article
stringlengths 0
682k
| abstract
stringlengths 146
3.69k
|
|---|---|
in the previous issue of critical care, friesecke and colleagues demonstrate that the survival rate of patients with severe lactic acidosis due to metformin accumulation can be strikingly higher than expected based on the initial clinical evaluation. metformin is nowadays the first - line drug of choice for the treatment of adults with type 2 diabetes. this drug is the sixth most frequently prescribed in the usa (> 50 million prescriptions in 2009) and is taken by almost 1.5% of the italian population. metformin is a safe drug when correctly used in properly selected patients. in particular, no cases of lactic acidosis (a relatively common side effect of other biguanide compounds) were reported in 347 trials with 70,490 patient - years of metformin use. real life can differ from research settings, however, and lactic acidosis has been repeatedly, although rarely, observed in patients treated with metformin. the number of inquiries to the swedish poison information centre for metformin intoxication has increased 10 times during the past decade, with 25 cases of severe lactic acidosis reported in 2007 and 2008. according to the american association of poison control centers forty - nine cases of lactic acidosis and accidental metformin accumulation were reported to the poison control centre of pavia (italy) from january 2005 to august 2010, resulting in 11 deaths. since metformin use is constantly increasing - there has been a 10 to 15% rise in prescriptions per year in the usa and italy - related cases of lactic acidosis may become less rare. the term metformin - associated lactic acidosis refers to any case of lactic acidosis that develops in a patient treated with metformin, with no further mechanistic insight. in most of the cases, however, lactic acidosis can not be directly attributed to metformin use but rather depends on concomitant low cardiac output, anemia, hypoxemia or liver failure. the term metformin - induced lactic acidosis specifically refers to cases that can not be explained by any major risk factor other than metformin overdose. the distinction between these two entities is sometimes very subtle and metformin accumulation may coexist with other risk factors, all contributing to the pathogenesis of lactic acidosis. the present case series includes 10 patients admitted to intensive care with lactic acidosis and metformin accumulation due to renal failure. at admission, arterial ph was 6.75 0.13 and lactatemia was 19 5 mmol / l. the simplified acute physiology score ii was 88 23 and the predicted mortality was 96%. eight (80%) patients had a cardiac arrest during their stay in intensive care. treatment consisted of vital function support and renal replacement therapy. despite the dramatic severity of clinical presentation, hospital survival was 50%. conversely, there were no survivors out of 31 patients with similarly severe lactic acidosis from other causes (mainly cardiogenic, septic or hemorrhagic shock) who were admitted to the same institution during the same period of time. this finding is in line with previous observations. in 49 patients treated with metformin who developed severe lactic acidosis, survival was 17% among those with no drug accumulation (that is, lactic acidosis was actually due to another precipitating event) and was 71% in those with metformin accumulation, despite a similar severity of hyperlactatemia. in another series, one out of 10 (10%) patients with lactic acidosis probably due to metformin accumulation actually died despite an initially predicted mortality of around 55%. we have recently reviewed the data for 24 critically ill patients with lactic acidosis and proven or probable metformin intoxication. despite an expected mortality of 70%, observed mortality was 21%. even patients with initial arterial ph down to 6.62, lactatemia up to 33 mmol / l or simplified acute physiology score ii as high as 87 managed to survive to hospital discharge. that lactic acidosis carries lactic acid per se, however, is unlikely to be the explanation for this association. this response provides some energy and a chance for cells to survive, even when oxygen availability or utilization are defective. cancer cells in a way provide the best evidence for lactate overproduction being an efficient response to hypoxia. by mainly relying on anaerobic metabolism, malignant cells can not only survive but even proliferate in a hypoxic environment, so that tumor growth can exceed angiogenesis. according to the theory of lactate shuttles proposed by brooks acidosis itself may arise as an adaptive response to inadequate energy provision and may extend cellular viability. the prognosis of lactic acidosis primarily depends on the underlying mechanism and on its reversibility. when lactic acidosis is due to metformin accumulation, then renal replacement therapy can efficiently remove the toxic substance (that is, metformin and not lactate !) and prognosis can be surprisingly good. the situation can be much more complex and less easily reversible when lactic acidosis is primarily due to severe hypoxia or tissue hypoperfusion. based on present and past observations, one may conclude that the decision to treat (or not to treat) a patient with suspected metformin - induced lactic acidosis can not be based only on the severity of clinical presentation. we personally believe that treatment of the critically ill patient should always include drug removal, as long as metformin accumulation is thought to be responsible for severe lactic acidosis. since a plasma metformin dosage is rarely available in most centers, intoxication should be considered highly probable whenever lactic acidosis and renal failure are uncommonly severe, other primary explanations are not evident and chronic metformin use is reported. | metformin is a safe drug when correctly used in properly selected patients. in real life, however, associated lactic acidosis has been repeatedly, although rarely, reported. the term metformin - induced lactic acidosis refers to cases that can not be explained by any major risk factor other than drug accumulation, usually due to renal failure. treatment consists of vital function support and drug removal, mainly achieved by renal replacement therapy. despite dramatic clinical presentation, the prognosis of metformin - induced lactic acidosis is usually surprisingly good. |
in june 2003, an outbreak of plague emerged in the oran area of algeria (4). during the following weeks, a total of 11 confirmed and all cases were bubonic plague ; septicemia and coma later developed in 2 patients. according to national health records, the last outbreak in oran was in 1946 and the last human cases of plague occurred in algeria in 1950. the aim of this study was, by using molecular methods, to investigate the presence of y. pestis in fleas collected from rodents. the sites of the original focus of reported plague cases were kehailia (3529n, 032e) and benaouali (3533n, 021e), in the area of oran and mascara, 450 km west of the capital, algiers (figure). fleas were collected from rodents trapped inside human residences and peridomestic areas within this area (figure) from september 2004 to may 2005 by using bts (besancon technique service, inra, montpellier, france) and sherman trap (h.p. specimens were stored in absolute ethanol before being tested in marseille, france, in may 2005. preliminary morphologic identification was performed (by i.b.) by using entomologic taxonomic keys (5). identification was confirmed by sequencing regions of siphonapteran 18s rdna, as previously described (6). sequences were compared with flea sequences deposited in the 18s rdna database of the whiting laboratory (6). ethanol - preserved fleas were rinsed with distilled water for 10 minutes and dried on sterile filter paper in a laminar biosafety hood. fleas were crushed individually in sterile eppendorf tubes with the tips of a sterile pipette. dna was extracted by using the qiaamp tissue kit (qiagen, hilden, germany) according to the manufacturer 's instructions. y. pestis dna was detected by real - time pcr with primers against the plasminogen activator (pla) gene of y. pestis (eurogentec, angers, france) as previously described (7). for this assay, negative controls consisted of extracted dna of uninfected fleas from colonies of our laboratory. positive control consisted of a plasmid previously developed in our laboratory for detecting bioterrorism agents ; using this control permitted both control of cycling efficacy and detection of contamination during the pcr process (7). to confirm positive results, extracted dna was amplified, and pcr products were sequenced by using 2 alternative spacer targets of y. pestis (spacers yp8 and yp9) as previously described (8). positive sample products were sequenced with an abi 3130xl genetic analyzer (applied biosystems, coignieres, france). sequences were compared with those available in genbank by using the nucleotide - nucleotide blast (blastn) program (available from http://www.ncbi.nlm.nih.gov/blast/) together with those of our local database (8). map of the zone where fleas were collected and sites of epidemic plague reported, algeria, june 2003. ninety five fleas were collected from rodents, including 21 rattus rattus, 13 r. norvegicus, 7 mus musculus, and 8 m. spretus trapped inside the houses and in the peridomestic areas of the cities of kehailia and benaouali (figure). using taxonomic keys, we identified all 95 fleas morphologically as x. cheopis (the rat flea) ; fleas index was calculated according to rats or mice, respectively (3.333 and 3.125). identity was confirmed by sequencing and comparison of an 1,867-bp informative region of siphonapteran 18s rdna (6). using the lightcycler (lc, roche diagnostics, mannheim, germany) real - time - pcr assay previously developed for detecting bioterrorism agents targeting the plasminogen activator gene (7), we found 20 (21.05%) of 95 fleas positive with a cycle threshold (ct) value ranging from 27.2 to 33.91. among these 20 positive fleas, 9 were also positive in multiple spacer typing (mst) assays by using primers targeting spacer yp8 and 8 with primers targeting the spacer yp9 (table). the mean ct value obtained with the lc assay for the 9 fleas positive with the yp8 primers was significantly lower that the mean ct value for the remaining 11 fleas only positive with the lc assay (29.56 1.55 ; n = 9 vs. 31.98 1.13 ; n = 11 ; p = 0.0005) (table). sequences of the pcr products obtained with yp8 and yp9 primers were 100% identical to sequences of y. pestis biovar orientalis (genbank accession nos. examined by lightcycler (lc) and multiple spacer typing (mst) assays. ct, cycle threshold ; sd, standard deviation ; nd, not done. p<0.05 between mean ct values of fleas positive with lc assay only and fleas positive with mst and lc assays. in this study we present molecular evidence of y. pestis in 20 x. cheopis fleas collected in the area of oran, algeria. the molecular methods used in our study have been previously validated (7,8), and precautions were taken to reduce risks for contamination during processing. rieux, the hero of albert camus (9) in " la peste, " aimed to relate the events of the plague outbreak in oran in the 1940s with the highest objectivity. he stated that " the virus " of plague can come back 1 day and he asked to be aware when it did. apparently plague has retired but is waiting in numerous foci and could reemerge, as it did in india during the 1990s. the " comeback " of plague in the region of oran occurred in june 2003. in this study, we detected y. pestis in rodent fleas collected from september 2004 to may 2005 in the same area as those plague cases occurred. the persistence of zoonotic foci of plague is worrying since persons living in these areas remain in close contact with rodents and fleas. despite the absence of new cases since june 2003 surveillance should be maintained to monitor this natural focus and potential spread resulting from climatic or habitat influences (10). a strong case could be made to extend surveillance to adjacent countries such as libya and mauritania, which also have natural foci of plague, according to the world health organization. in conclusion we believe that detection of y. pestis in fleas can be a useful tool for epidemiologic surveillance of plague in specific settings and could thus serve to study the risk for reemergence of the disease. | after an outbreak of human plague, 95 xenopsylla cheopis fleas from algeria were tested for yersinia pestis with pcr methods. nine fleas were definitively confirmed to be infected with y. pestis biovar orientalis. our results demonstrate the persistence of a zoonotic focus of y. pestis in algeria. |
the patient - centered scalable national network for effectiveness research (pscanner) is a consortium of three existing networks that together constitute a highly diverse patient population with respect to insurance coverage, socioeconomic status, demographics, and health conditions. system characteristics of pscanner 's participating institutions each institution is listed with its respective number of patients, number of hospitals / clinics, and the electronic health record (ehr) system. va informatics and computing infrastructure (vinci ; http://www.hsrd.research.va.gov/for_researchers/vinci/) is a major informatics initiative of the veterans health administration (vha) that provides a secure, central platform for performing research and supporting clinical operations activities. in addition to national data, vinci hosts commercial and custom analytical software for natural language processing, annotation, data exploration, and epidemiological analysis. the vha treats 8.76 million veterans within an integrated healthcare delivery system, which includes hospitals, outpatient pharmacies, ancillary care facilities, and laboratory and radiology services. since the 1980s, all va facilities have used the same electronic health record (ehr) system, named veterans information system technology architecture (vista). on a nightly basis, the va 's clinical data warehouse (cdw) is updated from vista. this cdw stores vast amounts of clinical data dating back to 2000. however, within pscanner, vinci patient data will be available for consultation through privacy - preserving, distributed computing methodology. the va team within pscanner will continue to develop analytical modules and map its cdw to the observational medical outcomes partnership (omop) common data model.1 the university of california research exchange (uc - rex ; http://www.ucrex.org) was established in 2010 and has been funded by the university of california office of the president since 2011 through the uc - biomedical research acceleration, integration, and development (uc - braid) initiative, which streamlines operations within the uc system such as institutional review board (irb) activity, biorepository coordination, and other research activities. uc - rex is also supported by the national institutes of health (nih) clinical translational science awards from five uc health systems (uc davis, irvine, los angeles, san francisco, and san diego). uc - rex has ehr data for over 12 million patients, and has used the i2b22 data model for cohort discovery based on a limited set of variables related to demographics, diagnoses, laboratory tests, and medications. in pscanner, uc - rex will map its cdws to the omop model. scalable national network for effectiveness research (scanner ; http://scanner.ucsd.edu) was established in late 2010 with agency for healthcare research and quality (ahrq) funds. its goal was to provide a secure, scalable distributed infrastructure to facilitate comparative effectiveness research3 among widely dispersed institutions, and to provide flexibility to participant sites in the means for data - driven collaboration. scanner developed a comprehensive service - oriented framework for mapping policy requirements into network software and data operations,4 and demonstrated ability to interoperate with institutions that were not in its initial member list. scanner services were adopted in interventional comparative effectiveness trials led by the university of southern california (usc) team and funded by the national institute on aging (nia). four interventional studies (three randomized trials and one quasi - randomized trial) have been carried out on the network. through these studies, scanner 's data model was further developed to capture important interventional variables and economic outcomes. sites included three federally qualified health systems in the los angeles area : altamed, queenscare family clinics, and the children 's clinic of long beach. the scanner team has collaborated with other networks in the development and/or utilization of standards and tools (eg, data model development of omop v.4.0 in collaboration with investigators from saftinet5). since 2010, components of scanner technology have facilitated scaling from the original ahrq- and nia - sponsored studies to an additional intervention study involving patient - reported data in an obesity cohort at queenscare family clinics and an independently funded center for medicare & medicaid innovation (cmmi) study targeting patients with congestive heart failure and patients with high body mass index. the scanner team also completed engagement research that included patients (six focus groups,6 california statewide survey of consumers, va patient surveys, patient navigator preliminary surveys, as well as a national survey). findings from these studies informed the approach to patient engagement in governance and in prioritization of research questions that will be used in pscanner. initial use cases in pscanner will focus on three conditions : (1) congestive heart failure ; (2) obesity ; (3) kawasaki disease. kawasaki disease, a rare disease, is an acute vasculitis that causes heart disease in children and young adults.7 patients / caregivers, clinicians, researchers, and administrators who represent these conditions will be recruited from participating clinical sites and advocacy and patient organizations to participate at multiple levels from stakeholder input, to advisory board, to national committee. patient leaders, such as the patient co - chair of the steering committee and patient co - chairs of the advisory board, will be key decision - makers in the development of guidelines that will apply to all three conditions for the whole network. they will also help design the best approaches for recruiting and engaging patients at all levels of governance. one example of our engagement process is the use of a systematic approach to achieve consensus on identification and prioritization of research questions to be studied in the network. we will apply the rand / ucla modified delphi appropriateness method, a deliberative and iterative approach to attaining consensus through discussion and feedback.8 while in - person engagement may be desirable, it is often not pragmatic : events can be time- and cost - prohibitive for larger groups of stakeholders. figure 1 depicts our planned method of engagement. to convene large (n=360) regional or national samples of stakeholders representing patients, clinicians, and researchers across the three different health conditions deliberative research has shown that offering data on opinions from subgroups of discussants as well as the overall group9 can facilitate more effective conclusions. we will use rand 's online delphi consensus management system, called expertlens,10 which allows stakeholders with different expertise to weigh in on all questions in order to float issues that might not be considered by a less diverse group. the system has been used in mixed stakeholder groups, including patients and clinicians, and found to facilitate rapid consensus panels for selecting research questions with large groups of stakeholders with much greater efficiency than the traditional delphi process.11 using this approach, pscanner will have the ability to capture consensus input from a large group of participating stakeholders in a systematic manner to drive research priorities. stakeholders from across patient - centered scalable national network for effectiveness research (pscanner) sites (360 total) will be recruited to participate in a three - round expertlens process, which will prioritize research questions that should be addressed by pscanner. in round 1 medians and quartiles of group responses to each question will be presented to the participants. in round 3, participants will be asked to modify their round 1 responses based on round 2 feedback and discussion. pscanner will adhere to recognized terminologies, including meaningful use or centers for medicare & medicaid services (cms) billing terminology standards for diagnosis codes (the international classification of diseases, ninth revision, clinical modification (icd-9-cm), icd-10-cm or snomed clinical terms (snomed ct)), procedures and test orders (current procedural terminology (cpt) or healthcare common procedure coding system (hcpcs)), and medications (national drug code (ndc) or rxnorm). in some cases, the native encoding for laboratory information is logical observation identifiers names and codes (loinc) ; in other cases, these mappings are translated and maintained as part of research data warehouses. federally incentivized standards for terminologies and structures have been established for communicating single records ; indeed, patients themselves can request these digital continuity of care documents and relay them to clinical data research networks (cdrns) or patient - powered research networks (pprns). however, multisite pcor analysis requires communicating rules for processing raw population - level data into prepared analytic datasets. there are emerging standards from health level seven (hl7), the health quality measures format (hqmf), and quality reporting document architecture (qrda) specifications for datasets and abstract data processing rules for electronic quality measures. these standards have not yet become fully integrated into federally incentivized data policy. in scanner, we adopted a syntax that is compatible with the hqmf and qdra because these standards have some preliminary endorsement by the national quality forum, cms, and office of the national coordinator as a means of specifying population - level datasets for electronic quality measures. pscanner datasets will be specified in this syntax, which can then be interpreted by an adapter to generate executable queries (scanner implemented an adapter for omop v.4.012). all institutions in pscanner have agreed to standardize their data model to omop and to install a pscanner node to allow distributed computing, which greatly enhances distributed count query capabilities into multivariate analytics. the standard operating procedures for data harmonization will include well - defined steps for data modeling and quality control using tools that have been developed and continue to be developed by the omop data management collaborative.1316 all steps will be published in a standard format to ensure that the data within the network will adhere to standard operating procedures, and that they can be easily shared with other members of pcornet that adopt omop or similar models. members of pscanner are active participants in the data quality assessment collaborative (http://repository.academyhealth.org/dqc/), and have developed additional tools for quality auditing and assessing validity and fitness for use in both research and other secondary uses of population - level data.1719 patient - centered scalable national network for effectiveness research (pscanner) architecture. it will use privacy and security tools to enable distributed analysis of data while keeping data in their host institutions and adhering to all applicable federal, state, and institutional policies. k, thousand ; m, million ; omop, observational medical outcomes partnership ; queenscare, queenscare family clinics ; sfgh, san francisco general hospital ; tcc, the children 's clinic of long beach ; ucd, university of california, davis ; uci, university of california, irvine ; ucla, university of california, los angeles ; ucsd, university of california san diego ; ucsf, university of california, san francisco ; va, veterans affair ; vm, virtual machine. pscanner addresses institutional policies and patient preferences for data sharing by leveraging recent privacy policy study findings in its technology design and implementation. scanner 's original partners consisted of institutions with highly diverse policies related to the use of ehrs for research. we produced a comprehensive comparison of the legal requirements and differences among federal and state regulations for states involved in scanner.13 we carefully documented health system privacy requirements obtained from institutional documents as well as interviews with system leaders. additionally, we interviewed patients and clinicians to understand their preferences towards individual privacy.6 20 the scanner team described the security and privacy standards used in cdrns.21 we also conducted a systematic review of privacy technology used in cdrns.3 we codified data - sharing policies13each institution specified the policies to which it should adhere. for example, institutions that could share patient - level data were welcome to do so, while institutions that had to keep their patient - level data within their firewalls could share aggregate data such as coefficient estimates, which are equally useful in building multivariate models that span all institutions.22 23 as other institutions joined the network, only new policies were encoded. we have architected pscanner so that authorized users can use a privacy - preserving distributed computation model and research portal that was successfully piloted in scanner. this portal includes a study protocol and policy registry for each study, sites approve specific analytic tools, datasets, and protocols for data privacy and security. role - based access controls (rbacs) corresponding to federal, state, institutional, and study - specific policies are encoded in the registry and enforced through scanner data access services. scanner 's main goal was to develop a set of highly configurable, computable policies to control data access and to develop effective methods to perform multisite analyses, without necessarily transferring patient - level data.3 22 24 25 traditional approaches to multisite research involve transferring patient - level data to be pooled for inferential statistics (eg, multivariate regression). while this can be supported, we conduct comparative effectiveness research with increased efficiency because scanner allows distributed regressions, thereby avoiding more complex irb and data use agreements. scanner 's analytic library was seeded with analysis tools used and validated in multiple publications,2629 and incorporated into the observational cohort event analysis and notification system (oceans) (http://idash.ucsd.edu/dbp-tools#overlay-context=idash-software-tools) and grid binary logistic regression (glore),22 which include multivariate analysis methods that allow model fitting, causal inference, and hypothesis testing. when a study policy is created, the site principal investigator specifies the allowable analytic methods and transfer protocols. in particular, each study 's site principal investigator will determine if results must be held locally and approved by a delegated representative prior to release for transfer. our distributed system allows the construction and evaluation of multivariate models that can be used for statistical process control, data safety monitoring in clinical trials, adjustment for confounders, propensity score matching, risk prediction, and other methods used in pcor (figure 3). patient - centered scalable national network for effectiveness research (pscanner) answers an end - user 's scientific question by distributing the corresponding query to each participating site, processing the query locally while preserving each site 's stringent data privacy and security requirements, then aggregating the responses into a coherent answer. the scanner central node is located within a secure health insurance portability and accountability act (hipaa)-compliant environment and will migrate to the platform developed for the nih - funded integrating data for analysis, anonymization, and sharing center (idash), which is now being modified to be federal information security management act (fisma) certified. for studies that require pooling of data, the hub will store the data in idash and will use methods that were developed to protect privacy of individuals3 30 31 and institutions from which the data originate.22 23 25 32 future work in the pscanner project will extend these capabilities to include infrastructure necessary for managing randomized clinical trials, including randomization, recruitment, and enrollment tracking systems. access to this environment is provided through a virtual private network, and we are implementing a two - factor authentication based on the rsa technology, which issues new keys every minute. these one - time keys are displayed on key fobs or through free apps as soft tokens on smartphones. requests are received by scanner software outside the firewall and transmitted to the virtual machine (vm) located inside the firewall according to predefined authorization rules. the scanner network software is compliant with national institute of standards and technology rbac, and applies best practices for restful web services to ensure that both data and role - based policy settings are not vulnerable to attack by adversaries.33 34 all communications are fully encrypted end - to - end, and all nodes participating in the network authenticate each other through x.509 certificate exchanges. users have to login through a virtual private network when they are not on campus. since the network currently only provides results of count queries, all results are provided automatically, with the addition of some noise in the counts35 36 to prevent users from uniquely identifying a specific patient through a series of queries. vinci and the va are transitioning to a two - factor authentication system to authorize users. currently, centrally managed username and password are required. soon, personal identification verification cards will be required va wide to access the va network. within a protected enclave of the secure va network, vinci hosts integrated national data. access to data is provisioned through an electronic system that matches irb protocol to datasets. vinci has 105 high - performance servers and 1.5 petabytes of high - speed data storage with multiple layers of security. unless explicitly requested and institutionally approved, all sensitive patient data must remain on vinci project servers. our network of three networks representing multiple health systems and diverse populations embodies the challenges and opportunities that pcornet itself has to face. while we have based the design of our system on qualitative research and stakeholder engagement, in practice, adoption and success will depend on many factors. for example, pscanner will encode a significant portion of policies in software, use a flexible strategy to harmonize data, and use privacy - preserving technology that enables highly diverse institutions to join the network and allow stakeholders to participate. significant challenges in terms of providing sufficient incentives for patients, clinicians, and health systems to participate and ensuring the sustainability of the network, which were not the focus of this article, will also need to be addressed. the pscanner project offers a unique opportunity to make progress toward these objectives, and share results with a community of researchers and representatives from a broader group of stakeholders. it represents a unique opportunity to reaffirm our goals : our health systems have public service as their primary mission, from both a healthcare and an educational perspective. pscanner is itself a reflection of this mission, teamwork, and focus on patient outcome research to improve health. | this article describes the patient - centered scalable national network for effectiveness research (pscanner), which is part of the recently formed pcornet, a national network composed of learning healthcare systems and patient - powered research networks funded by the patient centered outcomes research institute (pcori). it is designed to be a stakeholder - governed federated network that uses a distributed architecture to integrate data from three existing networks covering over 21 million patients in all 50 states : (1) va informatics and computing infrastructure (vinci), with data from veteran health administration 's 151 inpatient and 909 ambulatory care and community - based outpatient clinics ; (2) the university of california research exchange (uc - rex) network, with data from uc davis, irvine, los angeles, san francisco, and san diego ; and (3) scanner, a consortium of ucsd, tennessee va, and three federally qualified health systems in the los angeles area supplemented with claims and health information exchange data, led by the university of southern california. initial use cases will focus on three conditions : (1) congestive heart failure ; (2) kawasaki disease ; (3) obesity. stakeholders, such as patients, clinicians, and health service researchers, will be engaged to prioritize research questions to be answered through the network. we will use a privacy - preserving distributed computation model with synchronous and asynchronous modes. the distributed system will be based on a common data model that allows the construction and evaluation of distributed multivariate models for a variety of statistical analyses. |
initial workup exams demonstrated a 2.8 cm cortical lower pole tumor in the right kidney. renovascular hypertension, primary hyperadosteronism and pheocromocytoma are potential diagnosis that must not be forgotten and should be excluded. although rare, chronic pyelonephritis and renal tumors as rennin - producing tumors, nephroblastoma, hypernephroma, and renal cell carcinoma might also induce hypertension and should be in the diagnostic list of clinicians. approximately 5% of patients with high blood pressure have specific causes and medical investigation may usually identify such patients. furthermore, these patients can be successfully treated and cured, most times by minimally invasive techniques. this interesting case might expand knowledge of physicians and aid better diagnostic care in future medical practice. approximately 5% of patients with hypertension have specific secondary causes, which may be identified after meticulous medical history, physical examination, laboratory tests, and image workup. secondary hypertension might be caused by several conditions affecting the kidneys, heart, arteries, or the endocrine system. proper treatment addresses the underlying condition and tends to normalize blood pressure, reducing the risk of severe heart, kidney and brain complications. the purpose of this article is to report and illustrate an interesting case where radiological investigation discovered a renal tumor as a possible cause of hypertension. a 25-year - old female patient was referred for examination at our institution because of severe hypertension. when she arrived to our office, she was already taking propanolol, hydrochlorotyazide and spironolactone for blood pressure control. physical examination was essentially normal except for persistent high blood pressure (systemic blood pressure = 150x100 mmhg). laboratory screening included serum sodium, calcium, potassium, aldosterone, renin, cortisol, catecholamines, and urinary metanephrines. initial work - up revealed mild hypokalemia (3.4 meq / l) and increased renin levels (7.7 ng / ml / h) with normal aldosterone (22 ng / dl). contrast - enhanced computed tomography of the abdomen demonstrated a 2.8 cm, well circumscribed, solid, hypoenhancing cortical lower pole lesion in the right kidney with 100 hounsfield units (figure 1). the patient was counseled on options regarding radical nephrectomy and nephron - sparing surgery, as well as alternative for open or laparoscopic intervention. she decided for laparoscopic partial nephrectomy and the procedure was accomplished without intra - operative complications. histopathologic examination revealed a rare juxtaglomerular cell tumor known as reninoma (figure 2) after minucious immunohistochemical analysis, which was negative for cytokeratin 35bh11, ema, cd 34, cd 56, s-100, chromogranin a, hmb-45, wt-1, and cd 31 ; and positive for aml (areas), vimentin (focally), actin hhf35 (rare cels), and cd 117 (focally). patient s blood pressure normalized within 2 months of surgery (systemic blood pressure < 120x90 mmhg), allowing withdrawn of all medications. figure 1contrast - enhanced computed tomography reveals a 2.8 cm, well circumscribed, solid, hypoenhancing cortical lower pole mass in the right kidney with 100 hounsfield units (axial and coronal view). figure 2histological examination showing microscopic characteristics of juxtaglomerular tumor cells (eosin and hematoxylin) : tumor cells with mild nuclear atypia, inconspicuous nucleoli and pale ill - defined cytoplasm ; immunohistochemical study negative for chromogranin a, wt-1, and cd 31 ; positive for aml (areas), vimentin (focally), and cd 117 (focally). a 25-year - old female patient was referred for examination at our institution because of severe hypertension. when she arrived to our office, she was already taking propanolol, hydrochlorotyazide and spironolactone for blood pressure control. physical examination was essentially normal except for persistent high blood pressure (systemic blood pressure = 150x100 mmhg). laboratory screening included serum sodium, calcium, potassium, aldosterone, renin, cortisol, catecholamines, and urinary metanephrines. initial work - up revealed mild hypokalemia (3.4 meq / l) and increased renin levels (7.7 ng / ml / h) with normal aldosterone (22 ng / dl). contrast - enhanced computed tomography of the abdomen demonstrated a 2.8 cm, well circumscribed, solid, hypoenhancing cortical lower pole lesion in the right kidney with 100 hounsfield units (figure 1). the patient was counseled on options regarding radical nephrectomy and nephron - sparing surgery, as well as alternative for open or laparoscopic intervention. she decided for laparoscopic partial nephrectomy and the procedure was accomplished without intra - operative complications. histopathologic examination revealed a rare juxtaglomerular cell tumor known as reninoma (figure 2) after minucious immunohistochemical analysis, which was negative for cytokeratin 35bh11, ema, cd 34, cd 56, s-100, chromogranin a, hmb-45, wt-1, and cd 31 ; and positive for aml (areas), vimentin (focally), actin hhf35 (rare cels), and cd 117 (focally). patient s blood pressure normalized within 2 months of surgery (systemic blood pressure < 120x90 mmhg), allowing withdrawn of all medications. figure 1contrast - enhanced computed tomography reveals a 2.8 cm, well circumscribed, solid, hypoenhancing cortical lower pole mass in the right kidney with 100 hounsfield units (axial and coronal view). figure 2histological examination showing microscopic characteristics of juxtaglomerular tumor cells (eosin and hematoxylin) : tumor cells with mild nuclear atypia, inconspicuous nucleoli and pale ill - defined cytoplasm ; immunohistochemical study negative for chromogranin a, wt-1, and cd 31 ; positive for aml (areas), vimentin (focally), and cd 117 (focally). secondary hypertension is a topic of particular interest for urologists worldwide, mainly because it has potential causes that may be recognized and definitively treated by their specialty. patients with severe or refractory hypertension, sudden onset of hypertension, high blood pressure before 20 year - old or after 50 year - old, spontaneous hypokalemia, and unexplained renal dysfunction are situations in which complete workup for secondary hypertension and its related pathologies should be performed. renovascular hypertension, primary hyperadosteronism, and pheocromocytoma are among those causes and should always be ruled out (1 - 4). although rare, chronic pyelonephritis and renal tumors as renin - producing tumors, nephroblastoma, hypernephroma, and renal cell carcinoma might also induce hypertension by different mechanisms and should be a part of the clinician diagnostic list. the purpose of this article was to report and illustrate an interesting case where radiological investigation discovered a renal tumor as a possible cause of hypertension. partial nephrectomy and pathological examination confirmed a juxtaglomerular cell tumor known as reninoma. the rationale is to provide the better care for patients with reversible causes of hypertension, diminishing their need for medications and cardiovascular risks. in our case, the above - mentioned diagnoses must be remembered so that appropriate investigation can be started. renovascular hypertension is a condition in which patients have unilateral or bilateral renal artery stenosis and become normotensive when the vessel constriction is treated by angioplasty or surgery (1). doppler ultrasound is the most cost - effective study to screen renal artery stenosis, but it is dependent on the operator. atherosclerotic disease is more common in older patients and has worse outcomes than fibromuscular dysplasia when treated by angioplasty (5). this case was very illustrative to remind us that approximately 5% of patients with hypertension have reversible secondary causes (6). here, we presented a patient with reninoma, an unusual cause of hypertension that mainly affects young individuals (7 - 9). the patient was successfully treated by minimally invasive laparoscopic nephron - sparing surgery, reducing the risk of loss of renal function and shorting hospital stay. gottardo el al (8) reported the case of a 16-year - old hypertensive boy who presented with severe hypokalemia and markedly increased plasma renin activity. abdominal ultrasonography and contrast - enhanced computed tomography revealed a 2 cm well - circumscribed, solid, hypoenhancing cortical lesion in the lower pole of the left kidney. immunohistochemical (ihc) study comprised vascular markers (cd31 and vimentin), neuroendocrine tumor marker (cromogranin), mesothelioma marker (wt1), and hematopietic markers (cd117 and aml). all were negative or focally positive (vimentin, cd117) and were used to exclude others rare renal tumors. cases like reninoma do not have a specific pattern and ihc findings are inconsistent in the literature. our diagnosis was based on microscopic characteristics such as tumor cells with mild nuclear atypia, inconspicuous nucleoli and pale ill - defined cytoplasm (8, 10). mete (7) reported a similar case in which a 14-year - old boy with hypertension and preoperative diagnosis of reninoma underwent open nephron - sparing surgery for a 2 cm mass in right kidney. the patient became normotensive postoperatively and follow - up intravenous urography showed bilateral normally functioning kidneys. although image exams may find renal masses that could be associated to secondary arterial hypertension, there are other methods to prove such association. wong (9) demonstrated the utility of both appropriate imaging studies and selective venous catheterization following provocative administration of an ace - i for diagnosis of reninoma. we do not perform selective venous sampling routinely since it is a more invasive technique. nevertheless, it may help in cases where all other diagnostic modalities have been performed and doubt regarding the specific cause of secondary hypertension persists. general physicians, urologists and nephrologists are probably the most prone to seeing these patients in an office basis. we hope that our case may help these and other physicians in their future practice. laboratory testing and image workup may identify the cause of secondary hypertension and guide therapeutic options as in our case. untreated secondary hypertension culminates in complications such as heart failure, kidney failure and stroke. the detection of a secondary cause provides an opportunity to convert an incurable disease into a potentially curable one. moreover, even when cure can not be achieved, early recognition and management may prevent target organ damage, reduce socioeconomic burden and improve quality of life (11). | main findings a 25-year - old hypertensive female patient was referred to our institution. initial workup exams demonstrated a 2.8 cm cortical lower pole tumor in the right kidney. she underwent laparoscopic partial nephrectomy without complications. histopathologic examination revealed a rare juxtaglomerular cell tumor known as reninoma. after surgery, she recovered uneventfully and all medications were withdrawn.case hypothesis secondary arterial hypertension is a matter of great interest to urologists and nephrologists. renovascular hypertension, primary hyperadosteronism and pheocromocytoma are potential diagnosis that must not be forgotten and should be excluded. although rare, chronic pyelonephritis and renal tumors as rennin - producing tumors, nephroblastoma, hypernephroma, and renal cell carcinoma might also induce hypertension and should be in the diagnostic list of clinicians.promising future implications approximately 5% of patients with high blood pressure have specific causes and medical investigation may usually identify such patients. furthermore, these patients can be successfully treated and cured, most times by minimally invasive techniques. this interesting case might expand knowledge of physicians and aid better diagnostic care in future medical practice. |
diseases with symptoms of edema that are encountered a medical institutions vary from internal diseases (e.g., kidney, liver, heart, and endocrine diseases) to orthopedic diseases, central nerve disease, and malignant tumors. generally, edema exceeds a physiological compensatory function to an interstitial fluid and is defined as the condition in which superfluous water content is gathered1. its pathogeny includes situations in which the water provision system of the interstitial fluid becomes superfluous ; thus, the edema exceeds the power of the physiological water content redistribution, water content redistribution system of the interstitial fluid does not function sufficiently, and tissue fluids are not sufficiently collected1. an edema is categorized as either pitting edema2 or non - pitting edema. the origins of pitting edema include a reduction of the oncotic pressure by hypoalbuminemia, a rise in the plasma hydrostatic pressure, and hyperpermeability of the capillaries. conversely, the origin of non - pitting edema is reflux difficulty in a lymph and mucopolysaccharide, which causes docking deposition of protein in the stromata3. edema of the extremities is a somatic symptom that is also observed in daily life situations. although pitting edema is generally identified through questions, a physical examination, and palpation, it is difficult to evaluate the condition of an edema quantitatively. although palpation is the most convenient method, palpation is semi - quantitative and lacks reproducibility of a measured value. in addition, circumferential measurement is performed4,5,6,7, and the error of a measurement region is directly reflected in the error of a measured value ; and furthermore unification of a measured region is not prudent. moreover, performing laterality (measuring both sides) and variation (measuring twice) is meaningful because one alone measurement can not quantitatively evaluate an edema. other methods include water bath draining3, 8, 9, echography, computed tomography (ct), magnetic resonance image (mri), and lymph scintigraphy10, among other. recently, the impedance method11 has been performed in the fields of obstetrics and gynecology12. however, this evaluation method is a physical and economic burden to the patient because it requires a high - priced instrument and is not easy to perform. therefore, the development of a novel objective evaluation method that can easily determine the condition of an edema is warranted. for the reasons, conventional assessment methods are not practical and do not allow for quantitative evaluation. therefore, it is considered the status - quo that evaluation of an edema is not performed. in the case of a pitting edema, if acupressure is performed, a surface imprint remains. measuring the depth of the surface imprint is simple and, may be a valuable tool for use in the clinic. thus, the purpose of this study was to develop and verify the reliability of a new practical evaluation method for pitting edema, which uses the depth of the surface imprint as an indicator. the subjects of this study were 26 inpatients (52 legs ; 8 men, 18 women ; average age, 85.0 5.9 years) who were in a convalescent ward (table 1table 1.subjects characteristics (n = 26)age, years85.0 5.9gender, (male / female)8/18height, cm151.2 7.6weight, kg44.6 9.2bmi, kg / m19.4 3.4heart disease, n21central nerve disease, n15pancreopathy, n10orthopedic, n8kidney disease, n6pulmonary disease, n5bmi : body mass index. data for age, height, weight, and bmi are presented as the mean sd.). all subjects were diagnosed with edema by physical examination and palpation, and their general condition was comparatively stable., one leg, foot vulnerabilities, and those who were unavailable during the study period. data for age, height, weight, and bmi are presented as the mean sd. we sufficiently explained the details of the study to the subjects, and all participants signed informed consent. the study was approved by the ethics committee of the university of nishikyushu (approval no., we developed a measurement instrument (depth gauge for edema, km-212 - 003 ; unique medical company, tokyo, japan) to measure the depth of the surface imprint (fig. 2.construction drawing of the depth gauge for edema (left side, part 1 ; right side, parts 2, 3) shows a working drawing of the depth gauge for edema, which has three parts. part 1 is made of a milky polyacetal - quality material, and it makes contact with the region surrounding the surface imprint. the bottom portion is a wide rotund shape. because the area for measuring a surface imprint is a narrow region on a peripheral extremity, the diameter of the surface imprint was postulated to be about 20 mm ; thus, the diameter of the bottom of part 1 is 40 mm. part 2 is made of an acrylic - like material that is transparent, and the tip of this part makes contact with the deepest portion of a surface imprint. since it would not be able to make contact if it was too big and it would be painful to patients if it was too slim, we used a size of 3 mm, which was the optimal size after repeated test fabrications. part 3 is the gauge itself, which is attached to part 2. in order to perform a visual measurement using the depth gauge for edema, we considered 0.5 mm as the measurement error. during the measurement procedure (fig. 3fig. 3.measurement procedure), part 1 is held with the thumb, third finger, and fourth finger. then, using a forefinger, part 2 is then pushed down a little more than the depth of the surface imprint. next, after the tip of part 2 gently makes contact with the deepest region of the surface imprint, part 1 is pushed down until contact is made with the region of the surrounding surface imprint. when pushing down part 1 one precaution during measuring is to perform the process gently so that the surface imprint portion is not pushed too much by the tip of part 2. the two parts were elaborately fabricated so that the device could slide smoothly while measuring and then rest at the time of the visual measurement the pressing force becomes constant. instrument to measure the depth of the surface imprint construction drawing of the depth gauge for edema (left side, part 1 ; right side, parts 2, 3) measurement procedure we instructed the subjects to sit on the edge of a chair and to lightly ground the soles of their feet into the floor. then we measured the right and left sides during a relaxed condition so that muscular contraction was not initiated. we measured during the morning, which was considered the preinitiation of the examination or medical treatment. the measured region referred to in a previous study was the circumferential measuring method5. we pressed down for 10 sec on the back of the feet in the central region, on the line that connects the first os metatarsale caput of the bone and the fifth os metatarsale caput of the bone ; approximately 2 kg of compressive force was used, as measured with a digital force gauge (fg-5005 ; mother tool co., ltd., two examiners at maruyama hospital performed the edema measurements on different dates, and we adopted a test - retest method to evaluate the degree of unanimity. to examine the intra - rater reliability, examiner a performed the measurement a second time on the next day after the patient had rested. to examine inter - rater reliability, examiner b measured the edema in the subjects after the surface imprint was restored. examiner a had 10 years of clinical experience, while examiner b had 3 years of clinical experience. we analyzed the inter- and intra - rater reliabilities of the measured values from the edema depth gauge using intraclass correlation coefficients (icc). in the statistical analysis, we considered the level of significance at 5%, and spss version 21 for windows (spss inc., tokyo, japan) was used for all analyses. with regard to intra - rater reliability, the measured values of the depth of the surface imprint of the right dorsal foot using the edema gauge were 3.01 1.37 for the first time and 3.31 1.44 for the second time ; the icc was 0.91. the measured values of the depth of the surface imprint of the left dorsal foot were 3.23 1.29 for the first time and 3.39 1.35 for the second time ; the icc was 0.97 (table 2table 2.intra-rater reliability of measurementsmeasurementdepth of the surface imprint (mm)iccright foot dorsalfirst time3.01 1.370.91second time3.31 1.44left foot dorsalfirst time3.23 1.290.97second time3.39 1.35data are presented as mean sd. icc : intraclass correlation coefficient with regard to inter - rater reliability, the measured value of the depth of the surface imprint of the right dorsal foot dorsal by examiner b was 3.06 1.37 ; the icc was 0.99. the measured value of the depth of the surface imprint of the left dorsal foot by examiner b was 3.21 1.39, and the icc was 0.97 (table 3table 3.inter-rater reliability of measurementexaminersdepth of the surface imprint (mm)iccright foot dorsala3.01 1.370.99b3.06 1.37left foot dorsala3.23 1.290.97b3.21 1.39the data are presented as mean sd. we developed a practical evaluation method to easily measure the depth of the surface imprint of an edema. as a result of verifying the intra - rater reliability of this assessment technique, the icc was 0.91 for the right dorsal foot and 0.97 for the left dorsal foot, indicating a high consistency. since examiner a performed the second measurement on the day following the first measurement, it was presumed that the measured value would change, but there was high consistency between measurements. this may be because the test subjects used in this study were in comparatively stable conditions. therefore, that suggests measurements using the edema depth gauge are highly reproducible, even if we do not consider that the measurement was taken the next day. moreover, as a result of verifying the inter - rater reliability of the assessment technique, the icc was 0.99 for the right foot dorsum and 0.97 for the left foot dorsum, showing a high consistency. therefore, the inter - rater reliability of the measurements using the depth gauge for edema was also high. thus, even if different examiners perform measurements, a practically identical result can be derived. this means that the assessment technique using the depth gauge for edema is highly reliable. if an edema is defined as the superfluous stagnating condition of interstitial fluid, some questions arise about the quantifiable assessment technique of an edema. additionally, it is 70% of the weight of soft tissue such as skin ; alternatively, it is only about 10% of the weight of skeletal muscles13. therefore, the validity of a quantitative evaluation of systemic interstitial fluid is unknown. however, measuring of the depth of the surface imprint is a vital and valid assessment of the peripheral region. a circumferential measurement is an easy assessment technique to perform. according to a previous study on subjects with an edema, brodovicz. measured ankle joint circumference7, an 8-character circumference using a tape measure, and lower leg volumetry using water displacement ; they verified the inter - rater reliability of these three methods. however, these methods measured the entire body region, including all portio dura tissues (e.g., bone and soft tissues, including muscular and tallow). therefore, there was no parameter that could evaluate an edema using only one measurement. in medical practice, a comparison of both sides using the measurements on different dates can be performed to determine the difference between sides, which can serve as an assessment of an edema. conversely, it seems that the measured value using a depth gauge for edema may evaluate the condition of an edema using only one measurement. we verified the reliability of this new assessment technique (the depth gauge for edema) that measured the depth of the surface imprint of pitting edema. in particular, we did not verify the validity of the amount of changes in the circumference measurement or the measured depth of the surface imprint. therefore, a future study should verify the relationship of the tela subcutanea thickness measured by an echo check, and the measured value of the depth of the surface imprint. in conclusion, the depth gauge we developed is a simple and reliable method for evaluating pitting edema. | [purpose ] to develop and verify the reliability of a new practical evaluation method for pitting edema, which uses the depth of the surface imprint as an indicator. [subjects ] we included 26 inpatients (52 legs). [methods ] the subjects were diagnosed with edema, and we verified the inter- and intra - rater reliabilities of the edema gauge using intraclass correlation coefficients. [results ] for the first and second measurement values and the measured values between the examiners, the intraclass correlation coefficients were high. [conclusion ] therefore, our findings suggest that the edema gauge, which measures the depth of the surface imprint, has sufficient intra- and inter - rater reliabilities. |
western society is currently faced with an increasing incidence of vascular diseases such as hypercholesterolemia and atherosclerosis, mainly as a consequence of unhealthy lifestyle habits, an increase in obesity, and an aging population. vascular diseases and obesity are risk factors for disorders that affect cognitive function such as diabetes mellitus, stroke, vascular dementia, and alzheimer 's disease (ad) [1, 2 ]. sex differences exist in both ad and cardiovascular disease (cvd). while women have a higher risk for ad, men are generally more affected by cvd. for example, men are more prone to develop high serum cholesterol levels at a younger age than (premenopausal) women [4, 5 ]. most of these sex differences disappear, however, when women reach menopause, when they equal and even surpass men in the prevalence of cvd [3, 6 ]. for example, while men have thicker atherosclerotic plaques in the large coronary arteries, women tend to have more diffuse plaques that also impair the smaller microvasculature [4, 5, 7 ]. one factor influencing the prevalence of both vascular and alzheimer 's disease is the apolipoprotein e (apoe) genotype. the apoe genotype is a genetic risk factor for sporadic or late - onset ad. the risk for ad is increased in carriers of the 4 allele [8, 9 ], and the age of onset is decreased [8, 10 ] compared with 2 and 3 allele carriers. furthermore, in the nondemented elderly population and in healthy middle - aged people, the 4 allele is also associated with memory decline [1114 ]. the apoe gene encodes for the apolipoprotein e protein (apoe), which has several roles in the body and in the brain. the apoe4 isoform is a poorer functioning cholesterol transporter, which contributes to hypercholesterolemia [19, 20 ], which in turn causes atherosclerosis. in addition, it has been shown in the brain that less apoe3 than apoe4 is needed for similar sized lipid particles, suggesting an impaired or less effective delivery of cholesterol to neurons. furthermore, apoe is involved in the clearance of amyloid - beta (a) from the brain across the blood brain barrier. increased levels of a in the brain lead to an increased risk of ad, and a accumulation in blood vessel walls obstruction of blood vessels by atherosclerosis or cerebral amyloid angiopathy can affect cognition by causing cerebral hypoperfusion. furthermore, it has been shown that cerebral blood flow (cbf) is reduced in ad patients, and cbf reductions are predictive of conversion to ad in patients with mild cognitive impairment. as with cvd and ad, the apoe genotype has differential effects between the sexes. the increased risk for ad and cognitive deficits in the nondemented population in 4 carriers is higher in women [2628 ]. estrogen is one factor that interacts with apoe, and as such could explain these effects. for example, hormone replacement therapy in menopausal women may not be beneficial for cognition in carriers of an 4 allele [31, 32 ]. additionally, whereas estradiol facilitates neurite outgrowth in the presence of apoe2 and apoe3, it does not do so in the presence of apoe4. in addition, brain apoe levels can be affected by pharmacological estrogen treatment, and this effect is brain region - specific, most likely due to the differential distribution of estrogen receptor subtypes. the aim of the current study was to investigate sex differences in apoe, focusing on parameters that are important for cognitive functioning. therefore, we studied presynaptic density and neurogenesis in male and female apoe4 and apoe knockout mice, which are models of ad and vascular disease. homozygous apoe - deficient (b6.129p2-apoe / j) mice were originally obtained from jackson laboratories (bar harbor, me, usa) and subsequently bred in the central animal laboratory (cdl ; radboud university nijmegen medical centre, runmc). the background strain for these apoe knockout (apoe ko) mice is c57bl6/j. homozygous human apoe4 knockin mice were originally obtained from taconic transgenic models (hudson, ny, usa) and subsequently bred in the central animal laboratory (runmc). in this strain, the murine apoe gene is replaced with the human apoe4 alleles (4/4), after which the strain is backcrossed to c57bl6/j mice. c57bl6/j wild - type (wt) mice were originally obtained from harlan laboratories, inc. (horst, the netherlands) and subsequently bred in the cdl (runmc). in total, 22 male mice and 21 female mice of the 3 different genotypes (wt, apoe4, and apoe ko) aged 915 months (males : 912 months, m : 10.7 ; females : 1215 months, m : 13.2) were used in this study. the mice were housed in standard cages (makrolon type 3, 42.5 26.5 15.5 cm, with maximum 11 animals per cage) at 21c on a 12 h light / dark cycle (lights on at 7 a.m.) and were fed rodent lab chow. there were no differences in brain or body weight between the genotypes in males or females. the experiments were performed according to dutch federal regulations for animal protection and were approved by the veterinary authority of the radboud university nijmegen medical centre (permit numbers 11 - 090 and 2008 - 172). mice were anaesthetised with isoflurane (3 - 3.5% in a mixture of oxygen and n2o (2 : 1)) and transcardially perfused with phosphate buffered saline (0.1 m pbs) and with 4% paraformaldehyde. the brains were removed immediately after perfusion fixation, postfixed overnight in 4% paraformaldehyde at 4c, and transferred the next day to 0.1 m pbs containing 1% sodium azide. the brains were placed in 30% sucrose in 0.1 m phosphate buffer for 24 hours before cutting 40 m coronal sections on a sliding microtome (microm hm 440, walldorf, germany) equipped with an object table for freeze - sectioning at 60c. sections were divided into 6 complete series (1 out of every 6 sections) while cutting. the sections were stored in 0.1 m pbs with 1% sodium azide at 4c until they were used for immunohistochemistry. all staining was carried out according to standard protocols, and all steps were performed at room temperature on a shaker table. the staining was performed in separate sessions ; male apoe4, apoe ko, and wt mice were stained in one group, and female apoe4, apoe ko, and wt mice were stained in another group. before each staining session free - floating brain sections were first rinsed (rinsing of sections was always done with 0.1 m pbs) and endogenous peroxidase was blocked with 0.3% h2o2 in 0.1 m pbs. the sections were rinsed again and preincubated with 0.1 m pbs - bt (0.1 m pbs with 1% bovine serum albumin and 0.3% triton - x-100). the sections were then incubated overnight with a primary antibody (monoclonal rabbit anti - synaptophysin clone ep1098y, 1:20000 in pbs - bt for males, 1:10000 in pbs - bt for females, abcam inc., cambridge, uk ; goat anti - doublecortin (c18) : sc-8066, 1:3000 in pbs - bt, santa cruz biotechnology, inc., after another rinse, the sections were incubated for 90 min with a secondary antibody (donkey anti - rabbit biotinylated igg, 1:1500 in pbs - bt, jackson immunoresearch, west grove, pa, usa ; donkey - anti - goat biotinylated igg, 1:1500 in pbs - bt, jackson immunoresearch, west grove, pa, usa), rinsed again, and incubated with vector abc - elite (a and b, 1:800 in pbs - bt, vector laboratories, burlingame, ca, usa). finally, the sections were rinsed, preincubated with dab - nickel solution, incubated with dab - nickel solution with 0.3% h2o2, and rinsed to stop the reaction. the sections were mounted on gelatin - coated object glasses (0.5% gelatin and 0.05% chrome aluminium sulphate), dried overnight at 37c, dehydrated in an alcohol series, cleared in xylol, and enclosed in entellan. all quantifications were performed independently by two investigators who were blind to the experimental groups. the mean scores of the two investigators were used in all statistical analyses. to determine the number of synaptophysin - immunoreactive presynaptic boutons (sipbs), appropriate sections were digitised and photomicrographed using a zeiss axioskop microscope, equipped with a 100x oil immersion objective and a 10x projection lens. the selection of areas to be quantified was performed with the use of stereo investigator (microbrightfield software, williston, vt, usa). sipbs were analysed in the prelimbic area (prl), the cingulate gyrus (gc) and in the ca1, ca3 and dentate gyrus (dg) of the hippocampus (1.6 mm and 0.9 mm anterior and 2.1 mm posterior to bregma, respectively). within the prl and gc, two square boxes were placed within the borders of the intended brain areas. in the hippocampus, two randomly chosen regions per section were analysed in the stratum radiatum of area ca1 (sr), stratum lucidum of area ca3 (sl), inner molecular layer (iml), and outer molecular layer (oml) of the dg (figure 1)., four pictures were taken from each brain region (two investigators, two pictures each per brain region). all images taken were then processed with imagej (national institutes of health) for automatic quantification of the sipbs. images were first converted to 8-bit gray scale and then to 16-bit ; finally, contrast was enhanced. the threshold was set at 2647133153 for the males and at 2724230840 for the females. particles ranging between 0.1 and 4.5 m (circularity 0.0 - 1.0) were considered to be normal - sized sipbs and included in the analysis. mean scores per brain area were normalised (wt set as 100%), and these normalised scores were used in the analyses. appropriate sections were digitised and quantified using a zeiss axioskop microscope equipped with the microbrightfield software (williston, vt, usa). quantitative analyses were performed with a computer - assisted analysis system (stereo investigator). for every mouse, doublecortin - positive cells (figure 2) were counted in the entire hippocampus in 3 different sections (at 2.1 mm, 2.4 mm, and 2.7 mm posterior to bregma). the contours of the hippocampi were drawn at 5x magnification, and cells were counted at 20x magnification. the mean number of doublecortin - positive newly formed neurons was used in the analysis. data were separately analysed for male and female mice with univariate anovas with genotype as the independent factor, followed by tukey 's post hoc hsd. in female mice, an effect of genotype was found on the number of synaptophysin - immunoreactive presynaptic boutons (sipbs) in the inner molecular layer (iml) of the dentate gyrus in the hippocampus (f = 6.884, p < 0.01). post hoc analysis revealed a significant decrease in the number of sipbs in female apoe4 mice compared with female wild - type (wt) mice (wt : m = 100, sem = 4.67 ; apoe4 : m = 79.28, sem = 2.91 ; p < 0.01, figure 3). there were no significant differences in the number of sipbs in the cortex (prelimbic area and cingulate gyrus) or in other regions of the hippocampus (outer molecular layer, stratum radiatum, and stratum lucidum). in male mice, there were no significant differences between the genotypes in the number of sipbs in any of the investigated brain regions. a trend was observed in the number of doublecortin - positive newly formed neurons between genotypes in female mice (f = 3.531, p = 0.052, figure 4). there was a strong indication that neurogenesis is increased in female apoe ko mice compared with female wt mice. in this study, we investigated sex differences in apoe, focusing on presynaptic density and neurogenesis, parameters related to cognitive functioning. we studied these parameters in different apoe models of alzheimer 's disease (ad) and vascular disease in both male and female mice. we found a decreased presynaptic density in middle - aged female apoe4 mice and a trend towards increased neurogenesis in middle - aged female apoe knockout (apoe ko) mice compared with wild - type (wt) mice. in male mice,, we found a decrease in the number of synaptophysin - immunoreactive presynaptic boutons (sipbs) in the inner molecular layer (iml) of the dentate gyrus compared with controls. to our knowledge, no other studies have investigated presynaptic density in aging female apoe4 or apoe ko mice. studies in male mice either showed no difference between apoe4, apoe ko, and wt mice or demonstrated a decrease in presynaptic density in aged apoe ko mice [36, 37 ]. the decrease in sipbs in our female apoe4 mice is in line with autopsy studies in which a decrease in synaptic proteins or synaptic density was found in male and female patients with mild cognitive impairment (mci) or ad compared with controls [3840 ]. however, scheff. [38, 39 ] did not find a relationship of this decresase with the apoe genotype (2, 3, 4). the fact that we only found an effect in the molecular layer of the dentate gyrus and not in other regions of the hippocampus or in the cortex could indicate that mice at this age are at an early stage of the disease. the molecular layer of the dentate gyrus of the hippocampus receives a direct input from the entorhinal cortex via the perforant pathway [41, 42 ]. degeneration of these areas is an early event in both ad and cardiovascular disease [39, 43, 44 ]. others have found that the connections between the entorhinal cortex and the molecular layer of the dentate gyrus are selectively vulnerable to synaptic loss in aging humans [39, 46 ] as well as in several animal models of aging [47, 48 ]. neurodegeneration spreads from the entorhinal cortex to the molecular layer of the dentate gyrus and from there to the ca1 and ca3 regions of the hippocampus. finally, the cerebral cortex, like the prefrontal cortex, is affected when the spreading of neurodegeneration continues. as we only found an effect in the molecular layer of the dentate gyrus and not in the ca1 and ca3 regions or in other cortex regions in our current study, we assume that these middle - aged mice are at an early stage of the disease. in our female mice, we found the trend of an increased number of doublecortin - positive newly formed neurons, indicating that neurogenesis is enhanced in female apoe ko mice compared with controls. this result contrasts with that of li., who found a decrease in neurogenesis in female apoe ko mice. however, their mice were aged 6 - 7 months, which is much younger than our 12 to 15-month - old mice. it is possible that at an older age a compensatory mechanism, with an increased number of synapses and/or neurogenesis, is established in response to synaptic failure or insults to the brain [51, 52 ]. in contrast to the female mice, we did not find any differences in presynaptic density or in neurogenesis between male apoe4, apoe ko, and wt mice. the absence of an effect of genotype on the number of sipbs in male mice is in line with levi., who did not observe differences in presynaptic density in the hippocampus of male apoe3, apoe4, apoe ko, or wt mice. furthermore, liraz. were not able to detect differences between male apoe3 and apoe4 in hippocampal synaptophysin levels, as determined by western blot. however, veinbergs. did find a decrease in presynaptic density in the hippocampus and frontoparietal cortex of aged male apoe ko mice. in human autopsy studies, male and female patients with ad or mci it should be noted however, that the pattern of relative differences between the genotypes for the number of sipbs is similar for males and females in this study, when looking at the inner and outer molecular layer of the dentate gyrus. nevertheless, only the decrease in the number of sipbs in the iml in female apoe4 mice compared with wt controls reaches statistical significance. both in ad patients and in ad and apoe mouse models, conflicting results have been found regarding neurogenesis in male sex. most studies on ad showed a decrease in neurogenesis in both humans and in app and ps1 mouse models [55, 56 ]. conflicting studies found an increase in neurogenesis in male ad patients and in pdgf - appsw, ind ad transgenic mice. however, the first study suffers from methodological issues concerning differences between the ad and control group in age, sex, and postmortem interval. in studies of the apoe mouse model this study by levi and michaelson reported that neurogenesis, as measured immunohistochemically by doublecortin staining, is increased in 6-month - old male apoe ko mice and even more in apoe4 mice. in contrast, we did not find any differences in neurogenesis in our male mice. this discrepancy could possibly result from the age difference (6 versus 11 months) between the mice in these studies. it should be noted, however, that visual inspection of the neurogenesis data gives a similar impression for both male and female mice. we can not exclude the possibility that we would have seen the same trend in male mice with a larger group of animals. it is possible that estrogen plays a role, as it has many effects on the vasculature and on the brain. while estrogen 's effects on the vasculature are mainly positive [7, 5860 ], its interaction with apoe4 in the brain can have detrimental effects. in vitro regulation of apoe by estrogen is allele - dependent, and estradiol does not facilitate neurite outgrowth in the presence of apoe4, while it does so in the presence of apoe2 and apoe3. hormone replacement therapy is not beneficial to cognitive function in women who carry at least one 4 allele [31, 32 ] ; however, it can lower the incidence of ad and reduce cognitive decline in women not carrying the 4 allele [62, 63 ]. in addition, female carriers of an 4 allele, with an increased reproductive period and therefore a longer lifetime exposure to estrogen, have an increased risk for dementia and ad. the harmful effect of estrogen in those carrying the apoe4 genotype could also explain the stronger association of apoe4 with ad in women [2628 ] and the increased susceptibility of female apoe4 mice to spatial memory deficits [29, 30 ]. androgen - treated female apoe4 mice improved their performance in a spatial memory test. however, male apoe4 mice, which initially did not show any deficits, were impaired in spatial memory after blockade of androgen receptors. the current result, where only female apoe4 mice show a decreased number of sipbs, is also consistent with this view of a specific female susceptibility to the negative effect of apoe4. in our apoe mouse models, several mechanisms are involved in producing both the decrease in presynaptic boutons in female apoe4 mice and the increase in neurogenesis in female apoe ko mice. the severely compromised vasculature in apoe ko mice (severe atherosclerosis, impaired vascular endothelium - dependent relaxation, and aortic stiffening [6668 ]) results in a compensatory effect by increased neurogenesis. the specific interaction of apoe4 with estrogen, even though their vasculature is less affected than that of apoe ko mice (hypercholesterolemia and accelerated atherosclerosis), results in a deleterious effect in the form of a loss of synapses. in addition, male apoe4 mice could possibly benefit from protection by androgens from the effects of apoe4. the fact that a compensatory mechanism can be observed in female apoe ko mice, in contrast to male apoe ko mice, could be due to their difference in estrogen exposure. however, we should interpret the trend of increased neurogenesis in female mice with caution. although there is no indication of a trend in the male data, visual inspection of the graphs of the neurogenesis data gives a similar impression for both male and female mice. we found a difference in females compared with males in the number of presynaptic boutons and amount of neurogenesis. although the slightly higher age of the female group should be kept in mind, we do not expect a large influence due to an age difference of only two months. because our female mice can be considered premenopausal, large hormonal fluctuations are absent. therefore, both our male and female mice belong to the same stable age range. the c57bl6/j wild - type mice we use in the current study were obtained from harlan laboratories, inc. it is known that these mice carry a gene mutation resulting in an alpha - synuclein gene deletion. because we obtained the apoe4 and apoe ko mice from different vendors, this could have influenced our results. the alpha - synuclein deletion has some effects on synapse function related to neurotransmitter mobilisation [7072 ]. however, basal synaptic transmission is unimpaired, and there are no indications of an altered number of (pre)synapses or neurogenesis in c57bl6/alpha - synuclein deletion mice from harlan. thus, although we should keep this limitation in mind when interpreting our results, the use of these wt mice is not expected to significantly alter the outcomes of the experiments. in the present study, we used the presynaptic marker synaptophysin to obtain information on presynaptic density in apoe4 and apoe ko mice. future studies using postsynaptic markers, such as psd 95, or electron microscopic evaluation of the number of synapses are needed to acquire a more complete picture of synaptic density in these mouse models. to our knowledge, this is the first investigation of presynaptic density in aging female apoe4 and apoe ko mice. we found a decrease in presynaptic density in the hippocampus of middle - aged female apoe4 mice compared with wt mice. this may be the result of a specific harmful interaction of estrogen with apoe4, as we did not observe any differences in male mice. in addition, we found neurogenesis to be increased in middle - aged female apoe ko mice. previous studies have suggested a compensatory mechanism for synaptic failure by temporarily increasing the number of synaptic contacts and/or neurogenesis. the trend of increased neurogenesis found in female apoe ko mice in our study supports this hypothesis. our results support the previously determined sex - specific differences observed between apoe genotypes, which could account for some of the sex differences in ad and cvd. sex differences should be taken into account in any research concerning cvd, ad, or apoe. | atherosclerosis and apolipoprotein e 4 (apoe4) genotype are risk factors for alzheimer 's disease (ad) and cardiovascular disease (cvd). sex differences exist in prevalence and manifestation of both diseases. we investigated sex differences respective to aging, focusing on cognitive parameters in apoe4 and apoe knockout (ko) mouse models of ad and cvd. presynaptic density and neurogenesis were investigated immunohistochemically in male and female apoe4, apoe ko, and wild - type mice. middle - aged female apoe4 mice showed decreased presynaptic density in the inner molecular layer of the dentate gyrus of the hippocampus. middle - aged female apoe ko mice showed a trend towards increased neurogenesis in the hippocampus compared with wild - type mice. no differences in these parameters could be observed in middle - aged male mice. specific harmful interactions between apoe4 and estrogen could be responsible for decreased presynaptic density in female apoe4 mice. the trend of increased neurogenesis found in female apoe ko mice supports previous studies suggesting that temporarily increased amount of synaptic contacts and/or neurogenesis is a compensatory mechanism for synaptic failure. to our knowledge, no other studies investigating presynaptic density in aging female apoe4 or apoe ko mice are available. sex - specific differences between apoe genotypes could account for some sex differences in ad and cvd. |
because of their unique electronic properties, cyclic molecular structures ranging from benzene to natural light - harvesting complexes have received much attention. rigid -conjugated templated porphyrin nanorings serve as excellent model systems here because they possess well - defined structures that can readily be controlled and because they support highly delocalized excitations. in this study, we have deliberately modified a series of six - porphyrin nanorings to examine the impact of lowering the rotational symmetry on their photophysical properties. we reveal that as symmetry distortions increase in severity along the series of structures, spectral changes and an enhancement of radiative emission strength occur, which derive from a transfer of oscillator strength into the lowest (k = 0) state. we find that concomitantly, the degeneracy of the dipole - allowed first excited (k = 1) state is lifted, leading to an ultrafast polarization switching effect in the emission from strongly symmetry - broken nanorings. |
|
environmental variations affect the nutritional composition of food resources. a common example is animals encountering different quality of food depending on a dry or rainy season. this phenomenon is less evident in human agricultural populations, in which efforts are devoted to maintain consistent food resources, both in their physical and nutritional aspects. concomitantly, while humans in the industrialized world compensate for environment - induced variations in their own diet by using nutritional supplements, natural animal populations likely rely on genetic programs, such as their physiology and behavior, to compensate for such changes. the negative impact of natural dietary ingredients on health and fertility has traditionally been the domain of toxicologists or ecologists (for an in depth review on reproductive toxicological effects see ref. 1). for example, studies on the chemical defense of plants or animal preys have given deep insights into how organisms cope with diverse diets that potentially include harmful foods. however, only in recent years, developmental and cell biologists started to explore the impact of environmental compounds on the reproductive capacity of animals. although it has been noted that the environment and diet can have a negative impact on the plasticity of developmental programs, the impact on germ cell developmental programs has remained relatively unclear. studies that investigate dietary impact on reproductive cells are greatly aided by the proven advantages offered by genetically tractable model organisms. in particular, the transparent roundworm caenorhabditis elegans emerged as a powerful system to tackle such questions because : 1) food parameters are easily controlled in dietary experiments ; 2) its gonads and germ cells are readily accessible ; and 3) self - fertile hermaphrodites produce large progeny sizes to satisfy statistical needs. using c. elegans, we recently reported a genetic program that compensates for dietary variations and preserves the animal s reproductive capacity. our genetic work unveiled a novel diet - dependent sterility phenotype that affects only the reproductive cells and manifests in germline stem cell deterioration and in differentiation defects of female germ cells. due to an accumulation of strong genomic and cellular defects, this diet - induced sterility is irreversible and, intriguingly, only apparent upon concomitant loss of the genetic activity that encodes the nuclear hormone receptor protein nhr-114. this presumed transcription factor is present in other nematodes, and is highly related to the mammalian hepatocyte nuclear factor 4 (hnf4), which is an evolutionary conserved nuclear receptor involved in animal metabolism and gastrointestinal homeostasis. nutrition and metabolism are long - standing intertwined science disciplines that have been largely ignored by developmental biologists. however, genetic evidence of dietary influence on animal ontogeny is accumulating and challenges the classical separatist view on physiology and developmental programs. importantly, this dietary influence does not refer to caloric or nutrient related aspects, but rather refers to variable metabolites primarily produced in the gut. in addition to the intestinal cells, microbes of the intestinal tract are recognized as contributors to dietary metabolism, likely imposing changes in the physiology of a host organism. moreover, intestinal microbes may produce diverse metabolites that possess the potential to positively or negatively influence their host. hence, the emerging theme is that diet, in combination with gut microbes, influences a vast number of metazoan processes, suggesting that animals must possess mechanisms that integrate dietary and microbial information into their physiology and developmental pathways. for example, toll - like receptor signaling in the mammalian intestinal epithelium suggests that genetic pathways detect and respond to intestinal microbial components to promote intestinal function and integrity. however, it is still unknown to what extent and how dietary variations and intestinal microbes influence animal reproduction. moreover, given the important roles of intestinal microbes and their metabolites for human health, novel developmental diet - germ cell axis of communication may exist in animals to cope with dietary variation. virtually all laboratories across the world use as the standard diet of caenorhabditis elegans a specific e. coli bacterial strain that was introduced to the worm community by sydney brenner. surprisingly, in the absence of nhr-114 gene activity, we found that this e. coli b strain induces sterility ; nhr-114-deficient animals are fertile on other diets. remarkably, the sterility - inducing bacterial diet is converted into harmless food when grown on media supplemented with exogenous tryptophan, underscoring that the metabolic status of the bacteria drastically changes the reproductive capacity of an animal. moreover, therefore, our work suggests that somatic nuclear receptor nhr-114 activity has evolved to protect the germ cells from the negative effects of dietary variations and inconsistencies. in natural environments, feeding and reproduction of c. elegans is associated with colonization of rotten food, which inherently contains a diverse and variable microbial composition. hence, our findings imply that loss of nhr-114 gene activity may result in restricting natural populations of c. elegans in its dietary options and may confine the reproduction of these populations to specific dietary environments. therefore, in a natural environment the absence of nhr-114/hnf4 activity would be disastrous for the continuity of natural populations of c. elegans. only germ cells specialize in passing on genetic information to the next generation ; all other cells in multicellular organisms are somatic and support animal reproduction as a whole. germ cells of most animals, including invertebrates and humans, develop initially during embryonic and juvenile stages, forming a germline tissue that reaches homeostasis in the adult. germ cell developmental programs are in synchrony with gonadal development (a somatic tissue) and share following unique features : 1) an expansion of germ cell precursors into a proliferative pool of germline stem cells ; 2) a cell cycle transition from mitosis to meiosis in the maturing germ cells ; and 3) sex - specific differentiation into haploid gametes, i.e., sperm or oocytes. in the adult reproductive organs, the somatic support cells maintain the germline tissue and influence germ cell development through 2 types of systemic responses : fixed and transient. such an example of a fixed response is the neuroendocrine control of oocyte maturation in mammals, which occurs under defined developmental circumstances and in a periodic fashion in the adult. in contrast, transient responses are highly variable because they rapidly integrate changing environmental cues from external sources and the organism s physiology. such an example of a transient response is the proliferative control of germline stem cells. reports have shown that the feeding status of an animal affects germline tissue homeostasis and is a major trigger of transient responses in the reproductive organ. work spearheaded in genetic model organisms revealed a molecular basis of dietary influences on germline stem cells. in response to food abundance, studies on invertebrate model systems identified genetic pathways that involve insulin signaling, tumor growth factor- (tgf-) signaling, and nuclear hormone receptors to control germ cell proliferation dynamics. for example, in drosophila melanogaster germline stem cell proliferation activity is low in fasting conditions, but higher in feasting conditions. similarly, in caenorhabditis elegans, stem cell proliferation activity is controlled by nutrition as a consequence of neuronal insulin and germ cell intrinsic tgf- activity. these observations in flies and nematodes resonate well with longitudinal studies on adult humans, which have suggested that nutrient - rich and well - balanced diets can help to boost female fertility. this implies that by the time germ cells are used in reproduction, the entire body has already been exposed to various environmental and dietary influences. while the accumulation of somatic defects may decrease an individual s health, germ cell defects have the potential to completely hamper an individual s reproductive fitness. this is particularly problematic when the undifferentiated germ cell precursors the germline stem cells therefore, it is reasonable to assume that genetic mechanisms may have evolved to shield germ cells from potentially irreversible damage caused by dietary influence. nhrs combine a dna - binding domain (dbd) with a ligand - binding domain (lbd) that is capable of binding small lipophilic signaling molecules. typically, upon ligand binding, a conformational change that renders the receptor transcriptionally active is induced that is instrumental for mounting specific transcriptional responses. indeed, some intestinal nuclear receptors and hnf4 orthologs coordinate dietary homeostasis by coordinating nutrient uptake, eliminating toxic components and protecting against bacterial invasion, or modulating dietary responses. however, we found that the somatic activity of nhr-114 in the intestine is primarily responsible for protecting the integrity of the germline stem cells in the gonad. moreover, global gene expression analysis established a correlation between nhr-114 absence, and a genetic downregulation of a detoxification response, suggesting that nhr-114/hnf4 may govern a transcriptional compensatory program that protects immature germ cells from dietary toxins or toxic metabolites. since mammalian hnf4-alfa mediates similar detoxification responses in the gastrointestinal system, this activity may represent an evolutionary conserved intestinal function that also protects the physiology of specific tissues, such as the reproductive system (for a graphical summary see fig. 1). different environmental conditions (arrows) affect dietary composition, which is further metabolized by gut microbes. the activity of gastrointestinal nuclear receptors may detect toxins or toxic metabolites and elicit a genetic program that specifically shields germ cells from negative impact. this protection results in the capacity to efficiently reproduce and increase population size in diverse environments and may, therefore, underlie the colonization of new territories. therefore, the capacity of a natural population to feed on diverse diets may provide an ecological advantage over those populations that feed on more restrictive diets. for example, genetic programs that support the metabolism of diverse foods encountered in new environments may facilitate colonization of new territories. a diversified diet and proper germ cell function are 2 main factors that contribute to the reproductive success of an animal and both ensure the survival of the next generation. since fertility and reproduction rates are tightly linked to the availability of food resources, genetically programmed systemic responses must have evolved to coordinate germ cell homeostasis with food abundance. however, a better molecular understanding of how diet is linked to reproductive stem cells will still be required to understand the underlying physiological soma - to - germ cell interactions that support fertility. this topic is of increasing importance given that human dietary habits are rapidly changing on a global scale with a continuous population growth. overall, our findings provide a paradigm for understanding dietary impact on germ cell development. firstly, our work shows that germline stem cells are exceptionally vulnerable to dietary metabolites. secondly, that the dietary impact is at the level of cellular and genomic integrity and the process of cell division, which contrasts to the previously reported nutritional effect on dynamics of germ cell proliferation. thirdly, our finding that the metabolic status of the dietary bacteria specifically impacts the animal reproductive tissue adds a new angle to microbe - host interactions. this raises the question of whether the human gut microbiota may also impact fertility and similar genetic programs are in place to protect mammalian germline stem cells. | animals thrive in environments where food resources are abundant. while this correlation between population growth and food abundance is well established, much less is known about the influence of diet quality on physiological and developmental programs that support animal reproduction. here we discuss dietary impact on fertility, and highlight a recent report on the activity of a nuclear receptor that protects against dietary metabolites to maintain germline stem cell integrity and reproduction. |
the treatment of orbital floor fractures with silastic sheet was prominent, until the advent of the titanium plate. it was an adequate treatment ; however, it had a tendency to migrate through the skin. diplopia when present for months tends to be difficult to resolve surgically, and what makes this case unique is that diplopia has resolved after > 30 years. a 54-year - old male presented to our department with a right - sided chemosis, periorbital swelling and was systemically unwell. clinically, his visual acuity was 6/12 in his right eye and 6/6 in his left eye. he reported that he had surgery on a fractured right orbit 33 years ago and had had persistent diplopia since. he reported that his diplopia had worsened, but clinically his eye and swelling was much improved. a ct scan (fig. inferior and medial recti are both trapped by the implant. figure 1:coronal slice of ct scan demonstrating silastic sheet protruding through the right orbital floor. a decision was made to remove the implant surgically via a caldwell luc approach. the patient reported that his diplopia had resolved, for the first time, in 33 years. the treatment of orbital floor fractures with silastic sheet is well documented and there are large case series published. however, there is a high complication rate when using silastic as a material to repair orbital floor fractures. complications include : implant migration to the skin and the maxillary sinus, skin fistula, persistent diplopia, communication between the orbit and the sinus, periorbital cellulitis. the treatment of the fractured orbital floor has advanced over the last 30 years. computerized tomography, custom made implants, resorbable and non - resorbable implants, the use of endoscopic surgery and stereolithography all have an important role in the treatment of the fractured orbital floor. silastic complications may develop late and the latest published resolution of diplopia following surgery is 20 years. we feel that our patient is fairly remarkable, in that his diplopia has resolved at 33 years after initial surgery. | a 54-year - old male sustained a fractured right orbital floor 33 years ago, which was treated with a silastic implant. his diplopia never resolved, and he presented to us with an acute orbital cellulitis. computerized tomography showed a displaced inferior rectus and entrapment of both inferior and medial recti. the implant was removed surgically via a caldwell luc approach and his diplopia completely resolved after 33 years. |
