this model is to extrapolate the linear part of the arrott plot backward to obtain the spontaneous magnetization, and taking 91.3% of that value gives with a parallel forward extrapolation an intersection with the experimental arrott plot, yielding a value for h / m where this particular field corresponds to the anisotropy field ha (see the dashed lines in figure 10b ; for further details see ref (59)). using this simple estimate we obtain for eu3pt7b2 an anisotropy field of about 1 although the magnetization at 7 t at 2.8 k is not in a fully saturated state for both compounds we use that value for the saturation magnetization ms, while the spontaneous magnetization m0 is obtained from the backward extrapolation of the arrott plot as mentioned above. this yields for eu3pt7b2ms = 7.43 b / mol - eu and m0 = 7.24 b / mol - eu and for eupt4b ms = 5.13 b / mol - eu and m0 = 3.85 b / mol - eu. both the saturation as well as the spontaneous magnetization of eu3pt7b2 is well above the value expected for a eu ion (ms = gj = 7 b), indicative that a substantial 5d conduction electron polarization contributes to the total moment. the significant smaller saturation and spontaneous moment of eupt4b indicate, in line with results for the effective moments, a mixed - valence state. under the assumption that the conduction electron polarization is of similar magnitude in both compounds, the ratio of their saturation moments indicates that 69% of the eu ions are in the eu state in eupt4b, while a somewhat smaller fraction of about 53% is obtained using the ratio of the spontaneous moments. the latter is an underestimate caused presumably by the large high - field susceptibility of eupt4b also visible in the larger slope of the arrott plot in comparison to that of eu3pt7b2. further information on the ground state properties of eupt4b and eu3pt7b2 can be gained from specific heat measurements. temperature - dependent specific heat cp of eupt4b (a) and eu3pt7b2 (b). low - temperature details together with least - squares fits (solid lines) based on a ferromagnetic spin wave model. both eupt4b and eu3pt7b2 exhibit distinct -like anomalies around 35 and 57 k, respectively, idealized in figure 11 by solid lines, which can be attributed to a second - order phase transition of magnetic origin. a nonmagnetic isostructural compound to be used as an analogue was not available for a full comparative analysis. however, it is easily seen that the height of the anomaly cp = 56 j / molk in the case of eu3pt7b2 corresponds well to a mean - field - like transition of a j = 7/2 system (cp = n5r[j(j + 1)/(2j + 2j + 1) ], where n is the number of re atoms / mol. considering three eu atoms per mole yields cp = 60.39 j / molk, in fair agreement with experiment. the jump of the specific heat of eupt4b right at the magnetic phase transition temperature is only about 13 j / molk in comparison with the expected value of 20.13 j / molk. this reveals that only a fraction of the eu ions is involved in magnetic ordering (i.e., 65% eu and 35% eu), which is in line with the broad range of estimates from the magnetic data where we obtained 53% eu as a lower and 80% eu as an upper limit. low - temperature heat capacity data were analyzed in terms of a ferromagnetic spin wave model including a spin wave gap, i.e., cp = t + t + t exp(/t) with the sommerfeld value and proportional to the low - temperature debye temperature d (d = ((1944n)/). results of least - squares fits are shown as solid lines in the insets of figure 11, revealing excellent agreement with = 28 and 206 mj / molk, resulting in an effective 68 mj / molk per europium atom, = 0.000222 and 0.000702 j / molk, = 0.36 and 0.46 j / molk, and = 12.6 and 10 k for eupt4b and eu3pt7b2, respectively. both eu - based compounds are characterized by sommerfeld values well beyond simple metals, pointing to strong electron correlations induced by intra - atomic 4f5d exchange in eu ions in combination with a significant hybridization of eu and pt 5d orbitals. the latter is also corroborated by the high saturation magnetization of eu3pt7b2 which significantly exceeds the expected saturation moment of free eu ions. we note that largely enhanced sommerfeld values due to f d exchange have been reported for various gd intermetallics such as gd3co, gd3rh, and gd ni binaries. we studied the electrical resistivity of eupt4b and eu3pt7b2 from 0.3 k to room temperature (see figure 12). data evidence metallic behavior in both cases with rather low overall resistivities. unlike eu3pt7b2, in the resistivity curve of eupt4b a slight change of slope is observed at around 240 k, pointing to some additional, unanticipated scattering processes. for both compounds, anomalies of (t) figure 13 represents the magnetic field dependence of the resistivity of eu3pt7b2 and eupt4b. although the anomaly in both compounds is of ferromagnetic origin, application of a magnetic field causes different responses of the resistivity. the resistivity of eupt4b decreases slightly in the entire temperature range studied, and the (t) anomaly is suppressed by fields of 6 t. magnetoresistance of eu3pt7b2, on the other hand, is positive at low temperatures as well as in the high - temperature paramagnetic range and negative only in a narrow region around the transition temperature. despite the ferromagnetic ground state of eu3pt7b2 leading, in general, to a negative magnetoresistance, the classical magnetoresistance can overcompensate the one originated by magnetic interactions, resulting in an increase of (t) with increasing magnetic fields, at least for certain temperature ranges. the dominance of the classical magnetoresistance in eu3pt7b2 as compared to eupt4b might follow from the fact that the overall resistivity, specifically the residual resistivity, is much lower here than in the case of eupt4b. temperature - dependent electrical resistivity of eu3pt7b2 (a) and eupt4b (b) as a function of magnetic field. to quantitatively evaluate (t) of eu3pt7b2, experimental data were first split into two parts, i.e., a low - temperature region (below the magnetic phase transition) and a high - temperature paramagnetic part. in the paramagnetic regime the behavior of the resistivity of eu3pt7b2 grneisen term corresponding to the resistivity originated from scattering of conduction electrons on phonons and = 0 + mag, with mag describing the interaction of conduction electrons with localized magnetic moments. in the absence of crystalline electric field effects a debye temperature d = 312 k and = 32 cm were obtained from a least - squares fit in a temperature region over 80 k (dashed line, figure 12). in the low - temperature region, the resistivity of a ferromagnetic material with spin wave dispersion k is expected to behave like t. moreover, as a consequence of the enlarged gamma value, derived from the specific heat measurements, the electron electron scattering should also be taken into account and in turn be proportional to t at low temperatures as well, making it impossible to distinguish between both phenomena. as a result of the fit using = 0 + at, 0 = 7.64 cm was obtained. the low - temperature part of the resistivity of eupt4b is in good agreement with the temperature dependence of a ferromagnetic material. experimental data are well accounted for by = 0 + bt(1 + (2t/))e with = 12.8 k as the width of the gap in ferromagnetic spin wave spectrum. the high - temperature part, on the other hand, displays some characteristic curvature observed in systems strongly influenced by the crystalline electric field, supporting the mixed - valence hypothesis. three new ternary phases have been observed for the first time in the eu pt b system from arc - melted alloys annealed at 1020 k. crystal structures have been studied by x - ray single - crystal diffraction and validated by rietveld refinements of x - ray powder diffraction data. the results beautifully illustrate the structural diversity and versatility of a cacu5-type derivative family of structures, revealing three different structural series. eupt4b forms a ceco4b type and is composed of cacu5- and ceco3b2-type fragments stacked along the c axis ; eu3pt7b2 is built of ceco3b2- and mgcu2-type slabs and exhibit an ordered variant of puni3, namely, ca3al7cu2 type with al and cu atom sites occupied by pt and b atoms, respectively. in both compounds unique stacking of cacu5-, ceco3b2-, and thcr2si2-type slabs has been uncovered in the eu5pt18b6x structure ; the atom arrangement in the thcr2si2-type block is rare for the distribution of pt and b atoms on si and cr atom sites, respectively (baal4-type derivative structures), thus changing the coordination of the transition metal as compared to other representatives of a large family of thcr2si2-type compounds and exhibiting chains of edge - connected platinum tetrahedra [bpt4 ] running along the a - axis direction. with respect to eu eu linkage, the europium atoms are interconnected infinitely along the c axis in both eupt4b and eu3pt7b2 structures. the eu5pt18b6x structure exhibits the repeating blocks of 5 fused polyhedra of eu linked in a sequence... thcr2si2ceco3b2cacu5ceco3b2thcr2si2... ; the units are shifted for a 1/2a along the b - axis direction with respect to each other, forming blocks which are interlinked via thcr2si2-type fragment along the c axis. positioning of the b atom on the cr wyckoff site in the thcr2si2-type slab and consequently its nearest tetrahedral coordination plays a decisive role in formation of eu5pt18b6x structure, serving as a linking entity (figure 14) for the repeating structural units of fused eu polyhedra. although eupt4b exhibits a feromagnetic ordering at relatively high temperature of 36 k, a mixed - valence state for eu is observed. in a static case of valence distribution one would expect 50% eu and 50% eu as a consequence of obvious difference between the coordination polyhedra for two eu atoms unlike our case, where magnetic and specific heat measurements purpose more complex valence behavior. time - dependent studies are needed to distinguish between a static and a more complex dynamic case of mixed - valence state. in eu3pt7b2, the eu atoms are in the 2 + state and the compound orders feromagnetically at around 57 k. the electron part of specific heat was found to be 206 mj / molk, pointing to the existence of strong electron correlations. | three novel europium platinum borides have been synthesized by arc melting of constituent elements and subsequent annealing. they were characterized by x - ray powder and single - crystal diffraction : eupt4b, ceco4b type, p6/mmm, a = 0.56167(2) nm, c = 0.74399(3) nm ; eu3pt7b2, ca3al7cu2 type as an ordered variant of puni3, r3m, a = 0.55477(2) nm, c = 2.2896(1) nm ; and eu5pt18b6x, a new unique structure type, fmmm, a = 0.55813(3) nm, b = 0.95476(5) nm, c = 3.51578(2) nm. these compounds belong to the cacu5 family of structures, revealing a stacking sequence of cacu5-type slabs with different structural units : cacu5 and ceco3b2 type in eupt4b ; ceco3b2 and laves mgcu2 type in eu3pt7b2 ; and cacu5-, ceco3b2-, and site - exchange thcr2si2-type slabs in eu5pt18b6x. the striking motif in the eu5pt18b6x structure is the boron - centered pt tetrahedron [bpt4 ], which build chains running along the a axis and plays a decisive role in the structure arrangement by linking the terminal fragments of repeating blocks of fused eu polyhedra. physical properties of two compounds, eupt4b and eu3pt7b2, were studied. both compounds were found to order magnetically at 36 and 57 k, respectively. for eupt4b a mixed - valence state of the eu atom was confirmed via magnetic and specific heat measurements. moreover, the sommerfeld value of the specific heat of eu3pt7b2 was found to be extraordinarily large, on the order of 0.2 j / mol k2. |
a 53-year - old man presented to the emergency department with a 7-day history of right ear fullness, otalgia, and hearing loss. he had recently been treated with antibiotics for sinusitis at an outside hospital but his symptoms failed to resolve. physical examination demonstrated a mass behind an intact right eardrum, and tuning fork evidence of a conductive hearing loss. the remainder of his cranial nerve examination was normal, with the exception of the long - standing house - brackmann grade vi / vi right facial nerve paralysis. audiogram demonstrated a right moderate conductive hearing loss with flat (type b) tympanogram. the patient had a right parotid pleomorphic adenoma 35 years ago, which was treated by enucleation. he presented with several subcutaneous nodules 7 years after the initial treatment, which were treated by total parotidectomy. during surgery magnetic resonance imaging of the head confirmed a large, irregular, heterogeneous, and variably enhancing mass in the right mastoid with extension medially along the floor of the posterior fossa measuring ~5 the mass eroded through the mastoid laterally and inferiorly into the upper cervical soft tissues. the mass extended inferiorly into the parapharyngeal space and extrinsically compressed the right sigmoid sinus displacing it medially. in addition, a 1 1 cm enhancing nodule in the right cerebellum medial to the cystic lesion was observed. the differential diagnosis at this point included carcinoma ex pleomorphic adenoma, postradiation sarcoma, another parotid gland carcinoma, and recurrent pleomorphic adenoma. (a) axial t1, (b) axial t2, (c) coronal t1, and (d) sagittal t1-weighted images reveal a variably enhancing mass in the right mastoid air cells extending medially along the floor of the posterior fossa, extending inferiorly into the parotid bed and medially into the cerebellum. the patient was taken to the operating room for transtemporal resection. upon entering the mastoid, tumor was noted completely infiltrating the mastoid cavity. it eroded through the dura of the posterior fossa medial to the sigmoid sinus and into the cerebellum. the tumor had also eroded into the fallopian canal, requiring debridement and transection of the grossly involved facial nerve. the mass infiltrated the posterior semicircular canal and the aditus ad antrum ; however, the middle ear space and facial recess were free of tumor. once proximal and distal venous control was achieved, the sigmoid and transverse sinuses (both involved by tumor) were resected inferior to the vein of labb. finally, the remaining tumor was removed from the jugular foramen, lateral infratemporal fossa skull base, and the superior parapharyngeal region. throughout the procedure, the remainder of the specimen was examined following standard histological processing and staining with hematoxylin and eosin. upon final review, although there was evidence of destruction of the mastoid and involvement of the facial nerve, the growth pattern of the tumor was lobulated and expansile rather than directly infiltrative (fig. the tumor showed areas of cellularity without mitoses or cellular atypia as well as areas of abundant chondromyxoid matrix. immunohistochemistry performed on the most cellular areas demonstrated a low proliferation rate (< 2%) and diffuse but weak staining with p53. taken together, these findings excluded the possibility of a malignancy such as carcinoma ex pleomorphic adenoma, and were highly suggestive of an aggressive recurrence of an otherwise histologically benign pleomorphic adenoma. (a) expansile growth of tumor extending into the mastoid causing local destruction, h&e, low magnification. (b) cellular area of the tumor showing well - formed tubules in a chondromyxoid matrix, h&e, low magnification. (c) paucicellular region of the tumor with abundant chondromyxoid matrix and tyrosine crystal, h&e, high magnification. (d) k i-67 immunohistochemistry showing rare positive cell denoting a low proliferation rate. he immediately noted improvement in his hearing, though did have a transient vocal fold paresis which is currently resolving. pleomorphic adenoma, also known as benign mixed tumor, is the most common tumor affecting the parotid gland, but can occur in any major or minor salivary gland as well as extra - salivary tissue.14 pleomorphic adenoma is most common in middle age and in women,5 and although rare in children, it remains the most common solid parotid mass in the pediatric population.69 these tumors arise directly from salivary gland tissue and consist of epithelial and mesenchymal cells ; the latter can give rise to osseous, cartilaginous, hyaline, and myxoid elements, hence the name surgical resection is the treatment of choice for pleomorphic adenoma due to possible malignant transformation (to carcinoma ex pleomorphic adenoma) and its potential to reach massive size, causing significant morbidity and cosmetic deformity. the invasion of bony structures is rare.10 in this study, we identify a unique pattern of intracranial invasion of a recurrent pleomorphic adenoma, as there does not exist anywhere in the literature a case reported with such extensive intracranial spread of this benign tumor. recurrence of pleomorphic adenoma after excision is a well - known phenomenon and can present decades after resection of the primary tumor.11 the incidence of recurrent pleomorphic adenoma has been reported as high as 17%, depending on the surgical technique used in the primary excision.12 pleomorphic adenomas are not all truly encapsulated ; rather some possess pseudopodia that vary in thickness and extend from the tumor surface, contributing to postoperative recurrence.13 initially believed to be primarily due to tumor spillage during excision, recurrence may also be due to unique histological and genetic characteristics.12 additionally, the presence of microscopic satellite tumors left behind after resection has been reported to contribute to pleomorphic adenoma recurrence.13 more recently there has been an interest in determining the expression profile of various tumor marker genes to determine if particular expression patterns exist between pleomorphic adenomas and their malignant counterparts. several studies have demonstrated that carcinoma ex pleomorphic adenoma has a higher proliferative index, as determined by the expression of the proliferation marker k i-67, as well as accumulation of dysfunctional p53, than benign pleomorphic adenomas.1417 however, very few studies have examined the genetic differences between nonrecurrent and recurrent pleomorphic adenomas. stennert and colleagues studied the expression of the proliferative marker k i-67 in both myxoid and cellular types of recurrent pleomorphic adenomas and found a higher proliferative index in the more aggressive, cellular type recurrences.18 hamada and colleagues compared the expression patterns between nonrecurrent and recurrent pleomorphic adenomas for glycosylated phosphoprotein mucin 1 (muc1), which is upregulated in various cancers,19 and found that high expression of muc1 was a significant risk factor in developing recurrence.20 in our study the tumor showed a low proliferation (ki-67) rate (< 2%) with positive p53. positive p53 immunohistochemistry has been identified not only in malignant salivary gland tumors but also in tumors showing classic pleomorphic adenoma histology, cellular pleomorphic adenomas, and recurrent pleomorphic adenomas.2123 more significant is the utility of the nuclear antigen k i-67 as a predictor of tumor behavior, in malignant tumors a high proliferation rate is suggestive of more aggressive behavior.24 the low proliferation rate in addition to classic pleomorphic adenoma histology with no evidence of malignant transformation of either cellular or stromal components definitively placed this tumor into the category of a recurrent pleomorphic adenoma. clearly, more prospective investigations are needed to determine if immunohistochemical profiling can reliably predict recurrence. while several characteristics appear to individually contribute to recurrent disease, it is the combination of surgical technique, histology, and genetics that conveys the true risk. we present a unique case of massive transcranial invasion of a recurrent benign mixed tumor arising from the parotid. in the vast majority of cases reported of recurrent pleomorphic adenoma, the recurrent tumor is confined to the site of the primary tumor with some extension into surrounding tissue. while bone changes and destruction have been reported,10,25 we believe this case represents the most massive and destructive recurrent pleomorphic adenoma in the literature, and illustrates the point that recurrent pleomorphic adenoma must be within the differential diagnosis of any patient presenting with a malignant appearing intracranial lesion and a remote history of pleomorphic adenoma resection. | pleomorphic adenoma, also known as benign mixed tumor, is the most common tumor affecting the parotid gland and can reach massive size ; however, intracranial invasion is rare. recurrence of pleomorphic adenoma after excision is a well - known phenomenon and can present decades after resection of the primary tumor. here we present the case of a 53-year - old man who presented to our clinic with ear fullness, otalgia, and hearing loss 30 years after undergoing total parotidectomy and external beam radiotherapy for pleomorphic adenoma. magnetic resonance imaging revealed a massive transcranial tumor invading the mastoid cavity, the dura of the posterior fossa, the fallopian and semicircular canals, the jugular foramen, the lateral infratemporal fossa skull base, the sigmoid and transverse sinuses, and the superior parapharyngeal region. gross examination and histopathological studies confirmed that the mass was a recurrent pleomorphic adenoma. here we discuss the features of recurrent pleomorphic adenoma and review the current literature. |
many drug patents have recently expired or are scheduled to expire in the near future. in response, many drug manufacturers have expanded their generic drug portfolio, which requires them to conduct clinical trials that demonstrate that their generic equivalents perform similarly to the innovator drug product. regulations introduced by the united states food and drug administration (fda) and the european medicines agency (ema) over the last thirty - five years have strengthened measures to ensure the bioequivalency of drug products, which may be simultaneously manufactured by multiple drug makers [3 - 5 ]. bioequivalence and bioavailability testing standards have also emerged following recognition that bioinequivalence and variations in the bioavailability of drug products can result in therapeutic failure and/or toxicity [6 - 8 ]. in the united states, the successful approval of new and abbreviated new drug applications requires regulatory approval by the fda. recent studies have suggested that this process takes nearly a decade to complete the required series of pre - clinical studies and clinical trials. drug development is an expensive process that is marked by a high - failure rate. for these reasons, early stage bioequivalence and pharmacokinetic studies are essential in determining the fate of new drug products. in this study, we sought to systematically assess the current trends of ongoing and recently completed bioequivalence and bioavailability trials that have been registered within a national clinical trials registry. this study provides insight regarding the characteristics of current bioequivalence and bioavailability trials and may also provide assistance in prioritizing future areas of research. ] we identified bioequivalence and bioavailability trials registered in clinicaltrials.gov using the key words bioequivalence and bioavailability. briefly, clinicaltrials.gov is a publicly - available registry of clinical research studies that is maintained by the u.s. national institutes of health. as of mid-2013 there were nearly 150,000 studies registered in clinicaltrials.gov, with study sites in 185 countries (http://www.clinicaltrials.gov). our search was restricted to identify studies registered between 01 october 2007 and 31 december 2012 to coincide with the enactment of a federal law in 2007 that mandated the registration of all phase 2 - 4 interventional trials involving drugs, biological agents, and medical devices. we excluded all observational trials (n=34) as well as trials that were suspended (n=7), terminated (n=33), or withdrawn (n=26). the remaining trial registry entries were systematically examined and the following data elements were extracted : a unique trial identifier, study title, recruitment status, phase (0 - 4), study design, blinding status, interventional assignment to trial arms, primary endpoint classification, primary purpose of the trial, age group and gender eligibility criteria, and anticipated enrollment size. descriptive statistics were used to characterize the bioequivalence and bioavailability trials identified in the clinicaltrials.gov registry. comparisons between ongoing trials and those that have been completed were performed using the -test or fisher s exact test. all statistical analyses were undertaken in stata 11.2 (statacorp lp, college station, tx, usa). we identified bioequivalence and bioavailability trials registered in clinicaltrials.gov using the key words bioequivalence and bioavailability. briefly, clinicaltrials.gov is a publicly - available registry of clinical research studies that is maintained by the u.s. national institutes of health. as of mid-2013 there were nearly 150,000 studies registered in clinicaltrials.gov, with study sites in 185 countries (http://www.clinicaltrials.gov). our search was restricted to identify studies registered between 01 october 2007 and 31 december 2012 to coincide with the enactment of a federal law in 2007 that mandated the registration of all phase 2 - 4 interventional trials involving drugs, biological agents, and medical devices. we excluded all observational trials (n=34) as well as trials that were suspended (n=7), terminated (n=33), or withdrawn (n=26). the remaining trial registry entries were systematically examined and the following data elements were extracted : a unique trial identifier, study title, recruitment status, phase (0 - 4), study design, blinding status, interventional assignment