the liver is the largest internal organ in the body and performs many important functions, so it is not surprising that diseases of the liver are a major cause of morbidity and mortality throughout the world. among the most common liver disorders hcv infection is considered a major worldwide public health problem with a global prevalence of 3% (lower in europe ~1.03% and americas ~1.7% and highest in africa ~5.3%). in egypt, about 10- 13% of the population is infected with hcv, meanwhile, hcv antibody prevalence among blood donors ranged from 6% to 38% with a mean of 15%. hcv, the most common cause of viral hepatitis, may present with skin manifestations in the early stages of the disease. skin manifestations could be the first signal of hcv, even in the absence of hepatic symptoms. the skin manifestations of hcv include lichen planus (lp), necrolytic acral erythema (nae), porphyria cutanea tarda, mixed cryoglobulinemia, polyarteritis nodosa, psoriasis, erythema multiforme, pyoderma gangrenosum, and dermatomyositis. cell death can be separated into two distinct forms : necrotic death and programmed death or apoptosis. necrosis results from massive cell injury and is often accompanied by inflammation. on the other hand, apoptosis is a programmed death, occurring in response to either external or internal stimuli. increasing evidence suggests that most mammalian cells exist in a state of unstable equilibrium, poised either to proliferate or die depending on the balance between influencing factors. thus, most if not all of the cell death machinery may be present at all times. whether it actually gets used depends on the physiological status of one or more check points that regulate the decision whether to divide, differentiate, and initiate dna repair, or eliminate the cells by apoptosis. apoptosis is an essential strategy of dynamic balance in the living system to maintain homeostasis. it is generally believed that the ratio of proapoptotic to antiapoptotic bcl-2 family proteins is the critical determinant of cell fate. the bcl-2 family of proteins contains both proapoptotic (bax) and antiapoptotic (bcl-2, bcl - xl) proteins, which have special significance since they can determine if the cell commits to apoptosis or aborts the process. the tumor suppressor protein p53 is a nuclear phosphoprotein that, in its natural form (wild - type), can bind to dna and prevent cells from entering the s (synthesis) phase of the cell cycle until repair of dna damage, or alternatively eliminate the cells by sending them down an irreversible apoptotic pathway. this tumor suppressor protein p53 has a critical role in regulation of the bcl-2 family of proteins. under normal conditions however, significantly higher p53 expression has been reported in sun - exposed and photo - aged skin as a result of sun - induced dna damage. death receptor is a transmembrane receptor that is a member of tnf / nerve growth factor (ngf) receptor superfamily. caspase-3 is considered to be the most important of the executioner caspases and is activated by any of the initiator caspases (caspase-8, caspase-9, or caspase-10). to the best of our knowledge, no previous research has investigated the effect of advanced liver disease due to hcv infection, with its biochemical, metabolic, and hormonal alterations on the skin, regarding changes in apoptosis and its regulatory proteins. the present work aims to investigate the effect of advanced hcv liver disease on epidermal thickness, changes in the expression of various proapoptotic (bax, fas, p53, caspase-3), and antiapoptotic (bcl-2, bcl - xl) regulatory markers as well as the tunel technique for identification of apoptotic cells in skin samples of liver patients in comparison with normal healthy control subjects. the present study was conducted on 20 patients (13 males and 7 females), with advanced liver disease (hcv) attending the out - patient clinic of dermatology, std 's, and andrology department and both the out - patient clinic and the in - patient section of internal medicine department, al - minya university hospital. age of patients ranged from 22 to 70 years with a mean and sd of 47.711.63. after informed consent, 4-mm punch biopsies were obtained from apparently normal skin of the thigh of 20 hcv patients with advanced liver disease. the study was approved by the committee for postgraduate studies and research of al - minya university. control samples were obtained from the thighs of five healthy subjects (three males and two females), performing dermatosurgical procedures for another condition, and serving as a normal control group after taking an informed consent. the age of the control subjects ranged from 30 to 55 years, with a mean age of 40.49.4. biopsies were fixed in buffered 10% formalin, embedded in paraffin, sectioned into 5-m thick sections, and stained with hematoxylin and eosin (h&e) for histometric analysis. paraffin sections were also utilized for immunohistochemical examination of apoptosis regulatory markers (bax, fas, p53, caspase-3, bcl-2, bcl - xl) as well as the tunel technique for identification of apoptotic cells. a computer - assisted program (analysis five by olympus soft imaging solutions gmbh, johann krane - weg 39, d-48149 mnster, germany) was employed to measure epidermal thickness in h&e stained sections of biopsy specimens. the mean distance between the outermost surfaces of the epidermis, excluding stratum corneum, and the dermo - epidermal junction through the entire length of three - examined sections was determined at multiple points. for evaluation of bax and fas expression in the keratinocytes, : e3381, ready - to - use rabbit antibody, spring bioscience, fermont, ca 94538, usa), (fas : code no. : m3554, mouse monoclonal antihuman antibody, dako, carpinteria, 00ca, usa : at a dilution of 1:30 with the hrp method) ]. the ready - to - use lsab2 peroxidase, dab detection system (code no. : k0673, dako, carpinteria, ca, usa) was used to demonstrate antibodies expression according to the manufacturer 's instructions. for evaluation of p53, caspase-3, bcl-2, and bcl - xl expression in the keratinocytes, : rmpd 016, ready - to - use rabbit monoclonal antibody, dbs, ca, usa), (caspase-3 : code no. : ms1770r7, ready - to - use antibody, thermoscientific, ca, usa), (bcl-2 : code no. : pdm 016, ready - to - use monoclonal mouse antibody, dbs, ca, usa), (bcl - xl : code no. : # ms-1334-po, mouse monoclonal antihuman antibody, thermoscientific, ca, usa : at a dilution of 1:200 with the hrp method) ]. the ready - to - use detection system, universal hrp immunostaining kit (code no. : kp - dbs, ca, usa) was used to demonstrate antibodies expression according to the manufacturer 's instructions. the level of apoptosis regulatory markers expression in keratinocytes was evaluated, by two blinded histopathologists, in accordance with the scoring system devised by liang. this system results in a score ranging from 0 to 3 for both the degree of positivity (percentage of positively stained epidermal cells : 0 : 50%) and the degree of intensity of staining (from faint - brown [score 1 ] to deep - brown [score 3 ]). the sum of the two scores was taken as the level of expression. detection of apoptotic cells by the tunel technique was performed using a universal apoptosis detection kit which contains equilibrium buffer, biotin-11-dutp, tdt enzyme, streptavidin - hrp, and dab (code : kga7031, keygen biotech 3f, 15 block no.439 changhong road, nanjing, china) to detect apoptotic keratinocytes. apoptotic index was then calculated : data were coded, entered, and analyzed using an spss software package for statistical science (spss for windows, version 16.0.1, spss inc. statistical analysis included descriptive analysis as mean value and standard deviation (sd), independent - samples t - test and correlation coefficient (r) for the results. significance was expressed in terms of p - value and the level of significance was 0.05. a computer - assisted program (analysis five by olympus soft imaging solutions gmbh, johann krane - weg 39, d-48149 mnster, germany) was employed to measure epidermal thickness in h&e stained sections of biopsy specimens. the mean distance between the outermost surfaces of the epidermis, excluding stratum corneum, and the dermo - epidermal junction through the entire length of three - examined sections was determined at multiple points. for evaluation of bax and fas expression in the keratinocytes, sections were stained by the primary antibodies [(bax : code no. : e3381, ready - to - use rabbit antibody, spring bioscience, fermont, ca 94538, usa), (fas : code no. : m3554, mouse monoclonal antihuman antibody, dako, carpinteria, 00ca, usa : at a dilution of 1:30 with the hrp method) ]. the ready - to - use lsab2 peroxidase, dab detection system (code no. : k0673, dako, carpinteria, ca, usa) was used to demonstrate antibodies expression according to the manufacturer 's instructions. for evaluation of p53, caspase-3, bcl-2, and bcl - xl expression in the keratinocytes, : rmpd 016, ready - to - use rabbit monoclonal antibody, dbs, ca, usa), (caspase-3 : code no. : ms1770r7, ready - to - use antibody, thermoscientific, ca, usa), (bcl-2 : code no. : pdm 016, ready - to - use monoclonal mouse antibody, dbs, ca, usa), (bcl - xl : code no. : # ms-1334-po, mouse monoclonal antihuman antibody, thermoscientific, ca, usa : at a dilution of 1:200 with the hrp method) ]. the ready - to - use detection system, universal hrp immunostaining kit (code no. : kp - dbs, ca, usa) was used to demonstrate antibodies expression according to the manufacturer 's instructions. the level of apoptosis regulatory markers expression in keratinocytes was evaluated, by two blinded histopathologists, in accordance with the scoring system devised by liang. this system results in a score ranging from 0 to 3 for both the degree of positivity (percentage of positively stained epidermal cells : 0 : 50%) and the degree of intensity of staining (from faint - brown [score 1 ] to deep - brown [score 3 ]). detection of apoptotic cells by the tunel technique was performed using a universal apoptosis detection kit which contains equilibrium buffer, biotin-11-dutp, tdt enzyme, streptavidin - hrp, and dab (code : kga7031, keygen biotech 3f, 15 block no.439 changhong road, nanjing, china) to detect apoptotic keratinocytes. data were coded, entered, and analyzed using an spss software package for statistical science (spss for windows, version 16.0.1, spss inc. statistical analysis included descriptive analysis as mean value and standard deviation (sd), independent - samples t - test and correlation coefficient (r) for the results. significance was expressed in terms of p - value and the level of significance was 0.05. the epidermal thickness of liver disease patients ranged from 39.6 to 55.4 m with a mean of 46.2 m4.4. on the other hand, the epidermal thickness of the control group ranged from 57.4 to 75 m with a mean of 647 m. the epidermis of liver disease patients showed significantly lower thickness than the control group (p = 0.000) [table 1, figure 1 ]. mean value of epidermal thickness, score of pro - apoptotic (bax, fas, p53 and caspase-3) and anti - apoptotic markers (bcl-2 and bcl - xl) and apoptotic index in hcv liver patients and controls the epidermis of advanced hcv liver disease patients (a) is lower in thickness when compared to controls (b) (h and e, 100) cytoplasmic staining was observed in all bax positive specimens of both patients and controls. in liver disease patients, the stain was observed in both basal and squamous cell layers with a score ranging from 1.6 to 3.8 with a mean of 30.6. in controls, staining was mainly confined to the basal cell layer with a range from 0.2 to 2.5 with a mean of 2.30.1. the former was significantly higher than the control group (p=0.03) [table 1, figures 2 and 3 ]. expression of pro - apoptotic (bax, fas, p53, caspase-3) and anti - apoptotic (bcl-2, bcl - xl) markers, and apoptotic index in hcv liver patients and controls expression of pro - apoptotic markers (bax, fas, p53, caspase-3) in epidermal keratinocytes of advanced hcv liver disease patients (a, c, e, g) and in controls (b, d, f, h) respectively showing the following : significant increase of cytoplasmic expression of bax staining in basal and squamous cell layers in patients (a) when compared to that confined to the basal cell layer of controls (b) (immunohistochemical, 400).significant increase of membranous expression of fas staining in basal and lower 2/3 of squamous cell layers in patients (c) when compared to that confined to the basal cell layer of controls (d) (immunohistochemical, 400).significant increase of nuclear expression of p53 staining in basal and lower 2/3 of squamous cell layers in patients (e) when compared to that confined to the basal cell layer of controls (f) (immunohistochemical, 200).significant increase of cytoplasmic expression of caspase 3 staining in basal and squamous cell layers in patients (g) when compared to minimal staining confined to the basal cell layer of controls (h) (immunohistochemical, 400) significant increase of cytoplasmic expression of bax staining in basal and squamous cell layers in patients (a) when compared to that confined to the basal cell layer of controls (b) (immunohistochemical, 400). significant increase of membranous expression of fas staining in basal and lower 2/3 of squamous cell layers in patients (c) when compared to that confined to the basal cell layer of controls (d) (immunohistochemical, 400). significant increase of nuclear expression of p53 staining in basal and lower 2/3 of squamous cell layers in patients (e) when compared to that confined to the basal cell layer of controls (f) (immunohistochemical, 200). significant increase of cytoplasmic expression of caspase 3 staining in basal and squamous cell layers in patients (g) when compared to minimal staining confined to the basal cell layer of controls (h) (immunohistochemical, 400) membranous staining was observed in all fas - positive specimens. in liver patients, the stain was observed in the basal and lower 2/3 of squamous cell layers with a score ranging from 1.7 to 3.8, with a mean of 2.70.6. in the control group, the stain was mainly confined to the basal cell layer and it ranged from 1.5 to 2 with a mean of 1.70.2. fas expression in liver patients was significantly higher than control group (p=0.003) [table 1, figures 2 and 3 ]. the stain was observed in the basal and lower 2/3 of squamous cell layers with score ranging from 0.6 to 1.9 with a mean of 1.30.5. in control group, the positive staining was mainly seen in the basal cell layer and it showed a score ranging from 0.7 to 1.1 with a mean of 0.80.2. p53 expression in liver patients was significantly higher than control group (p=0.03) [table 1, figures 2 and 3 ]. p53 was positively correlated with bax (p=0.000), caspase-3 (p=0.04) and apoptotic index (p=0.000). while, it was inversely correlated with epidermal thickness (p=0.002). caspase-3 expression cytoplasmic staining was observed in all caspase-3 positive specimens of both patients and controls. in liver disease patients the positively stained cells were observed in the basal and squamous cell layers with a score ranging from 2.3 to 4.3 with a mean of 3.10.6. in the control group, minimal staining was noticed in the basal cell layer with a score ranging from 1.8 to 2.4 with a mean of 2.10.2. the marker was significantly higher in patients than controls (p=0.003) [table 1, figures 2 and 3 ]. caspase-3 was positively correlated with bax (p=0.05) and p53 (p=0.04), while it was inversely correlated with epidermal thickness (p=0.002). cytoplasmic staining was observed in all bcl-2 positive specimens of both patients and controls. in the liver patients group, the positive cells were observed in basal cell layer with a score ranging from 0.5 to 3.2 with a mean of 2.30.8. in the control group, the stain was mainly confined to basal layer showing a score ranging from 2.4 to 2.6 with a mean of 2.560.1. there was no statistically significant difference between the two groups (p=0.5) [table 1, figures 2 and 4 ]. bcl-2 expression was positively correlated with epidermal thickness (p=0.03). while, it was inversely correlated with caspase-3 expression (p=0.001). expression of anti - apoptotic markers (bcl-2, bcl - xl) in epidermal keratinocytes of advanced hcv liver disease patients (a, c) and in controls (b, d) : insiginificant lower cytoplasmic expression of bcl-2 staining, mainly confined to the basal cell layer, in patients (a) when compared to controls (b).insiginificant lower perinuclear cytoplasmic expression of bcl - xl staining, mainly confined to the basal cell layer, in patients (c) when compared to that confined to the basal and supra basal cell layer of controls (d) (immunohistochemical, 400). insiginificant lower cytoplasmic expression of bcl-2 staining, mainly confined to the basal cell layer, in patients (a) when compared to controls (b). insiginificant lower perinuclear cytoplasmic expression of bcl - xl staining, mainly confined to the basal cell layer, in patients (c) when compared to that confined to the basal and supra basal cell layer of controls (d) (immunohistochemical, 400). perinuclear cytoplasmic staining was observed in all bcl - xl positive specimens of patients and controls. in liver disease patients, the positively stained cells were observed in the basal cell layer with a range from 1 to 2.5 with a mean of 1.90.5. in control subjects, they were also observed mainly in the basal cell layer ; however, in some specimens positive suprabasal cells were also noticed. no statistically significant difference was found between the two groups (p=0.9) [table 1, figures 2 and 4 ]. apoptotic cells were demonstrated in basal and squamous cell layers in hcv liver patients with an apoptotic index ranging from 0 to 2 with a mean of 1.30.7. control subjects showed few apoptotic cells, if present, with an apoptotic index ranging from 0 - 1 with a mean of 0.20.4. the apoptotic index in liver disease patients was significantly higher than the control group (p=0.002) [table 1, figures 2 and 5 ]. apoptotic index was positively correlated with bax (p=0.001) and p53 expression (p=0.000), while it was inversely correlated with epidermal thickness (p=0.001). many apoptotic cells present in basal and squamous cell layer in advanced hcv liver disease patients (a), compared to few apoptotic cells seen in controls (b) (tunel, 400) the epidermal thickness of liver disease patients ranged from 39.6 to 55.4 m with a mean of 46.2 m4.4. on the other hand, the epidermal thickness of the control group ranged from 57.4 to 75 m with a mean of 647 m. the epidermis of liver disease patients showed significantly lower thickness than the control group (p = 0.000) [table 1, figure 1 ]. mean value of epidermal thickness, score of pro - apoptotic (bax, fas, p53 and caspase-3) and anti - apoptotic markers (bcl-2 and bcl - xl) and apoptotic index in hcv liver patients and controls the epidermis of advanced hcv liver disease patients (a) is lower in thickness when compared to controls (b) (h and e, 100) cytoplasmic staining was observed in all bax positive specimens of both patients and controls. in liver disease patients, the stain was observed in both basal and squamous cell layers with a score ranging from 1.6 to 3.8 with a mean of 30.6. in controls, staining was mainly confined to the basal cell layer with a range from 0.2 to 2.5 with a mean of 2.30.1. the former was significantly higher than the control group (p=0.03) [table 1, figures 2 and 3 ]. expression of pro - apoptotic (bax, fas, p53, caspase-3) and anti - apoptotic (bcl-2, bcl - xl) markers, and apoptotic index in hcv liver patients and controls expression of pro - apoptotic markers (bax, fas, p53, caspase-3) in epidermal keratinocytes of advanced hcv liver disease patients (a, c, e, g) and in controls (b, d, f, h) respectively showing the following : significant increase of cytoplasmic expression of bax staining in basal and squamous cell layers in patients (a) when compared to that confined to the basal cell layer of controls (b) (immunohistochemical, 400).significant increase of membranous expression of fas staining in basal and lower 2/3 of squamous cell layers in patients (c) when compared to that confined to the basal cell layer of controls (d) (immunohistochemical, 400).significant increase of nuclear expression of p53 staining in basal and lower 2/3 of squamous cell layers in patients (e) when compared to that confined to the basal cell layer of controls (f) (immunohistochemical, 200).significant increase of cytoplasmic expression of caspase 3 staining in basal and squamous cell layers in patients (g) when compared to minimal staining confined to the basal cell layer of controls (h) (immunohistochemical, 400) significant increase of cytoplasmic expression of bax staining in basal and squamous cell layers in patients (a) when compared to that confined to the basal cell layer of controls (b) (immunohistochemical, 400). significant increase of membranous expression of fas staining in basal and lower 2/3 of squamous cell layers in patients (c) when compared to that confined to the basal cell layer of controls (d) (immunohistochemical, 400). significant increase of nuclear expression of p53 staining in basal and lower 2/3 of squamous cell layers in patients (e) when compared to that confined to the basal cell layer of controls (f) (immunohistochemical, 200). significant increase of cytoplasmic expression of caspase 3 staining in basal and squamous cell layers in patients (g) when compared to minimal staining confined to the basal cell layer of controls (h) (immunohistochemical, 400) membranous staining was observed in all fas - positive specimens. in liver patients, the stain was observed in the basal and lower 2/3 of squamous cell layers with a score ranging from 1.7 to 3.8, with a mean of 2.70.6. in the control group, the stain was mainly confined to the basal cell layer and it ranged from 1.5 to 2 with a mean of 1.70.2. fas expression in liver patients was significantly higher than control group (p=0.003) [table 1, figures 2 and 3 ]. the stain was observed in the basal and lower 2/3 of squamous cell layers with score ranging from 0.6 to 1.9 with a mean of 1.30.5. in control group, the positive staining was mainly seen in the basal cell layer and it showed a score ranging from 0.7 to 1.1 with a mean of 0.80.2. p53 expression in liver patients was significantly higher than control group (p=0.03) [table 1, figures 2 and 3 ]. p53 was positively correlated with bax (p=0.000), caspase-3 (p=0.04) and apoptotic index (p=0.000). while, it was inversely correlated with epidermal thickness (p=0.002). caspase-3 expression cytoplasmic staining was observed in all caspase-3 positive specimens of both patients and controls. in liver disease patients the positively stained cells were observed in the basal and squamous cell layers with a score ranging from 2.3 to 4.3 with a mean of 3.10.6. in the control group, minimal staining was noticed in the basal cell layer with a score ranging from 1.8 to 2.4 with a mean of 2.10.2. the marker was significantly higher in patients than controls (p=0.003) [table 1, figures 2 and 3 ]. caspase-3 was positively correlated with bax (p=0.05) and p53 (p=0.04), while it was inversely correlated with epidermal thickness (p=0.002). cytoplasmic staining was observed in all bcl-2 positive specimens of both patients and controls. in the liver patients group, the positive cells were observed in basal cell layer with a score ranging from 0.5 to 3.2 with a mean of 2.30.8. in the control group, the stain was mainly confined to basal layer showing a score ranging from 2.4 to 2.6 with a mean of 2.560.1. there was no statistically significant difference between the two groups (p=0.5) [table 1, figures 2 and 4 ]. bcl-2 expression was positively correlated with epidermal thickness (p=0.03). while, it was inversely correlated with caspase-3 expression (p=0.001). expression of anti - apoptotic markers (bcl-2, bcl - xl) in epidermal keratinocytes of advanced hcv liver disease patients (a, c) and in controls (b, d) : insiginificant lower cytoplasmic expression of bcl-2 staining, mainly confined to the basal cell layer, in patients (a) when compared to controls (b).insiginificant lower perinuclear cytoplasmic expression of bcl - xl staining, mainly confined to the basal cell layer, in patients (c) when compared to that confined to the basal and supra basal cell layer of controls (d) (immunohistochemical, 400). insiginificant lower cytoplasmic expression of bcl-2 staining, mainly confined to the basal cell layer, in patients (a) when compared to controls (b). insiginificant lower perinuclear cytoplasmic expression of bcl - xl staining, mainly confined to the basal cell layer, in patients (c) when compared to that confined to the basal and supra basal cell layer of controls (d) (immunohistochemical, 400). perinuclear cytoplasmic staining was observed in all bcl - xl positive specimens of patients and controls. in liver disease patients, the positively stained cells were observed in the basal cell layer with a range from 1 to 2.5 with a mean of 1.90.5. in control subjects, they were also observed mainly in the basal cell layer ; however, in some specimens positive suprabasal cells were also noticed. no statistically significant difference was found between the two groups (p=0.9) [table 1, figures 2 and 4 ]. apoptotic cells were demonstrated in basal and squamous cell layers in hcv liver patients with an apoptotic index ranging from 0 to 2 with a mean of 1.30.7. control subjects showed few apoptotic cells, if present, with an apoptotic index ranging from 0 - 1 with a mean of 0.20.4. the apoptotic index in liver disease patients was significantly higher than the control group (p=0.002) [table 1, figures 2 and 5 ]. apoptotic index was positively correlated with bax (p=0.001) and p53 expression (p=0.000), while it was inversely correlated with epidermal thickness (p=0.001). many apoptotic cells present in basal and squamous cell layer in advanced hcv liver disease patients (a), compared to few apoptotic cells seen in controls (b) (tunel, 400) cytoplasmic staining was observed in all bax positive specimens of both patients and controls. in liver disease patients, the stain was observed in both basal and squamous cell layers with a score ranging from 1.6 to 3.8 with a mean of 30.6. in controls, staining was mainly confined to the basal cell layer with a range from 0.2 to 2.5 with a mean of 2.30.1. the former was significantly higher than the control group (p=0.03) [table 1, figures 2 and 3 ]. expression of pro - apoptotic (bax, fas, p53, caspase-3) and anti - apoptotic (bcl-2, bcl - xl) markers, and apoptotic index in hcv liver patients and controls expression of pro - apoptotic markers (bax, fas, p53, caspase-3) in epidermal keratinocytes of advanced hcv liver disease patients (a, c, e, g) and in controls (b, d, f, h) respectively showing the following : significant increase of cytoplasmic expression of bax staining in basal and squamous cell layers in patients (a) when compared to that confined to the basal cell layer of controls (b) (immunohistochemical, 400).significant increase of membranous expression of fas staining in basal and lower 2/3 of squamous cell layers in patients (c) when compared to that confined to the basal cell layer of controls (d) (immunohistochemical, 400).significant increase of nuclear expression of p53 staining in basal and lower 2/3 of squamous cell layers in patients (e) when compared to that confined to the basal cell layer of controls (f) (immunohistochemical, 200).significant increase of cytoplasmic expression of caspase 3 staining in basal and squamous cell layers in patients (g) when compared to minimal staining confined to the basal cell layer of controls (h) (immunohistochemical, 400) significant increase of cytoplasmic expression of bax staining in basal and squamous cell layers in patients (a) when compared to that confined to the basal cell layer of controls (b) (immunohistochemical, 400). significant increase of membranous expression of fas staining in basal and lower 2/3 of squamous cell layers in patients (c) when compared to that confined to the basal cell layer of controls (d) (immunohistochemical, 400). significant increase of nuclear expression of p53 staining in basal and lower 2/3 of squamous cell layers in patients (e) when compared to that confined to the basal cell layer of controls (f) (immunohistochemical, 200). significant increase of cytoplasmic expression of caspase 3 staining in basal and squamous cell layers in patients (g) when compared to minimal staining confined to the basal cell layer of controls (h) (immunohistochemical, 400) membranous staining was observed in all fas - positive specimens. in liver patients, the stain was observed in the basal and lower 2/3 of squamous cell layers with a score ranging from 1.7 to 3.8, with a mean of 2.70.6. in the control group, the stain was mainly confined to the basal cell layer and it ranged from 1.5 to 2 with a mean of 1.70.2. fas expression in liver patients was significantly higher than control group (p=0.003) [table 1, figures 2 and 3 ]. the stain was observed in the basal and lower 2/3 of squamous cell layers with score ranging from 0.6 to 1.9 with a mean of 1.30.5. in control group, the positive staining was mainly seen in the basal cell layer and it showed a score ranging from 0.7 to 1.1 with a mean of 0.80.2. p53 expression in liver patients was significantly higher than control group (p=0.03) [table 1, figures 2 and 3 ]. p53 was positively correlated with bax (p=0.000), caspase-3 (p=0.04) and apoptotic index (p=0.000). while, it was inversely correlated with epidermal thickness (p=0.002). caspase-3 expression cytoplasmic staining was observed in all caspase-3 positive specimens of both patients and controls. in liver disease patients the positively stained cells were observed in the basal and squamous cell layers with a score ranging from 2.3 to 4.3 with a mean of 3.10.6. in the control group, minimal staining was noticed in the basal cell layer with a score ranging from 1.8 to 2.4 with a mean of 2.10.2. the marker was significantly higher in patients than controls (p=0.003) [table 1, figures 2 and 3 ]. caspase-3 was positively correlated with bax (p=0.05) and p53 (p=0.04), while it was inversely correlated with epidermal thickness (p=0.002). cytoplasmic staining was observed in all bcl-2 positive specimens of both patients and controls. in the liver patients group, the positive cells were observed in basal cell layer with a score ranging from 0.5 to 3.2 with a mean of 2.30.8. in the control group, the stain was mainly confined to basal layer showing a score ranging from 2.4 to 2.6 with a mean of 2.560.1. there was no statistically significant difference between the two groups (p=0.5) [table 1, figures 2 and 4 ]. bcl-2 expression was positively correlated with epidermal thickness (p=0.03). while, it was inversely correlated with caspase-3 expression (p=0.001). expression of anti - apoptotic markers (bcl-2, bcl - xl) in epidermal keratinocytes of advanced hcv liver disease patients (a, c) and in controls (b, d) : insiginificant lower cytoplasmic expression of bcl-2 staining, mainly confined to the basal cell layer, in patients (a) when compared to controls (b).insiginificant lower perinuclear cytoplasmic expression of bcl - xl staining, mainly confined to the basal cell layer, in patients (c) when compared to that confined to the basal and supra basal cell layer of controls (d) (immunohistochemical, 400). insiginificant lower cytoplasmic expression of bcl-2 staining, mainly confined to the basal cell layer, in patients (a) when compared to controls (b). insiginificant lower perinuclear cytoplasmic expression of bcl - xl staining, mainly confined to the basal cell layer, in patients (c) when compared to that confined to the basal and supra basal cell layer of controls (d) (immunohistochemical, 400). perinuclear cytoplasmic staining was observed in all bcl - xl positive specimens of patients and controls. in liver disease patients, the positively stained cells were observed in the basal cell layer with a range from 1 to 2.5 with a mean of 1.90.5. in control subjects, they were also observed mainly in the basal cell layer ; however, in some specimens positive suprabasal cells were also noticed. no statistically significant difference was found between the two groups (p=0.9) [table 1, figures 2 and 4 ]. apoptotic cells were demonstrated in basal and squamous cell layers in hcv liver patients with an apoptotic index ranging from 0 to 2 with a mean of 1.30.7. control subjects showed few apoptotic cells, if present, with an apoptotic index ranging from 0 - 1 with a mean of 0.20.4. the apoptotic index in liver disease patients was significantly higher than the control group (p=0.002) [table 1, figures 2 and 5 ]. apoptotic index was positively correlated with bax (p=0.001) and p53 expression (p=0.000), while it was inversely correlated with epidermal thickness (p=0.001). many apoptotic cells present in basal and squamous cell layer in advanced hcv liver disease patients (a), compared to few apoptotic cells seen in controls (b) (tunel, 400) programmed cell death (apoptosis) is an essential strategy of dynamic balance in the living system. apoptosis is the major mechanism by which homeostasis of a number of physiological systems in the body is regulated. although apoptosis is an intrinsic process present in all cells, it can be regulated by extrinsic factors including growth factors, cell surface receptors, cellular stress, and hormones. apoptosis is morphologically and biochemically characterized by cell shrinkage, dense chromatin condensation, cellular budding, fragmentation, rapid phagocytosis by nearby cells, and dna fragmentation. in the skin, there is considerable evidence that apoptosis plays an important role in the pathogenesis of a wide variety of skin diseases. death of hepatocytes and other hepatic cell types is a characteristic feature of liver diseases as cholestasis, viral hepatitis, ischemia / reperfusion, liver preservation for transplantation, and drug / toxicant - induced injury. meanwhile, skin diseases characterized by increased apoptosis (lp) or necrosis (nae) of keratinocytes were previously reported in hcv liver disease patients. overactivation of the apoptotic process can lead to significant hepatocellular damage, while inhibition of apoptosis can promote the proliferation and transformation of cells. for example, apoptosis induction in infected liver cells, by hbv or hcv, is a defense mechanism to limit viral replication and promote their elimination. liver cell failure develops when the functional capacity of the liver can no longer maintain normal physiological conditions. this may be manifested on the skin, and it may affect other body systems in the form of hepatic encephalopathy, cardiovascular changes, portal hypertension, hepatopulmonary syndrome, and hepatorenal syndrome. in a similar model to liver cell failure, renal failure which is a systemic disease with cutaneous manifestations. the degree of renal failure in hepatorenal syndrome is a reflection of the degree of hepatocellular failure. interestingly, a recent study reported over expression of epidermal p53 and bcl-2 with increased epidermal thickness in chronic renal failure patients on maintenance hemodialysis : suggesting that an alteration in the proliferation/ apoptosis balance is most likely present in the skin of such patients. usually, apoptosis represents a counterbalance to proliferation, and decreased apoptosis is generally thought to be associated with epidermal hyperproliferation. in the present work, significant overexpression of proapoptotic markers (bax, fas, p53, and caspase-3) were detected in patients (p=0.03, 0.03, 0.003, and 0.003, respectively) : that could explain the increased apoptotic index in hcv liver patients (0.002). whether these changes were due to the metabolic and biochemical alterations present in such patients or to the direct effect of the virus remain to be elucidated. especially when taking into consideration that apoptosis induction in infected liver cells, by hbv or hcv, is considered by some authors as a defense mechanism to limit viral replication and promote their elimination moreover, the epidermal thickness of skin biopsies from patients was inversely correlated with the increased proapoptotic markers (bax : p=0.01, fas : p=0.04, p53 : p=0.002, and caspase-3 : p=0.002) and apoptotic index (p=0.001). these findings suggest that an alteration in the proliferation / apoptosis balance is present in the skin of such patients. it is still unclear whether skin diseases associated with hcv infection and characterized histopathologically by apoptosis (lp) or necrosis (nae) are due to an exaggerated response to such alteration or to another mechanism. on the other hand, no statistically significant difference in expression of antiapoptotic markers (bcl-2 and bcl - xl) in epidermal keratinocytes of hcv patients and the control group (p=0.5 and p=0.9 respectively) were detected. the result of hcv liver disease patients was different from that reported in chronic renal failure where the expression of bcl-2 protein (antiapoptotic) was found to be higher in skin samples obtained from apparently normal skin of chronic renal failure patients on maintenance hemodialysis than in skin samples obtained from control cases. the difference between the mean values of the two groups was highly significant (p=0.0003). meanwhile, in the present study, the epidermis of hcv liver disease patients showed significantly lower thickness than the control group (p=0.000) when measured by computer image analysis (histometry). on the contrary, in renal failure patients there were significant increase of the epidermal thickness in patients than controls (p<0.0001). however, overexpression of p53 protein was the only common finding in both chronic renal failure and hcv liver disease patients, which could be attributed to significant dna damage. the results of the present study suggest an alteration in keratinocyte proliferation / apoptosis balance in advanced hcv liver patients, which are associated with an increase in the expression of skin pro - apoptotic markers (bax, fas, p53, and caspase-3) with consequent increase of the apoptotic index and decreased epidermal thickness. whether this alteration in the skin proliferation/ apoptosis balance is attributed to the metabolic and biochemical changes present in liver cell failure or to the direct effect of the virus future research on a larger group of patients is mandatory, and should address various apoptotic regulatory proteins in the skin as well as other organs, in hcv patients and other liver diseases, to explain how the metabolic effects of liver diseases may affect skin apoptosis. | background : hepatitis - c virus (hcv) infection is considered a major worldwide public health problem with a global prevalence. maintenance of skin homeostasis requires a delicate balance between proliferation, differentiation, and apoptosis. meanwhile, it is unclear if there is an altered keratinocyte proliferation / apoptosis balance in advanced liver disease with hcv infection.aim:this work aimed to evaluate the epidermal thickness and changes in the expression of apoptosis regulatory markers as well as apoptotic index in skin samples of advanced hcv liver patients compared to normal controls.materials and methods : twenty biopsies were taken from apparently normal skin of advanced hcv liver disease patients, as well as five healthy control subjects. these specimens were used for histometric epidermal measurement, immunohistochemical staining of apoptosis regulatory proteins (bax, fas, p53, caspase-3, bcl-2, bcl - xl) as well as the tunel technique for detection of apoptotic cells.results:the mean epidermal thickness was significantly lower than the control group (p=0.000). there were significant overexpression of pro - apoptotic markers (bax, fas, p53, and caspase-3) in patients (p=0.03, 0.03, 0.003, 0.003 respectively), with increased apoptotic index in hcv liver patients (p=0.002) when compared to normal controls. on the other hand, no statistically significant difference were encountered in the expression of antiapoptotic markers (bcl-2, bcl - xl) in hcv patients when compared to normal controls (p=0.5, 0.9, respectively).conclusion : these findings suggest that an alteration in the proliferation / apoptosis balance is present in the skin of hcv liver patients. |
ligand - gated ion channels (lgics) are multimeric membrane proteins that play an important role in fast synaptic transmission and in the modulation of cellular activity. they are involved in many neurological disorders, such as alzheimer s disease, anxiety, epilepsy, and learning and attention deficit, and are target sites for many drugs, including anesthetics and muscle relaxants.(1) lgics exist in multiple conformations, of which the closed (inactive) and open (active) are the best - studied. the equilibrium between these two conformations is affected by the binding of an agonist, which stimulates the conformational change (gating) between the closed and the open states. once the channel is open, ions can flow through the channel, altering the postsynaptic neuron membrane potential. the 5-hydroxytryptamine 3 receptor (5-ht3r) is a member of the cys - loop lgic superfamily, which includes nicotinic acetylcholine (nach), -aminobutyric acid (gabaa, gabac), and glycine receptors.(2) these receptors are composed of five subunits arranged in a pentagonal array around a central pore. each subunit has a large extracellular n - terminal domain, which contains the ligand binding site, a transmembrane domain, and an intracellular domain. the transmembrane domain is composed of four -helices : m1, m2, m3 and m4 ; the m2 helix of each subunit lines the interior of the channel pore. mutagenesis experiments, in combination with various computational techniques, including homology modeling, ligand - docking, classical molecular dynamics, and first principle calculations, have supplied important information on the ligand - binding mechanism (see, e.g., refs (37)), but a clear atomistic picture of the successive gating mechanism is still missing. data show that regions located at the interface of the extracellular and transmembrane domains are critical in linking binding with channel opening ; these include the cys - loop, the 12 loop, and the m2m3 loop. a model has been proposed for 5-ht3r gating whereby transcis isomerization of a specific proline (pro308, alternatively labeled as pro8) at the apex of the m2m3 loop would induce a conformational change in m2, resulting in a displacement of the hydrophobic girdle that occludes the pore and opening the channel.(15) to examine the alleged switching role of proline in 5-ht3r and to provide atomistic insights to complement the mutagenesis experiments, we have performed a computational study of a proline dipeptide (n - acetylproline methylamide), the simplest model to study proline isomerization within a peptide, shown in figure 1. we also investigated a range of dipeptides of the proline analogues that were studied experimentally.(15) proline dipeptide. a number of previous studies of proline dipeptides have focused on single - point, total energy calculations by first principles methods in vacuo, for which the entropic contribution to the free energy was calculated within the harmonic approximation ; when included, the solvent effects were evaluated implicitly. here, using a classical force field scheme and the metadynamics method, we provide the free energy maps of the selected dipeptides and an evaluation of the free energy differences between the cis and trans isomers that takes into account the complexity of the basins of attraction without assumptions on their shape. at variance with previous free energy studies, we include the water solvent explicitly so as to quantify the effects of both intra- and intermolecular hydrogen bonds. our study is relevant not only for the ligand - gated ion channels that have inspired it, but also for other biomolecules in which the transcis isomerization of the prolyl peptide bond plays an important role.(24) it provides a reference database for experiments, where the properties of proline analogues have been coherently calculated under the same conditions. moreover, it can be easily extended to other proline analogues, pressure and temperature conditions, and solvents. we created the initial structures of proline dipeptide and its analogues using the program leap, contained in the amber simulation package,(25) by terminating the proline analogues with the two groups acetamide (ace) and n - methyl (nme). all the simulations were performed with the classical molecular dynamics amber(25) and orac(26) packages using the amber2003 force field.(27) we parametrized the nonstandard proline analogues by assigning to them partial charges from ab initio calculations ; for consistency and for a better agreement with ab initio calculations in vacuo, we used ab initio partial charges also for pro. specifically, we calculated the esp atomic partial charges(28) of pro and its analogues at a density functional theory (dft) level with the cpmd package,(29) using the pbe gradient - corrected xc - functional,(30) norm - conserving martinstroulliers pseudopotentials,(31) a kinetic energy cutoff for the wave function expansion in plane waves of 70 ry, orthorhombic cells of size 15 14 14 a, and the hockney method for neglecting the electrostatic interactions between neighboring cells.(32) we determined the partial charges assigned to the force field for the trans isomer ; however, we also calculated the dftesp charges of proline dipeptide for the cis isomer and verified that the differences were small (mainly confined to the redistribution of charge between n and h in the nh group, whose total charge remained however very similar). hence, the trans isomer charges are a good representation for all the conformers. for the simulations in aqueous solution, we surrounded the dipeptides with 431 tip3p water molecules(33) in a periodically repeated orthorhombic simulation cell. this was initially equilibrated at room temperature and atmospheric pressure using a time step of 0.5 fs for the molecular dynamic and evaluating the electrostatic contributions with particle mesh ewald.(34) the volume of the cell was kept fixed at the equilibrated value during the metadynamics, and the temperature was controlled using the nos thermostat,(35) whereas in gas phase, we used a stochastic velocity rescaling.(36) to assess the reliability of the amber2003 force field with the dftesp charges for the description of the proline dipeptide transcis isomerization, we compared selected potential energy profiles in vacuo as a function of the torsional angles (defined by the atoms ch3o1cc in figure 1) and (defined by n1ccn), obtained with amber2003 and dft calculations (figure 3)., we used the same protocol as for the esp charges ; each point corresponded to a geometry optimization at fixed and. the amber2003 force field qualitatively reproduces the location of the minima, maxima, and saddle points obtained with dft and, most importantly for our study, the relative stability of the trans and cis isomers. quantitatively, the differences in energy between the cis and trans absolute minima (ect) were 2.4 kcal / mol with amber and 3.6 kcal / mol with dft ; the barriers were at 90 and 0 15.3 kcal / mol with amber and 21.0 kcal / mol with dft and, similarly, at + 90 and 0 15.7 kcal / mol with amber and 20.6 kcal / mol with dft. the locations of our trans and cis minima and the corresponding etc are in fairly good agreement with previously published dft (b3lyp) and hartreefock results. the larger error of the force field in the energy barrier with respect to the cistrans energy difference is likely to be due to the relevance of electronic structure effects for the transition states in which the partial double bond character of the n1c1 bond is broken. although we were aware that the force field might not be able to capture subtle electronic structure effects, it was, indeed, able to reproduce the relevant features and allowed us to map the free energy surfaces (fes) in explicit solvent, a task that would be extremely computationally expensive with ab initio methods. potential energy profiles at selected values of and (in deg) obtained with dft (red) and the amber2003 force field with dftesp partial charges (black) for proline dipeptide in vacuo. the zero of the energy scale is set to the absolute minimum. to evaluate the free energy surfaces, we used the metadynamics method, which is an efficient way to sample the free energy of complex polyatomic systems in the space of a few course - grained quantities (collective variables, cvs).(37) metadynamics works by adding a history - dependent potential, built as a sum of gaussians, whose role is to discourage the system from revisiting regions in the cv space already visited, thus accelerating rare events involving barrier crossing. when metadynamics is used with properly chosen collective variables, it provides an unbiased estimate of the free energy surface. however, the efficiency of the metadynamics method strongly depends on which collective variables are chosen as reaction coordinates for a particular mechanism. in the case of pro transcis isomerization, the most intuitive choice of cv is the imide torsional angle (cn1c1ch3 in figure 1), which is equal to 180 for the trans and to 0 for the cis isomer. however, during the isomerization, this angle is coupled to the out - of - plane deformation (pyramidalization) of the imide nitrogen, described by the improper dihedral angle (c1cn1c) : this should also be specified in addition to to unambiguously identify the saddle points. alternatively, fischer.(40) proposed the use of the improper dihedral angle (ch3o1cc), which at the same time takes into account both the transcis isomerization and the nitrogen pyramidalization. similarly to, = 0 for the cis isomer and = 180 for the trans isomer ; at variance from, is around 90 at the saddle points, independently on the nitrogen pyramidalization, thus effectively removing the need to specify. in our metadynamics calculations, we used as cvs and also the torsional angle (n1ccn), which describes the orientation of the c - terminal amide. this is important because both experimental(41) and theoretical(40) studies have shown that the proline transcis isomerization is affected by the interaction between the c - terminal group and either the lone pair of the imide nitrogen (n1) or the imide carbonyl oxygen (o1). these interactions may, in fact, lower the torsional barrier by decreasing the double bond character of the bond between n1 and c1 in a process of autocatalysis. we built the history - dependent potential by summing up gaussians of width 9 and height w = 0.07 kcal / mol, with a stride of = 400 fs. we then estimated the free energy from the negative of the history - dependent potential at the end of the simulation. converged free energies required about 40 000 gaussians each, for a simulated time of 16 ns. to accelerate the free energy calculations, we adopted the multiple walker scheme, which allows an efficient parallelization of the method.(42) as discussed in refs (38) and (39), the statistical error on the estimated free energy depends on the rate, w/. our parameters were relatively conservative and allowed us to obtain accurate evaluations of the free energy profiles. the statistical errors were lower than 0.2 kcal / mol for the simulations in vacuo and lower than 0.3 kcal / mol for the simulations in aqueous solution. we further decreased the error by taking the average of the history - dependent potential over the last 4 ns of simulation.(43) in figure 4, we show the free energy maps as a function of and for proline dipeptide in vacuo and aqueous solution ; the zero in each graph is the absolute minimum. we obtained the free energy difference in vacuo between the cis and trans isomers by integrating over the relevant regions so as to account for the different shapes of the basin of attractions. our calculated value (2.4 0.2 kcal / mol) is in good agreement with previously published dft b3lyp/6 - 31g+d(d) and b3lyp/6 - 311++g(d, p) calculations, in which vibrational frequencies were calculated for the stationary points in the gas phase and then used to compute free energies. in vacuo, the trans global minimum at 180 and 60 corresponds to a configuration with an intramolecular hydrogen bond between the nh group and o1. the cis isomer has two minima ; no intramolecular hydrogen bonds were possible in this configuration ; hence, the transcis isomerization disrupts the intramolecular hydrogen bond within the dipeptide. the presence of intramolecular hydrogen bonds was highly affected by the environment. in vacuo, 90 < < 90), with ranging from 0 to 90 ; in water, its occurrence was reduced to 16%. this was due to the competition between the formation of the intramolecular hydrogen bond and that of intermolecular hydrogen bonds with the water molecules. specifically, o and o1 each formed, on average, 2.1 and 1.9 hydrogen bonds with water. n1 did not form any hydrogen bonds with water, whereas n formed only 0.8 hydrogen bonds (0.1 as acceptor and 0.7 as donor). these averages were evaluated for any value of ; restricting the averages to the trans isomer gave almost identical values (2.0 and 1.9 hydrogen bonds between water molecules and o and o1, respectively). the influence of the solvent is clearly reflected in the fes, where the unique trans minimum basin in vacuo is substituted by a pair of trans minima in water, at 145 and 25, as shown in figure 4. hence, in water, the trans basin is more similar to the cis one, where no intramolecular hydrogen bonds can be formed. because of the importance of the intermolecular hydrogen bonds, it is essential that explicit water molecules were included in the simulations. top : free energy maps at room temperature for proline dipeptide in vacuo (left) and water (right) as a function of the dihedral angles and. bottom : the corresponding free energy profile integrated over. the zero of the energy scale is set at the absolute minimum, and the spacing between lines is 0.2 kcal / mol. we calculated a free energy difference between the cis and trans isomers in water equal to 1.0 kcal / mol ; with an error of 0.3 kcal / mol, this is in good agreement with experiments, which estimates 0.6 kcal / mol. the reduction of the cistrans free energy difference in aqueous with respect to that in vacuo is in line with dft / b3lyp and implicit solvent calculations. the isomerization barrier, obtained from the fes profiles integrated over (figure 4) increased from 13.8 kcal / mol in vacuo to 15.6 kcal / mol in aqueous solution, thus confirming the mechanism of autocatalysis determined by the presence of the intramolecular hydrogen bond. although the environment in the ion channel is much more complex, we expect that simulations of the transcis proline switch in water represent a realistic environment. in fact, the m2m3 loop, where pro308 is situated, has been shown to be solvent - accessible in a variety of cys - loop receptors. hence, we believe that the studies in aqueous solution are a good representation of the in vivo situation. we therefore investigated the proline analogues (figure 2), which have been experimentally studied in the 5-ht3r, in aqueous solution. these analogues exhibit various ring features and preference for either of the two isomers.(47) the corresponding free energy maps are shown in figure 5, where, as in figure 4, the zero of the scale is aligned with the absolute minimum of each fes. the cistrans free energy differences with respect to pro and the lowest isomerization barriers are shown in table 1. all proline analogues favored the trans isomers, except dmp and tbp, which favored the cis. free energy maps at room temperature of the proline dipeptide analogues in aqueous solution as a function of the dihedral angles (horizontal, in deg) and (vertical, in deg). the isomerisation barrier is the smallest between the two calculated for clockwise and counterclockwise transcis isomerisation. in pip and aze, the size of the ring was, respectively, increased and decreased as compared to pro ; the relative stability of the cis and trans configurations was very similar in pip and pro, whereas the cis stability was slightly increased in aze. the steric interaction between the two methyl groups added to c and the ace methyl group disfavored the trans isomer. in tbp, the steric interaction between the bulky tert - butyl group attached to c and the ace group also disfavored the trans isomer ; however, the distance between the three methyl groups in the tert - butyl and the ace methyl group was larger than for dmp, resulting in a weaker interaction and a reduced destabilization of the trans. both the isomerization barriers of dmp and tbp were substantially lower than that of pro. the relative transcis stabilities of the fluoroprolines were also similar to that of pro, with t-4f - pro slightly stabilizing the cis more than both pro and c-4f - pro ; in aqueous solution, the fluorine atoms in both residues formed hydrogen bonds with water molecules, which neutralized the main effects of their presence on the ring. specifically, the fluorine atom acted as acceptor for, on average, 0.9 hydrogen bonds with water in the t-4f - pro simulation and 0.7 in the c-4f - pro simulation. 2-me - pro favored the trans isomer, due to the methyl group attached to c, which sterically interacted with the ace methyl group, disfavoring the cis configuration. the addition of a methyl group to c, as in the 3-me - pro, did not significantly affect the cis preference with respect to pro because it is farther away from the isomerization bond. in addition, 2,4-ch2-pro favored the trans isomer due to the steric interaction between the ace methyl group and the methylene group attached to c and c ; the presence of the methylene group substantially decreased the isomerization barrier with respect to pro. evaluation of the hydrogen bonds formed during the metadynamics for all the proline analogues revealed strong similarity to pro, with averages for the number of hydrogen bonds between water molecules and o1, o, nh, and n1 ranging from 1.9 to 2.2, from 1.6 to 1.8, from 0.5 to 0.9, and from 0.0 to 0.1, respectively. the percentages of occurrence of the intramolecular hydrogen bond were also not dissimilar from that of pro, ranging from 12% for pip to 20% for c-4f - pro. this indicates that the effect of the solvent for the proline analogues was as crucial as it was for pro. a transcis isomerization of a proline peptide bond is an attractive mechanism to change protein conformation and has been shown to be important in the function of several proteins. the data we present here support previous studies that show that such a mechanism can open the pore of the 5-ht3 receptor.(15) the comparison between the relative free energies of the cis and trans isomers of a range of proline analogue dipeptides and those inferred from the relative ec50s of the 5-ht3 receptor activation allowed us to isolate the isomerization of the proline peptide bond from all the other concurrent events that occur when 5-ht binds to this receptor and lead to channel gating. the strong correlation we found supports the proposal that transcis isomerization is, indeed, a realistic switching mechanism. in the previous published experimental paper,(15) the cistrans free energy differences correlated with the experimental ec50s were obtained from the literature for a range of different peptides at different experimental conditions, and the comparison was done only for a subset of the investigated proline analogues. here, we evaluated the relative cistrans free energy difference for all the experimentally investigated proline analogues, including those resulting in nonfunctional channels, using the same model system under the same conditions. hence, we considered our data more accurate and consistent. the theoretical protocol that we have developed can be easily extended to other residues and conditions so as to provide a reference database for future experimental measurements done in the same spirit of those by lummis.(15) in other proteins or involving other prolines. our simulations also revealed specific interactions within the dipeptides and with the solvent that explain the free energy profiles, thus providing additional information on the atomistic details of the isomerization mechanisms. in particular, the isomerization from trans to cis disrupted the hydrogen bond between the residues immediately preceding and following pro308 (specifically, between the nh group of nme and the o1 atom of ace). such a hydrogen bond, which was present in the trans isomer both in vacuo and in solution in different percentages, was, in fact, absent in the cis. this absence is likely to be mirrored in the m2m3 loop of 5-ht3r. through preliminary calculations on extended peptides mimicking the m2m3 loop, we verified that the hydrogen bond between the threonine and leucine that sandwich pro308 was, indeed, broken during the transcis isomerization ; the occurrence of another hydrogen bond between this threonine and another threonine in the m2m3 loop also decreased substantially during the isomerization : modifications in the interaction network might facilitate the movement of the m2 helix leading to the opening of the channel. indeed, the transcis proline isomerization has the potential to bring many changes in the interactions with surrounding residues in the 5-ht3 receptor, as can be inferred in figure 7. here, pro308 is shown in its trans and cis forms, together with nearby residues in homology models for the 5-ht3 receptor. pro308 and the two adjacent residues thr307 and leu309, highlighted with sticks, are in the m2m3 loop ; glu213 is in the f loop ; arg245 is at the boundary between the extracellular and the transmembrane domain ; and tyr250 is at the start of the m1 helix. these homology models were generated using modeller 6v2(51) as previously described,(3) with the extracellular domain based on the crystal structure of the acetylcholine binding protein (achbp) at 2.7 resolution (pdb i d : 1i9b(52)) and the transmembrane domain on the structure of the nach receptor at 4 resolution (pdb i d : 2bg9(53)). the cistrans free energy differences relative to proline, when plotted against those obtained from the ec50 values (figure 6), cluster mainly around two regions for the proline analogues that behave similarly to proline (pip, aze, t-4f - pro and c-4f - pro) and those with a clear preference for the cis isomer (tbp and dmp). they reveal a correlation coefficient of 0.98, similar to the experimental data previously reported(15) and indicating a tight relationship between the population of cis and trans isomers and the receptor response. the slope of the best fit, however, is different : from our theoretical data, it is m = 0.66, whereas the previous value was m = 1.(15) the latter suggests that the equilibrium between closed and open channels is purely due to the equilibrium between trans and cis pro308, but the new data suggest the relationship may be more complex and possibly nonlinear. a linear relationship in fact would also predict that all analogues, including 2-me - pro and 2,4-ch2-pro would be functional, with ec50s significantly less than the maximum concentration that has been tested. correlation between cistrans free energy differences from the metadynamics simulations and from experimental data (ec50s) on the activation of 5-ht3r;(15) the data for the mutants corresponding to functional channels are indicated as circles ; those corresponding to nonfunctional channels (hence with no available ec50), with triangles. homology models of the 5-ht3 receptors where pro308, in the trans (left) and cis (right) configurations, and selected surrounding residues are shown explicitly. pro308 and the adjacent residues thr207 and leu209 are in the m2m3 loop, glu213 is in the f loop, arg245 is at the boundary between the extracellular and the transmembrane domains, and tyr250 is at the start of the m1 helix. this does not, however, mean that the original hypothesis is incorrect. for example, the observed differences could be due to the inaccuracy in the empirical force field, which can not capture subtle electronic effects that can alter quantitatively, rather than qualitatively, the isomer population. the channel environment, which was absent in our calculations, is also likely to play an important role in triggering and catalyzing the isomerization so as to reconcile the observed gating time scale with that inferred from the isomerization barrier. in particular, there could be steric hindrance effects that might prevent isomerization paths allowed in water, such as in the case of 3-me - pro, which does not behave in the dipeptide much differently from proline, but in the experiments produced a nonfunctional channel. in summary, using classical molecular dynamics combined with state - of - the - art metadynamics, we have characterized the free energy surfaces of a series of proline dipeptide analogues as the simplest model of transcis proline switch and deduced information about the relative stability of their trans and cis conformers. although a number of issues, which would benefit from simulations of more complex systems, remain open, the excellent correlation between our calculated free energy difference and those deduced from the experimental ec50s support the idea of a switching role for pro308 for the gating of 5-ht3r. | transcis isomerization of a proline peptide bond is a potential mechanism to open the channel of the 5-ht3 receptor. here, we have used the metadynamics method to theoretically explore such a mechanism. we have determined the free energy surfaces in aqueous solution of a series of dipeptides of proline analogues and evaluated the free energy difference between the cis and trans isomers. these theoretical results were then compared with data from mutagenesis experiments, in which the response of the 5-ht3 receptor was measured when the proline at the apex of the m2-m3 transmembrane domain loop was mutated. the strong correlation between the experimental and the theoretical data supports the existence of a transcis proline switch for opening the 5-ht3 receptor ion channel. |
the incidence of hbv or hcv - associated viral hepatitis is increasing, along with the incidence of hepatocellular carcinoma (hcc). however, advances in diagnostic imaging techniques such as ultrasonography, computed tomography (ct), and magnetic resonance imaging (mri) now enable early detection and diagnosis of hcc. in recent years, hcc detected by these diagnostic imaging techniques has been treated locally by radiofrequency ablation (rfa) and other techniques, with favorable therapeutic outcomes comparable to hepatectomy [3, 4 ]. however, abdominal ultrasonography does not always provide precise guidance in identifying isoechoic tumors, tumors recurring locally in areas treated with lipiodol following transarterial chemoembolization (tace), or tumors recurring in areas treated by rfa or percutaneous ethanol injection (pei) procedures. we have recently utilized the approaches which involved preparing multiplanar reconstruction (mpr) images that matched ultrasonography images of lesions and expected puncture routes on a workstation. mpr images were reconstructed by matching ultrasonography images and ct data (digital imaging and communications in medicine (dicom) data) obtained by prior ct during arterial portography (ctap) and ct during hepatic arteriography (ctha), followed by more accurate coagulation based on scans of target areas while referring to the relative positions of surrounding vessels and organs shown of the images. one problem with this technique is that mpr images are prepared in advance, and critical discrepancies can arise in scans of intercostal spaces due to axial rotation of a probe between the mpr and ultrasound images. seeking to resolve this problem, we investigated the feasibility of hitachi medical real - time virtual sonography (rvs), a system that generates mpr images in real - time, as a probe scans over target areas. among consecutive subjects who admitted to saga medical school with diagnosed hcc from january 2004 to january 2005, candidates for unresectable invasive therapy were eligible for enrollment after informed consent was obtained. diagnosis was confirmed by needle biopsy or by plural imaging techniques including ultrasonography, dynamic ct, dynamic mri, and super paramagnetic iron oxide mri. subjects with up to 3 nodules less than 3 cm in diameter were excluded from this study and received transarterial chemo - embolization. ctap / ctha was performed for all enrolled subjects ; 1) to confirm hcc which showed low density tumor with ctap, high density tumor with early phase ctha, and low density tumor with corona enhancement with delayed phase ctha, 2) to survey multi - centric occurrence of hcc, and 3) to confirm intrahepatic tumor staging. the therapeutic system used comprised the hitachi medico digital ultrasound eub-8500 and hitachi medico workstation rvs (hitachi medico. the rvs, a revolutionary real - time mpr imaging machine that supports ultrasonography diagnosis developed by hitachi medico, consists of a small magnetic sensor attached to a convex - shaped eub-8500 probe. this magnetic sensor precisely and consistently captures changes in magnetic fields generated by the generator placed on the left flank of a patient and detects the changes in the location, direction, and rotation of the probe scanning of the patient. the rvs instantaneously processes changes in positional information detected by the magnetic sensor and generates real - time mpr images matching cross - sectional images of the abdomen captured by the probe (fig. 1). the actual procedure is as follows : 1) ctap / ctha was performed, followed by transfer of volume data (dicom data) to the rvs. ctap data was used because ctap detects portal and hepatic veins, which was captured by ultrasonography. the positional relationship of a tumor to these vessels is critical for identifying lesions which ultrasonography can not detect. 2) a magnetic field generator is placed on the left flank of a patient. 3) the sagittal section of the left hepatic lobe is first captured using a probe equipped with a magnetic sensor. when a ct image with the tip of the xiphoid process captured before mpr processing matches the tip of the xiphoid process on the actual abdominal ultrasound image, the rvs begins continuous generation of mpr images in real - time, displaying the images on the workstation monitor. 4) a cross - sectional image showing the tumor is displayed with the mpr image, and both images are corrected based on neighboring portal and hepatic veins ; and 5) the tumor is then punctured and coagulated under rvs - guidance in the conventional technique. the rfa device used in the methods were cool - tip electrode with a 2- or 3-cm exposed tip and a radiofrequency generator (radionics, burlington, ma). the procedures were each performed by one of three experienced rfa physicians (y.e, t.y, and t.m). abdominal dynamic ct was performed on all patients approximately 3 days and 1 month after the treatment for evaluation after rfa. complete response was confirmed by dynamic ct showed widely low density area with sufficient safety margin. among consecutive subjects who admitted to saga medical school with diagnosed hcc from january 2004 to january 2005, candidates for unresectable invasive therapy were eligible for enrollment after informed consent was obtained. diagnosis was confirmed by needle biopsy or by plural imaging techniques including ultrasonography, dynamic ct, dynamic mri, and super paramagnetic iron oxide mri. subjects with up to 3 nodules less than 3 cm in diameter were excluded from this study and received transarterial chemo - embolization. ctap / ctha was performed for all enrolled subjects ; 1) to confirm hcc which showed low density tumor with ctap, high density tumor with early phase ctha, and low density tumor with corona enhancement with delayed phase ctha, 2) to survey multi - centric occurrence of hcc, and 3) to confirm intrahepatic tumor staging. the therapeutic system used comprised the hitachi medico digital ultrasound eub-8500 and hitachi medico workstation rvs (hitachi medico. the rvs, a revolutionary real - time mpr imaging machine that supports ultrasonography diagnosis developed by hitachi medico, consists of a small magnetic sensor attached to a convex - shaped eub-8500 probe. this magnetic sensor precisely and consistently captures changes in magnetic fields generated by the generator placed on the left flank of a patient and detects the changes in the location, direction, and rotation of the probe scanning of the patient. the rvs instantaneously processes changes in positional information detected by the magnetic sensor and generates real - time mpr images matching cross - sectional images of the abdomen captured by the probe (fig. 1). the actual procedure is as follows : 1) ctap / ctha was performed, followed by transfer of volume data (dicom data) to the rvs. ctap data was used because ctap detects portal and hepatic veins, which was captured by ultrasonography. the positional relationship of a tumor to these vessels is critical for identifying lesions which ultrasonography can not detect. 2) a magnetic field generator is placed on the left flank of a patient. 3) the sagittal section of the left hepatic lobe is first captured using a probe equipped with a magnetic sensor. when a ct image with the tip of the xiphoid process captured before mpr processing matches the tip of the xiphoid process on the actual abdominal ultrasound image, the rvs begins continuous generation of mpr images in real - time, displaying the images on the workstation monitor. 4) a cross - sectional image showing the tumor is displayed with the mpr image, and both images are corrected based on neighboring portal and hepatic veins ; and 5) the tumor is then punctured and coagulated under rvs - guidance in the conventional technique. the rfa device used in the methods were cool - tip electrode with a 2- or 3-cm exposed tip and a radiofrequency generator (radionics, burlington, ma). the procedures were each performed by one of three experienced rfa physicians (y.e, t.y, and t.m). abdominal dynamic ct was performed on all patients approximately 3 days and 1 month after the treatment for evaluation after rfa. complete response was confirmed by dynamic ct showed widely low density area with sufficient safety margin. in this study, 21 patients included seven men and fourteen women were enrolled (fig. 2). twenty five nodules in 21 patients were diagnosed hcc (23 nodules were diagnosed by ctap / ctha, 2 nodules were diagnosed with needle biopsy as well differentiated hcc. rfa was performed using the present system to treat all 25 nodules in 21 patients. of the 25 nodules, 11 nodules were tumors with unclear margins, as seen in representative ultrasonography images shown in fig. 3, 5 were tumors arising in the vicinity of areas coagulated following radiofrequency ablation ; 4 were tumors that could not be fully identified due to their position beneath the diaphragm ; 4 were viable tumors emerging following tace in areas affected by posterior acoustic enhancement of lipiodol deposition ; and 1 was a recurrent tumor located at a resection stump following hepatectomy (table 1). in all cases, conventional ultrasonography failed to detect the entire lesion accurately. in contrast, the current rvs made it possible to accurately and conveniently ascertain the extent of nodules. rfa was performed using the present system to treat all 25 nodules in 21 patients. the average tumor diameter was 2.4 1.6 cm, and punctures and coagulation were performed an average of 2.2 and 3 times per session. dynamic ct for evaluation after rfa showed widely low density area with sufficient safety margin and confirmed that each tumor had been effectively coagulated. hcc is seen in the area with a reduced portal flow in segment 4 (arrow head) on ctap (fig. 4a), the area with high hepatic arterial flow on early - phase ctha (fig. in recent years, hcc has been treated effectively by combining various therapeutic techniques. among these techniques, use of percutaneous rfa in particular has grown, with therapeutic outcomes for hcc of less than 3 cm in diameter comparable to pei therapy or hepatectomy [3, 79 ]. a recent study shown rfa for hcc is a definitive treatment as a bridge to liver transplantation. but in recent years, treatment has increasingly tackled lesions recurring in the vicinity of areas treated by rfa or tace. such recurrent lesions and isoechoic tumors are often difficult to identify by conventional b - mode ultrasonography, and imaging success depends heavily on operator s skill. techniques used to improve the effectiveness of this approach include use of coded - harmonic images and ultrasonographic contrast media ; deliberate injection of pleural or peritoneal fluid to aid imaging ; and ct - guided punctures. we have recently utilized the approaches which involved preparing mpr images that matched ultrasonography images of lesions and expected puncture routes on a workstation. discrepancies can arise between mpr and ultrasound images due to axial rotation of a probe for scans of intercostal spaces. rvs could solve this problem by real - time adjustment based on neighboring portal and hepatic veins, and shapes of the liver bed. while reports have referenced therapeutic systems that generate mpr images like the rvs items are unable to reconstruct accurate and real - time mpr imaging capable of keeping pace with probe - scanning, the current rvs we employed makes it possible to accurately and conveniently ascertain the extent of nodules which were difficult to identify by conventional ultrasonography. rvs also clearly indicates the location of the lungs, intestines, or mesentery, minimizing the risk of inducing pneumothorax, puncturing the intestinal canal, or burning other organs, even when tumors are located beneath the diaphragm or in the liver bed. these qualities make it an extremely effective approach for treating liver tumors, including cases of hcc, which are not readily identifiable by conventional ultrasonography. several previous reports indicated that the hcc nodule, which was not detected by conventional b - mode and was detected only by ctap / ctha, was detected during surgical operation [1719 ]. as indicated in this study, rvs might be one of modalities which recovered defect of conventional b - mode and rvs enabled accurate detection for a target, which supported appropriate therapeutic approach to the hcc nodule. first, rvs requires close synchronization of mpr and ultrasound images, making it essential to obtain ct data on portal and hepatic veins, which makes it necessary to investigate rvs systems in patients in whom dynamic ct or dynamic mri is contraindicated due to issues such as contrast medium allergies or renal dysfunction. second, the synchronized image on rvs is not perfectly the same slice but the discrepancy in most cases can be adjusted with neighboring portal and hepatic veins, and shapes of the liver bed. in one case in this study third, it is difficult to lead accurately rfa needles to nodules in some cases, even when rvs can reveal the position of tumor. because of distortion of the liver, we experienced three nodules those were needed to re - insert for a sufficient puncture. as a result, effective ablations were performed in all cases in this study. in our current study, the outcome obtained from these patients using rvs systems showed favorable clinical course in spite of these limitations in relatively small sample size. further study with control group in larger number, our study demonstrates that the rvs system is capable of effectively and accurately percutaneous coagulation for hcc which is difficult to detect by conventional ultrasonography. | radiofrequency ablation has been applied to treat hepatocellular carcinoma, with favorable therapeutic outcomes. nevertheless, practitioners have approached radiofrequency ablation with some reluctance due to the difficulty of identifying isoechoic tumors and recurrent tumors. the aim of the present study is to investigate the efficacy of real - time virtual sonography to treat hepatocellular carcinoma difficult to detect by conventional ultrasonography. real - time virtual sonography is a system generating multiplanar reconstruction images in real - time using the hitachi medico eub-8500 equipped with a probe. the system included following components : 1) digital imaging and communications in medicine (dicom) data from dynamic ct, 2) a magnetic field generator to match the multiplanar reconstruction image on the monitor and the actual ultrasonography image, 3) the cross section with the tumor displayed as a multiplanar reconstruction image. total twenty - five nodules of twenty - one patients underwent radiofrequency ablation monitored by real - time virtual sonography. all nodules difficult to detect via conventional ultrasonography were clearly visualized in real - time. the average nodule diameter was 2.4 1.6 cm, and punctures and coagulation were performed an average of 2.2 and 3 times per session. dynamic ct after session confirmed effective coagulation of each nodule. in conclusion, this study demonstrates that the present system is capable of effectively and accurately treating tumors difficult to detect by conventional ultrasonography. |
a 49yearold woman suspected of having a right optic neuritis was referred to the neurology department. she had been diagnosed with systemic lupus erythematosus (sle) 10 years earlier, and, at the time of presentation, she was receiving azathioprine 50 mg three times a day, prednisone 5 mg daily, and belimumab 640 milligrams intravenously every 4 weeks. four months earlier, during an ophthalmologist screening test for retinal toxicity, an optic coherence tomography (oct) had shown a reduction in the thickness of the macular and retinal nerve fiber layer in the right eye. she was recommended to stop treatment with hydroxychloroquine, which the patient had been receiving since the initial diagnosis of sle 10 years before (200 mg orally per day). an mri showed a highintensity signal in her right optic nerve at that moment (fig., followup showed an inferior nasal scotoma in her right eye, not present in previous examinations, and she was referred to the neurology department. a perineural contrast enhancement can be seen on the right optic nerve, suggesting inflammation of the nerve sheath. during the first visit to the neurologist, physical examination did not reveal other pathological findings, so ancillary tests (visual evoked potentials and both orbital and cerebral mri) were requested. before the tests could be carried out, the patient developed vertical diplopia on the primary gaze position that was accentuated when looking up. a paralysis of the right eye in upgaze position was found on physical examination then. mri showed signs of inflammation in the right orbit with affected the orbital fat and conditioned a slight proptosis of the eyeball, not visible to the naked eye on physical examination. a mild posterior perineural signal could still be seen in the optic nerve, but also, both the right superior rectus and superior oblique muscles were thickened (fig., we found that these alterations in the muscles were already but subtly present in the first mri, long before the diplopia appeared (fig. visual evoked potentials demonstrated prolonged latencies after visual stimulus, consistent with a moderate demyelinating neuropathy of the right eye. extensive laboratory tests, including blood cell count, renal function, liver function, thyroid function, antiaquaporin4 antibodies, angiotensinconverting enzyme levels, and serologic tests for syphilis, hiv, herpesvirus, and borrelia burgdoferi, were negative or normal. antidsdna levels were 167 ui / ml, and serum complement levels were low, with c3 0.76 g / l and c4 0.07 g / l ; these results were similar to the results of previous blood tests. t2weighted brain and orbital mri. (a) coronal view of the mri performed nine months before the patient developed the symptoms. a slight thickening of the superior rectus, which appears hyperintense compared to the contralateral muscle, is patent, as well as mild infiltration of the surrounding fat. (c) axial cuts of the same mri showing also slight proptosis of the right eye. hydroxychloroquinerelated toxicity was ruled out due to both clinical and radiologic progression after suspension of the treatment. the patient was diagnosed with orbital inflammatory pseudotumor secondary to sle, and highdose corticosteroid therapy was initiated (oral metilpredinsolone one gram daily for 5 days), followed by slowly decreasing doses of prednisone to 10 mg daily. this therapy achieved to improve the symptoms and diplopia resolved, without permanent damage to the visual field. afterward, immunosuppressive treatment with rituximab was started. the patient has remained asymptomatic ever since, and both antidsdna and complement levels have returned to normal values. neuroophthalmic manifestations, however, are less frequent, with a prevalence of 3.6% in adults ; among these, optic neuritis is the most common form of presentation and also one of the most visually compromising complications of sle 1. the implication of orbital structures in sle and, specifically, inflammatory pseudotumor is very rare and therefore may go unnoticed 1, 2, 3. it usually presents with proptosis, pain, and diplopia, due to infiltration of the ocular muscles. although increases in the titers of antidsdna antibodies and decreases in the complement levels may accompany disease relapses, this is not true for all sle patients 4, 5. in our case, although high levels of antidsdna and low levels of c3 and c4 were found, these results were similar to the results of previous blood tests. visual loss due to inflammatory infiltration of the optic nerve is uncommon ; however, it may be a preceding sign, as in this case. 2, 6. response to corticosteroid therapy is excellent in most patients, but sometimes progression of the disease could lead to major damage 2. although sleassociated retinopathy has been associated with elevated levels of antiphospholipid antibodies 2, this does not seem to be the case in inflammatory pseudotumor, and due to its low incidence, no risk factors that could help early diagnosis have been identified. retinopathy and maculopathy are widely known complications of hydroxychloroquine treatment, although inflammatory pseudotumor has never been described in this setting. although visual loss may be irreversible and even worsen after suspending treatment with hydroxychloroquine, this is more likely if high doses of hydroxychloroquine are used for more than 5 years or if there is impaired renal or liver function 7, 8. although our patient had been treated with hydroxychloroquine for 10 years, the daily doses were below 6, 5 mg / kg, which are associated with very low risk of retinopathy. besides, she never presented impaired renal or liver function in successive blood tests. taking all this into account suspecting inflammatory pseudotumor and its relation to the sle is imperative to avoid further complications. in this case, the slow progression of the disorder, probably due to simultaneous immunosuppressive therapy and chronic treatment with low doses of oral corticosteroids, as well as the interference of confounding factors (treatment with hydroxychloroquine) delayed the diagnosis. however, when the patient developed diplopia a review of the previous mri showed that mild signs had been already present months before the symptoms appeared. therefore, after a new finding appears, going back to previous studies may help to put things into perspective. | key clinical messageorbital inflammatory pseudotumor is a rare complication of systemic lupus erythematosus. it may present a challenge for differential diagnosis, especially in the context of treatment with hydroxychloroquine, although dosage and duration of the treatment may guide us. although high antibody titers can be found, this is not specific. |
open surgical repair with graft implantation has been the standard therapy for patients with asymptomatic descending aortic aneurysms larger than 5 - 6.5 cm, while aortic dissections without complications generally have been treated conservatively,. within the last years, new and much less invasive treatment modalities have been developed. in 1991 the first stent graft implantation was reported for a thoracic aortic lesion. since then there has been a major development in graft configuration and some clinical experiences have been published since the first clinical series were published by the stanford group in 1994. we report our midterm results after stent graft repair of descending aortic aneurysms focusing on cerebral and spinal cord ischemia in high risk patients. between february 2000 and july 2003 a total of 21 patients with lesions of the descending thoracic aorta were treated with endovascular stent grafting in general anaesthesia. general inclusion criteria were : adequate vascular access through the iliac arteries and the abdominal aorta, adequate landing zone free of thrombus with minimal calcification, aortic neck diameter 50 mm and significant risk factors (table 1 (tab. stenting was indicated for acute dissection in patients with hypertension which were refractory to medical treatment of pain with clinical signs of malperfusion of the lower limbs. patients in the study underwent preprocedural imaging with spiral computed tomography (ct) using 3-mm slices. in cases of dissection preoperative assessment included visualisation of the false lumen and re - entry sites. within the 40 months period, 21 (17 men, 4 women ; mean age 66.1 years, range 29 - 90 years) patients with aortic pathologies were evaluated at our institution with 15 true aneurysms and 6 type b - dissections (stanford classification). all of the patients with pathologies of the descending aorta were not suitable for open surgery because of their comorbidities and their clinical classification (asa mean : 2.7). a team of two vascular surgeons performed the procedures using a talent stent graft system (world medical, a division of medtronic vascular, sunrise, fl, usa) in all cases with an oversize of 4 - 6 mm. 19 procedures were performed in the operating room (or) under general anaesthesia and endotracheal intubation, 2 in local anaesthesia. patients were placed supine and slightly (20 - 30 degrees) rotated to the right on a fluoroscopic image compatible operating table. intravenous heparin (10,000 iu) was administered as a bolus dose. in all cases we performed a single shot antibiotic prophylaxis by application of a 2 generation cephalosporine. if it was necessary to cover the left subclavian artery, neither a transposition nor a carotid - subclavian bypass the decision whether to reconstruct the left subclavian artery was made after overstenting according to the major clinical aspects. in one case usually the right femoral artery was exposed by cutdown and controlled proximally and distally. nearly in all cases a 0.035 inch terumo guidewire (terumo, frankfurt am main, germany) was inserted over a sheath and positioned in the ascending aorta. this was followed by the introduction of a 6-f pigtail catheter and an angiography (figure 1 (fig. 1)) of the aortic arch and the descending aorta using a high pressure injection - pump with a non - ionic contrast medium (imeron, altana pharma, germany). after marking the aortic arch with its branches as well as the descending aorta and the landing zone on the screen, a stiff guide wire was inserted and the angiography catheter removed. a delivery sheath (22, 24 or 25 f) was introduced with the punction of the common femoral artery. after pharmacologically controlled hypotension was induced (rr 5 cm, or twice the size of an adjacent nonaneurysmal aortic segment seems to be more reasonable. our average procedure time for aneurysms and b - dissections together was 91.3 minutes (range 55 - 145 minutes), and correlates well with data of other groups,,, whereas much longer operating times are described in literature. in our investigation the cumulative 30-day - mortality - rate was 9.5% and correlates well with comparable patient groups,,. however, all deaths of 4 out of 21 patients were not associated with endovascular treatment : two patients died of myocardial infarction and pneumonia within 30 days after stenting. total mortality during follow - up (mean 25.4 months) was 19% (4/21). the 4.8% (1/21) incidence of endoleaks in our study is in the lower range of comparable studies,,,. in the case with a small distal endoleak we waited 3 months for spontaneous sealing, and then performed a second procedure, overstenting the leak successfully. the deployment of endovascular stent grafts in the thoracic aorta may cause devastating neurological complications. in our patients we saw no stroke as described from other groups who explain those complications by severe hypovolaemia in those patients treated emergently or by alterations of the aorta by the guidewire during its passage through the arch and consecutive cerebral embolism. we overstented the left common carotid artery after bypassing the vessel by a carotid - carotid bridge in one case, and occluded the left subclavian artery in 3 out of 21 cases (14.3%) and found a postoperative neurological deficit in 2 patients i.e. 9.5%. in those two patients whose blood pressure had been extremely stable during the operative procedure we found a psychological alteration which we thought had its origin in the occluded left subclavian artery. the brain scintigrams were recorded to verify the supposed steal phenomenon in the patients suffering from a temporary organic brain syndrome. so we decided to perform a transposition in one and a carotid - subclavian bypass in the other patient on the first postoperative day, and both patients were asymptomatic indeed immediately after revascularisation. another dreaded complication, paraplegia, results from spinal cord ischemia secondary to intercostal artery occlusion, and is described in about 7% of the cases,,,. in our patients as described by others we routinely increase the mean blood pressure to about 90 mm hg for 24 hours immediately after exclusion of the aneurysm. a drainage of the cerebrospinal fluid as described in literature was performed in none of our patients because the benefit in respect to paraplegia is not yet definitively proven,,,. patients with acute or chronic type - b - dissection represent a cohort in whom the indication for stent graft treatment is still debated. in our study indications for endovascular treatment of b - dissections were : a progressive dissection, malperfusion of organs, therapy - refractory pain and/or hypertension. in all cases the entry site was closed. in two of our type b dissection patients (33.3%) four months after treatment because of a long dissection in both cases with perfusion of the celiac trunk, the superior mesenteric artery and the left renal artery through the false lumen, we decided not to cover the re - entry site but to treat it conservatively in order to avoid paraplegia after occlusion of some pairs of intercostal arteries, as well as mesenteric ischemia. in the remaining cases the false lumen was obliterated within the first follow up examination period, and the patients did well. in summary our results demonstrate that endovascular treatment of the descending aorta is feasible with acceptable early complication rates and acceptable mean term results even in hight risk patients. procedural overstenting of the subclavian artery requires subclavian revascularisation in the minority of cases. in selected patients endovascular treatment | methods : 21 patients (17 men, 4 women ; mean age 66.1 years, range 29 - 90 years) with 15 true aneurysms, and 6 type b - dissections were treated by implantation of a talenttm endoluminal stentgraft system from february 2000 to july 2003. in 3 cases it was necessary to overstent the left subclavian artery, in 1 case to overstent the left common carotid.results : 2 patients (9.5%) died during the first 30 days (1 myocardial infarction, 1 pneumonia). two patients (9.5%) suffered from cerebral ischemia and needed revascularisation. no paraplegia, no stroke occurred. one endoleak required additional stenting. no patient needed conversion. follow - up, average 25.4 months (range 0 - 39), was 100% complete. during this another two patients died of myocardial infarction i.e. 9.5% (the above mentioned endoleak, but no late migration were detected in the remaining patients). in all cases the graft lumen stayed patent.conclusions : treatment of descending thoracic aortic aneurysm with an endovascular approach has acceptable mortality and morbidity - rates even in high risk patients. procedural overstenting of the subclavian artery requires subclavian revascularisation in a minority of cases. |
many potential kidney transplant recipients are unable to receive a live donor transplant due to cross - match or blood type incompatibility. kidney paired donation (kpd) increases access to live donor transplantation. from its first realization as an exchange of kidneys between two incompatible donor / recipient pairs, kpd has expanded to include compatible pairs, non - directed donors, three - way and larger exchanges, and living / deceased donor exchanges. our center has been exploring kpd as a modality for facilitating living donor (ld) transplantation. in a single - center report (n = 70), we showed acceptable incidences of acute rejection, patient / graft survival rates over 10 years. here, we report our first successful three - way kpd transplantation resulting in transplantation of a highly sensitized patient and hard to match patient with ab donor. all potential donors and recipients were informed about risks and benefits of kpd prior to initiating evaluation. sufficient time was given consider donation preferences, discuss options with their family and the donor evaluation team, and attenuate feelings of pressure or coercion if kpd is presented later. all three pairs of recipients and donors were allowed to meet each other before transplantation. demographic and hla data immunological data 3 days prior to transplantation patient 1 was hard - to - match with broad human leukocyte antigen (hla) sensitization and had positive anti - human globulin - enhanced complement - dependent cytotoxicity cross matches a value of 90% with the donor, her husband. patient 2 was hard - to - match due to ab donor and a recipient blood type combination. patient 3 with b blood group was abo incompatible with his healthy willing donor of a1 blood group. three way kpd was planned of patient 1 with donor 2, patient 2 with donor 3, and patient 3 with donor 1. all donors were subjected to a diethylenetriamine pentaaceticacid renal scan before transplantation and all displayed satisfactory glomerular filtration rate (> 40 ml / min on each side). pre - transplantation and surgical data and outcome all surgeries were carried out on the same day by two transplant teams. all donors had single renal artery and single renal vein on the left side and underwent laparoscopic left donor nephrectomy. immunosuppressive therapy constituted induction with methylprednisolone 500 mg for 3 days + rabbit - anti thymocyte globulin (r - atg) (1.5 mg / kg single dose) along with calcineurin inhibitor based triple immunosuppression for maintenance therapy. cold ischemia time was 2 h 30 s, 32 min and 44 min respectively for patient 1, 2 and 3. none of the patients had rejection and all had stable graft function on discharge and at 1month after transplantation. demographic and hla data immunological data 3 days prior to transplantation patient 1 was hard - to - match with broad human leukocyte antigen (hla) sensitization and had positive anti - human globulin - enhanced complement - dependent cytotoxicity cross matches a value of 90% with the donor, her husband. patient 2 was hard - to - match due to ab donor and a recipient blood type combination. patient 3 with b blood group was abo incompatible with his healthy willing donor of a1 blood group. three way kpd was planned of patient 1 with donor 2, patient 2 with donor 3, and patient 3 with donor 1. all donors were subjected to a diethylenetriamine pentaaceticacid renal scan before transplantation and all displayed satisfactory glomerular filtration rate (> 40 ml / min on each side). all donors had single renal artery and single renal vein on the left side and underwent laparoscopic left donor nephrectomy. immunosuppressive therapy constituted induction with methylprednisolone 500 mg for 3 days + rabbit - anti thymocyte globulin (r - atg) (1.5 mg / kg single dose) along with calcineurin inhibitor based triple immunosuppression for maintenance therapy. cold ischemia time was 2 h 30 s, 32 min and 44 min respectively for patient 1, 2 and 3. none of the patients had rejection and all had stable graft function on discharge and at 1month after transplantation. live donation offers superior outcomes and is the most readily expandable source of kidneys for transplantation. abo incompatibility and kpd is feasible, successful, and if applied to larger donor pools, capable of expanding access to renal transplantation. we have earlier shown similar graft and patient survival and rejection rates of kpd versus living related donor kidney transplantation lrdktx over 2 years. three - way kpds were first reported in the usa in 2005. simulations demonstrated that the match rates in kpd pools could be significantly improved by using the algorithms that allowed three - way donations. this is because it is generally accepted that the donor operations should all be started simultaneously to reduce the chance that one of the transplants do esnotprogress (e.g. donor reneging). lack of awareness ; counseling and participation in kpd may significantly disadvantage patients within compatible donors. broader implementation of kpd across a wide number of centers has the potential to lead to more than 1000 additional live donor renal transplants every year. it is cost effective, feasible, and crucial to properly serve transplant candidates with healthy but in compatible ld. recent study results are valuable for encouraging participation of kpd pairs and transplant centers in national kpd program. in developing countries such as india, the costs of antibody removal protocols, and risk of infections in abo incompatible renal transplantation make kpd program attractive. future research should identify factors influencing donor and recipient willingness and preferences for entering kpd as compatible pairs and identify the perceived barriers to kpd participation among potential donors and recipients, and evaluate strategies for removing these barriers. transplant centers should work together towards national kpd program and frame a uniform acceptable allocation policy. three - way kpd is a valuable source of kidneys for renal transplantation. encouraging the use of this approach to expand the donor pool would be important specially in low - income countries where deceased donor program is in infantile stage and transplantation with desensitization protocol and abo incompatible transplantation are prohibitive due to economic constrains, risk of infections and lack of availability in all transplant centers. | providing transplantation opportunities for patients with incompatible live donors through kidney paired donation (kpd) is an important strategy for easing the crisis in organ availability. kpd is can overcome the barriers when the only living potential donors are deemed unsuitable owing to an incompatibility of blood type, of human leukocyte antigen cross - match, or both. in kpd, the incompatibility problems with two donor recipient pairs can be solved by exchanging donors. in the absence of well - organized deceased donor program, or transplantation with desensitization protocol and abo incompatible transplantation, living donor kpd promises hope to the growing number of patients suffering from end - stage renal disease in india. we report our first successful three - way kpd transplantation from india. in an era of organ shortage, this approach is relevant to encourage wider participation from kpd donors and transplant centers to prevent commercial transplantation. |
many simple rhythmic behaviors are controlled by specialized central pattern generator (cpg) networks in the spinal cord or brainstem with intrinsic oscillatory characteristics (grillner, 2006 ; kiehn, 2006). however, goal - directed upper - limb movements under cortical control can also exhibit rhythmicity. when tracking a moving target, trajectories are composed of multiple submovements (craik, 1947) at a frequency (usually one to four per second) that is largely independent of movement speed (miall., 1986 ; roitman., 2004 ; pasalar., 2005 ; selen., 2006). an oscillation at around 3 hz has also been reported in the kinematics of finger - tracking movements (mcauley., 1999). the motor cortical electroencephalogram (eeg) is phase locked to submovements (dipietro., 2011), and coherence spectra between the magnetoencephalogram (meg) and movement speed show peaks around 3 hz during visuomotor tracking (jerbi., 2007). brain - machine interface (bmi) studies have found low - frequency bands to be particularly informative for decoding direction from local field potentials (lfps ; rickert. 2011), megs (waldert., 2008), and eegs (waldert., 2008 ; bradberry., it has been argued that submovements reflect intermittent corrections driven by visual feedback of errors (craik, 1947 ; miall., 1986, 1993) and that their frequency should therefore be determined by extrinsic factors such as feedback loop delays. in support of this submovements are locked to eye movements (mcauley., 1999) and often disappear in the absence of vision (miall., 1993 ; mcauley., 1999 ; but see doeringer and hogan, 1998), whereas the introduction of artificial feedback delays alters their frequency (miall., 1986 ; miall and jackson, 2006). nevertheless, submovements are not restricted to tracking tasks, and a natural rhythmicity is observed across diverse upper - limb behaviors (kunesch., 1989) including self - paced isometric drawing (massey., 1992) and finger tapping (schner and kelso, 1988). moreover, low - frequency cortical oscillations have long been associated with slow - wave sleep, when large k complex potentials signifying transitions from down to up states of the cortex (colrain, 2005 ; cash., 2009) are accompanied by bursts of activity in the delta (14 hz)-frequency range (amzica and steriade, 1997). at least two mechanisms contribute to these delta oscillations : intrinsic currents that cause bursting patterns in thalamic relay cells (amzica., 1992 ; destexhe and sejnowski, 2003) and a second, purely cortical circuit (amzica and steriade, 1998 ; carracedo., therefore, it remains possible that oscillatory properties of cortical (and perhaps thalamic) circuits contribute to low - frequency rhythms in movement, functioning much like a cpg. recently, this intrinsic hypothesis has been proposed to explain the complex, multiphasic profiles of motor cortical firing rates observed during reaching (churchland., 2012 ; shenoy., the high - dimensional neural state was projected onto a plane revealing low - frequency cycles, even though movements in this case were not overtly rhythmic. it was proposed that this dynamical structure reflects an engine of movement (churchland., 2012), and could be reproduced by a recurrent neural network model trained to generate muscle patterns given static initial inputs and no sensory feedback (shenoy., 2013). the intrinsic hypothesis suggests that low - frequency cortical dynamics may be preserved across different movements and resemble spontaneous delta oscillations during sleep. therefore, we compared motor cortex activity in monkeys during an isometric movement task, while retrieving food from a klver board, during natural sleep, and under ketamine sedation. we found clear evidence for a common lfp correlation structure that could be explained by a single model of 3 hz oscillatory dynamics underlying all behavioral states. our results thereby unify two previously unrelated phenomena : low - frequency structure in movement kinematics and low - frequency oscillations during slow - wave sleep, providing a new insight into how the dynamics of cortical networks influence complex upper - limb behaviors. three monkeys controlled the 2d position of a cursor with isometric wrist torque to acquire targets in a center - out fashion (figure 1a). similar to isometric trajectories in humans (massey., 1992), the movements made by the monkeys were often composed of multiple, regular submovements. the representative single trial shown in figure 1b shows five submovements between the go cue and successful acquisition of the target, appearing as peaks in the radial speed of the cursor. the distribution of intersubmovement intervals (figure 2a), as well as their autocorrelation structure (figure 2b), revealed a tendency for submovements to occur rhythmically at a frequency of around 3 hz in all three animals. movement intermittency was also evident in the electromyogram (emg) from wrist muscles involved in the task, with a peak in coherence between radial position and rectified emg at 3 hz (figure 2c). lfps from multiple electrodes in primary motor cortex (m1) were low - pass filtered and mean referenced, revealing slow oscillations with a phase that varied across electrodes (figure 1c). principal component analysis (pca) reduced the lfp to two principal components (lfp - pcs ; figure 1d) capturing orthogonal projections of the dominant oscillatory mode. there was a striking correlation between lfp - pcs and submovements, evident even in single trials (figure 1d, bottom). coherence analysis over the whole session confirmed strong correlation between lfp - pcs and cursor speed at the 3 hz frequency of submovements (figure 2d). the relationship between lfp oscillations and submovements was visualized by projecting the lfp trajectory over time onto the pc plane (movie s1 available online). due to the 90 phase difference between components, this trajectory was cyclic with constant direction of rotation. each submovement was associated with a single lfp cycle, and the peak cursor speed occurred at a similar phase within each cycle (figure 2e). to examine how lfp - pc trajectories were related to submovement kinematics, we binned submovements into nine equal groups according to peak cursor speed. average lfp - pc trajectories for each group (figures 2f and 2i ; movie s2) had constant direction and frequency of rotation (figures 2 g and 2j) but an areal velocity (area swept out per unit time about the origin ; see equation 2 in experimental procedures) that increased with cursor speed (figures 2h and 2k). when binned according to the direction of submovements, average lfp trajectories in the pc plane appeared similar (figure 2l). however, plotting the trajectories in 3d pc space revealed a subtle variation in the axis of rotation for different submovement directions (figure 2 m ; movie s3). in three dimensions, we hypothesized that its magnitude should encode information about submovement speed, whereas its orientation might be informative of submovement direction. we tested this directly by decoding speed (or direction) from the magnitude (or orientation) of areal velocity vectors associated with individual submovements (see experimental procedures). decoding performance for 13 data sets across three monkeys is summarized in table s1, using a coefficient of determination (cod) between zero (chance decoding) and one (perfect decoding). in every case, we obtained significant decoding of the speed from areal velocity magnitude, with mean (sd) cod = 0.30 0.13. decoding submovement direction from areal velocity orientation was significant in 12/13 sessions, with mean cod = 0.15 0.07. as might be expected, direction decoding was better for faster submovements (figure 2n), with a cod of 0.26 0.17 for the fastest submovements. although statistically significant, this nevertheless corresponds to an average decoding error of approximately 75, only slightly better than chance (90 average decoding error). in summary, the rhythmic structure of submovements is reflected in low - frequency m1 lfps and can be revealed using pca to reduce the dimensionality of the multichannel data. in the space defined by the first three pcs, each submovement is associated with a cyclic lfp trajectory, and the peak of the submovement occurs at a consistent phase of the cycle. the areal velocity of the trajectory is proportional to the speed of the submovement, whereas the axis of rotation provides statistically significant (albeit modest) information about the direction of movement. on separate days, we recorded from the same electrodes during ketamine sedation (figure 3a). m1 lfps exhibited typical signatures of slow - wave sleep including spindles and large k complex potentials, thought to reflect transitions between cortical down and up states. consistent with this, most neurons had low firing rates prior to each k complex, and fired particularly strongly during its rising phase and peak. each k complex was associated with large - amplitude delta activity in the low - pass - filtered, mean - subtracted lfp, comprising either a single cycle or an extended burst of two or more cycles of low - frequency oscillation. figure 4 compares cortical activity aligned to the peak speed of submovements (during task performance) and aligned to the peak of k complexes (under ketamine sedation). both events were associated with phasic bursts of neural activity (figure 4b) and phase - locked low - frequency lfp oscillations in m1 (figure 4c), which were an order of magnitude larger in the sedated state. note that the same color scheme is used throughout figures 1 and 4c to represent the lfp phase relative to submovements during task performance but each electrode shows a similar phase relative to the k complex under sedation. as a result, average lfp - pc trajectories followed similar rotational cycles aligned to both submovements and k complexes (figure 4d). we calculated the circular - circular correlation coefficient (cc) across electrodes of phase relative to submovements (during task performance) against phase relative to k complexes (under sedation). for the sample pair of movement and sedation sessions shown in figure 4c, these phases were highly correlated (n = 10, cc = 0.81, p = 0.025 ; figure 4e), and across all the data sets this correlation was significant (p 0, this system exhibits stable periodic solutions. we regressed the time derivative, x, against 2d lfp - pcs, x, to find the three free parameters of a (the fourth is fixed by the trace constraint). because the lfp - pcs during the isometric task are orthogonal however, we did not impose this constraint during model fitting, because it will not necessarily hold when data from other conditions are projected onto the same pc axes. we measured the quality of fit to the lfp - pc derivative x(t) in each case with a vector coefficient of determination defined by(10)cod=1|x(t)x(t)|2dt|x(t)|2dt, where integration was performed over the entire recording. the same analysis was applied separately to lfp data that had been filtered into delta- (05 hz) and beta- (1030 hz) frequency bands using four - pole, zero - phase digital butterworth filters before mean referencing and pca. m1 and pmv lfps were averaged from 200 ms before to 200 ms after each spike. the lfp averages were then projected onto the pc axes determined from the isometric task data and normalized by the standard deviation of the firing rate. to allow comparison across different data sets, the m1 lfp - pc plane was rotated such that the average submovement - triggered trajectory had zero phase at the moment of peak cursor speed, and the phase of the spike firing was measured relative to this. significant phase locking across the population of neurons was assessed using the rayleigh test for circular uniformity in the circstat toolbox. | summaryupper - limb movements are often composed of regular submovements, and neural correlates of submovement frequencies between 1 and 4 hz have been found in the motor cortex. the temporal profile of movements is usually assumed to be determined by extrinsic factors such as limb biomechanics and feedback delays, but another possibility is that an intrinsic rhythmicity contributes to low frequencies in behavior. we used multielectrode recordings in monkeys performing an isometric movement task to reveal cyclic activity in primary motor cortex locked to submovements, and a distinct oscillation in premotor cortex. during ketamine sedation and natural sleep, cortical activity traversed similar cycles and became synchronized across areas. because the same cortical dynamics are coupled to submovements and also observed in the absence of behavior, we conclude that the motor networks controlling the upper limb exhibit an intrinsic periodicity at submovement frequencies that is reflected in the speed profile of movements. |
re - methylation of homocysteine (hcy) to methionine constitutes one of the most important reactions catalysed in one - carbon metabolism. there are numerous factors that influence hcy level including age, gender, cigarette smoking, alcohol consumption, various medications and polymorphisms in genes encoding enzymes acting in one - carbon metabolism (nygard. 1995 ; de bree. 2001 ; dierkes. 2007). two single nucleotide polymorphisms (c677 t and a1298c) in the methylenetetrahydrofolate (mthfr) gene are also important genetic predictors of hcy level (ulrich. accumulating evidence indicates that hcy level is also increased in schizophrenia patients (misiak. inconsistent results indicate that elevated hcy level occurs in first - episode schizophrenia (fes) patients. it has also been found that a 5-mol / l increase of plasma hcy may increase the risk of schizophrenia by 70 % (muntjewerff. additionally, hcy level may positively correlate with duration of untreated psychosis (dup) (ayesa - arriola. 2012), the severity of negative symptoms (goff. 2004 ; petronijevic. 2008 ; bouaziz. 2010) and cognitive deficits (levine. 2006). some authors suggest that mainly young schizophrenia males demonstrate elevated hcy levels (levine. (2013), it was found that siblings of schizophrenia patients are also characterized by elevated hcy level. these findings are in line with previous studies showing the association between polymorphisms in the mthfr gene and schizophrenia (muntjewerff. polymorphisms in the mthfr gene might also predict the development of metabolic side effects associated with second - generation antipsychotics (misiak. in addition, extensive evidence indicates that the prevalence of lipid and glucose metabolism disturbances is significantly higher in first - episode and drug - nave schizophrenia patients in comparison with healthy controls (chen. ; spelman. 2007 ; ryan. 2003 ; mcevoy. 2013). these findings point to the hypothesis that schizophrenia is in itself associated with metabolic deregulation. a number of environmental factors including alcohol consumption, cigarette smoking and various medications may influence one - carbon metabolism (nygard. there are also studies showing low folate level due to cannabis abuse in pregnant women (knight. 1978). however, the influence of cannabis on plasma levels of hcy, vitamin b12 and folate has not been investigated so far. cannabis abuse is increasingly recognized as a risk factor for the development of psychotic disorders including those from schizophrenia spectrum [for review see (casadio. 2011) ]. in the register - based study of 18,478 finnish inpatients with first hospitalization due to cannabis - induced psychosis, the 8-year cumulative risk of schizophrenia spectrum diagnosis was estimated at 46 % (niemi - pynttari. 2013). for instance, the longitudinal study of 45,570 swedish conscripts revealed that 31 % of cannabis users, who later developed schizophrenia, stopped using cannabis before the day of conscription (zammit. it has been shown that hcy administered in high concentration is an agonist at the glutamate binding site and a partial antagonist at the glycine co - agonist site in nmda receptors (lipton. these findings may be in line with studies showing that hypofunction of glutamatergic transmission acts in the pathophysiology of schizophrenia (coyle. (wang. 2012 ; fujiki. 2012), trigger mitochondrial dysfunction (kumar. 2011) and promote oxidative stress (dietrich - muszalska. 2012). although there is considerable interest in one - carbon metabolism alterations in schizophrenia, some questions still remain. there is a scarcity of studies on first - episode and/or drug - nave schizophrenia patients (garcia - bueno. therefore, it is still unresolved as to whether increased hcy level is associated with schizophrenia or occurs due to antipsychotic treatment. furthermore, given the limited efficacy of folate supplementation in the treatment of negative symptoms (hill. 2013b), it seems that searching for clinical variables associated with hcy level alterations, which may predict the outcome of supplementation strategies, is warranted. the aim of this study was to bridge the gaps in studies on one - carbon metabolism in schizophrenia and explore whether family history of schizophrenia and cannabis abuse influence plasma levels of hcy, vitamin b12 and folate in fes patients. we recruited 56 fes inpatients and 53 healthy controls (hc) with negative family history of schizophrenia or other psychotic disorders. both groups were matched for age, gender, body mass index (bmi) and ethnicity (all participants were caucasians). exclusion criteria were : mental retardation and/or general brain disorder, supplementation of folic acid or vitamins b, positive urine screening for illicit drugs (cannabis, amphetamine, opiates and ecstasy), drug and/or alcohol abuse / dependence during 1 year prior to the onset of psychotic symptoms, severe somatic comorbidities, the use of statins, fibrates, anti - hypertensive drugs or anti - diabetic medications and inability to give informed consent. a diagnosis of schizophrenia was based on dsm - iv and icd-10 criteria and confirmed using the operational criteria for psychotic illness (opcrit) checklist. opcrit constitutes a modern diagnostic tool creating a multidimensional insight into the course and psychopathology of psychotic disorders (mcguffin. furthermore, opcrit has high reliability determined using a kappa statistic in several classification systems e.g. kappa for icd-10 and dsm - iii - r has been estimated at 0.70 and 0.73 respectively (williams. we included the patients, who met dsm - iv and icd-10 criteria for lifetime diagnosis of cannabis abuse, but who reported cannabis cessation at least 1 year before the onset of schizophrenia. in addition, psychopathology was examined by using the positive and negative syndrome scale (panss) (kay. dup was defined as the time from appearance of the first prodromal symptoms to initiation of antipsychotic treatment. assessment of psychopathology and diagnosing processes were based on structured interviews with the patients and on medical records. clinical assessment with opcrit checklist and panss was performed by a trained and experienced clinician (b.m.). cigarette smoking was evaluated using pack - year index and the fagerstrm test (pomerleau. 1989). notably, opcrit was completed for the lifetime course of the disorder and evaluation of psychopathology with panss was performed on the day of recruitment. patients had a minimal dose of second - generation antipsychotics (olanzapine in 21 patients, risperidone in 21 patients and amisulpride in 2 patients) on the day of assessment and there were 12 drug - nave patients. average treatment duration was 5.10 4.45 days, while the average chlorpromazine equivalent was 150 137.8 mg per day on the day of recruitment. blood samples were obtained between 7.30 and 8.30 a.m. after at least 10-h overnight fasting from the antecubital vein. plasma glucose, lipoproteins, vitamin b12, folate and total cholesterol (tc) were determined using a cobas 6000 analyzer (roche, switzerland). in addition, enzymatic assays of esterase and cholesterol oxidase were used to measure tc level. high - density lipoprotein (hdl) level was measured using polyethylene glycol - modified enzymes. similarly, enzymatic methods with phosphoglycerol oxidase and peroxidase were used to measure plasma triglycerides. plasma low - density lipoproteins (ldl) were calculated using the friedewald equation (friedewald. 1972) : ldl (mg / dl) = tc (hdl + tg/5). plasma hcy level was measured using a chemiluminescence method in an immulite 2000 analyzer (siemens, germany). weight and height were determined using a balance beam scale with stadiometer, which was located on a firm and horizontal surface. body mass index (bmi) was calculated by dividing body mass in kilograms by the square of the height in meters (kg / m). demographic and clinical data between fes patients and hc, between patients with positive and negative history of schizophrenia, as well as between patients with and without lifetime diagnosis of cannabis abuse were compared using the mann whitney u - test (age, dup, bmi, biochemical parameters, pack - year index, fagerstrm test score, treatment duration, chlopromazine equivalent, panss subscales) and test (gender, the number of cigarette smokers). correlations between biochemical parameters and illness duration, age of onset of cannabis use, pack - year index and fagerstrm test score were assessed using the spearman s rank correlation coefficient. partial bonferroni correction (gong. 2000), which takes into account correlations between studied variables, was applied to the level of significance due to multiple comparisons of several metabolic parameters that are not independent. multivariable linear regression model was performed to determine the independent predictors of hcy level in fes patients. the model included : age, gender, bmi, pack - year index, cpz equivalent, treatment duration, as well as plasma levels of folate, vitamin b12, ldl, hdl, tg and tc. all analyses were performed using the statistical package for social sciences (spss) version 20. we recruited 56 fes inpatients and 53 healthy controls (hc) with negative family history of schizophrenia or other psychotic disorders. both groups were matched for age, gender, body mass index (bmi) and ethnicity (all participants were caucasians). exclusion criteria were : mental retardation and/or general brain disorder, supplementation of folic acid or vitamins b, positive urine screening for illicit drugs (cannabis, amphetamine, opiates and ecstasy), drug and/or alcohol abuse / dependence during 1 year prior to the onset of psychotic symptoms, severe somatic comorbidities, the use of statins, fibrates, anti - hypertensive drugs or anti - diabetic medications and inability to give informed consent. a diagnosis of schizophrenia was based on dsm - iv and icd-10 criteria and confirmed using the operational criteria for psychotic illness (opcrit) checklist. opcrit constitutes a modern diagnostic tool creating a multidimensional insight into the course and psychopathology of psychotic disorders (mcguffin. furthermore, opcrit has high reliability determined using a kappa statistic in several classification systems e.g. kappa for icd-10 and dsm - iii - r has been estimated at 0.70 and 0.73 respectively (williams. we included the patients, who met dsm - iv and icd-10 criteria for lifetime diagnosis of cannabis abuse, but who reported cannabis cessation at least 1 year before the onset of schizophrenia. in addition, psychopathology was examined by using the positive and negative syndrome scale (panss) (kay. dup was defined as the time from appearance of the first prodromal symptoms to initiation of antipsychotic treatment. assessment of psychopathology and diagnosing processes were based on structured interviews with the patients and on medical records. clinical assessment with opcrit checklist and panss was performed by a trained and experienced clinician (b.m.). cigarette smoking was evaluated using pack - year index and the fagerstrm test (pomerleau. 1989). notably, opcrit was completed for the lifetime course of the disorder and evaluation of psychopathology with panss was performed on the day of recruitment. patients had a minimal dose of second - generation antipsychotics (olanzapine in 21 patients, risperidone in 21 patients and amisulpride in 2 patients) on the day of assessment and there were 12 drug - nave patients. average treatment duration was 5.10 4.45 days, while the average chlorpromazine equivalent was 150 137.8 mg per day on the day of recruitment. blood samples were obtained between 7.30 and 8.30 a.m. after at least 10-h overnight fasting from the antecubital vein. plasma glucose, lipoproteins, vitamin b12, folate and total cholesterol (tc) were determined using a cobas 6000 analyzer (roche, switzerland). in addition, enzymatic assays of esterase and cholesterol oxidase were used to measure tc level. high - density lipoprotein (hdl) level was measured using polyethylene glycol - modified enzymes. similarly, enzymatic methods with phosphoglycerol oxidase and peroxidase were used to measure plasma triglycerides. plasma low - density lipoproteins (ldl) were calculated using the friedewald equation (friedewald. 1972) : ldl (mg / dl) = tc (hdl + tg/5). plasma hcy level was measured using a chemiluminescence method in an immulite 2000 analyzer (siemens, germany). weight and height were determined using a balance beam scale with stadiometer, which was located on a firm and horizontal surface. body mass index (bmi) was calculated by dividing body mass in kilograms by the square of the height in meters (kg / m). demographic and clinical data between fes patients and hc, between patients with positive and negative history of schizophrenia, as well as between patients with and without lifetime diagnosis of cannabis abuse were compared using the mann whitney u - test (age, dup, bmi, biochemical parameters, pack - year index, fagerstrm test score, treatment duration, chlopromazine equivalent, panss subscales) and test (gender, the number of cigarette smokers). differences were considered as statistically significant if the p value was 0.05)fes patientshcpack - year indexfagerstrm scorechlorpromazine equivalenttreatment durationpack - year indexfagerstrm scoreglucose r = 0.070 r = 0.078 r = 0.058 r = 0.048 r = 0.025 r = 0.023ldl r = 0.195 r = 0.145 r = 0.122 r = 0.034 r = 0.243 r = 0.237hdl r = 0.090 r = 0.101 r = 0.143 r = 0.100 r = 0.007 r = 0.010tc r = 0.180 r = 0.125 r = 0.023 r = 0.094 r = 0.184 r = 0.186tg r = 0.004 r = 0.016 r = 0.045 r = 0.164 r = 0.094 r = 0.105hcy r = 0.058 r = 0.062 r = 0.049 r = 0.136 r = 0.037 r = 0.040folate r = 0.134 r = 0.168 r = 0.045 r = 0.099 r = 0.065 r = 0.073vitamin b12 r = 0.006 r = 0.028 r = 0.064 r = 0.189 r = 0.083 r = 0.062 abbreviations : bmi body mass index, fes first - episode schizophrenia, hc healthy controls, hcy homocysteine, hdl high density lipoproteins, hyperhcy hyperhomocysteinemia, ldl low density lipoproteins, tc total cholesterol, tg triglycerides the comparison of first - episode schizophrenia patients and healthy controls abbreviations : bmi body mass index, fes first - episode schizophrenia, hc healthy controls, hcy homocysteine, hdl high density lipoproteins, ldl low density lipoproteins, tc total cholesterol, tg triglycerides p - value refers to the comparison of mean - ranks using the mann significant differences (p 0.05) abbreviations : bmi body mass index, fes first - episode schizophrenia, hc healthy controls, hcy homocysteine, hdl high density lipoproteins, hyperhcy hyperhomocysteinemia, ldl low density lipoproteins, tc total cholesterol, tg triglycerides table 3 presents a comparison of fes patients with and without positive family history of schizophrenia. patients with a positive family history of schizophrenia in first and/or second degree relatives had significantly higher mean levels of hcy in comparison with those with a negative family history of schizophrenia (13.40 6.35 mol / l vs. 9.86 2.74 mol / l, p = 0.017). in addition, mean plasma levels of hdl and vitamin b12 were significantly lower in fes subjects (p = 0.041 and p = 0.017, respectively), who had first and/or second degree relatives with schizophrenia (49.04 15.60 mg / dl and 350.24 142.98 pg / ml, respectively) in comparison with those, who did not have (58.10 16.28 mg / dl and 521.64 273.45 pg / ml, respectively). there were no between group differences with respect to family history of schizophrenia in age, gender, bmi, psychopathological manifestation assessed by panss, the fagerstrm test score and pack - year index.table 3the comparison of first - episode schizophrenia patients with respect to family history of schizophreniapatients with positive family history of schizophrenia (n = 16)patients with negative family history of schizophrenia (n = 40) p - value age (years)26.07 6.6830.00 8.230.102gender (males / females)7/923/170.388bmi (kg / m)24.16 3.9522.29 3.660.091glucose (mg / dl)86.10 9.3984.76 9.770.599ldl (mg / dl)94.85 32.4388.93 30.760.479hdl (mg / dl)49.04 15.6058.10 16.28 0.041 tc (mg / dl)168.43 39.21167.69 34.560.913tg (mg / dl)116.23 62.25103.75 59.690.272hcy (mol / l)13.40 6.359.86 2.74 0.017 folate (ng / ml)6.17 2.896.68 2.810.425vitamin b12 (pg / ml)350.24 142.98521.64 273.45 0.017 the number of cigarette smokers5160.761pack - year index1.93 3.112.46 4.870.746fagerstrm test2.00 2.761.68 2.930.678panss positive symptoms score23.50 3.2923.47 5.970.793panss negative symptoms score18.00 psychopathology score41.00 6.7843.22 8.050.342 abbreviations : bmi body mass index, hcy homocysteine, hdl high density lipoproteins, ldl low density lipoproteins, panss the positive and negative syndrome scale, tc total cholesterol, tg triglycerides p - value refers to the comparison of mean - ranks using the mann there was no significant difference after application of partial bonferroni correction (p > 0.0055) the comparison of first - episode schizophrenia patients with respect to family history of schizophrenia abbreviations : bmi body mass index, hcy homocysteine, hdl high density lipoproteins, ldl low density lipoproteins, panss the positive and negative syndrome scale, tc total cholesterol, tg triglycerides p - value refers to the comparison of mean - ranks using the mann whitney u - test. there was no significant difference after application of partial bonferroni correction (p > 0.0055) we divided fes patients into two subgroups those with a lifetime diagnosis of cannabis abuse and those, who had never abused cannabis. patients with a lifetime diagnosis of cannabis abuse had significantly lower mean levels of plasma hdl (45.83 18.56 mg / dl vs. 55.10 18.56, p = 0.041) and vitamin b12 (382.48 134.25 pg / ml vs. 409.25 235.44, p = 0.017) in comparison with those, who had not abused cannabis (table 4). on the other hand, lifetime diagnosis of cannabis abuse was associated with significantly higher mean level of plasma hcy (14.85 7.35 mol / l vs. 10.91 3.99 mol / l, p = 0.017). however, age at onset of cannabis use was not associated with alterations in plasma hcy, folate and vitamin b12 (table 5). notably, lifetime diagnosis of cannabis abuse was not associated with bmi, psychopathological manifestation assessed by panss and the indices of cigarette smoking. however, there were significantly more males among fes patients with a lifetime diagnosis of cannabis abuse in comparison with the group of patients, who had never abused cannabis (90.47 vs. 31.42 %, p 400 mg) might be associated with lower levels of plasma folate, but not hcy or vitamin b12. in conclusion, it should be noted that metabolic alterations seem to be more common in fes patients. it is most likely that schizophrenia is in itself linked to metabolic disturbances that have strong genetic underpinnings. alterations in one - carbon metabolism seem to be associated with fes psychopathology. an important but preliminary finding from our study, is the long - term deleterious effect of cannabis use on metabolic profile. the influence of various clinical factors on the severity of one - carbon metabolism dysfunction warrant the need of a personalized medicine approach in the treatment of psychopathological symptoms of schizophrenia and comorbid early deleterious alterations in metabolic profile. the majority of studies focus on the fact that antipsychotic treatment increases the risk of metabolic disturbances in the course of schizophrenia ; however, it should be stressed that there are also metabolic alterations that occur prior to the onset of psychosis and that are more common among patients having relatives with schizophrenia. such observations should lead to further research projects looking more closely into bidirectional relationships between biochemical metabolic markers and schizophrenia. | accumulating evidence indicates that elevated homocysteine (hcy) level occurs in first - episode schizophrenia (fes) patients. we included 56 fes patients and 53 healthy controls (hc). plasma level of hcy was significantly higher in fes patients than hc (p = 0.044). in addition, plasma levels of high - density lipoproteins (hdl) and folate were significantly lower in fes than in hc (p < 0.001). positive family history of schizophrenia was associated with lower plasma hdl (p = 0.041) and vitamin b12 (p = 0.017), as well as higher level of hcy (p = 0.017). patients with fes, who abused cannabis, had higher levels of hcy (p = 0.017), as well as lower levels of vitamin b12 (p = 0.017) and hdl (p = 0.041). plasma hcy negatively correlated with duration of untreated psychosis (r = 0.272, p = 0.042). there was a positive correlation between hcy level and the severity of negative symptoms (r = 0.363, p = 0.006) and general psychopathology (r = 0.349, p = 0.008) assessed using positive and negative syndrome scale (panss). vitamin b12 level was negatively associated with the severity of negative symptoms (r = 0.406, p = 0.002), while folate level negatively correlated with general psychopathology score (r = 0.365, p = 0.006) in panss. these results indicate that the severity of one - carbon metabolism alterations and hdl deficiency might be associated with family history of schizophrenia and cannabis abuse. lower vitamin b12 and folate along with elevated hcy may influence the severity of fes psychopathology. |
square turning is frequently used for corners, and semicircular turning is often used to avoid obstacles during activities of daily living1. balance is challenged during turning gaits, and this is one of the most common reasons for falls by older adults1, 2. many older adults have decreased postural stability and have considerable visual through, for example, cataracts, glaucoma, or macular degeneration, the leading cause of visual impairment3. vision plays a key role in stabilizing balance in a number of ways. visual cues before and during gait help us determine our speed of locomotion, and vision also allows us to influence the alignment of the body with reference to gravity and the environment during walking. previous biomechanical studies have indicated that head stabilization and motion coordination between the head and trunk enhance postural control to balance the moving body and visual acuity for navigational control through a cluttered environment4, 5. however, few studies have investigated the effects of gait velocity and com during square and semicircular turning gaits of older people with pbva. therefore, the purpose of this study was to investigate gait velocity and center of mass (com) during square and semicircular turning gaits of elderly women with good and poor visual acuity. a total of 20 elderly women who could walk independently were recruited from among community dwellers. visual acuity was measured with hahn s vision test chart (kor). the participants binocular visual acuity (bva) was evaluated separately with and without participants own spectacles before they performed the tasks. the participants were categorized into two groups : those with poor vision (pbva ; corrected bva 0.5) and those with good vision (gbva ; corrected bva 0.7). the pbva group consisted of subjects aged 75.00 (mean) 6.14 (standard deviation) years, with average height and weight of 149.26 4.68 cm and 50.06 5.85 kg, respectively, and left side va and right side va of 0.34 0.11 and 0.31 0.17, respectively. the gbva group consisted of subjects aged 77.45 6.15 years, with average height and weight of 149.43 3.89 cm and 50.42 6.24 kg, respectively, and left side va and right side va of 0.72 0.13 and 0.73 0.15, respectively. the inclusion criteria were as follows : older than age 65 years with bva of 5/10 or worse for the pbva group, older than age 65 years with bva of 7/10 or better for the gbva group, the ability to walk independently without any assistive device, and a score > 24 on the korean version of the mini - mental state exam. each subject provided her informed consent before participating in this study, which was approved by the inje university faculty of health sciences human ethics committee. gait velocity and com during square and semicircular turning gaits were measured with a tri - axial accelerometer (fit dot life, suwon, korea). the accelerometer was 35 35 13 mm in size and weighed 13.7 grams. the range of the sensor is 8 g and + 8 g, and it can be adjusted using the data acquisition software (fitmeter manager 2, ver. 1.2.0.14, korea). we recorded the raw data using the x-, y-, and z - axes of acceleration. the data were automatically transferred to a computer via a usb cable connection. in the present study, we selected a range of 2 g. data the investigator explained the procedure of the tests before the participants walked along pathways which were marked with colored tape on the floor to indicate inner leg placement. the square turning pathway consisted of a 3-m straight path, a 1.5-m 90 turn, and a 3-m straight return path. the semicircular turning pathway consisted of a 3-m straight path, a 2.35-m semicircular curved path with a radius of 0.75 m, and a 3-m straight return path. the accelerometer was fixed with double - sided adhesive tape over participants l3 spinous process. the participants were asked to walk on the pathway with bare feet at a self - determined speed for the two tasks : walking along the square turning gait pathway with a left turn and, walking along the semicircular turning gait pathway with a left turn. participants started and finished walking 2 m before and after the start and end of the pathways, respectively, to avoid the effects of acceleration and deceleration on measurements7. the velocities of square and semicircular turning (64.60 6.80 and 69.87 6.48 [cm / sec ], respectively) in the gbva group were significantly higher than those of the pbva group (49.78 4.87 and 53.58 6.86 [cm / sec ], respectively ; p < 0.05). the com of square and semicircular turning (1147.45 121.36 and 1289.71 199.35 [cm / s ], respectively) of the gbva group was significantly lower than that of the pbva group (1355.32 224.76 and 1542.48 289.03 [cm / s ], respectively ; p < 0.05). in the present study, we found that the velocity of the gbva group during square and semicircular turning gaits was significantly higher than those of the pbva group, and the com of the gbva group during square and semicircular turning gaits was significantly less than that of the pbva group. these findings indicate that visual acuity affects gait velocity and balance during square and semicircular turning gaits. rhea and rietdyk8 investigated the roles of visual exproprioception in navigating obstacles during walking under four visual conditions. they occluded that visual exproprioceptive information is used to finely regulate the lower limb trajectory during obstacle avoidance. thus, the gait velocity and balance control ability of older adults with gbva during square and semicircular turning are higher than those of older adults with pbva performing the same conditions. in this study, although the gait velocity of the pbva group was slower, their com movements were significantly greater than those of the gbva group. walking directly forward demands that equal forces be imparted to the body from by limbs, whereas turning requires limb kinetic asymmetry. furthermore, a greater threat to balance emerges because the com leans toward the inner side of the turning path9. our findings suggest that older adults with pbva use more cautious gait strategies to perform changes in the direction of travel, decreasing gait velocity to prevent falls. however, gait velocity frequently changed during turning gaits. therefore, we suggest that complex tasks such as changing the direction of travel while walking are among the biggest challenges for elderly people with pbva. thus, elderly people with pbva require balance and gait training in a diverse environment to prevent falls. | [purpose ] the purpose of this study was to investigate gait velocity and center of mass (com) during square and semicircular turning gaits between two groups of elderly people with differing visual acuity. [subjects ] twenty elderly korean women who could walk independently and who lived in the community were recruited. [methods ] we measured gait velocity and com using an accelerometer during two different turning gaits. [results ] the velocity during square and semicircular turning gaits of participants with good binocular visual acuity (gbva) was significantly higher than that of participants with poor binocular visual acuity (pbva). the com during square and semicircular turning gaits of the gbva group was significantly decreased compared with that of the pbva group. [conclusion ] these findings suggest that visual acuity affects velocity and com during square and semicircular turning gaits of elderly people. |
ependymomas are rare forms of primary brain tumors, accounting for 37% of all brain tumors [1, 2 ]. ependymomas, composed of neoplastic ependymal cells, are thought to arise from the ependymal cells in the ventricular system. the majority occur infratentorially in the pediatric population, while a smaller fraction occurs in adults, usually in the spinal cord. rare variants of ependymomas have been described and can include cellular, papillary, clear - cell, and tanycytic variants. tanycytic ependymomas are particularly rare and typically occur in the spinal cord as an intramedullary mass. first described by friede and pollak in 1978, tanycytic ependymoma represents a who grade ii ependymoma with characterized pathology described as containing bipolar cells with absent mitosis and low - to - moderate cellularity. here the patient is a 58-year - old male with a history of hypertension and type ii diabetes mellitus who presented to an outside hospital after developing chin and right arm tremors, followed by a seizure. the seizure was complicated by a fall and urinary incontinence ; the seizure resolved on its own. a ct completed at an outside hospital revealed a large, complex cystic mass in the frontal lobe and left hemispheric subarachnoid hemorrhage. mri analysis revealed a 5.6 8 5 cm complex cystic lesion in the left frontoparietal lobe, with a mass effect on the left lateral ventricle (fig. there was some enhancement in the cystic components that was also visualized on t1 imaging with gadolinium. surgery was performed, and a left frontoparietal brain lesion, which was initially suspected to be a low - grade glioma, was removed. however, the tumor was surprising in its grayness and more firm than it would be expected for a low - grade glioma. the surgery was repeated 3 days later for microdissection and tissue harvesting. during his hospital stay, the patient developed waxing and waning expressive aphasia, with the development of global aphasia, a right facial droop, and right - sided weakness. a ct demonstrated hemorrhage in the resection cavity, effacement of the left superior frontoparietal sulci suggestive of cerebral edema, and a slight increase in left to right midline shift from 1.3 to 1.5 cm. however, it was unclear if the aphasia stemmed from the clot or cerebral edema following the surgery. on the day following evacuation of the hematoma, the patient 's symptoms improved. the patient 's symptoms included residual slurred speech, which improved over the subsequent month. at his last visit, 18 months following surgery, he continued to do well with no evidence of clinical or radiographic recurrence. pathological analysis revealed brain tissue infiltrated by well - differentiated piloid cells with low - to - moderate cellularity (fig. analysis of immunohistochemical staining revealed glial fibrillary acidic protein - positivity solely in reactive astrocytes. the proliferative index of the tumor was low, with only 2% of cells positive for ki67 staining. this case report shows the diagnosis and current clinical outcome of a male adult patient with a supratentorial tanycytic ependymoma, who grade ii. this rare variant of ependymoma commonly occurs in the spinal cord. in a review of the literature, we identified only 6 cases of ectopic supratentorial tanycytic ependymomas (table 1) [4, 5, 6, 7, 8, 9 ]. four cases were identified after the onset of seizures, one after the onset of headaches, and one was incidental. locations varied among the cases, including both cortical and subcortical locations as well as right and left hemispheres. tumors were frontal, temporoparietal, temporo - occipital, parietal, and parieto - occipital. in this series of patients, the wide age ranges of the patients and the presence of the tumors throughout the hemispheres underscore the importance of considering ependymomas in the diagnosis of tumors occurring throughout the brain. this is especially crucial with regards to tanycytic ependymomas, which can be easily mistaken for pilocytic astrocytomas or fibroblastic meningiomas. this can occur due to the bipolar nature of the tumor cells on pathology along with low - to - moderate cellularity. nonetheless, a number of nonconventional ependymoma variants can also mimic other tumors within the brain. papillary ependymomas may demonstrate features similar to those of choroid plexus tumors, while myxopapillary ependymomas may mimic chordomas. in undiagnosed tumors that lack the typical staining pattern for more common intraparenchymal tumors, alternative diagnoses, including variants of ependymoma, must be considered. in conclusion, this case report represents the rare presentation of a tanycytic ependymoma in the supratentorial region in an adult male patient. proper pathological diagnosis of the rare variant of ependymoma is warranted as it can impact prognosis and treatment. | ependymomas, tumors of the ependymal cells, are very rare and usually present in the pediatric population. furthermore, there are even rarer variants of ependymomas that can include cellular, papillary, clear cell, and tanycytic subtypes. we present a case of a supratentorial tanycytic ependymoma in an adult male and review the literature in regard to this rare primary central nervous system neoplasm. |
malaria accounts for the highest cause of mortality in africa with 90% of the global malaria deaths occurring on this continent. it constitutes 9% of the disease burden to the people of africa and is responsible for 25% of deaths below the age of five years. susceptibility to malaria is increased by up to 3-fold during pregnancy, thereby making pregnant women one of the most vulnerable groups. submicroscopic malaria, defined as plasmodium infection below the threshold detectable by microscopy but detectable by polymerase chain reaction (pcr), has received lots of attention due to its role in disease transmission. due to the sequestration of plasmodium falciparum infected red blood cells in the placenta of pregnant women, malaria however pcr diagnosis is effective in detecting not only parasitaemia below the threshold of microscopy but also placental infections. pcr has been reported to be more sensitive in the detection of malaria during pregnancy than the microscopy of placenta impression smears ; 65% of women negative for malaria by microscopy were positive by pcr. in areas of stable malaria transmission in africa, the who recommends a package of intermittent preventive treatment in pregnancy with sulphadoxine - pyrimethamine (iptp - sp) and use of insecticide treated nets. nonetheless, achievement of high coverage of these preventive interventions among pregnant women remains elusive for many countries in sub - saharan africa. in ghana, the who recommendations were adopted and finally implemented in 2005 ; however coverage remains generally low. nonetheless, several studies have continued to report its effectiveness in prevention of pregnancy associated malaria [68 ]. it, however, becomes necessary to continue to access its usefulness in varying dynamics of pregnancy associated malaria. in this study, we investigated the effectiveness of iptp - sp against submicroscopic malaria among pregnant women in central region, ghana, barring all constraints associated with the administration of this intervention. the study area has been described elsewhere, but briefly the study was carried out in central region, ghana. central region (5300n, 100w) occupies an area of 9,826 square kilometers, which is about 6.6% of the land area of ghana. it has an estimated population of 1,805,488 and an annual population growth rate of 2.1% with 17 administrative districts. in 2008, the region registered 86,971 pregnant women thus recording 115.5% antenatal care coverage and 56.3% supervised delivery. ethical approval was sought from the ghana health service ethical review committee (i d number : ghs erc all activities including sample collection, processing, and analysis were carried out as required by the committee. the region was divided into two belts and four hospitals were selected from each belt : the coastal belt (15 km inland) (moree health centre, kasoa health centre, elmina health centre, and cape coast metropolitan hospital) and the forest belt (swedru hospital, our lady of grace hospital asikuma, saint francis xavier hospital, assin foso, and dunkwa - on - offin district hospital). the study was designed to evaluate the effectiveness of iptp - sp in the normal state of its implementation barring all challenges and obstacles as a result of health system problems. however, only hospitals with functional anc clinics where the iptp - sp policy is implemented were included in the study. using the method described by fisher a sample size of seven hundred and ten (710) was required to represent the population of pregnant women in central region based on the following assumptions : standard normal deviation of 1.96 corresponding to 95% confidence interval, 29% prevalence of malaria in pregnancy, and 0.05 degrees of accuracy. the total number of pregnant women reporting to each health facility yearly was made as a fraction of the total number of pregnant women seen in all these health facilities annually. the proportion for each facility was used to determine the number of pregnant women sampled from that facility. the pregnant women were recruited from antenatal care units of the hospitals after written informed consent was obtained according to the ethical review committee of the ghana health service. some health and obstetric pieces of information such as gestation, gravidity, glucose-6-phosphate dehydrogenase (g6pd) status, and sp intake were obtained from the antenatal clinic (anc) booklets of participants ; other information was collected using a structured questionnaire administered by trained research assistants. the assistants were recruited and trained to explain the questionnaire in their own local languages. three milliliters (3 ml) of venous blood was collected from the median cubital or cephalic veins of the arm of pregnant women into labeled vacutainers, containing ethelene diamine tetra acetic acid (edta). one hundred microliters (100 l) of the blood was spotted on whatman no. 1 filter papers, air dried and placed in labeled plastic envelopes, and then stored at 20c until usage. thick blood films were prepared on labeled microscope slides, giemsa - stained and observed by a trained and licensed senior biomedical scientist and a principal biomedical scientist for malaria diagnosis. a sample was labelled positive if one or more parasites are present and negative if none is seen after observing 100 high power fields. 21 haematology analyser (sysmex corporation, kobe, japan) and the numerical values were recorded. the sodium metabisulphite method was used to determine sickling status as described by cheesbrough. plasmodium falciparum dna was extracted from blood spots on filter paper using the chelex method of extraction as described by bereczky.. the 690 participants who were malaria negative by microscopy and included in the molecular analysis, only 688 were successful. a nested polymerase chain reaction (pcr) was carried out following the method described by beck and ley with slight modifications. the primary pcr amplified a 642 bp plasmodium falciparum dihydrofolate reductase (pfdhfr) gene. the reaction was set up in a 96-well plate to a final volume of 25 l per well containing 1x buffer, 1.5 mm mgcl2, 200 m dntp mix, and 0.25 m of each primer (m1 = 5 ttt atg atg gaa caa gtc tgc 3, m5 = 5 agt ata tac atc gct aac aga 3). each cycle constituted a denaturation step at 94c for 1 minute, an annealing step at 50c for 2 minutes, and an extension step at 72c for 2 minutes. five microlitres of the primary pcr product was used for the second amplification using the following primers : (f = 5 gaa atg atg gaa caa gtc tgc gac gtt 3) and (2f = 5 tta att tcc caa gta aaa cta tta gag ctt3) corresponding to codon 59108 of the pfdhfr gene. the reaction was set up in a 96-well plate to a final volume of 25 l per well containing 1x buffer, 1.5 mm mgcl2, 200 m dntp mix, and 0.25 m of each primer. each cycle constituted a denaturation step at 94c for 1 minute, an annealing step at 45c for 1 minute, and an extension step at 72c for 2 minutes. eight microlitres (8 l) of each nested pcr product was separated on 2% agarose gel stained with ethidium bromide. the gels were then photographed (figure 1) under uv light. any sample with a nested pcr product that showed a band equivalent to the 322 bp mark on the molecular weight marker was labeled as positive for malaria, specifically plasmodium falciparum infection. iptp - sp users are pregnant women who have taken at least one dose of sp and no other malaria prophylaxis while nonusers have not taken sp during the present pregnancy at the time of the study. gravidity was grouped as primigravidae (1st pregnancy), secundigravida (2nd pregnancy), and multigravidae (3rd or more pregnancies). frequencies and pearson 's chi - square were used to compare relationships between variables. to determine the independent effect of iptp - sp on submicroscopic malaria, possible confounding factors such as gestation, occupation, gravidity, g6pd, and sickling status were controlled. odds ratio (or) and confidence interval (ci) were calculated by using logistic regression in multivariate analyses. in the logistic regression analysis, all variables were treated as categorical except gestation and gravidity that were treated as categorical. for all statistical tests, p < the mean age of the participants was 32.9 years ranging from 17 to 46 years. when grouped by iptp - sp usage, there was no significant difference (p = 0.33) in the mean age for users 33.4 years range (2046) and nonusers 32.1 (1744). women using iptp - sp were significantly more educated (p = 0.011) and better employed (p = 0.001) than nonusers (table 1). there was a significant difference between the iptp - sp users and nonusers based on trimester (p = 0.001) and gravidity (p = 0.023) as more women with pregnancy experience were users than nonusers. there was no association between the two groups in terms of g6pd (p = 0.719) and sickling status (p = 0.123) (table 2). the prevalence of submicroscopic malaria was not significantly affected by the gestation (p = 0.575) and gravidity (p = 0.665). submicroscopic malaria significantly resulted in anaemia (p = 0.003) (table 3). increasing dosage of sp had a significant (p = 0.018) preventive effect on submicroscopic malaria. the prevalence of malaria by microscopy was 20.9% (182/872) and by pcr (submicroscopic) was 9.7% (67/688) but when submicroscopic infection was added it shot up to 28.6% (249/872). iptp - sp usage significantly reduced submicroscopic falciparum infection (or = 0.13, 95% ci = 0.070.23, p = 0.005) (table 4). from the logistic regression, after controlling for possible confounders, the effect of iptp - sp and gestation on submicroscopic malaria remained statistically significant (or = 0.11, 95% ci = 0.020.22, p = 0.006 ; or = 0.28, 95% ci = 0.180.42, p = 0.001) (table 5). eight hundred and seventy - two (872) consenting pregnant women participated in the study. all the participants were eligible to use sp but only 555/872 (63.6%) had used iptp. this may be because the women report late for antenatal care or they do not visit regularly. though data on anc attendance was not collected in the present study, late first anc clinic enrolments and fewer visits iptp - sp users were not significantly (p = 0.33) older than nonusers but weresignificantly more educated and better employed than nonusers. this should buttress the importance of education in health care ; as such health education schemes for pregnant women should be intensified in rural areas. the social status of ghanaians has often been linked to health care as people with stable income have been shown to exhibit better health seeking behavior. more women with pregnancy experience were iptp users ; this might be because the women were already conversant with the routine procedures at the anc. more third trimester participants were iptp users as there was a significant association between gestation and iptp usage. this is not surprising because at the third trimester pregnant women are expected to have had several anc visits during which the iptp intervention should have been administered. the prevalence of malaria by microscopy was 20.9% (182/872) while that of submicroscopic malaria was 9.7% (67/688). submicroscopic malaria in pregnancy may be as a result of parasitaemia below the threshold of microscopy or the sequestration of infected red blood cells in the placenta. these results are different from findings of a similar study in kumasi, ghana, where prevalence by microscopy was 51%, pcr was 49%, and both were 63%. despite the fact that both studies were carried out in different geographical areas of ghana, the kumasi study was conducted prior to the implementation of iptp - sp in ghana ; thus the difference in prevalence may be as a result of the implementation of malaria control measures. a number of studies have suggested that malaria infection of any parasite density may have a harmful effect on pregnant women and their developing fetuses [20, 21 ]. submicroscopic malaria has been highly implicated for its contribution to malariatransmission as well as complicating control programmes and treatment. in a recent study carried out in the sudan, pregnant women with submicroscopic malaria had a higher risk of having low birth weight babies. since malaria elimination programs have been directed towards mass screening and treatment of asymptomatic individuals, further research should strive to elucidate the degree to which submicroscopic malaria contributes to the infectious reservoir and, in turn, what diagnostic detection threshold is needed to effectively interrupt transmission. the prevalence of submicroscopic malaria did not differ significantly by gestation and gravidity (p = 0.575 and 0.665), respectively. however after controlling for possible confounding factors the prevalence of submicroscopic malaria became significant by gestational age (p = 0.001). more than half (52%) of the participants with submicroscopic malaria were anaemic (hb < 11.0 g / dl). anaemia in pregnancy is however multifactorial and can be caused by a number of reasons including poor nutrition, intestinal parasites, and socioeconomic status which have not been measured in this study. nonetheless, similar studies have reported the contribution of malaria to anaemia in pregnancy [6, 24 ]. these submicroscopic infections may be as a result of prevailing placenta infection, because diagnosis of placenta malaria from peripheral blood by pcr has been reported to approach 100% accuracy. due to the profound consequences of submicroscopic malaria, it is very important that the iptp intervention should not only be effective in clearing parasite from the peripheral blood but also prevent submicroscopic and placental infections. usage of iptp significantly reduces the presence of malaria infection both at microscopic and submicroscopic levels (p = 0.002, p = 0.005, resp.). studies have reported the protective efficacy of sulphadoxine - pyrimethamine when used as malaria prophylaxis during pregnancy. we further indicate here that its efficacy extends beyond the threshold of microscopic to submicroscopic infections. recent studies have reported treatment failures as well as rise in the prevalence of molecular markers of sp resistance. in ghana, for example, prevalence of molecular markers of sp resistance was 73% ; nevertheless sp remains effective in preventing ghanaian women from malaria [68 ]. it becomes important for further research to be carried out to clarify the relationships between drug resistance, treatment failure, and molecular markers of sp resistance. the prevalence of submicroscopic malaria reduced significantly (p = 0.018) with increasing dosage of sp. one clinical trial in malawi also underscored the increased efficacy of sp with increasing doses among delivering women. the major limitation of this study is the absence of data on pregnancy outcomes such as placental malaria, congenital and perinatal mortality, and birth weight. this was due to the cross - sectional nature of the study and did not allow for participants to be followed till delivery. however, reports have been made on the useful effect of iptp - sp in the reduction of low birth weight (lbw), neonatal mortality (nm), and placental malaria (pm) [8, 24, 25, 27 ]. another limiting factor may be the general health systems barriers, which include staff motivation, lack of skilled personnel, and availability of medications, capable of hindering the success of health care policies in sub - saharan africa [28, 29 ]. however, only hospitals with vibrant anc clinics were selected for this study : an attempt to limit the effect of this limitation. intermittent preventive treatment in pregnancy with sulphadoxine - pyrimethamine continues to be a useful regimen for the prevention of pregnancy associated malaria and submicroscopic malaria in pregnancy. | malaria infections undetectable by microscopy but detectable by polymerase chain reaction (pcr) (submicroscopic malaria) are common in endemic areas like ghana. submicroscopic malaria has been linked with severe pregnancy outcomes as well as contributing to malaria transmission. in this cross - sectional study 872 consenting pregnant women (gestation 20 weeks) were recruited from 8 hospitals in central region, ghana, between july and december 2009. malaria infection was detected by microscopy and pcr. haemoglobin was measured and anaemia was defined as haemoglobin lower than 11 g / dl. majority of the women, 555 (63.6%), were intermittent preventive treatment in pregnancy with sulphadoxine - pyrimethamine (iptp - sp) users while 234 (36.4%) were nonusers. the prevalence of malaria by microscopy was 20.9% (182/872) and 9.7% (67/688) of microscopy negative women had submicroscopic malaria. iptp - sp usage significantly (odds ratio = 0.13, 95% confidence interval = 0.070.23, p = 0.005) reduced the prevalence of submicroscopic malaria as more nonusers (51/234) than users (16/454) were pcr positive. after controlling for other variables the effect of iptp - sp remained statistically significant (odds ratio = 0.11, 95% confidence interval = 0.020.22, p = 0.006). these results suggest that intermittent preventive treatment with sulphadoxine - pyrimethamine is useful in the reduction of submicroscopic malaria in pregnancy. |
the assessment of left ventricular mechanical dyssynchrony (lvd) using phase analysis of gated myocardial perfusion single - photon emission computed tomography (spect) (mps) was introduced in 2005, allowing for the simultaneous assessment of left ventricular (lv) perfusion, function, and mechanical dyssynchrony. furthermore, compared to other imaging modalities such as echocardiography, magnetic resonance imaging, and equilibrium radionuclide angiography, phase analysis of mps has shown several advantages such as simplicity, widespread availability, superior reproducibility, applicability to retrospective data, and ability to simultaneously assess myocardial scar location. lvd assessed by the gmps has been recognized as an essential and additional criterion for response to cardiac resynchronization therapy (crt) in heart failure patients. aljaroudi outlined other potential clinical applications of lvd including prognostication and risk stratification of patients with ischemic, nonischemic cardiomyopathy, implantable defibrillators, and end - stage renal disease. it is important to determine whether these normal values are also applicable on the different ethnic groups and population. therefore, the aim of the study was to establish normal values of mechanical synchrony with gmps in indian population both in rest and stress images and to find out whether it differs significantly from the established database. this was a single center study performed at cardiothoracic centre at all india institute of medical sciences, new delhi. we retrospectively analyzed data of 120 patients who underwent technetium-99 m (99 mtc) sestamibi gmps for routine clinical indications between the period of january 2012 and december 2013. studies of patients with low pretest likelihood of coronary artery disease, no known history of cardiac disease and normal sinus rhythm on electrocardiogram (ecg) and having qrs duration 55% were considered normal by two experienced observers. nearly 812 mci (low dose) of 99 mtc sestamibi (hexakis-6 methoxyisobutylisonitrile) was injected at peak stress. acquisition was performed 4560 min after intravenous injection of 2430 mci (high dose) of 99 mtc sestamibi. gmps acquisition was performed on a dual head camera system (general electric medical system, infinia, hawkeye, waukesha, wi, usa). rest - gated images were acquired using a 15% window centered over the 140 kev photo peak of tc99 m with parallel hole, low energy, high - resolution collimator. ecg - gated spect imaging was performed with eight frames per cardiac cycle, using a 100% beat acceptance window. studies were acquired using step and shoot mode with the heads at an angle of 90 to each other. sixty projection (30 steps, 3 steps) of 20 s / projection were acquired over 180 from 45 right anterior oblique position to 135 left posterior oblique position. gmps studies were processed by two nuclear medicine physicians (am, hs) using commercially available cardiac software synctool (emory cardiac toolbox, emory university, atlanta, ga, usa) on a xeleris workstation (ge medical systems ; waukesha, wi, usa). spect nongated projection images were reviewed in cine mode in all cases to assess patient movement, sources of potential attenuation artifacts and gastric activity. the raw images (both gated and nongated data sets) were then prefiltered with a butterworth filter. the resulting transaxial image slices were reoriented to generate short axis, vertical long axis, and horizontal long axis images, using vendor provided software. for the assessment of cardiac dyssynchrony, each gated study was processed using cardiac software synctool first - harmonic fast fourier transform was used to extract a phase array (three - dimensional regional phases). the two parameters used to assess cardiac dyssynchrony : phase standard deviation (psd), which was the sd of the phase distributionphase histogram bandwidth (phb), which included 95% of the elements in the phase distribution. phase standard deviation (psd), which was the sd of the phase distribution phase histogram bandwidth (phb), which included 95% of the elements in the phase distribution. continuous data were expressed as mean sd compared using the paired and unpaired student 's t - test or wilcoxon rank test as appropriate. statistical analysis was performed using the statistical software packages spss 17 (spss inc., chicago, illinois, usa) and medcalc 11.3 (medcalc software, mariakerke, belgium). this was a single center study performed at cardiothoracic centre at all india institute of medical sciences, new delhi. we retrospectively analyzed data of 120 patients who underwent technetium-99 m (99 mtc) sestamibi gmps for routine clinical indications between the period of january 2012 and december 2013. studies of patients with low pretest likelihood of coronary artery disease, no known history of cardiac disease and normal sinus rhythm on electrocardiogram (ecg) and having qrs duration 55% were considered normal by two experienced observers. all patients underwent 1 day stress rest gated spect myocardial perfusion imaging according to american society of nuclear cardiology. nearly 812 mci (low dose) of 99 mtc sestamibi (hexakis-6 methoxyisobutylisonitrile) was injected at peak stress. acquisition was performed 4560 min after intravenous injection of 2430 mci (high dose) of 99 mtc sestamibi. gmps acquisition was performed on a dual head camera system (general electric medical system, infinia, hawkeye, waukesha, wi, usa). patients were positioned supine and limb leads placed for ecg gating. both stress and rest - gated images were acquired using a 15% window centered over the 140 kev photo peak of tc99 m with parallel hole, low energy, high - resolution collimator. ecg - gated spect imaging was performed with eight frames per cardiac cycle, using a 100% beat acceptance window. studies were acquired using step and shoot mode with the heads at an angle of 90 to each other. sixty projection (30 steps, 3 steps) of 20 s / projection were acquired over 180 from 45 right anterior oblique position to 135 left posterior oblique position. gmps studies were processed by two nuclear medicine physicians (am, hs) using commercially available cardiac software synctool (emory cardiac toolbox, emory university, atlanta, ga, usa) on a xeleris workstation (ge medical systems ; waukesha, wi, usa). spect nongated projection images were reviewed in cine mode in all cases to assess patient movement, sources of potential attenuation artifacts and gastric activity. the raw images (both gated and nongated data sets) were then prefiltered with a butterworth filter. the resulting transaxial image slices were reoriented to generate short axis, vertical long axis, and horizontal long axis images, using vendor provided software. for the assessment of cardiac dyssynchrony, each gated study was processed using cardiac software synctool first - harmonic fast fourier transform was used to extract a phase array (three - dimensional regional phases). the two parameters used to assess cardiac dyssynchrony : phase standard deviation (psd), which was the sd of the phase distributionphase histogram bandwidth (phb), which included 95% of the elements in the phase distribution. phase standard deviation (psd), which was the sd of the phase distribution phase histogram bandwidth (phb), which included 95% of the elements in the phase distribution. continuous data were expressed as mean sd compared using the paired and unpaired student 's t - test or wilcoxon rank test as appropriate. statistical analysis was performed using the statistical software packages spss 17 (spss inc., chicago, illinois, usa) and medcalc 11.3 (medcalc software, mariakerke, belgium). one hundred and twenty patients (sixty males, sixty females) were included in the study. mean lvef on stress and rest was 62.9 4% and 62.9 3.9%, respectively (p = 0.45). the values of psd and phb derived are given in table 1 [figure 1 ]. significant differences between synchrony parameters were noted between men and women both on stress (psd : 14.3 4.7 vs. 11 4, p = 0.0001 and phb : 40.1 11.9 vs. 34.7 12.6, respectively, p = 0.007) and on rest studies (psd : 8.9 2.9 vs. 7.7 2.7, p = 0.009 and phb : 30.6 7.6 vs. 25.3 8.6, respectively, p = 0.0001). furthermore, significant differences between synchrony parameters noted between stress and rest both in men (psd : 14.3 4.7 vs. 8.9 2.9, p mean + 2sd) will be significantly lower for the indian population [table 2 ] as compared to cutoff values established in the literature [table 3 ]. hence, the findings of this study suggest that a population - specific and methodology - specific normal database for assessment of cardiac mechanical dyssynchrony should be established. bmi which could be potential confounding factor could not be assessed due to retrospective nature of the study. cardiac mechanical dyssynchrony assessed by gated myocardial perfusion spect is influenced by the radiotracer and study protocol. hence, centers using gmps should have its normal database for assessment of cardiac mechanical dyssynchrony. | purpose of the study : normal values of cardiac mechanical synchrony parameters in gated myocardial perfusion single - photon emission computed tomography (gmps) are well established in literature from the western population. the aim of the study is to establish normal values of mechanical synchrony with gmps in indian population and to find out whether it differs significantly from established values.procedure:we retrospectively analyzed 1 day low - dose stress / high - dose rest gmps studies of 120 patients (sixty males, 52 11.7 years) with low pretest likelihood of coronary artery disease and having normal gmps study. in gmps, first - harmonic fast fourier transform was used to extract a phase array using commercially available software. phase standard deviation (psd) and phase histogram bandwidth (phb) were used to quantify cardiac mechanical dyssynchrony.results:the values obtained were as follows, psd : in men, 14.3 4.7 (stress) and 8.9 2.9 (rest), in women 11 4 (stress) and 7.7 2.7 (rest), and phb : in men, 40.1 11.9 (stress) and 30.6 7.6 (rest), in women, 34.7 12.6 (stress) and 25.3 8.6 (rest). the value of psd and phb was significantly less in indian population as compared with established values in literature. we also observed that synchrony indices derived from the low - dose stress studies are higher than high - dose rest studies.conclusions:the value of synchrony parameters differs significantly according to population and methodology suggesting that specific population and methodology - based normal database for assessment of cardiac mechanical dyssynchrony should be established. |
discontinuation of anticoagulated drugs when a minor oral surgery is to be undertaken has been a common practice. multiple studies, however, reported this concept to be associated with high potential risks, and that minor surgeries can be performed safely in anticoagulated patients without interruption of the drug administration. oral anticoagulant therapy (oat) is prescribed for a variety of diseases. whether to stop, modify or continue the oat when oral surgery is to be undertaken has long been a controversial issue. it is a vitamin k antagonist that results in a decreased effective protein c concentration. the most commonly used hemostatic measures include suturing, tranexamic acid, gel foam and cellulose. despite the reported efficacy of such agents, ankaferd blood stopper (abs) is a drug of herbal origin that has an unclear mechanism of action. this study was directed to evaluate the correlation between the international normalized ratio (inr) values and sufficiency of tranexamic acid and abs in controlling postextraction bleeding in anticoagulated patients. this study was approved by the review board of the faculty of dentistry, mansoura university and was conducted according to the world medical association declaration of helsinki on medical research protocols. this study was conducted in the period from august 2011 to april 2013 and included 160 patients receiving warfarin oat for at least 1 year, as well as 45 patients who had never been on oat. patients were referred to oral and maxillofacial surgery department, faculty of dentistry, mansoura university for tooth extraction. the values of the inr were measured for all patients preoperatively in the same day of tooth extraction using the standardized procedures. forty - five patients who had never received oat were selected and considered to be a negative control patients (group 1). one hundred and sixty patients receiving warfarin were representing a common pool for the anticoagulated patients included in this study. then, forty patients were randomly selected from each category of the anticoagulated patients by the second author (mourad s) to form two equal groups using random numbers for assignment. only patients with a single tooth to be extracted that can be removed with forceps without the need for mucoperiosteal flap and/or dental elevators were included in this study. patients with liver diseases, and those taking medications that would affect hemostasis such as non - steroidal anti - inflammatory drugs, heparin, and combined anti - platelet therapy were excluded. additional exclusion criteria included previous thromboembolism under oat and sever postextraction bleeding prior to starting oat. before tooth extraction, a local anesthetic injection of 2% mepivacain hydrochlorid with 1:20,000 levonordefrin (mepecain : alexandria co. for pharmaceuticals, alexandria, egypt) was administered, and no more than two carpules were used for each patient. all extractions were performed by forceps as atraumatically as possible by the same surgeon (salem a), who was unaware of the inr values. following tooth extraction, all patients were instructed to apply pressure on the gauze pack for 15 min. such cases were managed initially by applying a gauze pressure pack with tranexamic acid for another 15 min for patients included within group 2, and by spraying abs (ankaferd drug inc, istanbul, turkey) over the extraction socket, followed by instructing the patients to bite on a gauze pressure pack for 15 min for patients included in group 3. further failure of hemostasis was managed by application of gel foam in the extraction socket, which was then sutured with black silk suture (3 - 0) and the patient was instructed to bite on another gauze pack. all patients were reexamined for postoperative bleeding 15 min after the procedures as well as on the 1, 2, and 5 day after the extraction. postoperatively ; patients were given the routine post - extraction instructions, and paracetamol 500 mg was prescribed as an analgesic. all patients were instructed to report back to the operator immediately in case of any complaint of postoperative bleeding. the criteria described by lockhart. was used to define whether the postoperative bleeding would be considered clinically significant : bleeding lasting for more than 12 h, patient had return to the dental clinic or go to the emergency department, bleeding associated with large hematoma formation, and/or the necessity of blood transfusion. local hemostasis and postoperative data were processed using microsoft excel 2007 and statistical package for social science software (spss, version 17.0 ; ibm spss inc., student 's t - test was used for analysis of the parametric while kruskal wallis and mann whitney u - tests were used for the non - parametric data. the age and gender distribution of patients included in this study is shown in table 2. group 1 (negative control group) included 22 females and 23 males, with the age ranging from 25 to 65 years (mean value of 39.9 12). group 2 (tranexamic acid group) included 36 females and 44 males, with the age ranging from 23 to 75 years (mean value of 59.9 10.1). group 3 (abs group) included 38 females and 42 males, with the age ranging from 39 to 76 years (mean value of 57.4 9.3). there was no significant difference concerning the gender between all groups (p = 0.906). age and gender of patients included in the study in group 1, teeth were extracted due to deep non - restorable caries in 29 patients and severe periodontitis in 16 patients, compared with 38 patients with deep caries and 42 with periodontitis in group 2. in group 3, 39 patients had deep non - restorable caries, and 41 had severe periodontitis. for patients included in group 1, the inr values ranged from 0.9 to 1.2 with a mean of 1.1, while, in the group 2, the inr levels ranged from 1.5 to 3 with a mean of 2.2. for group 3, it ranged from 1.6 to 3, with a mean of 2.2. there was no significant difference between the inr levels between group 2 and group 3 (p = 0.794) [table 3 ]. distribution of inr levels among different groups the incidence of postoperative bleeding is described in table 4. no postoperative bleeding was encountered in group 1 (the negative control group), where biting on a gauze pack for 15 min was sufficient to control post - extraction bleeding. in contrast, 24 patients showed postoperative bleeding within group 2, among whom ten patients showed a persistent bleeding after application of tranexamic acid. on the other hand, 21 patients showed postoperative bleeding in patients within group 3, among whom eight patients showed a continuous bleeding after application of abs. this was statistically significant compared to group 1 but not to group 2 (p = 0.000 and 0.599). incidence of postextraction bleeding among anticoagulated patients in different groups in response to local hemostatic procedures twenty - four anticoagulated patients in group 2 showed continuous bleeding after application of the pressure pack (one patient of inr 2 and 23 patients of inr > 2). in an attempt to control bleeding, pressure pack with tranexamic acid was applied for another 15 min. ten patients of inr > 2 required packing the extraction site with gel foam followed by figure of eight suturing and another pressure pack. in group 3, sole pressure packs failed to control bleeding in 21 patients (two patients of inr 2 and 19 patients of inr > 2). eight patients of inr > 2 required packing the extraction site with gel foam, followed by figure of eight suturing and another pressure pack [table 4 ]. there was no significant difference between the secondary measures used to control postoperative bleeding (tranexamic acid / abs) (p = 0.809). although, a remarkable increase in the incidence of postextraction bleeding among patients with inr values > 2 was noted [table 5 ], however, regarding to the sufficiency of simple pressure pack to control postextraction bleeding for patients with inr values of either 2 or > 2, no significant difference was recorded between groups 2 and 3 (p = 0.559 and 0.374 respectively). on the other hand, when a secondary measure was used to control bleeding (tranexamic acid / abs), no significant difference was recorded between groups 2 and 3 (p = 0.93), revealing no evidence to support the superiority of tranexamic acid over abs. level of significance between incidence of postextraction bleeding and the applied hemostatic procedures regarding to different inr values none of the patients included in this study encountered bleeding after discharging from the institution. such bleeding is usually easily controlled in most cases. however, with increased bleeding tendency, the situation is usually more complicated. in such instances, the use of local hemostatic agents is usually indicated. performing minor surgery was reported to be safe in patients with an inr of up to 2.5. discontinuation of warfarin for 1 - 4 days preoperatively, causes the inr to fall below 1.5, which is very safe for any surgery to be undertaken. this protocol, however, does not guarantee the establishment of the 1.5 inr level. our findings revealed that, a remarkable increase in the incidence of postextraction bleeding among patients of inr values > 2. however, regarding the sufficiency of simple pressure pack to control postextraction bleeding for these patients with inr values of either 2 or > 2, no significant difference was recorded between 2 and 3 group (p = 0.559 to 0.374). these results can be attributed to equal division, separation and random inclusion of patients with inr values of either 2 or > 2, which lead to obtaining the same relative effect when simple pressure pack was used only in 2 and 3 group. we found no evidence to support the superiority of tranexamic acid over abs. in agreement with our results, several studies have reported tranexamic acid mouthwash to be an effective maneuver to control bleeding in anticoagulated patients undergoing oral surgical procedures, as well as fibrin glue, gelatin sponge and sutures., compared three different hemostatic modalities (fibrin glue, tranexamic acid, gelatin sponge and sutures) and reported no significant differences concerning postoperative bleeding in anticoagulated patients following tooth extraction. furthermore, a clinically relevant bleeding was also reported in another study comparing patients with discontinuation of oat versus those continuing with the anti - vitamin k therapy. in fact, these bleeding events were more frequent in the control than in the test group (non - significant differences). in these cases, tranexamic acid mouthwashes (4.8%, 10 ml, 4 times a day) were effective in controlling post - operative bleeding in all oat patients without discontinuation. different factors can influence the postoperative bleeding following minor oral surgery in patients receiving oat. morimoto. reported a significantly increased postoperative bleeding associated with surgical extraction and acute inflammation. other factors include the operator 's experience and the surgical technique. in our study, all extractions were done by one qualified oral surgeon with more than 10 years of experience (salem a). a wide range of the incidence of postoperative bleeding following dental extraction in anticoagulated patients has been reported in the literature. perhaps the different modalities used to control the bleeding initially in such patients can explain this diversity. packing of the extraction socket with a local hemostatic agent combined with suturing appears to be associated with decreased bleeding incidence. in our study, the incidence of postoperative bleeding following the use of local hemostatic agents was 12.5% and 10% in group 2 (tranexamic acid) and group 3 (abs) respectively. these results were in accordance with blinder. who reported an incidence of 12% in his study. the incidence of postoperative bleeding in our results is considered high in relation to others. suturing of extraction socket, for instances ; results in apposition of the socket margins and helps in controlling the bleeding. in our technique, we used only a pressure pack for 15 min, then another pack saturated with the hemostatic agent to test the ability of the material to control bleeding without the additional effect of sutures. another reason could be the presence of inflammation in a considerable number of the extracted teeth. when dealing with severe periodontitis and periapical infection, sometimes tooth removal is essential for resolution of inflammation. teeth included in this study were removed due to sever periodontits (51.9%), and deep caries with / without chronic periapical infection (48.1%). the predominant granulation tissue associated with chronic infection, combined with other inflammatory signs can contribute to the increased incidence of postoperative bleeding. ankaferd blood stopper is unique hemostatic agent of herbal origin that was used for those patients who did not respond to plain pressure pack with the need of additional application of local hemostatic agent. although, the abs mechanism of action still unclear, goker. described rapid formation of a protein network in response to exposure to abs. the network formation is reported to be related to the functions of blood proteins and red blood cells. ankaferd blood stopper is reported to induce physiological hemostatic process with no effect on individual clotting factors. this mechanism combined with providing tissue oxygenation renders abs superior to other hemostatic agents of gerbil origin. moreover, in an in vivo study on rats, cipil. reported a marked shortening of bleeding following leg amputation in response to topical application of abs. it combines the ease of application with low cost, and it is an effective hemostatic agent. agents of herbal origin, on the other hand, usually have a wider scope of activity. besides being a good hemostatic agent, abs has many other positive actions. it is reported to have antimicrobial activity, and to decrease inflammation and necrosis of bone and at the same time enhance new bone formation in early bone healing period, which are all desired properties following tooth extractions. to the best of our knowledge, and according to our results we believe that although, aot patients represent a troublesome condition confronting oral surgeon during early postextraction phase regarding to the variable expected bleeding risk. however, simple pressure pack for a proper time of application can play a pivotal role to control such risk for aot patients with inr values 2. on the other hand, for those patients with inr values > 2 abs can represent itself as a sufficient local hemostatic agent that is comparable with tranexamic acid. based on our findings, abs is an effective hemostatic agent comparable to tranexamic acid in controlling post - extraction bleeding in aot patients of inr values 3 with no evidence support the superiority of tranexamic acid over abs. | objectives : the management of patients receiving oral anticoagulant therapy (oat) undergoing minor oral surgeries is controversial. this study was designed to evaluate the correlation between international normalized ratio (inr) values and the sufficiency of two different local hemostatic measures in controlling postextraction bleeding in anticoagulated patients.materials and methods : one hundred and sixty patients receiving warfarin oat were included in this study. patients were selected so that 80 patients have inr values of 2, whereas the remaining patients have the inr values ranging from 2 to 3. forty patients were then randomly selected from each category to form two equal groups. forty - five patients who had never been on oat were selected as a negative control group (group 1). failure to achieve hemostasis using a pressure pack was managed using either tranexamic acid (group 2) or ankaferd blood stopper (abs) (group 3).results : the inr values of patients included in group 2 and 3 ranged from 1.5 to 3, with a mean of 2.2. no significant difference was recorded between the use of either tranexamic acid or abs in achieving hemostasis in anticoagulated patients with inr values ranging between 2 and 3 (p = 0.93).conclusion : based on our findings, abs is a hemostatic agent of good efficacy. the effect of abs in controlling post - extraction bleeding in anticoagulated patients with inr values 3 is comparable to tranexamic acid with no evidence to support the superiority of tranexamic acid over abs. |
overuse tendon injuries, namely, tendinopathies, pose a significant clinical problem in musculoskeletal medicine. the intrinsic pathogenetic mechanisms underlying the development of tendinopathies are largely unknown [2, 3 ] ; however, several model systems have recently implicated proinflammatory cytokines [46 ]. the interaction between cytokine production and inflammation is critical to tissue homeostasis and plays a key role in many diseases including rheumatoid arthritis and cardiovascular disease. previous studies highlight a huge influx of inflammatory cells, particularly mast cells [7, 8 ], at the site of tendon injury with the subsequent release of growth factors and cytokines [9, 10 ]. these factors chemotactically promote innate immune cell migration into the injured tissue and produce cytokines and growth factors (e.g., tgf-, igf-1, and basic fgf) in an attempt to produce tissue resolution [11, 12 ]. tenocytes demonstrate endogenous expression of various cytokines such as tnf-, il-1, il-6, il-10, vegf, and tgf- [1315 ]. increased amounts of il-1, il-1, tnf-, and ifn- were present in inflamed native equine tendon, while inflammatory gene expression was altered in a rodent supraspinatus tendon overuse model. mechanical factors also influence tendon cytokine profile whereby cyclic strain has been shown to induce vegf expression in tenocytes. conversely, stress deprivation leads to an overexpression of cytokines including il-1 and tnf- in the patellar tendon with subsequent mechanical deterioration of the tendon with additional investigation in il-6 deficient mice showing decreased tendon healing properties. these results fit the pathogenetic theory that inflammation drives early tendinopathy, when microrupture of tendon induces expression of damage - associated molecular patterns (damps) in an attempt to produce tissue healing. il-21 is a proinflammatory cytokine of the il-1 family and is produced mainly by cd4 + lymphocytes and natural killer t cells (nk). it is known to modulate t - cell proliferation, b - cell differentiation, and cytotoxic properties of nk cells, as well as the antigen presenting and t - cell activating abilities of dendritic cells. the il-21 receptor is composed of a specific il-21 receptor alpha chain and the common gamma chain receptor and has been found to be expressed at significantly higher mrna levels and by immunohistochemical staining in biopsy samples from patients with systemic sclerosis and rheumatoid arthritis (ra), compared to controls [23, 24 ]. furthermore, il-21r is present in higher levels in synovial fibroblasts and macrophages in ra, activating fibroblasts independently of tnf- and il-1. the purpose of this study was to investigate the presence and role of il- 21 and il-21r in human tendinopathy and was borne out of preliminary studies in animal and human models of tendinopathy in which the proinflammatory cytokines were found in increased levels [9, 26 ]. all procedures and protocols were approved by the south east area sydney ethics committee under acec no. fifteen supraspinatus tendon samples were collected from patients with rotator cuff tears undergoing shoulder surgery (table 1). the mean age of the rotator cuff ruptured patients was 54 years (range, 3570 years) and the mean tear size was 2.5 cm. patients were only included if there was no clinically detectable evidence of subscapularis tendinopathy on a preoperative mri scan or macroscopic damage to the subscapularis tendon at the time of arthroscopy by these criteria they represented a truly preclinical cohort. an independent control group was obtained comprising 10 samples of subscapularis tendon collected from patients undergoing arthroscopic surgery for shoulder stabilization without rotator cuff tears. the mean age of the control group was 35 years (range, 2041 years). arthroscopic repair of the rotator cuff was carried out using the standard three - portal technique as described previously. the cross - sectional size of the rotator cuff tear was estimated and recorded as described previously. the subscapularis tendon was harvested arthroscopically from the superior border of the tendon 1 cm lateral to the glenoid labrum. the supraspinatus tendon was harvested from within 1.5 cm of the edge of the tear prior to surgical repair. for immunohistochemical staining the tissue samples were immediately fixed in 10% (v / v) formalin for 4 to 6 hours and then embedded in paraffin. sections were cut to 5 m thickness using a leica - lm microtome (leica microsystems, germany) and placed onto superfrost ultra plus glass slides (gerhard menzel, germany). the paraffin was removed from the tissue sections with xylene, rehydrated in graded alcohol, and used for histological and immunohistochemical staining per previously established methodologies. for immunohistochemical studies, samples were rehydrated through a graded alcohol / xylene series and endogenous peroxide activity was blocked using 0.5% h2o2 in methanol. antigen retrieval was performed in 0.01 m citrate buffer at ph 6.0 for 30 minutes. avidin / biotin block was carried out using avidin d for 15 minutes, followed by biotin for 15 minutes. primary antibody, rabbit anti - human polyclonal il-21 antibody (lifespan biosciences, seattle, wa, usa), was then followed by biotinylated goat anti - rabbit igg as the secondary antibody. slides were then incubated with vectastain abc kit and staining was visualized using chromogen immpact dab, counterstained with haematoxylin. for il-21r staining, mouse anti - human il-21r primary antibody was used followed by biotinylated horse anti - mouse secondary antibody and conjugated with tyramide (perkin elmer, waltham, ma, usa) via hrp. positive (human tonsil tissue, human rheumatoid arthritis tissue) and negative control specimens were included, in addition to the surgical specimens for each individual antibody staining technique. omission of primary antibody and use of negative control isotypes confirmed the specificity of staining. five random high power fields (400) were evaluated by three independent assessors (nlm, jhr, alc). in each field the number of positive and negatively stained cells was counted and the percentage of positive cells was calculated giving the following semiquantitative grading, grade 0 = no staining, grade 1 10% cells stained positive, 2 = 1020% cells stained positive, and grade 3 20% cells positive. human tendon derived cells were explanted from hamstring tendon tissue of 5 patients (age 1830 years) undergoing hamstring tendon acl reconstruction. cultures were maintained at 37c in a humidified atmosphere of 5% co2 for 28 days. cells were subcultured and trypsinized at subconfluency, cells from the 3rd passage were used in normoxic conditions. rna was isolated from cells with trizol followed by qiagen rneasy kit (qiagen, crawley, uk) with additional dnase step. cdna was prepared from mrna with affinityscript (agilent technologies, ca, usa) per manufacturer instructions. sybr green real - time pcr was performed (applied biosystems, ca, usa) with abi prism 7900ht sequence detection system (ab) and all samples were normalized to gapdh, the housekeeping gene. significance was assessed with two - way paired student 's t - tests (rt - pcr), mann - whitney u tests (histological staining comparison), and kruskal - wallis one - way anova (patient comparison data) using graph pad prism 5 software (la jolla, ca, usa). statistics reported on real - time pcr data represent the mean of each experiment repeated in triplicate and then the pooled mean of n = 3 or 5. il-21r message and protein was significantly upregulated compared to control and torn tendon samples (figure 1). in contrast to il-21r, expression of il-21 mrna could not be detected in any tissue samples from the same tendon biopsy patients. there were no significant correlations between il-21r expression and the mean duration of symptoms, patient age, or number of steroid injections. torn tendon samples exhibited marked degeneration, mucoid change, and frank chondroid metaplasia (grade 4), whereas matched subscapularis tendon biopsies all control samples were classified as grade 1 consistent with normal fibrotendinous tissue with large distinct collagen fibrils. there were no significant correlations between bonar score and the mean duration of symptoms or patient age. il-21r was mainly expressed by cells in the sublining layer and by cells within the extracellular matrix in the early tendinopathy group (figure 2). within the torn group, only mild staining was noted in the sublining layer with minimal staining within the matrix. the majority of positive cells were tenocytes (confirmed with cd55 back to back staining) while further back to back staining with cd68 (macrophage) marker revealed a few (< 10%) cells to be of macrophage lineage. therefore, tendon fibroblasts were examined for their expression of il-21 by ihc. although no specific cell surface markers exist for tenocytes, we chose the surface marker cd55 that has been used by a collaborating laboratory (p.p.tak) as a fibroblast marker to check assurance the cultured cells were indeed fibroblasts. il-21r was detected in in vitro cultured tenocytes at both the message and protein level (figure 3). to this end, tenocytes were stimulated with il-1 or tnf-, two cytokines which are produced in excess in tendinopathy and known to regulate fibroblast activity. both cytokines upregulated il-21r expression and message (p < 0.01) and protein levels (figure 3) with the most significant change seen in combination. our study provides evidence that il-21r is present in early tendinopathy and can be modulated in tenocytes by proinflammatory cytokines promoting the concept of il-21r as inflammatory regulator in early tendon tissue damage. recent genome - wide association studies have provided convincing evidence that the chromosomal 4q27 region harboring the il-2 and il-21 genes is associated with chronic inflammatory disorders, including coeliac disease (a gluten - sensitive enteropathy), psoriasis, diabetes, rheumatoid arthritis, inflammatory bowel disease (ibd), asthma, and systemic lupus erythematosus (sle) [3133 ]. however, the precise role of the il-21/il-21r axis in fibroblasts and thus stromal cell pathologies remains to be established. il-21r expression was found to be markedly increased in systemic sclerosis patients with skin biopsies showing keratinocytes as the predominant source of il-21r. il-21r is also highly expressed in synovial macrophages and fibroblasts of rheumatoid arthritis (ra) patients. t cells derived from the peripheral blood or synovial fluid of these patients produced high levels of th1 cytokines after stimulation with il-21, whereas blockade of il-21 with the il-21r / fc fusion protein significantly inhibits inflammatory cytokine production in ra synovial membrane cultures. herein we, demonstrate significantly increased il-21r expression in early tendinopathy similar to that reported in ra and ssc suggesting an activated this may contribute to tendon weakening in a similar manner to activated fibroblasts contributing to joint erosion in ra where it is has been shown that the il-21/il-21r axis is involved in dysregulated matrix metalloproteinase production. more recently it has been demonstrated that il-21 might also function as an important mediator of the crosstalk between immune and nonimmune cells, given that it can enhance the production of chemokines and tissue - degrading matrix metalloproteinases (mmps) by epithelial cells and fibroblasts. interestingly il-21 was not detected by immunohistochemistry or real - time pcr which may suggest alternative ligands binding to il-21r in tendinopathy. this theory has been proposed for ra as some receptors bind multiple cytokines ; for instance, type ii receptor complexes consisting of il-4r and il-13r1 heterodimers are activated by both il-4 and il-13. we have previously reported increased levels of il-15 in early tendinopathy, which shares common cytokine receptor -chain (c), which is a functional component of the il-21r complex. thus it may be that downstream activation of the il-21r complex occurs in tendinopathy via il-15 costimulation or alterative cytokine interactions. secondly it may be that il-21 expression occurs extremely early in the tendinopathy spectrum and that our cohort represents a later stage in the pathological process ; however, we feel that the alternative ligand binding theory of il-21r is a more likely scenario within tendinopathy pathology. firstly, as the control group was substantially younger than the patient group, age - related changes within the tendon samples could contribute to the degenerative picture and inflammatory cell expression seen in the matched subscapularis tendons. however, the lack of degenerative change on mri and arthroscopic examinations suggests that the differences are truly at the cellular level as suggested by our work. secondly, subscapularis tendon is functionally and organizationally distinct from supraspinatus and thus responds to mechanical loading in a different manner which may alter its cellular profile. also control samples from subscapularis undergoing stabilization may not be truly normal controls but are currently the best available control tendon sample and this is reflected by a bonar score of 0. it is reassuring, however, that we found the same inflammatory and vascular cell subtypes in matched subscapularis tissue indicating that the inflammatory response may be uniform within joints subjected to tendon degeneration. in addition having subscapularis samples from the same patient eliminates bias that may result from variation between individuals and has been previously shown to be useful method in sampling of tissues. on the basis of these results we propose il-21r as a potential inflammatory mediator in tendinopathy. better understanding of the pathological cascade involving il-21r could lead to the development of cell targeted treatment modalities in early human tendon disease. | the pathogenetic mechanisms underlying tendinopathy remain unclear, with much debate as to whether inflammation or degradation has the prominent role. increasing evidence points toward an early inflammatory infiltrate and associated inflammatory cytokine production in human and animal models of tendon disease. the il-21/il-21r axis is a proinflammatory cytokine complex that has been associated with chronic inflammatory diseases including rheumatoid arthritis and inflammatory bowel disease. this project aimed to investigate the role and expression of the cytokine / receptor pair il-21/il-21r in human tendinopathy. we found significantly elevated expression of il-21 receptor message and protein in human tendon samples but found no convincing evidence of the presence of il-21 at message or protein level. the level of expression of il-21r message / protein in human tenocytes was significantly upregulated by proinflammatory cytokines (tnf/il-1) in vitro. these findings demonstrate that il-21r is present in early human tendinopathy mainly expressed by tenocytes and macrophages. despite a lack of il-21 expression, these data again suggest that early tendinopathy has an inflammatory / cytokine phenotype, which may provide novel translational targets in the treatment of tendinopathy. |
it is accepted that surgical treatment of super superobese patients (bmi > 60 kg / m) and high - risk patients with comorbidities, is responsible for an increased risk of postoperative morbidity and mortality after bariatric surgery [1, 2 ]. sleeve gastrectomy is a recently used surgical technique, with an acceptable rate of postoperative complications. it has been described as a first step before a gastric bypass or biliopancreatic diversion with duodenal switch. the restrictive technique of sleeve gastrectomy reduces the gastric capacity by approximately 80%. in his study this is a prospective study that included 30 consecutive super superobese patients and was designed to study the efficacy and safety of the sleeve gastrectomy in this group of these patients. for the 30 super superobese patients, we evaluated : the duration of intervention, the early (less than 30 days) and late postoperative complications, hospital stay, loss of excess weight (% ewl), and the need for a second operation in the case of insufficient weight loss. all patients were operated by laparoscopy, and they were placed in the operating table according to the french position (the surgeon was positioned between the legs of the patient). the greater curvature of the stomach was freed with the ligasure (covidien, norwalk, ct, united states) until the angle of hiss. the left crura of the diaphragm was systematically visualised and posterior attachments of the stomach released. a 34 french boogie was introduced into the stomach and positioned along the lesser curvature. the stomach was cut with an incision parallel to the boogie using a linear stapler (endo gia 45 covidien, 4.8 mm, norwalk, ct, united states). in each case, the resected stomach was placed in a plastic bag and was extracted via the umbilical trocar. staple line was consistently reinforced by a nonabsorbable suture (endostich surgidac-2/0, covidien, norwalk, ct, united kingdom). the fascia of each port site greater than 12 mm in diameter was always closed. cautious refeeding was permitted in the absence of fistula, and patients were discharged after removal of the drain. iron, vitamin, and essential mineral supplements were systematically given to the patient at their discharge. all patients were super superobese with a mean bmi of 66 kg / m (range from 60 to 85 kg / m). one patient had a complete situs inversus and 4 others (14%) had previous gastric banding. immediate postoperative complications occurred in 4 patients (14%) : two presented subphrenic hematomas, one developed a gastric fistula, and one had pulmonary embolism. all three surgical complications required the creation of a laparoscopic drainage with no need for further surgical treatment. of the 23 patients that had a followup greater than 18 months, weight loss was satisfactory in 17 patients (77%). six patients had insufficient weight loss defined by a bmi between 35 to 40 kg / m, progressive weight regain or persistence of comorbidities supposed to improve with further weight loss. if the patient gave his consent for a second operation, then a gastro - intestinal contrast study was performed, in the presence of a dilated gastric pouch due either to incomplete gastric resection or to the persistence of hyperphagia responsible for a mechanical dilation a resleeve was proposed, otherwise, the choice of a gastric bypass was made (figure 1). the choice of resleeve as a revisional surgery was made for 2 reasons firstly it is reasonable to reoperate a stomach when there is still a secondary gastric pouch a known cause of weight loss failure and secondly, resleeve according to our previous experience, although we do not have a long term followup, has been shown to have better results associated to less morbidity and mortality rates for superobese patients. three out of six patients were reoperated with a resleeve gastrectomy, and two with a gastric bypass surgery 18 to 23 months after the initial procedure. three years after the original sleeve gastrectomy, the average loss of bmi was 20 kg / m (range 10 to 39 kg / m, figure 2). the average percentage of excess weight loss at 3 years was 51% (range 2182%, figure 3), while the average weight loss was 56 kg (range 28144 kg) (figure 4). during the followup, a port site hernia requiring surgical treatment was observed in 2 patients (7%). perioperative risks (morbidity and mortality) are known to be high for patients with super superobesity. the multidisciplinary team preoperatively should carefully evaluate the benefit / risk ratio of bariatric surgery in any given patient. gastric banding presents less risk but is also less effective in super superobese patients. gastric bypass and biliopancreatic diversion although associated to a higher morbidity ratio demonstrate excellent efficiency in regard to weight loss. the magenstrasse technique uses a longitudinal section of the stomach without gastric resection has been proposed in super superobesity because of its lower morbidity and mortality. this procedure that divides the stomach into two compartments preliminary results showed that the sleeve gastrectomy, after a 24-month period postroperatively was equally effective as gastric bypass in terms of weight loss in the super superobese patients while presenting lower risk for complications (3,6% to 9% resp.). the frequency of complications after gastric bypass in the super superobese can reach up to 23% and up to 38% for duodenal switch. in the super superobese patients, the death rate was assessed up to 2.7% after gastric bypass and 6.25% after duodenal switch. among our 30 patients, we had 3 immediate postoperative complications like hematoma or fistula that were successfully treated with laparoscopic drainage. current studies on the sleeve gastrectomy have published an average followup of less than 3 years [7, 9, 10 ] while two separate studies [6, 9 ] using a stapler line reinforcement, that is, the same technique with our team, reported also no postoperative morbidity and mortality. the initial rapid weight loss, reported by previous studies [4, 9, 11 ], reached a plateau at 18 months after surgery. we found the presence of insufficient weight loss in only 23% of patients at 18 months. in our group of 30 patients, 23 had a followup more than 18 months, 5 had a second operation 3 of them had a resleeve gastrectomy and 2 a gastric bypass. it is known that the sleeve gastrectomy in the super superobese can be a definitive treatment for an average loss of excess weight by 50% at one year [3, 10 ]. we have shown that the sleeve gastrectomy for the super superobese can allow an average loss of excess weight by 53% at 18 months. if weight loss was insufficient, the sleeve gastrectomy could then be followed by a second operating procedure, like gastric bypass or biliopancreatic diversion. the second operation presented less technical difficulties thanks to the weight loss already achieved since the first sleeve gastrectomy. five patients were operated for a second time, three of them had a resleeve gastrectomy, and two a gastric bypass as a second - step procedure. although we present a small group in this study, there were no postoperative complications associated to the excellent weight loss and these results demonstrate the efficacy as well as the safety of the second intervention. it is known that bariatric surgery provokes weight loss through dietary restriction or through the malabsorption it imposes. the mechanisms responsible for decreased appetite are poorly understood. to make things more complicated some of the excellent early results like the decrease in blood sugar and insulin resistance seem to be independent from the weight loss. a great interest has been reported for the role of ghrelin, a hormone that is secreted by the gastric fundus a part of the stomach that is largely resected in a sleeve gastrectomy. ghrelin is secreted under the influence of cholinergic stimulation and has probably a major role in controlling appetite since its receptors are present in the pituitary and hypothalamus. in humans, the serum concentration of ghrelin is increased in anorexia nervosa, prader willi syndrome, and in patients with a reduced caloric diet. ghrelin 's concentrations are decreased by food intake and after gastrectomy or gastric bypass [13, 14 ]. the absence of contact between food and the lining of the stomach producing ghrelin inhibits its secretion. in the case of sleeve gastrectomy, the removal of the ghrelin - producing area could eventually explain the weight loss. two separate studies reached the same conclusions with our team and have provided evidence for both an early and late ghrelin decrease after the sleeve gastrectomy [16, 17 ]. | objective. this prospective study evaluated laparoscopic sleeve gastrectomy for its safety and efficiency in excess weight loss (% ewl) in super superobese patients (bmi > 60 kg / m2). results. thirty patients (33 women and 7 men) were included, with mean age of 35 years (range 18 to 59). mean preoperative bmi was 66 kg / m2 (range 60 to 85). the study included one patient with complete situs inversus and 4 (14%) with previous restrictive gastric banding. the mean operative time was 120 minutes (range 80 to 220 min) and the mean hospital stay was 7.5 days (4 to 28 days). there was no postoperative mortality or need for a laparotomy conversion. two subphrenic hematomas, one gastric fistula, and one pulmonary embolism, were the major complications. after 18 months 17 (77%) had sufficient weight loss and six had insufficient results, leading to either re - sleeve gastrectomy (3), or gastric bypass (2). three years after the initial laparoscopic sleeve gastrectomy, the mean ewl was 51% (range 21 to 82). conclusion. the laparoscopic sleeve gastrectomy is a safe and efficient operating procedure for treating super superobesity. in the case of insufficient weight loss, a second - stage operation like resleeve gastrectomy or gastric bypass can be proposed. |
the pas - gaf - phy and pas - gaf fragments from deinococcus radiodurans were expressed in the escherichia coli strain bl21 (de3) and purified by affinity and size - exclusion chromatography. crystallographic data was collected at beamline id23 - 1 of the esrf (see extended data table 1). time - resolved x - ray scattering with millisecond time resolution were recorded at beamline csaxs of the swiss light source. saxs measurements were performed at beamline bm29 of the european synchrotron radiation facility (esrf) and analysed as summarised in extended data table 2a. time - resolved x - ray scattering data in the micro- and millisecond ranges were collected at beamline id-14-b, biocars, of the advanced photon source at argonne national laboratory. molecular dynamics simulations (gromacs 4.5.5) were used to generate trial solution structures and theoretical scattering curves were evaluated using zernike expansion as implemented in sastbx. a, statistics of the static saxs (bm29) data, including radii of gyration (rg), maximum particle dimension (dmax), porod volume (vporod), forward scattering (i0). the molecular weights (mmexp) were estimated from the i0 of bsa using the formula m(sample) m(bsa)[i0(sample)/i0(bsa) ], where m(bsa) = 66 kda. a - c, singular value decomposition (s(q, t) = u s v) of time - resolved solution scattering data from pas - gaf - phy. two components suffice to describe the data, the final product (n=1) and a transient low - q depression (n=2). a, the first three basis spectra (1, 2 and 3 columns of u.s), and original x - ray scattering data (black) with reconstruction based on the first two singular values (all columns of u.s.v red) are shown. b, relative amplitudes of the two first basis spectra (1st and 2nd columns of v). d, the rise of the pfr product state as measured by direct integration of difference scattering curves (1.2 3 ms, which appears to decay while the structural signal rises. this could be because the absorption properties depend weakly on the large - scale rearrangement. e, direct static difference data from figure 1, amplified by q to reveal wide - angle oscillations. extended data figure 2 | light - induced changes in the secondary structure of the evolutionally conserved phy tongue. a, secondary structure and topology of the deinococcus radiodurans pas - gaf - phy construct. the structural elements in our crystal structures are very similar to other published phytochrome structures. the phy tongue region (box), however, was found to refold upon illumination. the five - stranded -sheet core of the gaf domain is extended by a small sixth -strand (called 2) that interacts with the phy tongue (see fig. the mini - sheet structure at the knot region is not included in the graph. b, omit map of the phy tongue in the dark crystal form (upper panel) and the illuminated crystal form (lower panel). in the dark crystal form, the omit map density (blue) supports the built -turn secondary structure (orange sticks), even though most of the side chains are poorly resolved. in the illuminated crystal form, the omit map (blue) clearly reveals the density of a helix with its bulky side chains (orange). the omit maps were calculated by repeating molecular replacement and a refinement step (see supplementary information) with a structure where the phy tongue was removed. c, sequence alignment of part of the gaf domain and of phy loop region. the conserved dip motif in the gaf domain and prxsf motif in the phy tongue are marked by asterisks (). five representatives from eubacterial (bphp), cyanobacterial (cph), higher plant, fungi (fph) and pas - less phytochromes are shown. tomato t1 bphp, rhodopseudomonas palustris tie-1 bphp3, pseudomonas aeruginosa pao1 bphp, agrobacterium fabrum str. pcc6803 syn - cph1, microcystis aeruginosa nies-843, nodularia spumigena ccy9414, cyanothece sp. pcc 7822, anabaena variabilis atcc 29413, physcomitrella patens phy1, zea mays phyb1, populus trichocarpa phya, selaginella martensii phy1, arabidopsis thaliana phya, synechococcus osb syb - cph1, synechococcus osa sya - cph1, nostoc punctiforme pcc73102, lyngbya sp. extended data figure 3 | biliverdin structure and spectra in crystals. a, photographs of the crystals under cryogenic conditions at the beamline id23 - 1. b, biliverdin omit maps of the dark (upper left) and illuminated (upper right) form support the existence of the modelled biliverdin conformations (yellow and orange). comparison of the electron density around the biliverdin with published structures (lower panels). in the dark form, the electron density indicates a conformation similar to the published pr structures, including a d. radiodurans structure (2o9c, cyan). however, the electron density supports neither the biliverdin as determined in the pfr structure of pabphp (3nhq, red), nor as determined in the pr structure of d. radiodurans (2o9c, cyan). therefore the rotation of the biliverdin d - ring can not be reliably determined and is modelled with both possibilities (15za, and 15ea, orange and yellow in upper right panel). omit maps were calculated as in extended data figure 2 and contoured at a sigma level of 3.0. c, representative absorption spectra of the dark (black) and illuminated (grey) crystals, recorded at 123k. note that the terms illuminated and dark refer here to the crystallization conditions (see supplementary information for details). illumination with red light in the crystallization drops at ambient temperature led to a slight increase of far - red absorption and disintegration of the crystals (data not shown). the spectrum of the illuminated crystals shows that a substantial proportion (> 50%) of the proteins reside in pfr state. the illuminated crystals could be switched to pr - like absorption with far - red illumination. reversely, also the pfr - like features could be increased with red light (data not shown) with illumination at ambient temperature. exposure with light increased the scattering background in the absorption measurements. the crystals seemed unaffected by the illumination when illuminated with red light in the crystallization drops. although the spectral analyses of the illuminated crystals do not indicate a pure pfr spectrum, and the biliverdin conformation can not be fit unambiguously to the electron density, the remainder of the electron density is homogeneous (extended data figure 2b). most importantly, the tongue region of the phy domain adopts the conformation resembling the pfr state of pabphp (extended data figure 4b). the conformations of the four monomers in an asymmetric unit are practically identical and hence we conclude that biliverdin can co - exist in both pr and pfr states inside this crystal form and still the protein part represents the structural aspects of the pfr state only. a, comparison of the dark crystal form (green / dark grey) to cyanobacterial cph1 in pr state (pdb code 2vea, orange / light grey). b, comparison of the illuminated crystal form (green / dark grey) to pabphp in pfr state (pdb code 3nhq, orange / light grey). in both the pr and pfr forms, key interactions are conserved between the phytochromes (black dashes), as well as the positions of three conserved tongue motives (see extended data figure 2c). the residues of these three motives / a)g, prxsf, and (w / f, y)xe, with numbering from the d. radiodurans sequence. trp451 was not modelled in our illuminated crystal structure, and part of the phy tongue has been removed for clarity. small changes in relative orientations between the difference crystal structures are observed, e.g. a slight tilt of helix of the pfr tongue. a, experimental saxs data of dark (pr) and pre - illuminated (pfr) samples. the data is merged from the concentration series (extended data table 2b) and normalized on 0.4 nm < q < 0.6 nm. b, guinier plot of the low - q region, shown for all concentrations. inset shows the radii of gyration (rg) calculated from the curves in (a) according to the guinier approximation. c, average difference scattering signals calculated from the solution - structural models using three methods : crysol (default settings), sastbx with spherical harmonic expansion (she, default settings), and sastbx with zernike polynomial expansion as described in supplementary information. the choice of calculation method does not significantly change the predicted x - ray difference scattering. d, determination of the relative pr / pfr populations represented by the bm29 data as described in supplementary information. we find that our pr sample contained only pr (top) whereas in the pfr sample 64% of the protein molecules adopted the pfr conformation (bottom). 1) represent, up to a scaling factor, the relation between pure pr and pfr populations. this is in contrast to traditional saxs which report on population mixtures, because the pfr state can not be easily produced with 100% population in solution. crystal packing interactions of the (a) dark and (b) illuminated crystal forms. the dimer of an asymmetric unit is shown in red and the symmetry mates in grey., crystal contacts are seen in the top regions of the phy domains and therefore may cause artefacts in the long scaffolding helix and in the opening of the phy domains. in the illuminated form contacts are such that the phy domains may be pushed closer together, which is consistent with the larger separation of the phy domains as refined from the solution x - ray scattering data. it is noteworthy that the relative orientation of the monomers in the dimer is different between all three known structures for pas - gaf - phy phytochromes. for pseudomonas aeruginosa the dimer is parallel with variations in between different copies of the dimer in the crystallographic unit cell, in two cyanobacterial phytochrome an antiparallel dimer is observed, and in our pr structure, the monomer have an angle of approximately 45. extended data figure 7 | solution - structural refinement. a, the distribution of phy domain separations (rpp) obtained from unbiased md simulations (production runs 1 - 3). 3 are indicated by crosses (with n = 100, m 610). while the pr structures cluster in a region of high sampling, the pfr structures lie at the edges of the phy - phy distribution, suggesting inadequate sampling. to remedy this, we artificially scanned the phy domain separation in separate simulations (production runs 4 and 5) to improve sampling. b, the new distribution of pulled phy domain separations in the pfr state. the final analysis and all solution - structural conclusions drawn in this study are based on the trajectories described in b. c - e, consistency test of the structural refinement procedure. c, a cutoff parameter rcut was introduced to reject all md frames rpp < rcut. the resulting average over rpp of the best n = 100 pairs is plotted as a function of rcut. it is found that rpp rcut, which indicates that the best fit to the difference x - ray scattering data is always at the highest separations available in sampling range. d and e show the dependence of the total and average error as a function of rcut, respectively. it is observed that the error decreases steeply for rcut 5 nm, and only marginally forrcut 5 nm. we therefore consider optimization in the latter range overfitting, and applied rcut = 5.0 nm in the refinement for the solution structures. | sensory proteins must relay structural signals from the sensory site over large distances to regulatory output domains. phytochromes are a major family of red - light sensing kinases that control diverse cellular functions in plants, bacteria, and fungi.1 - 9 bacterial phytochromes consist of a photosensory core and a c - terminal regulatory domain.10,11 structures of photosensory cores are reported in the resting state12 - 18 and conformational responses to light activation have been proposed in the vicinity of the chromophore.19 - 23 however, the structure of the signalling state and the mechanism of downstream signal relay through the photosensory core remain elusive. here, we report crystal and solution structures of the resting and active states of the photosensory core of the bacteriophytochrome from deinococcus radiodurans. the structures reveal an open and closed form of the dimeric protein for the signalling and resting state, respectively. this nanometre scale rearrangement is controlled by refolding of an evolutionarily conserved tongue, which is in contact with the chromophore. the findings reveal an unusual mechanism where atomic scale conformational changes around the chromophore are first amplified into an ngstrm scale distance change in the tongue, and further grow into a nanometre scale conformational signal. the structural mechanism is a blueprint for understanding how the sensor proteins connect to the cellular signalling network. |