to trial arms, primary endpoint classification, primary purpose of the trial, age group and gender eligibility criteria, and anticipated enrollment size. descriptive statistics were used to characterize the bioequivalence and bioavailability trials identified in the clinicaltrials.gov registry. comparisons between ongoing trials and those that have been completed were performed using the -test or fisher s exact test. all statistical analyses were undertaken in stata 11.2 (statacorp lp, college station, tx, usa). from october 2007 through december 2012 there were 2,388 interventional bioequivalence and bioavailability trials registered in clinicaltrials.gov. of these, 227 (10%) trials are actively recruiting participants, 15 (1%) are recruiting by invitation only, 87 (4%) are engaged in data analysis, and 2,059 (86%) have been completed. ongoing bioequivalence and bioavailability trials are more likely to be in later phase clinical trials, as reflected by a decrease in the proportion of phase 0, 1, and 1/2 trials from 75% among completed studies to 36% of ongoing studies (p<0.001). ongoing trials are also more likely to be double - blinded (27% vs. 12% ; p<0.001) and have larger sample sizes (p<0.001). similarly, ongoing trials are more likely to feature parallel group assignment and less likely to be crossover trials (p<0.001 for both). there has also been an increase in the proportion of trials that primarily involved research on treatments from 42% to 55% (p<0.001). the proportion of trials that exclusively recruited male participants declined from 20% to 9% (p<0.001) and the number of trials that enrolled children increased from 3% to 17% (p<0.001). more than half of the bioequivalence and bioavailability trials registered in clinicaltrials.gov were conducted internationally (58%). among ongoing trials, the majority of ongoing trials are recruiting participants in north america (52%) and europe (26%) ; however, east asia (7%), the middle east (4%), and south america (4%) are also involved in several ongoing bioequivalence and bioavailability trials. from october 2007 through december 2012 there were 2,388 interventional bioequivalence and bioavailability trials registered in clinicaltrials.gov. of these, 227 (10%) trials are actively recruiting participants, 15 (1%) are recruiting by invitation only, 87 (4%) are engaged in data analysis, and 2,059 (86%) have been completed. ongoing bioequivalence and bioavailability trials are more likely to be in later phase clinical trials, as reflected by a decrease in the proportion of phase 0, 1, and 1/2 trials from 75% among completed studies to 36% of ongoing studies (p<0.001). ongoing trials are also more likely to be double - blinded (27% vs. 12% ; p<0.001) and have larger sample sizes (p<0.001). similarly, ongoing trials are more likely to feature parallel group assignment and less likely to be crossover trials (p<0.001 for both). there has also been an increase in the proportion of trials that primarily involved research on treatments from 42% to 55% (p<0.001). the proportion of trials that exclusively recruited male participants declined from 20% to 9% (p<0.001) and the number of trials that enrolled children increased from 3% to 17% (p<0.001). more than half of the bioequivalence and bioavailability trials registered in clinicaltrials.gov were conducted internationally (58%). among ongoing trials, the majority of ongoing trials are recruiting participants in north america (52%) and europe (26%) ; however, east asia (7%), the middle east (4%), and south america (4%) are also involved in several ongoing bioequivalence and bioavailability trials. this study reveals that bioequivalence and bioavailability trials are part of a global clinical research enterprise. when compared to completed trials, ongoing trials are in later phases of clinical development, recruiting larger numbers of participants, and more likely to recruit women and children. these data suggest that bioequivalence and bioavailability studies are undergoing a transformation as drug makers seek to characterize the safety and efficacy of drug products in more rigorous trials that closely resemble their anticipated patient population. as the costs of healthcare and drug development have risen, there is a mounting incentive for improving our understanding of existing treatments while also enabling breakthrough discoveries. recently, the united kingdom has attempted to strategically align their clinical research funding with their public health priorities. although similar measures have not been enacted in the united states, it behooves policy makers to consider the vital role that bioequivalence and bioavailability studies play in bringing new and generic drug products to the public. as noted here, the quality of bioequivalence and bioavailability studies has improved rapidly, even over the last five years, and the horizon is bright. however, as the national debate on healthcare reform and research priorities unfolds we may need to re - evaluate our approach to bioequivalence and bioavailability trials to ensure that safe and efficacious medicines swiftly reach healthcare providers and their patients. | drug development is an expensive process that is marked by a high - failure rate. for this reason early stage bioequivalence and pharmacokinetic studies are essential in determining the fate of new drug products. in this study, we sought to systematically assess the current trends of ongoing and recently completed bioequivalence and bioavailability trials that have been registered within a national clinical trials registry. all bioequivalence and bioavailability studies registered in the united states clinicaltrials.gov registry from late-2007 through 2011 were identified. over this period, more than 2300 interventional bioequivalence and bioavailability trials were registered. as of 2013, the vast majority of studies (86%) have been completed, 10% are actively recruiting participants, and the remainder are engaged in data analysis (4%). when compared to completed trials, ongoing trials are in later phases of clinical development, recruiting larger numbers of participants, and more likely to recruit women and children (p<0.001 for all). these data suggest that the quality of bioequivalence and bioavailability studies has improved rapidly, even over the last five years. however, further work is needed to sustain and accelerate these improvements in the design of bioequivalence and bioavailability studies to ensure that safe and efficacious medicines swiftly reach healthcare providers and their patients. |
while type 1 diabetes (t1d) has not traditionally been associated with obesity and metabolic syndrome, recent studies indicate that the prevalence of patients with t1d that are overweight or obese is as high as 50%, with 8% to 40% meeting the diagnostic criteria for metabolic syndrome. the rising incidence of obesity in patients with t1d has been shown to be related to the use of intensive insulin therapy to maintain tight glycemic control [2, 3 ]. obesity is a growing problem for patients with t1d given the vicious cycle of obesity - induced insulin resistance necessitating increasing insulin requirements to preserve glycemic targets, which leads to further weight gain. although bariatric surgery has been proven to be an effective treatment modality for the improvement and resolution of type 2 diabetes (t2d) in patients who are obese [4, 5 ], the utility of bariatric surgery for t1d remains controversial. the initial belief that normalization of glucose levels in obese patients with t2d after bariatric surgery was primarily attributed to weight loss effects discouraged the application of bariatric procedures in patients with t1d, since autoimmune destruction of beta cells rather than obesity - induced insulin resistance was considered the major pathophysiologic factor for the development of t1d. while some authors suggest that weight loss independent mechanisms such as gastrointestinal hormone modulation also play a part in the remission and improvement of t2d after bariatric surgery [6, 7 ], the effectiveness of these changes in the absence of residual beta cell function, as is the case in t1d, remains unclear. few data is available regarding the impact of bariatric surgery in obese patients with t1d, although early small case reports suggest that bariatric surgery leads to reduction in insulin requirements in addition to improvements in body mass index and other comorbidities. therefore, given that the incidence of obesity in patients with t1d is increasing and that obesity can significantly complicate glycemic control, it is necessary to define the effects of bariatric surgery in this population. to date, bariatric surgery outcomes in obese patients with t1d have not been quantitatively summarized, although a number of single center experiences and small case series have been published in the last few years. the aim of this systematic review and meta - analysis is to evaluate the effects of bariatric surgery on body mass index (bmi), total daily insulin requirement, and glycated hemoglobin (hba1c) in obese patients with t1d. a comprehensive search of electronic databases including medline, embase, scopus, the cochrane library, and web of science from 1946 to july 2015 was completed. title searching was restricted to include type 1 diabetes mellitus in conjunction with the following keywords / terms : bariatric, gastric bypass, gastric band, and sleeve gastrectomy. a manual search of the reference lists of pertinent articles abstracts were screened by two independent reviewers and selected based on the following inclusion criteria : human studies, adult subjects 18 years, clinical obesity bmi 35 kg / m at baseline, primary bariatric surgery performed, diagnosis of t1d at baseline confirmed by the presence of pancreatic autoantibodies (islet cell or glutamic acid decarboxylase), absence of c - peptide, documented history of dka, and/or insulin therapy required from the time of diagnosis. articles were excluded if they were letters, comments, or published in abstract form only. full articles for all selected abstracts were screened more thoroughly using the same selection criteria. pertinent data was collected from full - text articles for all selected abstracts by two independent reviewers and discrepancies were resolved by consensus. while there was more than one publication from the same study population, only the most recent findings were included for the analysis. secondary outcomes included basic patient demographics, sample size, duration of study follow - up, type(s) of bariatric surgery performed, weight loss outcomes, and other diabetes related outcomes. descriptive categorical data were expressed as percentages and continuous data were expressed as weighted mean standard deviation (sd) where appropriate. meta - analysis was used to compare the outcomes of weight loss and glycemic control indicators (hba1c and total daily insulin requirement) where data was available. the estimated effects were calculated using the latest version of revman software provided by the cochrane website. the random - effects method was applied in our analysis, assuming that the true effect estimates varied among studies. preliminary searching of the electronic databases identified 202 potentially relevant articles. after screening abstracts against the selection criteria, republication of studies by czupryniak. and middelbeek. was excluded (n = 3), as well as studies where the primary outcome of interest could not be extracted (n = 2) [9, 10 ]. in total, 13 primary studies comprising 86 subjects were included in this systematic review and meta - analysis (figure 1). included studies were published between february 2010 and july 2015 ; 11 were case series and 2 were case reports [8, 1122 ] (table 1). of note, was excluded as the patient was < 18 years old and was clinically diagnosed with t2 dm at baseline. all studies had clear study designs, aims, consecutive study patients, and appropriate endpoints and follow - up times. subjects had a mean age of 41.16 6.76 years (n = 64) with a preoperative weight and bmi of 123.50 3.84 kg (n = 21) and 42.50 2.65 kg / m (n = 86), respectively. roux - en - y gastric bypass (rygb) was the favored procedure accounting for 69% (n = 59/86) of bariatric surgeries performed, followed by sleeve gastrectomy and biliopancreatic diversion at 15% (n = 13/86) and 14% reported two cases of adjustable gastric banding comprising 2% (n = 2/86) of the bariatric operations in this analysis. weight loss outcomes were evaluated based on changes to bmi postoperatively at 12 months and at study endpoint. eight studies reported bmi at 12 months postoperatively (n = 40) [13, 14, 1619, 21, 22 ] ; bmi at study endpoint was reported for all studies. there was a marked reduction in bmi postoperatively at 12 months and at study endpoint to 29.55 1.76 kg / m (p < 0.00001) and 30.63 2.09 kg / m (p < 0.00001), respectively (figure 2). changes to both total daily insulin requirement and hba1c were analyzed to determine the effect of bariatric surgery on glycemic control. postoperative daily insulin requirement at 12 months and study endpoint was reported in seven (n = 33) [14, 1619, 21, 22 ] and ten studies (n = 59) [8, 12, 1522 ], respectively. preoperative weighted mean total daily insulin requirement was 98 26 iu / d, which decreased significantly to 36 15 iu / d (p < 0.00001) and 42 11 iu / d (p < 0.00001) at 12 months and at study endpoint, respectively (figure 3). of note, weight - adjusted total daily insulin requirement at baseline and postoperatively at study endpoint was reported in all but one study (n = 76), which also decreased appreciably from 0.78 0.20 iu / d / kg to 0.48 0.11 iu / d / kg, respectively (p = 0.0001). in terms of hba1c, this was reported in eight studies at 12 months postoperatively (n = 40) [13, 14, 1619, 21, 22 ] ; hba1c at study endpoint was reported for all studies. weighted mean preoperative hba1c was 8.46 0.78% (n = 86), which decreased to 7.95 0.55% (p = 0.01) and 8.13 0.86% (p = 0.03) at 12 months and at study endpoint, respectively (figure 4). this systematic review and meta - analysis demonstrates that obese patients with t1d are able to achieve marked reductions in bmi after bariatric surgery. moreover, bariatric surgery not only leads to a substantial decrease in total daily insulin requirement but also improves long - term glycemic control as evidenced by a statistically significant reduction in hba1c postoperatively. while a qualitative summary of the current literature on the topic of bariatric surgery in patients with t1d has previously been published, this study is the first meta - analysis of its kind to evaluate weight loss and glycemic status related outcomes in this population. bariatric surgery has been proven to lead to cessation or reduction in insulin requirements for obese patients with t2d on insulin therapy. many authors suggest that this decrease in need for exogenous insulin is associated with the positive effect of weight loss on insulin sensitivity in the liver and peripheral tissues [6, 25 ]. similarly, this analysis reports a marked and sustained reduction in bmi for obese patients with t1d after bariatric surgery (weighted mean difference of 13.42 at study endpoint, p < 0.00001) that is accompanied by a reduction in total daily insulin requirement (weighted mean difference of 49.98 iu / d at study endpoint, p < 0.00001). the observed correlation between weight loss and reduced insulin requirements suggests that although insulin resistance has traditionally only been associated with the pathophysiology of t2d, it may play a role in obese patients with t1d as well. furthermore, this finding adds validity to the accelerator hypothesis that proposes that t1d and t2d, rather than being separate disease processes, belong to the spectrum of a single disorder driven by insulin resistance, which inevitably leads to beta cell loss but at different tempos depending on genetic background. the existence of latent autoimmune diabetes in adults (lada), which describes patients with the t2d phenotype who possess islet cell antibodies but experience slowly progressive beta cell failure [27, 28 ], also supports this hypothesis. this analysis also reports that obese patients with t1d are able to achieve appreciable reductions in hba1c after bariatric surgery (weighted mean difference of 0.64% at study endpoint, p = 0.03). however, while an improvement in postoperative hba1c was observed, it failed to meet the recommended target of 7.0% considered for optimal glycemic control. some studies suggest that the elevated postprandial secretion of glp-1 observed after bariatric surgery may not have as significant glucagonostatic effects as previously believed [13, 16 ]. more importantly, glp-1 has been shown in animal models and isolated human islets to enhance beta cell function, including beta cell glucose sensitivity and stimulation of insulin secretion, as well as inducing beta cell neogenesis and proliferation while suppressing apoptosis [6, 16 ]. these contributions appear to have less of a positive effect on glycemic control in patients with little to no residual beta cell function, as is the case in t1d. this finding is consistent with three case series included in this analysis that demonstrated improved glycemic control reflected in normalization of hba1c in patients with c - peptide positive t2d requiring insulin therapy but not in those with c - peptide negative t1d [1315 ]. other studies have suggested that ongoing islet cell regeneration is present even in patients with longstanding t1d and that the timing of bariatric surgery is crucial, as glp-1 mediated effects may help to preserve beta cell mass and prevent progression to total insulin deficiency if surgery is performed early in the course of the disease [6, 15, 16 ]. another complicating factor to good glucose control in the obese patients with t1d given their persistent absolute insulin requirement is the high glucose variability that occurs after bariatric surgery, specifically in rygb, which accounted for 69% of the procedures in this analysis. high and early postprandial hyperglycemic peaks followed by rapid interstitial glucose decreases are observed after rygb, which may account for the hypoglycemic - like symptoms that have been previously reported in patients with t2d after bariatric surgery [15, 22, 29 ] and, in the t1d population, can contribute to a mismatch between blood glucose and subcutaneous insulin administration. use of sleeve gastrectomy may be more suitable for obese patients with t1d as it facilitates a more predictable absorption of carbohydrates and potentially less glycemic variability than what is seen in rygb [5, 12 ]. the present study highlights the fact that the metabolic benefits of bariatric surgery in obese patients with t1d are not well studied and remain poorly understood. this analysis is limited by the quality of the available studies, the majority of which were case series with a few case reports. furthermore, there was significant statistical heterogeneity among the studies in the meta - analysis performed, which limits the conclusions that can be drawn from the available data. in addition, all included studies were insufficiently powered for the primary outcome of hba1c, with only one study describing an experience of more than 10 subjects. ideally, randomized controlled trials comparing medical management of obesity to bariatric surgery in patients with t1d are needed, similar to the well - established studies published for t2d. in addition, the current study was unable to address rates of improvement and resolution of comorbid conditions due to insufficient reporting or inconsistent definitions used across the studies. previous studies have reported conflicting findings regarding improvement of diabetes associated complications and cardiovascular disease [16, 22 ]. in summary, this systematic review and meta - analysis demonstrates that obese patients with t1d can achieve marked reductions in weight as well as improvements in glycemic status reflected in both total daily insulin requirement and hba1c after bariatric surgery. | background. the utility of bariatric surgery in type 1 diabetes remains controversial. the aim of the present study is to evaluate glycemic control outcomes in obese patients with type 1 diabetes after bariatric surgery. methods. a comprehensive search of electronic databases was completed. inclusion criteria included human adult subjects with bmi 35 kg / m2 and a confirmed diagnosis of type 1 diabetes who underwent a bariatric surgical procedure. results. thirteen primary studies (86 patients) were included. subjects had a mean age of 41.16 6.76 years with a mean bmi of 42.50 2.65 kg / m2. there was a marked reduction in bmi postoperatively at 12 months and at study endpoint to 29.55 1.76 kg / m2 (p < 0.00001) and 30.63 2.09 kg / m2 (p < 0.00001), respectively. preoperative weighted mean total daily insulin requirement was 98 26 iu / d, which decreased significantly to 36 15 iu / d (p < 0.00001) and 42 11 iu / d (p < 0.00001) at 12 months and at study endpoint, respectively. an improvement in hba1c was also seen from 8.46 0.78% preoperatively to 7.95 0.55% (p = 0.01) and 8.13 0.86% (p = 0.03) at 12 months and at study endpoint, respectively. conclusion. bariatric surgery in patients with type 1 diabetes leads to significant reductions in bmi and improvements in glycemic control. |
replacement of maxillary anteriors has always been a challenge for the restoring dentist as the associated problems in smile line determination, establishing anterior guidance and esthetics complicate the treatment plan. the loss of teeth may or may not be associated with a soft or hard tissue defect. local soft tissue unavailability, to cover the graft, can lead to failure of the graft. apart from other anatomic limitations, systemic influences such as diabetes, hyperparathyroidism, and other metabolic disorders can lead to failure. economic constraints and risk of failure can also limit the option of surgical technique for augmentation. conventional fixed partial dentures can be a treatment option for such situations and can be achieved with gingival extension of the metal framework with gingival porcelain.1 this can provide soft and hard tissue defect restoration along with replacement of teeth. a fixed - removable prosthesis system may be an alternative to such situations.2 the advantages of fixed prosthesis such as retention and stability and the advantages of a removable acrylic segment such as less weight, less cost and ease of maintenance is combined. the longevity of this system is documented by the pioneer of this prosthesis for a period of 20 years with evidence of optimal success rate. very few clinical reports have been documented in the literature with minimal follow - up over a period to validate the success of this treatment modality. james a. andrews,3 is presented below for such a condition, which had a definite advantage over other systems or a conventional removable acrylic denture. a 21-year - old male reported to the dental office, who was in need replacement of missing anteriors. he had a history of an accidental fall when he was 9 years of age, following which he had lost all the maxillary anterior teeth with dento - alveolar fracture of the maxilla. three years ago, he underwent replacement with a fixed partial denture fabricated in metal with acrylic facing. for the past 6 months, the prosthesis underwent repeated dislodgement due to the cementation failure (figure 1). on examination, there was missing maxillary anterior teeth, right and left first premolars had been prepared to receive a fixed partial denture. the attached gingiva thickness measured about <3 mm and there was a reduction in the labial vestibular depth. pre - operative photograph of patient with an unaesthetic prosthesis. with the background of the examination findings, the treatment plan for a fixed removable prosthesis was developed for the patient. the mounted diagnostic casts with facebow transfer provided visual appeal of the existing smile and about the plan for the prosthetic smile (figure 2a). diagnostic wax - up of the finished prosthesis was made with wax with incisal guidance kept as close to zero as possible. try - in of the metal framework was carried out and pick up impression was made with putty (condensation silicone) and sent to the lab, for the fabrication of removable partial denture (figure 2b and c). putty indices were made and sent to the laboratory along with the diagnostic wax up and hence that the metal framework of the bar could be fabricated within the substance of the removable acrylic segment. (a) facebow transfer, (b) metal try in, (c) pickup impression. the fixed part had metal ceramic crowns cemented to the prepared premolar teeth with a hader bar over the edentulous ridge with adequate tissue relief (figure 3a). final try in of the fixed and removable segment of the prosthesis was carried out. the removable partial denture was a conventional removable partial denture without a palatal extension which would anchor over the bar by means of retentive clips, which were fabricated chair side using auto polymerising acrylic resin (figure 3b and c). he was also encouraged for periodic recalls and checkups for the maintenance of the prosthesis and the components. follow - up in the 1st month revealed that he was extremely happy with the esthetics and able to use the prosthesis for chewing and other routine functions with ease (figure 4a and b). (a) cemented crown with blockout of undercut, (b) relief created in denture base for retentive clips, (c) retentive clip picked up in denture base using self cure resin (a) intraoral view of fixed and removable component,(b) post - operative photograph with esthetic smile replacement of missing teeth with soft and hard tissue defects have been carried out in the past with an attempt to rehabilitate the patient, fulfilling the objectives of preserving the remaining tooth structure, achieving optimum retention, stability, satisfying esthetics and a stable foundation for support. the major objective of any dentist would be to preserve the remaining tissues as muller devan rightly pointed out in his dictum.4 the planned prosthesis obtained support from the adjacent teeth or the bone, in an idea to distribute stresses to the bone and teeth. surgical augmentation of lost hard and soft tissues had a limitation, as the soft tissue procure to cover the augmented material would be inadequate. hence, the restoration of the defect was planned prosthetically along with the replacement of missing teeth. in this case, the support mechanism is shared by the tooth, and the tissues also to an extent and the bar serves as a retentive and stabilizing tool for the removable segment. the previous prosthesis had poor esthetics as the teeth were positioned short of the occlusal plane, to reduce the weight of the prosthesis and had failure of cementation due to increased span length. the added bulk of the material, to replace the soft tissues, would deliver the load on the remaining abutment teeth and compromise its periodontal status. another design of the prosthesis would be a complete fixed partial denture with an acrylic gingival prosthesis the availability of remaining bone and increased length of the crowns, thereby compromising the crown - fixture ratio have limited this option. the case selection in this situation has narrowed all other options to a simple yet time - tested design of fixed - removable prosthesis the andrews bar prosthesis. the main drawback in this system is the removable component, which reduces the acceptance towards the treatment, especially a younger individual. with proper counseling and reassurance, the patient can be made to accept the treatment and also be motivated for proper maintenance of the prosthesis. the patient should be called for regular check up and chair side replacements of retentive clips. selection of case is the key to success for any treatment. in the field of restoration and replacement, knowledge of techniques available along with the skill of the dentist and technician plays an important role in the success of the restoration. the pros and cons of the available treatment options, based on the limitations offered from the aspect of patient should be analyzed and decision should be made after discussion with the patient. when the patient is involved in the decision - making process, it can increase the level of acceptance of the treatment and motivate the individual toward maintenance of the prosthesis. in this case report with proper analysis of the diagnostic factors and involvement of the patient in the decision - making process, fixed removable prosthesis need not limit itself to be just a prosthetic alternative but a definite treatment option. | fixed replacement of maxillary anterior teeth with an associated bony defect has challenged the restoring dentist with problems like weight of the prosthesis thereby leading to weakening of abutment teeth, difficulty in establishing smile line and mechanical stability. this article describes the management of a patient with such defect with a forgotten prosthesis the andrew bridge system, which has a fixed and a removable prosthetic component with retentive clips, which anchors on to a bar spanning the edentulous space. andrew s bridge system has definite indications and offers immense advantages over the other prosthesis for rehabilitation of cases of such scenario. it addresses the problems aforementioned and provides the optimal retention, mechanical stability, esthetics and comfort to the patient. |