magnetic resonance imaging (mri) is one of the major imaging modalities in use today. compared to computed tomography (ct), mri has advantages in imaging soft tissues. however, its relatively long imaging time remains a great challenge for clinical application, often limiting its application. significant efforts have focused on faster data collection as well as reducing the amount of data required without degrading image quality. for example, parallel imaging [13 ] exploits redundancy in k - space by introducing multiple receiver channels, mitigating the aliasing artifacts caused by a reduced sampling rate. recently, compressed sensing based mri (cs - mri) allows high quality reconstruction from undersampled data by enforcing the pseudo - sparsity of images in a predefined basis or dictionary, such as the traditional two - dimensional (2d) separable wavelet transform or total variation. the discrete wavelet transform (dwt), for example, has three major disadvantages : shift sensitivity, poor directionality, and lack of phase information [7, 8 ]. for these reasons, traditional dwts fail to capture regularities of contours, since they are not able to sparsely represent one - dimensional singularities of 2d signals. therefore, improvements can be obtained by mitigating some of these disadvantages simultaneously. in this paper, we propose an improved compressed sensing method for mr imaging by utilizing the double - density dual - tree dwt. the authors in used dual - tree complex wavelet transform (dt - cwt) as a sparsifying transform, which only has wavelets oriented in six directions. but as natural images exhibit smooth regions that are punctuated with edges at several orientations, dual - tree complex wavelet transform may fail to sparsely represent the geometric regularity along the singularities, which require higher directional selectivity. but they can only sparsely represent the smooth contours but not the points in images [13, 14 ]. in this paper, we propose one possible solution by using a newly developed multiresolution tool, double - density dual - tree transform, which may provide sufficient sparse representation for mr images with different features. total variation is also exploited as a penalty in the reconstruction formulation to suppress noise. note that in, the authors applied their method to radial trajectories. in this paper, its variant on cartesian sampling is used for comparison, namely, cs dt - cwt. to differentiate between the original compressed sensing based mri algorithm and the improved version, we will denote the original algorithm in as cs and our proposed method as ics (improved compressed sensing mri)., we briefly review principles of mri and then discuss the design of our proposed algorithm. in section 3, we will present the experimental results of our algorithm in comparison with some other algorithms. finally, a brief conclusion will be drawn. mri signal is generated by the proton in hydrogen atoms, the main component of the human body. since protons are charged particles, when a human body is placed in an strong static magnetic field b0, protons will align themselves with the magnetic field, yielding a net magnetic moment precessing around b0. the frequency of larmor precession is proportional to the applied magnetic field strength as defined by (1)f=b0, where is a constant (42.57 mhz / t). if the frequency of the applied pulse is equal to the larmor frequency, the net magnetic moment will tilt away. once the rf signal is removed, the protons realign themselves such that the net magnetic moment is again aligned around b0. the protons return to equilibrium by emitting rf signal, which is then captured by a conductive field. this measurement is reconstructed to obtain gray - scale mr images. to produce a 3d image, a gradient magnetic field, gz, is added to b0 so that the larmor frequency changes linearly in the axial direction, z. hence, an axial slice can be selected by choosing a specific larmor frequency of that slice. additionally, two gradient magnetic fields, gx and gy, are applied causing the resonant frequencies of the protons to vary according to their positions in the x - y plane. as a result if the signal is fully sampled at the nyquist rate, a 2d inverse fourier transform is then used to transform the encoded image to the spatial domain. consider the following : (2)x = f1y, where y is the measurements from scanner, which is also called k - space data, f is the fourier transform matrix, and x is the desired mr image. but in the real world, downsampling may be needed for some applications, such as to fit the scans into one - breath hold or to enable real time - imaging. the 1d double - density discrete wavelet transform (dd - dwt) is based on one scaling function (i.e., low pass) and two different wavelets (i.e., high pass) where one wavelet is a half - sample shift of the other. the 2d transform applies the 1d transform alternately to the rows and column, giving nine subbands, where one is a low pass subband and the remaining eight subbands become eight wavelet filters. thus, the 2d complex double - density dual - tree discrete wavelet transform (cdddt - dwt) is implemented by using four 2d dd - dwt in parallel with different filter banks for rows and columns separately. lf and hf are the filter banks of the first level decomposition, which represent one scaling filter and eight wavelet filters. l and h are the filter banks for the second and remaining levels of decomposition. therefore, four low pass subbands (l11l14) and 32 high pass subbands (h11h14) are produced after one level of the transform. as a result, 32 wavelets are created by the sum and difference on each pair of subbands. the figures are obtained by setting all the wavelet coefficients to zero, for the exception of one wavelet coefficient in each of the high pass subbands of one level. therefore, if the transform has more directional wavelets, then fewer coefficients are needed to represent a given geometric object. obviously, 2d wavelet transform can resolve only three spatial - domain feature orientations : vertical, horizontal, and diagonal. in addition, the third wavelet does not have a dominant orientation, which is the main cause of artifact (checker board pattern). therefore, traditional 2d separable wavelet fails to sparsely represent geometric structures, such as edges. in figure 2(b), six orientations (15, 45, 75) are obtained by 2d dt - cwt. by contrast, complex double - density dual - tree wavelet transform has 32 wavelets oriented in 16 different angles (see figure 2(c)). the 16 wavelets shown in the first (second) row can be interpreted as the real (imaginary) parts of the set of 16 complex wavelets and the third row are the magnitudes of the 16 complex wavelets additionally, all of the wavelets are free of checker board pattern. as a result, we can get more accurate representation for the geometric regions. in figure 3 the first image group only contains a curve purposely designed to demonstrate the improved directionality property of cdddt - dwt. we reconstruct the test images using the first stage of transform coefficients. as we can see from figures 3(b) and 3(f), there are blocking artifacts in dwt reconstructions since it can only accurately represent vertical and horizontal lines. because dt - cwt has more directional wavelets, the reconstructed curve looks smoother and artifacts are reduced. but six orientations (figure 2(b)) are not sufficient to accurately represent this curve as it contains all directions. this is because it has more wavelets which are strongly oriented at 16 different angles. one may also conclude that 16 orientations are sufficient to represent any geometric object with high precision. compared to the curve, the points are better reconstructed by all the three transforms. as stated in the introduction section, wavelet transforms are good at capturing point singularities. from this example, we can see that cdddt - dwt can sparsely represent both contours and points, indicating its superiority for these tasks. the problem of undersampling k - space data actually leads to an underdetermined system of linear equations. one way to improve performance is to incorporate a prior knowledge into the reconstruction process which is based on the idea of sparsity in compressed sensing (cs) [2123 ]. the essence of cs is that a signal, which in our case is the image x, can be completely reconstructed with a high probability with far less samples than required by conventional nyquist - shannon sampling theorem, if the image has a sparse / compressible representation in a transform domain, such that most entries of the vector x are zero or close to zero. the entire process consists of three steps : encoding, sensing, and decoding. in the first step, the object image x of size n is encoded into a smaller vector y = fux of a size m (m < n) by the system matrix. fu denotes the fourier matrix associated with some undersampled trajectory while y is the corresponding undersample k - space data. directly solving the image is approximately sparse in cdddt - dwt, that is, = x, has few elements with relatively large magnitudes, a solution is possible. then the second step is obtaining the undersampled k - space data y from the imaging system. incorporating the sparsity prior knowledge into the process of image reconstruction, the third step is to recover (and thus x) by solving the following constrained optimization problem : (3)argminx||x||1 subject to ||fuxy||2<, where is a parameter controlling the data consistency. it has been mathematically proven that if the image has only k entries with relatively large magnitudes, the order of klog(n) measurements is sufficient to accurately reconstruct x via the 1 norm minimization procedure with high probability. as we have noticed from figure 3, therefore, in our proposed algorithm, we include the total variation (tv) as a penalty because it was shown that it is efficient in suppressing the noise in the reconstructed image. the constrained problem in (3) can also be converted into an unconstrained problem, giving rise to our proposed ics model : (4)arg minx1||x||1+2||x||tv+||fuxy||22, where two regularization factors 1 and 2 are introduced to leverage the cost function 's emphasis on the transform 1 penalty, tv penalty, and the data fidelity term. the selection of regularization factor has been an interesting area of research in the field of regularized iterative methods [25, 26 ]. a large 2 tends to suppress image gradient and make the reconstructed image look smooth, losing point - like features. in our study, we chose the optimized regularization parameters 1 and 2 for all methods for a fair comparison. the tv term of an image in this work is defined as follows : (5)||x||tv=|x|dx. in a discrete version, (5) becomes (6)||x||tv=i, j(xi+1,jxi, j)2+(xi, j+1xi, j)2. to speed up the implementation, we exploit a fast implementation of cdddt - dwt. since (4) poses an unconstrained convex optimization problem, we propose solving it using a nonlinear conjugate gradient descent algorithm that is similar to. it has been shown in that the iterative algorithm in our study has better performance than the algorithm in. the conjugate gradient requires the computation of j(x) which is (7)j(x)=1||x||1+2||x||tv+2fu(fuxy). as the 1 norm and total variation term (5) is the sum of absolute values, the absolute values, however, are not smooth functions, and as a result (7) is not well defined. in, lustig. approximated the absolute value with a smooth function, |x|xx+, where is a positive smoothing parameter. in this section, we report our experiments to evaluate and validate the proposed algorithm. there are five sets of experiments. in the first two experiments, numerical phantoms and simulated k - space data the third and fourth experiments used real data collected from real scanners. in the fifth experiment, we manually add noise to the k - space data of the fourth data set. the first phantom that we consider is the discrete shepp - logan, which contains geometrical structure and directional - oriented curves. the second phantom is purposely designed to be nonsparse under total variation domain and contains features difficult to reproduce with partial fourier sampling. in such way the final dataset was a coronal section of a brain obtained from a t1-weighted brain scan. to have a clear differentiation between these datasets, we name these four datasets as shepp - logan, phantom, axial brain, and coronal brain, respectively, as shown in figure 4. it should be pointed out that the proposed method also works with non - cartesian sampling pattern, such as spiral and radial trajectories, although these are not shown. reconstructions were performed at different sampling rates : 0.1, 0.15, 0.2, 0.25, 0.3, 0.35, and 0.4. a sampling pattern with sampling rate 0.2 is shown in figure 5 where white bar means that the data is sampled and black means otherwise (i.e., not sampled). the reconstructed data was quantitatively evaluated in terms of peak signal - to - noise rate (psnr) and structural similarity (ssim) index. psnr measures the difference between the reconstructed image x^ and original image x, which is defined by (8)psnr=20 log10(maxmse), where mse=(1/n)i=0n(xi - x^i)2 and max is the maximum possible pixel value of the image. the structural similarity (ssim) index is highly effective for measuring the structural similarity between two images. suppose and t are local image patches taken from the same location of two images that are being compared. the local ssim index measures three similarities of the image patches : the similarity of luminances l(, t), the similarity of contrasts c(, t), and similarity of structures s(, t). local ssim is defined as (9)s(,t)=l(,t)c(,t)s(,t) = (2t+c1p2+t2+c1)(2t+c2p2+t2+c2)(2t+c3t+c3), where and t are local means, and t are local standard deviations, and t is cross - correlation after removing their means. the higher the value of ssim, the higher image quality is delivered. in this paper, three methods will be compared under identical conditions. the first method uses the discrete wavelet transform (shown as cs) ; the second method uses dual - tree complex wavelet transform (shown as cs dt - cwt) ; the proposed method uses complex double - density dual - tree wavelet transform (cdddt - dwt, denoted by ics for the rest of the paper). reconstruction was done under the same conditions such as iterative algorithm and sampling pattern as the accuracy depends on the selection of optimum regularization parameters. we have used the last dataset, coronal brain, as an example to show the methodology of determining the optimal parameters. for each algorithm then we set 2 = 0.001 and searched the optimal value for 1 that gives the highest psnr, as shown in figure 6(b). thus, we used this recurring process to determine the optimum values of 1 and 2. figures 7(b), 7(c), and 7(d) are reconstructions by cs method, cs dt - cwt, and our proposed method ics, respectively. the weakness of the traditional separable wavelet transform in representing two - dimensional singularities, for example, curves and edges, is visualized with the reconstructed shepp - logan images. as we have seen that separable wavelet transform can resolve only three spatial - domain feature orientations. therefore, the ellipses are not sparsely represented, causing substantial artifacts in the reconstructed images (figure 7(b)). for example, two small ellipses around center (as indicated by white arrows) are faded away from the cs reconstruction. to see it clearly, detailed zoom - ins by contrast, the proposed method reconstructs the image with higher visual image quality. from figures 7(e)to 7(h), we can see that, with more directional wavelets, the ellipses are better reconstructed. the reconstruction by complex double - density dual - tree wavelet transform has the best visual image quality. additionally, the two small ellipses could be clearly recognized ; see figure 7(h). similar results can be obtained from the second phantom experiment. from figure 8(b), we can see significant aliasing artifacts in the cs reconstruction. these artifacts are caused by the use of nonideal low pass and high pass filters in the traditional separable wavelet transform. additionally, from the detailed zoom - in (figure 8(f)), we can see that cs can not reconstruct those closely placed lines separately. one possible reason for this phenomenon may be that the wavelets of dw - cwt and cdddt - dwt are finer than those of dwt see figure 1. this is evident that our method leads to a better reconstruction with higher spatial resolution. in order to see how the results vary with the sampling rates, experiments were also performed at sampling rates of 0.1, 0.15, 0.25, 0.3, 0.35, and 0.4. the plots of psnr and ssim versus different sampling rates for the phantom simulations are shown in figure 9. at sampling rate 0.25, the psnr of the shepp - logan image by our proposed method is 41.5 db, and structural similarity is well above 0.93. there is no visual difference between the reference and reconstructed images using the proposed method. on the other hand, reducing the sampling rate below 0.2, reconstructed images are obviously blurred and their quality is not acceptable. one possible reason for the failure of compressed sensing methods is that the initial image is too bad at such low sampling rates. figures 10 and 11 show the reconstructed images where (a), (b), (c), and (d) are original images, cs reconstructions, cs dt - cwt reconstructions, and our ics reconstructions, respectively. note that although both cs reconstructions are able to reduce the undersampling artifacts significantly, the images obtained by cs contain significant blocking artifacts along directional edges. to emphasize this point, detail views of the reconstructed images this is because the diagonal wavelet of traditional wavelet transform does not have a dominant orientation see figure 1(a). as a result, it can not represent the curves efficiently, leading to considerable artifacts along edges. dual - tree complex wavelet transform can resolve six orientations, both of which have a dominant orientation, and thus the image quality is greatly improved by cs dt - cwt. in contrast, since complex double - density dual - tree wavelet has improved directional selectivity and finer wavelets than dwt and dt - cwt, the proposed method preserves more edges and small structures. therefore, the images obtained using our proposed method are much closer to the original images. figure 10(h) and figure 11(h) indicate that edges are sharper in the reconstructed image using our proposed method. the evaluation matrices (psnrs and ssims) of the reconstructed images are also plotted against the sampling rates in figure 12. figure 12 also indicates that psnrs and ssims of reconstructions by our proposed method in all cases are higher than those of other methods. one should also note that the original cs method can produce an accurate reconstruction given a sufficient sampling rate. for instance, the results in showed that cs can produce high quality brain image without artifacts at sampling rate 0.42 (2.4 acceleration). note that the psnr of cs method is well above 35 db and ssim is as high as 0.9 at sampling rate 0.4. but at low sampling rates, reconstructed image is not satisfactory. as a result our proposed complex double - density dual - tree wavelet is able to capture those geometric features that are not captured by other transforms, producing a higher quality of image. the results of this test confirm that our proposed method outperforms the original cs method in preserving edges and suppressing undersampled artifacts. finally, we reconstructed the coronal brain image using imperfect k - space data to test the robustness of the proposed method. additive gaussian white noise e of relative magnitude ||e||2/||fxture||2 = 0.05 was purposely added to the k - space data., we can see that the parameter 2 is bigger when noisy data is used for reconstruction for all the methods. but if 2 is too large, the reconstructed image will be oversmooth, losing low contrast or detailed information. although the image quality is reduced, the proposed method can still maintain the best results. from the various results presented in this section, proposed method delivers higher psnr and ssim than other methods. however, the computation time of cs - based methods including the proposed algorithm is about 70 seconds. development of faster algorithms for solving problem (4) will be pursued in the future work. in this paper, an improved compressed sensing mri method is proposed. the directionality property of complex double - density dual - tree wavelet transform is investigated. considering the edge features and quality, we employ objective measurements to evaluate the performance of our approach. simulation results on phantom and in vivo data demonstrate that the proposed method can better reconstruct the edges and reduce undersampled artifacts than traditional cs - mri method does. in our implementation, we use the nonlinear conjugate gradient iterative method to solve the unconstrained optimization problem. further effort is needed to utilize a more advanced iterative method to improve reconstructed precision and reduce computational time for real time - imaging. extension of this work with the nonconvex optimization is being considered to further improve the reconstruction. | undersampling k - space data is an efficient way to speed up the magnetic resonance imaging (mri) process. as a newly developed mathematical framework of signal sampling and recovery, compressed sensing (cs) allows signal acquisition using fewer samples than what is specified by nyquist - shannon sampling theorem whenever the signal is sparse. as a result, cs has great potential in reducing data acquisition time in mri. in traditional compressed sensing mri methods, an image is reconstructed by enforcing its sparse representation with respect to a basis, usually wavelet transform or total variation. in this paper, we propose an improved compressed sensing - based reconstruction method using the complex double - density dual - tree discrete wavelet transform. our experiments demonstrate that this method can reduce aliasing artifacts and achieve higher peak signal - to - noise ratio (psnr) and structural similarity (ssim) index. |
acceptor systems such as substituted benzenes reveals many interesting processes occurring in electronically excited states. particularly, dual fluorescence of 4-(n, n - dimethylamino)benzonitrile (dmabn) in polar solution, consisting of an emission from the lb state and an anomalous red - shifted emission from the la state has attracted considerable attention. the lb state is usually characterized to be local excitation (le) and the la state as charge - transfer (ct) state. the position and intensity of the red - shifted band show a marked dependence on solvent polarity. this property was interpreted as an indication for a large dipole moment of the emitting state and hence for its charge - transfer character. in contrast to solution, in the gas phase, the emission spectrum of dmabn consists of a single local excitation (le) fluorescence band s1(lb), and evidence for a le ict process in dmabn was not found. the structural and electronic nature of the red - shifted emission band of dmabn the most widely accepted concept is based on the twisted intramolecular charge - transfer (tict) model in which the torsion of the dimethylamino group around the cn bond to the phenyl ring induces a charge transfer in which the former group acts as electron donor and the benzonitrile moiety as the electron acceptor. alternatively, a ct process has been suggested to occur at planar dmabn structures (pict model) where the vibronic interaction in the franck condon region is the important factor for the formation of the ct state. the third model to be mentioned here is the rehybridized ict (rict) model representing a bent cn state. even though it was not considered a viable alternative to the tict model for dmabn originally, in later work the main features have been taken up as the origin of a new state involved in the electron - transfer dynamics. based on the models listed above, the structural and dynamical aspects of the ict in dmabn have been widely investigated from an experimental as well as from a computational point of view. the absorption spectrum of dmabn in the gas phase consists of a main band with a maximum at 4.57 ev attributed to s2(la, ct) and a weak absorption with a lower - energy shoulder with a band maximum given at 4.13 ev attributed to the s1(lb, le) state. the ultrafast photodynamics of dmabn starting in the bright s2(la) state has been investigated by fuss. by means of femtosecond pump probe experiments in the gas phase using nonresonant multiphoton ionization as a probe process. the main mechanistic result deduced from this investigation is the ultrafast relaxation (68 fs) to the ct and lb - type s1 states. after equilibration within 1 ps, the molecule relaxes further within 90 ps to a lower excited triplet state and then decomposes within 300 ps. it was also shown that the passage through the conical intersection involves strong geometrical distortions which were related to a twist coordinate.. led to a similar analysis of the photodynamics indicating also a broadening of the rotational contour above an excess energy of 600 cm. this fact was ascribed in ref (18) to the conversion of the initially excited lb state to the higher - lying ct state with an activation barrier of 600 cm. quantum chemical calculations exploring the torsional potential within the tict model performed at configuration interaction with singles (cis), complete active space self - consistent field (casscf), and cas perturbation theory to second order (caspt2) by sobolewski. show that the former two methods do not provide a correct description of the torsional behavior of the le and ct states, e.g., the casscf approach does not lead to a crossing between the two states at 45. caspt2 calculations have been also performed by serrano - andres. in this work, the effect of the torsional mode in the tict model and the wagging mode of the dimethylamino group have been compared with respect to the charge transfer required by the dependence of the second fluorescence band on polar solvents. it was shown that in contrast to the torsional mode, the wagging mode was unable to lead to the required significant charge separation, thus favoring the tict model for the explanation of the experimental findings. a similar conclusion has been reached by mennucci. based on multireference perturbation configuration interaction (cipsi). full geometry optimizations of the le and ct states have been reported by rappoport and furche based on time - dependent density functional theory (td - dft) and by khn and httig using the approximate coupled - cluster singles - and - doubles method cc2. both studies also investigate the change in force constants and vibrational frequencies of the le and ct states as compared to the ground state and find good agreement with picosecond time - resolved infrared (ir) and resonance raman spectra. according to these studies, the le state has a c2 symmetric minimum. in the cc2 calculations, three coordinates contribute to the reaction path from le to ict : the twisting motion of the dimethylamino group, the just - mentioned pyramidalization of the ring carbon atom, and quinoidalization modes of the ring. both td - dft and cc2 support the assumption that the torsional mode stabilizes the ct state and is a major driving force of the photodynamics. the investigation by gmez. was dedicated to the description of the s2/s1 intersection seam and its connection to the internal conversion process. it was found that the torsion of the n(ch3)2 group is not included in the two coordinates describing the intersection seam. the first consists of a nonadiabatic reaction path, evolving after vertical excitation to s2 via the transient s2-pict structure toward the crossing seam. depending on the actual torsional angle, a wide range of the seam can be accessed where internal conversion to s1 can occur. on the basis of the fact that the minimum of the intersection seam has a planar structure, the other pathway possesses adiabatic character and connects the le and tict structures on the s1 state with an energy barrier of 18 kcal / mol from the side of the le structure. recent nonadiabatic photodynamics simulations based on the algebraic diagrammatic construction method to second order (adc(2)) show a picture which is in good agreement with the findings of gmez. the transition from the s2 to the s1 state is extremely fast (8.5 fs) and does not include the n(ch3)2 twisting motion. population of the tict state occurs primarily via equilibration from the le state as already suggested in ref (22) based on time - correlated single - photon counting experiments. the idea of the rict structure has been taken up in tddft / bp86 calculation by zgierski and lim. by variation of the c(ph)cn angle in dmabn, a 1a() state is found, located at 120 and 3.28 ev above the ground state. this state is characterized by the charge transfer from an aromatic orbital to a orbital of the cyano group. subsequent tddft / b3lyp calculations resulted in an energy of 4.20 ev for that state, a value which compares somewhat better with caspt2 results of 4.50 ev and 4.92 ev. transient excited - state absorption (esa) of dmabn measured in n - hexane and in acetonitrile (an) plays an important part in analyzing the role of the ict for the dual fluorescence mechanism. in hexane, a uniform decrease of all absorption bands is observed and no indication for an ict state is found. in acetonitrile, the situation is different. a decrease of the bands at 360 and 680 nm assigned to le absorption combined with an increase of the ict band at 320 nm is found. both the appearance of the ict band and the decrease of the bands assigned to the le state occur with the same lifetime of 4 ps. the character of the 680 nm band has been reassigned to a transition based on the absence of transitions with significant oscillator strength starting from the lb state computed at the tddft level and the observed blue shift of the 680 nm band with increasing probe delay times. the latter observation compares well with the charge - transfer character of the state. the just - mentioned reassignment led to the proposition of a -mediated ict mechanism where a reaction sequence of ict structures is proposed. however, it should be mentioned that caspt2 calculations were reported which, in contrast to the just - mentioned tddft investigations, give excitation energies for the le state which are in good agreement with the experimentally observed bands so that from that point of view a state need not be invoked for the assignment of the 680 nm band. the differences in the nanosecond decay time between the transient absorption of the tict state (4.8 ns) and the fluorescence decay of the ict (2.9 ns) in an led to the conclusion that these two states are not identical. combined casscf and caspt2 calculations reported in ref (38) indicated the existence of a partially twisted ict (ptict) structure with a twisting angle of 53. the fluorescence with the decay time of 2.9 ns was uniquely assigned to originate from the ptict structure. in view of the still existing different interpretations and structural models for the explanation of the dual fluorescence of dmabn, the purpose of the present study is to perform a detailed survey of the excited - state mechanism of ict using multireference methods which can simultaneously describe the energy surfaces of the le and ct states and their nonadiabatic crossing regions and are capable of full optimization of excited - state geometries and conical intersections. special emphasis is given to the calculation of solvent effects in the excited state using a polarizable continuum model based on the conductor - like screening model (cosmo). the question of dual fluorescence of dmabn in that solvent and the role of the state were addressed as well. because in this case conical intersections need not be considered and a multitude of excited states had to be computed which would increase the effort of mr calculations significantly, we decided to use for that purpose a more straightforward approach, the aforementioned adc(2) method in combination with the recently developed methods for excited - state solvation within cosmo. the geometry optimization of dmabn in the ground state was performed at second order mller plesset perturbation theory (mp2) using the split valence polarization basis (svp).c2v symmetry was used with c2 along the z axis and the benzene ring located in the yz plane. the calculations on electronically excited states were performed using the complete active space self - consistent field (casscf) method and multireference configuration interaction with single excitations (mr - cis) and with single and double excitations (mr - cisd), accounting for dynamic electron correlation effects. the active space chosen for the casscf wave functions was a cas(10,9) consisting of 10 electrons in 9 active and orbitals. the active space comprises the bonding and antibonding orbitals of the benzonitrile and of the amino n atom. in the casscf calculations, a state - averaging (sa) procedure was adopted with equal weights for the lowest three singlet states (sa-3). based on the molecular orbitals computed at the sa-3-casscf(10,9) level, mrci calculations were performed with an mr - cis reference space composed of 10 electrons in 9 orbitals (mr - cis(10,9)), of 8 electrons in 7 orbitals (mr - cis(8,7)), and with a mr - cisd reference space composed of 6 electrons in 5 orbitals (mr - cisd(6,5). in all cases, the 11 1s orbitals on the carbon and nitrogen atoms were kept frozen. the orbital occupation scheme of the different reference wave functions are collected in table s1 of the supporting information. size - extensivity corrections were taken into account in single - point calculations according to pople. geometry optimizations and the determination of the minima on the crossing seam (mxs) have been performed with the (10s6p3d)/[3s2p1d ] basis for n and c and (7s)/[2s ] for h. the extended basis [4s3p2d ] for n and c atoms was also applied in selected cases. the first basis set is termed ano - dz, and the second one ano - tz. dipole moments and population analysis data were computed at the mr - cis level for gas phase and solution. three states are included in the state - averaging procedure (sa-3) : the ground state and the two low - lying singlet excited states le and ct. the twisting () and wagging () angles of the amino group of dmabn were chosen as reaction coordinates to construct energy curves and energy surfaces for the s1 and s2 states. the twisting coordinate was defined as = (1 + 2)/2, and the wagging coordinate as = (1 2)/2, where 1 and 2 are the torsional angles c2c1n1c6 and c2c1n1c6, respectively (figure 1). solvent effects were taken into account in single - point calculations by means of the conductor - like screening model. nonequilibrium and equilibrium versions were used for the excited states in solution for mrci as described in refs (58 and 59). for a discussion concerning the excited - state adc(2)-cosmo calculations, see ref (39). condon excitations and fluorescent transitions were treated at the nonequilibrium level, whereas for the reaction paths the equilibrium approach was used. in the latter case optimized geometries of dmabn in the ground state (c2v symmetry) (a), in the s1(le) state (c2) (b), in the ct state (c1) (c), in the s2/s1 mxs (c2) (d) at the mrcis (8,7)/ano - dz level, and in the state (cs) (e) at the adc(2)/tzvp level. for the ground - state structure, the mrcis (8,7)/ano - dz results are given in roman type, mp2/svp data are presented in bold, and the experimental data in italic. geometries of le and ct stationary points, and the mxs between those two states were optimized at the mr - cis level using analytic mr - ci gradients and nonadiabatic coupling vectors. mr - cis second derivatives of the energy were computed numerically using analytically calculated first derivatives. all other calculations have been carried out with the program system columbus using its parallel version. to assess the accuracy of the different multireference approaches used, the two low - lying vertical excitation energies of dmabn were computed at casscf, mrcis, and mrcisd levels of theory using the ano - dz and ano - tz basis sets and compared to the experimental gas phase data (table 1). it should be noted that the absorption maximum (s2,abs) in the gas phase comes directly from the experimental spectrum, whereas the (s1,abs) is hidden under the strong s2 absorption and its value was obtained after extrapolation. the (10,9), (8,7), and (6,5) reference spaces were tested in mr - cis and mr - cisd calculations. total energy of b2(le) state : 455.6544360 au, calculated with the ano - dz basis set (atomic natural orbital (ano) basis set - (10s6p3d)/[3s2p1d ] basis for n and c and (7s)/[2s ] for h) and pople correction (+ p). total energy of a1(ct) state : 455.6332238 au calculated with the ano - dz basis set and pople correction (+ p). at all computational levels, the transition to the s1(b2) state possesses a small oscillator strength. it involves mainly a homo(namino, ncyano, cph)lumo+1(cph) transition with dominant local excitation character. it is due to a homo(namino, ncyano, cph)lumo(ncyano, cph,,namino) transition which possesses partial charge - transfer character. the orbitals, involved in the transitions above are plotted in figure s1a of the supporting information. the casscf calculation overestimates the energy of the s2(a1) state by 1.4 ev as compared to the experimental value, similar to the results reported in refs (8 and 28). the single excitation correction produces an energy decrease of s2(a1) by 1 ev, whereas the energy of the s1(b2) state is not changed. reducing the reference cas from (10,9) to (8,7) leads to an increase of the s1(b2) and s2(a1) energies by 0.10.3 ev. the single and double excitations calculations (mr - cisd(6,5)+p and mr - cisd(8,7)+p) do not improve the excitation energies and even lead to their slight increase. the extended basis set, ano - tz, changes the energies of both excited states only slightly. higher - order excitations using the pople correction lower the absorption energies significantly, bringing them into quite good agreement with experimental values. the calculated (s1/s2) gaps computed at the mrcis(8,7)+p and mrcisd(6,5)+p levels agree well with the experimental data (table 1). among the methods tested, the mrcis(8,7)+p / ano - dz provides the best approach with respect to experimental s1 and s2 vertical excitation energies (both excited states are overestimated by about 0.3 ev) and reproduces the (s1/s2) gap of 0.57 ev very well. in view of the good performance of the mrcis(8,7)+p / ano - dz level and because of considerations of computational efficiency, all calculated transition energies presented below were performed with this approach. next, the optimized geometries in the franck condon (fc) region are discussed (figure 1a c). the optimized geometries of s2/s1 mxs state and the state, discussed in the following sections, are given in figure 1d, e. the mp2/svp calculations for the s0 geometry yield a minimum at cs symmetry (i.e., = 0.0) and a wagging angle of = 10.2. the experimental and angles obtained from x - ray diffraction measurements (at 253 k) are 0.0 and 7.7, respectively. microwave spectroscopic measurements in the gas phase lead to a angle of about 15. the mp2 calculations reproduce well the amino c1n1 and c4c5 bond lengths (= 0.0050.007), whereas the calculated phenyl c c and cyano c5n2 bond lengths are longer by 0.020.03 as compared to the crystallographic data. the c2v symmetry structure (= = 0) is only slightly higher in energy by 0.06 kcal / mol than the cs structure. the ground - state dmabn structure was also calculated with the mrcis(8,7) method (figure 1a) ; the bond distances are comparable with the mp2 bond distances (up to 0.007). it should be noted that the mrcis(8,7) method reproduces better the cyano c5n2 bond length (1.157 versus 1.145 exptl), whereas with mp2/svp and cc2/tzvpp it is too large by 0.035. the phenyl moiety shows a quinoidal distortion along the long molecular axis (i.e., shortened c2c3, c2c3 bond lengths). the c namino bond distance (calcd, 1.372 (mp2) ; exptl, 1.365) is shorter than a normal single c n bond (1.46) because of the resonance between the dimethylamino part and the adjacent benzene ring. around the franck the le geometry was optimized without symmetry constraint at the mrcis(8,7)/ano - dz level. the optimized le geometry reveals a twisting angle of 13.9, a wagging angle of 0, and out - of - plane benzene h atoms (dihedral hcch angle, 5) (figure 1b). the calculated and values can be compared to the experimental ones of = 30 ; = 0 obtained by microwave spectroscopy ; = 30 by time - of - flight mass spectroscopy ; = 26 by resonant enhanced two - photon ionization ; and = 25, = 3 by rotationally resolved fluorescence spectra. it should be noted that the potential energy curve of the le state with regard to the twisting coordinate appears quite shallow in the region of 030 (see below), allowing the twisting angle to vary largely. the le geometry is characterized by an elongation of the phenyl c1c2 and c2c3 bond lengths by 0.017 and 0.036, respectively, and by slight variations of the c5n2, c2n1, and c4c5 bond lengths (up to 0.008) as compared to the ground state. the cc2/tzvpp calculations of dmabn (c2) show similar and values of 19 and 0, respectively, and similar trends in bond length changes. the intense ultraviolet (uv) absorption due to the s2 state is assigned to the ct state with a large dipole moment in the fc region. in the fc region, the s2(ct) geometry is not stable. instead, the ct state twists around the c1n1 bond and shows a minimum (then in the s1 state) at a twisting angle of 90.2 and a wagging angle of 0.8. selected structural data are given in figure 1c. the small deviations from 90 and 0 are not considered to be significant and are due to the shallow energy surface in this region of angles. the optimized ct geometry is characterized by significant quinoidal distortions (i.e., shortened c2c3 and c2c3 bond lengths) as compared to the ground state and also to the le structure. the most significant geometrical change was found for the c1n1amino bond, which elongates by 0.06, facilitating rotation around c the c4c5 bond is shortened by 0.02, whereas the cn bond is slightly stretched by 0.01 as compared to the s0 geometry. bond length changes have been estimated experimentally by comparing the vibrational frequencies in the ct state to those in the ground state. numerous efforts were made to measure the vibrational frequencies of dmabn in the ct state by picosecond ir, picosecond time - resolved resonance raman spectroscopies and femtosecond stimulated raman spectra. the elongation of the c namino and c ncyano bonds in the ct state was confirmed by these experimental studies, supporting the tict structure in which the -conjugation including the c namino bond is broken. for comparison, the ct geometry obtained by cc2/tzvp calculations showed a saddle point structure with a twisting angle at 90, a wagging angle of 0, and an out - of - plane angle at 41. the bond length changes (s0 to ct) calculated by cc2 and mrcis(8,7) methods follow the same trend. the calculated vertical excitation energies, minimum - to - minimum and vertical fluorescence energies in the gas phase and in an solution are presented in table 2. position of 00 transition (approximation) ; the result in ref (27) was used. laser - induced fluorescence (lif) excitation spectrum in the gas phase, ref (45). the calculated oscillator strength for the vertical excitation to the s2(ct) state is large and will dominate the absorption intensity in comparison to the s1(le) state. going from gas phase to an solution the experimental absorption energy decreases from 4.57 to 4.24 ev, resulting in a decrease of the e(s1s2) energy gap from 0.44 ev (gas) to 0.38 ev (an). in accordance with the experiment, the calculations in an solution showed a decrease of the vertical excitation energy of the s2 state (4.90 ev (gas) to 4.75 ev (an)) and of the e(s1,s2) energy gap from 0.58 ev (gas) to 0.41 ev (an) (table 2). a similar trend of the solvent effects (aprotic and protic solvent) was predicted from the average solvent electrostatic potential from molecular dynamics (asep / md) calculations of the dmabn uv / vis spectra. the energy diagrams of the le tict process for dmabn in the gas phase and an solution are compared in figure 2. le / ct energy diagram (ev) of dmabn in vacuum (black) and acetonitrile (red) calculated at the mrcis(8,7)+p / ano - dz level. the calculated e for the le tict reaction in the gas phase is positive (0.16 ev) in keeping with the positive formation enthalpy (0.05 ev), determined by extrapolation from plots of h vs the solvent polarity parameter. in line with the experiment, caspt2 calculations have predicted a positive e of 0.41 kcal / mol (0.02 ev) for a twisted ict and of 7.10 kcal / mol (0.31 ev) for a planar ict. the experimental and calculated endothermic reaction le ict of dmabn in the gas phase is in line with the absence of dual fluorescence in the gas phase. the cc2/svp calculations, however, have predicted a small exothermic gas - phase le ict reaction of dmabn (e= 1.84 kcal / mol/0.08 ev). this result was corrected by using higher - order coupled cluster single and double excitations with noniterative triple - corrected excitation energy (ccsdr(3)) calculations, which shifted the ict level to higher energy by 0.2 ev relative to the le level. in an solution, the e for the reaction le ict calculated at the mrcis(8,7)+p / ano - dz level is negative (0.25 ev), which is consistent with the experimental exothermic reaction (e = 0.28 ev). the exothermic le ict reaction is in accordance with the ict producing dual fluorescence in an solution. finally, dmabn relaxes into s0 via fluorescence emission from s1. the emission energy at the le geometry is 3.93 ev in the gas phase and 3.94 ev in an. the experiment predicts a somewhat larger solvent effect on le emission energies : 3.68 ev in the gas phase and 3.44 ev in an. the an solvent stabilizes the ct structure significantly more than the le structure leading to a negative energy of the le ct reaction (figure 2). the calculated emission energy of 3.27 ev for the optimized tict structure in the gas phase shows good agreement with the experimental ict emission energy of 3.55 ev for dmabn in the gas phase (extrapolated from solvent series). both experimental and calculated ict emission transitions of dmabn in an are found at lower energies, 2.52 and 2.77 ev, respectively. the an solvent produces greater stabilization of the ict structure and hence a red - shift of the emission maximum for dmabn in the tict state. similar results were obtained recently from adc(2)/cosmo calculations and from asep / md calculations. in table 3, the mrcis(8,7)/ano - dz dipole moments of the gs, le, and ct states are compared to the experimental values and to those obtained in other calculations. the mp2/svp optimized ground - state geometry of dmabn in c2v symmetry (, = 0) was taken as starting point for computing potential energy curves along the twisting angle (rotation around the c1n1 bond ; = 0, 15, 30, 45, 48, 49, 50, 60, 75, 90) and the two - dimensional potential energy surfaces in both the twisting and wagging (= 0, 5, 10, 15, 20) coordinates in the gas phase and an solution. the shape of the most important mos can be found in figures s1a, b and s2a, b of the supporting information. rigid potential energy curves along the twisting angle (the wagging angle is fixed at 0) (a) and charge transfer, qring+cn (e) (b) for the two lowest singlet excited states of dmabn in the gas phase at the mrcis(8,7)+p / ano - dz level. energies are given relative to the s0 energy of the ground - state minimum at c2v symmetry (, = 0). inspection of the potential energy curve along the twisting path (figure 3a) shows the two minima in the s1 state : the le state at the nontwisted geometry (= 0) and the ct state at the perpendicular twisted geometry (= 90) of dmabn. the energy of the nontwisted geometry is lower by 0.27 ev as compared to s1 at twisted dmabn. potential energy surfaces along the twisting () and wagging () coordinates of the two lowest singlet excited states of dmabn in the gas phase at the mrcis(8,7)+p / ano - dz level. as shown in figure 3a, with the increase of the twisting angle, the s1 and s2 states cross at 50. inspecting the calculated fragment charge of the phenyl ring plus cn group, qring+cn, computed from a mulliken population analysis, illustrates charge transfer in the s2 state that is only slightly larger than that in the s1 state for the nontwisted form (figure 3b). along the twisting coordinate between 0 and 48, the charge - transfer character of the s2(ct) state progressively increases by 0.1 e : the charge qring+cn decreases from 0.3 e to 0.4 e (the main contribution belongs to the acceptor (a) phenyl charge), whereas concomitantly the charge of the donor (d) amino group increases from + 0.3 e to + 0.4 e. at a twisting angle of 50, the character between the two states is abruptly exchanged because of the intersection of the two states. after the intersection the state characters are ct for s1 and le for s2. along the twisting coordinate from 50 to 90, the energy of the s1(ct) state decreases with the increase of its charge transfer (figure 3). the large dipole moment and large charge separation figure 4 displays the s1 and s2 energy surfaces in the torsion and wagging coordinates. it can be seen that altering the wagging angle does not lift this degeneracy significantly. the calculated potential energy curves, the fragment charge qring+cn, and energy surfaces of dmabn in an (equilibrium solvation conditions) are plotted in figures 5a, b and 6, respectively. for comparison, the nonequilibrium solvent calculations of the potential energy curves and surfaces of dmabn were also calculated. they are presented in the supporting information (figure s3 and figure s4). the computed potential energy curves and surfaces are very similar in both solvation cases. potential energy curves along the twisting angle (the wagging angle is fixed at 0) (a) and charge transfer, qring+cn (e) (b), of the two lowest singlet excited states of dmabn in acetonitrile for equilibrium solvent conditions at the mrcis(8,7)+p / ano - dz level. in an, the s1 and s2 energy curves resemble those in the gas phase up to = 50, only the energy gap, (s1/s2), is smaller for an solvation. the s1 energy curve in an shows also two minima as in the gas phase, but unlike the gas - phase curves the lower energy minimum appears at the twisted (90) dmabn form (by 0.46 ev). there is a quite strong stabilization of the s1 (ct) state at = 90, but the gap to the s0 state remains still quite large (2.9 ev). potential energy surfaces along the twisting () and wagging () coordinates of the two lowest singlet excited states of dmabn in acetonitrile for equilibrium conditions at the mrcis(8,7)+p / ano - dz level. to illustrate the stabilization of the tict state in solution, the fragment charge qring+cn for s0, s1, and s2 state inspection of the charge transfer in the s1 and s2 states for the gas phase (figure 3b) and solution (figure 5b) for the nontwisted dmabn form shows a slight solvent effect on the charge separation. the small difference in charge transfer for the s1 and s2 states found in the gas phase disappears in solution. on the other hand, the solvent causes a somewhat larger charge separation (0.09 e (gas), 0.13 e (an)) in the nontwisted ground - state form. along the twisting coordinates between 0 and 55, the charge transfer of the s2(ct) state progressively increases, following the trend found in the gas phase. the calculations predict a somewhat larger charge separation in solution for the s2(ct) state (increases by 0.2 e. from 0 to 50 twisting) ; the charge of the donor (d) amino group increases within the above - mentioned torsion range from + 0.3 e to + 0.5 e (and the qring+cn charge decreases from 0.3 e to 0.5 e accordingly, figure 5b), whereas in the gas phase, qamino and qring+cn charges are changed by only 0.1 e within that range of the twist angle. it should be noted that the charge transfer gets larger in solution (compared to the gas phase) primarily at twisting above 30. the fragment charge of the s1(le) state is hardly increased (up to 0.05 e) by the solvent effect in the twisting range of 0 to 50. at a twisting angle of 50, the character between the two states is exchanged (figure 5a) in analogy to the situation described for the gas phase. the fragment charge separation for the twisted (90) dmabn structure in solution remains larger by 0.1 e (going from 0 to 90 twist angle, qring+cn decreases by 0.31 e (an) versus 0.25 e (gas)). after the intersection, the s2 state obtains le character and its charge separation abruptly tends to zero and the s2(le) state loses practically any charge - transfer character. in the gas phase. the larger charge separation of the s1(ct) state in solution as compared to that in the gas phase agrees with its larger stabilization in polar solvent and with the fact that the minimum of the s1(tict) state is lower in energy than that of the s1(le) state. in an solution, the s1 and s2 energy curves intersect at approximately the same twisting angle of 50 as in the gas phase ; therefore, the s2/s1-mxs appears to be quite independent of the environment polarity. a survey of the s1 and s2 energy surfaces of dmabn in the gas phase and an (figures 4 and 6) shows that the wagging coordinate does not strongly affect the e(s1s2) energy difference in the s1/s2 crossing region and could play only a small role in assisting the twisting intracharge transfer mechanism. g- and h - vectors for the mxs between s2 and s1 computed at the mrcis(8,7)/ano - dz level in the gas phase. in figure 7, the energy gradient difference vector g and the nonadiabatic coupling vector h characterizing the branching space of the intersection cone are displayed for the mxs structure between s2 and s1 (figure 1d). these two vectors describe bond - stretch motions within the benzene ring and with the two substituents but do not contain the twisting angle. thus, in agreement with the calculations of gmez. and kochman. we find that this coordinate is not part of the branching space and thus will not participate in the nonadiabatic transfer from s2 to s1. the g - vector shows modes along the quinoidal c2/c3 and c2/c3 coordinates as suggested in ref (27). as already discussed in the introduction, an alternative deactivation path via a rehybridized ict (rict) in a bent cn state was suggested a long time ago and has been taken up recently emphasizing the importance of this state for the deactivation processes in dmabn (see ref (38) and references therein). to compare with the twisting pathway described in the previous section, adc(2) calculations have been performed along the c4c5n2 angle (see figure 1) similar to the investigations reported in ref (36). rigid potential energy curves along the ccn angle for the lowest singlet excited states of dmabn under cs symmetry restriction (a) in the gas phase and (b) in an solution at the adc(2)/tzvp level. starting point is the mp2/svp optimized ground - state geometry of dmabn (c2v, ccn = 180). optimized geometries of le, mxs, tict structures at mrcis (8,7)/ano - dz level and of structure at adc(2)/tzvp level were used. figure 8a shows the potential curves under cs symmetry restriction for several excited states in the gas phase in dependence of the ccn angle. most of the curves increase in energy when starting at the linear geometry at 180, only the is stabilized, similar to the findings in refs (8 and 36). in spite of the significant stabilization of this state, it still is located 1 ev above the le minimum (table 4). this fact led to the conclusion that at least in the gas phase this state would not contribute significantly to the deactivation dynamics in dmabn. moreover, analysis of the hessian matrix showed several imaginary frequencies related to out - of - plane modes. starting a geometry optimization from a slightly out - of - plane distorted geometry led to the le minimum structure. thus, at least in the gas phase the state does not correspond to a stable structure at the adc(2) level. in an solution (figure 8b), because of the large dipole moment of the state (15.9 d), polar solvation stabilizes this state significantly with respect to the two lowest states. table 4 shows that at the energy minimum (in the one - dimensional potential energy curve) the state is even a little lower than the le state. thus, the state is energetically accessible in comparison to the absorption energy of the bright s2 state (table 1). condon factors for the transition between the ground and states will certainly not favor this transition because of the strong bending of the ccn group in the latter state in comparison to the linear arrangement in the ground state. the discussion of the photodynamical deactivation model orients itself on the following observations reported in this work. a minimum on the crossing seam between the le and ct states (s1/s2) has been located at mrcis level as a twisted structure (figure 1d) as postulated in the tict model. in agreement with the results obtained from casscf calculations by gmez. and kochman., it is found that the twisting motion is not included in the branching space but characterizes the intersection seam. as a consequence, the seam will be accessible via a wider range of twisting angles. condon point in s2 to the twisted ct minimum on the s1 surface (rigid torsion, figure 3, gas phase). two minima have been located on the s1 surface, a quasi - planar le structure and an orthogonal ct structure (panels b and c of figure 1, respectively). the state is energetically too high to play a significant role in the gas phase dynamics. starting from the bright s2 state, the photodynamics will be driven by the twisting around the cn bond between the phenyl ring and the dimethylamino group because of the energetic stabilization of that state. however, the nonadiabatic transition to the s1 state is determined by planar intraring coordinates and not by the torsion. in fact, the recent surface hopping study by kochman. has shown that such a decay should occur at very early stages of the photodynamics, a fact which is also supported by the characterization of the branching space of the conical intersection between s2/s1 computed at the mrcis level. the equilibration between the le and tict states will occur on the s1 surface. in polar (acetonitrile) solution, the shape of the twisting potential curves is the same as in the gas phase (rigid torsion, figure 5). condon point to the mxs is slightly flatter as compared to the gas phase ; only the path from the mxs to the tict minimum is steeper. because the evolution of the charge transfer, qring+cn, in the gas phase and in an solution is quite similar for torsion angles up to the intersection, it is expected that the qualitative character of the branching space will not change and that also in solution it will be determined by intraring vibrations and not by the torsional motion. thus, it is quite likely that also in polar solution the initial dynamics will primarily proceed as in the gas phase and that the major fraction of the nonadiabatic decay will lead to the le state from which equilibration with the tict will occur. because of the enhanced stability of the latter state in polar solution as compared to the gas phase case, the tict state will be predominantly populated. the strong stabilization of the state in an solution has already been noted (figure 8), leading to a possible contribution to the photodynamics, as emphasized in refs (11,3638, and 83). however, starting with the photodynamics in the franck condon point, ccn bending of the nitrile group leads to a destabilization of the s1 and s2 states so that at least in the initial phase of the dynamics, population of the state by this mode can not be expected. as described in the previous paragraph, similar to the gas phase, the photodynamics will start in the s2 state with a twisting of the n(ch3)2 group and a rapid decay to the le structure. because of the comparable stability of the le and structures in an, participation of the latter structure in the later phases of the photodynamics is possible. from our static calculations it is difficult to predict to which extent the ccn bending motion will be actually activated. in any case, the final structure (in addition to the le minimum) in the excited state should be the tict structure. in our mrcis calculations and also in the adc(2) no additional partially twisted (ptict) minimum was found in contrast to the casscf optimizations performed by coto. in fact, the twisting angle of 53.4 reported in this latter work coincides almost exactly with the twisting found for the mxs (figure 1d), and figure 5 shows a barrierless reaction path on s1 to the tict structure. thus, a ptict structure stable over the time of several nanoseconds, as required by the proposal suggested in ref (38) (that this structure is the source of fluorescence), does not seem likely according to our findings. the mechanism leading to dual fluorescence of dmabn in the gas phase and in acetonitrile solution has been addressed using two computational methods : (i) the multireference configuration interaction with single excitations (mrcis) and (ii) the second - order algebraic diagrammatic construction (adc(2)) method. solvent effects have been based on the conductor - like screening model in both approaches. the mrcis calculations show that the main absorption proceeds to the s2 state possessing a charge - transfer (ct) character somewhat larger than that of the s1 state. in the gas phase as well as in an solution the excited s2(ct) state structure coordinate the s2 state is stabilized, crossing the s1 state at 50 in the minimum on the crossing seam (mxs). it is important to note that in agreement with the findings of gmez. the twisting angle is not part of the intersection space, which makes the intersection seam accessible for a larger range of twisting angles. this result is also well in line with the results of recent nonadiabatic dynamics simulations which show a very fast deactivation from s2 to s1 within 8.5 fs at practically planar geometries. the calculated fragment charge qring+cn in the gas phase and in solution are used to describe the character changes of both states at the conical intersection. the larger charge separation found for the twisted dmabn (tict) structure explains the enhanced stabilization of the s1(tict) state in polar solvent and hence the lower energy minimum of s1(ct) state in comparison to the s1(le) state. the adc(2) calculations have been used primarily to investigate the role of the ccn bent state. the results show that for the gas phase this state is energetically too high and should not participate substantially in the photodynamics starting from s2. in an solution this state the initial dynamics starting in the s2() state will begin with the (ch3)2n twisting or, as outlined in ref (27), also by pyramidalization of the carbon ring atom next to the nitrogen. the ccn bending, however, would lead to an initial destabilization of the states. nevertheless, in polar solution, because of the comparable stability of the le and planar states, the latter state could play a role in a later phase of the dynamics. finally, dmabn should either arrive in the s1(le) or s1(tict) structures from which fluorescence can occur. because of the close structural similarity of the ptict structure with the mxs structure, the former does not appear to be sufficiently stable to act as the origin of fluorescence with a lifetime of 2.9 ns. future work is certainly needed to shed more light on the question of whether the two different transient lifetimes found for absorption (4.8 ns) and fluorescence (2.9 ns) really point to the presence of two independent ict structures or whether an explanation based on one ict structure can be found. | the structural processes leading to dual fluorescence of 4-(dimethylamino)benzonitrile in the gas phase and in acetonitrile solvent were investigated using a combination of multireference configuration interaction (mrci) and the second - order algebraic diagrammatic construction (adc(2)) methods. solvent effects were included on the basis of the conductor - like screening model. the mrci method was used for computing the nonadiabatic interaction between the two lowest excited states (s2(la, ct) and s1(lb, le)) and the corresponding minimum on the crossing seam (mxs) whereas the adc(2) calculations were dedicated to assessing the role of the state. the mxs structure was found to have a twisting angle of 50. the branching space does not contain the twisting motion of the dimethylamino group and thus is not directly involved in the deactivation process from s2 to s1. polar solvent effects are not found to have a significant influence on this situation. applying cs symmetry restrictions, the adc(2) calculations show that ccn bending leads to a strong stabilization and to significant charge transfer (ct). nevertheless, this structure is not a minimum but converts to the local excitation (le) structure on releasing the symmetry constraint. these findings suggest that the main role in the dynamics is played by the nonadiabatic interaction of the le and ct states and that the main source for the dual fluorescence is the twisted internal charge - transfer state in addition to the le state. |
currently, a combination of genetic and environmental factors underlying the development of this disorder is discussed. genetic association and genome - wide association studies revealed several risk genes of schizophrenia, among them are neuregulin1, disc1, d - amino - acid oxidase activator (daoa / g72), zinc finger protein 804a (znf804a), transcription factor 4 (tcf4). environmental factors such as obstetric complications with hypoxia, prenatal infection, season of birth, drug abuse, and migration may interact with genetic factors, influencing onset and progression of the disease. this gene - environmental interaction may comprise epigenetic alterations like dna methylation and histone acetylation [35, 41 ]. an interaction between metabotropic glutamate receptor (grm3) gene variants and severe obstetric complications on hippocampus volume has been reported, but this finding was not specific for schizophrenia. furthermore, it is assumed that these risk factors may affect brain tissue during perinatal neurodevelopment and may lead to the onset of psychotic symptoms in early adulthood during the synaptic pruning process of the prefrontal cortex. in early adulthood, animal models of neonatal hippocampal lesions show behavioral deficits comparable to schizophrenia symptoms and reveal neurobiological deficits in the prefrontal cortex [17, 39 ], suggesting prefrontotemporal disconnectivity in the pathophysiology of the disease. meta - analyses of structural magnetic resonance imaging (smri) studies reveal gray matter volume deficits in different brain regions in schizophrenic patients. affected regions are the medial temporal lobe including the hippocampus, the heteromodal association cortex including the prefrontal, anterior cingulate, superior temporal and parietal cortex as well as the thalamus. the degree of gray matter reduction is in the range of 510% in the frontotemporal and basal ganglia - thalamocortical network [10, 13, 16 ]. beside effects of environmental factors like cannabis abuse and trauma on cortical thickness in schizophrenia patients or on reduced hippocampal volumes in patients and relatives with obstetric complications, schizophrenia susceptibility genes like neuregulin1 variants have shown impact on hippocampus volume, white matter density, and integrity in the anterior limb of the internal capsule. a znf804a risk variant was associated with reduced cortical gray matter thickness in several regions. smri and postmortem schizophrenia studies have shown volume loss in the medial temporal lobe, especially in the hippocampus, as one of the most consistent structural abnormalities. a meta - analysis of diffusion tensor imaging (dti) studies shows reductions in the myelin membranes and decreased white matter anisotropy in the deep left prefrontal and temporal cortex in schizophrenia and supports the hypothesis of structural and functional disconnectivity. neuronal axons traversing the limbic pathways from the hippocampus are connected to prefrontal cortex, anterior cingulate cortex, and thalamus. these pathways are involved in higher cognition and information processing, domains in which schizophrenia patients exhibit severe deficits. a variety of functional mri (fmri) studies revealed disturbed connectivity in complex hippoampal, prefrontal and cerebellar - thalamic - prefrontal networks in schizophrenia. in patients and non - psychotic subjects at increased risk dynamic causal modeling in fmri studies revealed decreased effective connectivity between the posterior hippocampus and prefrontal cortex during working memory tasks [3, 23 ]. according to these results, postmortem studies revealed a loss of myelin - building oligodendrocytes in prefrontal and hippocampal subregions, leading to impaired nerve cell propagation of information [24, 36 ]. an additional synaptopathy with decreased expression of glutamatergic and gamma - amino - butyric acid (gaba)ergic synaptic proteins and consecutive disturbance of microconnectivity [7, 25 ] is completing the complex framework of disconnectivity in schizophrenia. in schizophrenia patients, alterations of intracortical and intercortical connectivities at subsecond timescales were investigated by tms (see fig. 1) and these impaired connectivities have been linked to an abnormal cerebral lateralization and a cerebral asymmetry in schizophrenia patients.fig. the inhibitory connectivity between left premotor areas and the right primary motor cortex is not affected, whereas the facilitatory connectivity between these two areas is reduced. pmc premotor cortex, m1 primary motor cortex, ppc posterior parietal cortex, dashed line facilitatory connectivity, solid line inhibitory connectivity schematic presentation of connectivities between different cortical areas evaluated by tms in schizophrenia patients. the inhibitory connectivity between left premotor areas and the right primary motor cortex is not affected, whereas the facilitatory connectivity between these two areas is reduced. pmc premotor cortex, m1 primary motor cortex, ppc posterior parietal cortex, dashed line facilitatory connectivity, solid line inhibitory connectivity the inhibitory connection between both primary motor cortices (m1), which is discussed to be mediated by corpus callosum pathways, was found to be deficient in schizophrenia patients. one further study supported the idea of an altered interhemispheric connection, revealing a selectively impaired facilitatory connectivity between the left dorsal premotor cortex and the right m1. as a third disrupted interhemispheric pathway, the connection between right cerebellum and left m1 was shown to be deficient in schizophrenia patients, indicating a disrupted direct cerebellar - m1 connection or an abnormal cerebellar inhibitory output. a disturbed intrahemispheric connectivity between the right posterior parietal cortex (ppc) and the right m1 in schizophrenia patients has been reported, too. finally, a dysfunctional interhemispheric connection between the right premotor and left m1 was discovered with a plasticity inducting repetitive tms. eeg and meg provide insight into cortical rhythms and neuronal oscillations. in general, synchronous cortical rhythms this is of particular importance as disturbed oscillatory activity, alterations in synchronization and dysfunctional intra- and interhemispheric connectivities are an important feature in schizophrenia. quantitative analysis of resting eeg recordings displayed an increased delta and/or theta activity, a decreased main frequency, a low mean alpha frequency (hypofrontality) and an increased beta activity in schizophrenia patients [15, 26 ]. in dependence of the type of measure (steady - state evoked potentials, amplitudes, induced oscillations, and resting state), amplitudes and phases have been found to be abnormal in schizophrenia patients. a common pattern of the different brain oscillations in schizophrenia patients is a reduction in amplitude and altered phase synchronization in all frequency bands (with emphasis on the beta and gamma band activity) at rest, during sensory processing and cognitive tasks [38, 40 ]. further evidence is provided by animal studies showing that the synchronization of brain oscillations depends on cortico - cortical connections within and between hemispheres [11, 40 ]. therefore, the findings of impaired neural oscillation and the reduced phase synchronization in schizophrenia patients can be considered as a marker for a functional disconnectivity between different brain areas and for dysfunctional cortical networks. in schizophrenia patients, alterations of intracortical and intercortical connectivities at subsecond timescales were investigated by tms (see fig. 1) and these impaired connectivities have been linked to an abnormal cerebral lateralization and a cerebral asymmetry in schizophrenia patients.fig. the inhibitory connectivity between left premotor areas and the right primary motor cortex is not affected, whereas the facilitatory connectivity between these two areas is reduced. pmc premotor cortex, m1 primary motor cortex, ppc posterior parietal cortex, dashed line facilitatory connectivity, solid line inhibitory connectivity schematic presentation of connectivities between different cortical areas evaluated by tms in schizophrenia patients. the inhibitory connectivity between left premotor areas and the right primary motor cortex is not affected, whereas the facilitatory connectivity between these two areas is reduced. pmc premotor cortex, m1 primary motor cortex, ppc posterior parietal cortex, dashed line facilitatory connectivity, solid line inhibitory connectivity the inhibitory connection between both primary motor cortices (m1), which is discussed to be mediated by corpus callosum pathways, was found to be deficient in schizophrenia patients. one further study supported the idea of an altered interhemispheric connection, revealing a selectively impaired facilitatory connectivity between the left dorsal premotor cortex and the right m1. as a third disrupted interhemispheric pathway, the connection between right cerebellum and left m1 was shown to be deficient in schizophrenia patients, indicating a disrupted direct cerebellar - m1 connection or an abnormal cerebellar inhibitory output. a disturbed intrahemispheric connectivity between the right posterior parietal cortex (ppc) and the right m1 in schizophrenia patients has been reported, too. finally, a dysfunctional interhemispheric connection between the right premotor and left m1 was discovered with a plasticity inducting repetitive tms. eeg and meg provide insight into cortical rhythms and neuronal oscillations. in general, synchronous cortical rhythms this is of particular importance as disturbed oscillatory activity, alterations in synchronization and dysfunctional intra- and interhemispheric connectivities are an important feature in schizophrenia. quantitative analysis of resting eeg recordings displayed an increased delta and/or theta activity, a decreased main frequency, a low mean alpha frequency (hypofrontality) and an increased beta activity in schizophrenia patients [15, 26 ]. in dependence of the type of measure (steady - state evoked potentials, amplitudes, induced oscillations, and resting state), a common pattern of the different brain oscillations in schizophrenia patients is a reduction in amplitude and altered phase synchronization in all frequency bands (with emphasis on the beta and gamma band activity) at rest, during sensory processing and cognitive tasks [38, 40 ]. further evidence is provided by animal studies showing that the synchronization of brain oscillations depends on cortico - cortical connections within and between hemispheres [11, 40 ]. therefore, the findings of impaired neural oscillation and the reduced phase synchronization in schizophrenia patients can be considered as a marker for a functional disconnectivity between different brain areas and for dysfunctional cortical networks. insights to disturbed connectivity in schizophrenia have been provided by mri, postmortem, and animal studies. alterations in gabaergic and n - methyl - d - aspartate receptor (nmdar)-mediated transmission display a common neurobiological background of connectivity deficits revealed by tms / eeg / meg. first, studies on human brain tissues showed lower gaba - related transcripts in four cortical areas in schizophrenia patients. second, the results of different tms - studies using specific paradigms to investigate inhibitory intracortical networks point toward a gabaergic dysfunction in the motor system of this patient group. third, schizophrenia patients show a reduction in the mrna expression of the gaba - synthesizing enzyme, gad67, and a reduction in gabaergic interneurons in several cortical areas [2, 27 ]. these abnormalities in gabaergic transmission appear to be associated with nmdar dysfunction and dysfunctional nmdar, in turn, causes abnormal neuronal plasticity, which is thought to be a crucial pathophysiological process in schizophrenia patients. a theory about abnormal synaptic plasticity from stephan, friston and frith discussed the relationship between dysfunctional nmdar and disconnectivity in schizophrenia patients. in their theory, the underlying biological and pathophysiological agent of schizophrenia is a dysfunction of nmdar with a consecutive reduced synaptic and cellular plasticity. this would affect long - range connections in the developing brain, induce abnormalities in different neurotransmitter systems (dopamine, serotonine, acetylcholine, gaba), lead to aberrant corollary discharge and to impaired perceptual interference. this theory and other theories, discussing the glutamate - hypothesis of schizophrenia, are supported by several lines of evidence. a reduced ltp - like focal, spike - timing - dependent - like synaptic plasticity and a reduced ltp - like non - focal, cortical plasticity are recent neurophysiological findings in schizophrenia patients [14, 20 ]. taken together, this may indicate dysfunctional nmdars and a reduced signal - to - noise ratio with consecutive dysfunctional information processing. additionally, numerous studies display a link between nmdar dysfunction and affected cortical oscillations and mismatched negativity deficits. in summary, different neurophysiological, imaging, neuropathological and molecular biology methods have revealed a disconnectivity in schizophrenia patients the underlying pathobiology still needs clarification, but alterations in the gabaergic and glutamatergic, nmdar - mediated neurotransmissions might be possible candidates. | schizophrenia is considered as a neurodevelopmental disorder with genetic and environmental factors playing a role. animal models show that developmental hippocampal lesions are causing disconnectivity of the prefrontal cortex. magnetic resonance imaging and postmortem investigations revealed deficits in the temporoprefrontal neuronal circuit. decreased oligodendrocyte numbers and expression of oligodendrocyte genes and synaptic proteins may contribute to disturbances of micro- and macro - circuitry in the pathophysiology of the disease. functional connectivity between cortical areas can be investigated with high temporal resolution using transcranial magnetic stimulation (tms), electroencephalography (eeg), and magnetoencephalography (meg). in this review, disconnectivity between different cortical areas in schizophrenia patients is described. the specificity and the neurobiological origin of these connectivity deficits and the relation to the symptom complex of schizophrenia and the glutamatergic and gabaergic system are discussed. |
sensory disturbances in schizophrenia are often described as an inability to filter meaningful sensory stimuli.19 in experimental settings, this filtering inability has been examined most often using auditory evoked potentials to repeated sounds with the main aim of testing the brain s ability to inhibit (or gate) its response to repeated stimuli that in schizophrenic patients typically manifest as an inability to gate neuronal responses related to the p50 wave.1012 according to recent findings, sensory gating abnormalities represent early clinical symptoms of schizophrenia, typically characterized as a decreased ability of the brain to inhibit various responses to insignificant stimuli.1,5,7,1318 typical symptoms manifest as hypervigilance and difficulty in focusing attention, most likely due to disturbances of inhibitory neuronal activity in the hippocampus related to deficits of nicotinic cholinergic modulation.7,17,19,20 typically, the gating related to the p50 wave is linked to widely distributed neuronal activities involving the temporoparietal and prefrontal cortical networks, mainly during the early phases of processing, in which a very significant role is played by the ca3ca4 area of the hippocampus and its cholinergic inputs from the septal nucleus mediated by low - affinity nicotinic receptors affecting ca3ca4 interneurons.2124 these gamma aminobutyric acid (gaba)ergic interneurons transiently inhibit pyramidal neurons and mediate gating of the second stimulus during sensory stimulation usually used in event - related potential experiments.2528 in this context, the basic experimental finding in research of auditory p50 sensory gating is typically suppression of the response to the second identical (s2) stimulus presented shortly after the first (s1) stimulus. this event - related potential response manifests very early in information processing (about 50 milliseconds) and most likely represents an adaptive mechanism preventing from becoming overloaded by redundant sensory information from the environment.2931 these typical inhibitory deficits related to activity of pyramidal neurons in the ca3 region of the hippocampus were therefore identified as important contributors to the cerebral evoked responses that play a significant role in habituation of repeated stimuli depending on cholinergic stimulation of hippocampal inhibitory interneurons.27 because of this cholinergic stimulation, those interneurons manifest bursts of activity that release a sufficient amount of gaba to activate presynaptic gaba - b receptors on ca3 pyramidal neurons, and due to this release, the excitatory neurotransmitter glutamate is blocked, so that the ca3 pyramidal neurons can not respond to the second stimulus.27,28,32 current experimental and theoretical findings of normal responses to repeated auditory stimuli at the single neural level in animal models have provided some direct insights into the basic mechanisms of the sensory gating deficits.21 basic observations show that acetylcholine receptors on hippocampal interneurons are very sensitive to alpha bungarotoxin, a nicotinic antagonist.23,32 specific roles for these low - affinity nicotinic receptors in the p50 gating abnormalities in schizophrenia are supported by various recent physiological, pharmacological, and genetic studies.17,19,3341 for example, these data show that the flow of sensory information from the cortex to the hippocampus is controlled by nicotinic cholinergic input from the septum to the hippocampus.32,42 these findings are also supported by genetic studies indicating that nicotinic receptors (produced by the specific alpha-7-nicotinic acetylcholine receptor subunit gene, chrna7) influence inhibition of responses to repeated auditory stimuli.7,21,23,35,43,44 in addition, several studies show that these sensory gating disruptions are also influenced by alpha-2-selective noradrenergic antagonists (eg, yohimbine) and 3-methoxy-4-hydroxyphenylglycol.4549 altogether, these findings indicate that specific inhibitory deficits play a major role in sensory gating deficits that can be observed in event - related potential studies focused on the p50 wave. according to physiological theory, the main events enabling a decreased evoked response due to repetition of identical stimuli are linked to active inhibitory / excitatory mechanisms and passive habituation / dishabituation mechanisms. a basic explanation of this active gating theory suggests that local neuronal inhibitory activity of the s1 stimulus specifically inhibits and filters out the response to the s2, representing the second identical stimulus (the same as the previous one).5054 the second stimulus therefore has no new information and is inhibited. the inhibitory effect of the stimulus, which usually lasts several hundred milliseconds, develops inhibitory postsynaptic potentials at about 96% of neurons in the primary auditory cortex in the early period of the inhibitory response (20200 msec). during this period of inhibitory postsynaptic potentials, neural membrane resistance is reduced to 60%90% of its initial value. in the subsequent periods, the efficiency of inhibitory reactions typically decreases for periods lasting longer than 200 msec. in this context, it is likely that the decreased neuronal sensitivity to auditory stimuli repeated every 500 msec is caused by inhibitory processes in cortical neurons per se rather than their blocking due to in - flow of afferent excitatory impulses during the refractory period.55,56 any following inputs reset the cortical dynamics with a delay that ranges from 10 to several hundred milliseconds, enabling cortical mechanisms to process rapidly changing successive information in short time intervals.5759 for example, volkov and galazyuk57 in a more general context proposed that synchronous activations of a large number of cortical neurons by a short stimulus resulted in coordinated release of a large amount of inhibitory transmitters into the synaptic connections, enabling relatively prolonged hyperpolarization of post - synaptic neurons. as a consequence, a repeated stimulus leads to constant release of a small amount of neurotransmitter into the synaptic cleft, which may explain the process of continued inhibition. to explain this mechanism, it has also been proposed that the s1 stimulus may influence the initial evoked response that excites the hippocampal pyramidal neurons and also activate the inhibitory neurons that act as a comparator, and via this mechanism, the subsequent identical s2 stimulus produces diminished responses, when pyramidal neurons acting as the comparator are still active. on the other hand, when a subsequent nonidentical stimulus is presented, different sets of neurons are stimulated that were not stimulated before, resulting in an unhabituated response.6066 the current evidence also suggests that the main generators of p50 are located in the temporal lobes, but the main neuronal activities contributing to amplitude reduction in the p50 time range are localized in the frontal lobe.67 these processes are closely linked to those of memory reconsolidation, typically involving the medial temporal and frontal lobes that interact closely to allow successful remembering of and responses to sensory stimuli. whereas the medial temporal lobe is predominantly associated with encoding, storage, and retrieval of long - term memories, the prefrontal cortex is closely related to cognitive control processes such as selection, engagement, monitoring, and inhibition.68 recent findings indicate that schizophrenia is characterized by typical disturbances in cognitive processes that predominantly manifest as deficits of perceptual and attentional function.6975 in this context, the data suggest that these deficits are characterized by an inability to inhibit, or gate, irrelevant sensory inputs, leading to the sensory and information overload typical of individuals with schizophrenia.1,7682 this sensory gating deficit may result in neuronal hyperexcitability due to disturbances of neuronal inhibition at the subcortical and cortical levels.5,33,60,83 accordingly, typical cognitive and sensory processing deficits in schizophrenia are closely related to deficits in p50 auditory gating which are linked to nicotinic cholinergic - mediated disinhibitory processes, representing a new potential opportunity for therapeutic intervention in schizophrenia.40,41,43,44,8489 the data presented above strongly suggest that patients with schizophrenia manifest typical disturbances of habituation mechanisms linked to information overload, leading to disruption of information processing.9094 in this context, many studies have shown that the p50 sensory gating ratio in a paired click task is higher in patients with schizophrenia than in healthy controls, indicating more effective sensory gating processes.37,47,61,88,89,95113 a detailed meta - analysis8 rejected the possibility of the null hypothesis that these studies showed no effect, and also found that the differences were not the same across all studies. in this meta - analysis, the mean ratios in 45 of 46 group comparisons were smaller for controls than for patients. patterson have also shown that the observed differences in means were significant in 35 of these studies. they identified 46 studies suitable for analysis of p300 measures, including 1,443 patients and 1,251 controls. the pooled standardized effect size (the difference between the means of the two groups divided by the common standard deviation) for the p50 ratio was 1.56 (95% confidence interval 2.05, 1.06 ; p<0.001). across - study variations in filters, task difficulty, antipsychotic medication, and duration of illness did not influence the pooled standardized effect size significantly. patterson concluded that their meta - analysis confirms the existence of event - related potential deficits in schizophrenia, with significance similar to the most robust findings reported in neuroimaging and neuropsychology in schizophrenia. similar conclusions found also several others meta - analytic or detailed review studies which show sensory gating impairments in early stages of schizophrenia that become more prominent in chronic stages of schizophrenia.8,11,13,15,114 further meta - analytical data by chang confirm that the sensory gating deficit in patients with schizophrenia is well documented ; nevertheless, certain findings raise doubts about the validity and utility of the s2/s1 ratio as a measure of sensory gating. the meta - analytical results confirm that the s2/s1 ratio and the repeating (s2) stimulus discriminate effectively between patients with schizophrenia and healthy controls, in contrast with the consistent but smaller effect size for the s1 amplitude, and these findings likely reflect inhibitory deficits related to repeated redundant input. future studies are needed to clarify in detail the variables modifying sensory gating processes related to progression of schizophrenia and genetic predisposition to the illness.13,113,116 in this context, recent findings also show that schizophrenia is associated with impairments of functional brain connectivity, which in principle may be studied using the p50 suppression paradigm in close relationship with the functional integrity of connections between brain areas involved in cross - sensory processing. according to a study reported by magnee the typical filtering deficits studied as p50 deficits may be secondary to earlier sensory dysfunctions due to deficits in the integrity of connections between brain areas involved in low - level cross - sensory processing. in principle, this finding is in agreement with data suggesting that the main generators of p50 are located in the temporal lobes but that the neuronal activities predominantly contributing to amplitude reduction in the p50 time range are localized in the frontal lobe.67 this relationship between connectivity and p50 in schizophrenia is also in agreement with the finding that gamma and beta activity, which are likely to be specifically linked to neural synchrony, connectivity, and integration of information, are related to p50. in this context, the initial response to s1 is observed as a high gamma band oscillatory activity that after about 200 msec switches to beta frequency oscillations, which may reflect an encoding of the sensory perception.118121 there is also some interesting evidence showing that this post - s1 beta frequency response is inversely correlated with the s2 response in patients with schizophrenia.100,106,122 this suggests that p50 is basically linked to rhythmic activity of neural assemblies that code information processing within and across cortical circuits and modulate neuronal excitability.120,123126 based on these findings, sensory gating deficits related to schizophrenia might be explained by disconnection of information, mainly between temporal lobe generators and the frontal lobe, which may account for the diminished inhibitory activity of the frontal cortex linked to the p50 deficit. according to physiological theory, the main events enabling a decreased evoked response due to repetition of identical stimuli are linked to active inhibitory / excitatory mechanisms and passive habituation / dishabituation mechanisms. a basic explanation of this active gating theory suggests that local neuronal inhibitory activity of the s1 stimulus specifically inhibits and filters out the response to the s2, representing the second identical stimulus (the same as the previous one).5054 the second stimulus therefore has no new information and is inhibited. the inhibitory effect of the stimulus, which usually lasts several hundred milliseconds, develops inhibitory postsynaptic potentials at about 96% of neurons in the primary auditory cortex in the early period of the inhibitory response (20200 msec). during this period of inhibitory postsynaptic potentials, neural membrane resistance the efficiency of inhibitory reactions typically decreases for periods lasting longer than 200 msec. in this context, it is likely that the decreased neuronal sensitivity to auditory stimuli repeated every 500 msec is caused by inhibitory processes in cortical neurons per se rather than their blocking due to in - flow of afferent excitatory impulses during the refractory period.55,56 any following inputs reset the cortical dynamics with a delay that ranges from 10 to several hundred milliseconds, enabling cortical mechanisms to process rapidly changing successive information in short time intervals.5759 for example, volkov and galazyuk57 in a more general context proposed that synchronous activations of a large number of cortical neurons by a short stimulus resulted in coordinated release of a large amount of inhibitory transmitters into the synaptic connections, enabling relatively prolonged hyperpolarization of post - synaptic neurons. as a consequence, a repeated stimulus leads to constant release of a small amount of neurotransmitter into the synaptic cleft, which may explain the process of continued inhibition. to explain this mechanism, it has also been proposed that the s1 stimulus may influence the initial evoked response that excites the hippocampal pyramidal neurons and also activate the inhibitory neurons that act as a comparator, and via this mechanism, the subsequent identical s2 stimulus produces diminished responses, when pyramidal neurons acting as the comparator are still active. on the other hand, when a subsequent nonidentical stimulus is presented, different sets of neurons are stimulated that were not stimulated before, resulting in an unhabituated response.6066 the current evidence also suggests that the main generators of p50 are located in the temporal lobes, but the main neuronal activities contributing to amplitude reduction in the p50 time range are localized in the frontal lobe.67 these processes are closely linked to those of memory reconsolidation, typically involving the medial temporal and frontal lobes that interact closely to allow successful remembering of and responses to sensory stimuli. whereas the medial temporal lobe is predominantly associated with encoding, storage, and retrieval of long - term memories, the prefrontal cortex is closely related to cognitive control processes such as selection, engagement, monitoring, and inhibition.68 recent findings indicate that schizophrenia is characterized by typical disturbances in cognitive processes that predominantly manifest as deficits of perceptual and attentional function.6975 in this context, the data suggest that these deficits are characterized by an inability to inhibit, or gate, irrelevant sensory inputs, leading to the sensory and information overload typical of individuals with schizophrenia.1,7682 this sensory gating deficit may result in neuronal hyperexcitability due to disturbances of neuronal inhibition at the subcortical and cortical levels.5,33,60,83 accordingly, typical cognitive and sensory processing deficits in schizophrenia are closely related to deficits in p50 auditory gating which are linked to nicotinic cholinergic - mediated disinhibitory processes, representing a new potential opportunity for therapeutic intervention in schizophrenia.40,41,43,44,8489 the data presented above strongly suggest that patients with schizophrenia manifest typical disturbances of habituation mechanisms linked to information overload, leading to disruption of information processing.9094 in this context, many studies have shown that the p50 sensory gating ratio in a paired click task is higher in patients with schizophrenia than in healthy controls, indicating more effective sensory gating processes.37,47,61,88,89,95113 a detailed meta - analysis8 rejected the possibility of the null hypothesis that these studies showed no effect, and also found that the differences were not the same across all studies. in this meta - analysis, the mean ratios in 45 of 46 group comparisons were smaller for controls than for patients. patterson have also shown that the observed differences in means were significant in 35 of these studies. they identified 46 studies suitable for analysis of p300 measures, including 1,443 patients and 1,251 controls. the pooled standardized effect size (the difference between the means of the two groups divided by the common standard deviation) for the p50 ratio was 1.56 (95% confidence interval 2.05, 1.06 ; p<0.001). across - study variations in filters, task difficulty, antipsychotic medication, and duration of illness did not influence the pooled standardized effect size significantly. patterson concluded that their meta - analysis confirms the existence of event - related potential deficits in schizophrenia, with significance similar to the most robust findings reported in neuroimaging and neuropsychology in schizophrenia. similar conclusions found also several others meta - analytic or detailed review studies which show sensory gating impairments in early stages of schizophrenia that become more prominent in chronic stages of schizophrenia.8,11,13,15,114 further meta - analytical data by chang confirm that the sensory gating deficit in patients with schizophrenia is well documented ; nevertheless, certain findings raise doubts about the validity and utility of the s2/s1 ratio as a measure of sensory gating. the meta - analytical results confirm that the s2/s1 ratio and the repeating (s2) stimulus discriminate effectively between patients with schizophrenia and healthy controls, in contrast with the consistent but smaller effect size for the s1 amplitude, and these findings likely reflect inhibitory deficits related to repeated redundant input. future studies are needed to clarify in detail the variables modifying sensory gating processes related to progression of schizophrenia and genetic predisposition to the illness.13,113,116 in this context, recent findings also show that schizophrenia is associated with impairments of functional brain connectivity, which in principle may be studied using the p50 suppression paradigm in close relationship with the functional integrity of connections between brain areas involved in cross - sensory processing. according to a study reported by magnee the typical filtering deficits studied as p50 deficits may be secondary to earlier sensory dysfunctions due to deficits in the integrity of connections between brain areas involved in low - level cross - sensory processing. in principle, this finding is in agreement with data suggesting that the main generators of p50 are located in the temporal lobes but that the neuronal activities predominantly contributing to amplitude reduction in the p50 time range are localized in the frontal lobe.67 this relationship between connectivity and p50 in schizophrenia is also in agreement with the finding that gamma and beta activity, which are likely to be specifically linked to neural synchrony, connectivity, and integration of information, are related to p50. in this context, the initial response to s1 is observed as a high gamma band oscillatory activity that after about 200 msec switches to beta frequency oscillations, which may reflect an encoding of the sensory perception.118121 there is also some interesting evidence showing that this post - s1 beta frequency response is inversely correlated with the s2 response in patients with schizophrenia.100,106,122 this suggests that p50 is basically linked to rhythmic activity of neural assemblies that code information processing within and across cortical circuits and modulate neuronal excitability.120,123126 based on these findings, sensory gating deficits related to schizophrenia might be explained by disconnection of information, mainly between temporal lobe generators and the frontal lobe, which may account for the diminished inhibitory activity of the frontal cortex linked to the p50 deficit. there is now growing evidence that disruption of coherent neural binding is related to disintegration of consciousness in schizophrenia,127130 and that this could be related to sensory gating disturbances.127 in this context, sensory gating research might yield new findings connecting neuroscientific and psychological research of schizophrenia that could connect split mind according to original bleuler s concept with research of disturbed integration in neural information processing. together these findings suggest that mental disintegration in schizophrenia could be described as sensory and information disturbance related to disinhibition and neural disintegration. major findings supporting the need for future research in this area include data indicating that long - range synchrony of gamma oscillations reflecting neural connectivity that depends on excitatory postsynaptic potentials of gabaergic interneurons is also closely related to sensory gating processes.28,32,126 this relationship between gamma oscillations and gabaergic interneurons is especially important for investigation of schizophrenia, given that there is now evidence indicating disturbance of gabaergic interneurons in schizophrenia.127129 further, convergent findings indicate that a signaling deficiency leads to reduced gaba synthesis and disrupted coordination of neural representations and related changes in perception and cognition in patients with schizophrenia.127,129,130 there is also evidence that these gabaergic abnormalities play an important role in schizophrenia and that the changes in neural synchrony in schizophrenia are most likely linked to dysregulation of multiple neurochemical systems, also including glutamate, dopamine, and other neurotransmitter molecules. | sensory gating disturbances in schizophrenia are often described as an inability to filter redundant sensory stimuli that typically manifest as inability to gate neuronal responses related to the p50 wave, characterizing a decreased ability of the brain to inhibit various responses to insignificant stimuli. it implicates various deficits of perceptual and attentional functions, and this inability to inhibit, or gate, irrelevant sensory inputs leads to sensory and information overload that also may result in neuronal hyperexcitability related to disturbances of habituation mechanisms. these findings seem to be particularly important in the context of modern electrophysiological and neuroimaging data suggesting that the filtering deficits in schizophrenia are likely related to deficits in the integrity of connections between various brain areas. as a consequence, this brain disintegration produces disconnection of information, disrupted binding, and disintegration of consciousness that in terms of modern neuroscience could connect original bleuler s concept of split mind with research of neural information integration. |