after decades of drawbacks, cancer immunotherapy finally started to deliver its promise. as far as radiation and conventional cytostatic drugs mainly achieved its pinnacle in therapeutic efficiency and there is not much space left for their improvement, oncologists see the future of the anticancer treatment mainly in two approaches : targeted therapy and immunotherapy. however, for most common human cancers such as breast and prostate cancers there were no specific targets found so far (except her2 for a fraction of breast cancers). an emerging approach to treat such tumors is to boost tumor - specific immune response. this approach is based on a valid assumption that tumor development and growth is accompanied by suppression of host 's immune system and/or escaping from immune surveillance ; therefore stimulation of immunity or targeting hidden tumor antigens should lead to anti - tumor response. gurin) vaccine used to treat nonmuscle invasive form of bladder cancer is early successful example of such immune booster, which works, apparently, via stimulation of local innate immune response. currently, there are also several immunotherapeutics approved by fda or in phase iii clinical trials, such as monoclonal antibodies to pd-1 and ctla-4 which are effective in metastatic melanoma. their activity is based on relieving immunosuppression caused by tumors, and their efficiency in clinics (although only in fraction of patients) with rather mild toxicity is a proof of principle that immune system of a cancer patient is not completely disabled and can be awakened. another mainstream of cancer immunotherapy is based on boosting patient 's immune response to cancer - specific antigens (ag) by vaccines. accordingly, first were approved the vaccines against cervical cancer target ag of human papilloma viruses (e.g., e6/e7 antigens of hpv16 and hpv18). except for head and neck cancer where hpv is also involved, or hepatoma, where hcv plays a pathological role, a vast majority of human tumors, however, are not caused by viruses, therefore the choice of a tumor ag is challenging. furthermore, anticancer vaccines tested so far are not effective, in particular, since they apply selective pressure on cancer cells, which led to the loss of the vaccine - encoded ag (immunoediting) and resulted in the tumor relapse. as a result, despite numerous attempts, there is only one anticancer vaccine approved so far for common cancer (provenge for prostate cancer), with pap (prostate alkaline phosphatase) as an ag. however, this vaccine has rather limited effect (increase in survival by only 4 month), requires sophisticated in vitro production, and is very expensive. despite these drawbacks, it demonstrates that host 's immune system can be enforced to fight cancer, although with an additional help from in vitro propagated immune cells. dna vaccine is an antigen - encoding vector which is administered to the patient in order to elicit immune response. typically, a dna vaccine vector is a plasmid, circular double stranded bacterial dna. dna vaccines enter myocytes and tissue - resident apc (ag - presenting cells, e.g., macrophages) which results in intracellular synthesis of vaccine - encoded tumor antigen. after the vaccine - encoded protein is expressed and processed, antigen - derived peptides are presented to nave t - cells with subsequent generation of ag - specific cytotoxic cd8 + t - cells (ctl) and humoral immune response [7, 8 ]. the key difference between a dna vaccine and a protein vaccine is that the antigen is expressed intracellularly. as a result, the antigen undergoes posttranslational modifications and antigen presentation through an entire array of naturally occurring intracellular mechanisms, which leads to several advantages. for example, dna vaccines can induce very strong t - cell and b - cell responses even if amounts of antigen produced in situ is minimal. for example, a dna vaccine can encode two forms of an antigen, proteosome - resistant and proteosome degradable forms. it was shown that combination of these two forms elicits stronger immune response than either of these two forms alone. in the future, vaccine - encoded ag can be modified, so it can be produced in a form with an optimal rate of proteosome degradation of an encoded protein. furthermore, an order to modulate an intracellular ag fate, dna vaccines can be engineered to express a tumor ag fused with an adjuvant protein, for example, polyglutamine sequence, inducing intracellular self - binding and aggregate formation of the vaccine - encoded antigen, which also lead to better immunogenicity. until recently, there were two significant drawbacks of dna vaccine methodology. first, dna vaccines could not be used for cytotoxic proteins because high level of their expression would kill the vaccine - transfected cells. second, for some ags, extracellular expression of their wild - type protein forms could lead to manifestation undesirable / toxic activity of the ag protein. at the same time, it was not possible to inactivate negative functions of the ag protein introducing mutations into the plasmid, because a mutated gene possessed a very low expression level. due to developments of past decade, a vaccine - encoded protein can be modified to eliminate its negative and/or dangerous properties while preserving all immunogenic domains. utilizing plasmids as a backbone provides significant benefits. bacterial sequences such as unmethylated cpg islands in the plasmid vector operate as an adjuvant, stimulating activation of tlr9. from the point of view of public health feasibility, dna vaccines can be generated in large amounts and with clinical grade purity in inexpensive and rapid fashion ; they are safe and highly stable comparing to protein vaccines. despite their great promise dna vaccines face two major stumbling blocks : (i) immune response they elicit may be strong enough for small animals, but not for humans (see ref. for review) ; and (ii) mutations introduced into the antigen may alter its mrna structure, which may lead to severe reduction in expression level. nevertheless, there are several dna vaccines approved already for veterinary applications, including anti - melanoma dna vaccine (oncept) for dogs. among approaches to increase efficiency of anticancer dna vaccine in humans are improving its administration (e.g., electroporation and gene gun which increases delivery of plasmid dna by several times) and use of enhancers of immune response (e.g., gm - csf, il-2), which can be also coded by plasmid dna. use of viral vectors such as retroviruses, lentiviruses, and adeno (or adeno - associated) viruses, although increasing delivery of dna, but also have its limitation : possible carcinogenesis due to insertion of viruses in host genome, immunogenicity, broad tropism, limited packaging capacity, and difficulty of viral production. to avoid these drawbacks of viral vectors, current development of material sciences and nanotechnology, as well as in nucleic acid chemistry led to emergence of more efficient nonviral delivery system (e.g., lipid - based and polymeric) some of which are now being tested in clinical trials (see ref. for review). according to clinicaltrials.gov, there are 190 trials listed of cancer treatment which used or currently using dna vaccination alone or with some combination. among targeted cancer ag are e6/e7 proteins of hpv-16 for cervical cancer, alpha - fetoprotein for liver cancer, cea for colon cancer, trp2 for melanoma, pap for prostate cancer and some others. furthermore, there are several dna vaccines approved already for veterinary applications, including antimelanoma dna vaccine (oncept) for dogs, demonstrating feasibility of dna vaccination. in 2009, a group of specialists in cancer immunotherapy made an attempt to prioritize cancer antigens for acceleration of translational research (national cancer institute pilot project). they created nine criteria and evaluated 75 tumor antigens being studied in clinics and preclinically at that time. the first ranking criterion (weighting 31%), unsurprisingly, was therapeutic function (i.e., at least some efficiency in clinical trials), then, in descending order : (2) immunogenicity ; (3) role of agin oncogenicity ; (4) specificity ; (5) expression levels and percent of antigen - positive cancers ; (6) stem cell expression ; (7) number of patients with ag - positive cancers ; (8) number of antigenic epitopes ; (9) cellular location of ag expression ; first four criteria were the most important, giving in total 79% contribution in prioritization. if we exclude first therapeutic criterion to choose an ag for preclinical studies, there will be only three major criteria left. in other words, ideally, an antigen for anticancer vaccine should be : (i) immunogenic ; (ii) essential for cancers cells (to avoid its loss through immune - editing), but dispensable for normal tissues to reduce the risk of toxicity, and (iii) overexpressed in tumors as compared to the normal tissues. we hypothesized that p62 protein (sequestome 1) may be such an excellent target as a cancerag. structure of p62 (sqsm1) and functions of its domains in cell signaling and protein degradation. p62 protein is a major player in selective macroautophagy and serves as a signaling hub for several signal transduction pathways, among them nf - kb, traf6, map kinases, twist1 etc. [1922 ] (figure 1) importantly, p62 is dispensable for normal tissues, but essential for development and survival of tumors (table 1). first, p62 knockout mice are viable and demonstrate only minor anomalies (later - onset obesity), indicating that, at least under normal conditions, other proteins can substitute functions of p62 (e.g., p62 homolog nbr1 in autophagy). but as for tumor development, the situation is quite different. at least in several mouse models studied, knockout of p62 prevented or markedly delayed development of cancer caused by oncogenes (table 1). furthermore, fully transformed cells do not lose its dependence on p62 since its knockdown causes inhibition of growth or loss of viability (table 1). although p62 is not oncogene per se, such dependence of tumors on some proteins is a well - known phenomenon called nononcogene addiction. according to this notion, proteins dispensable for normal cells become necessary for transformed cells. along with oncogenes such as myc and ras whose inactivation leads to tumor suppression or even eradication, these nononcogenic proteins are also considered as good therapeutic targets especially when oncogenes are difficult to find or they are undruggable. which of the p62 activities are critical for tumorigenesis ? it appears that autophagy at early stages of tumor development is not required but rather detrimental. at these stages, p62 is important as a signaling hub, in particular, by activation of proinflammatory and prosurvival nf - kb pathway [19, 20, 26, 27 ] or twist1, which is involved in cell proliferation, migration, and metastases (figure 1). in contrast, at later stages of tumor development, autophagy plays a distinct protective role, and its inhibition per se has antitumor effect. some tumors such as pancreatic cancer become addicted to autophagy, and accordingly, there are several ongoing clinical trials with autophagy inhibitor chloroquine alone or in combination with chemotherapy [28, 29 ]. whatever the mechanisms of tumor dependence on p62, this is apparently a wide - spread phenomenon (table 1). another requirement for being a good agfor anticancer vaccine is the higher expression level in tumor tissue. indeed, according to data of oncomine (the largest database of human cancer microarrays) and other reports, at least 10 various types of human cancer have high levels of p62 comparing to normal tissue (table 1). for instance, in melanoma, p62 levels are 10-times higher (oncomine). furthermore, in several types of tumors, levels of p62 increase during progression (table 1) we have found that common oncogenes such ras, pik3ca, and her2 can induce p62 in vitro. in addition, tumor microenvironment such as inflammation and oxidative stress can activate p62 via nf - kb and nrf-2 transcription factors. interestingly, activation of these transcription factors also depends on p62 which leads to a positive feed - back loop [27, 31 ] (figure 1). the majority of cancer ags targeted so far are extracellular membrane proteins, but p62 is an intracellular protein. however, recently accumulated data indicate that intracellular proteins also can be feasible ags for antibody response, for instance survivin, prl-3 cancer - associated phosphatase, [3234 ], or wt1. there are several proposed mechanisms of targeting of these proteins by immune system : (i) uptake of antibodies (e.g., via endocytosis) and neutralization of the ag ; and (ii) displaying of the ag on the surface via unconventional secretion pathway ; [36, 37 ]. relative contribution of these mechanisms in immune response to intracellular agis currently unknown, but at least in case of prl-3 oncoprotein, both b - cells and nk cells seems to be necessary, whereas t - cells are dispensable. at the same time, antibody to wt1 was effective even in scid mice (i.e., without both t- and b - cells). last but not least, proteolytic fragments of intracellular p62 may be presented by mhc - i molecules to attract ctl, which makes dna vaccines and dna vaccination approach particularly attractive. based on above considerations, we have chosen p62 was as an ag for a dna vaccine and evaluated its antitumor effect. in studies of hundreds of animals, p62 vaccine has proven its effectiveness in five kinds of solid tumors in mice and rats : lung and breast carcinomas, melanoma and sarcoma (table 2). more importantly, it also possessed strong antimetastatic activity in three models of metastases : spontaneous metastases to lung (lewis lung carcinoma), to regionary lymph nodes (sarcoma 37), and induced metastases (by i.v. we also found that, at least in case of lung carcinoma and melanoma, p62 vaccine decreased both the number and size of metastasis, indicating that it suppresses both colonization of lung by tumor cells (e.g., formation of micrometastases), as well as growth of established metastases. of note, in case of melanoma, p62 vaccine was effective not only in preventive (given 2 weeks before tumor inoculation), but in therapeutic setting as well (after tumor inoculation), suppressing both primary tumor and metastases. this metastatic melanoma model, where tumor cells are already in circulation (after i.v. injection) and p62 being injected afterwards more closely resembles human cancer, where many patients are first diagnosed with cancer when metastatic process is already underway. since great majority of patients (about 90%) die from metastases rather than from primary tumors, such antimetastatic effect of p62 vaccine seems very encouraging. also encouraging are our preliminary data about the effect of the vaccine on spontaneous tumors in dogs, in particular, mammary tumors. given on compassionate use basis to several dogs with incurable cancers, p62 vaccine halted the progression of the disease and markedly improved animal 's well - being (manuscript in preparation). as a next step in preclinical development of p62 dna vaccine as a candidate for future clinical trials, its toxicological properties were tested in mice, rats, guinea pigs, and dogs. as one can see from table 3, the vaccine was well - tolerated, without acute or chronic toxicity, allergic activity, and it did not cause embryonic toxicity and teratogenicity. there was no hematotoxic, hepatotoxic, and nephrotoxic effects, as well as effects on carbohydrate and lipid metabolism. furthermore, histological examination of brain, heart, lung, liver, kidney, spleen, thyroid, and thymus did not find any anomalies (shifrin.. therefore, antitumor and anti - metastatic activity of p62 vaccine was not accompanied by any significant side effects, as expected for dna vaccines. overall, preclinical data presented above justifies further veterinary research and human clinical testing of p62-encoding dna vaccine as a novel anticancer agent. the authors are employees of curelab oncology inc. the authors alone are responsible for the content and writing of the article. | cancer immunotherapy is a thriving field, but its clinical achievements are modest so far. one of its major hurdles seems to be finding a feasible cancer antigen as a target for immune response. after many years of research, three major criteria for choice of tumor antigens emerged. an antigen should be : (i) immunogenic ; (ii) essential for cancers cells (to avoid its loss through immunoediting), but dispensable for normal tissues to reduce the risk of toxicity, and (iii) overexpressed in tumors as compared to the normal tissues. here we argue that p62 (sqstm1), a protein involved in autophagy and signal transduction, fits all the above criteria and can be chosen as a novel cancer antigen. accordingly, we carried out an extensive study and found antitumor and antimetastatic activity of p62-encoding dna vaccine in five types of commonly used transplantable tumor models of mice and rats, and spontaneous tumors in several dogs. given that toxicity of p62 vaccine was minimal, if any, we believe that p62-encoding vaccine merits further clinical development. |
this study took place in the women s ambulatory health services (wahs) clinic at hartford hospital, an inner - city, tertiary care hospital in hartford, conn. in july 2011, the wahs clinic changed its routine gdm screening from the 50-g, two - step process to the 75-g, one - step process. routine management included testing all nondiabetic pregnant women for gdm between 24 and 28 weeks gestation. high - risk women (patients with a history of gdm or macrosomia or who were obese) were screened at their initial prenatal visit. if that screening was negative, they were screened again between 24 and 28 weeks gestation. using the two - step method, women were considered to have screened positive for gdm if they had a serum glucose value 135 mg / dl 1 hour after the nonfasting 50-g challenge test. the threshold values used for the ogtt were : fasting 95 mg / dl, 1-hour 180 mg / dl, 2-hour 155 mg / dl, and 3-hour 140 mg / dl, based on the criteria of carpenter and coustan, with two abnormal values required for diagnosis. women with a 50-g test result > 183 mg / dl were not given the ogtt and were diagnosed with gdm. for the one - step screening, the criteria used for this method were based on the hyperglycemia and adverse pregnancy outcome (hapo) study. the threshold values were : fasting 92 mg / dl, 1-hour 180 mg / dl, and 2-hour 153 mg / dl. all women diagnosed with gdm were treated in a similar manner throughout the study period with dietary modification and/or insulin depending on their capillary blood glucose values. glucose screening and outcome data from the 9 months (1 october 2010 to 30 june 2011) preceding the change in screening method were collected and compared to data from the first 6 months (1 july 2011 to 31 december 2011) of the one - step screening process. for patients who had glucose testing performed at the end of the study period, data collection continued for an additional 3 months (1 january 2012 to 30 march 2012) to include delivery outcomes. included records were those of female patients 18 years of age who were seen at the wahs clinic during the allotted time period. excluded records were those of female patients who were 95 mg / dl fasting and > 120 mg / dl postprandially. another limitation is the historical nature of the data collected, although both groups, the health care providers, and the practices were similar throughout the study period. the one - step, 2-hour screening for gdm appears to be associated with an increased rate of gdm, despite decreased rates of screening, without improving maternal or neonatal outcomes. an increase in the rate of gdm using the one - step screening would also be expected to increase health care costs by increasing doctor visits, ultrasounds, nutrition and diabetes team counseling, and home glucose testing. | in briefscreening for gestational diabetes mellitus is controversial. in their high - risk obstetrical practice, the authors did not find a difference in delivery or neonatal outcomes when using a one - step versus a two - step screening process. they did find lower rates of compliance with screening when using the one - step method. |