posterior tibial slope that is created during proximal tibial resection in total knee arthoplasty (tka) has emerged as an important factor in the biomechanics of the knee joint and postoperative clinical outcome. the common approach is to restore the posterior tibial slope as closely as possible to the anatomical condition for greater knee flexion in the posterior cruciate ligament (pcl) retaining tka and a lesser slope in the posterior - stabilized tka1). posterior tibial slope affects the flexion gap, knee joint stability, and posterior femoral rollback that are associated with the range of knee joint motion2). in particular, considering that more bone resection in the anterior tibial plateau is necessary for knees with greater preoperative posterior tibial slope during posterior - stabilized tka than pcl retaining tka3), posterior tibial slope can affect the extension - flexion gap balance and joint line in the sagittal plane4). there is no controversy that the posterior tibial slope is correlated with flexion gap that facilitates flexion after surgery5). however, an excessive increase in the posterior tibial slope may result in abnormal anterior tibial translation, posterior instability, and anterior cam - post impingement, which can lead to ultra - high molecular weight polyethylene (uhmwpe) wear and biomechanical changes that eventually decrease the survivorship of tka6,7). the normal posterior tibial slope has been reported to be 6-98), but the optimal value has yet to be established. in the past decade, the advancement in implant designs, materials, and operative techniques has contributed to a reduction in the delamination of the uhmwpe component and structural changes and improvement in clinical outcomes. knee replacements undergo millions of load cycles and the wear on the replacements that is directly associated with the durability and longevity tends to occur in the surface of the damaged tibial component9) the generation of uhmwpe wear debris from the articular surface is affected by a variety of factors including articulation of the joint, implant structure, and bearing material. bartel.10) associated damage to the surface of tibial component with contact force on the surface of uhmwpe with the use of finite element analysis. however, there have been few domestic finite element analysis studies on the biomechanics of the articular surface of the knee and the relationship with the posterior tibial slope. the purpose of this study was to evaluate the relationship between the posterior tibial slope (0, 7, 10), the contact force, and stresses on the medial and lateral ligament during knee flexion after posterior - stabilized tka using finite element analysis. furthermore, we assessed the relationship between the posterior tibial slope and damage to the surface of tibial component. computer tomography (ct) images obtained at intervals of 1 mm were processed using mimics 14.0 (materialise nv, leuven, belgium) to allow for the geometrical and structural complexity of the knee. the models were constructed in the mid - sagittal plane using the contour data of the normal femur, tibia, and patella that were obtained from 29-year - old males, who had no bone metabolism disorders, history of taking medication that may affect the bone metabolism, and trauma. regarding the knee alignment, the anatomical femorotibial angle was in 6 extension, the mechanical axis of the femur was 0, anatomical axis was 6, and the varus angle was 3. the varus angle was defined as the angle formed by the anatomical axes of the femur and the tibia. the angles formed by the distal tibial articular surface and the floor, the anatomical axis of the tibia and the mechanical axis of the knee were measured by drawing an extension line parallel to the tibial pilon. preprocessing (modeling and mesh generation) was carried out using hypermesh 10.0 (altair engineering, troy, mi, usa), finite element analysis and postprocessing were done using abaqus 6.10 (abaqus, providence, ri, usa). dynamic models were constructed to simulate the motion and contact force on the uhmwpe during gait cycle. the meniscus was assumed to be a linear elastic material with an elastic modulus of e=59 mpa and a poisson ratio of v=0.49, and the patella with an elastic modulus of e=12 mpa and a poisson ratio of v=0.4511). cruciate and collateral ligaments were considered linear materials based on the neo - hookean model12). the locations of ligaments were determined by referring to the previous studies and consultation with clinicians13,14). the tibia and fibula were fixed in terms of the movement along and rotation around the x, y, and z axes, whereas the femur and patella were left completely free under load. anterior - posterior loads up to 100 n were applied to the center of the knee and tibial translation values were compared with those in the studies by li.15,16). ten - noded triangular elements were used to represent the implant bearing and femoral component. to reduce computational time in the dynamic explicit finite element analysis, the femoral component was assumed as conventional cobalt chrome with a density of 8,900 kg / m, an elastic modulus of 209 gpa, and a poisson ration of 0.3117). the uhmwpe was modeled as a plastic material because plastic properties as well as linear elastic properties significantly influence the mechanical behavior of the material17). material properties and locations of the major ligaments around the knee joint were determined based on the previous studies and consultation with clinicians13,14). the anterior and posterior ligaments are resected before implant insertion in posterior - stabilized tka. accordingly, only the medial and lateral ligaments were included in the analysis (fig. four springs were used to represent the anteroposterior (ap) displacement and varus - valgus rotation of the components and anatomical characteristics of soft tissues (fig. 3). the femoral component was constrained in varus - valgus degrees of freedom, while flexion rotation and compression loading were applied. the distal surface of the tibial insert was supported in the inferior - superior direction, insert tilt was constrained, and varus - valgus degrees of freedom was not constrained18). the standard gait cycle with the peak flexion angle of 62, as seen in figs. 3, the swing phase in which the foot is off the ground was assumed as 100% of the gait cycle and the knee at 20%, 50%, 60%, and 70% of gait cycle was observed. the coefficient of friction between the articulating surfaces was assumed to be 0.07 in agreement with the range reported in the literature20). posterior resection was performed at a valgus angle of 6 and posterior tibial slope was measured using a line that connects the center of the tibial intercondylar eminence and the center of the ankle and a perpendicular line on the lateral view of the knee as references. the same loading and boundary conditions were applied to the finite element models with different posterior slopes (0, 7, and 10, respectively) to predict the contact stress distribution, peak contact stress, and stress on the medial and lateral collateral ligaments. in addition to the posterior tibial slope, there are various factors that may affect the posterior - stabilized tka including the joint line change, flexion - extension gap, and leg alignment. however, the design variable of the posterior tibial slope was the only factor we considered in this study. the meniscus was assumed to be a linear elastic material with an elastic modulus of e=59 mpa and a poisson ratio of v=0.49, and the patella with an elastic modulus of e=12 mpa and a poisson ratio of v=0.4511). cruciate and collateral ligaments were considered linear materials based on the neo - hookean model12). the locations of ligaments were determined by referring to the previous studies and consultation with clinicians13,14). the tibia and fibula were fixed in terms of the movement along and rotation around the x, y, and z axes, whereas the femur and patella were left completely free under load. anterior - posterior loads up to 100 n were applied to the center of the knee and tibial translation values were compared with those in the studies by li.15,16). ten - noded triangular elements were used to represent the implant bearing and femoral component. to reduce computational time in the dynamic explicit finite element analysis, the femoral component was assumed as conventional cobalt chrome with a density of 8,900 kg / m, an elastic modulus of 209 gpa, and a poisson ration of 0.3117). the uhmwpe was modeled as a plastic material because plastic properties as well as linear elastic properties significantly influence the mechanical behavior of the material17). material properties and locations of the major ligaments around the knee joint were determined based on the previous studies and consultation with clinicians13,14). the anterior and posterior ligaments are resected before implant insertion in posterior - stabilized tka. accordingly, only the medial and lateral ligaments were included in the analysis (fig. four springs were used to represent the anteroposterior (ap) displacement and varus - valgus rotation of the components and anatomical characteristics of soft tissues (fig. 3). the femoral component was constrained in varus - valgus degrees of freedom, while flexion rotation and compression loading were applied. the distal surface of the tibial insert was supported in the inferior - superior direction, insert tilt was constrained, and varus - valgus degrees of freedom was not constrained18). the standard gait cycle with the peak flexion angle of 62, as seen in figs the swing phase in which the foot is off the ground was assumed as 100% of the gait cycle and the knee at 20%, 50%, 60%, and 70% of gait cycle was observed. the coefficient of friction between the articulating surfaces was assumed to be 0.07 in agreement with the range reported in the literature20). posterior resection was performed at a valgus angle of 6 and posterior tibial slope was measured using a line that connects the center of the tibial intercondylar eminence and the center of the ankle and a perpendicular line on the lateral view of the knee as references. the same loading and boundary conditions were applied to the finite element models with different posterior slopes (0, 7, and 10, respectively) to predict the contact stress distribution, peak contact stress, and stress on the medial and lateral collateral ligaments. in addition to the posterior tibial slope, there are various factors that may affect the posterior - stabilized tka including the joint line change, flexion - extension gap, and leg alignment. however, the design variable of the posterior tibial slope was the only factor we considered in this study. the amounts of tibial translation under the ap loads of up to 100 n were comparable to those in the study by li.15,16) (fig. 5). under the 100 n ap load, the anterior and posterior tibial translation was 2.39 mm and 4.98 mm, respectively, which was similar to 2.43 mm and 5.28 mm15), and 2.55 mm and 4.86 mm16), thus validating the accuracy of our finite element models. the posterior tibial slope appeared to be correlated positively with the contact stress area and inversely with the contact force on uhmwpe. however, the peak contact stress at 60% and 70% gait cycle was greater when the posterior tibial slopes were 10 than 0 and 7 (fig. the contact stress for 0, 7, and 10 posterior tibial slope were, by perspective percentage of the gait cycle : 17.8 mpa, 17.9 mpa, and 7.81 mpa at 20% gait cycle, 22.8 mpa, 7.15 mpa, and 0.238 mpa at 50% gait cycle, 99.3 mpa, 52.1 mpa, and 53.7 mpa at 60% gait cycle, and 8.64 mpa, 1.89 mpa, and 39.1 mpa at 70% gait cycle (table 1). however, the peak contact stress was greater in the 10 posterior tibial slope model than in the 0 posterior tibial slope model (120 mpa vs. 100 mpa). the posterior tibial slope was inversely correlated with the load on the medial and lateral collateral ligaments. the load on the collateral ligaments according to the posterior tibial slope is shown in fig. the load on the lateral collateral ligament, deep medial collateral ligament, anterior medial collateral ligament, and oblique medial collateral ligament was 2474 n, 1466 n, 258 n, and 195 n, respectively, in the 0 posterior tibial slope model, 2068 n, 886 n, 186 n, and 140 n, respectively, in the 7 model, and 1869 n, 936 n, 167 n, and 126 n, respectively, in the 10 model (table 2). the load on the deep lateral collateral ligament was 40 - 65% of that of the medial collateral ligament. the load on the anterior and oblique collateral ligaments was approximately 5 - 15% of that of the medial collateral ligament. the load was the greatest on the lateral collateral ligament, followed by in the order of deep, anterior, and oblique medial collateral ligaments. the amounts of tibial translation under the ap loads of up to 100 n were comparable to those in the study by li.15,16) (fig. 5). under the 100 n ap load, the anterior and posterior tibial translation was 2.39 mm and 4.98 mm, respectively, which was similar to 2.43 mm and 5.28 mm15), and 2.55 mm and 4.86 mm16), thus validating the accuracy of our finite element models. the posterior tibial slope appeared to be correlated positively with the contact stress area and inversely with the contact force on uhmwpe. however, the peak contact stress at 60% and 70% gait cycle was greater when the posterior tibial slopes were 10 than 0 and 7 (fig. the contact stress for 0, 7, and 10 posterior tibial slope were, by perspective percentage of the gait cycle : 17.8 mpa, 17.9 mpa, and 7.81 mpa at 20% gait cycle, 22.8 mpa, 7.15 mpa, and 0.238 mpa at 50% gait cycle, 99.3 mpa, 52.1 mpa, and 53.7 mpa at 60% gait cycle, and 8.64 mpa, 1.89 mpa, and 39.1 mpa at 70% gait cycle (table 1). however, the peak contact stress was greater in the 10 posterior tibial slope model than in the 0 posterior tibial slope model (120 mpa vs. 100 mpa). the posterior tibial slope was inversely correlated with the load on the medial and lateral collateral ligaments. the load on the collateral ligaments according to the posterior tibial slope the load on the lateral collateral ligament, deep medial collateral ligament, anterior medial collateral ligament, and oblique medial collateral ligament was 2474 n, 1466 n, 258 n, and 195 n, respectively, in the 0 posterior tibial slope model, 2068 n, 886 n, 186 n, and 140 n, respectively, in the 7 model, and 1869 n, 936 n, 167 n, and 126 n, respectively, in the 10 model (table 2). the load on the deep lateral collateral ligament was 40 - 65% of that of the medial collateral ligament. the load on the anterior and oblique collateral ligaments was approximately 5 - 15% of that of the medial collateral ligament. the load was the greatest on the lateral collateral ligament, followed by in the order of deep, anterior, and oblique medial collateral ligaments. in this study, we investigated the relationship between the posterior tibial slope and the contact stress at different phases of gait cycle, peak contact stress, and the stress on the medial and lateral collateral ligaments in posterior - stabilized tka using finite element analysis. posterior tibial slope was correlated positively with contact stress distribution and inversely with contact stress. on comparisons between the 0 posterior tibial slope model and 7 posterior tibial slope model at the same point in gait cycle (figs. 4, 8), the contact area was wide in the 7 model whereas narrow in the 0 model from 20% of the gait cycle where the angular displacement increases. it can be interpreted that the contact stress is distributed over a wider area between the femoral and the bearing components in knees with a posterior tibial slope of 7 compared to those with a posterior tibial slope of 0. in the 10 model, the contact area was even wider than that in the 7 model (fig. for some unidentified reasons, the peak contact stress was 20% higher in the 10 model that in the 0 model. due to the configurational differences of each model, the contact stress had different tendencies according to gait cycle. 7 shows the load applied on the medial and lateral collateral ligaments according to the gait cycle : the stress on the medial and lateral collateral ligaments for the lateral stability of the femur and tibia can be compared. in all three different posterior tibial slope models, the lateral collateral ligament that consists of one bundle supports greater stress than the medial collateral ligament that consists of three bundles. stress increases and decreases in a similar fashion as the flexion pattern of the gait cycle (figs. the stress is the greatest on the lateral collateral ligament followed by the deep and anterior ligaments and the oblique medial ligament (fig. the stress on the lateral collateral ligament was the greatest in the 0 model followed by 7 model and 10 model (fig. 7d), indicating the posterior tibial slope was inversely correlated with the stress on the lateral collateral ligament. therefore, the stress on the medial and lateral collateral ligaments is correlated with the knee flexion and contact stress21). limitations of this study include that pcl - retaining tka models were not included in the finite element analysis, each patient 's anatomical differences were not considered as variables, and the model construction was based on knees of the asian enrollees only. however, the significance of our study can be found in the fact that there have been few biomechanical studies on the influence of the posterior tibial slope on the contact surface and ligaments. considering that the ideal posterior tibial slope is between 0 and 5 in most posterior - stabilized tkas, the posterior tibial slope (design variable) was varied from 0 (within the ideal value), 7 (outside the ideal value), to 10 (twice the ideal value) in our models. however, we think improvements should be made in further studies because the same design variable was not maintained and larger posterior tibial slope models were not included in this study. in addition, further studies should involve more design variables and pcl - retaining tka models to verify more effective posterior tibial slope based on the findings of the biomechanical relationship between the contact surface, contact stress, and articular surface erosion. posterior tibial slope was correlated positively with stress distribution and inversely with contact stress in posterior - stabilized tka. however, the peak contact stress was higher in the 10 posterior tibial slope model than that in the other models with smaller posterior slope. in addition, the stress on medial and lateral collateral ligaments was inversely correlated with tibial posterior slope. | purposethe purpose of this study is to evaluate the effect of change in tibial posterior slope on contact force and ligament stress using finite element analysis.materials and methodsa 3-dimensional finite element model for total knee arthroplasty was developed by using a computed tomography scan. for validation, the tibial translations were compared with previous studies. the finite element analysis was conducted under the standard gait cycle, and contact force on ultra - high molecular weight polyethylene (uhmwpe) and stresses on lateral and medial collateral ligaments were evaluated.resultsthe tibial translations showed similarity with previous studies. as the tibial posterior slope angle increases, the contact stress area increased and was well distributed, and the contact force on uhmwpe decreased overall. however, the maximum contact force in the case for 10 case was greater than those for others. the stresses on ligaments were the greatest and smallest in 0 and 10 cases, respectively.conclusionsthe higher tibial posterior slope angle leads to the lower contact stress and more extensive stress distribution overall in posterior - stabilized total knee arthroscopy. however, it does not absolutely mean the smallest contact force. the stresses on ligaments increased with respect to the smaller tibial posterior slope angle. |
-chiral ethers are present in many natural products, biologically active molecules and synthetic intermediates.1 therefore, much effort has been directed towards efficient routes to enantiomerically enriched chiral ethers through allylic etherification reactions.2 within this context, there is currently ongoing interest in utilising unactivated allylic alcohol electrophiles in transition - metal - catalysed allylations of various nucleophiles,3 as the use of unactivated allylic alcohol electrophiles reduces the number of synthetic steps required (by virtue of not requiring prior derivatisation) and minimises byproduct formation. in terms of asymmetric intermolecular etherifications, a recent notable advance by carreira. uses ir catalysis to effect allylic etherifications on secondary allylic alcohols through formal sn2 selectivity.4 one of the key research efforts within our group has been to develop gold - catalysed5 regioselective methods towards allylic ethers6 and allylic thioethers.7 within this context, we recently developed a mild and air - stable gold(i)-catalysed direct allylic etherification of allylic alcohols.8 this dehydrative formal sn2 procedure9 requires neither the allylic alcohol electrophile nor the alcohol nucleophile to be activated (either to install a leaving group in the former or form an alkoxide in the latter), leading to mild reaction conditions that are tolerant of various functional groups as well as air and moisture (scheme 1 a).3a, 10 we were keen to extend this methodology to asymmetric methods by investigating various chiral, non - racemic -substituted substrates, which should be amenable to chirality transfer. in theory, an enantioenriched chiral allylic alcohol with -substitution (e.g., 4, scheme 1), which is easily accessible in good enantioselectivities by sharpless kinetic resolution11 or enzyme resolution,12 should be able to transfer its chirality13 to the allylic ether product 5, especially if a 6-membered ring hydrogen - bonded intermediate i is involved (scheme 1 b). access to chiral, non - racemic,-disubstituted allylic ethers such as 5 from unactivated alcohols also nicely complements recent ir - catalysed allylation methods by carreira.,4a which are confined to formation of unsubstituted secondary allylic ethers (r = h). it should be noted that shortly after our initial communication,8a mukherjee and widenhoefer disclosed an independent report on the same reaction.14 using a different set of catalysts and conditions, they carried out a substrate - scope study on the racemic reaction. in addition, they also elegantly show one example of a chirality - transfer reaction (see below). however, as the substrate scope of their chirality - transfer reaction was not reported and there was room for improvement with regards to the regioselectivity (5:1 of formal sn2/sn2 5/6), we decided that it was still important to continue with our independent studies. these are reported here, and include optimisation to give greatly improved regioselectivities, full substrate - scope studies and experimental and computational mechanistic investigations. our investigation began with the optimisation of reaction conditions to improve the regioselectivity for allylic etherifications, using secondary allylic alcohol 4 a as a model substrate (table 1). our previously reported conditions provided a poor 2:1 ratio of formal sn2/sn2 (5 aa/6 aa, entry 1), which needed to be improved drastically before chirality transfers could be investigated. during our optimisation, we discovered that addition of molecular sieves (ms) to the reaction mixture greatly improved the selectivity, exclusively yielding the formal sn2 product 5 aa (entries 28). 3 ms provided slightly higher yields compared to 4 ms (entry 2 vs. entry 5), however, the yields were modest when only 5 mol % of gold catalyst was employed (42 % and 56 %, respectively). portion - wise addition of gold catalyst (25 mol %) greatly improved the yields (entries 3 and 6), but addition of another portion of molecular sieves makes little difference (entry 3 vs. entry 4). finally, as a compromise between shorter reaction times and acceptable yield, we settled for the protocol shown in entry 8 as our optimised conditions for investigating the chirality - transfer reaction. note that under these newly optimised conditions, the formal sn2 product 5 is formed exclusively for all subsequent substrate - scope screens (tables 2 and2, 3). [a ] isolated yields. 5/6 and e / z ratios determined by h nmr analysis. with these optimised conditions in hand, we turned our attention to effecting chirality transfer in etherifications of a range of enantioenriched allylic alcohols (table 2). for this assay, alcohol 2 b was chosen as the nucleophile for ease of chiral stationary phase (csp)-hplc enantiomer separation in the product. gratifyingly, our first attempt with enantioenriched n - butyl allylic alcohol (r)-4 a gave the desired product (e)-5 ab in 88:12 e.r. from > 99:1 e.r. alternatively, starting with (z)-allylic alcohol 4 b, the opposite enantiomer of the product could be obtained with good transfer of chirality (entry 2). it should be noted, however, that the z - allylic alcohol starting materials (e.g., 4 b, entry 2) are more difficult to access in high e.r., resulting in poorer e.r. of product 5 bb, despite displaying a good degree of chirality transfer (81:1976:24 e.r.). reversing the substituents at the - and -positions of the allylic alcohol similarly gave high yield of product 5 cb with a high degree of chirality transfer (entry 3). replacing the n - butyl substituent with the sterically more demanding cyclohexyl also works well with the cy at the -position, but only moderately at the -position (entries 45). to verify that a more sterically hindered substituent at the -position causes a drop in chirality transfer, allylic alcohol 4 f, with an ipr at the -position was investigated. indeed, moderate chirality transfer of > 99:177:23 e.r. is observed (entry 6). [c ] determined by csp - hplc. [d ] e.r. benzyl - substituted allylic alcohol 4 g provided the best result in this assay, with excellent chirality transfer (> 99:199:1 e.r.) and > 20:1 e / z observed (entry 7). replacing the benzyl in 4 g (entry 7) with a ph substituent (4 h, entry 8) causes a drastic change (racemic product 5 hb). unlike with alkyl substituents (entries 1 vs. 3 and entries 4 vs. 5), swapping the ph substituent around now forms the same product (4 i5 hb, entry 8), so aryl substituents appear to be detrimental to both chirality transfer and formal sn2 selectivity. next, we decided to compare our procedure with substrate 4 j, which was the substrate chosen by widenhoefer. in their studies (entry 9).14 the chirality transfer is once again excellent (99:198:2 e.r.). it should be noted that using our newly optimised conditions, etherification proceeds with significantly higher formal sn2 selectivity (> 20:1 vs. 5:1 formal sn2/sn2). certain substituents on the allylic alcohol substrate were found to cause the chirality transfer to proceed moderately to poorly (entries 1013). for example, dimethyl allylic alcohol 4 k gave a high degree of racemisation (71:29 e.r. ; likewise, increasing the steric bulk of the substituent at the alcohol centre to tert - butyl alcohol 4 l also led to some racemisation during reaction (entry 11). substrates with -substituents performed the worst : 4 m and 4 n both give excellent > 20:1 e / z ratios, but almost complete racemisation under these conditions (entries 1213) and are therefore not suitable substrates for chirality transfer. we next turned our attention to investigating the tolerance of a range of different nucleophile alcohols by using model allylic alcohol substrate (r)-4 a (table 3).15 although para - bromobenzyl alcohol 2 d (entry 3) gave a comparable result to the original nucleophile alcohol 2 b, benzyl alcohol 2 c and para - methoxybenzyl alcohol 2 e yielded products 5 ac and 5 ae, respectively, with a greater degree of chirality transfer (97:3 e.r., entry 4).16 furfuryl alcohol 2 f was also tolerated, though with a reduction of enantioenrichment in product 5 af (entry 5). we then turned our attention to alkyl alcohols. extending the alkyl chain of benzyl alcohol by two methylene units preserved yield, formal sn2/sn2 and e / z alkene selectivity as well as chirality - transfer efficiency (entry 2 vs. entry 6). pleasingly, trifluoromethyl substitution of the nucleophile was tolerated (entry 7) as were haloalkanes (entry 8) and unprotected terminal alkenes (entry 9). when utilising diol 2 k, reaction occurred exclusively through the primary alcohol to give 5 ak in high yield and selectivity (entry 10). acid - labile groups such as acetals 2 l and 2 m were also found to be compatible with the reaction (entries 11 and 12). finally, we demonstrated that the reaction also proceeds very well (> 99:1 e.r.) using a more hindered secondary nucleophile alcohol such as cyclohexanol 2 n (entry 13). values determined by h nmr analysis. [b ] determined by csp - hplc of a derivative. [c ] determined by csp - hplc. [d ] determined by chiral shift h nmr spectroscopy. [e ] determined by csp - gc. [f ] using allylic alcohol (s)-4 j, > 99:1 e.r. the mechanism that we originally proposed for the allylic etherification reaction8a can also account for the chirality transfer and stereospecificity of the reaction (scheme 1). as gold(i) is an excellent -lewis acid,5e it is likely to activate the alkene functionality in the allylic alcohol towards attack by an external alcohol nucleophile (i, scheme 2).10f demetallation and elimination of water (enabled by intramolecular hydrogen - bonding, ii) will then regenerate the catalyst and produce the desired allylic ether product 5. a tightly bound chair - like 6-membered ring transition state17 is required for efficient chirality transfer, and also accounts for the stereospecificity of the e and z isomers. as shown in scheme 1 a, the e isomer has its substituent r in the equatorial position, whereas the z isomer has r axial (scheme 2 b), thus leading to the different stereochemical outcomes. having the substituent r equatorial also accounts for the e - selectivity of the reaction. proposed mechanism for successful chirality transfer and stereospecificity. it is clear from the proposed mechanism in scheme 1 that the hydrogen - bonded 6-membered transition state i is crucial for the chirality transfer, and also the e - selectivity. any erosion of ee could therefore be attributed to the disruption of this hydrogen - bonding pattern that would allow the reaction to occur without this 6-membered transition state i. one such mechanism is explored in the computational section below (see scheme 9). however, a second possibility for erosion of ee is the racemisation of the product 5 through isomerisation between the formal sn2 (5) and formal sn2 (6) products, catalysed by gold(i).6b, c, 17 indeed, during our related studies using thiols for thioetherification reactions, chirality transfer does not occur in the thioetherification reactions.7a, 18 experimental and computational studies showed that the racemisation is due to isomerisation between the formal sn2 and sn2 thioether products. clearly, using alcohol instead of thiol as a nucleophile allows for successful chirality transfer, except in certain substrates, such as -substituted 4 m and 4 n (entries 1213, table 2). therefore, we carried out several control experiments to ascertain the role of isomerisation of the products 5 and 6 in the erosion of ee. firstly, product 5 db (entry 4, table 2) was resubjected to the reaction conditions and no change was observed after 24 h (scheme 3 a). next, 5 eb was investigated, as this product was formed with only moderate chirality transfer (77:23 e.r., once again, no change was observed upon resubjection to the reaction conditions (scheme 3 b). finally, product 5 mb, which is formed as a racemic mixture by our method (entry 12, table 2) was investigated. this species, obtained in 98:2 e.r. by an alternative route,19 was found to racemise upon resubjection to the reaction conditions (scheme 3 c).20 from these results, it appears that slight erosion of ee is not caused by isomerisation / racemisation of the product (see later and scheme 9 for plausible racemisation mechanism). however, instances of complete racemisation, such as the formation of 5 mb and 5 nb from -substituted 4 m and 4 n, respectively, could be due to isomerisation and racemisation of the products under the reaction conditions. resubjection of products 5 db, 5 eb and 5 mb to the reaction conditions. it is clear from the results in table 1 that addition of molecular sieves is the key factor to improving the formal sn2/sn2 (5/:6) regioselectivity. our next control reaction (scheme 4) shows that molecular sieves are also crucial for chirality transfer and e / z selectivities. removing molecular sieves from the reaction results in a completely racemic product 5 db and a poor 3:1 e / z ratio (vs. 89:11 e.r. and 9:1 e / z with molecular sieves added).21 allylic etherification of 4 d without molecular sieves results in racemic product. previously, widenhoefer. had shown that chirality transfer is possible on substrate 4 j, without the need for molecular sieves (scheme 5).14 having just ascertained that molecular sieves are crucial to avoid racemisation, we therefore thought it important to investigate whether the conditions in scheme 5 allow for the omission of molecular sieves in chirality - transfer reactions, or whether successful chirality transfer without molecular sieves is in fact specific to substrate 4 j. our results in scheme 6 show that the latter is true. employing the conditions of widenhoefer. on substrate 4 d (which undergoes chirality transfer with molecular sieves under our conditions, table 2, but racemises in the absence of 3 ms, scheme 4), results in racemic product 5 db. however, employing substrate 4 j under conditions that usually result in racemisation (i.e., no 3 ms), results in efficient chirality transfer. therefore, it appears that the substituent on substrate 4 j plays a significant role in allowing the chirality - transfer process to proceed efficiently even without molecular sieves. for a more general substrate scope, however, the addition of molecular sieves to the reaction is crucial for successful chirality transfer. results by widenhoefer.14 control reactions to ascertain effects of conditions vs. substrate. (a) standard substrate by using the conditions of widenhoefer. (b) substrate 4 j by using conditions that usually result in racemisation. there are several possibilities regarding the mode of action of molecular sieves in the reaction that may lead to the observed chirality - transfer outcome. possible reasons for this could be : i) removal of excess water from the reaction ; ii) the slightly basic nature of molecular sieves, which may deactivate the gold catalyst;22 and iii) the polar surface of molecular sieves may result in the reaction occurring closer to the surface, thereby changing the aggregation levels or transition state. however, a control reaction to test point (i) shows that chirality transfer is observed regardless of whether the molecular sieves are activated or not, thus ruling out this possibility (scheme 7). in fact, the reaction occurs with even better yields and e.r. with unactivated vs. activated sieves (67 %, 94:6 e.r. vs. 90 %, 98:2 e.r., density functional theory (dft) calculations were therefore employed to explore the mechanism of these direct allylic etherification reactions. in particular scheme 1 and 2) was not borne out, except in the presence of molecular sieves. in the calculations we have studied the symmetrically substituted dimethyl allylic alcohol 4 k (as the r, e - isomer) reacting with ethanol (2 o) to give 5 ko. this choice removes the potential complication of any subsequent sn2 reaction at 5 ko as this would return the same 5 ko product. experimental studies indicate that the catalysis is not significantly affected by the nature of the alcohol and so ethanol was chosen for simplicity. the calculations (run with sdd pseudopotentials and basis sets on au and p, with d - orbital polarization on the latter, and 6 - 31 g basis sets on other centres) report free energies derived from a bp86-d3(toluene) protocol, that is, gas - phase free energies based on bp86 optimisations, corrected for dispersion and toluene solvation (using grimme s d3 parameter set and the pcm approach respectively, see supporting information for full details). the au - catalysed direct allylic etherification reaction is thought to proceed23 via coordination of the { au(pph3) } fragment at the c = c -bond of the allylic alcohol. as shown by mukherjee and widenhoefer,14 if the alcohol nucleophile attacks at the opposite face to au then only two outcomes are possible with an enantiopure substrate : with (r, e)-4 k either (s, e)-5 ko or (r, z)-5 ko will be formed (scheme 8). the formation of both products (alongside water) is computed to be thermodynamically downhill, with the e - isomer favoured over the z - form by 1.3 kcal mol. this equates to a e / z ratio of approximately 9:1 at 298 k, fairly typical of the e / z selectivities seen with dialkyl - substituted allylic alcohols (tables 1 and 2). possible outcomes of the au - mediated reaction of (r, e)-4 k with ethanol (2 o) to give either (s, e)- or (r, z)-5 ko. computed product free energies are indicated in kcal mol, relative to the reactant set to 0.0 kcal mol. for the computed mechanism, we consider the direct etherification to start from the -bound adduct [(ph3p)au{(r, e)-4 k}]etoh, i, in which the etoh is hydrogen - bonded to the oh group of the allylic alcohol.24 several arrangements of this adduct were located in the course of this study and the most stable of these, i a, has the etoh lying over the au centre (i.e., syn to au), with interactions to both the o of the allyl group (1.86) and also to one ch bond of the pph3 ligand (2.26, see figure 1, which also provides the associated labelling scheme). the most stable adduct, where the etoh is located on the other side of the c = c -bond (i.e., anti to au, i b), is 6.6 kcal mol higher in energy, with the etoh showing close contacts with one allylic proton, as well as the oh group. all energies in this section will be quoted relative to i a set to 0.0 kcal mol. computed structures of two forms of [(ph3p)au{(r, e)-4 k}]etoh, i, with computed free energies (kcal mol, relative to i a set to zero) and selected distances in. phosphine h atoms are omitted for clarity, with the exception of that interacting with the etoh molecule in i a. the key steps and associated energetics for direct etherification through anti - attack of etoh are outlined in figure 2. starting from i b, co bond formation proceeds through a transition state at + 10.9 kcal mol to give intermediate ii b at + 9.1 kcal mol. the computed structure of this species is shown in figure 3 and displays the anticipated hydrogen - bonded chair - like structure with the au and both me substituents all occupying equatorial positions. similar structures have been reported at a { au(nhc) } fragment.17a from here h transfer induces loss of water and concomitant formation of the auc bond to give intermediate iii b in which the allylic ether product is bound through the c = c bond and water is hydrogen - bonded to the ether oxygen. iii)b at + 11.1 kcal mol. an analogous series of events accounts for the formation of (r, z)-5 ko. starting from i c (g=+6.8 kcal mol), the chair - like intermediate ii c is formed via ts(i ii c is similar to ii b but now has one methyl substituent in an axial position. iii)c at + 13.2 kcal mol leads to iii c from which the allylic ether product is lost as the (r, z)-form. overall, these two allylic etherification processes proceed with modest barriers (99:1 e.r.). the reaction is very functional - group tolerant and proceeds in the presence of unprotected groups such as alkyl halides, tertiary alcohols, alkenes and acid - sensitive acetals. furthermore, we demonstrate that the addition of molecular sieves is crucial not only for excellent formal sn2 selectivity, but also to ensure efficient chirality transfer. the molecular sieves need not be activated to achieve this effect, which implies that it is not aiding the selectivity by removal of water. dft calculations suggest that chirality transfer should proceed under conditions that promote the reaction of a single alcohol as nucleophile. however, at higher alcohol concentrations proton chain transfer mechanisms become accessible, which permit alternative pathways that will erode the chirality transfer. a plausible role of the molecular sieves is to disrupt the aggregation of alcohol molecules in order to prevent loss of chirality through this pathway. whatever the underlying reasons, the impact of molecular sieves in controlling the outcome of these allylic etherification reactions is remarkable and synthetically useful. a solution of [pph3auntf2 ] (2:1 toluene adduct, 5 mol %), allylic alcohol 4 (0.101 mmol), alcohol 2 (0.506 mmol) and 3 molecular sieves (8 mg) in toluene (260 l) was stirred at 50 c under air for 8 h. then, [pph3auntf2 ] (2:1 toluene adduct, 5 mol %) was added and the resulting solution was stirred at 50 c for a further 16 h. the resulting solution was filtered through a short plug of silica, washing with 9:1 hexane / et2o. the filtrate was evaporated under reduced pressure to give the crude product, which was purified by flash column chromatography. full experimental procedures, characterisation for all new compounds and copies of h and c nmr spectra are provided in the supporting information. a solution of [pph3auntf2 ] (2:1 toluene adduct, 5 mol %), allylic alcohol 4 (0.101 mmol), alcohol 2 (0.506 mmol) and 3 molecular sieves (8 mg) in toluene (260 l) was stirred at 50 c under air for 8 h. then, [pph3auntf2 ] (2:1 toluene adduct, 5 mol %) was added and the resulting solution was stirred at 50 c for a further 16 h. the resulting solution was filtered through a short plug of silica, washing with 9:1 hexane / et2o. the filtrate was evaporated under reduced pressure to give the crude product, which was purified by flash column chromatography. full experimental procedures, characterisation for all new compounds and copies of h and c nmr spectra are provided in the supporting information. as a service to our authors and readers, this journal provides supporting information supplied by the authors. such materials are peer reviewed and may be re - organized for online delivery, but are not copy - edited or typeset. technical support issues arising from supporting information (other than missing files) should be addressed to the authors | gold(i)-catalysed direct allylic etherifications have been successfully carried out with chirality transfer to yield enantioenriched, -substituted secondary allylic ethers. our investigations include a full substrate - scope screen to ascertain substituent effects on the regioselectivity, stereoselectivity and efficiency of chirality transfer, as well as control experiments to elucidate the mechanistic subtleties of the chirality - transfer process. crucially, addition of molecular sieves was found to be necessary to ensure efficient and general chirality transfer. computational studies suggest that the efficiency of chirality transfer is linked to the aggregation of the alcohol nucleophile around the reactive -bound au allylic ether complex. with a single alcohol nucleophile, a high degree of chirality transfer is predicted. however, if three alcohols are present, alternative proton transfer chain mechanisms that erode the efficiency of chirality transfer become competitive. |
osteochondroma or exostosis is most common primary benign bony tumor comprising of more than one third of the total occurrences. osteochondromas are considered as an aberration in the normal physial growth plate and originate from the metaphysis of long bone with more than third (35 - 46%) of cases affecting the bone around the knee (lower end femur > upper end tibia), 10% cases involve the small bones of the hand and 5% involve the pelvis and flat bones like scapula (4 - 6%) are least involved. these tumors usually affect the growing skeleton and cease to increase in size after skeletal maturity. these are usually painless but may become painful due to neurovascular entrapment / compression, fracture at the stalk, bursal inflammation or malignant transformation. this article presents a case of osteochondroma on superior angle of scapula in a 23-year - old male presented with pseudo winging and snapping of scapula, crepitus on scapulothoracic motion and occasional pain since 5 years. however, there was no increase in size of the swelling or local and systemic signs of malignant transformation. x - ray demonstrated a pedunculated exophytic mass on supero medial aspect of the right scapula. the patient demonstrated full painless range of motion after 1 month and no recurrence was demonstrated during 1 year follow up. usually a patient presents in early to late childhood, however, in some cases it may be presented in adults. osteochondroma is the most common primary benign bone tumor that most of tenoccursnear the end of long bone usually solitary (90%), may be multiple in the form of hereditary multiple exostosis (hme) in about 10% of cases.. a scapular osteochondroma may be symptomatic mainly due to its mass effect as it may cause scapular pseudo winging and crepitus and snapping on scapulothoracic motion. winging of scapula is defined as prominence of medial border or vertebral border of scapula [3, 4 ]. it can be attributed to many causes but most commonly due to paralysis of serratus anterior muscle which needs to be ruled out. these tumors usually affect the growing skeleton and cease to increase in size after skeletal maturity. any increase in swelling of an asymptomatic swelling turning symptomatic herein, we describe a case of a 23-year - old patient who presented with a swelling on superomedial aspect of right scapula since 5 years. diagnostic work up and management along with clinical pictures a 23 year old male patient presented to the orthopaedic clinic with complaints of an isolated scapular swelling (right) since 5 years (figure 1). the swelling was also associated with crepitus and snapping of the right shoulder and slight restriction and pain on abduction. the patient reported no increase in size of the swelling over the years and demonstrated no increase in symptoms as well. there was no history of antecedent trauma, weight loss, loss of appetite or any other constitutional symptom. the patient wanted the swelling to be removed due to cosmetic reasons mainly as he was about to get married. however, snapping and crepitus / grating could be demonstrated on scapulothoracic movements and restriction in abduction was evident. an antero posterior skiagram of the right shoulder revealed a pedunculated mass arising from the supero medial angle of the scapula (figure 2). scapula shows the anteroposterior view of right shoulder with an exostosis arising from the superior angle of scapula ct scan and mri revealed a mushroom shaped exostosis over the superior angle of scapula (figure 3). shows the anteroposterior view of right shoulder with an exostosis arising from the superior angle of scapula the swelling diagnosed as ventral osteochondroma was excised. a laparoscopic resection of the same has been described, however, we performed an open excision of the swelling. an incision was used along the medial border of scapula wherein it was most prominent (figure 4). post operative course was uneventful and patient was able to perform full range of motion at his right shoulder after 1 month (figures 5,6). follow up was done till 1 year and no recurrence of the swelling was reported. osteochondroma is the most common benign tumor affecting the metaphysis of long bones, rarely involving the flat bones like scapula. usually the swelling is painless, however, symptoms may be detected when the swelling becomes large in size due to sheer bulk of the same. symptoms are usually attributed to neurovascular compression, bursal thickening, fracture through the stalk and rarely malignancy. however in case of scapula, symptoms may include snapping, grating / crepitus on scapulothoracic movements [2, 3, 4 ] and on and off pain etc may be present. ventral swellings may cause most of these symptoms and may also lead to untoward prominence of medial border which remains so even on pushing against a wall, hence called pseudowinging as opposed to winging which increases on performing this maneuver. snapping occurs when the normal smooth gliding of the concave portion of the anterior scapula over the convex thorax is disrupted. scapulo thoracic crepitus may also be produced by an abnormal shape of the scapula which interferes with scapulo - thoracic motion as can be expected in ventral swellings. sometimes ventral swellings may impinge on thoracic cage and restrict abduction which is again a feature of such swellings. usually this condition is benign however, growth in size after skeletal maturity, asymptomatic swelling turning symptomatic and other constitutional and local symptoms / signs may raise the suspicion of malignancy and other radiographic assessment modules need to relied upon like an mri or a ct scan which will clearly demonstrate the margins and cartilage cap thickness (> 2 cm signifies malignancy, < 1 cm benign and 1 - 2 cm questionable). in our case, the patient with scapular swelling demonstrated no increase in size or other features of malignancy. but we still opted for radiological assessment as it helped both in the surgical approach as well as ruled out any malignant transformation and hence malignancy. it is mandatory to get a biopsy for hpe analysis no matter how benign the swelling appears to rule out any traces of malignancy. however, proponents of arthroscopic excision claim that there is slow functional recovery and cosmetic disadvantage due to the larger incision. many authors have advocated arthroscopic excision for ventral mass, however it has risks of incomplete removal and recurrence. usually a patient presents in early to late childhood however in some cases it may be presented in adults. | introduction : osteochondroma or exostosis is most common primary benign bony tumor comprising of more than one third of the total occurrences. osteochondromas are considered as an aberration in the normal physial growth plate and originate from the metaphysis of long bone with more than third (35 - 46%) of cases affecting the bone around the knee (lower end femur > upper end tibia), 10% cases involve the small bones of the hand and 5% involve the pelvis and flat bones like scapula (4 - 6%) are least involved. these tumors usually affect the growing skeleton and cease to increase in size after skeletal maturity. these are usually painless but may become painful due to neurovascular entrapment / compression, fracture at the stalk, bursal inflammation or malignant transformation.case presentation : this article presents a case of osteochondroma on superior angle of scapula in a 23-year - old male presented with pseudo winging and snapping of scapula, crepitus on scapulothoracic motion and occasional pain since 5 years. however, there was no increase in size of the swelling or local and systemic signs of malignant transformation. x - ray demonstrated a pedunculated exophytic mass on supero medial aspect of the right scapula. the findings were confirmed on ct and excision of the lesion was done. the patient demonstrated full painless range of motion after 1 month and no recurrence was demonstrated during 1 year follow up.conclusion:scapular osteochondroma is a relatively rare condition. usually a patient presents in early to late childhood, however, in some cases it may be presented in adults. growth after maturity is indicative of a metastatic transformation. so an excision of the same should be accompanied with histopathological examinations. |
young adult college students in the united states are at a heightened risk for alcohol use problems due to their hazardous patterns of alcohol use [14 ]. particularly, among 14000 students from 119 universities, 31% endorsed criteria for alcohol abuse and 6% endorsed criteria for alcohol dependence. however, few college students seek treatment for alcohol use problems [1, 5 ], suggesting a need to identify risk factors for problematic drinking among these students. the national institute on alcohol abuse and alcoholism (niaaa) has stated that these young adults have personality traits and psychological vulnerabilities that place them at increased risk for problems with alcohol. the present study examined three traits that have been associated with problematic drinking : negative urgency (tendency to behave impulsively in face of strong negative emotions), sensation seeking (tendency to pursue stimulation through impulsive behaviors), and affect lability (rapidly changing affective states) [7, 8 ]. sensation seekers are thought to use alcohol to attain stimulation, whereas individuals who are high on negative urgency might use alcohol to alleviate negative emotions, and affectively labile individuals might use alcohol to regulate affective fluctuations. even though these characteristics indicate different pathways for alcohol use, all three traits have been associated with problematic drinking. however, there are inconsistencies : although sensation seeking has been associated with problematic alcohol use cross - sectionally [11, 12 ] and prospectively, other studies have failed to find this association either cross - sectionally or prospectively. similarly, negative urgency has been associated with problematic drinking [9, 15, 16 ], but some research has failed to find the negative urgency - problematic drinking association cross - sectionally [17, 18 ] and prospectively. finally, affectively labile individuals have also been shown to engage in problematic drinking [7, 1921 ], but the affect lability - problematic drinking association is not always consistent [20, 22 ]. taken together, these findings indicate that the effects of sensation seeking, negative urgency, and affect lability on problematic drinking are inconsistent., prior findings indicated that affect lability interacted with broader impulsivity traits to influence problematic drinking [7, 23 ], supporting the possibility that affect lability might also interact with more specific forms of impulsivity. however, those findings indicated that high levels of affect lability strengthened the effects of impulsivity traits on problematic drinking. in contrast, the present study proposed that higher levels of affect lability will attenuate the effects of sensation seeking and negative urgency on problematic alcohol use. specifically, we proposed that affect lability would compensate for emotional reactivity deficiencies among sensation seekers and would disrupt stable negative emotions among individuals high on negative urgency, both of which would reduce the risk for problematic drinking. indeed, prior studies indicated that sensation seekers are less reactive to aversive stimuli and threatening images. sensation seekers might engage in risky behaviors, such as alcohol use, in order to achieve stimulation and to compensate for these deficiencies in emotional reactivity [24, 27 ]. at the same time, affect lability has been shown to be present in some sensation seekers and has been characterized as enhanced emotional reactivity. high levels of affect lability might compensate for deficiencies in emotional reactivity among sensation seekers. if this is the case, affectively labile sensation seekers may be less likely to use alcohol as a means of compensation. we hypothesized that high levels of affect lability would weaken the effect of sensation seeking on problematic drinking. the experience of negative emotions might cause these individuals to focus on their immediate emotional needs [29, 30 ] and to engage in risky behaviors, such as alcohol use, in order to address those emotional needs. furthermore, prior findings indicated that risky behaviors among individuals high on urgency are driven by strong and stable emotional states [31, 32 ], suggesting that problematic alcohol use among individuals high on negative urgency might also be driven by strong and stable negative emotions. in contrast, affect lability is characterized by fluctuations in affective states. the presence of affect lability among individuals high on negative urgency might undermine the strong and stable negative emotions needed to drive alcohol use. we hypothesized that high levels of affect lability would weaken the effect of negative urgency on problematic drinking. study data were obtained from undergraduate students (n = 785) enrolled in lower level psychology courses at a us midwestern university. the final study sample was restricted to ages 1825, in order to focus on young adults, as recommended by niaaa. furthermore, the final study sample was also restricted to those who consumed alcohol on at least a monthly basis (n = 414), in order to ensure that observed effects were not confounded by abstention. the mean age of the sample was 20.11 years old (sd = 1.79). the sample was comprised of about 74% european american, 9% african american, 5% hispanic american, and 3% asian american with the remaining 9% comprising other races. participants completed the study in one session using a web - based questionnaire and were awarded course credit for participation. we decided to use two subscales of the alcohol use disorder identification test rather than the full scale. this is because the subscales allow us to measure specific constructs underlying problematic alcohol use, including alcohol - related problems and hazardous patterns of drinking, whereas the full scale assesses the risk for alcohol use disorders. additionally, as suggested by coskunpinar and colleagues, disaggregating alcohol outcomes will lead to more robust prediction by impulsivity - related traits. all items were rated on a 5-point likert scale, with higher ratings indicating higher levels of alcohol involvement. the hazardous alcohol use subscale consists of 2 items (=.83) and was calculated as a sum, with higher summed values indicating greater levels of hazardous alcohol use. alcohol - related problems consist of 4 items (=.67), with higher summed values indicating greater levels of alcohol - related problems. this subscale assesses whether participants have ever felt guilty after drinking, had blackouts and other alcohol - related injuries, and have had others expressed concerns about their drinking. sensation seeking and negative urgency were assessed using subscales of the upps - p impulsive behavior scale which is a 59-item inventory designed to measure personality pathways to impulsive behavior. all items were assessed in terms of likelihood of occurrence, with response options ranging from (1) disagree strongly to (4) agree strongly. the subscales were calculated as separate means, with higher mean values indicating higher levels of the trait. the sensation seeking subscale consists of 12 items, which assess the tendency to seek out stimulation and excitement (=.87). the negative urgency subscale consists of 12 items, which assess impulsive behaviors that are related to negative affect (=.86). affect lability was assessed using the affective lability scale - short form, which is an 18-item scale designed to measure fluctuations in affective states. the als - sf has three subscales, which include anxiety and depression lability, anger lability, and depression and elation lability. the anxiety - depression lability subscale consists of 5 items, which assess fluctuations between anxiety and depression (=.90). the anger lability subscale consists of 5 items, which assess changes in affective states from neutral to anger (=.89). the depression - elation lability subscale consists of 8 items, which assess fluctuations between depression and elation (=.88). response options for these items ranged from (1) very characteristic of me to (4) very uncharacteristic of me. separate mean values were calculated for each subscale, with higher mean values indicative of higher degrees of affect lability. using spss 19.0, we examined bivariate correlations among all study variables and performed a series of multiple regression and simple slope analyses. all continuous predictors were centered to facilitate interpretation of the interaction coefficients, and significant interactions were probed at the mean and + 1/1 sd of the moderator using simple slope analyses. because problematic alcohol use has been shown to differ between men and women, gender was included as a covariate in all analyses. age has also been differentially associated with problematic alcohol use and was included as a covariate. we tested all potential covariates by predictor interactions to ensure that the effects of the predictors were independent of the covariates and considered retaining any interactions that were significant at p <.01 to guard against alpha inflation. no covariate by predictor interactions met this criterion, suggesting that the effects of the covariates were independent of those of the predictors. sensation seeking (r =.13, p <.01) and negative urgency (r =.28, p < similarly, negative urgency (r =.21, p <.01) and sensation seeking (r =.26, p < anxiety - depression lability (r =.13, p <.01), depression - elation lability (r =.16, p <.01), and anger lability (r =.16, p <.01) were positively correlated with alcohol - related problems, but not with hazardous alcohol use. negative urgency, but not sensation seeking, was positively correlated with all the affect lability scales, with correlations ranging from.39 to.51 (all p <.01). next, we tested whether the specific affect lability traits moderated the effects of sensation seeking and negative urgency on alcohol - related problems and hazardous alcohol use. for hazardous alcohol use, the effect of sensation seeking was moderated by anxiety - depression lability (b =.48, p =.02). in this analysis, both gender (b = 1.17, p < 0.0001) and age (b = 0.15, p = 0.02) had significant effects on hazardous alcohol use. simple slope analyses indicated that sensation seeking was associated with hazardous alcohol use at low levels of anxiety - depression lability (b = 1.82, p <.001), but this effect weakened for those at mean anxiety - depression lability (b = 0.86, p <.001) and was nonsignificant at high levels of anxiety - depression lability (b = 0.09, p = 0.85) (see figure 1). furthermore, the interaction between negative urgency and anxiety - depression lability on hazardous alcohol use approached significance (b =.40, p =.06). both gender (b = 1.29, p < 0.0001) and age (b = 0.20, the effects of negative urgency on hazardous alcohol use were positive and significant among those low on anxiety - depression lability (b = 1.84, p <.001) and at mean anxiety - depression lability (b = 1.05, p <.001), but not at high levels of anxiety - depression lability (b = 0.25, p = 0.60) (see figure 2). for alcohol - related problems, the effect of sensation seeking was moderated by anger lability (b =.41, p =.01). gender (b = 0.49, p = 0.03), but not age (b = 0.01, p = 0.89), had a significant effect on alcohol - related problems. simple slope analyses indicated that sensation seeking was associated with alcohol - related problems at low levels of depression - elation lability (b = 1.10, p =.02), but the effect weakened at mean (b = 0.22, p = 0.16) and high levels of depression - elation lability (b = 0.66, p = 0.18) (see figure 3). furthermore, the interaction between depression - elation lability and sensation seeking approached significance (b =.41, p =.05). once again, gender had a significant effect on alcohol - related problems (b = 0.47, p = 0.04), but age did not (b = 0.002, p = 0.97). sensation seeking was associated with alcohol - related problems at low levels of anger lability (b = 1.14, p =.002), but not at mean (b = 0.28, p = 0.07) and high levels of anger lability (b = 0.59, p = 0.12) (see figure 4). consistent with our hypotheses, our results indicated that sensation seekers and individuals high on negative urgency are at lower risk for hazardous alcohol use and alcohol - related problems, but only within the context of higher affect lability traits. these findings help explain prior inconsistencies in the literature [11, 14, 16 ] by emphasizing the importance of considering specific emotional experiences in understanding how negative urgency and sensation seeking create risk for problematic drinking. moreover, these findings also clarify prior impulsivity - affect lability interactions [7, 23 ] by showing that affect lability interacts with more specific forms of impulsivity differently. finally, these findings emphasize the importance of considering these three factors when addressing problematic drinking among college students. it has been theorized that sensation seekers engage in risky behaviors, such as alcohol use, to compensate for deficiencies in emotional reactivity [24, 41 ]. our findings provide some support for the notion that the concurrent experience of affect lability might compensate for these deficiencies. specifically, college students who are high on both sensation seeking and affect lability might have less emotional reactivity deficiencies and might consequently be less likely to use alcohol to compensate for emotional reactivity deficiencies and to experience problems from alcohol use. relatedly, although affect lability is not typically considered a protective factor, these findings suggest that problematic drinking among sensation seeking college students could be reduced by increasing emotional reactivity. however, future studies are needed to examine the extent to which emotional reactivity might protect sensation seeking college students from engaging in problematic drinking. furthermore, our results support prior findings indicating that the urgency - risky behavior association is strengthened by strong and stable emotions [31, 32 ] by showing that affective fluctuations weaken the effect of negative urgency on problematic drinking. specifically, when college students high on negative urgency experience affective fluctuations, their current emotional states might not be stable enough to drive alcohol use behaviors. again, although affect lability is not a protective factor, these findings indicate that one approach of reducing problematic drinking among college students high on urgency is by disrupting strong and stable emotions. indeed, prior studies have indicated multiple therapeutic approaches that are effective for dealing with strong distressing emotions and alcohol use. however, future studies are needed to examine whether disrupting strong and stable negative emotions among college students high on urgency directly lead to a reduction in problematic drinking behaviors. finally, we have thus far discussed affect lability as a protective factor among college students who are high on urgency and sensation seeking. however, prior studies have indicated that affectively labile individuals engage in problematic drinking as a way of coping with affective fluctuations [7, 1921 ]. based on these prior studies, affect lability does not appear to be a protective factor. at the same time, there are some features of affect lability that might confer protection against problematic drinking for certain individuals. for instance, affect lability might render sensation seeking college students more emotionally reactive and might disrupt stable negative emotions among college students high on negative urgency. future studies should examine whether cultivating these specific features of affect lability can reduce problematic drinking among college students high on negative urgency and sensation seeking. although this sample of young adults helps attain the goal of understanding problematic alcohol use among young adults given their increased risk, it is unclear how the current results would generalize to other more diverse sample. furthermore, the internal consistency coefficient for our measure of alcohol - related problems was low (=.67), which may have limited our power to detect the effects of our predictors on alcohol - related problems. additionally, the current study did not examine how affect lability might interact with other impulsivity - related traits, such as positive urgency. finally, the interaction effects were small (b < 3), possibly limiting the clinical relevance of our findings and indicating that future studies should replicate these findings using college students with alcohol use disorders in order to further support clinical implications. overall, these results indicated that affect lability seems to alter the effects of sensation seeking and negative urgency on problematic drinking. these results suggest that we must take into account emotional stability and reactivity in order to elucidate whether sensation seeking and negative urgency are creating risk for problematic alcohol use among college students. our results also provide some support for the development of alcohol interventions that focus on disrupting stable negative emotions and that focus on increasing emotional reactivity. although affect lability is not necessarily a protective factor, practitioners and researchers should still consider how increasing some features of affect lability might be beneficial for college drinkers who are high on negative urgency and sensation seeking. | prior studies have suggested that affect lability might reduce the risk for problematic drinking among sensation seekers by compensating for their deficiencies in emotional reactivity and among individuals high on negative urgency by disrupting stable negative emotions. due to the high prevalence of college drinking, this study examined whether affect lability interacted with sensation seeking and negative urgency to influence college student problematic drinking. 414 college drinkers (mean age : 20, 77% female, and 74% caucasian) from a us midwestern university completed self - administered questionnaires online. consistent with our hypotheses, our results indicated that the effects of sensation seeking and negative urgency on problematic drinking weakened at higher levels of affect lability. these findings emphasize the importance of considering specific emotional contexts in understanding how negative urgency and sensation seeking create risk for problematic drinking among college students. these findings might also help us better understand how to reduce problematic drinking among sensation seekers and individuals high on negative urgency. |
lymphedema (le) is a condition in which lymphatic transport is compromised, allowing lymph fluid to accumulate between tissues. the accumulation causes progressive fibrosis between the skin and subcutaneous tissue, and is characterized by non - pitting swelling. this fibrosis and swelling damage lymphocytes and weaken the immune system, which eventually progresses to chronic inflammation and degeneration in the lymphatic system and peripheral tissues1. le causes various problems such as pain, tingling sensation, loss of sensation, muscle weakness, stiffness, and reduced joint range of motion (rom)2. according to previous studies, complex decongestive therapy (cdt) for le includes manual lymph drainage, application of a short stretch compression bandage (sscb), reduction of edema, and skin care. however, an sscb does not continuously maintain the pressure and must be rolled back every day6. if adverse effects on the skin occur and a sscb can not be applied, therapeutic exercises can not be safely performed. after right breast resection on june 2, 2006, a 57-year - old woman underwent axillary lymph node dissection and radiotherapy on october 24, 2012. beginning in december 2013, edema developed in the right upper extremity, for which she presented to the department of rehabilitation. she was diagnosed with le and received treatment of edema three times weekly. on the day of presentation, a physical therapist partially measured the circumference of the upper extremity by using a tape measure as follows : axillary, at 10 cm above the elbow, at the elbow, and at 10 cm below the elbow, wrist, and hand7. the measurements for the right upper limb were 34, 28, 28.5, 23, 16, and 19 cm, respectively. those for the left upper limb were 32, 25, 25, 22, 16, and 18 cm, respectively. the moisture ratio between the body water and the intracellular fluid in the upper extremity was measured by performing a biological analysis with inbodys10 (biospace ltd., the body water volume in the right arm was 1,550 ml, and the extracellular to total cellular (e / t) fluid ratio was 0.384%. the body water volume in the left arm was 1,390 ml, and the e / t fluid ratio was 0.378%. furthermore, the patient showed a restricted rom in the right arm as follow 120 flexion, 80 abduction, 15 external rotation, and 15 internal rotation. on the day of evaluation, the treatment was explained to the patient, and the patient underwent cdt and sscb application. on the next treatment day, because of the skin condition, cdt was administered without a sscb three times per week for 14 weeks. after the treatment on march 27, 2014, the patient was reevaluated. the measurements of the upper right limb (axillary, at 10 cm above the elbow, at the elbow, and at 10 cm below the elbow, wrist, and hand) were reduced to 34.5, 29, 24.5, 25, 16, and 18.5 cm, respectively. the body water volume was 1,680 ml (10.8%), and the e / t fluid ratio was 0.387% in the inbody biological analysis. rom improved to 160 flexion, 120 abduction, 40 external rotation, and 35 internal rotation. however, even though the values of the parameters of the right upper extremity were reduced, the le increased. next, the patient underwent pnf d2 flexion and breathing exercises three times a week for 14 weeks (36 sessions in total). the starting position for the exercise is the supine position, with the shoulder joint in extension, adduction, and internal rotation ; the elbow in extension ; and the forearm, wrist, and fingers in pronation. the shoulder was slowly stretched by flexion, abduction, external rotation, elbow extension, and forearm supination, and the wrist and finger were slowly stretched by extension. the arm and ear were 810 inches apart, and the thumb was pointed toward the floor. the patient stretched her upper extremities as much as possible and maintained the position. at the same time, breathing was stopped and held for 5 seconds. after that, while exhaling, the arm should be slowly returned to the starting position. this treatment is performed for 10 repetitions (three sets), followed by 1 minute of rest. this study conformed to the ethical standards of the declaration of helsinki (1975, revised 1983). the protocol for this study was approved by the institutional review board of hanyang university (hyi-15 - 046 - 1). after the pnf d2 flexion and breathing exercises, parameters of the right upper extremity and the body water volume were reduced. moreover, the restricted rom of the right side was improved. in the reevaluation on july 1, 2014, the parameters of the right upper extremity (axillary, at 10 cm above the elbow, at the elbow, and at 10 cm below the elbow, wrist, and hand) were reduced to 34, 28, 24, 24, 16, and 18 cm, respectively. in addition, the e / t fluid ratio was improved to 0.382%, and rom was improved to 180 flexion, 180 abduction, 80 external rotation, and 45 internal rotation. in this study, the effects of pnf d2 flexion and breathing exercises were studied in a patient with upper extremity le for whom the sscb treatment method could not used. as a result of the intervention, the circumference of the armpit was reduced by 0.5 cm ; that of 10 cm above the elbow, by 1 cm ; that of the elbow, by 0.5 cm ; that of 10 cm below the elbow, by 1 cm ; and that of the back of the hand, by 0.5 cm. a total of 100 ml (9.4%) of body water volume in the right upper extremity was eliminated, and the e / t fluid ratio was decreased by 0.005%. in addition, the rom of the extremity was improved to 20 flexion, 60 abduction, 40 external rotation, and 10 internal rotation. this study showed that pnf d2 flexion and breathing exercises were effective in reducing le and improving rom. this study suggests the cdt method and pnf d2 flexion and breathing exercises for patients for who a sscb could not be applied. in addition, it is already known that sscb compression force helps the natural pumping action of the muscle to increase circulation of venous and lymphatic fluid in edematous areas3. however, in a research by irdesel.8, comparison between a group that maintained pressure during the exercise and an opposition group did not show a beneficial difference in circulation. previous studies have shown that pnf exercise improves joint mobility and muscle function9,10,11,12. moreover, in a study by sharman.9, active pnf stretching was found to be the most effective method to improve rom. in addition, in a study by hindle.10, pnf stretching was found to improve rom, although plyometric, high - intensity, or maximum - intensity exercise reduced muscle consumption. after gonzlez - rav.11 implemented different exercises for 13 weeks and compared overall rom and shoulder rom in pnf groups, rom improved by 5.91 (70.9676.01) and 5.08 (71.8476.88), respectively, in the manual exercise groups but was reduced by 2.57 (68.1166.06) in the non - exercise group. however, in a comparison between the results of their study and those of previous studies, the same results could not be concluded owing to differences in study subjects. therefore, studies on increasing muscular strength through performance of pnf are needed in order to determine their effect on edema. moseley.13 analyzed breathing and gentle arm exercises, and observing le reduction in the upper extremity by 46 ml (5.8%) immediately after exercise, 50 ml (5.3%) after 30 minutes, 46 ml (4.3%) after 24 hours, and 33 ml (3.5%) after 1 week. this parameter was remeasured 1 month after exercise and was reported to have decreased by 101 ml (9.0%). although their research method differed, they reported a positive effect on le reduction because of the combined effects of breathing and upper extremity exercises. this study is a case report of individual treatment results in one patient, without a control group. because of this limitation, correlation could not be conclusively determined between the effects pnf d2 flexion and those of breathing exercises on le and rom. therefore, the present authors referred to studies such as that by moseley.11 and concluded that pnf d2 flexion and breathing exercises improved le and rom. although this study is a case report of a single patient, its results indicate that these exercises should be studied on a larger scale. | [purpose ] the aim of this study was to evaluate the effects of proprioceptive neuromuscular facilitation (pnf) d2 flexion and breathing exercises in a patient with lymphedema (le). [subject ] this report describes a 57-year - old woman with le in whom a short - stretch compression bandage (sscb) could not be used for treatment because of skin itching and redness. [methods ] the patient received complex decongestive therapy without a sscb. next, pnf d2 flexion and breathing exercises were conducted three times per week for 14 weeks (36 times). [results ] as a result, the circumference of the armpit was reduced by 0.5 cm ; that of 10 cm above the elbow, by 1 cm ; that of the elbow, by 0.5 cm ; that of 10 cm below the elbow, by 1 cm ; and that of the back of the hand, by 0.5 cm. a total of 100 ml (9.4%) of body water was eliminated from the right upper extremity, and moisture ratio was reduced by 0.005%. finally, range of motion was improved to 20 flexion, 60 abduction, 40 external rotation, and 10 internal rotation. [conclusion ] this study showed that pnf d2 flexion and breathing exercises were effective in reducing le and improving range of motion. |
the growth of home and community - based services (hcbs) under medicaid can be traced to the early 1980s when it was found that : a disproportionate percentage of medicaid resources were being used for institutional long - term care (davidson, 1980 ; grannemann and pauly, 1983 ; holahan, 1975 ; spiegel and podair, 1975). several studies documented that at least one - third of persons residing in nursing facilities that were medicaid funded would have been capable of living at home or in community residential settings if additional supportive services were available (fox and clauser, 1980 ; kraus,., 1978 ; pegels, 1980 ; weissert, 1986). institutional bias in the medicaid benefit and eligibility structure (grannemann and pauly, 1983 ; holahan, 1975 ; leonard, brust, and choi, 1989 ; weissert and scanlon, 1985). residents in both nursing facilities and intermediate care facilities for the mentally retarded frequently reported an unsatisfactory quality of life (de silva and faflak, 1976 ; gardner, 1977 ; lakin and hall, 1990 ; scheerenberger, 1976). a number of court cases resulted in court orders to deinstitutionalize persons with developmental disabilities. the hcbs waiver program was established by section 2176 of the omnibus budget reconciliation act of 1981 and was incorporated into the social security act (the act) at section 1915(c). under the hcbs waiver program, states can elect to furnish under medicaid, as an alternative to institutional care, a broad array of services (excluding room and board) that are not otherwise covered under the medicaid program. passage of this statute represented a first step towards recognizing that many individuals at risk of institutionalization can be supported in their homes and communities, thereby preserving their independence and bonds to family and friends, at a cost not higher than institutional care (health care financing administration, 1996). the act lists seven specific services that may be provided under the hcbs waiver program. although not specified in the act, other services may be provided at the request of the state if approved by hcfa. for example, these services may include transportation, in - home support services, meal services, special communication services, minor home modifications, and adult day care (health care financing administration, 1996). hcbs waiver services may be provided to individuals who are elderly and disabled, physically disabled, developmentally disabled or mentally retarded, or mentally ill. hcbs waiver services may also be targeted to individuals with a specific illness or condition, such as children who are technology - dependent or individuals with aids (health care financing administration, 1996). in the absence of the hcbs waiver these individuals would require the level of care offered in a hospital, nursing facility, or intermediate care facility for the mentally retarded. states have a great deal of flexibility in designing their own unique hcbs waiver program(s). this enables a state to identify a specific population and target services to that population to meet the population 's unique needs. as previously noted, the hcbs waiver program gives states the flexibility to develop and implement creative alternatives to institutional care for individuals who are medicaid eligible. this flexibility is advantageous to the states as it allows states to tailor their programs to the specific needs of the populations they wish to serve. for example, under the hcbs waiver a state may : provide services in the home or community as a cost - effective alternative to institutional care. target services to a specific group by waiving section 1902(a)(10)(b) of the act which relates to the comparability requirement. limit services to a specific geographic area by waiving section 1902(a)(1) of the act which relates to the statewideness requirement. request an exception to the deeming rules under the social security administration 's supplemental security income program, thereby the eligibility determination for an individual in the community on an hcbs waiver is made using institutional versus community deeming rules. the medicaid hcbs waivers are an important tool for states to meet the requirements of the americans with disabilities act (ada) as defined by the u.s. is properly regarded as discrimination based on disability in violation of the provisions of the ada. the court affirmed the policy that the ada supports access to community living for persons with disabilities by obliging states to administer their services, programs, and activities in the most integrated setting appropriate to the needs of the qualified individuals with disabilities. in addition, the court found that institutionalization severely limits a person 's ability to interact with family and friends, to work, and to make a life for himself or herself. to help states comply with the court 's ruling, hcfa and the department of health and human services ' office for civil rights have begun working with states and the disability community toward the goals of promoting hcbs and honoring individual choice in service provision. estimated total medicaid expenditures for the hcbs waiver program for 1998 were over $ 9 billion for an estimated 606,953 participants (harrington., 1999). states continue to renew existing hcbs waivers, as well as request new hcbs waivers. (arizona provides similar services under the authority of a section 1115 demonstration waiver rather than a section 1915(c) waiver [harrington., 1999 ].) | the history and current status of the medicaid home and community - based services waiver program are presented. the article discusses the states ' role in developing and implementing creative alternatives to institutional care for individuals who are medicaid eligible. also described are services that may be provided under the waiver program and populations served. |
not only is copd a significant cause of morbidity worldwide, but it is also the fourth - leading cause of mortality today and is estimated to be the third - leading cause of death by 2020. exacerbations of copd are the episodic periods of the disease, characterized by deterioration of respiratory function. respiratory infections are responsible for 50 - 70% of copd exacerbations, and environmental pollution causes another 10%. nearly 30% of all copd exacerbations have unknown etiology. although a meta - analysis found that the prevalence of pulmonary embolism (pe) was 20% among patients who were in a period of exacerbation of copd, that prevalence was found to be 13.7% in a recent study. the prevalence of pe in post - mortem studies ranges from 28% to 51%. the presentation of common symptoms of copd exacerbations, such as dyspnea and cough, might cause the diagnosis of acute pe to be overlooked. patients with copd are at risk of developing pe due to various reasons, such as immobility, systemic inflammation, and polycythemia. in addition, copd has been recently defined as an independent risk factor for pe. the prevalence of pe in a highly specific group of patients who were hospitalized for severe exacerbation with unknown origin was reported to be 25%. reported that venous thromboembolism (vte) was three times more prevalent in patients with an exacerbation of unknown origin than in patients with an exacerbation of known origin. the exact prevalence of pe in patients who are in a period of an acute exacerbation of copd and the clinical features of those patients are as yet unclear. the objective of the present study was to determine the prevalence of pe in patients during copd exacerbation and to describe the clinical aspects in those patients diagnosed with pe. this was a prospective study conducted in a university hospital in the city of ankara, turkey. all copd patients who were hospitalized due to acute exacerbation of copd between may of 2011 and may of 2013 were included in the study. the study protocol was approved by the research ethics committee of ufuk university, located in ankara, turkey. exclusion criteria were having a history of hypersensitivity after the injection of contrast material ; having chronic renal disease, pneumonia, or congestive heart failure ; having been under anticoagulant treatment ; and being unable to give written informed consent because of confusion or dementia. patients with an inconclusive diagnosis of copd were also excluded. as a result, a total of 172 patients were included in the study. the diagnosis of copd was confirmed by medical history and previous medical records (chest x - rays and pulmonary function testing). the severity of copd was determined by using the global initiative for chronic obstructive lung disease (gold) criteria. acute exacerbation was diagnosed when the patient with copd had a worsening in respiratory symptoms beyond the normal day - to - day variations that led to a change in medication. detailed clinical evaluations were performed for all participants by medical history, physical examination, and chest x - rays. blood samples were taken immediately for the evaluation of d - dimer, blood workup, arterial blood gas analysis, and n - terminal pro - brain natriuretic peptide (nt - pro - bnp) levels. d - dimer levels were measured with the tina - quant d - dimer assay system (boehringer, mannheim, germany), which is a particle - enhanced immunoturbidimetric assay. we used roche elecsys probnp assay (roche diagnostics, mannheim, germany) in order to determine nt - pro - bnp levels. risk factors for developing vte, such as surgery, malignancy, immobility (bed rest > 48 h), and previous vte, were noted while recording the history of the patient. we used the simplified version of the revised geneva score, well 's score, and the clinical classification proposed by miniati. in all patients who were included in the study. chest ct angiography (cta) was performed with a 16-section multidetector ct scanner (ge light speed 16 ; ge healthcare, milwaukee, wisconsin, usa) within 24 h of admission. the patients were injected 100 ml of non - ionic contrast media (iohexol omnipaque 300/100 ; ge healthcare, milwaukee, wi, usa) via an 18 g needle into the antecubital vein at a rate of 4 ml / s using a power injector (medrad stellant dual ; medrad, indianola, pa, usa). chest cta was carried out using a dedicated workstation (advanced workstation 4.0 ; ge healthcare). the diagnosis of pe was reached when an intraluminal filling defect surrounded by intravascular contrast or total occlusion of the pulmonary arterial lumen was detected at any level of the pulmonary arteries. doppler ultrasonography of the deep veins of the lower extremities was performed by an experienced radiologist who was blinded about the angiographic results. a standard method was used with a dedicated ultrasound unit (logiq 7 ; ge healthcare) and a 10l linear array transducer (bandwidth, 6 - 10 mhz) in order to investigate the presence / absence of intravenous thrombi. arterial blood gas analyses were performed with a gem premier 3000 blood gas / electrolyte analyzer (model 570 ; instrumentation laboratory, lexington, ma, usa). interpretation of the results was as follows : acidosis, ph 7.45 ; hypercapnia, paco2 > 45 mmhg ; hypocapnia, paco2 30 kg / m, whereas a diagnosis of cachexia was given to male patients with a bmi 140/90 mmhg on three separate occasions after hospital admission. the participants on antihypertensive or antidiabetic treatment were considered to have hypertension or diabetes mellitus. a diagnosis of coronary artery disease was based on previous medical records (echocardiogram and cta) of the patients. anemia was diagnosed based on hemoglobin levels (18 years of age and 18 years of age). the data was analyzed using the statistical package for the social sciences 11.5 pocket program (spss inc., categorical variables were expressed as absolute and relative frequencies, whereas continuous variables were expressed as means, standard deviations, medians, minimum values, and maximum values. the chi - square test was used in order to compare two independent groups of categorical variables. the mann - whitney u test was used in order to compare two independent groups of continuous variables. statistical significance was set at a value of p 0.05). the localization of thrombi in patients who had pe and the results of the doppler ultrasonography are shown in table 2. table 2localization of the thrombi on chest ct angiography and doppler ultrasonography of the lower limbs in the 172 patients studied. the ratios of low probability according to the revised geneva score, well 's score, and the clinical classification by miniati. in patients who had a confirmed diagnosis of pe was 18%, 24%, and 44%, respectively. the clinical probabilities of the patients who were diagnosed with pe (positive results on cta) according to the three abovementioned scores are shown in table 3. table 3clinical probabilities of the 50 patients diagnosed with pulmonary embolism according to the scoring systems used in the study. there was no statistically significant difference between the groups of patients with pe and without pe in terms of age, gender distribution, and presence / number of accompanying comorbidities (p > 0.05 for all). the prevalence of obesity was significantly higher among the patients with pe (p = 0.033). the prevalence of other comorbidities (cachexia, hypertension, diabetes mellitus, coronary artery disease, and anemia) was not different between the groups with or without pe (p > 0.05). however, the prevalence of immobility was significantly higher among those with pe (p = 0.024). risk factors for vte (trauma, malignancy, surgery, congestive heart failure, or previous history of vte) did not significantly differ between the two groups (p > 0.05). in addition, the presence of symptoms, such as cough, sputum, hemoptysis, dyspnea, tachycardia, fever, etc., did not significantly differ between the two groups (p > 0.05). pleuritic chest pain and lower limb asymmetry were significantly more prevalent among those diagnosed with pe (p = 0.038, and p = 0.002, respectively). levels of d - dimers and nt - pro - bnp were significantly higher among the patients with pe than among those without (p 0.05). the clinical and laboratory findings in the patients with and without pe are compared in table 4. table 4clinical and laboratory characteristics of the patients with and without pulmonary embolism. multiple logistic regression analysis revealed that obesity and lower limb asymmetry were the independent variables that predicted the presence of pe in the patients with copd (or = 4.97 ; 95% ci, 1.775 - 13.931 and or = 2.329 ; 95% ci, 1.127 - 7.105, respectively). the present study showed that pe was present in 29.1% of the patients who were hospitalized due to an exacerbation of copd. patients with pleuritic chest pain, lower limb asymmetry, and high nt - pro - bnp levels were more likely to develop pe, as were those who were obese or immobile. obesity and lower limb asymmetry were independent predictors of pe in the patients with copd exacerbation. because clinical features of pe are nonspecific (e.g., dyspnea and pleuritic chest pain), it might be underdiagnosed in patients with copd during periods of exacerbation. visual confirmation of the clot with an imaging technique is required in order to warrant anticoagulation therapy in appropriate dose and duration. the prevalence of pe in copd exacerbations is not precisely known, but a recent meta - analysis reported that the prevalence of pe in copd exacerbation with an unknown cause was 20%. the prevalence was higher (24.7%) in four studies that included hospitalized copd patients. however, tillie - leblond. found the prevalence of pe to be 25% in copd patients with severe exacerbation of unknown origin. in our study, we also evaluated the prevalence of pe among hospitalized patients with copd exacerbation, and it was even higher (29.1%). found the prevalence of pe among patients who were hospitalized due to copd exacerbation to be 13.7%, which was lower than that in our study. they found that being female, having chest pain, having hypotension, and having syncope to be predictors of pe in patients with copd exacerbation. similarly, we found positive relationships of pleuritic chest pain and lower limb asymmetry with the occurrence of pe. found that none of the patients with low - risk determination and 20.7% of those with moderate - risk determination had pe. in contrast, our study showed that, among the patients with pe, 24% had a low clinical probability, and 68% had a moderate clinical probability according to the well 's score. reported that patients with pe and copd had a lower pre - test probability for pe than the patients with pe but without copd. in the present study, a low probability according to all three scoring systems (revised geneva, well 's and miniati.) could not rule out pe in the patients with copd exacerbation. these results showed that the clinical risk assessment of patients with copd exacerbation for pe can mislead clinicians. the presence of common symptoms in copd exacerbation and pe might be the reason that causes a high incidence of low - risk probability in these patients. further studies are necessary to evaluate the inclusion of copd to the criteria for the clinical risk assessment for pe in order to overcome this problem. the variation in the prevalence of pe is thought to be the result of differences in study populations and study design. the prevalence of pe in copd patients who were admitted to the emergency department was reported to be 3.3% in a study. the low prevalence in that study might result from the evaluation of patients admitted to the emergency department. additionally, the authors did not further evaluate the copd patients who did not have a clinical suspicion of pe and had low d - dimer levels (48 h) e tev anterior, foram anotados durante o registro da histria do paciente. a verso simplificada do escore de genebra revisado, o escore de wells e a classificao clnica proposta por miniati. a angiotomografia (angio - tc) de trax foi realizada em tomgrafo multidetector de 16 canais (ge light speed 16 ; ge healthcare, milwaukee, wi, eua) no prazo de 24 h aps a admisso. os pacientes receberam 100 ml de meio de contraste no inico atravs de agulha 18 g inserida na veia antecubital a uma velocidade de 4 ml / s utilizando - se um injetor automtico (medrad stellant dual ; medrad, indianola, pa, eua). a angio - tc de trax foi realizada utilizando - se uma estao de trabalho exclusiva (advanced workstation 4.0 ; ge healthcare). chegou - se ao diagnstico de ep quando se detectava falha de enchimento intraluminal circundada por contraste intravascular ou ocluso total do lmen arterial pulmonar em qualquer nvel das artrias pulmonares. a ultrassonografia doppler das veias profundas dos membros inferiores foi realizada por um radiologista experiente e que no tinha conhecimento dos achados angiotomogrficos. um mtodo padro, com um aparelho de ultrassom exclusivo logiq 7 ; ge healthcare) e um transdutor linear de 10l (largura de banda : 6 - 10 mhz), foi utilizado para investigar a presena / ausncia de trombos intravenosos. a gasometria arterial foi realizada com um aparelho analisador de gases sanguneos e eletrlitos gem premier 3000 (modelo 570 ; instrumentation laboratory, lexington, ma, eua). a interpretao dos resultados foi a seguinte : acidose, ph 7,45 ; hipercapnia, paco2 > 45 mmhg ; hipocapnia, paco2 30 kg / m, enquanto o diagnstico de caquexia foi dado a pacientes do sexo masculino com imc 140/90 mmhg em trs momentos distintos aps a admisso hospitalar. o diagnstico de diabetes mellitus foi feito com base nos critrios da american diabetes association. os participantes em uso de tratamento anti - hipertensivo ou antidiabtico foram considerados portadores de hipertenso ou diabetes mellitus. o diagnstico de doena arterial coronariana foi feito com base nos pronturios anteriores (ecocardiograma e angio - tc) dos pacientes. a anemia foi diagnosticada com base nos nveis de hemoglobina (18 anos de idade e 18 anos de idade). os dados foram analisados com o programa statistical package for the social sciences, verso 11.5, porttil (spss inc., chicago, il, eua). as variveis categricas foram expressas em frequncias absolutas e relativas, enquanto as variveis contnuas foram expressas em mdias, desvios padro, medianas, valores mnimos e valores mximos. o teste do qui - quadrado foi utilizado para comparar dois grupos independentes de variveis categricas. o teste u de mann - whitney foi utilizado para comparar dois grupos independentes de variveis contnuas. variveis com p 0,05). a localizao dos trombos nos pacientes que apresentavam ep e os resultados na ultrassonografia doppler so apresentados na tabela 2. tabela 2localizao dos trombos na angiotomografia de trax e na ultrassonografia doppler de membros inferiores dos 172 pacientes estudados. as propores de baixa probabilidade segundo o escore de genebra revisado, nos pacientes com diagnstico confirmado de ep foram de 18%, 24% e 44%, respectivamente. as probabilidades clnicas dos pacientes diagnosticados com ep (achados positivos na angio - tc) segundo os trs escores mencionados acima so apresentadas na tabela 3. tabela 3probabilidades clnicas dos 50 pacientes diagnosticados com embolia pulmonar segundo os sistemas de pontuao utilizados no estudo. no houve diferena estatisticamente significativa entre os grupos de pacientes com ep e sem ep quanto a idade, distribuio por sexo e presena / nmero de comorbidades associadas (p > 0,05 para todos). a prevalncia de obesidade foi significativamente maior entre os pacientes com ep (p = 0,033). a prevalncia de outras comorbidades (caquexia, hipertenso, diabetes mellitus, doena arterial coronariana e anemia) no foi diferente entre os grupos com e sem ep (p > 0,05). porm, a prevalncia de imobilidade foi significativamente maior entre aqueles com ep (p = 0,024). os fatores de risco para tev (trauma, malignidade, cirurgia, insuficincia cardaca congestiva ou histria prvia de tev) no diferiram significativamente entre os dois grupos (p > 0,05). alm disso, a presena de sintomas, tais como tosse, escarro, hemoptise, dispneia, taquicardia, febre, etc. dor torcica pleurtica e assimetria de membros inferiores foram significativamente mais prevalentes entre aqueles diagnosticados com ep (p = 0,038 e p = 0,002, respectivamente). os nveis de dmero - d e de nt - pro - bnp foram significativamente maiores entre os pacientes com ep do que entre aqueles sem ep (p 0,05). os achados clnicos e laboratoriais nos pacientes com e sem ep so comparados na tabela 4. tabela 4caractersticas clnicas e laboratoriais dos pacientes com e sem embolia pulmonar. a anlise de regresso logstica mltipla revelou que obesidade e assimetria de membros inferiores foram as variveis independentes preditoras da presena de ep nos pacientes com dpoc (or = 4,97 ; ic95% : 1,775 - 13,931 e or = 2,329 ; ic95% : 1,127 - 7,105, respectivamente). o presente estudo mostrou que a ep estava presente em 29,1% dos pacientes hospitalizados por exacerbao da dpoc. os pacientes com dpoc e dor torcica pleurtica, assimetria de membros inferiores e altos nveis de nt - pro - bnp, assim como aqueles que estavam obesos ou imobilizados, apresentavam maior probabilidade de desenvolver ep. obesidade e assimetria de membros inferiores foram preditoras independentes de ep nos pacientes com exacerbao da dpoc. clnicas da ep so inespecficas (por ex., dispneia e dor torcica pleurtica), ela pode ser subdiagnosticada em pacientes com dpoc durante perodos de exacerbao. necessria a confirmao visual do cogulo por meio de uma tcnica de imagem para justificar a anticoagulao em dose e durao adequadas. a prevalncia de ep nas exacerbaes da dpoc no conhecida com preciso, mas uma recente meta - anlise relatou que a prevalncia de ep na exacerbao da dpoc de causa desconhecida foi de 20%. a prevalncia foi maior (24,7%) constataram que a prevalncia de ep em portadores de dpoc com exacerbao grave de origem desconhecida foi de 25%. em nosso estudo, tambm avaliamos a prevalncia de ep entre pacientes hospitalizados com exacerbao da dpoc, e ela foi ainda maior (29,1%). constataram que a prevalncia de ep entre pacientes hospitalizados por exacerbao da dpoc foi de 13,7%, menor do que a encontrada em nosso estudo. eles constataram que sexo feminino, dor torcica, hipotenso e sncope foram preditores de ep em pacientes com exacerbao da dpoc. de forma semelhante, constatamos que dor torcica pleurtica e assimetria de membros inferiores apresentavam relaes positivas com a ocorrncia de ep. constataram que nenhum dos pacientes classificados como de baixo risco e 20,7% daqueles classificados como de risco moderado apresentavam ep. em contrapartida, nosso estudo mostrou que, entre os pacientes com ep, 24% apresentavam baixa probabilidade clnica e 68% apresentavam probabilidade clnica moderada segundo o escore de wells. relatou que pacientes com ep e dpoc apresentavam menor probabilidade pr - teste de ep do que pacientes com ep mas sem dpoc. no presente estudo, baixa probabilidade segundo todos os trs sistemas de pontuao (genebra revisado, wells e miniati.) no permitiu excluir ep nos pacientes com exacerbao da dpoc. esses resultados mostraram que a avaliao de risco clnico para ep em pacientes com exacerbao da dpoc pode induzir os mdicos ao erro. a presena de sintomas comuns na exacerbao da dpoc e no ep pode ser a razo que faz com que haja uma alta incidncia de baixa probabilidade de risco nesses pacientes. a dpoc foi recentemente definida como sendo um fator de risco independente para ep. mais estudos so necessrios para analisar a incluso da dopc aos critrios de avaliao de risco clnico para ep a fim de contornar esse problema. acredita - se que a variao na prevalncia de ep seja resultado de diferenas nas populaes estudadas e nos desenhos dos estudos. a prevalncia de ep em pacientes com dpoc admitidos no servio de emergncia foi relatada como sendo de 3,3% em um estudo. a baixa prevalncia naquele estudo pode ser resultado da avaliao de pacientes admitidos no servio de emergncia. alm do mais, os autores no avaliaram mais profundamente os portadores de dpoc sem suspeita clnica de ep e com baixos nveis de dmero - d (< 0.5 g / ml). no presente estudo, todos os pacientes hospitalizados com exacerbao da copd foram avaliados por mtodos de imagem sem considerar as probabilidades clnicas de ep e os nveis de dmero - d., a prevalncia de ep entre pacientes hospitalizados com exacerbao da copd foi distintamente menor do que a encontrada em nosso estudo (5% vs. 29,1%), apesar das semelhanas na populao selecionada e no desenho dos dois estudos. porm, em contrapartida ao estudo deles, a localizao da ep na maioria dos nossos pacientes era perifrica. em ambos os estudos, os nveis de nt - pro - bnp foram significativamente maiores em portadores de dpoc com ep. de internao tenha sido maior nos portadores de dpoc com ep, aquele estudo no revelou diferena entre os dois grupos quanto ao tempo de internao. o qual no relatou nenhuma diferena nos nveis de paco2 em portadores de dopc com ou sem ep, o presente estudo mostrou que alcalose respiratria e hipocapnia foram mais comuns em pacientes com exacerbao da dpoc associada ep.. de forma semelhante, relatos anteriores mostraram que reduo da paco2 durante a exacerbao da dpoc pode indicar ep. os nveis de bnp aumentam em pacientes com insuficincia cardaca congestiva e infarto agudo do miocrdio ; o bnp tambm um marcador de disfuno ventricular direita na ep aguda e correlaciona - se com a presso arterial pulmonar. mostraram que indicadores ecocardiogrficos de insuficincia cardaca direita aguda foram mais prevalentes em portadores de dpoc com ep. em nosso estudo, exclumos os pacientes com insuficincia cardaca congestiva na avaliao inicial. os nveis de nt - pro - bnp foram significativamente maiores em portadores de dpoc com ep do que naqueles sem ep. a ecocardiografia requer percia e conhecimento, e nem todos os centros mdicos tm capacidade para realiz - la. porm, as medies de nt - pro - bnp podem ser mais acessveis para a avaliao de insuficincia cardaca direita e presso arterial pulmonar em portadores de dpoc sem insuficincia cardaca congestiva que esto sendo investigados para ep. hipotenso e sncope foram os sintomas mais comuns no estudo realizado por gunen., o que pode ser explicado com base na localizao dos trombos (metade dos pacientes com ep apresentava trombo em localizao central). no presente estudo, os trombos em pacientes com exacerbao da dpoc e ep eram mais comumente perifricos (segmentais e subsegmentais) em 80% dos pacientes, e dor torcica pleurtica foi o sintoma mais comum. em nossa populao de estudo, a localizao perifrica da maioria dos trombos pode ser o motivo das taxas de mortalidade semelhantes porm, importante detectar e tratar adequadamente os trombos localizados perifericamente a fim de prevenir recidivas, que podem causar a morte. embora este seja o maior estudo de avaliao da prevalncia e das caractersticas de pacientes com exacerbao da dpoc associada ep, tratou - se de um estudo de centro nico. alm disso, o presente estudo investigou a prevalncia de ep e as condies clnicas em que se suspeitava de ep apenas em pacientes com exacerbao da dpoc. em concluso, a prevalncia de ep em pacientes com exacerbao da dpoc em nosso estudo foi maior do que a esperada. a exacerbao da dpoc e a ep podem estar associadas. em vista disso, a ep deve ser considerada em pacientes com exacerbao da dpoc, especialmente naqueles que esto imobilizados, apresentam dor torcica pleurtica, apresentam altos nveis de dmero - d, nt - pro - bnp e ph e apresentam baixos nveis de paco2. obesidade e assimetria de membros inferiores foram preditores independentes da presena de ep em nossos pacientes. estudos maiores so necessrios para avaliar a prevalncia de ep em pacientes com exacerbao da dpoc de uma forma mais precisa e para proporcionar uma compreenso dos fatores e mecanismos que influenciam o desenvolvimento de ep nessa populao. | objective : because pulmonary embolism (pe) and copd exacerbation have similar presentations and symptoms, pe can be overlooked in copd patients. our objective was to determine the prevalence of pe during copd exacerbation and to describe the clinical aspects in copd patients diagnosed with pe.methods:this was a prospective study conducted at a university hospital in the city of ankara, turkey. we included all copd patients who were hospitalized due to acute exacerbation of copd between may of 2011 and may of 2013. all patients underwent clinical risk assessment, arterial blood gas analysis, chest ct angiography, and doppler ultrasonography of the lower extremities. in addition, we measured d - dimer levels and n - terminal pro - brain natriuretic peptide (nt - pro - bnp) levels.results:we included 172 patients with copd. the prevalence of pe was 29.1%. the patients with pleuritic chest pain, lower limb asymmetry, and high nt - pro - bnp levels were more likely to develop pe, as were those who were obese or immobile. obesity and lower limb asymmetry were independent predictors of pe during copd exacerbation (or = 4.97 ; 95% ci, 1.775 - 13.931 and or = 2.329 ; 95% ci, 1.127 - 7.105, respectively).conclusions : the prevalence of pe in patients with copd exacerbation was higher than expected. the association between pe and copd exacerbation should be considered, especially in patients who are immobile or obese. |