bone formation below the crown of mandibular horizontal incompletely impacted third molar on radiograph is frequently seen in the middle - aged and elderly. tooth germ has a thick lamina dura with a broad space between the crown and the surface of alveolar bone. since bone formation is generally seen accompanying bone modeling in young individuals, the deposition of bone gradually reduces the space between the crypt wall and the tooth to the dimensions of the periodontal ligaments.1 after bone growth, remodeling by balancing osteoblasts and osteoclasts is regulated as homeostasis in the volume of bone ; however, remodeling does not prevent skeletal aging after the third decade of life, resulting in decreased bone mass.2 moreover, bone resorption is affected with local factors, including inflammation and mechanical forces, malignant tumor, and administration of bisphosphonate and hormones. however, we have identified bone formation, from which it is difficult to discern the space from the enamel surface below the crown of mandibular incompletely impacted third molars in middle - aged and elderly individuals,3 and discussed the mechanism of occurrence,4 whereas an apparent space between the crown and bone with lamina dura was seen in young healthy individuals. local factors in the mouth, except ipsilateral tooth loss, did not seem to influence bone formation without the lamina dura in the space in elderly men ; that is, bone below the crown seems to arise from alveolar bone, although the reason why the space is filled with bone formation without a lamina dura in the middle - aged and elderly is unknown. this phenomenon may be crucial for maintaining teeth. in events during enamel maturation, death of ameloblasts occurs during the maturation stage of amelogenesis,5,6 and is defined as apoptotic death,7,8 which lasts until eruption, when the epithelium of the enamel organ fuses with the oral epithelium.9 maturing enamel loses organic content,10 accompanied with a decrease in the function of proteinases and degradation of proteins secreted into enamel,11 the peak of which occurs in the maturation stage.12 thus, ameloblasts may be a source of the proteinases digesting matrix protein in enamel.13 we hypothesized that mature enamel after protein loss might not reject bone and fills the space below the crown rather than a high activity of bone tissue in the elderly, whereas proteins secreted from ameloblasts may inhibit bone formation during eruption. we then studied the third molar with radiolucency without a lamina dura below the crown comparing with that with a lamina dura without radiolucency and that without a lamina dura without radiolucency to assess these characteristics and the effects of local factors. this provides a foundation for understanding the cause of bone formation in the third molar independently of the oral environment. we report the clinical importance of this bone formation, which is probably derived from mesenchymal tissue in the absence of cement and periodontium, especially in the middle - aged and elderly. orthopantomographs were examined in 104 teeth from 88 men and 67 teeth from 58 women who had horizontal incompletely impacted third molars at the initial examination for diagnosis and treatment between january 1988 and december 1995 at matsumoto dental university hospital, oral and maxillofacial surgery (table 1). the mean age standard deviation (sd) of 88 men was 48.93 13.59 (range, 3189 years), and that of 58 women was 41.93 9.46 (range, 3175 years). horizontal incompletely impacted third molars, in which the crown is partly at the level of the alveolar bone ridge, were monitored regarding the lamina dura and radiolucency below the crown of the tooth to the cementoenamel junction. the status of a horizontal incompletely impacted third molar was confirmed with orthopantomographs taken with a panoramax auto 20 ma, 8084 kvp (asahi, kyoto, japan) and the films were processed in an automatic developing machine (konica srx-501 ; konica, tokyo, japan). incompletely impacted third molars were horizontal to the second molar in angulation and were not fully covered with bone. horizontal angulation was measured using horizontal lines drawn at various heights at the occlusal plane of the second molar14 or the first molar when the second molar was lost, or the premolar when the second and first molars were lost. the inclination of the occlusal plane of the third molar was read from the line on a compass. teeth with inclinations of 70 or greater were selected as horizontal angulation following shiller.14 radiograms were measured twice by the same experienced oral surgeon. teeth with an inclination of 69 or smaller on either measurement were excluded from the study. teeth were classified into three groups based on the presence / absence of the radiolucency and the lamina dura below the crown of the horizontal incompletely impacted third molar, and analyzed by comparing these groups. out of three groups, one was the third molar with lamina dura without radiolucency (figure 1), one without a lamina dura with radiolucency (figure 2), and one without a lamina dura without radiolucency (figure 3). measurements of the presence / absence of radiolucency and the lamina dura were performed twice by an experienced oral surgeon. radiolucency below the crown was defined by a diffuse lucent area due to irregular widening of follicular space, ranging in width from 0 to 3.5 mm in maximum amount below the crown. the presence of the lamina dura below the crown was defined by a fully or partly uniform line as still present, even if the line was partly irregularly ruptured. absence of the lamina dura was defined as no detection of a white line below the crown. on the other hand, the degree of bone resorption at the mesial surface of the canine and the first molar was assessed for aging or periodontal disease. exposure of the root surface of the teeth was measured from the cementoenamel junction to the alveolar crest at the mesial site of the teeth, and exposure of the root surface was calculated as a fraction of the root length as determined radiographically. the mean sd rate of bone resorption between the first and second measurements in the canine and first molar was calculated, with the mean sd in those teeth in relation to the ipsilateral third molar, and grouped into categories with or without the lamina dura and the radiolucency below the crown of the third molar. imperfect views of the root because of imbrication of individual roots due to curvature of the dental arch were excluded from the assessment. when assessment of the presence or absence of radiolucency or lamina dura was different between the first and second measurements, this was also excluded from the study. patients with an apical lesion at the root of the mandibular second or third molar, a radiographically true cyst or tumor in the mandible, diffuse radiolucency below the crown, a completely impacted third molar, vertical impaction or distoangular impaction, and a restoration ending below the cementoenamel junction of the second molar were excluded from analysis. rates of teeth with and/or without a lamina dura and/or radiolucency and the ages of patients were calculated and analyzed statistically using student s t - test, fisher s t - test, or analysis among these groups. rates of teeth with and/or without a lamina dura and/or radiolucency and the ages of patients were calculated and analyzed statistically using student s t - test, fisher s t - test, or analysis among these groups. fifty - eight teeth with a lamina dura without radiolucency, 12 teeth without a lamina dura with radiolucency, and 34 teeth without a lamina dura without radiolucency in men, and 43 teeth with a lamina dura without radiolucency, 8 without a lamina dura with radiolucency, and 16 without a lamina dura without radiolucency in women were seen in subjects with a mandibular horizontal incompletely impacted third molar (table 1). we observed that the group with a lamina dura without radiolucency was significantly younger than the group without a lamina dura without radiolucency in men (p < 0.0001) and women (p < 0.01), and younger than the group without a lamina dura with radiolucency in men (p < 0.05) (table 2). alveolar bone resorption in the canine and first molar region could be assessed in 49 teeth with a lamina dura without radiolucency in men, 8 without a lamina dura with radiolucency in men, 28 without a lamina dura without radiolucency in men, 39 teeth with a lamina dura without radiolucency in women, 7 without a lamina dura with radiolucency, and 16 without a lamina dura without radiolucency. alveolar bone resorption in the canine and first molar regions in subjects was not different between these groups. tooth loss in men was significantly higher in the group without a lamina dura with radiolucency than with a lamina dura without radiolucency (p < 0.00001), and without a lamina dura without radiolucency (p < 0.0001). for other measures of tooth loss in women, the number of teeth treated with metal repair, and the number of decayed teeth in the ipsilateral mandible, there were no significant associations between these three groups. our results show that men with a lamina dura without radiolucency were younger than those without a lamina dura with radiolucency and without a lamina dura without radiolucency, and women with a lamina dura without radiolucency were younger than women without a lamina dura without radiolucency. tooth loss was higher in men without a lamina dura with radiolucency than in men with a lamina dura without radiolucency, and without a lamina dura without radiolucency. this indicates that the presence of probable chronic inflammation, shown in men without a lamina dura with radiolucency, may be discerned from sound radiographic findings in men with a lamina dura without radiolucency and without a lamina dura without radiolucency, and teeth without a lamina dura without radiolucency may remain relatively constant until middle and older age, whereas teeth with a lamina dura without radiolucency are seen in young subjects. in subjects with chronic inflammation without a lamina dura with radiolucency, sd in age was greater than in the other two groups in both genders. this may strengthen the thought that teeth without a lamina dura without radiolucency can arise independently of the conditions around the third molar in men and probably women. moreover, increased teeth loss in men may be possibly related to poor oral health,15,16 although this could not be assessed in this study. thus, bone formation without a lamina dura below the crown is independent of the oral status in ipsilateral teeth, and arises from alveolar bone. the third molar may, as the occasion demands, maintain the status of a lamina dura without radiolucency, or become with radiolucency without a lamina dura, and develop to the status with bone formation without lamina dura with aging. although the progress is unclear, this may be based on homeostasis, local stimuli, such as inflammation, or apoptosis of enamel below the crown in the third molar. the finding that bone formation reduces the space between the alveolar bone and the crown below the third molar in the middle - aged and elderly, although it is unclear whether specifically coupled enamel / bone exchange is seen, radiographically differed from bone resorption normally regulating eruption in the young and bone resorption in aging. bone production is suppressed during enamel formation, resulting in burgeoning accompanied by bone resorption. enamelysin (matrix metalloproteinase [mmp])13 degrades amelogenin,17 eliminates enamel matrix proteins,18 facilitates replacement of the organic matrix with minerals,19 and processes amelogenin during the secretory stage,20 although bone resorption in tooth eruption is seen associated with the expression of osteoprotegerin.21 reduced enamel secretion due to apoptosis may also drive bone production. after enamel maturation is complete, the entire enamel organ is greatly reduced.22 thus, apoptosis of enamel is essential for eruption, and bone formation below the crown may be induced by a decline in enamel activities. this suggests that enamel matrix protein (emd), which is extracted from fetal porcine tooth germs and contains enamel proteins of amelogenin and ameloblastin etc.,2325 can not exclude the suppression of bone production. moreover, emd may function in ectomesenchymal tissue, whereas apoptotic mature enamel may help mesenchymal tissue. apoptosis in ameloblasts of the erupting molar tooth is temporarily seen as part of the reduced dental epithelium. accompanying eruption, apoptotic reactions are no longer seen in the remainder of the reduced ameloblasts.9 progressively decreased enamel secretion can show a sustained increase in bone production. in consequence, the border of tooth and bone, which is generally interstratified by periodontium or connective tissue, can become closer with aging. delays or prevention of eruption in horizontal incompletely impacted third molar may arise from bone formation below the crown in the middle - aged and elderly as the controlling mechanisms of the final condition without any stimuli, such as inflammation. this may provide a clue to comprehend complex signaling in the periodontium or periostium, and diseases involving the membranes. ten cate26 noted that the origin of new bone formed at the time of periodontal ligament organization might develop from the layer of ectomesenchymal cells investing the tooth germ, and the dental follicle is the formative organ for tooth support tissues. however, the bone formation in the current study may be caused by a different mechanism arising from the surface of alveolar bone without periodontium and cement. radiographic findings show that enamel contributes to bone formation and that dead enamel can be used to induce bone formation by intervening in bone loss. the phenomenon that apoptotic enamel loses protein and proteinase activities lead to bone formation seems to have an unanticipated role in strengthening bone in the elderly. recently, peak thickness in subjects aged 40 to 49 years was reported in mandibular cortical bone,27 but data was not identified in the third molar. we doubt if the increased thickness of cortical bone may be absent of lamina dura. in conclusion, this concept of close contact with enamel due to dead enamel could be extended to clinical applications using material which shares certain characteristics of matured enamel captured by dead amelogenin. further exploration in animal trials should obtain sufficient evidence to determine the superiority of mature enamel with respect to bone formation. | bone formation below the crown of mandibular horizontal incompletely impacted third molar is frequently seen in the middle - aged and elderly. the phenomenon shows lamina dura loss without radiolucency and we hypothesized the participation of mature enamel without any influence on the environmental oral status. in order to investigate the characteristics of the phenomenon based on the presence / absence of the lamina dura and radiolucency below the crown, we studied the relationship between 58 men and 43 women with a lamina dura without radiolucency, 12 men and 8 women without a lamina dura with radiolucency, 34 men and 16 women without a lamina dura without radiolucency, and the status of teeth in the ipsilateral mandible. subjects without a lamina dura without radiolucency were significantly older than those with a lamina dura without radiolucency in both men (p < 0.0001) and women (p < 0.01), indicating different chronological causes. men without lamina dura with radiolucency showed significantly more tooth loss than those with a lamina dura without radiolucency (p < 0.00001) and those without a lamina dura without radiolucency (p < 0.0001), indicating the influence of poor oral health. thus, the phenomenon without a lamina dura without radiolucency may show the clinical importance of bone formation in the elderly. |
the apollo is a new endoscopically guided irrigation aspiration system recently cleared by the us food and drug administration for the evacuation of intraventricular hemorrhage (figure 1). the apollo system is composed of an aspiration irrigation system, which can be attached via flexible tubing to the apollo wand. the 2.6 mm wand houses an internal agitator wire that macerates clot material to maintain patency of the system during aspiration. the aspiration irrigation system (b) provides the capability for aspiration and saline irrigation and transmits vibrational energy to the internal agitator element within the wand. cone beam ct (cb - ct ; dynact, siemens healthcare, forchheim, germany) has been shown to have adequate contrast resolution to differentiate intracranial hemorrhage from brain parenchyma and cerebrospinal fluid, and sufficient contrast and spatial resolution to allow the measurement of intracranial hemorrhage.13 cb - ct has also been shown to be a useful tool to guide transcranial ventricular access.4 5 the application of cb - ct to guide hematoma evacuation potentially provides the significant advantage of a much smaller cranial access (8f vs 1422f) than if the procedure was performed under endoscopic guidance as well as the opportunity for the seamless, periodic, real - time, intraprocedural evaluation of hematoma volume and morphology. we present the first assessment of the feasibility of cb - ct - guided hematoma evacuation using the apollo system in a cadaver model. two cadaver heads were used in this experiment. both were immobilized in a radiolucent head holder on the angiography table (doro, pmi, freiburg, germany). all imaging was performed with an artis zeego (siemens healthcare, forchheim, germany) angiographic system. in the first cadaver, a standard 6f vascular sheath (figure 2a) an aspiration catheter (5max penumbra inc, alameda, california, usa) was then manipulated to the level of the carotid terminus under fluoroscopic roadmap control. a microcatheter (027 high flo renegade, boston scientific, fremont, california, usa) was then introduced and manipulated to the distal tip of the aspiration catheter. the back end of a standard 0.014 microwire was then loaded into the microcatheter and used to perforate the carotid terminus. the microcatheter and then the aspiration catheter were advanced over the microwire into the basal ganglia (figure 2b). cone beam ct was then performed to localize the tip of the aspiration catheter within the brain parenchyma (figure 2c). next, coagulated pig blood was injected through the aspiration catheter directly into the brain parenchyma. the coagulated pig blood was a mixture of blood clot, non - coagulated serum, and saline. the catheter was removed, and cb - ct was repeated to document the size and configuration of the hemorrhage (figure 2d). transvascular hematoma creation and cb - ct - guided hematoma evacuation with the apollo system. a standard 6f sheath was inserted directly into the left internal carotid artery (a) and sutured into position. next, a 5max catheter with an internal hi flo renegade microcatheter was positioned at the left carotid terminus. after perforation of the carotid terminus with a microwire, the 5max catheter was manipulated over the renegade microcatheter and microwire into the brain parenchyma (b). a sagittal reformation of cone beam ct data performed to document the position of the catheter tip (c), demonstrated its placement within the ipsilateral basal ganglia. after infusion of blood products through the 5max catheter and removal of the catheter, cb - ct confirmed the successful creation of a parenchymal hematoma (d). using points demarcated on cb - ct and registered using the iguide software (e and f), an 8f sheath was manipulated under live fluoroscopic guidance into the superficial aspect of the hematoma along its long axis. cb - ct was repeated to document the location of the sheath, demonstrating its position within the leading edge of the hematoma, in line with the long axis of the clot (h). these cb - ct data were then registered using the iguide software, and the apollo wand was introduced through the sheath freehand and activated to achieve clot evacuation under fluoroscopic guidance (see online supplementary movie 2). after clot evacuation, repeat cb - ct showed a marked reduction in the volume of hematoma with resolution of the local mass effect (i, j). in the second cadaver, a burr hole was created at the mid - pupillary line, about 10 cm posterior to the glabella, and the dura was incised. the coagulated pig blood solution was then injected through the sheath, directly into the brain. cb - ct was repeated to define the volume, morphology, and location of the hematoma (figure 3a). transcranial hematoma creation and cb - ct - guided hematoma evacuation with the apollo system. sagittal re - formation of cone beam ct data confirms placement of an 18f sheath extending into the right periventricular white matter via a right coronal burr hole with successful creation of a right parenchymal hematoma which has ruptured into the adjacent right lateral ventricle (a). axial re - formation of cb - ct data before (b) and after (c) the evacuation of hemorrhage with the apollo system shows a marked reduction in parenchymal and intraventricular blood products. the parenchymal hemorrhage cavity has now collapsed and the ventricular system has been decompressed and now contains air rather than blood. after creation and documentation of the hematomas, cb - ct data were loaded into the cb - ct guidance software (iguide, siemens healthcare, forchheim, germany). the long axis of the hematoma was defined and extrapolated to the cranial surface (figure 2e, f). a site on the surface of the hematoma was also demarcated as the target for sheath placement. these two points were used to define the site of burr hole creation and the trajectory for sheath insertion. the distance between the cranial surface and the leading edge of the hemorrhage was measured. the robotic c - arm system was manipulated into a down - the - barrel configuration, the target trajectory extending orthogonal to the center of the imaging plane. the site for the burr hole drilling was demarcated physically using the system 's laser crosshair and simultaneously displayed as an overlay on live fluoroscopy (see figure 2 g, online supplementary movie 1). a standard 8f vascular sheath was cut to match the length of the distance between the scalp surface and the leading edge of the hematoma and then manipulated under live fluoroscopic guidance along the path defined by cb - ct (see online supplementary movie 1). once in position, repeat cb - ct was performed to confirm the location of the sheath and its orientation with respect to the configuration of the hemorrhage (figure 2h). the boundaries of the hematomas were manually demarcated and used to define a three - dimensional target for live fluoroscopic guidance (iguide, siemens healthcare, forchheim, germany) of the apollo system. the irrigation after confirmation that the tip of the wand was within the targeted volume from several different robotic c - arm positions, the irrigation aspiration system was activated. hematoma material could be visualized within the aspiration tubing as it was evacuated from the cavity. when the aspiration tubing contained only clear aspirate, the position of the wand was manipulated through the sheath into a different location within the demarcated hematoma cavity under live fluoroscopic guidance and aspiration was repeated. after aspiration, cb - ct was performed to assess the size and configuration of the remaining hematoma (figures 2i, j and 3b, c). hematoma volumes were measured and manually demarcated on consecutive axial multiplanar re - formations with 1 mm slice thickness.6 in addition, a second volume calculation was performed using the maximal orthogonal dimensions of the (ellipsoid) hematomas (). two cadaver heads were used in this experiment. both were immobilized in a radiolucent head holder on the angiography table (doro, pmi, freiburg, germany). all imaging was performed with an artis zeego (siemens healthcare, forchheim, germany) angiographic system. in the first cadaver, a standard 6f vascular sheath (figure 2a) was inserted into the internal carotid artery and sutured into position. an aspiration catheter (5max penumbra inc, alameda, california, usa) a microcatheter (027 high flo renegade, boston scientific, fremont, california, usa) was then introduced and manipulated to the distal tip of the aspiration catheter. the back end of a standard 0.014 microwire was then loaded into the microcatheter and used to perforate the carotid terminus. the microcatheter and then the aspiration catheter were advanced over the microwire into the basal ganglia (figure 2b). cone beam ct was then performed to localize the tip of the aspiration catheter within the brain parenchyma (figure 2c). next, coagulated pig blood was injected through the aspiration catheter directly into the brain parenchyma. the coagulated pig blood was a mixture of blood clot, non - coagulated serum, and saline. the catheter was removed, and cb - ct was repeated to document the size and configuration of the hemorrhage (figure 2d). transvascular hematoma creation and cb - ct - guided hematoma evacuation with the apollo system. a standard 6f sheath was inserted directly into the left internal carotid artery (a) and sutured into position. next, a 5max catheter with an internal hi flo renegade microcatheter was positioned at the left carotid terminus. after perforation of the carotid terminus with a microwire, the 5max catheter was manipulated over the renegade microcatheter and microwire into the brain parenchyma (b). a sagittal reformation of cone beam ct data performed to document the position of the catheter tip (c), demonstrated its placement within the ipsilateral basal ganglia. after infusion of blood products through the 5max catheter and removal of the catheter, cb - ct confirmed the successful creation of a parenchymal hematoma (d). using points demarcated on cb - ct and registered using the iguide software (e and f), an 8f sheath was manipulated under live fluoroscopic guidance into the superficial aspect of the hematoma along its long axis. cb - ct was repeated to document the location of the sheath, demonstrating its position within the leading edge of the hematoma, in line with the long axis of the clot (h). these cb - ct data were then registered using the iguide software, and the apollo wand was introduced through the sheath freehand and activated to achieve clot evacuation under fluoroscopic guidance (see online supplementary movie 2). after clot evacuation, repeat cb - ct showed a marked reduction in the volume of hematoma with resolution of the local mass effect (i, j). in the second cadaver, a burr hole was created at the mid - pupillary line, about 10 cm posterior to the glabella, and the dura was incised. the coagulated pig blood solution was then injected through the sheath, directly into the brain. cb - ct was repeated to define the volume, morphology, and location of the hematoma (figure 3a).. sagittal re - formation of cone beam ct data confirms placement of an 18f sheath extending into the right periventricular white matter via a right coronal burr hole with successful creation of a right parenchymal hematoma which has ruptured into the adjacent right lateral ventricle (a). axial re - formation of cb - ct data before (b) and after (c) the evacuation of hemorrhage with the apollo system shows a marked reduction in parenchymal and intraventricular blood products. the parenchymal hemorrhage cavity has now collapsed and the ventricular system has been decompressed and now contains air rather than blood. after creation and documentation of the hematomas, cb - ct data were loaded into the cb - ct guidance software (iguide, siemens healthcare, forchheim, germany). the long axis of the hematoma was defined and extrapolated to the cranial surface (figure 2e, f). a site on the surface of the hematoma was also demarcated as the target for sheath placement. these two points were used to define the site of burr hole creation and the trajectory for sheath insertion. the distance between the cranial surface and the leading edge of the hemorrhage