ultrasound examinations have become the routine technique for the evaluation of the inflammatory changes in the musculoskeletal system in children in the course of systemic inflammatory conditions such as jia. they allow to identify the inflamed structures of the locomotor system such as e.g. joints, bursae, and tendon sheaths, and to determine the type of the inflammatory changes (the presence of fluid and/or synovial hypertrophy) and their severity. however, even though where there are no inflammatory changes within the examined area, the classical ultrasound examination rules them out with a probability nearing 100%, where they are present, an accurate evaluation of their severity is subjective and tends to depend on numerous factors, such as the examiner 's experience, the position of the limb in the case of peripheral joints, or the device and the transducer used. in pediatric patients the considerable variations in the size of the joints depending on the child 's age, and the presence, especially in the youngest children, of large quantities of hypoechogenic cartilage tissue easily mistaken for inflammatory changes, make up for additional difficulties. in compliance with the ultrasound examination standards, the severity of inflammatory changes is determined in a semi - quantitative 3-degree scale, describing them as slight, moderate and severe. some authors score the fluid and the synovial membrane jointly, whereas others score them separately. this may lead to substantial variations between researches in the scoring of the fluid and the synovium, to the effect of different assessment of the effectiveness of the undertaken treatment. this is where the application of 3d imaging option, routinely used e.g. for fetus assessment, becomes helpful. 3d imaging may facilitate an objective evaluation of the severity of the inflammatory changes, and their quantitative presentation. this paper discusses the suitability and the limitations of 3d imaging for the sake of ultrasound examinations of the musculoskeletal system in pediatric patients with rheumatologic conditions. ultrasound examinations are crucial for the vascularity assessment of inflammatory changes detected in the structures of the locomotor system. rheumatologic patients are evaluated with the help of power doppler and color doppler options. these, however, are not always sufficiently sensitive to detect synovial vascularity, which prompted search for other ways of determining the flow within the inflamed structures. the introduction of third generation uca, which are readily mobile within the vascular bed and reach the vascularized synovium with the blood stream, while at the same time being resistant to the pressure in the left heart ventricle, has facilitated more sensitive detection of the flow within the synovial membrane. even though the role of uca for rheumatology has not yet been fully determined, they hardly seem to find routine application in future clinical practice. the role of 3d imaging is to present the examined region in a spatial way, thereby facilitating evaluation which is accurate and as objective as possible. the examined structures are frequently recorded in the form of tissue blocks which are processed and assessed after the examination has been completed, allowing a thorough, comprehensive analysis of the examined region, and calculation of various parameters whose assessment in the course of a routine, gray - scale ultrasound is difficult, if not impossible altogether. additional volumetric transducers (for the locomotor system ultrasound, a linear one) facilitating data acquisition, as well as suitable software for further processing are required to carry out a 3d examination. the acquisition of 3d data takes place while the transducer is statically placed over the assessed area which is then automatically swept by the ultrasound beam. the collected data are presented in three planes : x, y and z (fig. 1). the 3d option allows imaging in a plane parallel to the front - face of the transducer z or c plane (also known as bird 's eye view), inaccessible in typical 2d imaging. a valuable 3d option in ultrasound examinations in rheumatology is the presentation of the revealed inflammatory changes in the form of a solid (fig. this gives the possibility to calculate accurately the volume of the involved structures, such as joints or bursae. due to their irregular shape, their volume should not be estimated with the aid of standard algorithms used for volumetric evaluation, employing three dimensions or one dimension and the area of the change. the unquestionable advantage of calculating the volume of an inflamed structure presented in 3d consists in the feasibility to objectively assess both the severity of the inflammation process, and the changes potentially occurring in response to treatment (fig. 3d imaging of the subacromial - subdeltoid bursa (sasd) also revealing the vascularity of the bursa walls in color doppler option 3d imaging. fig. 2 sasd volume, 6 weeks after topical administration of glucocorticoids this type of imaging, however, has numerous limitations. it is impossible to present as one solid some structures that are larger and longer (e.g. some involved tendon sheaths), and which exceed the size swept by the ultrasound beam. also, there is the problem of assessing larger joints through osseous structures, impermeable to the ultrasound beam. cartilage elements of poor echogenicity present in children 's skeleton structures can be mistaken for inflammatory changes, making the examination more difficult. in 2d imaging, dynamic examination aids such cases, helping to successfully distinguish inflammatory changes and cartilage structures. the small size of the examined structures in younger children causes some problems too, and so does poor adherence of the transducer to the examined region e.g. the ankle. moreover, 3d investigations are sensitive to motion artifacts, therefore the examined region should be stabilized and still upon data acquisition, which is naturally more challenging in pediatric patients than in adults, of tentimes requiring multiple attempts. it also seems that 3d evaluation should be applied for structures in which the inflammation process occurs mainly in the form of synovial membrane hypertrophy, since inflammatory changes visible predominantly in the form of effusion, which is prone to pressure and readily mobile, may render varying images during a single examination. a 3d examination may also be combined with the doppler option, as in 3d power doppler ultrasound (3d pdu). it facilitates three - dimensional imaging of the distribution of vascular segments within an involved structure, t hu s enabli ng to a ssess t he va scu la r a rch itect u re of a given change (fig. 4). the additional benefit is a quantitative assessment of the vascularity of the region of interest, e.g. the hypertrophic synovium in the joint or in the bursa, and presenting it in the form of parameters such as the vascular index (vi), the flow index (fi) or an index combining both preceding parameters, the vascular - flow index (vfi). determining these parameters for specific inflamed synovial structures allows to evaluate treatment effectiveness accurately, and to detect potential remission in the course of follow - up examinations. assessment of the sasd vascular architecture visible in examination 1 all things considered, 3d imaging is an interesting option for the sake of assessment of inflammatory changes visible in an ultrasound examination of patients suffering with rheumatologic conditions. it makes the examinations more objective and provides new parameters valuable for the analysis of the vascularity of the changes, and thereby of the inflammation process activity. hence, it aids follow - up examinations and helps to evaluate remission in response to treatment. it is, nonetheless, considerably limited by factors such as the necessary equipment (specialized transducer and software), anatomy, and the time required for the examination (a technically valid examination and its further processing are substantially more time - consuming than the classical ultrasound method). as a result currently, third generation uca are used in clinical practice, such as sonovue from bracco, that is sulphur hexafluoride stabilized by a phospholipid shell. the investigation uses a suspension of gas - filled microbubbles of a diameter < 10 m allowing the agent to move easily within the vascular tree, without the risk of occluding the microcirculation. with the blood flow, the bubbles reach also inflamed regions such as the thickened and hypertrophic synovium present in jia, thereby finding use in rheumatology diagnostics. contrast - enhanced ultrasound examinations were first employed for rheumatology, including jia patients, in the beginning of the last decade. yet, originally, the agents were used to enhance doppler signal in vessels, hence facilitating vessel detection in the classical doppler options like contrast - enhanced power/ color doppler (cepd / cecd). these days, the flow of uca in blood vessels is rendered as gray - scale image with low mechanical index (mi), known as contrast - enhanced ultrasound (ceus) (fig. 5), and is carried out with special software. even in the beginning, it was noted that regardless of the used method, uca in rheumatology increase the sensitivity of vascular detection in the synovium as compared to the classical doppler options. the agents help to detect vessels of a diameter < 40 m, invisible in classical doppler options, bringing us closer to evaluation of flow at tissue level. contrast - enhanced ultrasound of the wrist joints. on the left side, visible contrast - enhanced synovium within the midcarpal and the radiocarpal joint ; synovial membrane enhancement in the radiocarpal joint is partial, with an area of unvascularized synovium. on the right side, view of the evaluated area in b - mode option the test is carried out upon administering the uca suspension intravenously, e.g. into the basilic vein. then, the flow of the agent into the inflamed region, displaying hypertrophic and thickened synovial membrane, is observed in real time. fluid and inactive changes, such as old, fibrous synovium are not enhanced. hence, contrast - enhanced ultrasound helps to distinguish active changes in need of treatment or treatment modification, from inactive ones found e.g. in the case of a long - established jia with a persisting residual synovial hypertrophy. the effect may also be evaluated quantitatively by analyzing time intensity curve (tic) and then estimating the area under curve (auc). it is not only peripheral joints that may be evaluated in this way, as some reports have suggested the usefulness of uca e.g. for the assessment of sacroiliac joints. the examination has numerous limitations, including the cost of the contrasting agent, and invasiveness (intravenous administration of the agents). uca are safe substances which are quickly removed from the body, and rarely cause any side effects, yet so far they have not been registered for use in rheumatology or pediatric rheumatology. oftentimes, the vascularity assessment performed with the aid of classical doppler options is sufficient. the sensitivity of traditional examinations using power doppler option is comparable to the sensitivity of postcontrast mri. jia cases with subclinical course of disease, where classical doppler ultrasound does not reveal synovial inflammatory activity, would be where contrast agents should be employed to confirm the activity of the inflammation process. as of now, ceus examinations remain a highly sensitive method of synovial vascularity assessment, yet one without practical indications. 3d imaging is an option enabling a more accurate assessment of inflamed structures such as joints or bursae, which moreover provides new parameters useful for the assessment. also, it contributes to an increased comparability of assessment by various examiners, and helps to determine treatment effectiveness in follow - up ultrasound examinations. due to limitations arising from equipment requirements and technical difficulties, the method is rarely used in clinical practice. contrast - enhanced ultrasound is the most sensitive ultrasound method available, allowing to detect the synovial vascularity in rheumatologic patients, and to confirm the vascular flow where it is impossible to determine by classic doppler ultrasound. due to the high cost of the contrast agents, the invasiveness of the method, and the fact that uca have not yet been registered for pediatric rheumatology examinations author does not report any financial or personal links with other persons or organizations, which might affect negatively the content of this publication and/or claim authorship rights to this publication. | the application of 3d imaging in pediatric rheumatology helps to make the assessment of inflammatory changes more objective and to estimate accurately their volume and the actual response to treatment in the course of follow - up examinations. additional interesting opportunities are opened up by the vascularity analysis with the help of power doppler and color doppler in 3d imaging. contrast - enhanced ultrasound examinations enable a more sensitive assessment of the vascularity of inflamed structures of the locomotor system, and a more accurate analysis of treatment 's effect on changes in vascularity, and thereby the inflammation process activity, as compared to the classical options of power and color doppler. the equipment required, time limitations, as well as the high price in the case of contrast - enhanced ultrasound, contribute to the fact that the 3d analysis of inflammatory changes and contrast - enhanced ultrasound examinations are not routinely applied for pediatric patients. |
many people with identifiable psychiatric illness do conflict with the law, often by no fault of their own but because of symptoms of their psychiatric illness and end up in jails. such symptoms include impaired judgment, lack of impulse control, suspiciousness, disinhibition, paranoia, inability to trust others, delusions and hallucinations. it is quite likely that act of incarceration may well exacerbate certain underlying psychiatric conditions. the effect of such incarceration may well be so severe as to precipitate mental abnormality in vulnerable individuals. different levels of stress during incarceration give rise to different incidence of psychiatric morbidity among remand prisoners. they were acquitted of their criminal charges by reason of insanity at the time of commission of the crime under section 473 cr. it was found that 40 of them suffered from schizophrenia, 10 from affective disorders (3 mania and 7 depression), 1 epilepsy and 2 temporary insanity. the criminal patients who were inpatients in the government mental hospital madras during 1972 were taken into consideration by somsundram. only guilty but insane (19) out of total 79 inpatients were studied and he found that 18 were schizophrenic. jha studied case records of criminal patients admitted in ranchi mansik arogyashala and found 338 schizophrenic patients out of 1011 criminal patients admitted there during the years 1925 to 1963 giving an incidence of 33%. singh and verma, in an indian prison study, studied 50 consecutive subjects convicted of murder or attempt to murder and imprisoned at central jail amritsar from january 1970 onwards. fifteen (30%) of the subjects were found to have no evidence of psychiatric illness. the most common diagnosis was anxiety neurosis in 4 (8%) and depressive reaction in 8 (16%) cases. psychopathic personality disorder was found in 8 (16%) cases, schizophrenia in 2 (4%), sexual deviation in 2 (4%), alcohol addiction in 6 (12%) and opium dependence in 5 (10%). mohan and dhar assessed 120 undertrials as per icd-10 and 9% were diagnosed having different psychiatric disorder. twenty eight percent suffered from schizophrenic psychosis, 13% from mdp, 14% from anxiety state and depression, 9% from malingering and 7% from seizure disorder in the assessed number of under trials. pre - existing psychiatric illness before committing major crime was detected in 35% of undertrials referred. steadman. studied a random sample of 3332 inmates representing 9.4% of new york 's general prison population as well as 352 of the 360 inmates in the prison 's mental health units. they found that 8% of the sample had severe psychiatric functional disabilities that clearly warranted some type of mental health intervention, and another 16% had significant mental disabilities that required periodic services (specific diagnoses were not given). agbahowe. conducted a study to find prevalence of psychiatric morbidity among convicted inmates at a medium security prison in nigeria. they assessed 100 inmates and found schizophrenia in 2, major depression in 2, recurrent mild depression in 21, generalized anxiety disorder in 8 and somatization disorder in 1. did retrospective, self - report survey of pre - arrest drug use in a representative sample of 1751 men serving a prison sentence. reported drugs used were cannabis (34%), opiates (9%), amphetamines (9%) and cocaine (5%), including 1% crack users. drug dependence was reported by 11%, including 7% dependent on opiates, 2% on amphetamines and 1% on cocaine. mason. concluded that of 548 newly remanded prisoners studied, 57% men were using illicit drugs and 33% met dsm - iv drug misuse or dependence criteria. there are limited studies on prevalence of psychiatric morbidity in prisoners housed in central jails. most of the studies may be labeled as head counting in terms of socio - demographic attributes. so, it was decided to undertake a study on psychiatric and socio - demographic aspects of prisoners in order to fill this gap. to examine the socio - demographic profile of convicted prisoners.to evaluate the prevalence of psychiatric disorders in convicted prisoners. to examine the socio - demographic profile of convicted prisoners. to evaluate the prevalence of psychiatric disorders in convicted prisoners. for the purpose of study, 500 convicted prisoners of central jail, amritsar, were taken. the study was carried out in the period extending from 1 april 2003 to 30 september 2004. the study was carried out with due permission of the superintendent, central jail, amritsar. the permission was refused for inclusion of prisoners in the maximum - security wing for security reasons. prisoners with chronic psychiatric manifestations (including mental retardation and other chronic psychotic disorders) were kept in separate place named as prison psychiatric unit.they were excluded to avoid bias. the inclusion and exclusion criteria were as follows : subjects in the age range of 1860 years;informed verbal consent of prisoners. subjects in the age range of 1860 years ; informed verbal consent of prisoners.. prisoners not consenting ; uncooperative prisoners ; prisoners in prison psychiatric unit ; prisoners in maximum security wing. informed verbal consent was taken after explaining the nature and purpose of study to them. central jail, amritsar, has about 800 male convicts and 30 female convicts. out of 30 females, so, 20 females were interviewed and 480 males were interviewed to complete the sample. subjects in the age range of 1860 years;informed verbal consent of prisoners. subjects in the age range of 1860 years ; informed verbal consent of prisoners. prisoners not consenting;uncooperative prisoners;prisoners in prison psychiatric unit;prisoners in maximum security wing. prisoners not consenting ; uncooperative prisoners ; prisoners in prison psychiatric unit ; prisoners in maximum security wing. prisoners were approached individually at random. informed verbal consent was taken after explaining the nature and purpose of study to them. central jail, amritsar, has about 800 male convicts and 30 female convicts. out of 30 females, so, 20 females were interviewed and 480 males were interviewed to complete the sample. socio - economic status of rural prisoners was calculated by using socio - economic status scale (rural) by pareek udai and trivedi g. socio - economic status of urban prisoners was calculated by using socio - economic status scale (urban) by kuppuswamy. present state examination (pse) is a system that enables objective assessment of present mental state of adult patients suffering from neurotic and functional psychotic disorders. it includes a semi - structured interview schedule and a comprehensive glossary of criteria for rating 140 signs and symptoms. although by itself, pse does not generate the diagnosis, it provides the information that can be related to disease categories in the international classification of disease (icd-10). the psychiatric assessment of prisoners was made on the basis of above instruments and scales, supplemented with a clinical interview. socio - economic status of rural prisoners was calculated by using socio - economic status scale (rural) by pareek udai and trivedi g. socio - economic status of urban prisoners was calculated by using socio - economic status scale (urban) by kuppuswamy. present state examination (pse) is a system that enables objective assessment of present mental state of adult patients suffering from neurotic and functional psychotic disorders. it includes a semi - structured interview schedule and a comprehensive glossary of criteria for rating 140 signs and symptoms. although by itself, pse does not generate the diagnosis, it provides the information that can be related to disease categories in the international classification of disease (icd-10). the psychiatric assessment of prisoners was made on the basis of above instruments and scales, supplemented with a clinical interview. mean age of the prisoners was 36.38 years, 36.6% of the prisoners were illiterate and 50% of the prisoners belonged to nuclear families. the above table shows that maximum number of prisoners (33.8%) belonged to socioeconomic status iii and 73.6% of the prisoners belonged to socioeconomic status iii, iv and v [table 1 ]. sociodemographic profile of prisoners (n=500) current diagnosis of psychiatric illness excluding substance abuse / dependence was found in 23.8% of the prisoners [table 2 ]. prevalence of psychiatric illness among prisoners (n=500) information on current substance abuse (inside the jail premises) could not be collected because respondents were not willing to disclose the information. 56.4% of the prisoners had history of substance abuse / dependence prior to incarceration, 39.8% of the prisoners met abuse / dependence criteria for alcohol and 5% were multiple substance abusers. drug abuse / dependence prior to incarceration (n=500) table 4 shows that among prisoners with psychiatric illness, maximum (34.45%) belonged to socioeconomic status iii, 32.78% belonged to socio - economic status iv, 16.81% belonged to socio - economic status v, 12.60% belonged to socioeconomic status ii and least 3.36% belonged to socioeconomic status i. socio - economic status wise distribution of prisoners with and without psychiatric illness (n=500) in prisoners without psychiatric illness, 33.60% belonged to socioeconomic status iii, 27.82% belonged to socioeconomic status ii, 25.98% belonged to socioeconomic status iv, 10.76% belonged to socioeconomic status v and 1.84% belonged to socioeconomic status i. statistically the data was not found to be significant (p>0.05) using chi - square test. table 5 shows that among prisoners with psychiatric illness, 47.90% stayed for 36 years, 25.21% stayed for 69 years, 12.61% stayed for 13 years, 6.72% stayed for less than 1 year, 4.20% stayed for 912 year and 3.36% stayed for more than 12 years. distribution of total sample according to total period of stay among prisoners with and without psychiatric illness (n=500) among prisoners without psychiatric illness, 39.90% stayed for 36 years, 22.83% stayed for 13 years, 16.54% stayed for 69 years, 12.86% stayed for less than 1 year, 4.72% stayed for 912 years and 3.15% stayed for > 12 years. statistically the data was not found to be significant (p>0.05) using chi - square test. in the present study, 500 convicted prisoners were interviewed, among which there was preponderance of male prisoners i.e. 480 males to 20 females in the ratio of 24:1. this finding is in accordance with the fact that majority of the crimes are committed by males. in our study, 76% of the prisoners belonged to rural area which matches study by sethi. who concluded that majority of the prisoners came from rural areas (70%). but our finding is in contrast to study by singh and verma who concluded that 92% of the criminals who committed murder were from a rural background. this variation may be due to difference in populations studied, as in their study prisoners committing only murder were included but in our study prisoners committing all the crimes were included. sethi. concluded that majority of the convicts (77%) were illiterate or had their education up to primary which is in contrast to our study in which only 51.4% of the prisoners were illiterate or had their education up to primary. this variation may be due to vast time difference between the two studies. during the last 20 years about 70% of the murderers were married in the study by singh and verma, which is close to finding of our study in which 65.6% of the prisoners were married. about 74% of the criminals came from lower and middle socio - economic classes (grade iii to v) in study by singh and verma. in our study maximum number of prisoners belonged to socioeconomic status iii (33.8%) and 73.6% of the prisoners belonged to socioeconomic status iii, iv and v, which matches the study by singh and verma (74%). in our study 23.8% birmingham. who found psychiatric morbidity up to the extent of 24% and 26%, respectively. in terms of diagnostic breakup, depression was most common psychiatric disorder in this study (18% of the total sample). agbahowe. in nigeria reported depression in 23% of the inmates. in study by singh and verma, dysthymia was found in 9 (1.8%) in our study, which matches the past literature. 2% prisoners had dysthymia in a study by herrman. in our study, studies by somsundram, jha, mohan and dhar had very high incidence of schizophrenia. studies by somsundram and jha were done on criminals admitted in mental hospital and study by mohan and dhar was done on undertrials who were referred to them in medical college, while our study was done in jail. the findings of our study are also in agreement with coid 's observations that major psychosis was no more common in the majority of the studies of criminal population. in our study, 11.2% of the prisoners were dependent on various substances out of which 6.6% were dependent on alcohol. these findings are in agreement with findings of mason. who found 57% men were using illicit drugs and 32% met misuse or dependence criteria for alcohol. these findings differ from study done by bushnell and bakker, who reported lifetime alcohol disorder up to extent of 81%. findings of study by bushnell and bakker are quite high as compared to our study and reasons for this might be lying in the roots of different socio - culture of these two countries. 11% of the prisoners were dependent on various substances in study done by maden., which is similar to the findings of our study but in their study cannabis (34%) was most commonly abused substance in contrast to our study in which alcohol (39.8%) was most commonly abused substance. in which 95% obtained a diagnosis of dependence on one or more substances and these variations may be due to differences in social and geographical backgrounds. we do, however, have insufficient knowledge about the extent of psychiatric treatment provided in our prisons. most inmates have a number of defined problem areas, with substance use, depression and anxiety disorders most prevalent. the high rate of common psychiatric disorders argues for the use of improved psychiatric screening instruments, improved assessment and treatment capacities in the prison and an increased number of psychiatric inpatient facilities to care for the inmates who are too unwell to be treated in the prison. the burden of psychiatric illness in this vulnerable and marginalized population poses a serious challenge to researchers and clinicians alike. number of female prisoners studied was less.effect of treatment on outcome and course of illness was not evaluated.uncooperative prisoners and prisoners not consenting were not included in the study number of female prisoners studied was less. | context : the prevalence of psychiatric illness in correctional settings is significantly elevated, with higher than community rates reported for most mental disorders.aims:(1) to examine the socio - demographic profile of convicted prisoners. (2) to evaluate the prevalence of psychiatric disorders in convicted prisoners.materials and methods:500 convicts were assessed for psychiatric morbidity with the help of (a) socio - demographic proforma, (b) pareek udai and trivedi g 's socio - economic status scale (rural) (household schedule), (c) kuppuswamy 's economic status scale (urban) and (d) present state examination (pse).results:23.8% of the convicted prisoners were suffering from psychiatric illness excluding substance abuse. 56.4% of the prisoners had history of substance abuse / dependence prior to incarceration.conclusions:the results suggest that a substantial burden of psychiatric morbidity exists in the prison population of india and the burden of psychiatric illness in this vulnerable and marginalized population poses a serious challenge to psychiatrists. |
a 73-year - old diabetic patient presented with a recent - onset visual decline od. 1a ] with mild non - proliferative diabetic retinopathy with no macular edema ; left fundus was normal. optical coherence tomography (oct) revealed vitreomacular traction ; central macular thickness (cmt) was 630m [fig. 1b ]. after obtaining an informed consent from the patient, he underwent vitrectomy, erm removal, and membrane peeling with dual staining : trypan blue dye 0.15% (retiblue, aurolab, madurai, india) for erm and brilliant blue g 0.05% (ocublue plus, aurolab, madurai, india) for internal limiting membrane. 4 weeks later, bcva had improved to 20/40 ; cmt was 379 m [fig., bcva gradually declined to 20/60 with cmt increasing again to 412 m and recurrence of macular cystic changes [fig. the patient received intravitreal triamcinolone acetonide (ivta, 4 mg/0.1 ml) od. within 4 weeks, bcva recovered to 20/40 (cmt : 323 m). over the next 10 weeks, the bcva improved to 20/20 od [fig. (a) fundus od reveals macular epiretinal membrane, (b) horizontal oct scan reveals vitreomacular traction ; central macular thickness (cmt) is 630. note the central defect in the inner segment - outer segment (is - os) junction, (c, d) one month postoperatively, macula is free of membrane, oct shows partial recovery of foveal contours (cmt : 379), (e, f) 2.5 months postoperatively, macula developed cystoid thickening (cmt : 412), (g - h) six months postoperatively, macular edema resolved (cmt : 319), with an intact is - os junction and external limiting membrane persistence of macular edema after vitrectomy for erm removal is well - known ; and is generally attributed to chronic vascular leakage. but recurrence of edema after an initial post - surgical resolution has been rarely reported. we attempted treatment of recurrent macular edema with ivta on the basis that it would favorably affect macular edema due to both vascular and inflammatory etiologies. remarkably, ivta did not merely restore the post - operative visual outcome, but improved it to 20/20 ; a rare event in erm surgery in spite of the excellent visual gains reported. this outcome was obtained in spite of an interrupted inner segment - outer segment (is - os) junction in the pre - operative oct [fig. finally, visual recovery is reported to peak around 12 - 24 months after erm removal with reconstitution of is - os junction ; we obtained both the milestones much earlier, at 6 months postoperatively in this case. konstantinidis used ivta routinely after vitrectomy for erm ; they reported excellent visual outcomes, which were obtained in a short time, as in our case. however, proactive use of ivta as reported by these authors may invite other problems like secondary glaucoma and cataract ; and can be recommended as a default part of surgical protocol only after a head - to - head trial against vitrectomy without ivta for erm. i propose a case for using ivta to enhance surgical outcome when residual or recurrent macular edema is observed after erm removal. | a patient underwent successful vitrectomy for macular epiretinal membrane with anatomical and functional improvement. 10 weeks later, there was a recurrence of macular edema with corresponding visual decline. an intravitreal injection of triamcinolone acetonide not only restored the macular anatomy but also improved the visual outcome beyond that achieved after surgery. |
inflammation is receiving an increasing amount of attention for its potential role in the pathogenesis of a variety of disorders, from insulin resistance and type 2 diabetes mellitus (t2 dm) to fatty liver and cardiovascular disease (cvd). current evidence shows that c - reactive protein (crp) level is a plasma protein and a sensitive and dynamic systemic marker of inflammation could be influenced by both clinical and genetic factors. ppars are orphan nuclear receptors belonging to the steroid, retinoid, and thyroid hormone receptor superfamily of ligand - activated transcription factors [4, 5 ]. three distinct receptor types have been cloned and characterized : ppar, ppar/, and ppar. ppar was less studied in previous study, compared with ppar and ppar. several evidences suggested biological roles for ppar in many genotypes. deletion of ppar from foam cells increased the availability of inflammatory suppressors, which in turn reduced atherosclerotic lesions. on the other hand, activation of ppar ppar agonists could promote cholesterol accumulation in human macrophages and increase serum high density lipoprotein (hdl) while lowering triglyceride levels in obese animal models [9, 10 ]. however, the associations between variants of the ppar, corresponding gene - gene interactions with crp level, were rarely studied. so in this study, we sought to examine the association between 4 ppar polymorphisms with crp level and the additional interaction among the 4 single nucleotide polymorphisms (snps). a total of 1096 subjects were included in investigated population, excluded subjects with abnormal increasing of crp level (10 mg / l) because of any reasons, such as infection (n = 35), trauma (n = 15), and any others factor (n = 8), and crp were missing (n = 10), a total of 1028 subjects (538 men, 490 women), with a mean age of 45.3 13.8 years, were included in the study, including the genotyping of polymorphisms. the selected subjects were similar to those who were not selected in terms of age, sex, smoking status, and alcohol consumption. data on demographic information and lifestyle risk factors for all participants were obtained using a standard questionnaire administered by trained staffs. body weight and height were measured, and body mass index (bmi) was calculated as weight in kilograms divided by the square of the height in meters. cigarette smokers were those who self - reported smoking cigarettes at least once a day for 1 year or more. alcohol consumption was expressed as the sum of milliliters of alcohol per week from wine, beer, and spirits. physical activity was divided into three levels, including light, moderate, and heavy. we selected snps within the ppar gene using the following methods : (1) previously reported associations with metabolic abnormalities, (2) known heterozygosity and a minor allele frequency (maf) greater than 1%. 4 snps of ppar were selected for genotyping in the study : rs2016520, rs9794, rs1053046, and rs1053049. genomic dna from participants was extracted from edta - treated whole blood, using the dna blood mini kit (qiagen, hilden, germany) according to the manufacturer 's instructions. abi prism7000 software and allelic discrimination procedure were used for genotyping of aforementioned 4 snps. a 25 l reaction mixture including 1.25 l snp genotyping assays (20x), 12.5 l genotyping master mix (2x), and 20 ng dna and the conditions were as follows : initial denaturation for 10 min and 95c, denaturation for 15 s and 92c, annealing and extension for 90 s and 60c, and 50 cycles. the mean and standard deviation (sd) for normally distributed continuous variables and percentages for categorical variable were calculated and compared. the categorical data were analyzed using test or the fisher exact test if necessary. further, continuous variables were analyzed using student 's t - test or one - way analysis of variance, followed by the least significant difference multiple - range tests for comparison between groups. hardy - weinberg equilibrium (hwe) was performed by using snpstats (available online at http://bioinfo.iconcologia.net/snpstats). line regression analysis was performed to verify polymorphism association between snp with crp levels using gender, age, smoking and alcohol status, and physical activity as covariates in the model. generalized multifactor dimensionality reduction (gmdr) was employed to analyze the interaction among 4 snps ; some parameters was calculated, including cross - validation consistency, the testing balanced accuracy, and the sign test, to assess each selected interaction. the cross - validation consistency score is a measure of the degree of consistency with which the selected interaction is identified as the best model among all possibilities considered. the testing balanced accuracy is a measure of the degree to which the interaction accurately predicts case - control status with scores between 0.50 (indicating that the model predicts no better than chance) and 1.00 (indicating perfect prediction). finally, a sign test or a permutation test (providing empirical p values) for prediction accuracy can be used to measure the significance of an identified model. a total of 1028 subjects (538 men, 490 women), with a mean age of 45.3 13.8 years, were selected. minor allele frequencies of rs2016520, rs9794, rs1053046, and rs1053049 were shown in table 2. all genotypes were distributed according to hardy - weinberg equilibrium (all p values more than 0.05). line regression analysis on association between 4 snps and crp level was conducted (table 3). we found that the crp level was lower in the subjects with minor alleles of rs2016520 and rs9794, compared to subjects with wild genotype. compared to the carriers of the common genotype (rs2016520-tt), the carriers of the c allele (tc + cc) of rs2016520 were associated with a significant decreased level of crp, regression coefficients were 0.338, and standard error was 0.104 (p = 0.001). compared to the carriers of the common genotype (rs9794-cc), the carriers of the g allele (cg + gg) of rs9794 were also significantly associated with decreased level of crp, regression coefficients were 0.219, and standard error was 0.114 (p = 0.012). however, the other 2 snps in ppar were not significantly associated with crp level after covariate adjustment. we employed the gmdr analysis to assess the impact of the interaction among 4 snps, after adjustment for covariates including gender, age, smoke and alcohol status, and physical activity. table 4 summarizes the results obtained from gmdr analysis for two- to four - locus models with covariates adjustment. there was a significant two - locus model (p = 0.0107) involving rs2016520 and rs9794, indicating a potential gene - gene interaction between rs2016520 and rs9794. overall, the two - locus models had a cross - validation consistency of 10 and had the testing accuracy of 62.17%. to obtain ors and 95% cis for the joint effects of candidate snps (rs2016520 and rs9794) on crp, we conducted interaction analysis among snps in the 2-locus models. subjects with rs2016520-tc or cc and rs9794-cg or gg genotypes have lowest crp level, difference (95% ci) = 0.50 (0.69 to 0.21) (p < 0.001), compared to subjects with rs2016520-tt and rs9794-cc genotypes, after adjustment for gender, age, smoke and alcohol status, and physical activity (table 5). the frequency of the c allele was 24.9% in the present population, which is lower than the proportion in the han population of dalian reported by yu. c - reactive protein (crp) is a well - established biochemical marker of inflammation and has been used to predict future cardiovascular disease, metabolic syndrome, and future development of type 2 diabetes mellitus [3, 1921 ]. current evidence shows that crp level is a complex trait, influenced by both clinical and genetic factors. family and twin studies have found that additive genetic factors account for 2740% of the variance in crp level, suggesting a role for genetic variation in determining serum levels. the results of this study indicated that minor alleles of rs2016520 and rs9794 were associated with lower crp level, compared to subjects with wild genotype. compared to the carriers of the common genotype (rs2016520-tt), the carriers of the c allele (tc + cc) of rs2016520 were associated with a significant decreased level of crp. compared to the carriers of the common genotype (rs9794-cc), the carriers of the g allele (cg + gg) of rs9794 were also significantly associated with decreased level of crp. however, the other 2 snps in ppar were not significantly associated with crp level after covariate adjustment. in contrast to ppar and ppar, the role of ppar in crp level is less well defined. gu. indicated that rs2016520 in ppar was not associated with crp level both in normal weight and obese subjects in a chinese population. liang. suggested that ppar attenuated crp - induced proinflammatory effects through cd32 and nf-b pathway. ppar may serve as a more potent therapeutic target than ppar in atherosclerosis or inflammatory therapy, and the potency of 1 m ppar is similar to that of 10 m ppar in anti - inflammatory effect. as we have known that a multiple genotype was influenced by both genetic and environment factors and the genetic factors including many gene mutations, so it is necessary to investigate the synergistic effect of multiple snp on crp level. we employed the gmdr analysis to assess the impact of the interaction among the 4 snps on crp level with covariates adjustment. subjects with rs2016520-tc or cc and rs9794-cg or gg genotypes have lowest crp level, difference (95% ci) = 0.50 (0.69 to 0.21) (p < 0.001), compared to subjects with rs2016520-tt and rs9794-cc genotypes. in addition, rs9794 was not associated with crp, but it can significantly affect level when accompanied with rs2016520. these findings indicate that a minor gene (even when its main effects are close to nil) can have a strong effect on level, due to the presence of gene - gene interaction. several mechanisms of association between activation of ppar and decreased crp level have been suggested. liang. indicated that untreated endothelial cells express a basal level of ppar and ppar agonist exerts an anti - inflammatory effect in crp - treated endothelial cells. we also demonstrated that less concentration of ppar than ppar agonist is needed to attenuate both crp - induced adhesion molecules and the ability of monocyte to attach to endothelial cells. ppar could attenuate crp - induced nf-b activation and vcam-1 and mcp-1 expression in endothelial cells. moreover, it was found that the decreased adhesion molecule expression would result in significant fewer monocytes attaching on the crp - treated endothelial cells. similar to one of the mechanisms in endothelial cells, activation of ppar has been shown to promote the binding of inflammatory suppressor bcl-6 to the promoter of group iia secretory phospholipase a2, an inflammatory marker for atherosclerosis, and therefore inhibit the inflammation induced by il-1b in vsmcs. limitations of this study should be considered. the selected snps were not sufficient to capture most genetic information of the ppar. further studies should include more snps, even the other ppar isoforms, such as ppar or ppar. secondly, there was a relatively small sample size in the study, though the number of study participants met the requirement for analysis ; future studies should be conducted in different races. thirdly, the interaction between gene - environment factors on level should be studied in the future papers. in conclusion, the results of this study indicated that minor alleles of rs2016520 and rs9794 were associated with lower crp level, compared to subjects with wild genotype, and we also found a potential gene - gene interaction between rs2016520 and rs9794 on decreased crp level. | aims. to examine the association between 4 single nucleotide polymorphisms (snps) of peroxisome proliferator - activated receptors (ppar) polymorphisms and c - reactive protein (crp) level and additional gene - gene interaction. methods. line regression analysis was performed to verify polymorphism association between snp and crp levels. generalized multifactor dimensionality reduction (gmdr) was employed to analyze the interaction. results. a total of 1028 subjects (538 men, 490 women) were selected. the carriers of the c allele (tc or cc) of rs2016520 were associated with a significant decreased level of crp, regression coefficients was 0.338, and standard error was 0.104 (p = 0.001). the carriers of the g allele (cg or gg) of rs9794 were also significantly associated with decreased level of crp, regression coefficients was 0.219, and standard error was 0.114 (p = 0.012). we also found a potential gene - gene interaction between rs2016520 and rs9794. subjects with rs2016520-tc or cc, rs9794-cg or gg genotypes have lowest crp level, difference (95% ci) = 0.50 (0.69 to 0.21) (p < 0.001), compared to subjects with rs2016520-tt and rs9794-cc genotypes. conclusions. rs2016520 and rs9794 minor allele of ppar and combined effect between the two snp were associated with decreased crp level. |
in a recent issue of critical care, parnell and colleagues examined host gene expression changes in whole blood from critically ill patients infected with pandemic h1n1 influenza a infection. the measurable genomic response of the host to influenza may provide important information not only on viral pathogenesis but also on the immune response, its dissemination within the infected host, and its transmission in a population. the authors evaluated transcriptional changes in blood samples obtained from 39 patients and 18 healthy controls. of the 39 patients, eight had polymerase chain reaction (pcr)-confirmed pandemic h1n1 influenza a virus, 16 had culture - documented bacterial pneumonia, and 12 had systemic inflammatory response syndrome of undefined etiology. a support vector machine class predictor identified a blood - based h1n1 gene expression signature, but a separate unique bacterial signature, or secondary bacterial infection, could not be generated. distinguishing bacterial pneumonia from other causes of upper and lower respiratory tract infection, improvements in the timely and accurate classification of the causative agent(s) of respiratory infection could have a profound impact on health and quality of life by improving appropriate antibiotic use and infection control interventions. the development of inexpensive and easy - to - use rapid diagnostics to accurately distinguish bacterial pneumonia from viral pneumonia in routine clinical specimens (for example, blood) would represent a major advance in health care and have a significant impact on improving the clinical management and outcome of acute pneumonias. at present, infectious disease diagnostics focus on one or more pathogens of interest (for example, the urinary pneumococcal antigen test or multiplex pcr for respiratory viruses) or one - analyte - at - a - time biomarkers (for example, c - reactive protein or procalcitonin elevation as a marker for severe bacterial infections). in other fields, high - dimensional gene expression data offer a higher level of precision in the diagnosis of acute and chronic diseases. infectious disease lends itself well to these analyses since the host response to pathogens entails a cascade of cellular events and expressed molecules that can be readily measured on a genome scale. the dimension and complexity of such data provide unique opportunities to uncover patterns that can distinguish subtle phenotypes in ways that traditional single - molecule techniques can not and to use these patterns in models to predict with precision the way the genome interacts with environmental stimuli, such as infectious or other noxious agents. recently, strategies have been developed by several groups to use host gene expression to classify viral, bacterial, and fungal bloodstream infections - a strategy termed a ' paradigm shift ' by some investigators in the field. the rationale for this approach is clear - immune effector cells respond to pathogens with characteristic gene expression patterns reflecting the interaction of the pathogen with pattern recognition receptor signaling. these patterns, captured by microarray or alternative technologies, offer robust classification of infectious pathogens. in vitro [11 - 13 ] and ex vivo data provide proof - of - concept that gene expression patterns exhibited by host immune cells have, in addition to common cellular programs, pathogen - specific components. parnell and colleagues should be applauded for their work in this area and extending the paradigm of hostbased classification of infectious disease. however, the study has some limitations that need to be recognized so that future investigations of this type continue to move this important area of investigation forward. the sample size is relatively small and thus the generalizability of the findings remains to be elucidated. the authors recognize that additional validations with expanded cohorts are necessary to determine whether these findings represent an h1n1-specific molecular signature or one that is more representative of influenza viruses or other respiratory pathogens. in addition, the question of whether these results would be generalizable to population extremes (such as the very young or the aged and immune - compromised) and the impact of medications, particularly antiviral and other antimicrobial drugs, on the accuracy of the classifier would absolutely need to be addressed. has limited utility for clinical infectious disease diagnostics, and the signatures developed here need to be migrated to a more conventional platform for diagnostics, such as reverse transcription - pcr, and revalidated. critical work on sample processing, turnaround time, and sensitivity, specificity, and negative and positive predictive values also would need to be assessed prior to any claims about the suitability of the signatures as a diagnostic. it is interesting that the investigators were unable to develop a signature for the bacterial pneumonia where others have had some success. perhaps this reflects the heterogeneity of the subjects, issues with accurate phenotyping, or statistical methodology limitations. bacterial pneumonias are heterogeneous, and the details of the case definition and adjudication of the phenotypes in these types of studies are critical components of the study design. the development of a specific bacterial host response signature will be essential to the advancement of this technology to clinical application. nonetheless, the results of this work are a significant step forward in the use of genomics to understanding the host response to an important pathogen in global health. both authors are applicants for a patent to apply gene expression signatures for the diagnosis of viral infection. in addition both authors receive us government funding to study host based genomic biomarkers of infectious disease. | capturing the host response by using genomic technologies such as transcriptional profiling provides a new paradigm for classifying and diagnosing infectious disease and for potentially distinguishing infection from other causes of serious respiratory illness. this strategy has been used to define a blood - based rna signature as a classifier for pandemic h1n1 influenza infection that is distinct from bacterial pneumonia and other inflammatory causes of respiratory disease. to realize the full potential of this approach as a diagnostic test will require additional independent validation of the results and studies to examine the specificity of this signature for viral versus bacterial infection or co - infection. |
dna microarray technology, a powerful tool in functional genome studies, has yet to be widely accepted for extracting disease - relevant genes, diagnosis, and classification of human tumor [13 ]. generally, genes are ranked according to their differential expression by analysis of combination of normal and tumor samples, and genes above a predefined threshold are considered as candidate genes for the cancer being studied. however in addition to the false - positive problem, the imbalance between the number of samples and genes may potentially degrade the classification accuracy and it can lead to possible overfitting and dimensional curse or even to be a complete failure in the analysis of microarray data. an efficient way to solve these problems is gene selection. in fact, a good gene - selection method that can identify key tumor - related genes is of vital importance for tumor classification and identification of diagnostic and prognostic signatures for predicting therapeutic responses [5, 6 ]. identifying minimum gene subsets means discarding most noise and redundancy in dataset to the utmost extent, resulting in not only classification accuracy improvement but also tumor diagnosis cost decrease in clinical application, which is still a key challenge in gene expression profile- (gep-) based tumor classification. rough set theory has been successfully used in feature selection [7, 8 ]. however, it is difficult to directly and effectively deal with real - valued attributes of microarray dataset. dataset discretization is usually adopted to tackle the problem, but the pretreatment may lose some useful information. to combat this problem, hu. first presented the basic concepts on neighborhood rough set (nrs) model and designed a novel feature selection method called forward attribute reduction based on neighborhood model (farnem) to select a minimal reduct, which avoided the preprocess of data discretization and hence decreased the information lost in pretreatment. but the reduct which satisfies criterions of higher classification performance and fewer gene numbers is not unique and full of chance. obviously, it is not appropriate to use only a gene subset (a reduct) to train classifier, which necessitates it to select numerous minimal gene subsets with the highest or near highest dependence on training set to avoid the selection bias problem. breadth - first search (bfs), a basic graph search algorithm that begins at the root node and explores all the neighboring nodes, were adopted to implement our goals for selecting any number of optimal and minimum gene subsets. however, for n nodes, there are 2 combinations of gene subsets in total. the computational complexity is too high. to circumvent these problems, we proposed a breadth - first heuristic search algorithm based on neighborhood rough set (hbfsnrs) to select numerous gene subsets. the dependence function of nrs was selected as the heuristic information. to prioritize the numerous selected genes, previous studies showed that significant class predictor genes whose expression profile vector show remarkable discrimination capability among different class samples of specific cancer maybe play a crucial role in the development of cancer. we hypothesized that the occurrence probability of genes in the final selected gene subsets may reflect the power of tumor classification and the significance of them to some extent. to probe our hypothesis, hbfsnrs method was also compared with four related methods : pam, clanc, kruskal - wallis rank sum test (kwrst), and relief - f to demonstrate its good performance, efficiency, and effectiveness in gene selection, prioritization and cancer classification. our proposed method is different from the traditional gene selection strategies : filters and wrappers. the filter methods are based mostly on selecting genes using between - class separability criterion, and they do not use feedback information from predictor performance in the process of gene selection, such as relative entropy, information gain, kwrst, and t - test. the wrapper methods select genes by using a predictor performance as a criterion of gene subset selection such as ga / svm and ga / knn. all of the microarray datasets, without respect to training and test dataset, were normalized per gene by subtracting the minimum expression measurements and dividing by the difference between the maximal and minimum values of that gene. the expression levels for each gene were scaled on [0, 1 ]. gene preselection can improve the classification performances since it may reduce the noise, which is also the common procedure for most classification application. all of the genes on the arrays of training data were sorted according to kwrst which is suitable for multiclass problem. in this study, the p top ranking genes (the initial informative gene set g) were used for finding minimum gene subsets for constructing ensemble tumor classifier with hbfsnrs. generally speaking, more than 1% of genes in the human genome are involved in oncogenesis, so we set the number of the selected top - ranked gene p = 300. the basic concepts of neighborhood rough set (nrs) have been introduced by hu.. in our proposed algorithm, the dependence function of nrs was introduced to evaluate the goodness of selected gene subsets. here assume there are c subclasses of cancers, let d = { d1, d2,, dm } denotes the class labels of m samples, where di = k indicates the sample i being cancer k, where k = 1, 2,, c. let s = { s1, s2, sm } be a set of samples and g = { g1, g2,, gn } be a set of genes, the corresponding gene expression matrix can be represented as x = (xij)mn, where xij is the expression level of gene gi in sample sj, i = 1, 2,, n, j = 1, 2,, m, and usually n m. given an information system for classification learning ndt = s, g d, v, f, where s is a nonempty sample set called sample space, g is a nonempty set of genes also called condition attributes to characterize the samples, d is a set of output variable called decision attribute (class labels of tumor samples), va is a value domain of attribute a g d, f is an information function f : s (g d) v, v = agd va, a reduction is a minimal set of attributes bg. given for all si s and bg, the neighborhood b(si) of si in the subspace b is defined as (1)b(si)={sj sjs,b(si, sj) }, where is the threshold and b(si, sj) is the metric function in subspace b. there are three common metric functions that are widely used. let s1 and s2 be two samples in n - dimensional space g = { g1, g2,, gn}. f(s, gi) denotes the value xis of gi in the sample s. then minkowsky distance is defined as (2)p(s1,s2)=(i=1n|f(s1,gi)f(s2,gi)|p)1/p, where (1) if p = 1, it is called manhattan distance 1 ; (2) if p = 2, it is called euclidean distance 2 ; (3) if p =, it is called chebychev distance. here, we use the manhattan distance., xc are the sample subsets with decisions 1 to c, b(xi) is the neighborhood information granules including xi, and is generated by gene subset b g, then the lower and upper approximations of the decision d with respect to gene subset b are, respectively, defined as (3)lowerb(d)=i=1c lowerb(xi),upperb(d)=i=1c upperb(xi), where lowerb(x) = { xi | b(xi)x, xi s } is the lower approximations of the sample subset x with respect to gene subset b, and is also called positive region denoted by posb(d) which is the sample set that can be classified into one of the classes without uncertainty with the gene subset b. upperb(x) = { xi | b(xi)x, xi s } denotes the upper approximations, obviously upperb(x) = s. the decision boundary region of d to b is defined as (4)bnb(d)=upperb(d)lowerb(d). the neighborhood model divides the samples into two groups : positive region and boundary region. through these neighborhood information, we can not completely be sure that these samples can be classified into the class. the samples in different gene subset subspaces will have different boundary regions and positive regions. the size of the boundary region reflects the discriminability of the classification problem in the corresponding subspaces. the greater the positive region is, the smaller the boundary region will be, and the stronger the characterizing power of the condition attributes will be. so we use the dependency degree of d to b to characterize the power of the selected gene subsets, which is defined as the ratio of consistent objects (5)b(d)=card(posb(d))card(s), where card(s) and card(posb(d)) denotes the cardinal number of sample set s and posb(d), respectively. if b(d) = 1 we say that d depends totally on b, and if b(d) 50, mll, t - all, tel - aml1. for breast - cancer datasets, there are too many (54675) affymetrix probe identifiers, therefore the raw data were processed following these steps : affymetrix probe identifier was converted to entrez identifier. when multiple probes corresponded to the same entrez i d, we averaged over these probe intensities. to avoid overfitting problem and improve classification accuracy and stability, an ensemble classifier was constructed on the basis of the selected gene subsets. we observed that the final integrated results (table 2) were not satisfactory and no higher classification accuracy obtained compared to some individual classifiers. the main reason may be that our methods used all the selected gene subsets as classification model, which contain many redundant and tumor - unrelated genes and figure 2 shows the classification accuracy with different numbers of the top - ranked genes sorted according to the significance of genes defined as (6), from which we found that only a few top - ranked genes were enough to obtain higher classification accuracy. meanwhile, when more genes were used as predictor set, there was only a little increase or even decrease in the classification performance. therefore, we inferred that too many selected genes involve much more redundancy and irrelevancy, which degrades the classification accuracy. in order to elaborate the effectiveness of hbfsnrs, we compared the accuracy of our approach with other common filter methods including t - test, information gain, kwrst, and relief - f. the experimental results indicate that our method is significantly superior to t - test and information gain, and slightly outperforms kwrst and relief - f in the aspect of tumor classification. for simplicity, we only present kwrst and relief - f results here (figure 2). we found that only a few top - ranked genes could achieve higher accuracy in the classification of tumor samples of different classes by our proposed search algorithm. for all dataset, the prediction accuracy by hbfsnrs is superior to other methods regardless of the much fewer genes used in cancer classification. for breast - cancer dataset, using one active gene could test outcome with the accuracy of 22.73% by relief - f, 63.64% by kwrst, whereas 100% test accuracy was obtained using one gene by the proposed hbfsnrs method. for colon - cancer dataset, using one, six active genes could get the prediction accuracy of 80% and 85% by our method, 65%, 70% by relief - f, and 65%, 75% by kwrst, respectively. for prostate - cancer dataset, when using more than ten genes for tumor classification, kwrst significantly outperformed our method and relief - f, but our method performs as well as the kwrst when only using the few top - ranked genes (both of our method and kwrst could get 97.06% accuracy using one gene). what is more, we compared our method with other statistical methods pam and clanc. pam, a statistical technique for class prediction from gene expression data that uses nearest shrunken centroids, was used to identify class predictor genes. clanc ranks genes by standard t - statistics, which does not shrink centroids and uses a class - specific gene selection procedure. in our context, clanc slightly outperformed pam, so we only present the comparison with clanc here (table 3). in comparison with clanc, our method could obtain higher classification accuracy when using a few top - ranked genes. the one - gene model by our method provides the classification accuracy of 100%, 80%, and 97.06% for breast - cancer, colon - cancer, and prostate - cancer dataset, respectively, whereas clanc requires more genes to get the same accuracy. in all dataset, the test accuracies on independent test dataset are 87% with six genes, 94% with 12 genes, and 97% with 18 genes by our method. using the same six, 12, 18 active genes could test outcome with the accuracy of 86%, 95%, and 97% by clanc, respectively, which indicates our method was comparable for all dataset. as a comparison, the minimum genes with the highest accuracy can be obtained in the classification process by hbfsnrs. in addition, results show that our method is obviously better than clanc in colon - cancer and breast - cancer cross - platform datasets. we proposed that these few genes whose expression profile vector showed remarkable discrimination capability may closely correlated to cancer and could be seen as possible disease signatures. mining genes that give rise to ontogenesis is one of key challenges in the area of cancer research. biologically the experimental results proved that the selected genes with high classification accuracy are functionally related to carcinogenesis or tumor histogenesis, so we could infer that the few top - ranked genes may be very important for tumor diagnosis. the 10 top - ranked genes according to the sig score for each tumor that were regarded as the candidate cancer genes listed in table 4. to demonstrate our method 's ability in uncovering known cancer genes and predicting novel cancer biomarkers, we downloaded a list of 25 breast cancer biomarkers that have been annotated in the omim database. unfortunately, our used dataset (the 300 top - ranked genes selected by kwrst) does not include the 25 known breast cancer genes. therefore our method can not be evaluated with it in terms of uncovering known cancer genes. from another point of view, it is verified that higher differential expression of a gene does not necessarily reflect a greater likelihood of the gene being related to cancer. in other words, important genes might not be necessarily differentially expressed. but it is undeniable that higher differential expressions of genes are inevitably important in the cancer diagnosis and development. next, literature search method was used to check whether our method can predict novel cancer biomarkers. in the top 10 genes ranked by (6) for breast cancer, we found that these genes play an important role in the occurrence of breast cancer. the collagen triple helix repeat containing 1 (cthrc1), ranked the first, whose aberrant expression is widely presented in human solid cancers including breast cancer and seems to be associated with cancer tissue invasion and metastasis. the pdz and lim domain protein 4 (pdlim4), ranked the second, was frequently methylated in breast cancers but not in normal breast tissues. the keratin, type i cytoskeletal 17 (krt17), ranked the third, was specifically overexpressed in basal - like subtypes of breast cancer. the secreted frizzled - related protein 1 (sfrp1), ranked the fourth, was recently found to be associated with progression and poor prognosis in early stage of breast cancer. the collagen alpha-1 (iii) chain (col3a1), ranked the fifth, was up - regulated in both invasive ductal and lobular carcinomas cells when compared with normal ductal and lobular cells. the peptidase inhibitor 15 (pi15), ranked the sixth, was also differentially expressed but it was down regulated in lobular and ductal invasive breast carcinomas. the actin gamma - enteric smooth muscle (actg2), ranked the seventh, is involved in the architecture and remodeling of cytoskeleton in basal medullary breast cancer. the tissue factor pathway inhibitor 2 (tfpi2), ranked the eighth, whose aberrant hypermethylation with gene promoter was associated with metastasis in breast cancer. the serpin b5 (serpinb5), ranked the ninth, an epithelial - specific serine protease inhibitor, was a biomarker in disseminated breast - cancer cells.the fibronectin 1 (fn1), ranked the tenth, was recently suggested to be associated with the prognosis of patients with breast cancers. finally, we examined gene pathway that involved by the 10 top - ranked genes. the study is carried out using the software which can help the researchers to better understand the biological phenomenon understudied by pointing out significant cellular functions of the selected genes from the webpage results indicate that the pathways that the 10 top - ranked genes are involved in are ecm - receptor interaction (col3a1, fn1), focal adhesion (col3a1, fn1), vibrio cholerae infection (actg2), p53 signaling pathway (serpinb5), small cell lung cancer (fn1), wnt signaling pathway (sfrp1), regulation of actin cytoskeleton (fn1), pathways in cancer (fn1), which agree well with current knowledge on breast cancer. thus it can be seen that the selected genes that closely related to adhesion, motility, and metastasis may provide new insights in the underlying molecular mechanisms related to disease development, in designing therapy and in prognostication for patients with breast carcinoma. thus, the analysis of existing biological experiment results of breast - cancer dataset well illustrates that our method has great power of identifying tumor - related genes. furthermore, another case study for prostate - cancer dataset was presented here. in the 10 top - ranked genes, six of them (hpn, maf, gstp1, wwc1, junb, and rnd3) have been reported to be associated with prostate cancer. the hepsin (hpn), ranked the first, a cell surface serine protease that is markedly up - regulated in human prostate cancer, which is overexpression in prostate epithelium in vivo causes disorganization of the basement membrane and promotes primary prostate cancer progression and metastasis to liver, lung, and bone. the transcription factor (maf), ranked the second, was down - regulated in the tumors relative to normal prostate tissue and may be regarded as the candidate tumor suppressor gene. the glutathione s - transferase p (gstp1), ranked the fourth, whose cpg island hypermethylation is the most common somatic genome alteration described for human prostate cancer. the gene wwc1, ranked the sixth, was found to interact with histone h3 via its glutamic acid - rich region and that such interaction might play a mechanistic role in conferring an optimal er transactivation function as well as the proliferation of ligand - stimulated breast - cancer cells. the transcription factor jun - b (junb), ranked the seventh, is an essential upstream regulator of p16 and contributes to maintain cell senescence that blocks malignant transformation of tac. junb thus apparently plays an important role in controlling prostate carcinogenesis and may be a new target for cancer prevention and therapy. the rho - related gtp - binding protein rhoe (rnd3), ranked the ninth, a recently described novel member of the rho gtpases family, was regarded as a possible antagonist of the rhoa protein that stimulates cell cycle progression and is overexpressed in prostate cancer. genes related to a specific or similar disease phenotype tend to be located in a specific neighborhood in the protein - protein interaction network, and a protein is likely to be coexpressed with its interaction partners and those proteins that have similar function. here, we applied a protein - network - based method to analyze the effect of neighborhood partners on the selected genes using all interactions in the human protein reference database. figure 3 indicates the protein - interaction network for each top - ranked gene of prostate cancer (kiaa0430 has no interaction partners in hprd). the red - ellipse nodes represent the 10 top - ranked genes that were ranked by the sig score in (6), among which, those with an asteroid sign means known cancer genes. the diamond nodes indicate the direct interaction partners of the selected genes that were not cancer genes, and blue - octagon nodes show those partners that are identified as known cancer genes which were collected by querying the memorial sloan kettering computational biology website, oncogene, tumor suppressor, and are shown as [4, 44 ]. among the 10 top - ranked genes for prostate - cancer dataset (figure 3), 6 genes (abl1, junb, map, p4hb, gstp1, and rnd3) that listed with an asteroid sign have been identified to be known cancer genes. here, we mainly illustrate the three genes p4hb, pex3, and abl1 that we did not find reports on their association with prostate cancer. in the three genes, p4hb and abl1 have been known as cancer genes. pex3 is also a famous disease gene which was the cause of peroxisome biogenesis disorder, complementation group 12, and zellweger syndrome. it can be seen that mutation in these genes can lead to many diseases and may have a close relationship with prostate cancer. in this sense, our method is effective on cancer - related gene selection.. suggest that cancer linker degree (cld) of a protein which was defined as the number of cancer genes to which a gene is connected is a good indicator of the probability of being a cancer gene. we analyzed the cancer linker degree (cld) of 10 top - ranked genes on each of the four datasets. for prostate cancer, as is shown in figure 4, most of the top - ranked genes have a direct interaction with known cancer genes excluding the gene pex3, and the cld of abl1, junb, wwc1, maf, p4hb, gstp1, hpn, and rnd3 is 46, 13, 2, 6, 7, 1, 1, and 1, respectively. in the 10 top - ranked genes of all (tcfl5 and lrmp have no interaction partners in hprd), smarca4, dntt, and nono are known cancer genes, and the cld of smarca4, dntt, nono, cd72, mpp1, and cd99 is 19, 3, 6, 1, 2, and 2, respectively. for breast cancer, cthrc1, pi15, and serpinb5 have no interaction partners in hprd. in the remaining 7 genes of 10 top - ranked genes, sfrp1 and tfpi2 are known cancer genes, and sfrp1, tfpi2, fn1, col3a1, and krt17 have a direct interaction with known cancer genes, the cld of which is 2, 1, 17, 2, and 1 respectively. for colon cancer, fuca1 has no interaction partners in hprd. in the remaining 9 genes, myh9 is a known cancer gene, the cld of des, myh9, c3, and 2-sep is 4, 3, 1, and 1, respectively. these results show that besides a few selected genes that typically correspond to known specific cancer mutations, a considerable portion of the top - ranked genes have many direct interactions with cancer genes, which suggests that these genes should be very likely to be involved in cancer and may play a central role in the protein network by interconnecting many known cancer genes, and thus the top ranked genes can be regarded as reliable disease biomarkers. an ongoing challenge is to identify new prognostic markers that are directly related to disease and that can more accurately predict the likelihood of gaining cancer in unknown samples. results indicate that our proposed method of gene selection by hbfsnrs has the following advantages in trying to tack this challenge. (1) our method could obtain the highest or near highest prediction accuracy of tumor classification with the minimum gene subset. (2) lists of ranked potential candidate cancer biomarkers with a specific cancer are presented by our approach. (3) our proposed method can obtain many optimal gene subsets in a short period of time, which is essential to the whole search process. (4) compared to other gene ranking methods kwrst and relief - f, our method is relatively stable and contains little chance factors. the success of our methods, gene selection by hbfsnrs, can be attributed to a combination of several aspects. first, we adopted the dependence function of nrs to evaluate the goodness of selected gene subsets. there are two main advantages for this point : time saving and tumor classification without the feedback and leaked information of the test dataset. second and more importantly, the designed process of gene search by our method can select any number of optimal gene subsets in a comparatively short time, which is an optimization of best - first search. finally, considering the selection of value in the evaluation of gene subsets has the problem that the genes with different value will have different ranked positions or relevance to cancer. to avoid this problem of selection bias, we defined a sig score to describe the significance of genes by combining five groups of results that obtained by each value. we presented two case studies on breast cancer and prostate cancer to illustrate the power of our method to identify tumor - related genes. one limitation of our approach is in data quality : current high - throughput technologies remain error prone and may be far from complete. in a recent paper, zhang. held that the integration of microarray data gives us more analytical power and reduces the false discovery rate. given a specific cancer, efficient ways to integrate multiple independent microarray data may be a good way to solve the issue of data quality. the other limitation is the optimization of the threshold value of neighborhood rough set. on one hand, we tried the neighborhood rough set reduction method to evaluate the goodness of the selected gene subsets to save time in tumor classification without using the feedback information of the test dataset. on the other hand, the threshold selection is obtained through the feedback information of the test set. in addition, different values may select different gene subsets, hence the genes with different value will have different positions in gene prioritization, so the selection of has become more critical for gene prioritization. fortunately, the choice of is not so important for gene ranking because the change of gene position in different values is not significant. in our study, spearman 's rank correlation coefficient was used to determine whether there is a consistency between the results of gene prioritization with different values. our proposed hbfsnrs method has improved the performance of tumor classification based on microarray and identified and prioritized lists of potential tumor - related genes from gep, our future work will benefit further from integrating other sources. recent high - throughput technologies have produced vast amounts of protein - protein interactions, which represent valuable resources for candidate - gene prioritization and give us new insights into the mechanism of disease. a great number of studies have shown that integration of multiple sources of data is more reliable for predicting cancer genes than the use of a single criterion [4, 4648 ]. thus, it is an efficient method to integrate gep and protein interaction network for gene prioritization. although gene expression data and protein interaction data have been integrated for gene prioritization [49, 50 ], the results are not satisfactory. | selection of reliable cancer biomarkers is crucial for gene expression profile - based precise diagnosis of cancer type and successful treatment. however, current studies are confronted with overfitting and dimensionality curse in tumor classification and false positives in the identification of cancer biomarkers. here, we developed a novel gene - ranking method based on neighborhood rough set reduction for molecular cancer classification based on gene expression profile. comparison with other methods such as pam, clanc, kruskal - wallis rank sum test, and relief - f, our method shows that only few top - ranked genes could achieve higher tumor classification accuracy. moreover, although the selected genes are not typical of known oncogenes, they are found to play a crucial role in the occurrence of tumor through searching the scientific literature and analyzing protein interaction partners, which may be used as candidate cancer biomarkers. |
with an estimated 70,530 new cases and 14,680 deaths in the united states in 2010, bladder cancer is the most common malignancy of the urothelium and kidneys. metachronous disease is common, and surveillance for additional tumors is a lifelong challenge in patients with bladder cancer. ct urography (ctu) is defined as a ct examination of the urinary tract that is performed both before and after intravenous (iv) contrast material, and includes excretory phase images. ctu is emerging as the imaging test of choice for the evaluation of the urinary tract for a variety of disorders, including hematuria. although the precise role of ctu has not been defined, recent data suggest that ctu can be used to detect bladder cancer with a sensitivity and specificity close to cystoscopy. this article reviews the anatomic variants and benign entities that mimic bladder cancer at ctu. although techniques vary among institutions, the goal of ctu is to achieve a set of images that include a fully opacified and distended intrarenal collecting system, ureters, and bladder. we obtain an unenhanced ct scan of the abdomen and pelvis to identify calculi, including those in the bladder, that could be masked by excreted contrast material. unenhanced ct scans also allow measurement of the native attenuation of masses throughout the urinary tract that can be used to assess for enhancement. in patients over the age of 40 years, we image the kidneys in the nephrographic phase at 100 s after contrast material injection (80 ml of iodinated contrast material ; 370 mg i / ml), to detect and characterize renal masses. an excretory phase scan of the abdomen and pelvis is obtained at 15 min. in patients 40 years or younger, a split - bolus, two - phase protocol is used to limit radiation exposure. following an unenhanced scan of the abdomen and pelvis, 40 ml of iv contrast medium are administered. after an 8-min delay, 80 ml of iv contrast medium are administered and followed by a scan of the abdomen and pelvis at 100 s. both protocols may be augmented with 250 ml of iv normal saline infused during the delay periods. we prefer to administer 10 mg of iv furosemide (lasix ; abbott laboratories, north chicago, il) 23 min before the intravenous contrast material in patients over the age of 40 years. furosemide, and to some extent saline, contribute to distension of the upper urinary tracts and bladder during excretory phase imaging. an underdistended bladder can appear thickened, particularly along its anterior wall, and mimic bladder cancer (fig. 1). since the specific gravity of contrast medium is higher than urine, incomplete mixing of unopacified urine and contrast material often results in a urine contrast level. furosemide increases urinary flow rate, thereby increasing both distention and mixing of the contrast material, the latter likely via an increased ureteral jet phenomenon. others have used a log - rolling technique to promote mixing of contrast material and urine in the bladder. wide window settings may be required, particularly if ctu is not supplemented with furosemide, as dense contrast material may obscure small urothelial masses (fig. 2). figure 1(a) a 67-year - old man with painless hematuria. axial image from the unenhanced phase of a ct urogram shows apparent thickening of the anterior bladder wall (arrowheads) concerning for bladder cancer. (b) axial image from the excretory phase of a ct urogram supplemented with iv furosemide demonstrates that the bladder is normal. the bladder is well distended, and the urine and contrast material are mixed providing a homogeneous background ideal for detection of bladder masses. axial image from the excretory phase of a ct urogram (window level 50, window width 350) supplemented with iv normal saline demonstrates a distended bladder with dense contrast material layering dependently. (b) same image viewed with a wider windowing (window level 50, window width 630) demonstrates a 2-mm papillary urothelial carcinoma (arrowhead) that was obscured using soft tissue windows. axial image from the unenhanced phase of a ct urogram shows apparent thickening of the anterior bladder wall (arrowheads) concerning for bladder cancer. (b) axial image from the excretory phase of a ct urogram supplemented with iv furosemide demonstrates that the bladder is normal. the bladder is well distended, and the urine and contrast material are mixed providing a homogeneous background ideal for detection of bladder masses. axial image from the excretory phase of a ct urogram (window level 50, window width 350) supplemented with iv normal saline demonstrates a distended bladder with dense contrast material layering dependently. (b) same image viewed with a wider windowing (window level 50, window width 630) demonstrates a 2-mm papillary urothelial carcinoma (arrowhead) that was obscured using soft tissue windows. the distended bladder has a round or oval form with a peritoneum - covered dome. the remaining surfaces of the bladder abut the extraperitoneal space. the apex of the bladder, connected to the umbilicus by the urachus during embryologic development, is directed anterosuperiorly ; the bladder neck is positioned inferiorly. a prominent urachal remnant may cause focal nodularity at the anterosuperior aspect of the bladder and mimic a mass (fig. 3). this pitfall may be avoided by noting that the thickening is limited to the serosal side of the bladder, midline, and is contiguous with the fibrous urachal remnant (the median umbilical ligament) extending anterosuperiorly towards the umbilicus. figure 3(a) a 31-year - old woman with hematuria and a prominent urachal remnant. axial image from the excretory phase of a ct urogram demonstrates focal thickening of the anterior bladder wall in the midline (arrow). (b) sagittal image from the excretory phase of a ct urogram demonstrates thickening limited to the serosal surface of the bladder wall (arrow). also note a thin linear remnant extends from the bladder dome to the umbilicus (arrowheads). the urine analysis was normal 2 years after the examination, and no cause for the patient s hematuria was found. (a) a 31-year - old woman with hematuria and a prominent urachal remnant. axial image from the excretory phase of a ct urogram demonstrates focal thickening of the anterior bladder wall in the midline (arrow). (b) sagittal image from the excretory phase of a ct urogram demonstrates thickening limited to the serosal surface of the bladder wall (arrow). also note a thin linear remnant extends from the bladder dome to the umbilicus (arrowheads). the urine analysis was normal 2 years after the examination, and no cause for the patient s hematuria was found. the internal urethral orifice is located at the bladder neck at the inferior angle of the trigone. the ureters traverse a short, oblique, intramuscular course before opening at the posterolateral angles of the trigone at the ureterovesical junction (uvj). the intramural ureter may appear to protrude into the bladder lumen, and can simulate a bladder mass depending on the location of the uvj, the angle at which the ureter inserts, and the imaging plane (fig. a tumor can often be excluded by noting that the bulge is subtle, located at the uvj, and bilateral, with symmetry in at least one imaging plane. in contradistinction, 5) typically cause more mass effect. however, benign processes such as post - operative changes (fig. 6) and endometriosis (fig. figure 4(a) an 84-year - old man with a history of bladder cancer and normal ct urogram. axial image from the excretory phase of a ct urogram shows apparent thickening of a normal left ureterovesical junction (uvj) (arrow). (b) coronal reformations demonstrate normal symmetric appearance of the bilateral ureterovesical junctions (arrows). axial image from the excretory phase of a ct urogram shows mild asymmetric thickening of the left uvj (arrow). axial image from the excretory phase of a ct urogram demonstrates focal wall thickening (arrow) just anterolateral to the right uvj (arrowhead), at the site of the previous resection. urine cytology was negative, and cystoscopic biopsy demonstrated postoperative inflammatory changes. note the normal left uvj (curved arrow). axial image from the excretory phase of a ct urogram demonstrates focal mass - like wall thickening just superolateral to the right uvj (arrow). (a) an 84-year - old man with a history of bladder cancer and normal ct urogram. axial image from the excretory phase of a ct urogram shows apparent thickening of a normal left ureterovesical junction (uvj) (arrow). (b) coronal reformations demonstrate normal symmetric appearance of the bilateral ureterovesical junctions (arrows). axial image from the excretory phase of a ct urogram shows mild asymmetric thickening of the left uvj (arrow). cystoscopic biopsy demonstrated urothelial carcinoma. a 71-year - old man with a history of resected bladder cancer. axial image from the excretory phase of a ct urogram demonstrates focal wall thickening (arrow) just anterolateral to the right uvj (arrowhead), at the site of the previous resection. axial image from the excretory phase of a ct urogram demonstrates focal mass - like wall thickening just superolateral to the right uvj (arrow). 8), schistosomiasis, tuberculosis, and radiation - induced cystitis generally cause diffuse, symmetric bladder wall thickening. diffuse or multifocal bladder cancer typically causes asymmetric, multifocal wall thickening (fig. 9). rarely, inflammatory conditions such as cystitis glandularis (fig. 11), and those associated with diffuse wall thickening are likely benign. however, urothelial carcinoma may calcify (fig. 12), and therefore cancer should be suspected when calcification is associated with a mass. figure 8a 55-year - old man with gross hematuria. coronal image from the excretory phase of a ct urogram shows diffuse bladder wall thickening with irregularity of the urothelial surface (arrowheads). the left ureter (curved arrow) is mildly obstructed due to the thickened wall. coronal image from the excretory phase of a ct urogram demonstrates multifocal nodular wall thickening (arrows) involving most of the bladder, and causing bilateral hydronephrosis and hydroureter (arrowheads). axial image from the excretory phase of a ct urogram shows focal thickening of the posterior bladder wall (arrow), and an enlarged left external iliac lymph node (arrowhead). figure 11a 75-year - old woman with a history of bladder cancer treated with intravesical bacillus calmette - gurin (bcg). axial image from the excretory phase of a ct urogram demonstrates foci of bladder wall calcification (arrows) without associated mass or wall thickening. biopsy revealed chronic inflammation and granulomas at all sites, related to prior bcg treatment. axial image from the excretory phase of a ct urogram shows a mass along the right lateral bladder wall with calcifications (arrowheads). coronal image from the excretory phase of a ct urogram shows diffuse bladder wall thickening with irregularity of the urothelial surface (arrowheads). the left ureter (curved arrow) is mildly obstructed due to the thickened wall. a 53-year - old man with gross hematuria and urothelial carcinoma. coronal image from the excretory phase of a ct urogram demonstrates multifocal nodular wall thickening (arrows) involving most of the bladder, and causing bilateral hydronephrosis and hydroureter (arrowheads). surgical pathology at cystectomy revealed multifocal high grade urothelial carcinoma. a 75-year - old man with hematuria. axial image from the excretory phase of a ct urogram shows focal thickening of the posterior bladder wall (arrow), and an enlarged left external iliac lymph node (arrowhead). a 75-year - old woman with a history of bladder cancer treated with intravesical bacillus calmette - gurin (bcg). axial image from the excretory phase of a ct urogram demonstrates foci of bladder wall calcification (arrows) without associated mass or wall thickening. biopsy revealed chronic inflammation and granulomas at all sites, related to prior bcg treatment. a 57-year - old man with hematuria and urothelial carcinoma of the bladder. axial image from the excretory phase of a ct urogram shows a mass along the right lateral bladder wall with calcifications (arrowheads). in patients with a history of bladder cancer, prior surgical treatment may cause focal wall thickening and abnormal enhancement that may be indistinguishable from recurrent tumor, even at cystoscopy (figs. patients who have received intravesical immunotherapy with bacillus calmette - gurin (bcg) may develop granulomatous changes in the bladder wall, mimicking bladder cancer (fig. knowledge of past history and the presence of radiation - induced changes in nearby small bowel loops can help reach the diagnosis. figure 13a 56-year - old man with hematuria 6 weeks following transurethral resection of superficial bladder cancer. axial image from the excretory phase of a ct urogram shows focal wall thickening at the site of prior resection (arrow). axial image from the excretory phase of a ct urogram demonstrates focal bladder wall thickening along the left lateral wall (arrowheads), at the site of previous resection. cystoscopy revealed no evidence of malignancy. a 56-year - old man with hematuria 6 weeks following transurethral resection of superficial bladder cancer. axial image from the excretory phase of a ct urogram shows focal wall thickening at the site of prior resection (arrow). cystoscopic biopsy and urine cytology revealed no evidence of residual malignancy. a 62-year - old man with a history of resected bladder cancer. axial image from the excretory phase of a ct urogram demonstrates focal bladder wall thickening along the left lateral wall (arrowheads), at the site of previous resection. blood clots can simulate bladder neoplasms, however, they are typically odd - shaped or linear, smoothly marginated ; they do not enhance. also, they are luminal findings, and multiplanar reformations can be used to demonstrate that they do not arise from the bladder mucosa (fig. cystoscopy may be needed to distinguish clots that abut or adhere to the bladder wall, from urothelial cancer (fig. axial image from the excretory phase of a ct urogram shows irregular soft tissue at the bladder base, projecting into the bladder lumen (arrows). (b) coronal reformations demonstrate linear structures in the bladder lumen without attachment to the bladder mucosa (arrows). axial image from the excretory phase of a ct urogram shows an apparent papillary mass at the bladder base (arrow), concerning for bladder cancer. cystoscopy revealed a blood clot adherent to the bladder wall, without evidence of bladder cancer. axial image from the excretory phase of a ct urogram shows irregular soft tissue at the bladder base, projecting into the bladder lumen (arrows). (b) coronal reformations demonstrate linear structures in the bladder lumen without attachment to the bladder mucosa (arrows). also note nodular enlarged prostate gland indenting the bladder base (curved arrow). axial image from the excretory phase of a ct urogram shows an apparent papillary mass at the bladder base (arrow), concerning for bladder cancer. cystoscopy revealed a blood clot adherent to the bladder wall, without evidence of bladder cancer. benign prostatic hyperplasia (bph) can cause bladder outlet obstruction and bladder wall thickening due to detrusor muscle hypertrophy (fig. 19) can cause protrusion of nodular, mass - like tissue into the bladder at its base. this nodular tissue may be asymmetric, and can have either a smooth or an irregular surface. distinguishing a bladder base cancer from an enlarged prostate gland therefore may be difficult with excretory phase imaging, even using coronal reformations (fig. since urothelial cancers are typically hypervascular, bladder base urothelial cancers can be differentiated from the prostate gland when the pelvis is examined 70 s after the injection of iv contrast material, when the bladder is distended with unopacified urine. however, addition of these images to the ctu protocol described above would increase the radiation dose of the examination. figure 17an 83-year - old man with a prolonged history of urinary frequency, urgency and dysuria secondary to benign prostatic hyperplasia. severe diffuse symmetric bladder wall thickening (arrows) due to detrusor muscle hypertrophy is mildly obstructive, manifested as mild left hydroureteronephrosis (arrowheads) and mild right hydroureter (curved arrow). axial image from the excretory phase of a ct urogram shows papillary - appearing soft tissue at the bladder base (arrows). coronal image from the excretory phase of a ct urogram shows a smooth nodular soft tissue mass contiguous with prostate, projecting into the bladder base (arrow) to the left of a urinary catheter (curved arrow). coronal image from the excretory phase of a ct urogram shows an apparent mass (arrows) at the bladder base inseparable from the prostate gland. an 83-year - old man with a prolonged history of urinary frequency, urgency and dysuria secondary to benign prostatic hyperplasia. severe diffuse symmetric bladder wall thickening (arrows) due to detrusor muscle hypertrophy is mildly obstructive, manifested as mild left hydroureteronephrosis (arrowheads) and mild right hydroureter (curved arrow). a 76-year - old man with urinary frequency, urgency and dysuria. axial image from the excretory phase of a ct urogram shows papillary - appearing soft tissue at the bladder base (arrows). coronal image from the excretory phase of a ct urogram shows a smooth nodular soft tissue mass contiguous with prostate, projecting into the bladder base (arrow) to the left of a urinary catheter (curved arrow). coronal image from the excretory phase of a ct urogram shows an apparent mass (arrows) at the bladder base inseparable from the prostate gland. knowledge of normal anatomy and benign conditions that mimic neoplastic disease will help reduce the number of false - positive ct urograms. although cystoscopy will be needed to differentiate benign from malignant bladder processes in some situations, continued experience with ctu and knowledge of the appearance of benign conditions will help limit the number of patients needing further investigation. | abstractthe objective of this review article is to learn how to recognize anatomic variants and benign entities that mimic bladder cancer at computed tomography (ct) urography. building on recent data that suggest that ct urography can be used to diagnose bladder cancer, recognition of anatomic variants and benign entities will help improve radiologists ability to diagnose bladder cancer. |
bacillus calmette guerin (bcg) vaccine, derived from multiple passages of wild - type mycobacterium bovis, has been used in humans since 1921 and is still the only vaccine available against tuberculosis (1). approximately, 100 million children routinely receive one or more bcg vaccines in most countries of the world every year and in iran yearly, 1.4 million neonates receive one dose at birth as per the expanded immunization program (2). although bcg immunization is relatively safe, it may be associated with adverse events, such as self - limited injection site lesions, regional adenitis, and in rare cases, life threatening disseminated bcg infection (3). the incidence of disseminated bcg infection has previously been reported to be 0.19 - 1.56 cases per one million vaccinated infants and such disease has been mainly seen in severe immune deficiency, with high mortality rate (3, 4). diagnosing disseminated bcg infection that affects mainly infants and young children and is characterized by fever, weight loss, lymphadenopathy, and hepatosplenomegaly requires a high index of physicians suspicion (5). a wide variety of differential diagnosis should be considered including other mycobacterial, some bacterial, viral, parasitic, and fungal infections as well as neoplastic and connective tissue diseases, and also metabolic or hematologic diseases with superimposed infections (3, 5). to confirm the diagnosis, differentiation of isolated mycobacterium bcg sub - strain from atypical mycobacteria and other members of mycobacterium tuberculosis complex (mtc) such as m. tuberculosis, wild - type m. bovis, and m. africanum by various methods is mandatory (5). although isolation by culture and then identification are the optimal confirmatory steps in diagnosis, polymerase chain reaction (pcr) is directly applicable for smear - positive clinical specimens, indicating that it is a rapid and specific diagnostic test. a precise and rapid diagnosis of disseminated bcg infection is crucial in starting a prompt aggressive anti - mycobacterial treatment, which needs to be continued for a prolonged period of time (3, 5). the present study aimed to report on the various manifestations, laboratory findings and outcomes of this rare life - threatening complication in a considerable number of infants and young children managed at a single center and to propose pcr as an efficient confirmatory diagnostic method applied directly on pathology specimens. we retrospectively reviewed the medical files of all children hospitalized for disseminated bcg infection at nemazee teaching hospital, a referral hospital in southern iran, between 1990 and 2007. all of the 34 individuals included in this study were diagnosed and treated as disseminated bcg infection, by a pediatric infectious diseases specialist. the presumptive diagnosis was based on (a) the presence of systemic syndromes compatible with disseminated mycobacterial disease, (b) a positive history of bcg vaccination, (c) a temporal relationship between bcg vaccination and disease, (d) the presence of disease in the region of vaccination, (e) histopathologic evidence of mycobacterial infection including the presence of acid fast bacilli and/or granuloma at two or more anatomic sites other than the site of vaccination, and (f) having inconclusive results for the work - ups of other diseases. the pathologic reports of 59 samples were available in the patients medical files, including 24 bone marrow aspirations or biopsies, 14 liver biopsies, 13 distant lymph node aspirations or biopsies, three skin rash biopsies, two bone biopsies, two lung biopsies and one gastric washing. the competency of the immune system was evaluated by different tests including nitroblue - tetrazolium test, t - cell and b - cell counts by flow cytometry (facscalibur, bd. us), human immunodeficiency virus (hiv) test by enzyme - linked immunosorbent assay (elisa) and evaluation of serum immunoglobulins and ch50. twenty - eight samples from 21 patients, including nine smears from bone marrow specimens and 19 formalin - fixed and paraffin - embedded (ffpe) tissue specimens (i.e., six lymph node, nine liver, one subcutaneous nodule, one lung, one rib, and one smear of intra - abdominal abscess) were available. nucleic acid extraction was performed on one to five sections (5 m) of these specimens. (fermentas co., lithuania) lysis and phenol - chloroform (sina gene co., iran) extraction, followed by ethanol (merck co., germany) precipitation to isolate deoxyribonucleic acid (dna) from the smears and tissues. for differentiating m. bovis bcg from the other members of the m. tuberculosis complex, we performed an in - house multiplex pcr method to confirm the identity of the isolates, as described by magdalena. the following primers were used : spacer region - specific primers for m. bovis bcg, spacer region 33 specific (5acaccgacatgacggcgg3) and spacer region 34 specific (5cgacggtgtgggcgagg3) ; the insertion sequence is6110, mtc - specific primers, tb284 (5ggacaacgccgaattgcg3), tb850 (5taggcgtcggtgacaaaggccac3) ; and mycobacterium genus - specific (65-kda antigen gene) primers, tb11 (5accaacgatggtgtgtccat3) and tb12 (5cttgtcgaaccgcataccct3). the pcr conditions were 95c for three minutes ; 30 cycles at 95c for 20 seconds, 65c for 30 seconds, and 72c for 30 seconds ; and 72c for seven minutes. the products were analyzed by electrophoresis on a 2% (wt / vol) agarose gel (8). negative controls contained the pcr mixture without a dna template and positive controls contained mycobacterial dna extracted from the bcg vaccine. the patients were classified into two categories, definite and probable cases, according to the working definition of disseminated bcg disease described by talbot. in 1997 (5). the definite disseminated bcg infections three criteria, including : (i) identification of m. bovis bcg substrain by pcr, (ii) evidence of infection (including a positive culture, pcr or histopathologic demonstration of acid - fast bacilli) at two or more anatomic sites beyond the site of vaccination, and (iii) the presence of a systemic syndrome compatible with mycobacterial infection (such as fever, weight loss, and anemia). the probable case was defined based on all the criteria for a definite case except a positive pcr for m. bovis bcg (9). in the present study, the pcr result for m. bovis bcg was either negative or not performed in probable cases. the study design, conduct and assessments were all in accordance with ethical considerations, established and approved by the ethics committee of shiraz university of medical sciences. data were analyzed using spss, version 11.5 (spss, chicago, il). there were 34 consecutive patients, 21 definite (tables 1) and 13 probable (table 2) cases, reported from 1990 to 2007. all patients were healthy at birth and vaccinated routinely with the pasteur 1173 m. bovis bcg substrain at the insertion of the deltoid. the patients were one to 60 months old with a mean (sd) of 10.2 (12.5). abbreviations : a indicates alive ; bm, bone marrow ; cgd, chronic granulomatous disease ; c, clarithromycin ; cmi, unidentified cell - mediated immune defect ; d, died ; dln, distant lymphadenopathy ; e, ethambutol ; f, fever ; gln, generalized lymphadenopathy ; hsm, hepatosplenomegaly ; i, isoniazid ; lad, lymphadenopathy ; mo, months, o, ofloxacin ; p, pneumonia ; r, rifampin ; scid, severe combined immunodeficiency ; s, streptomycin. evidence of dissemination included the histopathologic demonstration of acid - fast bacilli and/or typical histopathologic changes with granulomatous inflammation and/or the identification of mycobacterium substrains, by standard polymerase chain reaction. evidence of dissemination included the histopathologic demonstration of acid - fast bacilli and/or typical histopathologic changes with granulomatous inflammation and/or the identification of mycobacterium substrains, by standard polymerase chain reaction. fever in 31 (91.2%), axillary lymphadenopathy in 26 (76.5%) with fistulization in 50%, hepatosplenomegaly in 25 (73.5%), stunted growth in 21 (61.8%), distant lymphadenopathy in 16 (47.1%), cough (longer than three weeks) in 15 (44.1%), skin rash in 9 (26.5%) and vomiting in 9 (26.5%) were the most commonly reported signs and symptoms. disseminated bcg infection was diagnosed in three of the cases after laparotomy for bowel obstruction (cases 13 and 18, table 1 ; case 5, table 2). specific pathologic findings (presence of granuloma and/or acid fast bacilli in tissue specimens) were found in 12 of 13 (92.3%) biopsies or aspirations of distant lymph nodes, 12 of 14 (85.7%) liver biopsies and 15 of 24 (62.5%) bone marrow aspirations and biopsies. in the two lung biopsies and one of the two bone biopsy specimens, one gastric washing, done for a patient with pneumonia, and two of three biopsies of skin rashes revealed acid fast bacilli (tables 1 and 2). the most common abnormal findings in blood profiles were as follows : anemia in 30 (88.2%), leukopenia (white blood counts less than 4000/l) in 16 (47.1%), thrombocytopenia (platelet counts less than 150000/l) in 15 (44.1%), and leukocytosis (leukocyte count that was two standard deviations above the mean count for a particular age) in 15 (44.1%). severe combined immunodeficiency (scid) was identified in 12 (35.3%), followed by unidentified cell mediated immune defect in 4 (11.8%) and chronic granulomatous disease in 1 (2.9%). disseminated bcg infection developed in two brothers (case 8, table 1 ; case 13, table 2) and a brother and sister (cases 7 and 19, table 1) among the patients. response to therapy was poor, with an overall mortality rate of 58.8% (20 of 34). of the 20 patients who died of disseminated bcg infection, 15 (75%) had an immune defect. in contrast, of the fourteen patients who recovered, only two (14%) had an identified immunodeficiency. all 12 infants with severe combined immunodeficiency (scid) died despite the received treatment. different treatment protocols were used in our patients, i.e. the patients were mostly treated with isoniazid and rifampin up to 2004 and afterwards by three or more anti - tuberculosis drugs (tables 1 and 2). disseminated bcg infection was confirmed in 21 patients by pcr, which was directly applied to the 28 available clinical specimens in pathology specimen bank and one intraabdominal abscess specimen (tables 1 and 2) (10). pcr results were positive on 26 specimens for m. bovis bcg including 9 of 9 (100%) bone marrow smears slides, 16 of 19 (84.2%) of ffpe tissue specimens and one intra - abdominal abscess specimen. as for 16 ffpe tissue specimens, pcr results on 3 specimens from skin rash, bone and lung were positive for m. bovis bcg ; and pcr positivity was 100% for distant lymph nodes (6 of 6) and 77.8% for liver (7 of 9). herein, we on report 34 patients with disseminated bcg infection, 21 definite and 13 probable cases and to the best of our knowledge, this is the largest study on children with definite disseminated bcg infection, reported from iran. disseminated bcg infection is a rare consequence of bcg vaccination, with a reported frequency of less than five per million vaccines and has mainly been seen in children with severe immune deficiencies (3). adverse reactions to bcg vaccine appear to be grossly underreported (11). approximately, 1.4 million children receive bcg vaccines every year in iran and according to recent reports from iran, the number of disseminated bcg infections is estimated to be higher than the expected rate (12 - 19). the greater reactogenicity of pasteur 1173p2 strain vaccines, used in the national immunization program or higher prevalence of primary immunodeficiency may be possible explanations, which need further investigations (20, 21). the majority of our patients (91.2%) were infants, consistent with previous reports in which 76 -100% of the patients were under two years of age (5, 13, 17 - 19, 22). the most clinical presentations in our series were fever found in 31 (91.2%), axillary s lymphadenopathy in 26 (76.5%) with fistulization in 50%, hepatosplenomegaly in 25 (73.5%), and stunted growth in 21 (61.8%), in agreement with previous reports (5, 13, 17 - 19, 22). unusual presentation of disseminated bcg infection could be accompanied by gastrointestinal manifestations. of the 34 patients, two cases presented bowel obstruction (cases 17 and 26, table 1) and one with intussusception (case 5, table 2). one patient with retroperitoneal abscess presented an abdominal mass, as reported previously (case 11, table 1) (10). the histopathologic evidence of mycobacterial infection including the presence of acid fast bacilli and/or granuloma in tissue specimens removed by the liver and distant lymph node biopsy had very high yield of diagnosis (85.7% and 92.3%, respectively), so in children with suspected disseminated bcg infection in the absence of distant lymphadenopathy, liver biopsy could be suggested for early diagnosis. besides, biopsy or smear of other organs such as the skin nodules, bone and lungs may serve as diagnostic tools, as previously reported (5, 23, 24). the identification of m. bovis bcg substrain in tissue specimens of patients with suspected disseminated bcg infection is required for definite diagnosis. in this study, disseminated bcg infection was confirmed in 21 patients by pcr, which was directly applied to the 28 available clinical specimens with high rate of positivity (92.8%, 26 out of 28) (tables 1 and 2) (10). in fact, the spread of bcg is a normal sequela of bcg vaccination, yet the identification and speciation of m. bovis bcg substrain by standard pcr in a patient with clinical findings consistent with disseminated bcg infection, could serve as a well - established criteria for the diagnosis of disseminated bcg infection (5, 9). as for our patients, response to therapy was poor, with an overall mortality rate of 58.8%, which differ significantly in immunocompromised cases and patients without an identifiable immunodeficiency (75% vs. 14%, respectively ; p = 0.0003). the overall mortality rate of 71% was reported previously, despite aggressive management, and it ranged between 0% in patients without an identifiable immunodeficiency to 83% in immunocompromised counterparts (5). chemotherapy seems to be complicated by the inherent resistance of all m. bovis strains to pyrazinamide, the inherent intermediate resistance of some bcg strains to isoniazid, and the emergence of additional resistance during inappropriate therapy (25, 26). in a review in 1993, most m. bovis isolates from 73 patients were sensitive to isoniazid and rifampin, so during 1991 - 2004, the majority of our patients were treated with a combination of isoniazid and rifampin. concern for the selection of antibiotic - resistance, led to a change from the two - drug combined therapy to three or more drugs since about 2005 in our cases (27). it has been suggested that four or more anti - tuberculosis drugs should be used for longer than one year in children with disseminated bcg disease until full recovery. the mortality in our patients who received different regimens of anti - tuberculosis was not significantly different (tables 1 and 2). it seems that the patient s outcome is determined by their immunity state and/or progression of infectious process rather than anti - tuberculosis regimens. several reports suggest that early bone marrow transplantation together with appropriate antimicrobials in immunocompromised patients is effective in restoring immunity and curing the infection (27, 28). in the present study, about half of the patients were with identified with immunodeficiency. despite a few cases of disseminated bcg infection reported in normal hosts, immunodeficiency has been detected in the majority of patients i.e., 86% in the review of talbot. although, in our study, the majority of immunologic defects predisposed patients to mycobacterial infections, in our study, the majority of immunologic deficiencies except the defects of inretleukin-12-interferon- (il-12-inf-) axis predisposed patients to mycobacterial infections were investigated. the major defects of il 12- inf- axis leading to mendelian susceptibility to mycobacterial diseases (msmd) includes ifn r1, il-12r 1/il-12 p40, and signal transducers and activator of transcription (stat) 1 deficiency (31, 32). the major defects of the il-12-inf - g axis include ifn r1, il-12r 1/il-12 p40, and signal transducers and activator of transcription (stat) 1 deficiency (31, 32). four patients with sibling relationship in our series were immunodeficient and all except one died despite aggressive treatment (cases no 7 and 8, table 1 ; no 4 and 13, table 2). since most of the cases with disseminated bcg infection had immunodeficiency, mostly inherited as autosomal recessive, we suggest that all the siblings of cases with disseminated bcg infection should not be vaccinated at birth until complete evaluation and immunological work ups are performed. in conclusion, infants and young children with prolonged fever, hepatosplenomegaly, lymphadenopathy and a history of bcg vaccination should be examined for disseminated bcg infection. polymerase chain reaction specific for m. bovis bcg in tissue specimens has a high rate of positivity in such cases. nevertheless, further studies and clinical trials are required to assess the most appropriate anti - tuberculosis regimen (33). | background : disseminated bacillus calmette guerin (bcg) infection is a rare but life threatening complication of bcg vaccination. it has been mainly seen in severe immune deficiency. a precise and rapid diagnosis is crucial for prompt initiation of an aggressive anti - mycobacterial treatment. polymerase chain reaction (pcr) is directly applicable to smear - positive clinical specimens, proven to be a rapid and specific diagnostic test.objectives:the aim of this study was to investigate disseminated bcg infection among 34 children in southern iran, mainly confirmed by pcr.patients and methods : we included all the patients hospitalized with disseminated bcg infection at a referral teaching hospital in southern iran between years 1990 and 2007. the clinical and laboratory data including the immunological workups were obtained through a review of the medical files. we recalled all pathology samples from pathology specimen banks and used an in - house pcr specific for mycobacterium bovis bcg substrain to confirm the diagnosis.results:from the total of 34 children hospitalized with disseminated bcg infection, 21 were categorized as definite and 13 probable. thirty - one patients (91%) were under two years of age and 41% were male. the most common clinical findings were fever in 31 (91.2%), axillary s lymphadenopathy in 26 (76.5%), hepatosplenomegaly in 25 (73.5%), stunted growth in 21 (61.8%), and distant lymphadenopathy in 16 (47.1%). polymerase chain reaction positivity rate was 100% (9 of 9) in bone marrow smear slides and 84.2% (16 of 19) for formalin - fixed and paraffin - embedded tissue specimens. immunodeficiency state was detected in 50% and the overall mortality rate was 58.8% (20 of 34).conclusions : disseminated bcg infection should be considered in the differential diagnosis of infants and young children with fever, hepatosplenomegaly, lymphadenopathy, and history of bcg vaccination. the pcr method has a high positivity rate and can serve as a useful tool for the rapid and specific identification of m. bovis bcg substrain infection. |