was measured. the robotic c - arm system was manipulated into a down - the - barrel configuration, the target trajectory extending orthogonal to the center of the imaging plane. the site for the burr hole drilling was demarcated physically using the system 's laser crosshair and simultaneously displayed as an overlay on live fluoroscopy (see figure 2 g, online supplementary movie 1). a standard 8f vascular sheath was cut to match the length of the distance between the scalp surface and the leading edge of the hematoma and then manipulated under live fluoroscopic guidance along the path defined by cb - ct (see online supplementary movie 1). once in position, repeat cb - ct was performed to confirm the location of the sheath and its orientation with respect to the configuration of the hemorrhage (figure 2h). the boundaries of the hematomas were manually demarcated and used to define a three - dimensional target for live fluoroscopic guidance (iguide, siemens healthcare, forchheim, germany) of the apollo system. the irrigation after confirmation that the tip of the wand was within the targeted volume from several different robotic c - arm positions, the irrigation aspiration system was activated. hematoma material could be visualized within the aspiration tubing as it was evacuated from the cavity. when the aspiration tubing contained only clear aspirate, the position of the wand was manipulated through the sheath into a different location within the demarcated hematoma cavity under live fluoroscopic guidance and aspiration was repeated. after aspiration, cb - ct was performed to assess the size and configuration of the remaining hematoma (figures 2i, j and 3b, c). hematoma volumes were measured and manually demarcated on consecutive axial multiplanar re - formations with 1 mm slice thickness.6 in addition, a second volume calculation was performed using the maximal orthogonal dimensions of the (ellipsoid) hematomas (). hematoma volumes were measured and manually demarcated on consecutive axial multiplanar re - formations with 1 mm slice thickness.6 in addition, a second volume calculation was performed using the maximal orthogonal dimensions of the (ellipsoid) hematomas (). intracranial hemorrhages could be successfully created using either a transvascular or transcranial approach. the transvascular approach through the carotid terminus created a prototypical hypertensive - type hemorrhage within the deep gray matter nucleus (figure 2d). the transvascular injection of hematoma material into the brain parenchyma through the aspiration catheter was met with some resistance and hematoma material was mixed with additional saline to facilitate injection. injection via the transcranial approach through an 18f access was considerably easier, but created a periventricular parenchymal hemorrhage, which decompressed into the ventricular system (figure 3a, b). the injected blood products created a hematoma, with a density that could be easily differentiated from that of the adjacent brain parenchyma (figures 2d and 3a, b). this allowed measurement of the volume of the hemorrhage and demarcation of the hemorrhage for cb - ct - guided evacuation. cb - ct facilitated the accurate placement of the 8f guiding sheath into the hematoma with the tip positioned in the superficial aspect of the hematoma and the sheath oriented parallel to the long axis of the hematoma in both cases (figure 2h). cb - ct enabled real - time fluoroscopic - guided evacuation of the hemorrhages using the apollo system (figure 2i, j, 3b, c). ultimately the hematoma volumes (manually demarcated areas on consecutive axial multiplanar reconstruction images) were reduced from 14.8 to 1.7 cc (88.5%) with 189 s of irrigation aspiration in the first case (parenchymal hemorrhage) and from 26.4 to 4.1 cc (84.2%) in 300 s in the second case (parenchymal and intraventricular hemorrhage). the total volumes of aspirated material (saline and blood products) measured in the collection canisters were 110 and 190 cc for cases 1 and 2. when the maximal dimensions of the hematoma were used to calculate hemorrhage volumes, the first hemorrhage measured 14.2 cc and was reduced to a volume of 1.6 cc and the second measured 25.2 and was reduced to a volume of 5.5 cc. manual demarcation of the hematoma volume remaining after evacuation was more precise than the typical long - axis volumetric calculations, given the more dispersed configuration of the residual blood products. intracranial hemorrhages could be successfully created using either a transvascular or transcranial approach. the transvascular approach through the carotid terminus created a prototypical hypertensive - type hemorrhage within the deep gray matter nucleus (figure 2d). the transvascular injection of hematoma material into the brain parenchyma through the aspiration catheter was met with some resistance and hematoma material was mixed with additional saline to facilitate injection. injection via the transcranial approach through an 18f access was considerably easier, but created a periventricular parenchymal hemorrhage, which decompressed into the ventricular system (figure 3a, b). the injected blood products created a hematoma, with a density that could be easily differentiated from that of the adjacent brain parenchyma (figures 2d and 3a, b). this allowed measurement of the volume of the hemorrhage and demarcation of the hemorrhage for cb - ct - guided evacuation. cb - ct facilitated the accurate placement of the 8f guiding sheath into the hematoma with the tip positioned in the superficial aspect of the hematoma and the sheath oriented parallel to the long axis of the hematoma in both cases (figure 2h). cb - ct enabled real - time fluoroscopic - guided evacuation of the hemorrhages using the apollo system (figure 2i, j, 3b, c). ultimately the hematoma volumes (manually demarcated areas on consecutive axial multiplanar reconstruction images) were reduced from 14.8 to 1.7 cc (88.5%) with 189 s of irrigation aspiration in the first case (parenchymal hemorrhage) and from 26.4 to 4.1 cc (84.2%) in 300 s in the second case (parenchymal and intraventricular hemorrhage). the total volumes of aspirated material (saline and blood products) measured in the collection canisters were 110 and 190 cc for cases 1 and 2. when the maximal dimensions of the hematoma were used to calculate hemorrhage volumes, the first hemorrhage measured 14.2 cc and was reduced to a volume of 1.6 cc and the second measured 25.2 and was reduced to a volume of 5.5 cc. manual demarcation of the hematoma volume remaining after evacuation was more precise than the typical long - axis volumetric calculations, given the more dispersed configuration of the residual blood products. intracranial hemorrhage (ich) is a devastating disease, substantially more common than subarachnoid hemorrhage, accounting for between 10% and 15% of all strokes.7 up to half of patients with ich do not survive their initial hospitalization and an additional one - third require long - term care after discharge.8 no medical or open surgical interventions improve outcomes.912 many reasons have been proposed to explain the failure of open surgical treatments to improve outcomes in patients with ich. one of the more common explanations is that regional trauma caused to uninjured brain by the open surgical resection offsets any benefit offered by the surgical evacuation.9 more recently the minimally invasive surgery and tpa in ich evacuation (mistie ii) trial provided evidence that minimally invasive hematoma evacuation could reduce peri - hematoma edema, improve patient outcomes, reduce length of hospital stay, and reduce mortality.13 14 moreover, the investigators observed that greater procedural reductions in clot volume correlated with better patient outcomes. minimally invasive hematoma decompression is theorized to be effective by reducing the direct toxic effect of blood products on the surrounding brain parenchyma and by alleviating local mass effect, which can create regional ischemia in the surrounding parenchyma.15 16 the mistie procedure involves manual syringe aspiration of a hematoma with a 14f cannula, followed by placement of a smaller bore drainage catheter, which can be irrigated with tissue plasminogen activator to maintain its patency.13 the apollo system potentially enables more thorough initial clot evacuation through a much lower profile system (80%) of the hematoma volume within a very short period to time (35 min). in summary, the cadaver model of intracranial hemorrhage described is useful for the evaluation of devices designed for the minimally invasive evacuation of parenchymal and/or intraventricular hemorrhages. it is feasible to use cb - ct to guide the transcranial placement of sheaths and devices designed for minimally invasive hematoma evacuation. the apollo system allowed the efficient and almost total evacuation of a parenchymal and mixed parenchymal | introductionthe apollo system (penumbra inc, alameda, california, usa) is a low profile irrigation aspiration system designed for the evacuation of intracranial hemorrhage.objectiveto demonstrate the feasibility of using apollo in combination with cone beam ct guidance.methodsparenchymal (n=1) and mixed parenchymal intraventricular hematomas (n=1) were created in cadaver heads using a transvascular (n=1) or transcranial (n=1) approach. hematomas were then imaged with cone beam ct (cb - ct), and the long axis of the hematoma defined. the cb - ct data were then used to guide transcranial access to the hematoma defining the location of the burr hole and the path to the leading edge of the hematoma. an 8f vascular sheath was then placed under live fluoroscopic guidance into the hematoma. a second cb - ct was performed to confirm localization of the sheath. the hematoma was then demarcated on the cb - ct and the apollo wand was introduced through the 8f sheath and irrigation aspiration was performed under (periodic) live fluoroscopic guidance. the operators manipulated the wand within the visible boundaries of the hematoma. after irrigation aspiration, a control cb - ct was performed to document reduction in hematoma volume.resultstransvascular and transcranial techniques were both successful in creating intracranial hematomas. hematomas could be defined with conspicuity sufficient for localization and volumetric measurement using cb - ct. live fluoroscopic guidance was effective in navigating a sheath into the leading aspect of a parenchymal hematoma and guiding irrigation aspiration with the apollo system. irrigation aspiration reduced the parenchymal hemorrhage volume from 14.8 to 1.7 cc in 189 s in the first case (parenchymal hemorrhage) and from 26.4 to 4.1 cc in 300 s in the second case (parenchymal and intraventricular hemorrhage).conclusionsthe cadaver model described is a useful means of studying interventional techniques for intracranial hemorrhage. it seems feasible to use cb - ct to guide the evacuation of intraparenchymal and intraventricular hemorrhage using the apollo system through a minimally invasive transcranial access. |
the cytokine response to surgery involves inflammation, immune and pituitary hormonal responses, hematopoiesis, and tissue repair. the major cytokine synthesized after surgery is interleukin-6 and this stimulates acute phase protein (app) synthesis in the liver. concentrations of apps rise significantly during acute inflammation owing to surgery, myocardial infarction, infections, and tumors [1, 2, 3, 4 ]. c - reactive protein (crp) is one of the plasma acute phase proteins with the largest and earliest rise. increase in the synthesis of apps is accompanied by a decrease in the synthesis of some proteins called negative app. albumin (alb) is a negative app and albumin values fall in the presence of inflammatory cytokines [1, 3 ]. except for ritual circumcision, boys are circumcised because of medical indications such as recurrent balanitis, severe phimosis, and paraphimosis. circumcision prevents urinary tract infections, reduces the incidence of penile carcinoma, also reduces the spread of hiv and other sexually transmitted diseases [5, 6, 7 ] some physicians performing circumcision without any form of analgesia, believe that neonates do not feel or remember pain, but local anaesthesia including topical application of cream, emulsion or jel, or dorsal penile nerve block, and penile ring block are recommended for neonatal circumcision [5, 9 ]. although circumcision can be performed under local anaesthesia even in older boys, general anaesthesia is required in children older than six months of age. in our society, the parents choose the anesthesia type but at the departments of pediatric surgery, general anesthesia is preferred. there are several studies reporting the effects of the type of anaesthesia on acute phase response [2, 3, 11, 12 ]. khilnani hypothesized that children have a different stress response to surgery than adults and they found that hormonal responses to surgical stress in children were not affected by age, length of surgery, and anaesthetic technique. to our knowledge acute phase response (crp and albumin) to circumcision has not been previously studied. the purpose of this study was to confirm the acute phase protein response to circumcision and investigate the effects of anaesthesia on this response. we obtained local hospital ethics committee approval and written informed consent from the parents of 115 children, aged 1 to 13 years. children with malnutrition, suspected infection, or chronic inflammatory conditions and receiving medications known to interfere with stress response were excluded. after 6 hours fasting all patients were premedicated with midazolam 0.1 mg / kg intramuscularly or 0.3 mg / kg rectally and monitored via electrocardiogram, noninvasive arterial blood pressure, and pulse oximetry (cardiocap/5, datex ohmeda, louisville, colo, usa) during the operation. the type of anaesthesia was determined according to the parents and the surgeons ' preference. the children in group 1 (itga : intratracheal general anaesthesia, n = 40) received sevoflurane 2% via mask, fentanyl 1 g / kg intravenously (iv) for induction, and rocuronium bromide 0.5 mg / kg iv was given as muscle relaxant. after endotracheal intubation, 50% nitrous oxide in oxygen with 2% sevoflurane was used for maintenance. in group 2 (general anaesthesia with mask, n = 20), children received 50% nitrous oxide in oxygen with sevoflurane 2%-3% via mask and fentanyl 1 g / kg iv. ketamine 1 - 2 mg / kg iv was used in group 3 (intravenous anaesthesia with ketamine, n = 20). in group 4 (local anaesthesia, n = 35), dorsal penile nerve block or penile ring block (1 - 2 or 24 ml of lidocaine 20 mg / ml and epinephrine 0.0125 mg / ml, subcutaneously) was used for circumcision. the distal incision was marked and created carrying sharply down to buck 's fascia. after frenuloplasty, the proximal incision was marked and carried down deeply into the dartos fascia. the sleeve of tissue was divided in the midline and the redundant tissue was excised. blood samples for protein analysis were obtained by venipuncture from children 24 hours before circumcision during preoperative evaluation (sample 1), on admission to hospital, after premedication (sample 2), and 24 hours after circumcision (sample 3). three ml of blood were centrifuged, serum collected and stored at 20c until assayed. serum crp and albumin values were determined by immunoturbidimetric and colorimetric methods, respectively, with sigma kits (sigma diagnostics, fla, usa) using hitachi 717 auto analyzer (boehringer mannheim, germany). crp concentrations remained inferior to the detection limit of assay used were accepted as zero. the parameters among the four groups were compared by anova test (a value of p.05). in group 2 (mask) and group 4 (local anaesthesia), the same crp values were obtained before surgery. we observed no increase in crp values after circumcision in four groups (table 1). the albumin values 24 hours before surgery (sample 1) and on admission (sample 2) were similar for all groups, and the values remained steady throughout the study. the common age period of cultural circumcision is 1 to 8 years, in our country. although circumcision is usually performed under local anesthesia including dorsal penile nerve block or penile ring block and topical anesthesia, pediatric surgeons prefer general anaesthesia. during cytokine response to surgery, acute phase proteins, including crp, are synthesized in the liver, but plasma concentrations of some visceral proteins such as albumin, termed the negative phase reactant, decrease, because of alteration in synthesis rate or increased catabolism [1, 3 ]. the effects of anaesthesia on acute phase response to surgery have been studied in adults. it was found that the cytokine production in cardiac surgery was not affected by type of anaesthesia, thoracic analgesia combined with inhalation anaesthesia or high dose opioid anaesthesia. in this study, types of anaesthesia (general or ketamine) did not affect the response. we obtained similar results in our previous study investigating the effects of anaesthetic techniques and delivery types on crp and albumin values during uncomplicated delivery. no influence of anaesthetic techniques was found except haemodilution due to volume loading in regional anaesthesia. eleven proteins were studied by simpson, to investigate the influences of halothane and different doses of fentanyl (2 - 3 and 12 /kg) on acute phase response to elective cholecystectomy. they could not find any evidence of variation in stress suppression related to anaesthesia. the supplementation of isoflurane anaesthesia with different doses of fentanyl (3 and 15 g / kg) did not modify the cytokine response to abdominal hysterectomy. crp increased after 24 hours, but there was no significant difference between the groups. in our study, the children in group 1 (itga) and group 2 (mask) received sevoflurane anaesthesia with fentanyl (1 g / kg). we did not observe any difference in crp and alb as acute phase protein response to circumcision, between these groups and the other groups. bourguignat suggested that there was incomplete or absent acute phase response in some postoperative patients. there was no increase of crp after osteosynthesis in their 5 of 74 patients. these five patients had no hepatic insufficiency or protein malnutrition, and no infection was observed during the survey period. they interpreted the results as an apparent lack of crp response because of the limit of detection of the assay. in their study and our study, crp detection limit was 0.05 mg / dl and crp concentrations (< 0.05 mg / dl) were undetectable. preoperative fear, anxiety, starvation, length, and type of surgery and premedication are the factors affecting the hormonal response. we used the same premedication (midazolam 0.1 mg / kg intramuscularly or 0.3 mg / kg rectally) for all children and there was no difference in the length and type of surgery. no change was observed between the values 24 hours before surgery (sample 1) and on admission to hospital (sample 2). we think that adequate preoperative sedation with midazolam may prevent acute phase response, by decreasing preoperative fear and anxiety. the doses we have used provide good sedation and make the children drowsy or sleepy. booker showed that most infants had an increase in alfa-1 acid glycoprotein (aag) in response to major surgicaltrauma. the type of surgery in our study may be the reason of observing no significant changes in preoperative and postoperative values of crp and albumin. circumcision is not a major surgery, but in an earlier study, acute phase changes were observed in children recovering from minor surgery (inguinal hernia, undescended testis). there was no difference in albumin values on postoperative days when compared with preoperative values. it was concluded that prognostic inflammatory and nutritional index (pini) was more valuable for monitoring stress response. a physiologic stress including increases in heart rate and blood pressure can be reduced if analgesia is employed and local anaesthesia can relieve the distress seen during circumcision. in one study by stang, dorsal penile nerve block was found to be effective in reducing behavioral distress and modifying the adrenocortical stress response. it was reported that the injection itself did not increase stress and did not offset the beneficial effects of anaesthesia. the langerhans cells are an epithelial component of the immune system and lack of the epidermal langerhans cells at the inner surface of the prepuce may produce reduced immunological response to cutaneous antigens. perhaps this histological difference between the inner and outer surface of the prepuce may cause reduced cytokine response to sleeve of foreskin and incision. the macrophages and monocytes start acute phase response at the site of tissue injury by releasing the mediators. cytokine response to surgery reflects the extent of tissue injury and is decreased with minimally invasive techniques. wolff evaluated the possible tissue damage during extra corporeal shock wave lithotripsy and observed no marked crp elevations because of minimal tissue damage. in circumcision, the size of injured tissue is small and the systemic absorption of mediators may be decreased because the penis is an end organ. in conclusion, there was no change in crp and albumin values as acute phase protein response to circumcision and type of anaesthesia did not affect this response. although undetectable changes at crp and albumin concentrations may occur, no stress response to circumcision may be explained with the size of injured tissue or anatomical (end organ) and histological type of the prepuce. | concentrations of acute phase proteins (crp : c - reactive protein, albumin) change during surgery. we investigated the acute phase response to circumcision and the effects of anaesthesia on this response. the children were divided into four groups ; group 1 (intratracheal general anaesthesia, n = 40), group 2 (general anaesthesia with mask, n = 20), group 3 (ketamine, n = 20), group 4 (local anaesthesia, n = 35). blood samples were obtained, 24 hours before circumcision, after premedication, and 24 hours after circumcision. crp and albumin before circumcision were comparable for all groups. there was no increase in crp, and albumin remained steady throughout the study. no difference was observed among the groups, and related to anaesthesia. no responsiveness may be explained with the size of injured tissue or anatomical and histological type of preputium. |
the social worlds of animals are filled with many different types of interactions, and social experience interacts with organismal stress on many levels. social stressors have proven to be potent across a wide range of species, and their study in rodents has led to greater understanding of the role of stressor type, timing, and other factors impacting physiology and behavior. while negative social interactions can be acutely damaging, social interaction can alsomoderate stressful experiences, buffering potentially adverse impacts and contributing to resilience. in this review we consider three main classes of effects : the social environment as a stressor ; the effects of stress on subsequent social behavior ; and social buffering of stressful experience (fig. 1). we explore mechanisms that mediate links between stress and social behavior, and consider sex differences in these mechanisms and behavioral outcomes. finally, we discuss data from a wide variety of rodent species wherever possible, in order to explore the universality and specificity of findings in single species. responses to stress span a spectrum from detrimental immediate and long - term effects to resilience and protection against future stressors. the effects of stress exposure and consequent trajectory depend on the nature of the stressor, the severity, duration (acute vs. chronic), sex / gender, genetics, timing of exposure (early life, adolescence, adulthood or aging) as well as the perception of the stressor by the individual for example, stressor controllability dramatically affects resilience versus vulnerability as an outcome (maier and watkins, 2005, amat., 2010, lucas., 2014 recently it was shown that even the gender of researchers can affect rodent stress levels and influence results of behavioral tests (sorge., 2014). one of the most commonly measured immediate physiological responses to stress is activation of the hypothalamic corticotropin releasing factor (crf, also called crh) is released from the hypothalamus, and is the primary trigger of adrenocorticotropic hormone (acth) secretion from the anterior pituitary. acth then triggers systemic release of glucocorticoids (cort) from the adrenal gland (bale and vale, 2004). we describe outcomes related to hpa - axis responsivity, as well as several additional neurochemical players including bdnf, serotonin, and multiple neuropeptides in the text below. social behavior is complex and varies with the behavioral test chosen, and whether focal individuals are tested with familiar or novel conspecifics, with same- or opposite - sex individuals, or with familiar or unfamiliar strains. the laboratory setting is a sparse environment compared to the complexity of nature, both physically and socially. some research aims to quantify social behavior in complex housing areas such as enriched caging with social groups (e.g., artificial, visible burrow systems (blanchard., 2001, 2006), and large, semi - natural enclosures (e.g. king, 1956, dewsbury, 1984, ophir., 2012, margerum, 2013). other research relies on constrained social interactions in tests designed to measure a few particular aspects of social behavior (crawley, 2007). for example social interaction tests typically measure the amount of time spent in social contact or investigation with a conspecific. social choice tests take place in multi - chambered apparatuses that allow investigation of either a conspecific or a non - living stimulus such as a novel object or empty restrainer (moy., 2007). variations on this test involve a choice of a familiar versus unfamiliar individual, such as in the partner preference test (williams., 1992). social habituation / dishabituation tests are often used to assess social recognition and memory for familiar individuals (ferguson., 2002 ; choleris., 2003). social motivation may be assessed by measures of effort expended to access another individual (lee., 1999), or by conditioned place preference for a social environment (panksepp and lahvis, 2007). other tests measure specific aspects of social competency, such as memory and social inferences involved in hierarchy (cordero and sandi, 2007, grosenick. recent studies of pro - social behavior in rats have focused on latency to free a restrained rat under different scenarios (ben - ami bartal., 2011, ben - ami bartal., there is no peripheral hormonal indicator of sociability, but two neuropeptides have been highly implicated in many aspects of mammalian social behavior : oxytocin (ot) and arginine vasopressin (vp). oxytocin is produced in the hypothalamus and facilitates a wide variety of processes related to social behavior, including maternal behavior, trust, anxiolysis, and sexual pair - bond formation (reviewed in ross and young, 2009, young., 2008, neumann, 2008, zucker., 1968, carter., vasopressin activity has been associated with aggression, anxiety, and social behavior (reviewed in kelly and goodson, 2014), as well partner preference formation in male prairie voles (cho., 1999, young and wang, 2004). the locations and densities of oxytocin receptors (otr) and vasopressin type 1a receptors (v1ar) have been associated with species variations, as well as with individual variations in social behavior from affiliation to aggression (e.g. everts., 1997, young, 1999, beery. many studies have also investigated the role of the mesolimbic dopamine system and opioid regulation of rewarding social behaviors such as pair - bonds between mates (aragona, 2009, resendez., 2012) ; we describe these and additional research avenues throughout. in addition to considering how social behavior is assessed, we must consider the significance of the behavior to the species in which it is assessed. social behavior encompasses skills from social recognition to social memory, as well as many distinct types of interaction, including with peers, potential reproductive partners, competitors, and offspring. some of these interactions are better studied in some species than others ; for example biparental care is only present in a few rodent species that have been studied in laboratories, namely prairie voles (microtus ochrogaster), california mice (peromyscus californicus), and djungarian hamsters (phodopus campbelli). monogamous pairing with mates is similarly rare among rodents, and is most studied in prairie voles and california mice. mechanisms supporting group living have been in explored in colonial rodents including naked mole - rats (heterocephalus glaber), tuco - tucos (ctenomys sociabilis), seasonally social meadow voles (microtus pennsylvanicus), and others (anacker and beery, 2013). the idea that some problems are best studied in particular species is far from new ; this principle was promoted in 1929 by the late physiologist and nobel laureate august krogh (krebs, 1975). in contrast to krogh 's assertion that species should be selected for their suitability for studying particular problems, modern biological research is strongly biased towards rats and mice ; in 2009 rats and mice made up approximately 90% of mammalian research subjects in physiology, up from 18% at the time krogh 's principle was articulated (beery and zucker, 2011 supplementary material). lab strains of mice and rats are highly inbred and in many ways quite different from their wild peers. use of multiple species allows researchers to compare and contrast mechanisms across the phylogenetic tree. while the depth of mechanistic information available for non - model organisms is much less than for rats and mice, the comparative perspective is essential for understanding to what extent mechanisms underlying social behavior are unique to particular species, common across broader groups, or are variations on a theme (phelps., 2010, katz and lillvis, 2014 ; hofmann., 2014). in this review we focus on rats and mice for which data on stress and social behavior are most abundant, but incorporate findings from other rodent species whenever possible. and although laboratory research in rodents is heavily male - biased (beery and zucker, 2011), we review a substantial body of findings on the interrelationship of stress and social behavior in females., rodents may encounter competition for resources such as territory, food, and access to mates, and even solitary species interact with conspecifics and their chemical cues, if only to avoid them in the future. widely used models of social stress in rodents include social subordination, crowding, isolation, and social instability (fig. 1, left side). while most studies have been conducted in mice and rats, prairie voles and other social rodent species provide an opportunity to study the role of identity of the social partner, and how separation from a mate differs from isolation from a same - sex peer. in humans, social rejection is used as a potent experimental stressor (kirschbaum., 1993), and decades of work in humans and non - human primates have demonstrated that an individual 's position in the social hierarchy has profound implications for health and well - being (adler., 1994, sapolsky, 2005). in rodents, the most prominent model of stressful social interaction social defeat is typically induced by a version of the resident - intruder test in which a test subject is paired with a dominant resident in its home cage. dominance may be assured by size, prior history of winning, strain of the resident, and/or prior housing differences (martinez., 1998). social defeat is typically used as a stressor in male rodents, for whom dominance is easier to quantify and aggressive interactions related to home territory are presumed more salient. a few studies report effects of social defeat on females, particularly in syrian hamsters in which females are highly aggressive and dominant to males (payne and swanson, 1970). in rats and mice, females do not always show a significant response to this task and the effect in males is far greater (palanza, 2001, huhman., 2003). thus, other stress paradigms such as social instability are more widely used with females (haller., 1999). social defeat can have a more substantial impact on male rodent physiology and behavior than widely used stressors such as restraint, electric shock, and chronic variable mild stress (koolhaas., 1996, blanchard., 1998, sgoifo., 2014). in the short - term, social defeat produces changes in heart rate, hormone secretion, and body temperature, with longer - term impacts on a wide variety of additional outcomes including activity, social behavior, drug preference, disease susceptibility and others (martinez., 1998, sgoifo unlike physical stressors such as restraint, social defeat does not appear to be susceptible to habituation or sensitization (tornatzky and miczek, 1993, sgoifo., 2002), and can be used in groups housed with a single dominant individual (nyuyki., 2012). social defeat stress has profound effects on hippocampal morphology and function (reviewed in mcewen and magarinos, 2001, buwalda., 2005, these effects include reduction in hippocampal volume (czh., 2001) related to dendritic remodeling and reduced neurogenesis (magarios., 1996, gould., 1998), social defeat also alters the ratio of mineralocorticoid to glucocorticoid receptors in the hippocampus (buwalda., 2001, veenema., 2003). as with most of neurobiological research, attention has centered on neurons as the brain mediators of the biological embedding of the social world. however, following recent reports on the effects of stress (in general, and particularly social stress) on astrocytes, oligodendrocytes and microglial cells, it has become clear that glial cells are likely to play a role in this process, and deserve more attention in future studies (braun., 2009,, 2011, araya - calls., 2012, chetty., social hierarchy has also been explored in settings where dominance is established through unstaged social interactions that occur on an ongoing basis (e.g. blanchard., 1995, blanchard., 2001). a low position in the social (and economic / resource) hierarchy appears to be stressful across a wide range of species. negative health effects of low social status have been particularly well documented in non - human primates (e.g. sapolsky, 1989, sapolsky, 2005, virgin and sapolsky, 1997, wu., 2014 ; shively review, 2015). in humans, lower socioeconomic status (ses) predicts decreased mental and physical health in a graded fashion, and subjective perception of socioeconomic status may be an even more potent mediator than objective ses (adler., 1994, kawachi and kennedy, 1999, siegrist and marmot, 2004, singh - manoux., 2005). while low social status appears stressful across all instances discussed thus far, several studies have demonstrated that low status is not always stressful, in part dependent on species - particular life - history traits. for example, subordinate status is most stressful in species with despotic hierarchies, and may not be a stressor in high status is more stressful in societies in which dominance must be continuously defended than in stable social hierarchies (sapolsky, 2005). in a meta - analysis of cortisol levels in primates, abbott. (2003) found that subordinates had higher basal cort levels only when exposed to higher rates of stressors due to subordinate status, and when subordinate status afforded them few opportunities for social contact. in naked mole rats, a highly social rodent species that lives in large underground colonies, all but a few animals in each colony are reproductively suppressed subordinates (sherman., 1991). in this instance, subordinates are related to breeders and are non - aggressive except in the event of loss of the breeding queen or her mates (clarke and faulkes, 1997). reproductively suppressed subordinates do not have higher cort levels than breeders and may have lower levels (clarke and faulkes, 1997, clarke and faulkes, 2001). while it is not yet clear how stress relates to status in this species, social subordination must be considered in the context of how it affects the individuals involved. housing density affects rodent behavior, and both crowded and isolated social environments have been used as stressors in rodents. crowding is a naturalistic stressor especially for social or gregarious species that relates to high population density and resource competition in the field. in house mice, several studies have shown that crowding can impair reproductive function and may be part of population size regulation (christian and lemunyan, 1958, christian, 1971). in the highly social, group - living rodent species the degu (octadon degus), increased group size is associated with greater dispersal consistent with a social competition hypothesis (quirici., 2011). in the laboratory, crowding typically consists of large numbers of mice or rats (e.g. > 6 rats / cage (brown and grunberg, 1995, reiss., 2007)) with ad libitum access to resources such as food and water. crowding must be somewhat extreme to induce stressful outcomes, as group - housing (e.g. 46 rats or 12 mice in a sufficiently large area) is often used as a key component of environmental enrichment (sztainberg and chen, 2010, simpson and kelly, 2011). social crowding has been shown to impact many different physiological outcomes in male mice, rats, and prairie voles. these include changes in organ weights, hormone secretion, hpa reactivity, pain sensitivity, telomere length, and cardiac outcomes (gamallo., 1986, gadek - michalska and bugajski, 2003, kotrschal., 2007, grippo., 2010, tramullas., 2012, puzserova., crowding of pregnant dams also produces changes in the offspring birth weight, pubertal timing, and reproductive behavior (e.g. harvey and chevins, 1987, ward., 1994) and may lead to lasting changes through a subsequent generation (christian and lemunyan, 1958). there appear to be important sex differences in the consequences of crowding, with one study in rats finding that crowding is a stressor for males but has the capacity to calm females (brown and grunberg, 1995). at the opposite extreme social isolation is employed as a stressor in previously group - housed mice and rats (heinrichs and koob, 2006) ; in both species, extended (213 week) solitary housing produces an isolation syndrome particularly in females, consisting of hyperadrenocorticism, reduced body weight, altered blood composition, and enhanced pain responsiveness among other outcomes (hatch., 1965, valzelli, 1973). these changes coincide with alterations in behavior including aggression, mating behavior, learning, and pain sensitivity (valzelli, 1973). more recent studies have added a host of additional physiological outcomes related to stress and depressive behavior, including changes in dopamine signaling in different brain regions (heidbreder., 2000), altered heart rate and cardiac function (spni., 2003, carnevali., 2012), and neurogenesis (stranahan., 2006, lieberwirth and wang, 2012). which outcomes are affected by isolation depend in part on the age at which isolation occurs (reviewed in hall, 1998), and there are sex differences in the effects of social isolation. these suggest that isolation may be stressful for females but not necessarily to the same extent for males (hatch., 1965, palanza, 2001, palanza., 2001). assessing the impacts of both isolation and crowding share the problem of what to consider as the control comparison, as anxiety and other behavioral outcomes vary along a continuum of group sizes (botelho., 2007). in recent decades, prairie voles have become a popular model for studying social behaviors because of their unusual capacity to form socially monogamous pair - bonds with opposite sex mates (getz., 1981). an additional advantage of this species is that the effects of social manipulations can be contextualized in terms of findings from field populations and semi - natural settings (e.g. ophir., 2008, mabry., 2011). in wild prairie voles, cohabitation with a mate or a mate and undispersed offspring is common (getz and hofmann, 1986), and reproductively nave prairie voles are affiliative towards their same - sex cage mates. in the lab, separation of adult prairie voles from a sibling cage - mate for 12 months reduced sucrose consumption (a measure of anhedonia), and was associated with increased plasma levels of oxytocin, cort, and acth, as well as increased activity of oxytocin neurons in the hypothalamus following a resident intruder test. these effects were more profound in females (grippo., 2007). further work has shown that social isolation from a sibling also leads to changes in cardiac function associated with cardiovascular disease (grippo. 2012), and immobility in the forced swim test (grippo., 2008) considered a measure of depressive behavior. some physiological and behavioral sequelae were prevented or ameliorated by exposure to environmental enrichment, or by peripheral administration of oxytocin (grippo., 2009, grippo., 2014), as has been demonstrated in rats (hellemans., social isolation of prairie voles from weaning has been associated with higher circulating cort, and greater crf immunoreactivity in the paraventricular nucleus (pvn) of the hypothalamus (ruscio., 2007). while the majority of current studies have focused on social isolation from a non - reproductive partner, recent investigation into disruption of opposite - sex pairs takes advantage of this unusual feature of prairie vole behavior, and suggests that mate - pair disruption has substantial autonomic and behavioral consequences for both male and female prairie voles (bosch., 2009 ; mcneal., 2014). as the work in prairie voles illustrates, it is important to consider the natural history of species when social manipulations are performed. for example, male syrian hamsters housed in isolation are more aggressive than those housed in groups (brain, 1972), but that is not to suggest that isolation was distressing, or produced an unusual behavioral phenotype, as this species is naturally solitary (gattermann., conversely, crowding might be a particularly potent but unnatural stressor for this species, and it has been associated with increased mortality (germann., 1990, marchleswska - koj, 1997). social species provide good subjects for studying the influence of social interactions on health and related outcomes, and this has been demonstrated both in the laboratory and in the field. in a species of south american burrowing rodent the colonial tuco tuco (c. sociabilis) females may live alone or share a burrow with several other adults members and their young (lacey., 1997). yearling c. sociabilis that live alone (whether via dispersal in the field or investigator manipulations in the lab), have significantly higher baseline fecal glucocorticoid metabolite levels than do group - living individuals in the same environments (woodruff., 2013). in a putatively monogamous species of wild guinea pig (galea monasteriensis), social separation induces increases in cortisol secretion that are only rectified by return of the social partner (adrian., 2008). the study of species in the context of their natural behavior allows us to better understand stress - related outcomes in a variety of rodent species. some studies employ both crowding and isolation in alternation (for example, 24 h of each for 2 weeks), as a model for chronic social instability (e.g. haller., 1999, herzog., 2009). social instability has particularly been used as a social stressor for female rats, for whom crowding and social defeat are not always effective stressors (palanza, 2001). in the crowding phase, females exposed to this variable social environment show increased adrenal weight, increased corticosterone secretion, decreased thymus weight, and reduced weight gain relative to females housed in stable male female pairs (haller., 1999). a second study replicated these findings and demonstrated that social instability also induced dysregulation of the hypothalmic pituitary gonadal (hpg) axis (elevated luteinizing hormone, prolactin, and disrupted estrus cycles), and reduced sucrose preference and food intake (herzog., 2009). this stressed phenotype persisted for several weeks without habituation and led to a depressive - like phenotype. prior history of social instability in the form of early - life separation from the mother also exacerbates vulnerability to later life chronic subordination stress (veenema., 2008) in humans, stressful situations can promote affiliative behavior (zucker., 1968, teichman, 1974, taylor, 2006) and anticipation of stressful events can promote group cohesion and liking for group members (latan. all stress is not the same, however, and in some cases, social behavior is reduced after a stressor in fact social withdrawal is one of the diagnostic criteria for post - traumatic stress disorder (dsm v, american psychiatric association, 2013). while effects of stress on social behavior are evident in humans, most of our understanding of these impacts, and of the underlying molecular and cellular mechanisms, come from rodent studies. in rodents, several stressors and manipulations of the hypothalamic adrenal (hpa) hormonal axis have been shown to impact a variety of subsequent social behaviors. in this case, much of what we know comes from research on prairie voles for which there appear to be important differences between the sexes, with some outcomes dependent on whether the partners are same - sex siblings or opposite - sex mates. as previously mentioned, prairie voles provide an opportunity to study pair - bond formation between males and females, as this species forms reproductive pair bonds both in the laboratory and in the field. prairie voles also exhibit unusually high levels of circulating cort relative to other rodents including montane voles, rats, and mice (devries., 1995) moderated by reduced tissue sensitivity to glucocorticoids (taymans., 1997, klein., 1996). stress has opposite effects on the formation of mate preferences in male and female prairie voles. in males, males do not typically form a partner preference for a female after 6 h of cohabitation, however they form significant preferences within this time interval when paired after a brief swim stress (devries., 1996). preference formation is also facilitated by cort administration in male prairie voles, and impaired by adrenalectomy (devries. some doses of central crf administration also facilitate partner preference formation in males (devries., 2002). interestingly, cort decreases after pairing with a female, but partner preferences are not established during the early cohousing interval, and cort levels have returned to baseline by the time male preferences have been formed (devries., 1997). in female prairie voles, stress impairs partner preference formation, but this effect is prevented in adrenalectomized voles (devries., 1996). this phenomenon appears to be mediated by cort, as exposure to cort during (but not after) cohabitation with a novel male prevents partner preference formation, and adrenalectomized females form partner preferences after shorter cohabitation periods than are typically necessary (devries., 1995). cort levels are naturally low immediately following cohousing with a male, and partner preferences are formed before they return to baseline (devries., 1995). in rats, in particular, stress has been shown to inhibit mating behavior in males and in naturally cycling females, via elevation of the inhibitory hypothalamic hormone rf - amide related peptide 1 (kirby., 2009, geraghty., 2013). same - sex interactions have not been as well explored in prairie voles as opposite - sex affiliative interactions have been, although some data suggest same - sex affiliative behavior in prairie voles may be enhanced following a stressor (devries and carter, unpublished data referenced in carter, 1998). same - sex affiliative behavior can be studied more broadly in rodent species that live in groups, so additional rodent species may be informative for this question. meadow voles are conditionally social rodents, with photoperiod - mediated seasonal variation in social huddling. while females are aggressive and territorial in summer months, they live in social groups and huddle with conspecifics in winter months or short day lengths in the laboratory (madison., 1984, seasonal variations in huddling and partner preference formation allow for the study of the endocrine and neurobiological mechanisms underlying changes in social tolerance and peer affiliation outside the context of mate - pairing. in meadow voles, cort varies seasonally (boonstra and boag, 1992, galea and mcewen, 1999, pyter., crf / urocortin pathways may also link stress - reactivity and social behavior in this species, as crf1 and crf2 receptor densities change with day length and are associated with huddling behavior (beery., 2014). stress exposure prior to pairing impairs preference formation for a same - sex individual in female of this species (anacker., 2014). in addition, familiarity of the conspecific prior to the stressor may influence whether social behavior is increased or decreased. wild rats live in gregarious colonies, where social interactions may be beneficial for predator avoidance and under other stressful conditions (macdonald., 1999). in male rats, social defeat stress leads to social avoidance less time spent in social contact with an unfamiliar non - aggressive rat (meerlo., 1996) and avoidance of the dominant rat (lukas., 2011). non - social stressors may have the opposite effect, for example, in groups of familiar male rats, rats spend more time huddling in large groups during an immediate stressor (cat fur or bright light). this effect has been termed defensive aggregation, and is facilitated by oxytocin (bowen., 2012, bowen and mcgregor, 2014). exposure to chronic social defeat stress leads to social avoidance, altered fear acquisition and elimination, anhedonia, changes in neural circuitry and transmission, neurogenesis and metabolism in groups of exposed versus unexposed subjects (chou. however, looking at individual outcomes reveals a much more complex picture, even in inbred mice. for example, measuring social motivation after exposure to social defeat stress reveals a bimodal segregation of the group into affected and unaffected individuals. affected individuals spend less time interacting with conspecific peers in the social zone, while unaffected (unsusceptible) individuals spend time in the social zone similar to unstressed individuals. susceptibility to social aversion following social defeat is associated with a suite of other signs of stress including decreased sucrose preference, decreased body weight, and increased sensitivity to cocaine - induced conditioned place preference (krishnan., 2007). what is the difference between responders and non - responders, or a resilient vs. vulnerable trajectory ? interestingly, this resilience phenotype did not correlate with social motivation pre - stress, nor with levels of circulating glucocorticoids (krishnan., 2007). however, stress - susceptibility has been correlated with stress - induced increase in levels of brain derived neurotrophic factor (bdnf), a key regulator of dopamine release in the nucleus accumbens (nac). following 10 days of repeated social defeat, bdnf protein levels were persistently elevated in the nac of mice. reduction of bdnf levels in the ventral tegmental area (vta) via local bdnf knockdown provided an antidepressant - like effect relative to untreated, defeated mice and prevented social aversion (berton., 2006). investigation of the individual differences between susceptible and unsusceptible mice revealed that susceptibility was characterized by increased nac bdnf, but reinforced the importance of bdnf release from the vta, as knockdown in the vta but not nac promoted resilience. susceptibility