glucagon - like peptide-1 (glp-1) is secreted from the enteroendocrine l cells of the intestinal mucosa and is released into the portal circulation in response to meal ingestion through posttranslational processing of proglucagon by prohormone convertase-1 in its secretory cells. glp-1 enhances insulin secretion and inhibits glucagon release in a glucose - dependent manner, prompting the development of glp-1-based therapies for the treatment of diabetes. glp-1-based diabetes therapies affect glucose control through several mechanisms, including slowed gastric emptying, regulation of postprandial glucagon, reduction of food intake, and enhancement of glucose - dependent insulin secretion without the risk of hypoglycemia. however, the clinical responsiveness to glp-1 analogues varies among patients with type 2 diabetes mellitus, which suggests that genetic factors may be crucial in the pharmacological responsiveness of these patients. in order to establish the correct treatment protocols in clinical practice and taking into consideration the high cost of these new drugs, it is important to clarify this critical issue in patients with type 2 diabetes mellitus. among genetic variants, the diabetes - associated variants in tcf7l2 (rs7903146) and wfs1 (rs10010131) have been shown to affect the response to exogenous glp-1, while variants in kcnq1 (rs151290, rs2237892, and rs2237895) have been reported to alter endogenous glp-1 secretion [68 ]. however, a validation study showed no effect regarding variants in tcf7l2, kcnq1, and wfs1 on glp-1 concentrations after a standard 75 g oral glucose tolerance test (ogtt) or glp-1-induced insulin secretion in healthy subjects without diabetes. the glucagon - like peptide 1 receptor (glp1r) specifically binds glp-1 and related peptides with a lower affinity such as the gastric inhibitory polypeptide and glucagon. the glp1r is a member of the class b1 family of g protein - coupled receptors, and polar interactions (hydrogen bonds or salt bridges) between glp1r and agonists have recently been predicted. some glp1r gene polymorphisms have been found to be related to the strength of these interactions. however, the relationship between these polymorphisms and the responsiveness to glp-1 analogue treatment has yet to be explored. pharmacogenetics has the potential to increase benefits and reduce side effects in patients whose drug responses are not average, and possibly to tailor treatments for these outliers. a previous study reported that differences in the insulinotropic response to exogenous glp-1 in healthy volunteers depended on the presence or absence of two common polymorphisms of the glp1r gene. however, the relationship between these single nucleotide polymorphisms (snps) and the effect of glp-1 analogues in patients with type 2 diabetes mellitus has not yet been established. currently, glp-1 analogues are most often used for patients with poorly controlled type 2 diabetes mellitus. however, the overall general control rate is not good which may be partially due to the complex etiology involved in type 2 diabetes mellitus. furthermore, the lack of normal beta cell secretary function is emphasized in modern practice. therefore, the effect of glp-1 analogues could be affected by various beta cell functions in patients with type 2 diabetes mellitus. in order to study the effect of a glp-1 analogue in patients with poorly controlled type 2 diabetes mellitus, we first optimized insulin therapy in this study. continuous subcutaneous insulin infusion (csii) or an insulin pump is a viable choice for patients with diabetes mellitus who require close - to - physiologic insulin treatment. with insulin pump therapy provided during hospitalization it is possible to standardize the sugar control profile in patients with type 2 diabetes mellitus in a short period of time, thereby allowing for the further evaluation of the clinical response to glp-1 analogues. to investigate the relationship between the snps of glp1r and the effectiveness of glp-1 analogue treatment in patients with type 2 diabetes mellitus, we performed exon resequencing of the glp1r gene in patients with poorly controlled type 2 diabetes mellitus who were treated with a glp-1 analogue in this study. thirty - six patients with type 2 diabetes were enrolled into this study from 2011 to 2013. the inclusion criteria were (a) age > 20 years ; (b) diabetes mellitus diagnosed > 2 years ; (c) a1c level of 8% to 12% ; and (d) receiving premixed insulin twice daily with a total insulin daily dose of > 0.6 u / kg / day. the exclusion criteria were (a) recent history of drug or alcohol abuse ; (b) sensitivity to analogous products ; (c) serious cardiovascular disorders ; (d) participation in another clinical investigation study ; (e) ongoing influenza, autoimmune disease, or other metabolic disorders ; and (f) pregnant or lactating women. this study was approved by the institutional review board of the chang gung memorial hospital and registered with clinicaltrials.gov (nct01473147 and nct02026024). written informed consent was obtained from all subjects. a finger - stick test was performed to examine premeal (ac) and 2-hour postmeal (pc) glucose levels after three meals in addition to bedtime and nocturnal glucose levels for a total of 8 measurements a day. the glucose level was normalized in the first 3 days, and the patients received a combined therapy with exenatide 5 g twice daily for the remaining 3 days. the responsiveness to the glp-1 analogue was evaluated by the standard deviation of plasma glucose (sdpg), mean amplitude of glycemic excursions (mage), and mean glucose compared to the baseline. the 75 g ogtt was performed at baseline and at the end of the study to assess the insulin sensitivity index and homeostasis model assessment - insulin resistance [16, 17 ]. we stopped pharmacological treatment for at least 12 hours (premixed insulin after the evening dose) before performing the 75 g ogtt at baseline. to eliminate the effect of ultra - short acting insulin, aspart, in the use of csii, the 75 g ogtt was performed 2 hours after csii had been stopped (end of the study). the insulin regimen was switched from premixed insulin to csii according to a previously described hospital - based protocol [18, 19 ]. in brief, the prepump total daily dose of insulin was used as the starting dose of csii. half of the dose was infused continuously as the basal dose, and the other half was divided for each meal as the bolus dose. the basal insulin dose was then titrated as precisely as 0.1 u per hour to maintain the blood glucose targets in the range of 90140 mg / dl from bedtime throughout the nocturnal period, and at 70140 mg / dl before each meal. the bolus insulin dose was titrated up or down carefully by 1 u for a fixed amount of carbohydrates to maintain the postprandial glucose range between 70 and 180 mg / dl. we found that using 50% of the total daily dose as the basal insulin dose was usually an overestimation among our patients. therefore, we focused on reducing the basal infusion rate to prevent hypoglycemia and increased the bolus dosage for a fixed amount of carbohydrates during meals. all of the patients received an adequate adjustment based on this 3-day titration protocol. at the end of the study, the switch in treatment of twice - daily or multiple - daily injections in csii was equal to the divided total daily insulin dose or the total daily basal dose and respective premeal bolus dose according to a recommended protocol. the medical team included diabetologists, educators, and dieticians, who were all on call to manage any unexpected occurrences during hospitalization. genomic dna was extracted from the leukocytes of peripheral blood from the 36 patients according to the manufacturer 's recommendations (genomic dna extraction kit, rbc bioscience, taiwan). pcr was performed to amplify the promoter, all 13 exons and intron - exon boundaries of the glp1r gene (genbank accession number al035690) using specific primer sets and pcr conditions as described in supplementary table 1, in supplementary material available online at http://dx.doi.org/10.1155/2015/176949. all of pcr products were confirmed by electrophoresis on 1.5% agarose gels and directly sequenced using an automated sequencer abi 377 (applied biosystems, foster city, ca) to determine the dna sequences. differences between groups with regard to continuous variables were tested using student 's t - test. differences in proportions were assessed using a chi - square test or fisher 's exact test, as appropriate. multiple linear regression analyses using additive genetic models were performed to adjust baseline variables and conducted with spss 20 (ibm spss inc., the level of statistical significance was set at a p value of 0.05 or less. all statistical analyses were conducted using the matlab program, version r2013a (mathworks inc., the mean age, gender, mean bmi, duration of diabetes mellitus, and a1c levels are shown in table 1. the mean glucose, sdpg, and mage were significantly decreased after glp-1 analogue treatment (180.2 5.4 versus 147.9 3.8 mg / dl, p 0.2) in the 36 patients (supplementary figure 1). among these 19 snps, we chose the reported missense snp (rs3765467) and the only one dinucleotide repeat polymorphism (rs5875654) for comparison. the rs5875654 was a short tandem repeat (str) with 2-base - pair deletion of 8ga/7ga. the genotype of the 8ga/7ga variant was decomposed with the mixed sequence reader program and further confirmed by pcr cloning following sequencing analysis (figure 1). the rs5875654 and rs761386 snps showed complete linkage disequilibrium (ld, with r = 1). the allele frequencies of these 3 missense and silent variants were depicted in table 2. by analysis of the quantitative trait loci for other clinical variables, the two snps rs3765467 and rs761386 were found to be significantly associated with changes in the standard deviation of plasma glucose (sdpgbaseline sdpgtreatment with glp-1 analogue) in the enrolled patients (p = 0.041 and 0.019, resp.) the clinical characteristics of the subjects according to the recessive genotype subgroups are summarized in supplementary table 2 and all clinical variables were not significant between subgroups except for the sex distribution of rs3765467. however, the results remained the same and there was no change after adjusting for the sex variable. in particular, the t allele of rs3765467 and rs761386 was found to be associated with an opposite sdpg change (lower in rs3765467 and higher in rs761386) after glp-1 analogue treatment. the association of the sdpg change with rs3765467 and rs761386 by multiple linear regression analyses using the additive genetic models with adjustment of age, sex, bmi, and glycemic states at baseline also demonstrated the same trend (table 3). the mean glucose and mean amplitude of glycemic excursions at baseline, treatment, and the change between the two time - points showed no significant differences between rs3765467 and rs761386 (supplementary figures 2 and 3). the association data of the remaining 16 common variants with each trait is shown in supplementary table 3. the effects of glp1r genotypes on glucose, insulin, and c - peptide concentrations during the 75 g ogtt after glp-1 analogue treatment are shown in figure 3. the (ct / tt) recessive model of rs761386 showed significantly higher glucose levels at 120 minutes of the 75 g ogtt (p = 0.032) ; however the insulin and c - peptide levels were not significantly different between the two genotypes throughout the ogtt for both rs3765467 and rs761386. the associations of the glucose, c - peptide, and insulin changes with rs3765467 and rs761386 by multiple linear regression analyses using the additive genetic models with and without adjustment of age, sex, bmi, and glycemic states at baseline showed no significance (table 4). to the best of our knowledge, this is the first study to reveal the relationship between genetic variations of glp1r and the response to a glp-1 analogue in patients with type 2 diabetes mellitus, although the number of enrolled cases in this study is limited. based on our understanding of the characteristics of the glp-1 analogue, exenatide, added to csii during hospitalization, we could evaluate the real response to the glp-1 analogue in patients with poorly controlled type 2 diabetes mellitus by excluding variable residual beta cell function. the combination of exenatide and insulin has previously been evaluated in clinical trials [22, 23 ]. in a placebo - controlled trial, another randomized trial examined the replacement of insulin with exenatide in patients with type 2 diabetes and found that glycemic control deteriorated in 38% (11 of 29) of the patients who received exenatide compared with 19% (3 of 16) of the patients who continued insulin. the patients who lost glycemic control were more likely to have a longer duration of disease, lower c - peptide concentrations (suggesting less endogenous beta cell function), and larger insulin requirements at baseline. however, the combined use of basal - bolus or csii and exenatide could maintain minimal beta cell function and potentiate the clinical effect of exenatide. the 3-day conditioning period with csii treatment is short compared to the time spent in the general outpatient therapy. but our protocol followed the suggestion of pump therapy in the previous report. in this hospital based practice, we could simply focus on reducing the basal infusion rate to prevent hypoglycemia and increasing bolus insulin dosage for the fixed carbohydrate amount in meals. for the limitation of the total of one week of hospitalization, we could make use of the 3-day conditioning period with csii treatment to efficiently detect the effect of glp-1 analogue in these poorly controlled patients with type 2 dm. three snps have previously been associated with a response to infused glp-1 or glp-1 concentrations in response to an oral challenge (table 5) [12, 14 ]. a previously published report showed that heterozygotes of the minor allele of rs3765467 were associated with an increase in glp-1 response in healthy volunteers. however, there were no significant differences in clinical response except for a lower sdpg change in the current study. ethnic diversity and the characteristics of the participants may be reasons for this discrepancy. as shown in figures 2 and 3, a significant difference in sdpg change after glp-1 analogue treatment was found between subgroups of genotype rs3765467 despite there being no significant differences in glucose, insulin, and c - peptide level on ogtt. the effects of glp-1 analogue involve both beta cell and non - beta cell responses. based on the results of this study, the variant of rs3765467 had an impact on sdpg change after glp-1 analogue treatment favorably through the effect of non - beta cell related function, for example, glucagon suppression. the finding that there were no differences in glucose, insulin, and c - peptide levels in ogtt just reflected the lesser impact of this variant on the beta cell secretion. the expression of a nonsynonymous snp (rs367543060), which results in the substitution of methionine for threonine at position 149 of glp1r in cell systems, has been documented to decrease binding affinity for glp-1 and intracellular signaling after hormone receptor binding [12, 25 ]. the thr149met mutation was detected only in the proband among subjects with type 2 diabetes (1/791) but not in controls in a study from japan. although the minor allele frequency data is not available at present, the variation of t149 m of glp1r was not detected in our enrolled patients. in the current study, the presence of the dinucleotide repeat polymorphism in the str (8ga/7ga) of the glp1r gene was nominally associated with altered glucose control with the use of a glp-1 analogue. the significant snps in this study were located within intronic noncoding regions, and therefore the mechanisms of their actions remain elusive. recent studies have reported that variants in tcf7l2 (rs7903146) and wfs1 (rs10010131), which have been shown to affect the response to exogenous glp-1, and variants in kcnq1 (rs151290, rs2237892, and rs2237895), which have been demonstrated to alter endogenous glp-1 secretion, are all identified in noncoding intron regions [69, 26 ]. given that none of the chosen snps were located in coding regions, these genetic variants in glp1r may affect gene expression but not the function of the gene product. the actions of glp-1 (primarily stimulation of insulin secretion and suppression of glucagon secretion) are mediated by binding to its cognate receptor. exenatide, a glp-1 receptor agonist, binds to the glp-1 receptor with greater affinity than its natural ligand due to a nine - amino - acid cooh - terminal sequence that is absent in native glp-1. the substitution of glycine for alanine at position eight of native glp-1 has been reported to decrease its affinity for the receptor, suggesting that both n- and cooh - terminal ends of glp-1 bind the receptor. the application of chimeric glp-1/gip peptides together with molecular modeling suggests that his of glp-1 interacts with asn of glp1r, and that thr of glp-1 has close contact with a binding pocket formed by ile, leu, and met of glp1r. the location of the str related to the unresponsiveness of the glp-1 analogue is around the coding region in exons 9 - 10 responsible for the binding sites. further studies assessing the function of gene regulation may help to clarify the relationship of this novel genetic variation and drug response. one of the limitations of this study is the lack of data on the impact of long - term a1c control for the genetic variants of glp1r. however, having well - controlled blood sugar management by csii during the hospitalization period could help to further clarify the different pharmacological effects of the glp-1 analogue in this type of patient. although the reported p values became insignificant after multiple testing adjustments, the small sample size due to clinical difficulties in keeping patients hospitalized might not allow for such a statistical correction. future large - scale studies aiming at elucidating the contribution of glp1r genetic variations to glp-1 analogue response will need to take into account the likelihood of the small effects of these variants on the quantitative traits to ensure that they are adequately powered to reproducibly determine such effects. while it is certainly possible that these variants had smaller effects on glp-1 analogue - induced responses in this study, the clinical application of screening for genotype 7ga/7ga in rs5875654 and t / t in rs761386 could reveal which patients would be unresponsive to the glp-1 analogue. it is important to develop approaches that help to effectively manage the use of expensive drugs in current modern incretin - based therapy of type 2 diabetes mellitus and to control unnecessary expenses. the variable response to a glp-1 analogue was not statistically correlated to the polymorphisms of the glp1r gene in patients with poorly controlled type 2 diabetes mellitus. | aim. the relationship between genetic polymorphisms of the glucagon - like peptide-1 (glp-1) receptor (glp1r) gene and unresponsiveness to glp-1 analogue treatment in patients with poorly controlled type 2 diabetes mellitus (dm) is unclear. methods. thirty - six patients with poorly controlled type 2 dm were enrolled and they received six days of continuous subcutaneous insulin infusion for this study. after the normalization of blood glucose in the first 3 days, the patients then received a combination therapy with injections of the glp-1 analogue, exenatide, for another 3 days. all 13 exons and intron - exon boundaries of the glp1r gene were amplified to investigate the association. results. the short tandem repeat at 8ga/7ga (rs5875654) had complete linkage disequilibrium (ld, with r2 = 1) with single nucleotide polymorphism (snp) rs761386. quantitative trait loci analysis of glp1r gene variation with clinical response of glp1 analogue showed the missense rs3765467 and rs761386 significantly associated with changes in the standard deviation of plasma glucose (sdpgbaseline sdpgtreatment with glp-1 analogue) (p = 0.041 and 0.019, resp.). the reported p values became insignificant after multiple testing adjustments. conclusion. the variable response to the glp-1 analogue was not statistically correlated with polymorphisms of the glp1r gene in patients with poorly controlled type 2 dm. |
in the previous issue of critical care we read with great interest a report of the first experimental study of recombinant human activated protein c (rhapc) in oleic acid - induced nonseptic acute lung injury (ali) in sheep. impairment of the protein c pathway plays a central role in the pathogenesis of sepsis. treatment with rhapc has been reported to increase survival from severe sepsis. the administration of rhapc may correct the dysregulated anticoagulant mechanism and prevent propagation of thrombin generation and the formation of microvascular thrombosis. it is likely that the beneficial effects of rhapc observed in experimental and clinical studies of severe sepsis result from a combination of mechanisms that modulate the interdependent processes of coagulation and inflammation. protein c levels also decrease markedly in ali, of both septic and nonseptic origin. low levels of protein c in ali are associated with poor clinical outcome. in the present study, the authors of the well known group of lars bjertnaes (troms, norway) showed that simultaneous administration of rhapc ameliorates oleic acid - induced (non - septic) lung injury. the rise in pulmonary artery pressure, the development of pulmonary edema and the derangement of arterial oxygenation subsequent to intravenous bolus infusion of oleic acid all improved significantly during coadministration of rhapc. we recently reviewed studies of rhapc treatment in sepsis - related ali and found the timing of drug administration to be critical in these experiments. when given prior to the injury in a porcine model or given simultaneously in pseudomonas aeruginosa - induced lung injury in rats, the oxygenation further deteriorated beneficial effects could only be shown when rhapc was given post injury in various ovine models [9 - 11 ]. we hypothesized that rhapc in the early stage of ali may disturb the complex coagulation balance at the alveolar level, and may impede an initially positive effect of coagulation activation, because in the early phase of ali the epithelial side as well as the endothelial side of the capillary barrier are involved with fibrin deposition, reflecting a shift in the alveolar / fibrinolysis balance. the beneficial effects of the simultaneous treatment in the present study, however, are in contrast to our hypothesis and lead away from the coagulation cascade to the activity of neutrophils in ali. during inflammation, activated neutrophils accumulate in the lungs and other organs, thus contributing to organ system dysfunction. neutrophils express receptors for rhapc and neutrophil chemotaxis is inhibited by exposure to rhapc, explaining its beneficial effects. our group uses an ovine model of smoke inhalation and sepsis to induce ali, since smoke inhalation and sepsis are major contributors to mortality in burn patients. the lungs of sheep have a special feature, a single bronchial artery, and a single lymphatic draining of the lung. a 10-fold increase in bronchial blood flow the venous outflow of the bronchial circulation drains into the pulmonary microcirculation at the precapillary level. considering the fact that initial damage to the airway appeared to drive the pathophysiology of the parenchyma, investigators hypothesized that the bronchial blood might deliver cytotoxic materials or cells into the pulmonary microcirculation. to test this hypothesis, several investigators have tied off the bronchial artery of sheep and then exposed the animals to smoke. in these studies what could be the linkage between the airway, the bronchial venous drainage and parenchymal injury to the lung ? many of the neutrophils, however, have been activated in the bronchial areas their f - actin is activated and the cells are stiff and can not deform. these stiff cells are carried to the pulmonary microvasculature, where they are impaled by the narrow pulmonary capillaries. the final proof of this hypothesis was to deplete the animals of their neutrophils and determine how this affected the response to inhalation injury. in these studies of sheep depleted of their leukocytes, when rhapc binds to these receptors, before the cells are drained via the bronchial venous system into the pulmonary microvasculature, a reduction of ali may be anticipated. taking these facts together, the results of waerhaug and colleagues appear in a different light ; of course oleic acid - induced ali is different from smoke inhalation, but, given the direct injury to the lung and the fact that sheep have the single bronchial artery, the beneficial effects of a simultaneous treatment with rhapc might be more advantageous than in other models especially since only sheep subjected to peritoneal sepsis or endotoxin infusion presented with reduced extravascular lung water. future studies are warranted to determine the effects of rhapc in an ovine model when the bronchial artery is tied off to clear its mechanism in ali. | impairment of the protein c pathway plays a central role in the pathogenesis of sepsis. treatment with recombinant human activated protein c (rhapc) has been reported to increase survival from severe sepsis. protein c levels also decrease markedly in acute lung injury, of both septic and nonseptic origin. low levels of protein c in acute lung injury are associated with poor clinical outcome. the present article discusses the beneficial effects of rhapc in oleic acid - induced lung injury as well as the controversies between different animal models and the timing of drug administration. the unique bronchial circulation in ovine models seems to be responsible for the beneficial effects of rhapc when given simultaneously to the injury. |
minimally invasive dentistry is an approach that seeks to maintain the patient 's oral health with preventive measures and to treat possible disturbances of health as early as possible and with as little intervention as possible. this requires that caries is detected at an early stage of development and that its status can be monitored frequently. however, the current methods for diagnosing caries are able to detect caries only at a relatively advanced stage. accordingly, methods for early detection of caries have been researched for the past twenty years. many of these methods still require extensive research before they can be used in clinical practice. optical caries diagnosis methods are based on the fact that caries cause changes in the tooth 's optical properties at an early stage of development. this was a pilot study to investigate whether diffuse reflectance visible / near - infrared spectroscopy (vis / nir - s) can be used to detect dental caries lesions. reflectance spectroscopy measures the intensity of light at several different wavelengths, that is, its spectra, after the light has reflected from the studied object. diffuse reflectance refers to light that has been reflected from the inside of the object, rather than from its surface. in this study the intensity was measured at wavelengths in the visible range and at wavelengths in the near - infrared range, covering wavelengths in the range 4201000 nanometers. within this range, the intensity was measured at 2305 different wavelengths, so that the difference between consecutive wavelengths was approximately 0.25 nm. this study was limited to studying natural caries lesions that could be diagnosed with fiber - optic illumination, on smooth surfaces of extracted tooth. a theory of caries diagnosis using near - infrared spectroscopy emerges from the previous studies of detecting caries lesions with near - infrared light [27 ]. according to this theory, the development of a caries lesion increases the porosity of the affected tissue, which in turn leads to an increased scattering of light in the lesion. wavelengths in the near - infrared range are considered better than the wavelengths in the visible range, because the former can penetrate deeper into the tissue and are less affected by stains on the tooth. the purpose of this study was to provide additional evidence in support of this theory. the dental services of the city of vaasa provided extracted human teeth for the study. the teeth were stored immersed in denatured alcohol in order to disinfect them and to keep them hydrated. before inspection and measurements, the teeth were inspected by the first author with fiber - optic illumination, after the technique was introduced to him by the second author, in order to detect healthy areas of enamel and areas of enamel that contained caries lesions. in total 21 teeth were used in the study. a total of 109 points of enamel were measured on the teeth, consisting of 69 points which were thought to represent healthy enamel and 40 points which were thought to represent caries lesions. each measurement point produced a spectra, a sample for the rest of the analysis. in pattern recognition terminology the diagnosis of a given sample, as either healthy or carious, is called the label of the sample. the analysis of the samples tries to create a method which estimates the diagnosis, the label, of the sample based only on the measurements. an optical fiber, placed in contact with the sample, conveys light from a light source to the sample. another optical fiber is placed in contact with the sample at a small distance from the first fiber. some fraction of the light which scatters inside the sample will eventually exit the sample so that it enters the second optical fiber. it then gets conveyed to a spectrometer, which measures the spectra of the reflected light. photonics describes the key properties with the absorption coefficient and the scattering coefficient of the material. the measured spectra is analyzed in order to deduce information about the sample material. the measurements were made with a spectrometer hr4000 (ocean optics inc., dunedin, fl, usa) and with a general purpose transmission dip probe model t300-rt - vis / nir (ocean optics inc., the probe contains two optical fibers, both with a diameter of 300 m, housed in a stainless steel assembly with a diameter of 3.175 mm. one of the fibers is connected to a light source and brings light to the sample. the light source used in this study was a tungsten halogen lamp hl-2000 (ocean optics inc., dunedin, fl, usa). thus, the study had to be carried out with a probe that was readily available in our laboratory. however, it was considered to be suitable for this study when the ferrule enclosing the inner assembly was removed, exposing the stainless steel assembly that houses the fiber optics. the period of time for which the spectrometer collects light when it is making one measurement is called the integration time. in this study integration time a longer integration time produces better measurement results than a short one, because the intensity of the collected light increases at all wavelengths, yielding a better signal - to - noise ratio (snr). therefore, the integration time is typically set as long as possible. however, if the intensity of the collected light at a given wavelength exceeds the measurement range of the spectrometer, the spectrometer saturates. in that case the intensity can not be measured, and we know only that it exceeded the maximum measurable value. in order to make the measurement results comparable to results that would have been obtained with the same spectroscope using another light source or another integration time this is done by measuring the smallest and the greatest intensity value that a measurement can produce with the given integration time for each wavelength and by scaling all other measurements to that range. the lowest possible intensity values are obtained by measuring the so - called dark current, which is caused by thermal noise. measuring a white reference sample produces the greatest possible intensity values. in this study, the integration time was set so that the white reference sample (a white reference tile ws-2, avantes inc., a spectrometer must also be calibrated for its detector, so that its measurement results are comparable to those obtained by other spectroscopes. this is done by measuring the spectra of a sample whose spectra is known. in this study the used spectroscope was calibrated for its detector by the manufacturer as part of its construction. a spectroscopic measurement result contains many small random errors, which are collectively called (thermal) noise. when the dark current is subtracted from the spectra, the mean value of the effect caused by the noise is shifted to zero, and thus the effect of noise is observed as errors which have a normal distribution with a zero mean. in order to minimize the effect of noise in the samples, each point was measured one hundred times consecutively, and the resulting spectra were averaged. this meant that the probe needed to stay as motionless as possible for two seconds. however, a far shorter time period would have probably been sufficient. as a further measure against noise, the samples were smoothed by using the savitzky - golay method with a window length of 61 and sixth degree polynomials. this method selects the coefficients of a sixth degree polynomial so that the polynomial is the best possible approximation for the measurement result, that is, the spectra, for the 30 wavelengths before a given wavelength and for the 30 wavelengths after it. the value of the polynomial at the given wavelength replaces the measured intensity at that wavelength. this removes, or smoothens, fast and small changes in the spectra, which are mainly caused by noise. a simple computational algorithm, based on exhaustive search, was then used to find a set of rules that could be used for detecting caries lesions. at this point, the goal was to classify the samples into two classes : points on healthy enamel (healthy samples) and points on caries lesions (carious samples). for this, a set of rules was searched for, so that every rule had the following format : if the sample 's normalized intensity at a given wavelength is greater than (or smaller than) a given threshold i, the sample is classified as carious ; otherwise, the sample is classified as healthy. thus, each rule had three parameters : the wavelength, the intensity threshold i, and whether or not the threshold is an upper or lower limit for the intensity. if, and only if, one or more of the rules classified the sample as carious, the sample was classified as carious. if none of the rules considered the sample as carious, it was classified as healthy. it was hoped that the algorithm would select a set of rules which resembles the results found in earlier studies on this subject. a number of wavelengths were selected from the range of available wavelengths (4201000 nm) as options for parameter in the search, so that the intervals between the wavelengths were equal and the first and the last wavelength were always selected as options. the search was done with different numbers of wavelengths. for each of the selected wavelengths, the algorithm sorted the samples ' intensities at that wavelength and considered the midpoint between each two consecutive intensities as a possible threshold i in a rule. the algorithm calculated the classification accuracy on the training set for each of the pairs and i described above, using the threshold i first as an upper limit for classifying the sample as carious and then using it as a lower limit, and chose the values of and i and the type of threshold, which gave the best accuracy (see pseudo - code at pseudocode 4). after a rule had been selected this way, the algorithm selected another rule with the same method, so that the new rule gave the best possible accuracy when used together with the previously selected rule(s). this was continued until the maximum allowed number of rules, here five rules, was reached, or until the classifier was unable to find a new rule which would improve the classification accuracy. this algorithm, like every machine learning method, requires a set of samples which is used for searching for the rules and a separate set of samples which is used for evaluating the accuracy that is achieved with the resulting rules. the former set of samples is called the training set and the latter set is called the validation set. this may cause problems for the machine learning method when the samples are divided into a training set and a validation set, because some types of samples may become overrepresented in the training set, misleading the learning method as it tries to recognize what discerns the two classes from each other. in this study, this risk was alleviated by using a 4-fold cross - validation. in this method, the samples are divided into four groups, and one of them is used as the validation set while the other three groups form the training set. each group in turn is used as the validation set, and the results from these four folders are averaged. this way each sample is a part of the training set in three folders and a part of the validation set in one folder. it is unlikely that the same types of samples would be overrepresented in all four training sets, unless the entire set of available samples has this problem. a single training set which has this problem would stand out from the others, and the skewed learning results from it would be corrected by the results from the other training sets. while the small set of samples may still give a skewed representation of the kinds of samples which are being studied, the cross - validation seeks to minimize this problem. in this study the averaging was done so, that a median rule set was constructed from the rules which the algorithm selected for the folders, and all of the samples were then classified with the median rule set. median of the numbers of rules in the folders determined the number of rules in the median rule set. some manual deliberation was used when constructing the rules of the set. for each rule in the final set, a temporary rule set was composed by selecting one rule from each folder 's rule set, so that the rules in the temporary set resembled each other, if that was possible given the available rules. the median of the wavelengths used in the rules in the temporary rule set determined the wavelength for the rule in the median rule set. the intensity threshold and the type of threshold were selected similarly for the rule in the median rule set. each sample was diagnosed as either healthy or carious by the first author, and the selected rules estimated each sample to be either healthy or carious. based on these two properties, samples which were diagnosed as healthy and which were estimated to be healthy by the rules are called true negatives (tns). similarly, carious samples which were correctly estimated are called true positives (tps). a healthy sample which was estimated to be carious is called false positive (fp) and a carious sample which was estimated to be healthy is called a false negative (fn). these four values can be used to calculate the following five values which describe the accuracy of the selected rules. positive predictive value (ppv) is the probability that the classifier, that is, the set of rules, is correct when it estimates a sample to be carious. negative predictive value (npv) is the probability that a healthy estimate is correct. accuracy is the fraction of the samples which were correctly estimated, that is, where the rules gave the correct answer. positive predictive value (ppv) is the probability that the classifier, that is, the set of rules, is correct when it estimates a sample to be carious. negative predictive value (npv) is the probability that a healthy estimate is correct. accuracy is the fraction of the samples which were correctly estimated, that is, where the rules gave the correct answer. after the classification rules had been selected and the samples had been classified according to them, there were fifteen samples which the author had diagnosed as carious but which were classified as healthy (false negatives). the spectra of these samples were virtually indistinguishable from the spectra of the healthy samples (see figure 3(a)), at least for the analysis methods used in this study. thus, a hypothesis was made that these samples, the false negative cases, had been misdiagnosed by the author and subsequently mislabeled. the rules that were selected by the algorithm suggested that a short wavelength, namely, 420 nm, was relatively useful in the diagnosis of caries. therefore, another hypothesis was made, according to which a number of samples had been diagnosed by the author as carious while in fact the measured points were only stained and were thus false positive cases of the diagnosis, even if they had been classified correctly by the classifier. notation i() refers to the normalized intensity of the spectra at wavelength. in other words, the sample was thought to represent a stain if it had a small scattering coefficient at both a long wavelength (815 nm, which is in the near - infrared range) and a short wavelength (420 nm). the samples, or the spectra of the measured points, are presented in figure 2. the number of wavelengths which were selected as options for the rule 's parameter, that is, parameter wavelengthoptioncount, had only a small effect on the accuracy of the resulting median rule set. when only the shortest wavelength (420 nm) and the longest wavelength (1000 nm) were available as options, the median rule set had an accuracy of 82%. with three wavelengths to choose from, when the number of options was between four and six, the accuracy was 85%. with greater numbers of wavelengths available, the accuracy was 84%. this suggested that the rules depicted a phenomenon which was consistently present in all four folders. when the number of options for the rules ' wavelengths was 15, the median rule set indicated that a sample is carious if, and only if, i(420) a confusion matrix of the classification accuracy that is achieved with these rules is presented in table 1, showing that these rules reached an accuracy of 84%. as can be seen in figure 3(a) and in table 1, there were fifteen carious samples which were classified as healthy (false negatives), and whose spectra was virtually indistinguishable from the spectra of the healthy samples. as explained in section 2.4, this leads to a hypothesis that these samples had been misdiagnosed and subsequently mislabeled, and that they therefore represented healthy samples and were in fact classified correctly. according to the theory on optical caries diagnosis, an elevated intensity in the near - infrared range is the best indication of a dental caries lesion. however, the rules selected by the search algorithm indicated that a short wavelength, namely, 420 nm, was relatively useful in the diagnosis of caries. as explained in section 2.4, another hypothesis was thus made, according to which a number of samples had been diagnosed as carious while in fact they were only stained. all samples that were identified as stained had been diagnosed and classified as carious, and thus appeared to be true positive cases. these suspected misdiagnoses had not lowered the apparent accuracy of the classification, but they may have caused the rule set to erroneously consider stains as caries lesions. when the search algorithm was run again, giving 15 options for the parameter, after first relabeling the fifteen false negative cases as healthy samples (first hypothesis) and then relabeling the eight suspected stains as healthy samples (second hypothesis), the algorithm selected only one rule in every cross - validation folder. all rules set an upper limit for the normalized intensity at a wavelength in the near - infrared range. the median of those rules was i(791) 0.3255, which is consistent with the theory. this study suffers from a small number of samples. although the study used 109 measurements, they were taken from only 21 individual teeth this fact is significant, because it is probable that samples taken from a single tooth resemble each other more than samples taken from different teeth or from different patients. fifteen of those measurements were considered to be misdiagnosed by the first hypothesis, and further eight measurements were considered to be misdiagnosed by the second hypothesis. therefore, further study is needed to increase the reliability of the accuracy estimate of this method. the measurement results together with the theory on the topic suggest that many of the measurements which were supposedly made from a caries lesion are in fact made from healthy enamel, which was in some cases stained. when we make these suggested corrections to the labeling of the samples, the samples seem to fit well to the theory and the samples can easily be accurately classified. these kinds of diagnostic mistakes, or false positive diagnoses, are a credible explanation, because the diagnoses were made by a novice on the subject. however, such corrections also pose a risk that the measurement results are relabeled to make them fit the theory, which would inflate the accuracy of the method. the composition of the dental tissues varies from tooth to tooth and between different sites of a given tooth. as can be seen in figure 2, the spectra of the different healthy samples vary quite a bit, especially at the visible wavelengths. this suggests that the threshold intensity or intensities for diagnosing a suspected lesion as carious might also vary similarly. in order to compensate for the inter - tooth and intra - tooth variance, we might consider measuring the average spectra for a given tooth by measuring several points on the tooth surface, that is, by scanning the surface and by evaluating how much the spectra of the suspected lesion differ from the tooth 's average. unfortunately, this approach could potentially make this method less effective for its original purpose. the method is being developed for the detection of caries lesions at an early stage of development. thus, the dentist does not necessarily notice all of the lesions which are detected by the device. if the inspected tooth surface contains several developing caries lesions, the average spectra of the surface could be something in between the healthy enamel and the carious enamel, making the lesions appear too similar to the average surface to be diagnosed as carious. the scanning method would also make it rather awkward to inspect several teeth per patient. quantitative light - induced fluorescence (qlf) and laser - induced fluorescence (lf) are two optical methods for the detection of caries lesions. they are based on fluorescence, or the phenomenon that when the tooth sample is illuminated with a light source, some of the light is absorbed in the sample, after which the sample emits light at a longer wavelength. for both methods study the sample was considered carious if the measured intensity was greater than a fixed threshold, i(791) 0.3255. the proposed explanation is that the increased scattering due to caries causes more light to be reflected to the measuring fiber optic. > 520 nm because increased scattering due to caries interferes with the detection of the fluorescence, and lf expects to find increased intensity at the near - infrared range caused by fluorescence from organic molecules in the sample. since the samples in this study were stored in denatured alcohol, they were probably relatively free of organic molecules. further study is required to determine whether the fluorescence from organic molecules, that is, the phenomenon measured by lf, interferes with the detection method outlined in this study, especially for in vivo measurements. if it does interfere, it probably makes the method more eager to label a sample as carious, thus increasing its sensitivity and reducing its specificity. this effect may be modified, at least in part, by selecting a new set of rules based on results from in vivo measurements. incidentally, in contrast, authors of this study felt that the method outlined in this paper helped them to increase specificity. an ability to measure the amount of dental tissue lost to caries could be pursued by inducing caries in vitro to a tooth sample (see [6, 17, 18 ]) so that the amount of mineral dissolved from the tooth could be measured without destroying the sample, and by measuring the spectra of the sample at varying degrees of mineral loss. one possible method for this would be to cycle the tooth sample in de- and remineralization solutions and to measure the amount of mineral dissolved to the solutions with a mass spectrometer. finding a method to calculate the amount of the mineral loss from the spectra would be a regression problem. it seems that spectroscopic measurements can help to reduce false positives at in vitro setting, including those caused by stains. however, the work reported in this paper was a pilot study, and further research is required to evaluate the strength of the evidence for the method 's performance at in vitro setting and to extend the measurements to in vivo setting. | background. a caries lesion causes changes in the optical properties of the affected tissue. currently a caries lesion can be detected only at a relatively late stage of development. caries diagnosis also suffers from high interobserver variance. methods. this is a pilot study to test the suitability of an optical diffuse reflectance spectroscopy for caries diagnosis. reflectance visible / near - infrared spectroscopy (vis / nirs) was used to measure caries lesions and healthy enamel on extracted human teeth. the results were analysed with a computational algorithm in order to find a rule - based classification method to detect caries lesions. results. the classification indicated that the measured points of enamel could be assigned to one of three classes : healthy enamel, a caries lesion, and stained healthy enamel. the features that enabled this were consistent with theory. conclusions. it seems that spectroscopic measurements can help to reduce false positives at in vitro setting. however, further research is required to evaluate the strength of the evidence for the method 's performance. |
parkinson 's disease (pd) is a progressive neurodegenerative disorder affecting 1 - 2% of the elderly population. in addition to the well - known motor problems of pd patients, that are related to nigrostriatal dopamine deficits, also nonmotor symptoms are common. these symptoms strongly affect quality of life of pd patients as they include autonomic dysfunction, sleep problems, cognitive and neuropsychiatric changes [25 ], all changes unrelated to degeneration of the substantia nigra (sn). apart from dopaminergic cell loss, the deposition of -synuclein is a prominent neuropathological hallmark of pd. according to the staging concept described by braak this coincides with the occurrence of nonmotor symptoms and can be observed already in early stages of pd, that is, in incidental lewy body disease (ilbd). moreover, -synuclein can activate microglial cells, and neuroinflammatory responses are indeed important pathological features of pd [810 ]. accumulation of -synuclein has been reported in the hippocampus (hc), which may contribute to the cognitive and depressive changes that represent prominent nonmotor symptoms in pd [11, 12 ] (figure 1). of interest, the hc is also one of the few brain regions where stem cells reside. in the hippocampal subgranular zone (sgz), stem cells undergo proliferation before they migrate through the granular cell layer (gcl), where they eventually become newborn, functional neurons that contribute to network function. in addition to this unique process of adult neurogenesis, which is largely confined to the dg, stem cells in the hc can proliferate and respond to neurodegenerative conditions. for instance, overexpression of -synuclein in pd models induces aberrant differentiation of neural progenitors and alters cellular plasticity in the hippocampus [1315 ]. also striatal deafferentiation, or the loss of dopaminergic neurons, affects both neurogenesis and proliferation in the hc. in addition, several parkinson - related pathogens induce degeneration of human neural stem cells (nscs) or reduce neurogenesis. stimulation of cellular plasticity on the other hand, for example through exercise, antidepressant treatment or high frequency stimulation, reverses impairments in neurogenesis in pd models and may even benefit pd patients [21, 22 ]. the discovery that the human brain contains stem cells has instigated extensive research into their proliferative responses during neurodegeneration and into their potential for brain repair. in related animal models for alzheimer 's disease (ad), changes in cellular plasticity and proliferation appear to depend on the extent of pathology and the severity of the disorder. regarding pd, stem cells and related cellular plasticity markers are also altered in relevant animal models [2426 ], but only few studies exist on proliferative changes in human pd brain, most of which have focused on the sn [27, 28 ] and subventricular zone (svz) [29, 30 ]. in the human sn and svz, discrepant results have been obtained between different studies, and this topic remains subject of debate [26, 29, 3134 ]. thus far, little attention has been paid to cellular proliferative changes in the human hc, a brain region relevant for nonmotor symptoms in pd, like cognitive and depressive changes. moreover, besides proliferation of nscs, glial cells within the cns may also proliferate in response to neuropathological changes. indeed, in the ad hippocampus or in experimental multiple sclerosis, for example, proliferation of cns resident microglia has been observed [35, 36 ]. here, we first studied proliferative changes in prodromal and established cases of pd and, given the differential -synuclein deposition, we include both the ca (nonneurogenic) and the dg (neurogenic) subregions. as activated microglial cells are present in the hc in pd and implicated in pd pathogenesis [9, 37 ], we also questioned whether microglial cells proliferate in these conditions. we selected hippocampal tissue of well - established and neuropathologically confirmed pd patients (braak pd stages 46), matched control subjects (braak pd stage 0), and incidental lewy body disease (ilbd) cases (braak pd stages 13) (figure 1). as these latter cases lacked clinical symptoms of pd during their lives and did not receive dopaminergic medication, but displayed a neuropathological braak -synuclein deposition at autopsy, they can be considered a presymptomatic and prodromal state of pd. to assess cell proliferation, we used the well validated marker minichromosome maintenance protein 2 (mcm2) [38, 39 ] and colabeled it with the microglial marker iba1 to investigate to what extent cell proliferation in the hc is accounted for by microglia. human postmortem hippocampal tissue was obtained from the netherlands brain bank (nbb, amsterdam, the netherlands). in compliance with all local ethical and legal guidelines, informed consent for brain autopsy and the use of brain tissue and clinical information for scientific research fourteen clinically diagnosed and neuropathologically verified pd patients (braak pd stages 46) were selected as well as six clinically healthy controls without neurological or psychiatric disease, that displayed some pd -synuclein pathology at autopsy (braak pd stages 13) and were classified as ilbd cases. for the control group, nine healthy subjects without neurological or psychiatric disease and without any -synuclein pathology (braak pd stage 0) were included. the three groups were matched for gender and age ; age of the control subjects ranged from 62 to 92 years, in the ilbd cases from 56 to 91, and in the pd patients from 59 to 96. also braak neurofibrillary tangles (nft) and amyloid - beta (a) plaques scores were matched between control subjects, ilbd cases, and pd patients, ruling out any possible difference in proliferation due to differences in ad pathology. the clinicopathological data of the patients and the braak staging for pd and ad of all donors is summarized in table 1. braak scores for ad and pd neuropathology were provided by the nbb and had been obtained after careful neuropathological evaluation of disease - relevant brain areas by experienced neuropathologists. the density and distribution of lbs / lns, nft, and a plaques were determined using classic bodian staining and immunohistochemistry for -synuclein (clone km51, novacastra, bioconnect bv) and hyperphosphorylated tau (clone at8, pierce, rockford, il) and a (clone 6f/3d, dako, dakocytomation bv), respectively. at autopsy, brain regions were dissected and immersion - fixed in 4% formaldehyde for four weeks, after which they were embedded in paraffin. from the paraffin blocks that contained the hc, 10-micrometer (m) sections were cut on a microtome, mounted, and dried in a stove overnight at 37c before immunohistochemical analysis. sections were mounted on positively charged glass slides (menzel - glaser superfrost plus, braunschweig, germany). various markers are available to identify cell proliferation or specific phases of the cell cycle in human postmortem brain tissue [3942 ]. of these, the minichromosome maintenance protein 2 (mcm2) is involved in the control of dna replication and commonly used in cancer research as a reliable marker for detecting dividing and slowly cycling putative stem cells in situ [38, 43, 44 ]. mcm2 expression starts in early g1 and is maintained throughout the cell cycle, also in cells that proliferate without actually synthesizing dna, and is thus present in higher numbers than, for example, the short - lived proliferation marker ki-67 [38, 45, 46 ]. moreover, the majority of the cells that express mcm2 coexpress the immature neuronal marker doublecortin and mcm2 was therefore also used to study cellular plasticity in comparable tissues. various tests to validate and confirm specificity of mcm2 and related markers have been performed by us and others before [38, 46, 47 ], for example, on samples of young rat brain and human colon, that were processed and embedded in the exact same way as the human brain tissue used in the current study [39, 41 ]. sections were heated in a stove for one hour at 56c, before they were deparaffinized in xylene and rehydrated through a graded series of ethanol (100%, 96%, 90%, and 70%, resp.) and tbs. for subsequent antigen retrieval, sections were rinsed in 10 mm tris buffer (ph 9.0) containing 1 mm edta (tris - edta) and afterwards placed in preheated tris - edta buffer in a steamer at 9099c for 30 minutes. after pretreatment, the sections were allowed to regain room temperature (rt), rinsed in tris - buffered saline (tbs, ph 7.6), and incubated for 20 min in tbs containing 0.3% h2o2 and 0.1% sodium azide to block endogenous peroxidase activity. nonspecific binding was blocked with 5% nonfat dried milk in tbs containing 0.5% triton (tbs - t, ph 7.6 ; blocking solution) for 30 min at rt. subsequently, sections were incubated overnight at 4c with mouse anti - mcm2 (bm28, bd transduction lab 610700, mouse 1:600). sections were then washed in tbs and incubated for 2 hr at rt in biotinylated goat anti - mouse iggs (1:400 ; jackson immunoresearch laboratories inc., west grove, pa, usa) followed by hrp - labeled avidin - biotin complex (abc complex, 1:400 ; vector laboratories, burlingame, ca, usa) in tbs - t for 1 hr at rt. after dehydration in graded ethanol solutions, sections were cleared in xylene and coverslipped in entellan (merck). for double - immunofluorescent labeling of microglial cells and mcm2 expression, iba1 (wako chemicals, 019 - 19741, rabbit, 1:300) and mcm2 (1:1000) were used. sections were pretreated with tris - edta (ph 9.0) and primary antibodies were diluted in the blocking solution, as indicated above. after an overnight incubation at 4c, the sections were washed and subsequently incubated for 2 h at rt with donkey anti - rabbit alexa fluor 488 labeled donkey anti - rabbit iggs (iba1) and biotinylated goat anti - mouse iggs (mcm2) (1:400, jackson immunoresearch, west grove, pa, usa), followed by abc complex (1:800) for 1 h and biotinylated tyramide enhancement in tbs for 20 min. hereafter, sections were incubated with alexa fluor 594 labeled streptavidin (1:800, jackson immunoresearch, west grove, pa, usa). after washing, sections were coverslipped with vectashield and examined using a confocal microscope (leica tsc - sp2-aobs ; leica microsystems, wetzlar, germany). for standardization purposes, hippocampal sections were collected only around the anterior to midlevel of the hc of every subject and only when large dentate gyrus (dg) and cornu ammonis (ca) subregions were both present. furthermore, mcm2-positive cells were included in the subsequent analysis only when they displayed a clearly immature, mitotic, and/or migratory morphology, and were located in an isolated manner (figure 2). semiquantification was performed by assessing the numbers of mcm2-positive cells present in the five main hc grey matter regions, that is dg, ca4, ca3, ca2, and ca1, at a 10x magnification and then expressed per surface area (region of interest, roi, 1 mm) using cell olympus soft imaging solutions gmbh software (tokyo, japan). statistical analyses were performed using the spps package version 20.0 (statistical product and service solutions, chicago, il, usa). the mean and standard deviation of the number of mcm2-positive cells were calculated for each group and within each subject for all the different subregions of the hc. the data did not meet criteria for normal distribution ; thus statistical analyses were performed using nonparametric tests. statistical analysis was executed with the nonparametric kruskal - wallis test to examine main group effects between controls, ilbd, and pd patients. results were considered significant if they fell below an alpha of p 0.016, after bonferroni correction. within the same cases, statistical analyses for the different subregions of the hc were performed with the nonparametric related samples friedman 's analysis to examine main region effects, followed by paired wilcoxon tests as post hoc tests. results were considered significant if they fell below an alpha of p 0.02, family wise error- (fwe-) corrected. this critical value was established with sisa (http://www.quantitativeskills.com/sisa/calculations/bonhlp.htm), which uses the mean correlation between variables (r = 0.65) that are mutually correlated (i.e., number of mcm2-positive cells) for the alpha correction and allows one to perform a less stringent correction than the bonferroni method for multiple comparisons. in the pyramidal layer and dg of the hc of all three patient groups, generally low numbers of mcm2-positive cells were found that displayed morphology typical for proliferating cells, such as a doublet shape and small size (figure 2 and figures 5(b), 5(e), and 5(h)). except for a significant main effect in the number of mcm2-positive cells between the hippocampal subregions within the control group (figure 3(a) ; p = 0.034, related samples friedman 's analysis), no significant differences were found between the subregions within each of the 2 different patient groups (figures 3(b) and 3(c)). further analysis revealed a trend towards an increase in the dg compared to the ca3, ca4, and ca1 within the control group (figure 3(a) ; resp., p = 0.043, p = 0.043, and p = 0.08 ; nonparametric mann - whitney u test, significance reached at alpha of p 0.02, fwe - corrected ; ctr dg mean = 2.45 1.03 ; ctr ca3 mean = 0.31 0.21 ; ctr ca4 mean = 0.35 0.25 ; ctr ca1 mean = 0.93 0.56). taking all data together revealed a significant increase in the number of mcm2-positive cells in the total hippocampal grey matter (ca1-ca4, dg combined) in the ilbd cases compared to control subjects (figure 4(a) ; p = 0.004 ; nonparametric mann - whitney u test, significance reached at alpha p 0.016, bonferroni - corrected ; ctr mean = 5.21 2.23 ; ilbd mean = 45.24 25.29 ; pd mean = 26.51 9.25). when analyzing the subregions separately, a significant main group effect was found for ca3 and ca4 between control subjects, ilbd cases, and pd patients (resp., p = 0.006, p = 0.16 ; nonparametric independent samples kruskal - wallis analysis). further analysis revealed there was a significant increase in the number of mcm2-positive cells in the ca3 and ca4 of the ilbd cases compared to the ca3 and ca4 of control subjects (figures 4(d) and 4(e) ; resp., p = 0.001, p = 0.003 ; nonparametric mann - whitney u test, significance reached at alpha p 0.016, bonferroni - corrected ; ctr ca3 mean = 0.31 0.21 ; ctr ca4 mean = 0.35 0.25 ; ilbd ca3 mean = 13.05 8.77 ; ilbd ca4 mean = 4.95 1.67) and a trend towards an increase in the numbers of mcm2-positive cells in the other three hippocampal subregions of the ilbd cases compared to the control subjects (figures 4(b), 4(c), and 4(f) ; ca1 p = 0.097 ; ca2 p = 0.082 ; dg p = 0.191 ; ctr ca1 mean = 0.93 0.56 ; ctr ca2 mean = 1.17 0.62 ; ctr dg mean = 2.45 1.03 ; ilbd ca1 mean = 5.88 3.17 ; ilbd ca2 mean = 14.82 9.58 ; ilbd dg mean = 6.45 4.04). no significant differences were found between pd patients and control or ilbd cases in total hc or within any of the subregions (figure 4). to determine whether microglia are proliferating, double immunofluorescence and confocal microscopical analysis revealed that the majority of mcm2-positive cells colocalized with iba1-positive microglia (representative examples are shown in figure 5). of each patient group, 3 cases were double stained for iba1 and mcm2 and the percentage coexpression was determined. in the control subjects, mcm2-positive cells were rare in the ca regions but always colocalized with iba1 (100%). in ilbd cases, the highest number of mcm2-positive cells was present in the ca subregions. an average of 14 positive mcm2 cells were counted, of which an average of 13 were iba1 positive, yielding 93% coexpression. in pd patients, an average of 6 positive mcm2 cells were counted, of which on average 5 were iba1 positive, that is, 83%. in the dg, overall less mcm2-positive cells were counted ; however, the percentages of colocalization with iba1 were similar to ca regions. in general, quantification revealed > 90% of the mcm2-positive cells in the hc to be microglia in control subjects, ilbd cases, and pd patients (representative examples are shown in figures 5 and 6). we studied proliferating cells in the hc of control subjects, ilbd cases, and established pd patients. using mcm2 as marker, no difference was observed in the amount of proliferating cells between control subjects and pd patients. however, in the presymptomatic ilbd cases, a clear increase in mcm2-positive cells was found. interestingly, over 90% of the mcm2-positive cells were colabeled with iba1, indicating that microglial cells are the main proliferating cells in the hc of ilbd cases and pd patients. in control subjects, the low number of mcm2-positive proliferating cells observed in the hc is consistent with the low rates of hippocampal proliferation and neurogenesis found before in the aged rodent, primate, and human hc and in comparable pd brain tissue [30, 41, 4851 ]. within the control group, mcm2-positive cells were increased in the dg compared to other hippocampal regions (figure 3(a)), which was of interest as most proliferation was beforehand expected to occur in this subregion. interestingly, the differences between the dg and other subregions were no longer present in the ilbd and pd groups, with higher numbers of proliferating cells in all subregions (figures 3(b) and 3(c)), suggesting that the disease process has triggered additional proliferative responses also outside the dg, and in fact throughout the hc. when total counts in the combined hc were compared between the three cohorts, significant increases in proliferation were found in the ilbd cases, but no difference was present between the pd group relative to the control group (figure 4(a)). this was unexpected as, based on experimental studies, lowered dopamine levels were expected to reduce hippocampal proliferation. also the increase in ilbd cases was unexpected as no clinical symptoms were present in this cohort (yet) and although not quantified, their dopamine levels are assumed to be unaltered. however, there is also some dat - spect data that reflects a decrease of striatal dopamine levels and nigral degeneration already in the premotor stage of pd [5254 ]. whether these cases can be readily compared to our ilbd cases remains to be answered. subdividing the different hc subregions revealed that the significant increase in the entire hc in ilbd was mainly due to the ca3 and ca4 and to a lesser extent to the ca2 subregion (figures 4(c), 4(d), and 4(e)). since ilbd can be considered a presymptomatic state of pd, this result suggests that an early and disease - related induction of proliferation occurs in the hc. neurons that attempt to reenter the cell cycle, there are no indications that proliferation in the ca subregions will actually give rise to new neurons. also the current morphology, consistent with a proliferative phenotype, and the localization of the mcm2 cells, that is, closely apposed to a pyramidal neuron and thus suggestive of a satellite cell (figure 2, arrowhead), hinted that proliferation in nonneurogenic subregions likely reflects that of a nonneuronal cell type, for example, microglia. to confirm this, we used immunofluorescent colabeling of mcm2 with iba1 and established that almost all proliferating cells in the pd hc represent microglia. the increase in ilbd cases relative to control subjects and pd patients suggests that proliferation of microglia occurs early in pd, prior to actual deposition of -synuclein. in most pd cases, neuronal populations in the hc show accumulation of -synuclein [56, 57 ] which may activate the brain 's immune system through microglia activation. it is still debatable whether neuronal -synuclein inclusions (lewy bodies / lewy neurites) cause microglial activation and/or neuronal death, or whether lbs / lns act as protective containers and that it is the extracellular -synuclein oligomers and fibrils that are toxic and activate microglia. on the other hand, neurons containing -synuclein inclusions could communicate with microglia and activate them by neuron to glia signaling. indeed, while different microglial phenotypes are present in the sn, hc, and ob in pd, their functional role and hence the implications of microglia proliferation for pd etiology remain elusive [37, 5961 ]. transgenic mice overexpressing wild - type -synuclein develop -synuclein inclusions shortly after birth but show unchanged cell proliferation in their svz and hc at later ages [14, 62, 63 ]. in related prion disease models, proliferation of microglial cells is considered important in their turnover [64, 65 ] and to a larger extent to account for the expansion of the resident microglia population during, for example, prion disease development. a related study on ad mouse models found changes in proliferation and microglia to coincide in time with increases in amyloid plaque load, suggesting that the accumulation of aberrant proteins like amyloid, and possibly also of -synuclein, may trigger microglial proliferation. while in vitro studies had already demonstrated that the aggregated form of -synuclein can trigger microglial activation [10, 68 ], the hc of ilbd cases is largely devoid of -synuclein depositions, and a role for soluble forms or -synuclein oligomers can thus not be excluded. -synuclein oligomers can, for example, activate microglia via toll - like receptor-2 (tlr2) and thereby stimulate proinflammatory cytokine production [69, 70 ]. in agreement, in a separate study, we found tlr2 expression to be upregulated in microglia in the hc of ilbd cases. in addition to increasing the cell population, an alternative, more speculative, interpretation of proliferation in microglia could be phagocytosis of -synuclein. the release of -synuclein and the subsequent uptake by neighboring neurons or glia suggest possibilities for cell - to - cell transfer and propagation that was recently proposed as conceptual model for proteinopathies [71, 72 ] and is consistent with the spatiotemporal progression of pd neuropathology over the brain. interestingly, neuron - to - glia transmission is accompanied by microglia activation [26, 74 ] and could thus underlie some of the proliferative changes observed in microglia in our current study. for instance, -synuclein secreted by neurons is released into the extracellular space and can be taken up by microglia and phagocytosed. several forms of -synuclein have been found to induce microglial activation [10, 75, 76 ]. similar to amyloid - beta, such secreted proteins can be sensed by microglia through toll - like receptors that could lead to the activation of inflammatory response genes and their proliferation [61, 69, 71, 7779 ]. another possibility is that proliferative changes reflect altered calcium signaling that was, for example, found to be dysregulated in microglia in close vicinity to amyloid plaques in ad brain. these options are still speculative, and ongoing phagocytosis of -synuclein inside microglia is technically difficult to visualize in postmortem human brain but may provide a possible explanation for the microglial proliferation we observed. our current hippocampal data are in contrast with a previous study on proliferation in the svz in pd and pd models, indicating that cell proliferation in the svz, and possibly also in the dg, may be under dopaminergic control [16, 29, 81, 82 ]. these authors used nestin and beta tubulin as markers and found significant reductions in proliferation in the hc of 3 pd patients and 5 pd patients with dementia, which they compared to 3 controls. although different markers were used, we did not find any indication for a reduction in proliferation in the hc our cohorts, together comprising 20 patients and 9 controls. another study on the svz failed to find differences in the proliferative capacity between controls and pd patients too. while followed by an interesting debate [32, 33 ], this also suggested that proliferating progenitor cells are at least not reduced in pd. the methodological limitations that exist for visualization of neuronal proliferation in human postmortem brain [8388 ] do not seem to hold explicitly for microglia proliferation. mcm2 can thus be used as a marker to determine also nonneuronal cell proliferation in human postmortem material. in conclusion, the increase in numbers of proliferating cells in the hc of ilbd cases, a prodromal state of pd, but not in clinically established pd patients, indicates an early response to developing pathology in the pd hc. as almost all of the proliferating cells in the hc are microglia, this implies that neuroinflammatory processes may play an important role in ongoing pd pathology. | besides dopamine - deficiency related motor symptoms, nonmotor symptoms, including cognitive changes occur in parkinson 's disease (pd) patients, that may relate to accumulation of -synuclein in the hippocampus (hc). this brain region also contains stem cells that can proliferate. this is a well - regulated process that can, for example, be altered by neurodegenerative conditions. in contrast to proliferation in the substantia nigra and subventricular zone, little is known about the hc in pd. in addition, glial cells contribute to neurodegenerative processes and may proliferate in response to pd pathology. in the present study, we questioned whether microglial cells proliferate in the hc of established pd patients versus control subjects or incidental lewy body disease (ilbd) cases as a prodromal state of pd. to this end, proliferation was assessed using the immunocytochemical marker minichromosome maintenance protein 2 (mcm2). colocalization with iba1 was performed to determine microglial proliferation. mcm2-positive cells were present in the hc of controls and were significantly increased in the presymptomatic ilbd cases, but not in established pd patients. microglia represented the majority of the proliferating cells in the hc. this suggests an early microglial response to developing pd pathology in the hc and further indicates that neuroinflammatory processes play an important role in the development of pd pathology. |
post - traumatic stress disorder (ptsd) is a pathological response to a traumatic event affecting many combat veterans. sleep disturbance, nightmares and insomnia are distressing and often treatment - resistant symptoms of ptsd (1, 2) and are also the criteria to diagnose ptsd in the diagnostic and statistical manual of mental disorders, 4th edition, text revision (dsm - vi - tr). although, sleep disturbances are often viewed as a secondary symptom of ptsd that resolve into treating the underlying disease, but recently it is suggested that disturbed sleep may be a core feature of ptsd (3). sleep disturbances and insomnia are common residual complaints after successful ptsd treatment (4). in contrast, sleep target intervention improves both sleep disturbances and ptsd symptom severity (3). previous studies suggest that increased central nervous system (cns) noradrenergic activity might contribute to the pathophysiology of ptsd (5, 6). mellman., showed a relationship between nighttime central noradrenergic activity and sleep disturbance in chronic ptsd (7). elevated levels of norepinephrine disturb normal rapid eye movement (rem) sleep and increase non - rapid eye movement (nrem) sleep in patients with ptsd (3). also, specific involvement of the postsynaptic alpha 1-adrenoceptor in this pathophysiologic process is suggested in some clinical studies (6, 8). prazosin is a generic alpha 1-adrenoceptor antagonist used to treat hypertension and the urinary symptoms of benign prostatic hypertrophy (9). prazosin crosses the blood brain barrier and particularly blocks central nervous system responses to adrenergic stimulation (9, 10). prazosin is significantly more effective than placebo to reduce sleep disturbance and ptsd trauma nightmares and to improve global clinical status in both civilian and military veteran in several relatively small placebo - controlled trials (10 - 12) ; however, results of randomized controlled trials (rcts) were mixed, since recent rct reported no reduction in the nightmare frequency (12). although, the department of veterans affairs (va)/department of defense clinical practice guideline for the management of post - traumatic stress recommends that clinicians provide prazosin to treat sleep disorders and nightmares with a level b strength (13), the effectiveness of prazosin for nightmares and insomnia is not directly assessed among veterans, and on the other hand, the current clinical experiments showed no significant improvements in sleep disturbance and nightmares among veterans with ptsd. the current rct aimed to assess the effects of prazosin on sleep, nightmares and daytime psychiatric symptoms among veterans with chronic ptsd. the current study was approved by the ethical committee of kermanshah university of medical sciences (kums) and conducted in kermanshah, west of iran, from march 2013 to november 2014. informed contest was obtained from all participants and the project was registered under the code : irct2013022512596n1 at the iranian center of clinical trials (irct.ir). study participants included 32 veterans of iran - iraq war (1980 to 1988) with chronic ptsd. all subjects met dsm - iv - tr criteria for ptsd related to combat exposure and the diagnosis of ptsd was made by a psychiatrist based on the results of the clinician administered ptsd scale (caps) interview. the caps is a structured clinical interview aimed to uncover core and associated symptoms of ptsd. the combat traumatic event (the index event) reported by the participant was evaluated at the beginning of the interview to determine whether it met the diagnostic criteria for criterion a (traumatic event). if the index event met the criteria, frequency and intensity of 17 ptsd symptoms were rated on 5-point scales ranging from 0 (never [frequency ], not at all [intensity ]) to 4 (daily or almost daily, [extremely ]). when the participant reported at least the frequency rating of 1 and the intensity rating of 2 for the symptom, the symptom was considered as positive (14, 15). also, a self - report measure of ptsd checklist (pcl) was used to assess daytime symptom severity. the pcl is a 17-item self - report checklist of ptsd symptoms based closely on the dsm - iv criteria. respondents rate each item from 1 (not at all) to 5 (extremely) to indicate the degree to which they were bothered by that particular symptom over the past month. previously, goodarzi validated the persian version of pcl with alpha cronbach s as 0.93 (16). subjects had scores of at least 4 (of a maximum of 8) on caps recurrent distressing dreams item, and at least 4 on the caps difficulty falling asleep / staying asleep item. medical history and examination revealed that all participants were in good general health and without restless legs syndrome, narcolepsy and other substance abuse for at least three months. patients with a diagnosis of depression were not excluded, since combat veterans with ptsd usually have concurrent depression. objective sleep was evaluated by two consecutive overnight actigraphic assessments before intervention and two consecutive overnight actigraphy after intervention. the actigraph is a portable device (similar to a wrist watch) that records patient movements to evaluate sleep parameters such as total sleep time (tst), sleep - onset latency, total wake time, number of awakenings (nwak) and sleep efficiency (se) (18 - 21). participants wore an ambulatory monitoring actigraph (somnomedics, germany) on the wrist of their non - dominant hand. data recorded by the actigraph were then transferred to a computer and the average of variables over two nights was used for analysis. prazosin was initiated at 1 mg one hour before bedtime for three nights ; then increased to 2 mg before bedtime. if trauma - related nightmares were not at least moderately reduced by participant report after the night seven and there were no clinically significant adverse effects, prazosin was then increased by weekly 2 mg increments to a possible dose of 10 mg at bedtime. dose increase was stopped and the dose was maintained at a dose that the participant reported at least moderately reduced trauma - related nightmares. an additional increase by 5 mg to a maximum 15 mg prazosin at bedtime could be prescribed if nightmares had not moderately improved and adverse effects were not problematic at one week after achieving the 10 mg dose. this is a common prazosin usage pattern employed throughout several studies (10 - 12, 22, 23). trauma - related nightmares were again rated by a psychologist in a visit at least one week after maintenance of prazosin dose. phone contact for adverse effect query was made in the morning after drug initiation and after each dose increase through the titration phases. if a medication was stopped because of an adverse effect(s), the specific symptom(s) experienced by the patient was noted. if no reason for discontinuation was documented by a provider and refill history revealed non - adherence, then the patient s non - adherence was indicated. additional reasons to distinguish the study drug included treatment failure, resolution of ptsd nighttime symptoms and paradoxical worsening of symptoms. if a provider documented that the study medication was to be discontinued, but did not describe the reason, the case was categorized as other reasons for discontinuation. main outcome measures were the caps recurrent distressing dreams item, daytime symptom severity measured by pcl and the objective sleep quality assessment using actigraphy. the caps recurrent distressing dreams item is computed by summing frequency and intensity of trauma - related distressing dreams. scores ranged from 0 to a maximum score of 8 (frequency of daily or almost every day and intensity of extreme, incapacitating distress, could not return to sleep). sleep quality parameters included tst, sleep latency (sl), se and nwak. based on the pilot study, to detect a decrease of 1.4 in the nightmare frequency, a minimum sample size of 32 patients was required, with an alpha of 0.05, an expected standard deviation of less than 3 and a power of 0.80. the data before and after treatment were compared using chi 2 (or the fisher exact test) for categorical variables and paired t - test for continuous variables. of the 36 subjects, four failed to complete scheduled outcome assessment because of protocol discontinuation. two discontinued because of adverse effects (dizziness) and two were lost to follow - up for unknown reasons. the final mean dose of prazosin was 8.9 2.8 mg (ranging from 1 to 15 mg). analysis of pcl revealed that prazosin had no significant effects on reduction of daytime symptoms (pre - pcl score= 56.2 16 vs. post - pcl score= 51.4 17.3 ; p = 0.69). prazosin produced no significant improvement in each of the outcome measures addressing frequency and intensity of trauma - related nightmares (the caps recurrent distressing dreams item). before intervention, mean frequency and intensity of trauma - related nightmares were 2.84 1.2 and 3.2 0.9, respectively. after eight weeks of intervention, frequency and intensity of nightmare were 2.56 1.4 and 2.88 1.2, respectively (table 2). abbreviations : caps, the clinician administered post - traumatic stress disorder scale ; pcl, ptsd checklist ; tst, total sleep time ; sl, sleep latency ; se, sleep efficiency ; nwak, number of awakenings. data presented as mean sd. pre- to post - treatment changes on mean frequency and intensity nightmare did not reach the statistically significant level (p > 0.05). also, table 2 presents means and standard deviations of tst, sl, se and nwak measured by actigraphy for the study subjects before and after the intervention. average tst before intervention ranged from 5.3 to 8.6 hours (mean 7.62 1.2 hour). actigraphy measures demonstrated that tst ranged from 4.8 to 8.5 hours (mean 7.06 2 hour) after the treatment. comparison of the average tst ratings measures across the two assessment time showed no significant differences between pre- and post - treatment actigraphy measurements (p = 0.472). similar results were observed for sl, se and nwak during bedtime (p > 0.05) (table 2). the current study assessed the efficacy of prazosin in reduction of ptsd symptoms and distressing nightmare in veterans with chronic ptsd. the findings demonstrated that although the reduction in the total caps score was observed during prazosin use in the study subjects, differences between pre- and post - treatment scores were not statistically significant. findings of the current study were opposite to the previous findings (10, 11, 22, 23) showing that the administration of prazosin in the veteran samples were associated with clinically significant improvements in ptsd symptoms, nightmares and sleep complaints. the lack of a significant effect of prazosin administration on total caps score may be due to the short half - life and action duration of prazosin. the mean elimination half - life of prazosin is about 2.5 hours and its duration of action is six to eight hours (24, 25). due to prazosin short half - life, it is administrated two or three times per day in general medicine to treat symptoms of benign prostatic hypertrophy and hypertension (10). it seems that a single dose at bedtime can not provide adequate concentrations of prazosin to affect ptsd symptoms during the following daytime hours. consistent with this opinion, taylor. suggested that adding two daytime prazosin doses (midmorning and evening) can reduce ptsd symptoms in persons with civilian trauma ptsd (26). based on prazosin pharmacokinetic considerations, it is difficult to explain why bedtime or evening doses of prazosin had significant effects on nightmare and ptsd symptoms. there are controversies about the equal effects of prazosin on ptsd symptoms and total caps scores. evening prazosin (mean = 9.5 mg / day) compared to placebo significantly reduced both nighttime ptsd symptoms and total caps score in vietnam combat veterans (11). however, the second randomized clinical trial by raskind suggested that compared to placebo, prazosin (mean = 13 mg / day) had significant improvement in the frequency of trauma - related nightmares (based on the recurrent distressing dreams item of the caps) and sleep quality (based on pittsburgh sleep quality index (psqi), but did not have a significant effect on total caps score (10). on the other hand, the study by germain. showed greater reductions in insomnia severity and daytime ptsd symptom severity in the prazosin group rather than placebo ; however, prazosin was not associated with reductions in nightmare frequency (12)., selected patients based on persistent nightmares ; therefore, sampling factors may be for the cause of difference between the results of raskind studies (10, 11, 22) and those of the others. furthermore, this difference may be ascribed to the use of prospective nightmare diaries and the participation of veterans with low nightmare frequency. in the current study, treatment response to sleep was defined as the improvement of objective insomnia and sleep quality measured by the actigraphy. the use of actigraphy has greater sensitivity for recording insomnia and sleep quality compared to that of a subjective sleep quality assessment (18, 19, 27). due to the lack of enough evidence and discrepancy in studies conducted on the effects of prazosin on ptsd symptoms and nightmares in patients with ptsd, any argument on the mechanisms of prazosin action in nightmares in ptsd is difficult. nightmares are mainly presented during light sleep and disrupted rem sleep, and are mostly attended by motor activity (28, 29). the effects of block of alpha-1 adrenergic receptor pathway on rem sleep in humans are unclear and those of the animal studies are not consistent. some animal studies reported that prazosin decreased rem in rats (30, 31) ; others reported increased rem in rats (32) and cats (33, 34) by administration of prazosin. on the other hand, the conditions which lead to the advent of trauma nightmares are uncertain, and there is no evidence to affirm that ptsd trauma nightmares differ from non - trauma nightmares or normal dreams (35). while motor activity during rem is observed in patients with ptsd, there is no evidence that motor activity during rem is a characteristic of ptsd or related to nightmares (36, 37). although few animal studies conducted in this regard, it is important to consider the idea that prazosin can regulate rem sleep in ptsd. the current study findings showed that prazosin had no significant effect on reduction of ptsd symptoms and nightmares among veterans with chronic ptsd. however, since there are conflicting study results on the effectiveness of prazosin, further clinical trials with larger sample sizes, based on polysomnographic assessments, are needed to define the effect of prazosin on sleep physiology and whether such effects relate to the therapeutic response. the current study findings showed that prazosin had no significant effect on reduction of ptsd symptoms and nightmares among veterans with chronic ptsd. however, since there are conflicting study results on the effectiveness of prazosin, further clinical trials with larger sample sizes, based on polysomnographic assessments, are needed to define the effect of prazosin on sleep physiology and whether such effects relate to the therapeutic response. | backgroundprazosin is significantly effective to reduce sleep disturbance and trauma nightmare in patients with post - traumatic stress disorder (ptsd) ; however, results of different studies were evaluated.objectivesthe current randomized clinical trial aimed to assess the effects of prazosin on sleep parameters and nightmares among veterans with chronic ptsd.materials and methodsthirty - two veterans with chronic war - induced ptsd and distressing nightmares were randomized into prazosin and placebo groups for eight weeks. the main symptoms were qualified using the recurrent distressing dreams item of the clinician administered ptsd scale (caps) and the daytime symptom severity was measured by ptsd checklist (pcl) and the objective sleep quality assessment by actigraphy.resultscompared with placebo, prazosin had no significant effects on reduction of daytime symptoms (p = 0.69) and frequency and intensity of trauma - related nightmares. also, there were no significant differences between pre- and post - treatment actigraphy measurements (p > 0.05).conclusionsthe study findings showed that prazosin had no significant effect on reduction of ptsd symptoms as well as nightmares among veterans with chronic ptsd. further clinical trials are needed to define the effect of prazosin on sleep physiology and whether such effects regarding the therapeutic response. |