to defeat was further shown to be mediated by enhanced firing of vta dopamine neurons, with resilience characterized by a lack of activity - dependent bdnf release (krishnan., 2007). interestingly, unsusceptible individuals were not lacking a neural response, but in fact showed greater change in gene expression patterns in the vta than susceptible individuals suggesting that behavioral non - responsiveness is an active process and not merely a lack of the pathological process. analysis of differential gene expression revealed significant down - regulation of several members of the wnt (wingless)-dishevelled signaling cascade, including phospho - gsk3 (glycogen synthase kinase-3), in the nac of susceptible, but not resilient, mice (wilkinson. regulation of hpa axis activity, and specifically reduced expression of crf (regulated by stress - induced demethylation of regulatory areas of the gene crf1) was shown in the subset of vulnerable mice that displayed social avoidance (elliott., 2010) and in mice that displayed short latency to defeat in the resident / intruder paradigm (wood., 2010). supporting this finding, knockdown of crf levels diminished stress - induced social avoidance (elliott., 2010). in a separate model of chronic subordinate colony housing, mice selectively bred for low anxiety were behaviorally resilient to subordination stress, and showed distinct hpa axis responses (fchsl., 2013). several neurotransmission systems are implicated in social - stress resilience vs. vulnerability : in addition to bdnf - control of dopamine mentioned above, differences in the nac dopaminergic system resulting from differential maternal behavior are correlated with increased preference for social interactions in a group of highly groomed rat offspring (pea., 2014). vulnerable and resilient animals differ significantly in the expression of ampa receptors in the dorsal hippocampus, and activation of ampa receptor during the stress exposure prevented the physiological, neuroendocrine, and behavioral effects of chronic social stress exposure (schmidt., 2010). knockout of serotonin transporter increases the vulnerability to social avoidance following social defeat (bartolomucci., 2010). finally, supression of the gabaergic system is seen in the pre - frontal cortex of mice showing depressive symptoms following social defeat (veeraiah., 2014), and in amygdala of mice exposed to peripubertal stress (tzanoulinou., 2014). similar suppression is found in the cortex of human patients with ptsd (meyerhoff., 2014). stress exposure not only alters social interaction, but that social interaction can in turn play a role in buffering or moderating the effects of that stressor, providing adaptive value of social networks for coping with stress exposure. we can think about stress - resilience in multiple layers : life - long programming of stress - resilient individuals originating from the early life environment and in particular through maternal interactions (parker., 2012 ; lyons., 2010, szyf., 2007) ; short - term resilience after an acute moderate stressor promoting better functioning after a secondary stressor (kirby., 2013) ; or resilience that comes from mitigating (buffering) the effects of stress by positive, supportive social environment, or even by aggressive social interactions. for example, lower ranking baboons that show displacement of aggression on peers have lower cort levels (virgin and sapolsky, 1997). the effects of social buffering are far reaching, and in humans there is evidence that social relationships aid immune function, cardiovascular health, and other health - related outcomes (reviewed in berkman and kawachi, 2000). stable natural social relationships have even been associated with increased longevity in humans and other species (humans : holt - lunstad., 2010 ; baboons : silk., the endocrine consequences of social buffering were first described in primates (coe., 1978, mendoza., 1978) and primate studies continue to be important particularly for our understanding of natural social buffering in the context of stress. for example in female chacma baboons, loss of a partner results in elevated cort and also in enhanced social behaviors such as allogrooming which may help mediate the decline to baseline levels (engh., 2006). studies of social manipulations in rodents have also played a pivotal role in our understanding of social support on a variety of behavioral, endocrine, and neurobiological outcomes (reviewed in devries., 2003, kikusui., 2006). in rodents, most studies of social buffering have focused on the presence or absence of a conspecific such as the cage - mate after a stressor. as one might imagine, many different variables may affect whether social buffering occurs, including the familiarity of the conspecific, the relative hierarchy, presence or absence during stress exposure, whether the cage - mate was also stressed, sex of the individual and partner, sensory modalities of exposure to that individual, timing of the availability of social support and so forth. while these parameters have by no means been explored in all combinations, we summarize what is known for each variable across a variety of rodent species. rats temporarily housed in an open field spend more time together than expected by chance (latan, 1969), and stressed males are more likely to interact socially than non - stressed males (taylor, 1981). investigator - manipulated housing conditions (solitary-, pair-, or group - housing) also affect reactions to stress. conditioned avoidance of noxious stimuli is reduced in pair - housed animals (hall, 1955, baum, 1969). pair - housed rats also show reduced impacts of stress exposure relative to rats housed alone in their response to white noise (taylor, 1981) and foot shock (davitz and mason, 1955, kiyokawa., 2004). group - housed rats exposed to social defeat exhibit greater growth and less anxiety behavior in repeated open field exposure relative to solitary - housed rats (ruis., 1999). solitary housing increases anxiety - like behaviors on its own (see above section) ; thus distinguishing between effects of isolation and effects of a stressor (and their potential interactions) requires that all housing conditions be paired with both the stressor and lack thereof. in studies where this has occurred, pair - housed animals do not show stress - induced anxiety behavior changes relative to control pair - housed animals, unlike solitary - housed individuals (nakayasu and ishii, 2008). more recent studies have examined novel behavioral outcomes, including social buffering effects on pain tolerance (reviewed in martin., 2014) and changes in alcohol consumption (anacker., 2011 social housing impacts hpa axis responsiveness to a stressor or to hormonal stimulation via crf. following crf administration, male group - housed rats have reduced cort and acth relative to isolated males (ruis., 1999). in young male guinea pigs, presence of the mother or an unfamiliar adult female attenuates increases in plasma acth, cortisol and vocalizations in response to a novel environment (hennessy., 2000), with additional, subtly varying effects across the lifespan (hennessy., 2006). studies in prairie voles allow for distinction between buffering by social peers and reproductive partners. in prairie voles, exposure to a novel individual of the opposite sex leads to a decline in serum cort over the following 1560 min in both males and females, while same - sex novel pairings did not influence serum cort (devries., 1997, devries., this decline in cort may be important for the ability of the female to form a partner preference, while it must pass in order for males to form (cort - dependent) partner preferences (devries, 2002). the nature of social buffering may be quite different within established social relationships : in prairie voles, female sibling pairs experienced elevated cort following separation and this effect was attenuated following reunion (unpublished data referenced in carter., 1995). in males, loss of a female partner also resulted in increased circulating cort as well as increased adrenal weight (bosch., the presence of a partner may provide social buffering from a stressor ; female prairie voles that recovered alone from immobilization stress exhibited high levels of cort and increased anxiety behavior, while females recovering with their male partner showed no such elevation (smith and wang, 2014). while cort is an easily measured signal that often relates to stress level, it is worth noting that measurement of glucocorticoids is not always a clear indicator of either stress exposure or stressed affect, and stress may result in both enhanced and dampened cort profiles depending on timing and chronicity (e.g. sapolsky. social companionship has been associated with outcomes beyond the hpa axis, although many of these changes may ultimately be related to common pathways. for example, in prairie voles, females recovering from immobilization stress with a male partner showed no cort elevation, coupled with evidence of increased oxytocin (ot) release in the paraventricular nucleus (pvn) of the hypothalamus. direct administration of ot to the pvn reduced cort responses to a stressor, while oxytocin receptor antagonist (ota) injection prevented the ameliorative effects of housing with the partner (smith and wang, 2014). this parallels research in humans in which ot and social buffering interact to reduce cort responses to a social stressor (heinrichs., 2003). for example, the presence of a conspecific in an open - field test reduces peripheral prolactin in male rats (wilson, 2000). relative to isolated individuals, socially housed female siberian hamsters experience improved wound healing ; an effect which is mediated by oxytocin (detillion., 2004). while little is known about the natural social organization of this hamster species (wynne - edwards and lisk, 1989), wound healing has also been studied in three species of peromyscus mice for which social organization is well characterized. in the two species of monogamous or facultatively monogamous peromyscus mice, wound healing was facilitated by social contact. this was not the case in the promiscuous species, and this species did not experience reduced cort with pair - housing (glasper and devries, 2005). this suggests that social housing was beneficial only to the species that normally resides with a partner. some recent findings in humans suggest that higher blood oxytocin and vasopressin levels may also be associated with faster wound healing in our species (gouin., 2010). social environment during stress has been shown to impact gastric ulcer formation in male rats following a stressor, however, only the social environment at the time of testing and not prior housing affected ulcer frequency (conger., 1958). (2005) found that group - housed chronically stressed female rats had less adrenal hypertrophy than solitary - housed, stressed females. social housing and support, social support reduces heart rate and alters the ratio of systolic to diastolic blood pressure after performing stressful tasks (lepore., 1993, thorsteinsson., 1998). in mice and prairie voles,, 2003, grippo., 2007), as well as other measures of cardiovascular health (grippo., 2011). not all social interactions are equal, and the effects of social companionship may differ by partner familiarity, sex, age, species, and affective state. most studies of social buffering have explored one or two of these contexts at a time, but some evidence suggests that each of these can, but does not necessarily, impact the social buffering provided. in guinea pigs, the presence of both familiar and unfamiliar adults reduces hpa activation in response to a novel environment ; however for young (pre - weaning) guinea pigs, this effect is greater with the mother (graves and hennessy, 2000), and the salience of different individuals changes over the life course and varies with sex (kaiser., 2003). in a pair of studies in male rats, armario. found the surprising result that cort levels in an open field were higher when paired with a familiar versus an unfamiliar individual (armario. in prairie voles, brief separation from a mate, but not from a same - sex sibling, increased depressive - like behavior (bosch., 2009). partner identity / familiarity was also found to be critical in a recently developed paradigm in which helping behavior is measured in rats. in this study, rats were motivated to rescue a trapped rat from restraint only if it was matched to their own strain, or a strain they had exposure to from birth ; they were uninterested in freeing rats of an unfamiliar strain (ben - ami bartal., exposure to nave, unshocked individuals can lessen stress responses relative to exposure to shocked individuals (kiyokawa., 2004), similar to earlier findings in fear - conditioned rats (davitz and mason, 1955). future research on social buffering in rodents will hopefully make progress into questions of how and when social support is helpful, and what the optimal timing and type of that support is. in contrast, anxiety is a lasting state that is not an immediate response to the external environment. while stressful events can have impacts on social behavior, individual differences in anxiety also relate to variation in social behavior. for example, in humans, extraverted personality is associated with lower trait anxiety (jylh and isomets, 2006, naragon - gainey., 2014). in rodents, the social interaction test in which social interaction with a familiar or an unfamiliar individual are measured in an open arena was initially developed to be an ethologically relevant measure of anxiety behavior (file and hyde, 1978). social interaction times of individual male and female rats are positively correlated with exploratory behavior in classic tests of anxiety - like behaviors. for example, individuals that spend more time in social interaction are more likely to spend more time in the center region of an open field or the light portion of a light - dark box (starr - phillips and beery, 2014). maternal care, particularly maternal grooming behavior, has lasting effects on offspring anxiety behavior. high levels of maternal grooming are associated with reduced anxiety behavior in two paradigms : pup reunion after brief separation and/or handling, and natural, individual variation in maternal care (reviewed in gonzalez. natural variations in the amount of time dams spend licking and grooming their new pups in the first week of life impacts their offspring in many ways that persist into adulthood. reduction in stress - reactivity in rats reared by high - licking dams appears to be mediated by increased glucocorticoid receptor expression in the hippocampus (liu., 1997, weaver., 2004) which enhances negative feedback on the hpa axis (sapolsky., 1985, recent studies have shown that natural variation in maternal care affects a wide range of outcomes beyond anxiety behavior, including social behaviors. high levels of early maternal grooming are associated with increased play behavior in juvenile male rats (parent and meaney, 2008, van hasselt., 2012), increased social interaction in adult offspring of both sexes (starr - phillips and beery, 2014), and altered play dominance rank in adult female rats (parent., 2013). effects of maternal contact have also been described in other species ; for example in prairie voles, maternal care and family structure have been associated with social investigation in adolescence, and changes in parental and mate - directed behaviors in adulthood (ahern and young, 2009, perkeybile., 2013). early experience of maternal care is sometimes associated with changes in oxytocin and vasopressin system regulation (reviewed in veenema, 2012), although it is not yet clear whether such changes underlie the known differences in social behavior. in a synthesis of findings across rodents, primates, and human studies, shelly taylor proposed that in addition to flight - or - flight responses to stress, females show pronounced tend and befriend responses to a stressor (taylor., 2000). taylor related tending to parental nurturing behaviors, based on evidence that rat dams lick their pups (tending) following separation, that oxytocin appears to be more elevated in females following a stressor, and that oxytocin can act both as an anxiolytic and to promote affiliative behavior. befriending was related to the adaptive value of social support under stressful conditions, and its particular value for females that might be more vulnerable than males. whether or not shared history of maternal care - giving and defensive social behaviors best explains distinct female responses to stress, the existence of such sex differences in stress / social behavior interactions has been demonstrated repeatedly. we have discussed several examples in this review ; first, we described sex differences in the potency of particular stressors, for example crowding is particularly stressful for males, but is either calming to females or does not have major effects on physiological endpoints (brown and grunberg, 1995, kotrschal., 2007). even when the same event is stressful to both males and females, the sequelae of stress exposure may differ, for example stress impairs classical conditioning in females, which is the opposite of the effect found in males (wood and shors, 1998). sex differences are also present in social behavior responses to stress : conditions of stress, high cort, and high crf facilitate pair - bonding in male prairie voles, while the same conditions impair pair - bonding in females voles (devries., even where both sexes appear to be supported by their same - sex peers, male and female rats exhibit anxiety responses and adrenal reactions under different combinations of conditions (westenbroek., 2005). some of these differences may relate to neurochemical variation in the brains of males and females. both oxytocin and vasopressin are important for social behavior, and there are sex differences in the production and release of these neuropeptides, the location and density of their receptors, and their roles in social behavior (bales and carter, 2003, carter, 2007). there are many sex differences in human psychiatric disorders, most notably anxiety and depression, which some argue are based on sex differences in responses to stress (bangasser and valentino, 2014). one consequence of these findings is that we must study the interactions of stress and social behavior in both sexes in order to make meaningful conclusions about each sex. this idea is gaining greater appreciation within the scientific and funding communities (mogil and chanda, 2005, cahill, 2006, zucker and beery, 2010, couzin - frankel, 2014, clayton and collins, 2014, woodruff., 2014). the social environment can cause stress or ameliorate the impacts of stress, and social behavior responds to stress. these effects may happen all together or at different times, and vary with individual genetic background, experience, sex, species, and other factors. while it is not feasible to study all such factors in a single study, almost a century of research has helped to show which stressors are most impactful in males and females, and how such stress is reflected in neurochemistry. interaction time is a longstanding measure of social behavior, but recent studies have begun to employ more nuanced approaches for instance measuring helping behavior and distinguishing preferences for familiar versus unfamiliar individuals. while adverse social conditions (from subordination to isolation) are potent stressors, the interactions between stress and social behavior also offer multiple entry points into the study of stress resilience. stress resilience varies with early life social environment in particular with experience of maternal behavior and life history of exposure to mildly stressful experiences. resilience can also arise from the mitigating or buffering effects of positive (or negative) social interactions. there is a vast body of literature linking stress and social behavior and their roles in resilience. we may learn the most from these studies when we consider the social life of the organism, and look beyond group averages to individual variability. | the neurobiology of stress and the neurobiology of social behavior are deeply intertwined. the social environment interacts with stress on almost every front : social interactions can be potent stressors ; they can buffer the response to an external stressor ; and social behavior often changes in response to stressful life experience. this review explores mechanistic and behavioral links between stress, anxiety, resilience, and social behavior in rodents, with particular attention to different social contexts. we consider variation between several different rodent species and make connections to research on humans and non - human primates. |
hirayama disease, a rare neurological disease, is characterized by insidious unilateral or bilateral muscular atrophy and weakness of the forearms and hands, without sensory or pyramidal signs. the disease progresses initially, but spontaneous arrest is known to follow several years after the onset, unlike motor neuron disease with which it is commonly confused. hirayama disease is characterized by focal ischemic changes in the anterior horn cells of the lower cervical cord that result in amyotrophy, which is usually unilateral but may also be bilateral. we describe the characteristic findings of flexion magnetic resonance imaging (mri) suggestive of hirayama disease. a 17-year - old male reported in the medicine out patient clinic with a one year history of slowly progressive weakness and atrophy that started in the left hand and the forearm and gradually involved the right hand. the hand weakness limited several activities of his daily living and he could no longer play cricket because of the same. his past medical history was noncontributory ; he denied any allergic disease and none of his family members had similar symptoms. neurological examination revealed severely wasted and weak forearms and hands, tremors but no evidence of pyramidal, spinothalmic, posterior column lesions, polyminimyoclonus or autonomic disturbances. plain cervical spine radiographs showed no abnormalities, or misalignment of the vertebral bodies [figure 1 ]. plain cervical spine (lateral view) radiograph shows no abnormality and no misalignment of the vertebral bodies mri was performed on magnetom concerto 2002b siemens 0.2 tesla mr unit. the following mr sequences were used : 1)precontrast axial, sagittal and coronal t1 and t2-weighted spin - echo.2)post gadolinium contrast axial and sagittal t1-weighted spin - echo.3)axial and sagittal gradient - refocused echo (gre) flexion cervical mr study. cervical mr images in the neutral position showed focal atrophy of the lower cervical cord at the c4 - 7 vertebral levels but no abnormal intramedullary high signal intensity [figure 2 ]. when the neck was flexed, the posterior wall of the cervical dural sac between c4 and d1 vertebral levels was seen to shift anteriorly ; the markedly flattened and anteriorly displaced cervical cord was compressed over the posterior surface of the c4 to d1 vertebral bodies. an enhancing epidural space, isointense with the cord on t1-weighted images and hyperintense on t2-weighted images was noted at the posterior aspect of the lower cervical canal [figures 3 and 4 ]. cervical t1w - sagittal mr image in the neutral position shows focal atrophy of the lower cervical cord at the c4 - 7 vertebral levels but no abnormal intramedullary high signal intensity cervical gre - sagittal mr image in the flexion position shows the posterior wall of the dural sac between c4 and d1 vertebral levels to shift anteriorly, and the anteriorly displaced cervical cord compressed over the posterior surface of the vertebral bodies cervical gre - axial mr image in the flexion position shows the markedly flattened, anteriorly displaced cervical cord due to the epidural lesion (black arrow) the patient was prescribed a cervical collar to prevent neck flexion. this disease was described first by, and named after, hirayama in 1959 and most cases of this disease have been reported from japan and india. this non - familial disorder mostly hits young men, progresses slowly and is often self - limited. researchers argue that wasting and weakness associated with this disease is because of imbalanced growth between the patient 's vertebral column and spinal canal contents. the imbalanced growth causes a tight dural sac and displaces posterior dural wall anteriorly when the neck is flexed. normally, the spinal dura mater is loosely anchored to the vertebral canal by the nerve roots and the periosteum at (a) the foramen magnum and the dorsal surfaces of c2 and c3 and (b) the other at the coccyx. the dura mater is slack enough to adjust to the increased length of cervical spine in flexion. in patients with hirayama disease, however, the tight dural sac separates the posterior dural sac from its subjacent lamina and on neck flexion, can not compensate for the increased length of the posterior wall. the posterior dural wall shifts anteriorly, and the cervical spinal cord gets compressed against the posterior margin of adjacent vertebral bodies. this compression affects the anterior spinal artery and causes microcirculatory disturbances in its territory in the lower cervical cord ; the anterior horn cells which are vulnerable to ischemia begin to degenerate, resulting in localized cord atrophy of the lower cervical region, weak and wasted hands and forearms. hirayama disease is also associated with raised levels of serum ige and several allergic disorders. blood often stagnates in the compressed lower cervical cord allowing platelets to aggregate and cause histamine to be released, factors that cause arterial spasm and microcirculatory disturbances. moreover, the finding that atopic disorders affect young people more than the elderly, men more than women, and asians more than non - asians may in part explain the distribution of hirayama disease. the key to diagnose this disease during mri scanning is to obtain images when the neck is flexed. mr studies in flexion not only show the anterior displacement of the posterior wall but also a well - enhanced crescent - shaped lesion in the posterior epidural space of the lower cervical canal. although hirayama disease is a self - limiting disorder, early diagnosis is necessary because a cervical collar, by preventing neck flexion, may arrest the progression of the disorder. in conclusion, this case showcases how cervical mri, with neck flexed, can pick up dynamic cord compression and contribute to the diagnosis of hirayama disease | a 17-year - old male, who gave up his favorite sport cricket and started playing football, presented with one - year history of slowly progressive atrophic weakness of forearms and hands. neurological examination showed weak and wasted arms, forearms and hand but no evidence of pyramidal tract, spinothalmic tract and posterior column lesions. plain cervical spine radiographs showed no abnormal findings. cervical magnetic resonance imaging (mri) showed asymmetric cord atrophy ; images obtained with neck flexed showed the anterior shifting of the posterior wall of the lower cervical dural sac resulting in cord compression. these findings suggest hirayama disease, a kind of cervical myelopathy related to the flexion movements of the neck. |
at baseline (20022004) 122 participants with type 2 diabetes and 56 age-, sex-, and iq - matched control participants were included ; all were between 56 and 80 years of age (7,8). exclusion criteria were a psychiatric or neurological disorder (unrelated to diabetes) that could influence cognitive functioning, a history of alcohol or substance abuse, or a history of dementia. baseline scans that could be used for volumetric analyses were available in 110 participants with type 2 diabetes and in 50 control participants. of these 160 participants, 6 had died, 4 could not be contacted, 2 were excluded based on the exclusion criteria (1 control participant had a fasting glucose 7.0 and 1 patient had severe comorbid disease), and 63 were not able or willing to participate in the follow - up. reasons for not participating were lack of interest (n = 26) ; comorbidity (n = 20 ; three reported dementia : two patients and one control participant) ; unwillingness or new contraindications to undergo mri, such as a pacemaker (n = 9) ; or other reasons (n = 8). two participants were excluded based on artifacts in the scans, which made reliable volumetric measurements impossible. this left a total of 83 participants (55 patients and 28 control participants, mean follow - up time : 4.1 0.4 years) for inclusion in the present study. age and sex distribution and estimated iq at baseline were not significantly different between participants included (n = 83) and not included (n = 77) in this follow - up mri study. importantly, baseline brain volumes (7) were also not significantly different between participants and nonparticipants. the study was approved by the medical ethics committee of the university medical center utrecht, and all participants signed an informed consent form. at baseline and follow - up, the same standardized interview was used to question participants about level of education (seven categories), medication use, hypercholesterolemia, smoking, history of a macrovascular event (myocardial infarction or stroke requiring hospitalization or surgical or endovascular treatment of atherosclerotic arterial disease), and diabetes duration. at baseline and follow - up, weight and height were measured and blood samples were taken to determine a1c, fasting glucose, and cholesterol levels. at baseline, blood pressure was measured automatically at home on 10 different time points during the day. at follow - up, blood pressure was measured in a seated position at three time points during the half - day visit. hypertension was defined as a systolic blood pressure > 160 mmhg or diastolic blood pressure > 95 mmhg or self - reported use of blood pressure lowering drugs prescribed primarily for hypertension. hypercholesterolemia was defined as a fasting cholesterol > 6.2 mmol / l or self - reported use of lipid - lowering drugs. bmi was calculated as weight (in kilograms) divided by the square of height (in meters). all participants had a neurological examination at baseline and follow - up ; none of the participants had focal abnormalities suggestive of central lesions, such as infarcts. iq was estimated with the dutch version of the national adult reading test, which is generally accepted to reflect the premorbid level of intellectual functioning (8,9). to control for selective loss to follow - up, the cognitive status of participants (a week after participation in the follow - up examination) and nonparticipants was assessed with the modified dutch version of the telephone interview for cognitive status (tics - m), a screening instrument designed to identify people with dementia (10,11). mri scans were acquired at baseline and follow - up on a 1.5 t philips magnetic resonance system using a standardized protocol (38 contiguous slices, voxelsize : 0.9 0.9 4.0 mm) and consisted of an axial t1 (repetition time in ms [tr ] : 234, echo time in ms [te ] : 2), t2 (tr : 2,200, te : 100), proton density (pd) (tr : 2,200, te : 11), inversion recovery (ir) (tr : 2,919, te : 22, inversion time in ms [ti ] : 410), and fluid - attenuated inversion recovery (flair) (tr : 6,000, te : 100, ti : 2,000). on both time points, all images (t1, t2, pd, and ir) of each participant were rigidly registered to the flair image by using elastix (13). scan inhomogeneities were corrected by a shading correction algorithm (14). to exclude all nonbrain and non cerebrospinal fluid (csf) tissue, a brain mask was created for every participant using all baseline images in a k - means the clusters that contained brain and csf were combined, and additional nonbrain and non - csf structures in the formed mask were automatically excluded and holes were filled by using a standardized protocol of morphological operators. a 3-voxel dilation of the mask was performed to include all csf, and the result was manually adjusted to only contain tissue above the foramen magnum. to construct a follow - up mask with the same brain coverage, the baseline flair was rigidly registered to the follow - up flair of the same participant, and the resulting transform parameters were used to transform the baseline brain mask (13). a standardized combination of morphological operators was applied to fill holes and smooth the follow - up mask. the uncorrected flair images were multiplied voxelwise by the binary brain mask, followed by a shading correction to provide better correction (14). for the volume measurements on one time point, volumes were measured by k - nearest neighbor based probabilistic segmentation, an automatic and validated approach to brain segmentation (15). this method is based on manually classified training data, which consists of flair and ir images of 10 matched subjects with a different extent of cerebral atrophy and wmh made by an identical scanning protocol to the images in this study. gray and white matter, peripheral csf (csf without lateral ventricles), lateral ventricular, and wmh volume were automatically classified. the results of the probabilistic classification of all tissues were visually checked for all participants, and incorrectly classified images were excluded. in two participants, a small meningioma was found, which was manually excluded. to reduce the effects of noise, the wmh classification was thresholded on a 0.5 probability, after which isolated classified voxels were automatically excluded. because this confounds the measurement of wmh volume, infarcts were manually segmented from the wmh volume and added to the total brain volume. the total volume of the individual tissues was calculated by multiplying the probabilities by the voxel volume. to correct for between - subject differences in intracranial volume (volume of all classified tissues combined), all baseline and follow - up volumes were expressed as a percentage of intracranial volume. total brain volume (gray and white matter + wmh + infarcts) was calculated on both time points. the total brain, peripheral csf, lateral ventricular, and wmh volume were analyzed. participant characteristics were compared between the type 2 diabetic group and the control group using independent - samples t tests. tics - m scores were compared between participants and nonparticipants at the follow - up examination by an independent - samples t test and differences in loss to follow - up between groups were assessed by pearson tests. within - group changes in brain volumes over time were assessed by using paired t tests. because of nonnormal distribution (kolmogorov - smirnov, p 160 mmhg or diastolic blood pressure > 95 mmhg or self - reported use of blood pressure lowering drugs prescribed primarily for hypertension. hypercholesterolemia was defined as a fasting cholesterol > 6.2 mmol / l or self - reported use of lipid - lowering drugs. bmi was calculated as weight (in kilograms) divided by the square of height (in meters). all participants had a neurological examination at baseline and follow - up ; none of the participants had focal abnormalities suggestive of central lesions, such as infarcts. iq was estimated with the dutch version of the national adult reading test, which is generally accepted to reflect the premorbid level of intellectual functioning (8,9). to control for selective loss to follow - up, the cognitive status of participants (a week after participation in the follow - up examination) and nonparticipants was assessed with the modified dutch version of the telephone interview for cognitive status (tics - m), a screening instrument designed to identify people with dementia (10,11). mri scans were acquired at baseline and follow - up on a 1.5 t philips magnetic resonance system using a standardized protocol (38 contiguous slices, voxelsize : 0.9 0.9 4.0 mm) and consisted of an axial t1 (repetition time in ms [tr ] : 234, echo time in ms [te ] : 2), t2 (tr : 2,200, te : 100), proton density (pd) (tr : 2,200, te : 11), inversion recovery (ir) (tr : 2,919, te : 22, inversion time in ms [ti ] : 410), and fluid - attenuated inversion recovery (flair) (tr : 6,000, te : 100, ti : 2,000). on both time points, all images (t1, t2, pd, and ir) of each participant were rigidly registered to the flair image by using elastix (13). scan inhomogeneities were corrected by a shading correction algorithm (14). to exclude all nonbrain and non cerebrospinal fluid (csf) tissue, a brain mask was created for every participant using all baseline images in a k - means the clusters that contained brain and csf were combined, and additional nonbrain and non - csf structures in the formed mask were automatically excluded and holes were filled by using a standardized protocol of morphological operators. a 3-voxel dilation of the mask was performed to include all csf, and the result was manually adjusted to only contain tissue above the foramen magnum. to construct a follow - up mask with the same brain coverage, the baseline flair was rigidly registered to the follow - up flair of the same participant, and the resulting transform parameters were used to transform the baseline brain mask (13). a standardized combination of morphological operators was applied to fill holes and smooth the follow - up mask. the uncorrected flair images were multiplied voxelwise by the binary brain mask, followed by a shading correction to provide better correction (14). for the volume measurements on one time point, volumes were measured by k - nearest neighbor based probabilistic segmentation, an automatic and validated approach to brain segmentation (15). this method is based on manually classified training data, which consists of flair and ir images of 10 matched subjects with a different extent of cerebral atrophy and wmh made by an identical scanning protocol to the images in this study. gray and white matter, peripheral csf (csf without lateral ventricles), lateral ventricular, and wmh volume were automatically classified. the results of the probabilistic classification of all tissues were visually checked for all participants, and incorrectly classified images were excluded. in two participants, a small meningioma was found, which was manually excluded. to reduce the effects of noise, the wmh classification was thresholded on a 0.5 probability, after which isolated classified voxels were automatically excluded. the automated segmentation tends to classify the gliotic core around infarcts as wmh. because this confounds the measurement of wmh volume, infarcts were manually segmented from the wmh volume and added to the total brain volume. the total volume of the individual tissues was calculated by multiplying the probabilities by the voxel volume. to correct for between - subject differences in intracranial volume (volume of all classified tissues combined), all baseline and follow - up volumes total brain volume (gray and white matter + wmh + infarcts) was calculated on both time points. the total brain, peripheral csf, lateral ventricular, and wmh volume were analyzed. participant characteristics were compared between the type 2 diabetic group and the control group using independent - samples t tests. tics - m scores were compared between participants and nonparticipants at the follow - up examination by an independent - samples t test and differences in loss to follow - up between groups were assessed by pearson tests. within - group changes in brain volumes over time were assessed by using paired t tests. because of nonnormal distribution (kolmogorov - smirnov, p 0.05). as expected, the groups differed on vascular risk factors and glycemic control. at follow - up, nine patients and three control participants had new brain infarcts. defined as a myocardial infarction or stroke requiring hospitalization or surgical or endovascular treatment of atherosclerotic arterial disease. a tics - m was obtained from 51 (76% with diabetes) of 67 nonparticipants at follow - up who were still alive and could be contacted and from 79 (66% with diabetes) of 83 participants. the tics - m score was similar and normally distributed for participants and nonparticipants (participants mean 36.9 4.4, nonparticipants 35.1 6.0, p > 0.05). among all nonparticipants, three patients with type 2 diabetes (3% of baseline sample) and two control participants (4% of baseline) had marked cognitive impairment based on caregiver - reported dementia or a tics - m score 0.05). at follow - up, 14 control participants had impaired fasting glucose levels (5.66.9 brain volumes at baseline and changes in volume over time in this group were similar to the other control participants. moreover, if these 14 individuals were removed from the comparison between the diabetic and control group, the results remained essentially the same. in separate analyses for individuals below and above the age of 65 years, the differences between the diabetic and control group remained largely identical (data not shown). in separate analyses for men and women, female patients with type 2 diabetes compared with female control participants had a smaller baseline total brain volume (2.07% [3.36 to 0.78 ], p = 0.002), a larger baseline peripheral csf (1.28% [0.09 to 2.47 ], p = 0.036) and lateral ventricular (0.78% [0.25 to 1.32 ], p = 0.005) volume, and a greater increase in lateral ventricular volume over time (0.21% in 4 years [0.04 to 0.37 ], p = 0.016). although the directions of these effects were similar in male participants, no significant baseline or longitudinal between - group differences were found for male participants (p > 0.05). in table 3, the secondary analyses on metabolic and vascular risk factors within the type 2 diabetic group are shown adjusted for age and sex. increasing age was associated with a smaller total brain volume (volume difference per 5-year increase of age [95% ci ] 1.00% [1.59 to 0.41 ], p = 0.001) and a larger peripheral csf volume (0.93% [0.38 to 1.48 ], p = 0.001). increasing age was also associated with a greater decrease in total brain volume over time (difference in change over time per 5-year increase of age 0.06% per year [0.10 to 0.02 ], p = 0.005) and a greater increase in peripheral csf volume (0.05% per year [0.01 to 0.09 ], p = 0.010). the presence of hypertension at baseline was not associated with baseline brain volumes, but hypertension was associated with a greater decrease in total brain volume over time (difference in change over time between patients with hypertension versus no hypertension 0.10% per year [0.20 to 0.01 ], p = 0.033) and a greater increase in peripheral csf volume (0.12% per year [0.04 to 0.20 ], p = 0.006). no significant associations between baseline brain volumes or brain volume change and sex, diabetes duration, a1c level, mean arterial pressure, total cholesterol levels, hypercholesterolemia, bmi, and history of a macrovascular event were found (p > 0.05). relationship between baseline determinants and baseline volumes and volume change over time in patients with type 2 diabetes data are regression b coefficients (95% ci) for each determinant, adjusted for age and sex. relative total brain volume decreases and relative peripheral csf, lateral ventricular, and wmh volume increases over time. therefore, negative b values in change over time reflect a greater decrease in relative total brain volume, whereas in the other volumes positive b values reflect a greater increase of these volumes. defined as a systolic blood pressure > 160 mmhg or diastolic blood pressure > 95 mmhg or self - reported use of blood pressure lowering drugs prescribed primarily for hypertension. defined as a myocardial infarction or stroke requiring hospitalization or surgical or endovascular treatment of atherosclerotic arterial disease. at baseline patients with type 2 diabetes had more cerebral atrophy than control participants. both the control and the type 2 diabetic group showed a significant progression of cerebral atrophy and wmh volume over 4 years. patients with type 2 diabetes had a greater increase in lateral ventricular volume than control participants. in explorative analyses on risk factors within the type 2 diabetic group, increasing age was associated with more cerebral atrophy and increasing age and the presence of hypertension at baseline were associated with greater progression of cerebral atrophy. the baseline findings of our study are in line with previous cross - sectional studies, which consistently report an association between type 2 diabetes and modest cerebral atrophy (rev. in 3). to the best of our knowledge, no longitudinal studies that specifically addressed progression of cerebral atrophy over time in type 2 diabetes have been published. however, in a longitudinal study on cardiovascular risk factors and dementia in the elderly, diabetes was found to be associated with a greater increase in lateral ventricular volume (16). moreover, some cross - sectional studies observed an association between diabetes duration and severity of cerebral atrophy (6,17) but not invariably (7). in combination with the results of these previous studies, our results suggest that cerebral atrophy in patients with type 2 diabetes progresses only slowly relative to control participants over the course of years. hence, the average rate of decline in patients with type 2 diabetes stayed within the range of normal ageing and does not approach the accelerated loss that is observed in disease states such as alzheimer 's disease (18). it is important to note that in our study population, cognitive decline was also not accelerated in the type 2 diabetic group relative to control participants (10). cross - sectional studies on the association between type 2 diabetes and wmh, as assessed with visual rating scales, showed inconsistent results (rev. in 4). however, when detailed rating scales were used, a modest association with deep wmh was observed (5,8). recent longitudinal studies (19,20) on the association between wmh progression and vascular risk factors in the elderly reported an association between diabetes and an increased wmh progression rate. we found no significant association between type 2 diabetes and wmh volume for cross - sectional as well as longitudinal measurements in the present study, whereas we did observe an association in our baseline cohort (7). this discrepancy can be explained by the relatively large interindividual variability in wmh volume, the small difference in wmh volume between groups combined with the relatively limited sample size of the present study. volumetric methods that can also make a distinction in periventricular and deep wmh and a larger sample size are needed to look at this association in more detail. the sex - related differences in baseline brain volumes between groups observed in our study were comparable to the differences found in our baseline study in which between - group brain volume differences were also only significant for female participants (7). previous studies on cognitive functioning or dementia in patients with diabetes did not observe sex - specific increases in the rate of cognitive decrements (2). however, it must be noted that the effect of sex on brain volume change and cognition in diabetes has not yet been analyzed systematically, and this is a topic that will need to be addressed in further studies. relatively few studies have specifically examined metabolic and vascular determinants of brain - imaging abnormalities in patients with type 2 diabetes. cross - sectional studies (7,17,21,22) report hypertension, diabetes duration, and history of macrovascular events as determinants of cerebral atrophy and diabetes duration as a determinant of wmh volume. in the present study, cross - sectional studies in community - dwelling elderly subjects showed a1c level as a determinant of wmh volume and a1c and bmi as determinants of cerebral atrophy (23,24). furthermore, in longitudinal population - based studies, not specifically in individuals with diabetes, a history of stroke was found as a determinant of wmh progression, and a1c levels, and bmi and severe wmh were found as determinants of cerebral atrophy progression (19,24). studies on cognitive dysfunction in type 2 diabetes have identified both vascular factors and elevated a1c as possible determinants (8,25), but results are not always consistent across studies. although experimental studies identify several possible mechanisms that may contribute to cerebral damage in type 2 diabetes, including glucose toxicity, vascular disturbances, and abnormal insulin signaling in the brain, it is yet unclear which of these factors are the main causal factors of cerebral damage in humans (2). the strength of the present study is the prospective design in combination with precise automatic brain volume measurements and detailed assessment of metabolic and vascular determinants in patients and control participants. the observed changes in brain volumes over time are well outside the error of measurement of our method. limitations include the loss to follow - up, which can lead to possible selection bias. nevertheless, compared with the participants at follow - up, nonparticipants were similar in age, sex distribution, estimated iq, and baseline brain volumes. the results of the tics - m also show no selection bias due to drop out of participants with severely impaired cognitive functioning. however, the relatively healthy patient population and the risk factor profile of the control participants could have underestimated the effects of type 2 diabetes. finally, the analyses of the determinants were affected by the modest sample size and difficulties inherent to the assessment of these determinants. diabetes duration, for example, can not be firmly established because diabetes develops insidiously and tends to be undiagnosed during the first years after onset. in addition, the actual levels of risk factors such as a1c and blood pressure, change over time and under the influence of treatment. in conclusion, the greater increase in lateral ventricular volume over time in patients with type 2 diabetes as compared with control participants shows that type 2 diabetes is associated with a slow increase of cerebral atrophy over the course of years. | objectivetype 2 diabetes is associated with a moderate degree of cerebral atrophy and a higher white matter hyperintensity (wmh) volume. how these brain - imaging abnormalities evolve over time is unknown. the present study aims to quantify cerebral atrophy and wmh progression over 4 years in type 2 diabetes.research design and methodsa total of 55 patients with type 2 diabetes and 28 age-, sex-, and iq - matched control participants had two 1.5 t magnetic resonance imaging scans with a 4-year interval. volumetric measurements of total brain, peripheral cerebrospinal fluid (csf), lateral ventricles, and wmh were performed with k - nearest neighbor based probabilistic segmentation. all volumes were expressed as percentage of intracranial volume. linear regression analyses, adjusted for age and sex, were performed to compare brain volumes between the groups and to identify determinants of volumetric change within the type 2 diabetic group.resultsat baseline, patients with type 2 diabetes had a significantly smaller total brain volume and larger peripheral csf volume than control participants. in both groups, all volumes showed a significant change over time. patients with type 2 diabetes had a greater increase in lateral ventricular volume than control participants (mean adjusted between - group difference in change over time [95% ci ] : 0.11% in 4 years [0.00 to 0.22 ], p = 0.047).conclusionsthe greater increase in lateral ventricular volume over time in patients with type 2 diabetes compared with control participants shows that type 2 diabetes is associated with a slow increase of cerebral atrophy over the course of years. |
Subsets and Splits
No saved queries yet
Save your SQL queries to embed, download, and access them later. Queries will appear here once saved.