human mitochondrial sequence data has been used to make various inferences about the origins of modern humans, including a single out of africa dispersion event (1,2) (currently the most popular theory for modern human origins), multiple dispersions from africa (3), and a multi - regional, parallel development model (4). despite all this work, no attempt has been made to construct and analyze a worldwide human mitochondrial consensus sequence. this is partly due to the fact that a consensus sequence can not be derived directly from current phylogenetic methodology. it is also due to the fact that large numbers of high - quality, full - length mitochondrial sequences have not been available until recently. however, with the publication of hundreds of sequences from human populations worldwide, an analysis of the full mitochondrial genome can be completed in detail for the first time. the standard measure for all mitochondrial studies is the revised cambridge reference sequence (rcrs), but the rcrs is not a consensus sequence and should not be used as such. while the rcrs provides a uniform nucleotide numbering scheme, it is simply a reconstruction of a single european individual 's mtdna and contains several rare alleles (5). the rcrs also tells us nothing about the degree of variation on a nucleotide - by - nucleotide basis. construction and analysis of a worldwide consensus sequence, however, allows for the study of variation within human populations at each nucleotide position. this is especially important in light of the fact that phylogenetic reconstructions focus only on the relatively few nucleotide positions which drive tree topology. while there are several thousand full - length mitochondrial sequences that one can obtain from sources such as the national institutes of health 's national center for biotechnology information (http://www.ncbi.nlm.nih.gov/), many of these are of questionable quality. the earliest studies on full - length sequences used early - generation dna sequencing technology (6), and, because of this there are many other sequences that are either unprovenanced, unpublished (and therefore untested by peer review), from patents (and therefore often poorly described and often manipulated for patent purposes), from commercial genealogical databases (which have not been rigorously vetted by the scientific community), or from studies of mitochondrial - linked diseases (with a focus on aberrant sequences). in addition, there are at least five errors that are commonly found in mtdna databases : base shifts, reference bias, phantom mutations, base misscoring and artificial recombination (7). many sequence data sets have been flagged by latter studies as containing such errors, often years after the publication of warnings and methods that one can use to detect them (8). some effort has been made by the original authors to go back and re - sequence problematic samples, occasionally with less - than - satisfactory results (911)., kong. (12) flagged 13 sequences from tanaka. all this forces the researcher to delve deeply into the literature if he or she wants to use publicly available sequences in further analyses. the problems with current mtdna data sets have led to pleas for better quality control (8,14) and any database consisting of published sequences must be constructed with this issue in mind. the current set of 827 sequences (not including the rcrs) was carefully assembled from the literature and should represent the best human mitochondrial sequences currently available. network phylogenetic methods (using the reduced median (15) or the newer median - joining (16) algorithm) are often used in mitochondrial studies. in light of the high degree of homoplasy among diverse mitochondrial lines, a judicious selection of variable sites must be employed when using these techniques to keep the number of possible ancestral trees at a manageable level. a consensus approach, however, allows for the creation of a working ancestral mitochondrial model sequence despite the presence of homoplasies, polytomies or other confounding relationships. while a consensus can not be considered an ancestral sequence, per se, if the underlying tree topology is balanced and the major clades are adequately sampled, the two approaches will point to the same ancestral sequenceor nearly so (1719). both approaches are less than perfect. the calculation of a consensus is highly dependent upon equal sampling of extant branches, yet it can reveal details of the ancestral sequence that can not otherwise be seen, such as variation at positions that do not drive tree topology. on the other hand, phylogenetically derived ancestral sequences are estimations of likely ancestral states and are dependent on the reliability of underlying evolutionary models (19). while the latter is emphasized to a greater extent in the literature, the former is a valid approach simply because it provides different types of information. current phylogenetic methods for constructing ancestral mtdna trees depend on several key assumptions, e.g. a clock - like evolution of mtdna, a lack of recombination and a lack of selection. perhaps the most commonly used phylogenetic method, the median - joining algorithm (16), places the most similar sequences into nested relationships first (by taking the consensus of sequence triplets) and adds the most variable sequences last. this is a parsimonious approach, but creates an interesting situation : sequences that have changed in a non - clock - like manner will have a disproportionate influence on tree structure. clock - like evolution has been questioned for the african l2 clades (20,21), making it difficult to accurately place l2 in the human mitochondrial phylogenetic tree and this also raises questions about the structure of the tree in general. in their introduction, howell. (21) list a series of studies that argue against the clock - like evolution of mtdna and whether or not mtdna fits the neutral model of evolution. in addition to questions about the mitochondrial clock, new data have been published that indicate that recombination may occur within mitochondrial lineages and may account for certain homoplasies in the mtdna phylogenetic tree, although the issue has been debated for some time (24). the analysis reported here expands upon the results presented by several previous studies, especially that of ingman. that study pioneered full - length mitochondrial analysis, with an examination of 53 diverse sequences. the primary purpose of the current work was to test for the degree of conservation at each mitochondrial nucleotide position within extant human populations, using a consensus approach and employing the best sampling of worldwide mtdna available to date. the result is a very strong consensus model that indirectly reflects upon the ancestral human mitochondrial genome and more fully informs us about the degree of human mitochondrial variation. all full - length human mitochondrial sequences available as of november 2006 were downloaded from genbank (http://www.ncbi.nih.gov/). for the initial analysis, poor - quality and questionable sequences were removed from the data set according to the information made available by several authors (67,12,2833). also excluded were sequences that were not published in peer reviewed literature, were from patents, had a hela origin, or were from disease patients. as far as it is known, the resulting list of 827 sequences from 22 separate studies (6,12,21,31,32,3752) should be free from the most common errors described above. a complete sequence list is included in supplementary data. a master sequence alignment was created in bioedit (53) manually, with special attention being paid to problem areas noted in the literature. an alignment program (e.g. clustalw) was not used for reasons of speed and accuracy around gaps. throughout the alignment, a set of minimization rules was applied that produced the fewest number of changes necessary in subjective areas. bioperl (54) was used for all calculations, using the rcrs as a template for nucleotide numbering. a hash table that included all variant positions was created from the master alignment with sequence name and nucleotide position as keys. all calculations were performed on this hash table and output was directed to a series of text files. these calculations included a compilation of variable positions, detected alleles, allele frequencies and transition / transversion status (supplementary data). the worldwide human mitochondrial consensus sequence (supplementary data) was reconstructed from the hash table by picking the majority allele at each variable position and adding in the invariant sites from the rcrs (there is no accession number included for the consensus sequence because genbank does not catalog theoretical sequences or sequences that have no physical counterpart). rather than removing regions of recurrent length variation from the analysis, as is often the case in mitochondrial studies, eleven each poly - x site was composed of a variable number of nucleotide repeats with at least three variants found in the data set. the starting position of each site was chosen to reflect the first variable position within the repeat (most sites had an invariant set of upstream repetitive nucleotides). the variable nucleotides from the start to the end of the poly - x site, numbered according to the rcrs, and any additional nucleotide inserts not found in the rcrs were treated as a single variant nucleotide position for all calculations. the 9-bp deletion at positions 8281 - 8289 is a common and well - characterized feature. it is treated as a poly - x site because individual sequences carried 1, 2 or 3 copies of this repeat (ccccctcta n ; sequences with only 1 repeat carry the deletion). table 1.poly - x sitessitetypenumber of allelesp290291poly - a30.998309poly - c40.522315poly - c30.935498poly - c30.995520523ca repeat50.746571573poly - c80.971960poly - c70.9895899poly - c40.9878276poly - c50.990828182899-bp deletion60.99316, 19216, 193poly - c50.945 all full - length human mitochondrial sequences available as of november 2006 were downloaded from genbank (http://www.ncbi.nih.gov/). for the initial analysis, poor - quality and questionable sequences were removed from the data set according to the information made available by several authors (67,12,2833). also excluded were sequences that were not published in peer reviewed literature, were from patents, had a hela origin, or were from disease patients. as far as it is known, the resulting list of 827 sequences from 22 separate studies (6,12,21,31,32,3752) should be free from the most common errors described above. a complete sequence list is included in supplementary data. a master sequence alignment was created in bioedit (53) manually, with special attention being paid to problem areas noted in the literature. an alignment program (e.g. clustalw) was not used for reasons of speed and accuracy around gaps. throughout the alignment, a set of minimization rules was applied that produced the fewest number of changes necessary in subjective areas. bioperl (54) was used for all calculations, using the rcrs as a template for nucleotide numbering. a hash table that included all variant positions was created from the master alignment with sequence name and nucleotide position as keys. all calculations were performed on this hash table and output was directed to a series of text files. these calculations included a compilation of variable positions, detected alleles, allele frequencies and transition / transversion status (supplementary data). the worldwide human mitochondrial consensus sequence (supplementary data) was reconstructed from the hash table by picking the majority allele at each variable position and adding in the invariant sites from the rcrs (there is no accession number included for the consensus sequence because genbank does not catalog theoretical sequences or sequences that have no physical counterpart). rather than removing regions of recurrent length variation from the analysis, as is often the case in mitochondrial studies, eleven each poly - x site was composed of a variable number of nucleotide repeats with at least three variants found in the data set. the starting position of each site was chosen to reflect the first variable position within the repeat (most sites had an invariant set of upstream repetitive nucleotides). the variable nucleotides from the start to the end of the poly - x site, numbered according to the rcrs, and any additional nucleotide inserts not found in the rcrs were treated as a single variant nucleotide position for all calculations. the 9-bp deletion at positions 8281 - 8289 is a common and well - characterized feature. it is treated as a poly - x site because individual sequences carried 1, 2 or 3 copies of this repeat (ccccctcta n ; sequences with only 1 repeat carry the deletion). table 1.poly - x sitessitetypenumber of allelesp290291poly - a30.998309poly - c40.522315poly - c30.935498poly - c30.995520523ca repeat50.746571573poly - c80.971960poly - c70.9895899poly - c40.9878276poly - c50.990828182899-bp deletion60.99316, 19216, 193poly - c50.945 the world wide human mtdna consensus is composed of 16 569 nucleotides. based on the current data set, 84.1% of the mitochondrial genome is invariant. personal mutations (i.e. those that occur in only one sequence within the data set) comprised 43.8% of the variable sites (7.0% of the total mitochondrial genome). based on the current state of sequencing technology and critiques of published data sets, less than 2% of all sites were actually polymorphic (i.e. the minor allele frequency was > 1%). common minor allele (i.e. an allele found in 5% or more of the sequences). the 827 sequences within the data set contained 2631 variant positions, and on average differed from the consensus by 21.6 10.0 (sd) nucleotides (figure 1). much of the variation observed was within specific regions of the mitochondrial genome (table 2). this included the well - known hypervariable regions (hvs1 and hvs2) as well as the 55 non - coding nucleotides within the coding region. table 2.variation within specific regions of the mitochondrial genomelocusnumber of variant sites% variant sitesd - loopd - loop total39214.6 hvs 11816.8 hvs 21144.3 7s dna2388.9coding regioncoding region total227285.3 non - coding nucleotides230.9 trnas1585.9 12s ribosomal rna993.7 16s ribosomal rna1254.7 nadh dehydrogenase subunits99637.4 cytochrome c oxidase subunits43116.2 cytochrome b2178.1 atp synthase subunits2117.9loci positions were obtained from mitomap (www.mitomap.org). percent calculations included poly - x sites (table 1) as single events in nucleotide counts. note : the overlap between several of these categories means that the number of variant sites will be higher than reported in the text and the percentages will sum to greater than unity. figure 1.pairwise nucleotide differences between all individuals within the data set and the worldwide consensus. variation within specific regions of the mitochondrial genome loci positions were obtained from mitomap (www.mitomap.org). percent calculations included poly - x sites (table 1) as single events in nucleotide counts. note : the overlap between several of these categories means that the number of variant sites will be higher than reported in the text and the percentages will sum to greater than unity. there are 12 differences between the rcrs and the human consensus (73, 263, 315 + c, 750, 1438, 2706, 4769, 7028, 8860, 11 719, 14 766, and 15 326), representing 11 transitions and one indel. this list exactly parallels the changes necessary to go from the rcrs (haplogroup h2a), through each of the intermediate haplogroups, to macrohaplogroup r according to achilli. the highly recurrent 315 + c indel can be inferred to reflect an historical deletion within the rcrs. all sites that are un - selected and freely drifting in a large population might be expected to eventually display all four nucleotides (i.e. the nucleotide could be a, t, g or c). in the entire mitochondrial genome there were only six such sites (positions 185, 13 928, 16 176, 16 265, 16 266 and 16 318), and each had a clear majority nucleotide. the average p at these 4-fold degenerate sites was 0.97 0.02 (sd). note that four of these six positions are in hvs 1 (figure 3). there are only 36 positions where p was less than 0.90 (0.22% of the human mitochondrial genome). in every one of these cases, the ancestral nucleotide was clearly either a purine or a pyrimidine (six of these sites displayed three alleles, but in all cases the third allele had a frequency of less than 0.005). table 3 contains a summary of the number of alleles and primary allele frequencies for the global consensus sequence. table 3.summary statistics for the number of alleles and primary allele frequency (p) data on a site - by - site basisnumber of allelespaverage1.1690.998 sd0.4060.012 min10.521 max81.000relative to the rcrs, there are 31 insertions within the data set that are not within the designated poly - x sites. reported values are the same (to three decimal places) whether or not one includes the insertions. figure 2.primary allele frequency (p) distribution, where p is defined as the frequency of the most common allele at each position. data for the 11 poly - x sites are treated separately (table 2). the allele count is a measure of the number of alleles (i.e. a, t, g or c) found at each position. data for the 11 poly - x sites are treated separately (table 2). summary statistics for the number of alleles and primary allele frequency (p) data on a site - by - site basis relative to the rcrs, there are 31 insertions within the data set that are not within the designated poly - x sites. reported values are the same (to three decimal places) whether or not one includes the insertions. primary allele frequency (p) distribution, where p is defined as the frequency of the most common allele at each position. data for the 11 poly - x sites are treated separately (table 2). the allele count is a measure of the number of alleles (i.e. a, t, g or c) found at each position. data for the 11 poly - x sites are treated separately (table 2). the most variable position (309) had a p of only 0.52. this is a poly - c region within hvs 2 that has a highly variable number of c residues. there were several similar sites (poly - x sites) that were treated separately in the analysis (see methods section). despite the high variability in repeat length within these sites, the consensus sequence is still essentially unambiguous, with p equal to at least 0.95 for all but three of the poly - x sites (table 1). i tested the effects of including 491 additional full - length sequences from three older data sets (27,34,35) and one recent data set (36) plus 191 non - disease sequences from tanaka. (13). including these sequences produced no change in any consensus nucleotide and only had a trivial effect on the number of variable positions, number of alleles per site and primary allele frequencies. due to the presence of many private and rare alleles, most changes in the dominant allele frequency stayed in the range of p = 1.000.99. these sequences were excluded from the primary data set only because questions have been raised concerning their accuracy (see methods section). i also tested the effects of including the 277 diverse coding region sequences from kivisild. (23). ignoring the lack of data for the d - loop, inclusion of these sequences added 768 new variable sites and 49 new private mutations. despite the added diversity, the average number of alleles per site only increased slightly and no consensus nucleotide changed. the kivisild data set is less than one - third the size of that used to generate the current consensus and their sequences do not include the d - loop. even though this smaller data set of incomplete sequences can not fully resolve the consensus sequence, it does include a much higher proportion of sequences from sub - saharan africa. therefore, i performed a consensus analysis on just these 277 partial sequences to determine the degree to which the techniques are dependent upon the proportional representation of world regions within the included sequences. the consensus for the kivisild data set contains five transitions (8701, 9540, 10 398, 10 873, 12 705) in addition to the ones found in the world consensus. these five transitions are putative steps either between macrohaplogroups r and n (32) ; or between macrohaplogroup r, macrohaplogroup n and superhaplogroup l3 (23,51). these five positions are also among the 11 positions with the lowest p in the world consensus. this indicates that final resolution of a very few sites will be subject to sample size and composition. yet only the sites which drive the major breaks in tree topology are expected to be within this group. it is important to note that, despite the large difference in the proportions of regional representation between the world consensus and the kivisild data sets, their consensi are 99.97% identical. the world consensus sequence is unambiguous except for a very few nucleotide positions. in the cases where the majority nucleotide was not overwhelmingly dominant, the ancestral nucleotide could still be unambiguously classified as either a purine or a pyrimidine. thus, the amount of mitochondrial sequence divergence within humans since the most recent common ancestor is quite low. only a few polymorphisms separate the major lineages, and the remaining variable sites are simply some degree of homoplasy is also evident and recent claims that recombination can explain at least some of the homoplasy (24) within human mtdna lineages need to be considered. according to the newest available phylogenetic calculations (23), there are perhaps as few as 30 differences between the macrohaplogroup r consensus and the root node of all extant human mitochondrial sequences. these few positions are the most likely to change within the consensus with the addition of new data. other potential revisions within the consensus sequence should be very rare since we have already seen that nearly all sites are either invariant or contain only very rare minor alleles. therefore, adding new sequences, even from diverse sources such as the highly heterogeneous african - specific clades, should not significantly change the consensus. the consensus is a robust representation of the founder human mitochondrial sequence, with the exception of a few, slightly ambiguous nucleotide positions. the phylogenetic approach and the consensus approach for discovering the ancestral sequence should produce nearly identical results if the underlying phylogeny is evenly balanced across branches (1719). at this time, it is not possible to perfectly balance the sampling among the various people groups due to a dearth of sequences for some groups. for example, there is a preponderance of non - african mitochondrial sequences in our data set and there is a general lack of available samples from certain geographic areas (e.g. central africa (22)). this will doubtless be corrected over time as more full - length sequences become available. inclusion of more sequences from sub - saharan africa will increase the total number of variable sites. however, since the african - specific lineages are so highly heterogeneous, it is not expected that these additional sequences will have a significant affect on the consensus sequence. | with the recent increase in the available number of high - quality, full - length mitochondrial sequences, it is now possible to construct and analyze a comprehensive human mitochondrial consensus sequence. using a data set of 827 carefully selected sequences, it is shown that modern humans contain extremely low levels of divergence from the mitochondrial consensus sequence, differing by a mere 21.6 nt sites on average. fully 84.1% of the mitochondrial genome was found to be invariant and private mutations accounted for 43.8% of the variable sites. ninety eight percent of the variant sites had a primary nucleotide with an allele frequency of 0.90 or greater. interestingly, the few truly ambiguous nucleotide sites could all be reliably assigned to either a purine or pyrimidine ancestral state. a comparison of this consensus sequence to several ancestral sequences derived from phylogenetic studies reveals a great deal of similarity, where, as expected, the most phylogenetically informative nucleotides in the ancestral studies tended to be the most variable nucleotides in the consensus. allowing for this fact, the consensus approach provides variation data on the positions that do not contribute to phylogenetic reconstructions, and these data provide a baseline for measuring human mitochondrial variation in populations worldwide. |
we report on a chronic hemiparetic patient whose gait recovery was delayed until healing of an injured corticoreticulospinal tract (crt), which was demonstrated on diffusion tensor tractography (dtt). a 71-year - old female presented with complete paralysis of the right extremities resulting from a spontaneous intracerebral hemorrhage. at 5 months after onset, when she was admitted for rehabilitation after undergoing rehabilitation at the previous university hospital, she presented with severe weakness of the right leg (manual muscle test : 0 2- score) and could not even stand. motor weakness of her right leg improved to the point that she was able to extend her knee on gravity - eliminated position at 11 months and against some resistance at 30 months after onset. this discontinuation elongated to the cerebral cortex on 32-month dtt, whereas on 32-month dtt, the right crt had become thicker compared with that on 5-month dtt. an injured crt healed in a patient who was able to walk independently after approximately 2 years of rehabilitation starting 5 months after the onset of intracerebral hemorrhage. gait dysfunction, a common sequela of brain injury, is usually caused by problems such as motor weakness, somatosensory problem, and movement in coordination. approximately 20% to 30% of stroke patients do not regain gait ability ; therefore, gait disability is a serious disabling sequelae of stroke. most gait recovery, and also motor recovery after stroke, occurs within 3 months after onset. stroke patients can walk when the motor function recovers in the hip and knee joint of the leg at least to the degree of being able to lift against gravity. several studies have reported gait recovery by the recovery of injured corticospinal tract (cst) or corticoreticulospinal tract (crt). jang found thickening of crt in the unaffected side showed association with gait function in 54 chronic stroke patients. in 2016, jang and kwon reported that thickening of injured cst (perilesional recovery) at the early - stage rehabilitation contributed to gait function in a patient with a pontine infarct. this suggests that detailed knowledge about gait recovery could aid more stroke patients in regaining their gait ability even for stroke patients who could not walk after 3 months from onset. it contributes to gait function by controlling the proximal muscles of the extremities and axial muscles. recent diffusion tensor tractography (dtt), which is derived from diffusion tensor imaging (dti), has a unique advantage in evaluation of microstructural integrity of white matter by detection of water diffusion properties. a technique for identifying the crt using selection of fibers passing through regions of interest (rois) was reported in 2012. after introduction of identification of the crt by dtt, a few studies have reported on the recovery of an injured crt with gait function in stroke patients., we report on a chronic hemiparetic patient whose gait recovery was delayed until healing of an injured crt, which was demonstrated on dtt. a 71-year - old right - handed female presented with complete paralysis of the right extremities [medical research council (mrc) : 0/5 ] at the onset of a spontaneous intracerebral hemorrhage (ich) (table 1). the volume of hemorrhage (22950.7 mm), was measured by insight toolkit - snake automatic partitioning program (university of pennsylvania, philadelphia, pa). no previous medical history of neurological, physical, or psychiatric illness was observed except for hypertension and diabetes. five months after onset, she was admitted to the rehabilitation department of a university hospital after undergoing rehabilitation at a different university hospital. brain magnetic resonance (mr) images taken upon admission showed a leukomalactic lesion in the left corona radiata and basal ganglia (fig. 1a). for measurement of gait function, functional ambulation category (fac, full mark : 5 points) was measured. she presented with mild conduction aphasia, severe weakness of the right leg (mrc : hip flexor ; 2, knee extensor : 0, and ankle dorsiflexor : 0) and could not even stand (fac : 0 point) (table 1). she began comprehensive rehabilitative therapy, which included neurotropic drugs (methylphenidate, pramipexole, amantadine, levodopa, and venlafaxine), movement therapy, and neuromuscular electrical stimulation of the right knee extensor and ankle dorsiflexor. movement therapy was conducted 30 min / d and 5 times per week in our physical and occupational therapy department. her rehabilitation was continued until 32 months after onset at the inpatient clinic of our hospital and 2 other local rehabilitation hospitals, and the outpatient clinic of the rehabilitation department of our hospital. motor weakness of her right leg improved to the point that she was able to extend her knee on gravity - eliminated position at 11 months and against some resistance at 30 months after onset. she was able to walk independently at 30 months after her stroke (fac : 3.5 points). seven age and sex - matched normal control subjects (mean age : 67.9 5.0 years, range : 6277 years) with no history of neurological disease were recruited for this study. the patient and all normal control subjects provided informed consent, and the study protocol was approved by yeungnam university hospital institutional review board. a, brain computed tomography (ct) images show hematomas in the left corona radiata and basal ganglia at onset and t2-weighted magnetic resonance (mr) images show a leukomalactic lesion in the left corona radiata and basal ganglia at 5 months after onset. the left corticospinal tract (cst) shows narrowing compared with the right cst on 5-month dtt. the left corticoreticulospinal tract (crt) shows discontinuation at the basal ganglia level on 5-month dtt (blue arrow) and this discontinuation is elongated to the cerebral cortex on 32-month dtt (red arrows), whereas on 32-month dtt, the right crt has become thicker than it was on the 5-month dtt (green arrow). diffusion tensor imaging scanning was performed at 5 and 32 months after onset, using a 6-channel head coil on a 1.5-t philips gyroscan intera (philips, best, the netherlands) with 32 gradients. seventy contiguous slices and imaging parameters were acquired as follows : acquisition matrix = 96 96, reconstructed to matrix = 192 192, field of view = 240 240 mm, tr = 10,398 milliseconds, te = 72 milliseconds, epi factor = 59 and b = 1000 s / mm, nex = 1, and a slice thickness of 2.5 mm. fiber tracking was performed using the fiber assignment continuous tracking algorithm implemented within the dti task card software (philips extended mr work space 2.6.3) (threshold fractional anisotropy = 0.15, angle = 27). images for correction of residual eddy - current image distortions and head motion effect, using a diffusion registration package (philips medical systems). for reconstruction of the cst, 2 rois were placed on the upper (roi 1) and lower pons (roi 2) on the axial image (portion of the anterior blue color). for reconstruction of the crt, reticular formation of the medulla (roi 1), and tegmentum of the midbrain (roi 2) on the axial image were used. fractional anisotropy (fa) and tract volume of the cst and crt were measured. dtt parameter values varying more than 2 sds from normal control values were defined as significant differences. in contrast, the left cst was narrowed compared with the right cst, and similar findings were observed for both csts on 32-month dtt compared with 5-month dtt. regarding the crt, the left crt was discontinuous at the basal ganglia level on 5-month dtt, and this discontinuation elongated to the cerebral cortex on 32-month dtt. in addition, the right crt presented integrity between the cortex and brainstem on 5-month dtt, and on 32-month dtt, the right dtt had become thicker compared with the 5-month dtt. regarding dtt parameters, the fa values of the cst and crt were similar in both hemispheres on both 5 and 32-month dtts. however, the tract volumes were increased in the cst and crt in both hemispheres and the order of the increment of tract volume was as follows : the left crt : 2171254 ; the right crt : 9971588 ; the left cst : 368519 ; and the right cst : 15561712. compared with normal controls, significant differences in fa, and tract volume of the left cst on both 5 and 32-month dtt were observed. regarding the crt, significant differences in fa and tract volume of both crts on 5-month dtt were observed. in addition, on 32-month dtt, both crts in fa were lower than that of normal controls, but the tract volume of both crts did not differ significantly from the normal controls. diffusion tensor imaging scanning was performed at 5 and 32 months after onset, using a 6-channel head coil on a 1.5-t philips gyroscan intera (philips, best, the netherlands) with 32 gradients. seventy contiguous slices and imaging parameters were acquired as follows : acquisition matrix = 96 96, reconstructed to matrix = 192 192, field of view = 240 240 mm, tr = 10,398 milliseconds, te = 72 milliseconds, epi factor = 59 and b = 1000 s / mm, nex = 1, and a slice thickness of 2.5 mm. fiber tracking was performed using the fiber assignment continuous tracking algorithm implemented within the dti task card software (philips extended mr work space 2.6.3) (threshold fractional anisotropy = 0.15, angle = 27). images for correction of residual eddy - current image distortions and head motion effect, using a diffusion registration package (philips medical systems). for reconstruction of the cst, 2 rois were placed on the upper (roi 1) and lower pons (roi 2) on the axial image (portion of the anterior blue color). for reconstruction of the crt, reticular formation of the medulla (roi 1), and tegmentum of the midbrain (roi 2) on the axial image were used. fractional anisotropy (fa) and tract volume of the cst and crt were measured. dtt parameter values varying more than 2 sds from normal control values were defined as significant differences. on 5-month dtt, the entire right cst pathway was intact. in contrast, the left cst was narrowed compared with the right cst, and similar findings were observed for both csts on 32-month dtt compared with 5-month dtt. regarding the crt, the left crt was discontinuous at the basal ganglia level on 5-month dtt, and this discontinuation elongated to the cerebral cortex on 32-month dtt. in addition, the right crt presented integrity between the cortex and brainstem on 5-month dtt, and on 32-month dtt, the right dtt had become thicker compared with the 5-month dtt. the fa values of the cst and crt were similar in both hemispheres on both 5 and 32-month dtts. however, the tract volumes were increased in the cst and crt in both hemispheres and the order of the increment of tract volume was as follows : the left crt : 2171254 ; the right crt : 9971588 ; the left cst : 368519 ; and the right cst : 15561712. compared with normal controls, significant differences in fa, and tract volume of the left cst on both 5 and 32-month dtt were observed. regarding the crt, significant differences in fa and tract volume of both crts on 5-month dtt in addition, on 32-month dtt, both crts in fa were lower than that of normal controls, but the tract volume of both crts did not differ significantly from the normal controls. in this study, we investigated the changes of the cst and crt in a patient who was able to walk independently after approximately 2 years of rehabilitation starting 5 months after a cerebral hemorrhage. the results of dtt parameters appeared to be consistent with the changes of dtt configurations : the discontinuous left crt elongated to the cerebral cortex and the right crt became thicker on 32-month dtt. because neither cst improved, we believe that the recovery of the injured left crt was most attributed to regaining gait ability in this patient. the right crt also appeared to contribute to regaining gait ability, apparently consistent with a previous study showing that activation of the unaffected crt could contribute to gait recovery in stroke patients with severe injuries of the affected cst and crt. to the best of our knowledge, this is the first study to suggest recovery of the injured crt contributes to regaining gait ability in chronic hemiparetic patients. since the introduction of dtt for the crt, a few studies have reported on the recovery of an injured crt. in 2013, yeo and jang reported on a patient who showed recovery of a discontinued crt in the affected hemisphere during 3 weeks from 3 weeks after the onset of ich. subsequently, in 2014, a patient whose injured crt had recovered by transcallosal fibers during 10 weeks from 6 weeks after the onset of ich was reported. in 2015, jang reported on a patient who developed reorganization of an injured crt to the medial area over a 4-week period starting 6 weeks after a cerebral infarct. by contrast, we demonstrated the recovery of an injured crt in a chronic patient who was able to walk independently after approximately 2 years of rehabilitation beginning 5 months after the ich. first, because this is a single - case study, we could not study differences in predictors of gait recovery such as age, type of stroke, or type of therapy. second, results of dtt might present false - positive and negative results due to the hemorrhage or a malatic cavity. third, although gait is involved in many neural tracts including extrapyramidal motor tracts, such as the rubrospinal tract and the vestibulospinal tract, we investigated only the cst and crt. therefore, further studies including larger case numbers and for overcoming the limitations should be warranted. in conclusion, recovery of an injured crt was found in a patient who was able to walk independently after approximately 2 years of rehabilitation starting 5 months after the ich. | abstractobjectives : we report on a chronic hemiparetic patient whose gait recovery was delayed until healing of an injured corticoreticulospinal tract (crt), which was demonstrated on diffusion tensor tractography (dtt).case presentation : a 71-year - old female presented with complete paralysis of the right extremities resulting from a spontaneous intracerebral hemorrhage. at 5 months after onset, when she was admitted for rehabilitation after undergoing rehabilitation at the previous university hospital, she presented with severe weakness of the right leg (manual muscle test : 0 2- score) and could not even stand. she received comprehensive rehabilitative therapy for 32 months after the onset. motor weakness of her right leg improved to the point that she was able to extend her knee on gravity - eliminated position at 11 months and against some resistance at 30 months after onset. she was able to walk independently at 30 months after onset.results:the left crt was discontinuous at the basal ganglia level on 5-month dtt. this discontinuation elongated to the cerebral cortex on 32-month dtt, whereas on 32-month dtt, the right crt had become thicker compared with that on 5-month dtt.conclusions:an injured crt healed in a patient who was able to walk independently after approximately 2 years of rehabilitation starting 5 months after the onset of intracerebral hemorrhage. |
the bromodomain (brd) family of proteins recognize acetylated - lysine (kac) in proteins and represent a set of protein protein interaction modules that are becoming increasingly explored in the field of drug discovery. the bet family of brds is a subset of this larger bromodomain family and is made up of four members : brd2, brd3, brd4, and brdt in humans, with each containing two brd modules that share high sequence similarity and highly similar binding sites. the bet family shares the same conserved tertiary structure of bromodomain proteins, with the kac binding site being formed as a central cavity by an atypical left - handed four - helix bundle flanked by the za loop and the bc loop (figure 1a). this binding site is primarily hydrophobic, with key polar interactions being formed between the acetyl carbonyl of kac and a family - conserved asparagine residue as well as a structurally conserved water molecule. mimicking the interaction of this acetyl group has been the basis for generating small - molecule inhibitors of the readout function of the bromodomain proteins (figure 1b), which was exemplified by the discovery of (+) -jq1 (figure 1c). outside of the highly enclosed base of the pocket, inhibitors of the bet family have shown that occupying the adjacent regions, known as the hydrophobic shelf (occupied by phenyl in figure 1c) and za channel (occupied by thiophene in figure 1c), leads to nanomolar potency and a high degree of selectivity toward other bromodomains (figures 1c and 2). (a) structure of first bromodomain of brd4 bound to an acetylated peptide (pdb i d : 3uvw). (b) interaction of kac with brd4 (pdb i d : 3uvw). (c) (+) -jq1 bound to brd4 with a chlorophenyl ring occupying the hydrophobic shelf and thiophene occupying the za channel (pdb i d : 3mxf). the inhibition of the bet family of bromodomains has been proposed as a therapeutic strategy in multiple disease areas including cancer, inflammation, and obesity. here, we have focused on brd4, which was identified as a therapeutic target in aml, other cancers, and inflammatory disease, as a representative member of the bet subfamily. a number of small - molecule inhibitors of bet family members have now been published. a key feature of these inhibitors is a kac mimetic that anchors the molecule into the brd binding site via hydrogen bonds and hydrophobic interactions, which is critical for potent binding. a limited number of chemotypes that possess these features had been published when this work started and has been increasing (figure 2). these include triazolodiazepine (e.g., (+) -jq1), isoxazole (e.g., gsk1210151a), dihydroquinazolinone (e.g., pfi-1), tetrahydroquinoline, benzimidazole (e.g., bic1), indolizine, thiazolidinone, triazolopyridine, and tetrahydrothienopyridine scaffolds. structure, activity, and le of published bet - family inhibitors classified by kac mimetic. upon starting this work, only the triazolodiazepine, dihydroquinazolinone, and benzimidazole kac mimetics had been disclosed. to offer more possibilities for drug - design efforts against brd4 and other bromodomains different chemotypes binding to the same protein often show different physicochemical properties, distinct biological profiles, and offer additional opportunities for intellectual property generation. here, we describe a virtual screening approach that focuses on kac mimetics and identifies novel scaffolds that fit this profile. furthermore, we designed the virtual screen in a fashion largely independent of the bromodomain targeted, and we present the validation of the approach against brd4. the enclosed kac binding site of bromodomains imposes strict geometric constraints on inhibitors, requiring excellent shape complementarity in this part of the pocket. to meet these constraints, we wanted to take advantage of the availability of brd4 and other bromodomain crystal structures by utilizing molecular docking. however, the docking of several million commercially available compounds and in particular the processing of the results is still a time - consuming and labor - intense task. frequently, methods of higher throughput, such as similarity- or pharmacophore - based searching, are used to select a smaller set of compounds that is then subjected to docking. our approach to preselect a set of compounds for which docking can be managed recognizes the key role of the kac mimetic in all known bromodomain inhibitors. we initially selected commercially available compounds that feature an kac mimetic chemotype, that is, compounds that feature a moiety that has the potential to match the hydrogen - bond pattern and the steric constraints of the kac binding site. specifically, we created an extensive set of chemotpyes by exploring published data, intuitive design, and similarity searches. this set consisted of known chemotypes and, critically, also many chemical structures not yet described as bromodomain inhibitors. next, we converted these chemotypes into substructures searches and retrieved commercially available compounds that feature these kac mimetic substructures. this set of compounds was then subjected to docking against the first bromodomain of brd4 (brd4(1)). after an extensive filtering of the results and the purchasing and testing of selected compounds, we identified six inhibitors, including four unprecedented kac mimetics. to validate our results further, we generated crystal structures of selected compounds bound to brd4(1) and established early sar around the novel chemotypes through synthesis and the purchase of derivatives. our work is relevant to scientists working on bromodomain inhibitors because it addresses three goals : first, through the focus on kac mimetics, it efficiently preselects a subset of commercially available compounds and ensures that a large number of kac mimetics are included in the docking step ; second, through the docking step, it meets the tight geometric requirements of the kac binding site ; and third, this approach is applicable to other bromodomains for which crystal structures are available. furthermore, we report an extensive compilation of novel chemotypes that can act as kac mimetics and will thus be useful for other design approaches and scaffold hopping, and we report novel inhibitors of brd4 that have the potential to be developed into significantly more potent compounds. our approach centered on identifying a series of chemotypes that had the potential to mimic kac and fit the geometric constraints of the brd4(1) binding pocket. these were then converted into substructure searches that were used to mine commercially available compounds for inhibitors of brd4 using the emolecules database. one branch we will refer to as the literature substructures branch, which was based on the kac mimetic substructures extracted from published bromodomain inhibitors. these were also modified to generate structurally related substructures that maintained the key pharmacophore (e.g., 1,2,4-triazole to isoxazole). the other branch we will refer to as the similarity searching branch, which was based on pharmacophore, shape, and 2d fingerprint similarity searches derived from the published (+) -jq1 and the crystal structure of it bound to brd4(1) (pdb i d : 3mxf). the results of each of these branches was submitted to docking, and through a series of filters designed to reduce docking false positives, compounds were selected for purchase (figure 3). we generated a library of bromodomain - focused substructures through the identification of the kac mimetic substructure from published bromodomain inhibitors. to expand the number of substructures considered an example of this approach starting from (+) -jq1 is highlighted in figure 4. the substructures carried forward to the rest of the approach are shown in the supporting information, figure s1. example of the generation of substructures from (+) -jq1 for the literature substructures approach. with this branch, we were looking for novel kac mimetics featuring chemotypes distinct from already known inhibitors. to identify such chemotypes, we used similarity searches (e.g., shape or pharmacophore) that allowed the identification of distinct chemotypes that nevertheless share the pharmacophoric features critical for binding of the probe compound (+) -jq1. these similarity searches gave us a rich set of putative kac mimetics from 2.4 million commercially available compounds. however, we reasoned that as a result of the tight geometric constraints of the brd4 binding site many of these would not be able to bind, despite a high similarity, because even a simple change (e.g., from a methyl to an ethyl group) may lead to clashes within the kac pocket. to enrich for compounds that fit the tight geometric constraint of the binding site, we thus performed a docking step and extracted kac mimetics with sufficient shape complementarity. it is important to note that this docking step serves the purpose of creating a virtual library of kac mimetics in conjunction with the similarity search and is distinct from the final docking step that will be described later and served the purpose of selecting compounds for purchase. specifically, pharmacophore, shape, and 2d fingerprint searches were performed on 2.4 million commercially available compounds for the initial similarity search. three pharmacophore searches were used, probing the base of the acetyl - lysine binding site, the hydrophobic shelf, and the za channel, using the structure of brd4(1) as an excluded volume (pdb i d : 3mxf). the first search contained all of the features known to contribute to the potent binding of inhibitors : two acceptors within the acetyl - binding site at the base of the pocket as well as hydrophobic substituents in the za channel and the hydrophobic shelf positions. this placed fairly tight constraints on the molecules being screened against the probe, and as a result only a few molecules were able to match these criteria. to allow for more molecules to match and to focus on the kac mimetic parts of the molecules, these constraints were relaxed by removing the requirement for the molecule to occupy the hydrophobic shelf. one further search was performed that required only one of the two acceptors within the acetyl binding site at the base of the pocket because examples of single - acceptor - atom kac mimetics are known (e.g., dihydroquinazolinone derivatives). one shape - based and one 2d fingerprint similarity search were also applied to find molecules with a similar shape and similar functional groups to the entire (+) -jq1 molecule. one additional shape - based search was also applied to (+) -jq1, with the chlorophenyl and tertiary - butyl ester removed to focus on the kac part of the binding site. each of these similarity searches was expected to identify different compounds and therefore maximize the chances of finding hits. a key step of our virtual screening approach was the use of an extensive set of substructures that we obtained from published data, intuitive design, and similarity searches, as already described. these substructures were consequently used to identify all commercially available examples of each of the substructures, employing substructure searches on the emolecules database. the results were then submitted to a second docking step and subsequent selection for purchase, as detailed below. this docking step was performed in the same manner as the one from the similarity searching branch, but it was necessary because of the different ligands present. it is important to note that this substructure search also ensured that all examples of a particular substructure of interest were identified and fed into the final docking step. this is in contrast to our experience with similarity searches where a number of representatives of a particular chemotype are frequently missed, for example, because of different tautomers, protomers, or conformers of the starting library compounds. the results of each of the substructure searches were subsequently docked against brd4(1) to predict the binding mode and to calculate a score, from which examples of each substructure can be selected for purchase. one of the limitations of using docking as a part of a virtual screen is that it generates false positives, reducing the enrichment of actives. many of the false positives, however, involve the scoring of the molecules, with the pose generation considered to be sufficiently accurate to be useful. a recent report by ferreira. these include failure to penalize high - energy conformations of the molecules as well as the presence of heteroatoms that are not engaged in favorable interactions with the receptor. using this knowledge, we defined the following criteria that are necessary to be fulfilled by a molecule and its docking pose to be considered for purchase:(1)no obvious high - energy conformations (using the csd as validation) (see the experimental section for details).(2)the majority of the heteroatoms form interactions with the receptor or are satisfied by internal hydrogen bonds, and key interactions defined by the hypothesis are formed.(3)no clashes with the receptor or vacant sites unlikely to be filled by water molecules or protein movement.(4)no reactive groups or groups known to interfere in biochemical assays. no obvious high - energy conformations (using the csd as validation) (see the experimental section for details). the majority of the heteroatoms form interactions with the receptor or are satisfied by internal hydrogen bonds, and key interactions defined by the hypothesis are formed. no clashes with the receptor or vacant sites unlikely to be filled by water molecules or protein movement. no reactive groups or groups known to interfere in biochemical assays. to implement these criteria, we manually inspected the docking poses as a pragmatic approach. this allowed for the defined criteria to be implemented quickly and each individual molecule to be considered on its own merit. at least 500 of the top ranked ligands from each docking run were inspected, and representative compounds from each scaffold that fulfilled these criteria were selected, resulting in a set of 150 compounds. our approach is heavily based on docking and extensively takes advantage of human input for the final selection of compounds. to benchmark our approach, we sought a valid control experiment to compare our results to. many retrospective analyses suggest that ligand - based methods frequently outperform the equivalent structure - based approaches when it comes to discriminating between active and inactive compounds ; therefore, we chose an experiment based on these approaches as a control. we based our selection on the same 2d fingerprint and shape - based similarity searches as the similarity searching part of our virtual screening approach starting from the entire (+) -jq1 ligand and its bound conformation to brd4(1), but in this experiment docking and subsequent visual inspection were not utilized. to select compounds and to ensure that a minimum level of diversity was achieved, the top 50 compounds from each method, ranked by similarity to (+) -jq1 with unique murcko scaffolds, were selected for purchase. one hundred compounds in total were selected using this approach in a fully automated way, and there was no overlap between the compounds selected by the control experiment and those from the virtual screen. using our virtual screening protocol detailed above and including the compounds selected from the control experiment, 250 compounds were purchased and prepared as dmso stock solutions. ten of these compounds were insoluble in dmso, and as such they were not carried forward to biochemical screening. the remaining 240 compounds were initially screened using the alphascreen assay format at a single concentration up to 250 m, depending on compound solubility. six compounds exhibited an inhibition of brd4(1), but only two of these compounds yielded an ic50 : 1 had an ic50 of 4.7 m, and 2 had an ic50 of 80.9 m. the ic50 of the remaining compounds was higher than the solubility and as such could not be determined. despite the modest activity of some of the hits, we next sought to cocrystallize all novel kac mimetics that showed significant binding, and we obtained crystal structures of four compounds bound to brd4(1). finally, we investigated derivatives of five of these compounds through purchase and synthesis, yielding compounds that showed significantly improved activity. 2 was not followed up further because of publications appearing after the virtual screen was performed detailing derivatives of this isoxazole scaffold. the structures of these hits and the data gathered for each of the compounds are summarized in table 1. the docking poses used to initially select these six compounds can be found in the supporting information, figure s2. see the experimental section for details. following hplc purification of a commercial sample. following the identification of six compounds as inhibitors of brd4(1), crystal structures of four of the compounds in the kac binding site were obtained (figure 7). this allows the binding mode to be used to design more potent analogues and to compare the docking poses to the experimentally observed binding mode that the docking was trying to predict. extremely high accuracy was attained for the docking of 3 and 4, for which the docking poses were within experimental error of the crystal structure poses (rmsd 0.30). in the case of these two compounds, the protein showed very limited movement from its conformation bound to (+) -jq1 with an rmsd of 0.37 between the model used (pdb i d : 3mxf) and each of the triazolopyrimidine bound structures, which may have contributed to the success of the docking experiment. in the case of 1 and 5, the docking predicted the experimentally observed pose of the ligand (rmsd < 2.0) but with a few subtle differences. some of these differences were the result of water molecules bridging interactions that the docking was unable to consider. comparisons between the predicted and experimentally determined poses can be seen in figure 8. details of all of the crystallographic binding modes will be discussed in the context of each of the series below. crystal - structure binding modes of four of the identified inhibitors bound to brd4(1). the right panel gives a through - protein view highlighting the binding mode of each kac mimetic. (a) compound 1, (b) compound 3, (c) compound 4, and (d) compound 5. overlay of the observed crystallographic pose (cyan carbons) with the docking pose in the model from pdb i d : 3mxf (yellow carbons) following alignment of the two proteins using moe. (a) compound 1, (b) compound 3, (c) compound 4, and (d) compound 5. compounds for which more information has been gathered will now be described. the chloropyridone scaffold was selected using the literature substructures branch derived from the known dihydroquinazolinone inhibitors. the evolution of the initial dihydroquinazolinone substructure involved the removal of the phenyl ring, and we hypothesized that the chloropyridone motif would be able to mimic the remaining dihydropyrimidone substructure (figure 9). the carbonyl and nh donor were maintained through this modification, with the chlorine atom occupying the same location as the methyl group it replaced. a substructure search performed on the emolecules database yielded 82 commercially available examples of this substructure. following the docking and selection process detailed above, 1 and 7a were selected for purchase. 1 was the most potent of the 240 compounds initially tested, with an ic50 of 4.7 m and associated le of 0.28. structurally related 7a, also tested in the original batch of 240 compounds, was found to be inactive. the only other commercially available compounds containing the chloropyridone and triazole functionalities were 7b and 7c. these were subsequently purchased and tested (table 2) and found to be significantly less active. a crystal structure of 1 bound to brd4(1) was obtained with the carbonyl of the pyridone occupying a similar position to the carbonyl oxygen of the acetyl - group of kac, forming the same interactions with the nh donor of the asn140 side chain and conserved water molecule. the chlorine atom occupies the base of the pocket that the methyl group of kac would usually occupy, and the nh donor of the pyridone forms a water - mediated hydrogen bond to the carbonyl of the conserved asn140 side chain. this is the first example of a chlorine substituent occupying the base of the kac binding pocket, which can potentially be incorporated into other templates, replacing the methyl group commonly used at this position. the remaining interactions of 1 involve the triazole that forms an interaction with one of the conserved water molecules and occupies the za - channel region of the pocket as well as hydrophobic interactions of the phenyl and pyridine rings (figure 7a). 3 and 4 both contain the same triazolopyrimidine scaffold and were initially selected on the basis of the hypothesis that they mimic kac. the observation that 3 and 4 show significant inhibition as well as, importantly, the cocrystal structures of these compounds with brd4(1) validated this hypothesis and confirmed the triazolopyrimidine as a novel kac mimetic. the triazolopyrimidine engages in the same interactions in both structures as the carbonyl of the acetyl group of kac, albeit through two nitrogen atoms compared to each lone pair of the carbonyl (figure 7). this strong complementarity is likely the reason for the accurate prediction of the docking experiment as well as for the minimal movement of the protein from the reference model (pdb i d : 3mxf). a number of commercial derivatives of this scaffold were subsequently purchased (supporting information, figure s3). gratifyingly, 8b demonstrated a substantially improved activity toward brd4(1), with an ic50 of 24 m and associated le of 0.33, demonstrating that this class of compounds can be further improved. the comparison of the matched pair compounds 4 and 8a, which only differ by the presence of an amino substitution at the triazolopyrimidine, suggested that introduction of the amino group into compounds 3 and 8b may lead to an improvement of activity. the improvement in potency can be rationalized by the observation that the amino group forms an interaction with the conserved asparagine, as seen in the crystal structure of 4 with brd4(1) (figure 7c), and completes the acceptor acceptor donor motif that is observed for published inhibitors (e.g., dihydroquinazolinones) as well as some of the other inhibitors identified here (2, but also 1 and 6 if the carbonyl is considered as 2 acceptors)., the improved activity of 8c over 4 is likely due to an interaction of the benzylamino group of 8c with the hydrophobic shelf, as observed from the crystal structures of 3 bound to brd4(1). this interaction is known to provide improvements in potency in other series of bet - family inhibitors, including (+) -jq1, and is not found in the complex of 4 with brd4(1). compound 8d shared comparable activity to 8c, showing that the methylation of the benzylic amine is not required for activity. finally, introduction of an amino group into 8b to yield 8e maintained the activity but in this case did not lead to an improvement in potency. however, compounds 8b e demonstrate that there is scope for further improvement of the initial hits 3 and 4 and that a reasonable le (0.3) can be achieved. reagents and conditions : (a) pocl3, reflux, 2 h ; (b) r1 amine, etoh, reflux, 2 h. 5 demonstrated inhibition of brd4(1), but its ic50 was lower than its solubility and could not be determined ; however, the crystal structure bound to brd4(1) revealed two interesting features. first, the acetyl group was not acting as the kac mimetic but formed an interaction with the backbone nh donor of asp88, an interaction that has not been observed in any published bromodomain crystal structure to date (figure 10). although the crystallographic orientation of the molecule was predicted by the docking pose, this particular interaction with the backbone nh donor of asp88 was not, suggesting another way in which potency and potentially selectivity can be achieved from the brd4(1) binding site. the second interesting feature of this binding mode is that the quinoline nitrogen does not appear to be forming a direct interaction with the protein. from the crystal structure, electron density could be observed in close proximity to the quinoline nitrogen (figure 11), suggesting an interaction through a bridging water molecule. interestingly, the distance between the oxygen of the water molecule and the ligand appeared to be very short (2.14), and we speculated that the active ingredient of this compound was in fact the quinoline n - oxide ; however, mass spectrometry did not detect the n - oxide. we nevertheless decided to synthesize the n - oxide 14a, and 5 was resynthesized along with it (scheme 2), and both compounds were tested for brd4(1) inhibition. the resynthesized batch of 5 demonstrated activity similar to the original sample, however, the pure n - oxide generated a significantly improved ic50 of 42 m (table 4). this is a good example of a single - atom change in a ligand resulting in the displacement of a single water molecule and achieving an increase in activity. interaction of the acetyl group of 5 with backbone donor of asp88 in brd4. alternate views of the binding mode of 5 can be seen in figure 7d. electron density of 5 including a water molecule in close proximity to the quinoline nitrogen (2fo fc map). reagents and conditions : (a) tf2o, et3n, chcl3, rt, 2 h ; (b) acetamidophenylboronic acid, pd(pph3)4, csco3, dioxane, 120 c, 30 min ; (c) mcpba, dcm, reflux, 3 h. see the experimental section for details. although pyrrolopyridone 6 demonstrated the lowest activity of the compounds initially identified as hits, it also contained the fewest heavy atoms, suggesting decent ligand efficiency despite its modest activity. in addition, it represented another example of a novel kac mimetic, and we sought to demonstrate that somewhat larger derivatives show improved inhibition. although few pyrrolopyridones were commercially available, a number of related pyrrolopyrimidones could be sourced. gratifyingly, the phenyl substituted compounds 15a and 15b showed substantially improved activities, with an le above 0.3 (table 5). this improvement in potency is consistent with the phenyl ring occupying the za channel, as would be expected from the docking pose of 6 (supporting information, figure s2). see the experimental section for details. within our virtual screening approach, two branches were used : the literature substructures and similarity searching branches. as hypothesized, overall, a hit rate of 2.5% was achieved for all of the compounds tested, and a hit rate of 4.2% was achieved for the 143 compounds selected by our virtual screening approach (table 6). strikingly, all of the active compounds had been identified from our virtual screen rather than from the control experiment, highlighting the success of the approach. we believe that the superiority of our virtual screening approach compared to the control branch is due to several factors. first of all, our kac mimetic approach reduced the number of commercially available compounds sufficiently to enable docking, yet it ensured that a large number of kac mimetics were taken forward into the docking step. second, the application of docking rather than just a similarity search ensured that the purchased compound have a high likelihood of meeting the tight geometric constraint of the kac binding site. finally, our extensive manual filtering and human input after docking removed several potential false positives. within the compounds selected by the virtual screen, 76 came from the literature substructures approach and two hits were identified. sixty seven compounds came from the similarity searching approach, from which four of the six actives were identified. four kac mimetics that were unprecedented for bromodomain inhibition were discovered, fulfilling the main goal of this work. we initially expected that the literature substructures branch would yield the higher hit rate because of the presence of validated and structurally related warheads. interestingly, this turned out not to be the case, with a higher hit rate being achieved by the similarity searching branch. a possible reason for this observation is that the published inhibitors are optimized for the brd4(1) binding site and possess good shape - complementarity as well as a kac mimetic warhead. compounds selected for the literature substructures branch possessed this warhead, but without optimization suboptimal binding in the upper part of the pocket may have abrogated any activity. we describe a structure - based virtual screening approach to identify inhibitors of bromdomains together with the validation of this approach, resulting in the discovery of novel inhibitors of brd4(1). the key elements of this approach are the extensive design and use of substructure queries to compile a set of commercially available compounds featuring novel putative kac mimetics followed by subjection of this set to docking for final compound selection. using this approach, we selected and tested 143 compounds and identified novel hits, including four unprecedented acetyl - lysine mimetics. a control experiment that failed to identify hits however, through use of cocrystal structures and structure - based design, we were able to improve the potency considerably into a range frequently found for screening hits. this work is therefore a good example of how novel but initially modestly potent compounds are identified with a fast and very limited screening effort and then quickly optimized through the use of cocrystal structures. because of the similarity between bromodomain binding sites and the focus on the kac mimetic, this approach is applicable to the large fraction of bromodomains for which structural information of sufficient resolution is available. furthermore, we believe that the novel kac mimetics disclosed here will serve as valuable starting points for the development of potent inhibitors of brd4(1) and other related bromodomains. we used the icr vendor collection, which is a library of 2.4 million commercially available compounds from 11 vendors for which details have been described by langdon. single protonation states were generated using filter. at the time of performing the virtual screen against brd4(1), the only inhibitors published were the triazolodiazepines, bic1, and simple dihydroquinazolinones. a number of published structures were available, but the only suitable ligand - bound structures were with triazolodiazepines. for this reason, the structure used for the virtual screen was that of (+) -jq1 bound to the brd4(1) (pdb i d : 3mxf), which was used in the structure - based pharmacophore searches and the bound pose of (+) -jq1 for shape - based similarity searches, and it was also the structure used for the docking experiments. water molecules with the following uids were treated as part of the pocket for docking experiments and pharmacophore excluded volumes : 9, 12, 15, 23, 33, and 209. we performed three pharmacophore searches on the basis of the (+) -jq1 molecule bound to brd4(1) (pdb i d : 3mxf) using the receptor as an excluded volume. the first pharmacophore was the most complex containing five points, including two acceptors from the triazole ring of (+) -jq1, a hydrophobic substituent for the methyl group at the base of the pocket, and two further hydrophobic substituents at the za - channel and hydrophobic shelf positions of the binding site. this pharmacophore characterized each feature known to significantly contribute to the potency of (+) -jq1 and found just 6540 matching ligands. the next pharmacophore was a derivative of the first, relaxing the requirement for both acceptors on the triazole ring to just one of the two. the third pharmacophore was also a derivative of the first one, but this time with the pharmacophoric point corresponding to the hydrophobic shelf removed. again this increased the number of matching ligands but not as significantly as for the second pharmacophore to 41 890. (a) pharmacophore searches 1 and 2 (with 2 requiring only one acceptor). we performed two shape - based similarity searches : one on the full (+) -jq1 ligand in its bound conformation from pdb i d 3mxf and one on a reduced version of the ligand with the ester and chlorophenyl groups removed to focus on the kac mimetic part of the binding site (figure 13). both searches were performed with two acceptor pharmacophore points from the triazole part of the (+) -jq1 ligand. the top 100 000 compounds ranked by the tanimotocombo scoring function from each search were taken through to subsequent docking steps. shape - based similarity searches used with acceptor pharmacophoric points included (red spheres). a single 2d similarity search was performed using the ecfp4 fingerprint and the (+) -jq1 ligand as a template in pipeline pilot. the top 100 000 ligands ranked by tanimoto similarity were taken through to subsequent docking steps. the structure was preprocessed using the protein preparation wizard in maestro, with the assign bond orders, create disulfide bonds, and convert selenomethionines to methionines options selected. grids for glide docking were then generated using the receptor grid generation tool in maestro using an enclosing box of size 20 around the center of (+) -jq1 and other settings left at the default. docking was performed using glide with default settings. for more than 5000 ligands, the compounds were initially docked using glide in htvs mode and the 5000 top ranked compounds by glidescore were docked using glide in sp mode. for fewer than 5000 ligands, water molecules included were treated as rigid, with hydrogen positions used as defined by the protonate3d step. to analyze the observed dihedral angle of certain substructures in the csd, initial substructure searches and the dihedral in question were defined using conquest and the data output and analyzed using vista. a high - energy conformation was defined as one that possessed a dihedral angle not observed in the csd for sufficiently populated substructures. all reagents were diluted in 50 mm hepes, 100 mm nacl, 0.1% bsa, ph 7.4 supplemented with 0.05% chaps and allowed to equilibrate to room temperature prior to addition to plates. a 24-point 1:2 serial dilution of the ligands was prepared over the range of 1500 m, and 4 l was transferred to low - volume 384-well plates (proxiplatetm-384 plus, perkinelmer) followed by 4 l of his - tagged protein (brd4(1), 250 nm). the plates were sealed and incubated at room temperature for 30 min before the addition of 4 l of biotinylated peptide at an equimolar concentration to the protein (the peptide used for brd4(1) : h - sgrgk(ac)ggk(ac)glgk(ac)ggak(ac)rhrk(biotin)-oh ; cambridge research biochemicals, uk). the plates were sealed and incubated for a further 30 min before the addition of 4 l of streptavidin - coated donor beads (25 g / ml) and 4 l of nickel chelate acceptor beads (25 g / ml) under low - light conditions. the plates were foil sealed to protect from light, incubated at room temperature for 60 min, and read on a pherastar fs plate reader (bmg labtech) using an alphascreen 680 excitation/570 emission filter set. ic50 was calculated in prism 5 (graphpad software) after normalization against corresponding dmso controls, and they are given as the final concentration of compound in the 20 l reaction volume. aliquots of the purified proteins were set up for crystallization using a mosquito crystallization robot (ttp labtech). coarse screens were typically set up onto greiner 3-well plates using three different drop ratios of precipitant to protein per condition (100 + 50, 75 + 75, and 50 + 100 nl). all crystallizations were carried out using the sitting - drop vapor - diffusion method at 4 c. brd4(1) crystals with 1 were grown by mixing 150 nl of protein (9.9 mg / ml and 5 mm final ligand concentration) with an equal volume of reservoir solution containing 0.2 m sodium sulfate, 0.20 m nabr, 0.1 m btprop ph 8.5, 20.0% peg6k, 10.0% ethylene glycol. brd4(1) crystals with 3 were grown by mixing 100 nl of protein (9.0 mg / ml and 5 mm final ligand concentration) with 200 nl of reservoir solution containing 0.20 m na(malonate), 0.1 m btprop ph 8.5, 20.0% peg3350, 10.0% ethylene glycol. brd4(1) crystals with 4 were grown by mixing 150 nl of the protein (9.0 mg / ml and 10 mm final ligand concentration) with an equal volume of reservoir solution containing 0.20 m na2so4, 20.0% peg3350 and 10.0% ethylene glycol. brd4(1) crystals with 5 were grown by mixing 150 nl of protein (9.9 mg / ml and 5 mm final ligand concentration) with an equal volume of reservoir solution containing 0.2 m sodium sulfate, 0.20 m licl, 0.1 m tris ph 8.0, 20.0% peg6k, 10.0% ethylene glycol. in all cases, diffraction - quality crystals grew within a few days. all crystals were cryo - protected using the well solution supplemented with additional ethylene glycol and were flash frozen in liquid nitrogen. data were collected in - house on a rigaku fre rotating anode system equipped with a raxis - iv detector at 1.52. indexing and integration was carried out using mosflm, and scaling was performed with scala. initial phases were calculated by molecular replacement with phaser using the known model of brd4(1) (pdb i d : 2oss). initial models were built by arp / warp followed by manual building in coot. thermal motions were analyzed using tlsmd, and hydrogen atoms were included in late refinement cycles. data collection and refinement statistics can be found in the supporting information, table s1. the models and structure factors have been deposited with pdb accession codes 4mep (brd4(1)/ compound 1), 4men (brd4(1)/ compound 3), 4meq (brd4(1)/ compound 4), and 4meo (brd4(1)/ compound 5). commercially available column chromatography was performed on a biotage sp1 purification system using biotage flash silica cartridges. semiprep hplc purification was achieved using 1000 l standard injections (with needle rinse) of the sample at a 20 mg / ml concentration in dmso onto a phenomenex gemini column (10 m, 250 21.2 mm, c18, phenomenex). chromatographic separation at room temperature was carried out using a gilson gx-281 liquid handler system combined with a gilson 322 hplc pump (gilson) over a 15 min gradient elution (grad15 min20mlslipo.m) from 40:60 to 100:0 methanol / water (both modified with 0.1% formic acid) at a flow rate of 20 ml / min. vis spectra were acquired at 254 nm on a gilson 156 uv vis detector (gilson). collection was triggered by uv signal and collected using a gilson gx-281 liquid handler system (gilson). lc ms and hrms analysis was performed on an agilent 1200 series hplc and diode array detector coupled to a 6210 time - of - flight mass spectrometer with dual multimode apci / esi source. analytical separation was carried out at 30 c on a merck purospher star column (rp-18e, 30 4 mm) using a flow rate of 1.5 ml / min in a 4 min gradient elution with detection at 254 nm. the mobile phase was a mixture of methanol (solvent a) and water containing formic acid at 0.1% (solvent b). gradient elution was as follows : 1:9 (a / b) to 9:1 (a / b) over 2.5 min, 9:1 (a / b) for 1 min, and then reversion back to 1:9 (a / b) over 0.3 min, and finally 1:9 (a / b) for 0.2 min. samples were prepared as solutions in a deuterated solvent and referenced to the appropriate internal nondeuterated solvent peak or tetramethylsilane. compound 1 was purchased as a 5 mg solid sample from chembridge (supplier i d 25722975). h nmr (500 mhz, dmso) 2.21 (s, 3h), 7.45 (s, 1h), 7.477.55 (m, 4h), 7.66 (t, 1h), 7.72 (s, 1h), 8.07 (d, 1h), 8.11 (d, 2h), 8.51 (d, 1h). hrms m / z calcd for c19h15cln5o [m + h ], 364.0960 ; found, 364.0961. compound 2 was purchased as a 5 mg solid sample from key organics ltd. h nmr (500 mhz, dmso) 2.13 (s, 3h), 6.93 (s, 2h), 7.547.65 (m, 4h). hrms m / z calcd for c11h10f3n2o [m + h ], 243.0740 ; found, 243.0741. h nmr (500 mhz, cdcl3) 2.37 (s, 3h), 2.60 (s, 3h), 3.20 (s, 3h), 5.31 (s, 2h) 6.07 (s, 1h), 7.137.20 (m, 4h), 8.34 (s, 1h). hrms m / z calcd for c15h18n5 [m + h ], 268.1557 ; found, 268.1558. compound 4 was purchased as a 5 mg solid sample from princeton biomolecular research inc. h nmr (500 mhz, dmso) 6.34 (s, 2h), 7.18 (s, 1h), 7.577.63 (m, 3h), 8.14 (d, 2h). the methyl peak was not observed and was expected to be below the dmso peak. hrms m / z calcd for c12h12n5 [m + h ], 226.1087 ; found, 226.1091. compound 5 was initially purchased as a 5 mg solid sample from chembridge (supplier i d 50866471). h nmr (500 mhz, dmso) 2.07 (s, 3h), 7.21 (d, 1h), 7.36 (s, 1h), 7.487.56 (m, 2h), 7.70 (d,1h), 7.75 (t, 1h), 7.81 (s, 1h), 7.84 (d, 1h), 8.01 (d, 1h), 10.14 (s, 1h). hrms m / z calcd for c18h16n2o [m + h ], 277.1335 ; found, 277.1333. triflic anyhydride (0.95 ml, 5.65 mmol) was added to a solution of 2-methylquinolin-4-ol 12 (750 mg, 4.71 mmol) and triethylamine (0.66 ml, 4.71 mmol) in anhydrous dcm (5 ml) under nitrogen and stirred for 2 h. the reaction mixture was concentrated in vacuo. the resulting purple oil was purified by column chromatography (etoac to 5% meoh in etoac) to afford title compound (863 mg, 63%). lc ms (esi, m / z) tr 2.82 min, 292.18 [m + h ]. h nmr (500 mhz, cdcl3) 2.87 (s, 3h), 7.35 (s, 1h), 7.68 (t, 1h), 7.86 (t, 1h), 8.05 (d, 1h), 8.17 (d, 1h). n-(3-(2-methylquinolin-4-yl)phenyl)acetamide (5). to a solution of 2-methylquinolin-4-yl trifluoromethanesulfonate 13 (280 mg, 0.79 mmol) in dioxane / water (2:1, 4.5 ml) were added acetamidophenylboronic acid (283 mg, 1.58 mmol), tetrakis triphenylphosphine palladium (45.6 mg, 0.04 mmol), and cesium carbonate (386 mg, 1.185 mmol). the reaction mixture was heated at 120 c for 30 min under microwave conditions. the reaction mixture was diluted with etoac (20 ml) and washed with water (20 ml). the aqueous layer was re - extracted with etoac (20 ml), and the combined organic layers were dried (mgso4) and concentrated in vacuo. the residue was purified by column chromatography (20% etoac in hexane to 100% etoac) to afford the title compound (141 mg, 65%). lc ms (esi, m / z) tr 1.97 min, 277.13 [m + h ]. h nmr (500 mhz, cdcl3) 2.23 (s, 3h), 2.81 (s, 3h), 7.237.29 (m, 2h), 7.447.57 (m, 3h), 7.647.74 (m, 3h), 7.89 (d,1h), 8.15 (d, 1h). hrms m / z calcd for c18h17n2o [m + h ], 277.1335 ; found, 277.1336. h nmr (500 mhz, dmso) 4.05 (s, 3h), 6.24 (d, 1h), 6.39 (d, 1h), 6.81 (t, 1h), 7.26 (d, 1h), 10.81 (s, 1h). hrms m / z calcd for c8h9n2o [m + h ], 149.0709 ; found, 149.0709. 3-chloro-5-(3-isopropyl-1-(3-methylpyridin-4-yl)-1h-1,2,4-triazol-5-yl)pyridin-2(1h)-one (7a). compound 7a was purchased as a 5 mg solid sample from chembridge (supplier i d 90638099). h nmr (500 mhz, dmso) 1.24 (m, 1h), 1.32 (d, 6h), 2.08 (s, 3h), 7.34 (s, 1h), 7.47 (d, 1h), 7.68 (s, 1h), 8.59 (d, 1h), 8.71 (s, 1h). hrms m / z calcd for c16h17cln5o [m + h ], 330.1116 ; found, 330.1114. compound 7b was purchased as a 5 mg solid sample from chembridge (supplier i d 95921162). h nmr (500 mhz, dmso) 0.930.99 (m, 7h), 2.07 (s, 2h), 4.29 (s, 4h), 6.90 (d, 1h), 6.977.03 (m, 2h), 7.41 (s, 1h), 7.69 (s, 1h). hrms m / z calcd for c19h20cln4o3 [m + h ], 387.1218 ; found, 387.1207. compound 7c was purchased as a 5 mg solid sample from chembridge (supplier i d 26575894). h nmr (500 mhz, dmso) 2.34 (s, 3h), 7.367.42 (m, 3h), 7.517.57 (m, 2h), 7.66 (s, 1h). hrms m / z calcd for c14h11clfn4o [m + h ], 305.0600 ; found, 305.0592. h nmr (500 mhz, dmso) 7.56 (s, 1h), 7.627.69 (m, 3h), 8.158.20 (m, 2h), 8.63 (s, 1h). the methyl peak was not observed and was expected to be below the dmso peak. hrms m / z calcd for c12h11n4 [m + h ], 211.0978 ; found, 211.0976. h nmr (500 mhz, dmso) 3.13 (s, 3h), 5.39 (s, 2h), 6.44 (s, 1h), 7.00 (s, 2h), 8.49 (s, 1h). the methyl peak was not observed and was expected to be below the dmso peak. hrms m / z calcd for c12h13cln5s [m + h ], 294.0575 ; found, 294.0571. 2-amino-5-methyl - triazolo[1,5-a]pyrimidin-7(3h)-one 9 (500 mg, 3.028 mmol) was added to cooled (0 c), stirring pocl3 (3 ml). the reaction mixture was allowed to warm to rt and was heated to reflux for 2 h. the reaction mixture was concentrated in vacuo, and the residue was dissolved in dcm (20 ml). water (20 ml) was added, and the resultant precipitate was isolated by filtration. the residue was purified by triturating with dcm and used in subsequent reactions without further purification (345 mg, 62%). lc ms (esi, m / z) tr 1.15 min, did not ionize [m + h ]. h nmr (500 mhz, tfa) 2.91 (s, 3h), 7.72 (s, 1h). n - methyl-1-(p - tolyl)methanamine. 4-methylbenzyl chloride (0.933 ml, 7.112 mmol) was added to a solution of 40% aqueous methylamine (10 ml, 18.031 mmol) in etoh (10 ml) and stirred at rt for 12 h. the reaction mixture was concentrated in vacuo, the residue was dissolved in water (20 ml), and the ph adjusted to 12 with 2 m naoh. the resulting yellow oil was purified by reverse - phase c18 flash column chromatography (water) to afford the title compound (112 mg, 12%). lc ms (esi, m / z) tr 0.85 min, 136.11 [m + h ]. h nmr (500 mhz, cdcl3) 2.36 (s, 3h), 2.46 (s, 3h), 3.73 (s, 2h), 7.15 (d, 2h), 7.22 (d, 2h). 7-chloro-5-methyl - triazolo[1,5-a]pyrimidin-2-amine 10 (50 mg, 0.275 mmol) was added to a stirred solution of n - methyl-1-(p - tolyl)methanamine (74 mg, 0.55 mmol) and k2co3 (38 mg, 0.275 mmol) in anhydrous ethanol (0.5 ml). the reaction mixture was heated to reflux for 2 h. the reaction mixture was concentrated in vacuo, and the residue was dissolved in etoac (10 ml) and water (10 ml). the aqueous layer was re - extracted with etoac (10 ml), and the combined organic layers were dried (mgso4) and concentrated in vacuo. the residue was purified using an scx-2 column (meoh) to afford the title compound (5.63 mg, 42%). lc ms (esi, m / z) tr 2.63 min, 283.17 [m + h ]. h nmr (500 mhz, cdcl3) 2.36 (s, 3h), 2.49 (s, 3h), 3.08 (s, 3h), 4.66 (brs, 2h), 5.19 (s, 2h), 5.94 (s, 1h), 7.12 (d, 2h), 7.15 (d, 2h). hrms m / z calcd for c15h19n6 [m + h ], 283.1666 ; found, 283.1665. 7-chloro-5-methyl - triazolo[1,5-a]pyrimidin-2-amine 10 (50 mg, 0.275 mmol) was added to a stirred solution of p - tolylmethanamine (1.36 mmol) and k2co3 (38 mg, 0.275 mmol) in anhydrous ethanol (0.5 ml). the reaction mixture was heated to reflux for 2 h, with reaction progress monitored by lc ms. the residue was dissolved in ethyl acetate (10 ml) and water (10 ml). the aqueous layer was re - extracted with ethyl acetate, and the combined organic layers were dried (mgso4) and concentrated in vacuo. the residue was purified by column chromatography (0% meoh in etoac to 20% meoh in etoac) to afford the title compound (31 mg, 42%). lc ms (esi, m / z) tr 2.47 min, 269.15 [m + h ]. h nmr (500 mhz, cdcl3) 2.38 (s, 3h), 2.48 (s, 3h), 4.51 (d, 2h), 4.61 (brs, 2h) 5.94 (s, 1h), 6.14 (s, 1h), 7.21 (d, 2h), 7.24 (d, 2h). hrms m / z calcd for c14h17n6 [m + h ], 269.1509 ; found, 269.1510. 7-chloro-5-methyl - triazolo[1,5-a]pyrimidin-2-amine 10 (50 mg, 0.275 mmol) was added to a stirred solution of 1-(5-chlorothiphen-2-yl)-n - methylmethanamine (111 mg, 0.688 mmol) and k2co3 (38 mg, 0.275 mmol) in anhydrous ethanol (0.5 ml). the reaction mixture was heated to reflux for 2 h, with reaction progress monitored by lc the residue was dissolved in ethyl acetate (10 ml) and water (10 ml). the aqueous layer was re - extracted with ethyl acetate, and the combined organic layers were dried (mgso4) and concentrated in vacuo the residue was purified by column chromatography (0% meoh in dcm to 10% meoh in dcm) to afford the title compound (4.32 mg, 42%). lc ms (esi, m / z) tr 2.71 min, 309.07 [m + h ]. h nmr (500 mhz, cdcl3) 2.50 (s, 3h), 3.07 (s, 3h), 4.75 (brs, 2h), 5.29 (s, 2h), 5.95 (s, 1h), 6.77 (m, 2h). hrms m / z calcd for c12h14cln6s [m + h ], 309.0684 ; found, 309.0684. mcpba (37.5 mg, 0.317 mmol) was added slowly to a stirring solution of n-(3-(2-methylquinolin-4-yl)phenyl)acetamide 5 (50 mg, 0.181 mmol) in anhydrous dcm (1.3 ml). the reaction mixture was heated at 45 c for 3 h. the reaction mixture was cooled to room temperature and quenched with aq sat. the reaction mixture was extracted with dcm (2 10 ml), dried (mgso4), and concentrated in vacuo. the residue was purified by column chromatography (0% meoh in dcm to 10% meoh in dcm) to afford the title compound (7.2 mg, 14%). lc ms (esi, m / z) tr 2.61 min, 293.13 [m + h ]. h nmr (500 mhz, cdcl3) 2.17 (s, 3h), 3.04 (s, 3h), 7.19 (d, 1h), 7.28 (s, 1h), 7.46 (t, 1h), 7.607.66 (m, 2h), 7.69 (d, 1h), 7.86 (t, 1h), 7.97 (d, 1h), 8.10 (brs, 1h), 8.82 (d, 1h). hrms m / z calcd for c18h17n2o2 [m + h ], 293.1285 ; found, 293.1287. compound 15a was purchased as a 5 mg solid sample from sigma - aldrich (supplier cnc i d 310754082). h nmr (500 mhz, dmso) 2.30 (s, 3h), 4.03 (s, 3h), 7.18 (d, 2h), 7.80 (d, 1h), 7.85 (s, 1h), 7.89 (d, 2h), 12.15 (s, 1h). hrms m / z calcd for c14h13n3o [m + h ], 240.1131 ; found, 240.1133. compound 15b was purchased as a 5 mg solid sample from sigma - aldrich (supplier cnc i d 310754657). h nmr (500 mhz, dmso) 4.08 (s, 3h), 7.22 (t, 2h), 7.87 (1h, s), 7.88 (1h, s), 8.06 (2h, dd), 12.03 (1h, s). hrms m / z calcd for c13h11fn3o [m + h ], 244.0881 ; found, 244.0877. | bromodomains (brds) are epigenetic readers that recognize acetylated - lysine (kac) on proteins and are implicated in a number of diseases. we describe a virtual screening approach to identify brd inhibitors. key elements of this approach are the extensive design and use of substructure queries to compile a set of commercially available compounds featuring novel putative kac mimetics and docking this set for final compound selection. we describe the validation of this approach by applying it to the first brd of brd4. the selection and testing of 143 compounds lead to the discovery of six novel hits, including four unprecedented kac mimetics. we solved the crystal structure of four hits, determined their binding mode, and improved their potency through synthesis and the purchase of derivatives. this work provides a validated virtual screening approach that is applicable to other brds and describes novel kac mimetics that can be further explored to design more potent inhibitors. |
long - term exposure to high concentrations of lead results in renal dysfunction. during a prospective study of environmental lead and pregnancy outcomes in 1502 women residing in two towns in yugoslavia, we explored whether moderate exposure to lead results in increased rates of proteinuria. the geometric mean blood lead concentrations (bpb) were 17.1 and 5.1 micrograms / dl in the smelter and nonexposed towns, respectively. increases in bpb were associated with increased odds ratios for both trace and > or = 1 + proteinuria, measured using a urinary dipstick. comparing the women in the upper 10th percentile of exposure to those in the lowest 10th percentile, the adjusted odds ratio for > or = 1 + proteinuria was 4.5 (95% ci 1.5, 13.6). similarly, the adjusted odds ratio for trace proteinuria was 2.3 (95% ci 1.3, 4.1). similar to other studies showing associations between chronic exposure to lead and renal dysfunction, our data suggest that long - term exposure to environmental lead may be associated with proteinuria.imagesfigure 1.figure 2. |
|
the aging of the world population is expected to be accompanied by increased pneumococcal pneumonia in older adults. to address this, the community - acquired pneumonia immunization trial in adults (capita), a large, randomized, placebo - controlled trial conducted to assess the 13-valent pneumococcal conjugate vaccine (pcv13) in adults 65 years, found statistically significant vaccine efficacy for first episodes of vaccine - type community - acquired pneumonia (vt - cap ; 46%), nonbacteremic / noninvasive vt - cap (45%), and vt invasive pneumococcal disease (75%), along with an acceptable safety profile. study results were presented to the us advisory committee on immunization practices in june 2014, which subsequently recommended sequential pcv13 and 23-valent pneumococcal polysaccharide vaccination for adults 65 years. thus, appropriate protection of adults at risk for pneumococcal cap will include vaccination with pcv13. |
|
alkylsilanes are known to self - assemble at the surface of oxide materials. this ability has been widely exploited, for example, to tune the wetting and electronic transport properties of the surface. furthermore, alkylsilanes are often used as coupling agents for attaching organic moieties or nanoparticles to the oxide surface, forming tailored three - dimensional supramolecular arrays. in this respect, aminoalkylsilanes, such as (3-aminopropyl)triethoxysilane (aptes, scheme 1), have been extensively employed. the ability to control the surface properties of technologically relevant materials, such as tio2, opens new perspectives in cutting - edge industrial sectors, such as microelectronics, sensors, and photovoltaics. furthermore, surface functionalization of tio2 has been recently employed to immobilize specific biomolecules, paving the way toward the design of novel chemical sensors and biosensors, drug release systems, and materials with increased biocompatibility. to this end, alkylsilanes such as aptes are ideal linker candidates because they can be selectively photodegraded to prompt the controlled release of proteins, enzymes, and bioactive molecules. moreover, by irradiating the silane - functionalized tio2 surface through a patterning mask, a site - selective degradation of the organic layer can be obtained, for example producing patterns with wetting contrast ; the resulting patterns can be used to assemble complex, hierarchical structures where metal nanoparticles, polymers, or biological molecules are chemisorbed to specific surface sites. light irradiation of silane - functionalized tio2 can also be used as a trigger to activate the on - demand controlled release of active substances from stimulus - responsive pickering emulsions. despite the increasing interest in aptes - functionalized tio2, no general consensus exists on the structure of the organic inorganic interface. several models have been proposed, mostly in the case of sio2 substrates, such as hydrogen bond - mediated coupling of nh2 (or nh3) and surface oh (or o) groups or direct chemisorption via the silane headgroup, with the further complication of the possible formation, to various extents, of o si o si qualitative estimates of the relative number of various aptessurface interaction modes are usually drawn by comparing the intensities of xps peaks in the n 1s region. however, the presence of surface contaminants makes an accurate quantification on this basis a very difficult task. also, the exact attribution of the measured xps chemical shift to the putative state of the surface nitrogen species is a debated aspect. the silane surface interaction mode is a crucial aspect for the development of advanced composite materials because it determines whether nh2 terminal groups are available to react with electrophilic species, allowing further functionalization through standard chemical procedures, and it has been shown to depend crucially on the substrate type and functionalization conditions. in this work, we aim to shed light on the preferred interaction modes of aptes molecules with the tio2 surface. synchrotron xps and nexafs experiments were complemented by afm, hr - tem, and ft - ir measurements on pristine and aptes - functionalized nanocrystalline tio2. high - level plane - wave (pw) density functional theory (dft) calculations were also performed to simulate possible arrangements of the chemisorbed aptes molecules at the tio2 surface. finally, afm, ftir, xps, and nexafs measurements on ex situ solar - irradiated samples on the time scale of an hour allowed us to go a step further with respect to a purely static picture, providing information on the photoinduced oxidation mechanism of the organic layer. it is worth noting that the silane oxidation pathway has been scarcely investigated in the literature, whereas its study represents a crucial issue for a series of applications involving a light - triggered response, such as the use of these hybrids as nanocarriers for drug release. all chemicals were purchased from sigma - aldrich with reagent - grade purity and used as received ; doubly distilled water passed through a milli - q apparatus was utilized. the tio2 substrate film was deposited on a commercial ito layer (sigma - aldrich, 812 /sq) as reported elsewhere. the procedure was repeated two times to obtain a 150-nm - thick tio2 film. as specified elsewhere, the grazing incidence x - ray diffraction confirmed that it consisted mainly of the anatase polymorph. to remove surface contaminants by photocatalytic oxidation and promote extensive surface hydroxylation, the bare tio2 film underwent extensive photo - oxidation by uv irradiation through an iron - halogenide lamp (jelosil hg500, effective power density 58 mw cm between 300 and 400 nm). water contact angle measurements served as a probe for the completeness of the oxidation process : uv irradiation was stopped when complete wetting was observed. finally, the film was placed, together with a teflon cup filled with aptes diluted in toluene (150 l of 2 m solution), in a glass bottle under a dry n2 atmosphere to avoid aptes gelation. the bottle was kept in an oven at 80 c for 2 h. subsequently, the film was sonicated in toluene for 15 min and then blown dry with an n2 gas stream. the final water contact angle, as determined by a krss easy drop apparatus, was 55 5. the photocatalytic degradation of the aptes layer was studied by irradiating aptes - tio2 films with simulated solar light using a halogen lamp (lot oriel, effective power density 15 mw cm in the range of 300800 nm). the degradation of the hydrophobic layer was monitored by water contact angle measurements (krss easy drop). three different irradiation times (t = 0, 30, and 60 min, corresponding to initial, intermediate, and ca. 0 water contact angle values) were selected as relevant benchmarks to study the reaction. to ensure consistency, all of the irradiated samples were obtained from the same functionalized tio2 film, which was cut in pieces, and each piece was irradiated for a different time. the bare and aptes - functionalized tio2 films were analyzed by atomic force microscopy (afm) with a ntegra aura (nt - mdt) device in tapping mode, equipped with nsc35/aibs tips (masch). the adsorbed species at the surface of aptes - functionalized anatase tio2 during photocatalytic degradation were analyzed by fourier transform infrared (ft - ir) spectroscopy using a perkinelmer spectrum 100 ft - ir (atr) spectrometer. x - ray spectroscopy (xps) and near - edge x - ray absorption fine structure (nexafs) experiments were carried out at the bending magnet source of the materials science beamline at the elettra synchrotron in trieste. full technical details are reported in section s1.1 of the supporting information, si. the adsorption geometries of aptes molecules at the most stable (101) anatase tio2 surface were investigated by dft + u calculations using the generalized gradient approximation (gga) with the perdew burke ernzerhof (pbe) parametrization of the exchange and correlation functional, as implemented by the vasp plane - wave program. afm scans on unfunctionalized tio2 (figure 1a) show a homogeneous surface with low roughness (estimated root - mean - square, rms, on a 10 10 m area < 1 nm). aptes - bearing surfaces (figure 1b) show a homogeneous coverage consistent with the formation of an aptes monolayer (see also section 3.2). the few nanometric aggregates in figure 1b are attributable to contamination and residues from the preparation process. the effect of simulated solar light irradiation was also investigated (figure 1c, d). after 30 min, the surface appears less homogeneous, with appreciable aggregates (figure 1c) whose presence might be related to the occurrence of either vertical polymerization among physisorbed aptes or their degradation residues. the increased hydrophilicity of tio2 upon irradiation can easily result in the presence of adsorbed water molecules, which might promote such polymerization. prolonged irradiation (figure 1d) results instead in a more homogeneous and polished surface, as shown by rms values, which might be indicative of (almost) complete aptes degradation. afm topography images of bare tio2 (a), aptes - functionalized tio2 (b), and aptes - tio2 after 30 min (c) and 60 min (d) of light irradiation. the corresponding rms roughness estimates are (a) 0.56, (b) 0.75, (c) 1.46, and (d) 1.18 nm. reference unfunctionalized tio2 was first analyzed to investigate the effect of surface contaminants on the recorded signals. to this end, xps spectra were collected before and after sputtering by ar ions for 10 min. comparing the xps spectra of the as - synthesized and sputtered tio2 layers shows that adventitious surface c and n species are indeed present, which are almost entirely removed after sputtering (figure s2). these species are likely ascribable to the fast adsorption of atmospheric contaminants at the bare tio2 surface because of its well - known photoinduced amphiphilic behavior. in the unfunctionalized substrate, before sputtering (figure 2a) the ti 2p region is characteristic of ti(iv) (ti 2p3/2 458.7 ev, = 5.7 ev). the o / ti ratio is close to the theoretical value of 2 (table 1). upon surface functionalization with aptes (figure 2a), the ti signals shift to a slightly lower b.e. (= 0.3 ev), which is indicative of more electron - rich ti atoms. furthermore, in agreement with previous reports, the ti peaks also show a slight decrease in intensity. if significant, the latter might be attributed to the attenuation of the signal due to the limited inelastic mean free path of electrons, i.e., the probe depth of xps, because in functionalized samples they have to cross the adsorbed alkylsilane layer before reaching the detector. it should be underlined that the detected xps signals contain information on both the aptes layer and the underlying oxide because they show both organic species and surface ti ions. this is expected on the basis of the probe depth of the emitted photoelectrons considered here (5.36.5 for kinetic energies in the range of 50170 ev). note that these probe depths are comparable to the monolayer thickness in the limiting case of fully grafted aptes molecules normal to the surface at the maximum extension of the linear hydrocarbon chain (see also section 3.5). these findings, together with the homogeneity of the afm image of aptes - tio2 (figure 1a), are consistent with the formation of a monolayer. high - resolution xp spectra of the pristine (dotted line) and aptes - functionalized tio2 (solid line) as a function of irradiation time (0, 30, and 60 min) : ti 2p (a) and o 1s (b). estimated standard deviations are given in parentheses. upon ex situ light irradiation, a progressive shift of the ti 2p peaks toward higher binding energy (b.e.) takes place along with an increase in ti relative content, i.e., the effects of aptes functionalization are reversed. after 60 min of irradiation, an almost full recovery of the chemical states of near - surface transition - metal ions is observed. as for the o 1s signal (figure 2b), surface this is likely the signature of surface band bending, which determines the formation of a negative space charge layer and implies that ti ions achieve a more reduced state, also according to paw - dft outcomes (section 3.5.2). furthermore, a marked increase in the component at higher b.e. is appreciable, which seems to be related to a component at 532.3 ev (table s1) possibly ascribable to c o bonds of surviving ethoxy moieties. accordingly, the o / ti ratio increases upon functionalization with aptes from 2.2 to 2.7 (table 1). this is due to the silane stoichiometry (scheme 1), which brings 3 atoms of oxygen per si center, and implies an incomplete condensation of the ethoxy functionalities with surface hydroxyl groups. however, a higher o content might imply either the presence of unhydrolyzed ethoxy groups or uncondensed si furthermore, upon light irradiation the o / ti ratio increases to 3.0 (table 1) and the intensity of the components ascribable to oh and c o species also increases with respect to the pure oxide (table s1). these observations might be related to the expected increase in surface hydroxylation upon light irradiation as well as to the progressive oxidation of the alkyl chain of aptes. moreover, the presence of organic c o features in the c 1s region, whose relative weight decreases upon irradiation (table s1) with respect to the c = o peak (figure s5 and table s3). the si 2p region (figure 3a) in aptes - tio2 shows an 1.85 ev - wide peak at 102.2 ev, which could be indicative of different environments around the si atom. the si / ti ratio is 0.6 (table 1), in agreement with previous reports of aptes monolayers on tio2. upon solar irradiation, the signal shifts to higher b.e. as a result of further oxidation of the adsorbate. interestingly, the si / ti ratio remains almost unchanged with respect to the nonirradiated sample. figure 3b shows the high - resolution xp spectra of the n 1s region for the pristine and functionalized tio2 samples. partial surface contamination due to n - containing species is unavoidable, and indeed a weak n 1s peak at around 400.3 ev is already present in the unfunctionalized tio2 film (feature marked as i in figure 3b). literature studies report several conflicting attributions to this component, e.g., surface n2 or amides. when aptes is added, however, organic nitrogen due to the aliphatic amine moiety is clearly recognizable because two components neatly distinguishable from the contaminant species appear (marked as ii and iii in figure 3b, curve at t = 0 min), with a relative weight of 60:40. in agreement with previous reports on aptes - functionalized oxides, these features can be attributed to free nh2 (399.6 ev) and to either h - bonded nh2 or nh3 (401.3 ev). 400.3 ev) due to the reaction of the amine group with atmospheric co2 has been previously reported for amine - containing monolayers. in the present case, however, the absence of significant amounts of amides is confirmed by the very low c = o content observed in the c 1s xp spectrum of the nonirradiated sample (table s3) as well as by ftir results (vide infra). high - resolution xp spectra of the pristine (dotted line) and aptes - functionalized tio2 (full line) as a function of irradiation time (0, 30, 60 min) : si 2p (a) and n 1s (b). the c / n ratio is about 5, i.e., higher than the theoretical value of 3 expected in fully grafted aptes - tio2 ; this might be related to adventitious carbon as well as to unhydrolyzed ethoxy groups. another possible reason for the higher - than - expected c / n ratio could be that some aptes molecules might present a reversed or folded configuration. as a result, the nitrogen signal would be attenuated by the limited electron mean free path. the latter hypothesis is also supported by dft calculations and ftir results (vide infra). as the solar irradiation proceeds, after 30 min, no further changes are detectable in the n 1s xps signal (compare the curves at t = 30 and 60 min in figure 3b), and the residual peaks are very broad and weak, similar to that due to adsorbed impurities in pristine tio2. these findings are likely related to the disappearance of the aptes nitrogen (figure s6). (i) before irradiation, 40% of amine groups are involved in hydrogen bonds or are protonated, which is in good agreement with previous reports about sio2 and other oxides, showing a higher proportion of free amine with respect to h - bonded / protonated nh2. (ii) upon irradiation, simulated solar light promotes extensive oxidation of the aptes alkyl chain. mineralization does not affect the si headgroup, as observed for other silanes, whereas the alkyl chain degradation leads to the cleavage of the amino group. the degradation pathway of aptes molecules adsorbed at the tio2 surface under simulated solar irradiation was also studied via ft - ir spectroscopy. the spectrum of the bare tio2 reference can be found in figure s7. to disentangle the ft - ir background due to the tio2 substrate from the aptes signature, difference spectra were analyzed as a function of the irradiation time (figure 4). differential absorbance ft - ir spectra obtained by subtracting the curve of the pristine samples from those of aptes - functionalized tio2 at different irradiation times : 40002500 cm spectral range (a) and 1900900 cm spectral range (b). vertical lines are a guide to the eye and indicate the main peak positions at 0 min. despite a rather unfavorable signal - to - noise ratio, the changes observed as a function of the irradiation time are systematic and have physical significance. the as - synthesized sample (t = 0 min) shows a clear envelope in the 30002850 cm spectral region, attributable to the c in particular, bands at 2920 and 2864 cm are due to the asymmetric and symmetric stretches of ch2 groups on the alkyl chain, whereas no clear indication of ch3 asymmetric modes is discerned. previous studies of surface functionalization by alkylsilanes of tio2 and other oxides reported the occurrence of negative peaks in the oh (surface hydroxyls) and hoh (undissociated water molecules) regions, which were attributed to the formation of si o si bonds between the surface and alkylsilane molecules with a consequent loss of surface hydroxyl groups and physisorbed water. on the contrary, in the present case no negative peaks in these ranges are observed. reported a slight increase in the width of the broad peak at 3500 cm for aptes - functionalized zeolites, which was attributed to the overlap of the symmetric n it is worth noting that the same band was reported at 3346 cm for the free amine and at about 3305 cm for terminal amine groups cross - linked with silanol groups. as for the low - frequency branch of the spectrum, the absorption bands at 1562 and 1628 cm were assigned to the scissor modes of nh2 groups and to the asymmetric nh3 deformation mode, respectively. the corresponding symmetric nh3 deformation mode can be related to the component at ca. n stretching in amines. the overlap of the stretching bands of si o si, si c prevents a complete attribution of the peaks falling in the 9501250 cm region. the stretching mode of si o si bonds has been reported in the range of 10101150 cm. si moieties is expected to fall at 1024 cm, and the si o c stretching modes were also assigned at about 1050 cm. solar - light irradiation (figure 4) leads to the disappearance of the bands related to chx moieties (especially the bands at 30002850 cm), in agreement with xps results. also, the peaks associated with nh2 bending disappear as the irradiation time increases, while a peak at 1645 cm strengthens. this peak can be assigned to the in - plane hoh bending mode of water molecules. an alternative attribution of this peak to the c = o stretching mode of amides is contradicted by the concomitant disappearance of nh2 bending signals. peaks in the 16001200 cm region disappear in the first 20 min of irradiation, and a new peak appears at 1427 cm after a longer irradiation, which might be attributed to c o h bending. 1100 and 1015 cm are still appreciable even after prolonged irradiation (180 min), although they shift to higher wavenumbers as the degradation proceeds and at the same time their relative intensities change. this evidence suggests that the amine group is degraded very rapidly (in the first 20 min), as also supported by xps analyses, whereas the degradation of alkyl chains requires longer times. the silane headgroup is instead still appreciable after prolonged irradiation, as confirmed by the persistence of the two main peaks in the 11501000 cm region, even though the observed shift in the peak position and the change in relative intensity suggest the occurrence of oxidation (i.e., loss of the contributions due to si figures 5 and 6 show the nexafs spectra of tio2-functionalized aptes surfaces at both grazing and normal incidence geometries across the c k and n k edges. prior to irradiation, the c k - edge signals (figure 5a) are dominated by two main peaks, namely, a sharp resonance at 288.4 ev and a broader one at 292.5 ev. c (or c n) orbitals, and the former could be due to c 1s (c h). it should be mentioned, however, that a c 1s (c = o) resonance might be present at 289 ev, probably because of x - ray - induced oxidation of the alkyl chain. indeed, the sample after 30 min of irradiation (figure 5b) shows a more intense peak at 288.6 ev, which could be related to the presence of c 1s (c = o) transitions, as also supported by xps results showing an increased content of c = o species. even though some artifacts are still appreciable in the pre - edge region, probably because of auger transitions, the resonances at 292 ev in ni geometry are invariably stronger than in gi geometry, which suggests a preferential horizontal orientation of aptes alkyl chains with respect to the surface. c k - edge nexafs spectra of aptes adsorbed on tio2, measured at normal (ni, solid lines) and grazing (gi, dashed lines) x - ray incidence as a function of different ex situ solar light irradiation times : t = 0 (a) and 30 min (b). n k - edge nexafs spectra of aptes adsorbed on tio2, measured at normal (ni, full lines) and grazing (gi, dashed lines) x - ray incidence as a function of different ex situ solar irradiation times (t = 0, in black, and t = 30 min, in red). previous studies reported a lack of polarization dependence of aptes monolayers, which was attributed to a completely disordered layer structure. our c k - edge nexafs results seem instead to support the formation of a low - density monolayer with aptes molecules tilted toward the surface, in agreement also with dft calculations, which will be reported in section 3.5. such a difference with literature reports could be related to the preparation procedure adopted here : chemical vapor deposition has been previously reported to lead to a lower degree of cross - linking with respect to wet procedures as a result of the absence of a prepolymerization step in solution. as for n k - edge spectra (figure 6), at t = 0 min a sharp peak is present at 398399 ev, whose attribution is debated : it has been assigned to either n = c or n c = c resonances originating from radiation damage or to n 1s (n h) resonances of nh3. interestingly, this feature vanishes in samples degraded for 30 min, consistent with the disappearance of the aptes n 1s xps peak upon solar irradiation. the large shoulder at 401402 ev could be attributed to either n h transitions or to nc resonances arising from radiation damage ; however, it is still present after the degradation of the silane (red curves in figure 6) and is therefore attributable to either aptes or adventitious nitrogen - adsorbed species. this is not surprising because the amine end group is expected to be conformationally more free than the whole hydrocarbon chain, resulting in less preferred orientations for the nitrogen - bearing groups. the observed changes in the spectra upon irradiation indicate possible changes in the intermolecular h bonding or even fragmentation of the molecules, in agreement with xps and ft - ir results (sections 3.2 and 3.3). accordingly, the n signal is more isotropic (red curves in figure 6) because there are fewer differences between the ni and gi k - edge spectra. the aptes adsorption on a 11.5 21.0 (101) anatase tio2 surface was simulated by plane - wave (pw) dft calculations. pw - dft has already been successfully employed to study the adsorption of amino - terminated silanes on a different class of substrates. the (101) anatase tio2 surface was selected according to hr - tem images (figure s8) showing that the thermodynamic { 101 } facets are predominant in our anatase tio2. this was expected on the basis of our synthesis conditions, which allow crystallites to nucleate and grow under thermodynamic control, as it is well known that the most stable surface on anatase has a (101) orientation. because the vasp program suite always applies 3-d periodic boundary conditions, to reproduce a 2-d periodic slab, we introduced a vacuum layer along the third dimension that was thick enough (14) to avoid unphysical interactions between neighboring slabs (figure s1). the accuracy of the functional and of the chosen computational setup was verified through calculations on isolated aptes molecules, i.e., by comparing the vasp - predicted molecular geometries and electronic structure in vacuo with geometries optimized through atom - centered linear combinations of gaussian - type functions (lc - gtf). the nwchem package was used to perform such benchmark calculations at the 6 - 311g(p, d)/pbe theory level, i.e., using the same exchange - correlation functional employed in pw simulations (table s4 and figure s9). the relative absolute differences in bond lengths among the pw and lc - gtf models were invariably lower than 1% with very similar electronic structures, so we feel confident that our plane - wave simulations are able to reproduce with satisfactory accuracy the highly localized states associated with the adsorbed silanes. given the good agreement between the two types of calculations, we conclude that our computational procedure is able to reproduce the correct features of aptes molecules in both gas and gas surface arrangements. the theoretical coverage corresponds to 0.41 (0.82) molecules / nm when the aptes monomer (dimer) is adsorbed (to be compared with an average monolayer density on glass or silicon substrates of 2.14.2 molecules / nm). to better simulate the adsorption process, a large slab of tio2 anatase (4 4 4 unit cell) was modeled, i.e., four o ti the surface was hydroxylated, simulating a dissociative water chemisorption process (scheme 2, figure 7). this picture is probable for defective surfaces such as our nanostructured system, where there are numerous acid ti(v) sites. physisorbed water was not included in our model because it is reversibly bound to the surface and its interactions with aptes molecules are intrinsically dynamic, i.e., they produce an effect on a time - averaged basis. on the other hand, strongly bound chemisorbed water likely has a more significant influence because it can form stable hydrogen bond networks also involving the organic layer. chemisorption geometries of aptes molecules (a d, scheme 2) at a (101) anatase surface. only the upper layers of the 4 4 4 supercell are shown. color code : ti (light blue), o (red), h (white), si (yellow), n (deep blue), and c (brown). o layers were relaxed to model the surface region perturbed by the interface and by the aptes molecular adsorption. the two bottom layers were instead kept fixed in order to simulate the bulk tio2. indeed, silane binding onto anatase has been reported to induce local conformational changes in the tio2 structure, including small geometry rearrangements of the ti and o ions next to the molecular adsorbate. six binding modes between the silane group and the surface were modeled (scheme 2). the single molecule was chemisorbed with either one (scheme 2a), two (scheme 2b), or three si o ti covalent bonds, implying the loss of one, two, or three ethoxy groups. the adsorption of oligomers was also taken into account : both a covalently bonded si finally, reversed adsorption geometries, i.e., where the silane molecule interacts with the oxide surface via the amino group, were considered : one geometry involving the formation of covalent interactions (scheme 2d). aptes physisorption mediated by a h - bond between the amine group and a surface silanol was not simulated because of the intrinsic limit of the dft procedure in modeling correlations among distant electrons responsible for dispersive interactions. it is also worth noting that, upon solar irradiation, the si - containing headgroups seem to remain grafted onto the surface, as shown by xps (table 1, rows 4 and 5) and ftir (as appreciable from peaks at 11501000 cm in figure 4) results. this implies that physisorption, if any, should be just a minority interaction mode. hence, the chemisorption modes shown in scheme 2a c should adequately represent the aptes tio2 interface. for each system, the corresponding isolated aptes derivative with three, two, or one ethoxy group (eto), i.e., si[(ch2)3nh2](oet)3, si[(ch2)3nh2](oet)2oh, or si[(ch2)3nh2]oet(oh)2, was considered for gas - phase benchmark calculations (vide supra). by comparing gas - phase and adsorbed analogues (table 2), the molecular distortion taking place upon surface adsorption can be determined for the different geometries. oh bond is present, then the average is given.) o : bridging atom in the si oet bond. o : bridging atom in the si o si system in the aptes dimer (c). the h atom involved in the h - bonding interaction is always considered. if no relevant hydrogen bonds are present, then the average value is given. distance between the amine h atom and the oxide o atom on the tio2 surface acting as a hydrogen bond acceptor. see scheme 2 and figure 7 for the meaning of these labels. in the adduct (d), the amine hydrogen is directly linked to the surface through a n o bond, with dn o = 1.2894. a first important result is that, according to the calculations, not all of the considered adsorption geometries are feasible. in particular, the simulation of aptes chemisorption via three hydroxyl groups did not lead to a converged electronic structure result, and we conclude that a tripodal link to the surface is not feasible. the formation of three si o ti bonds between a single aptes molecule and the oxide surface thus seems to be prevented by the bond lengths / angles in the silane molecules in conjunction with the structure of the tio2 surface. it is worth noting that such findings are in agreement with previous ft - ir studies.figure 7 shows the corresponding fully relaxed configurations of the geometries that reached a converged electronic structure result. ti bond forms (figure 7a), the aptes molecules lie horizontally on the surface because of the formation of a hydrogen bond interaction between the h of the aptes amine group and an o of a surface hydroxyl group (nho distance 1.42, table 2). acceptor no distance comparable to the length of charge - assisted bonds found between charged groups in metalorganic complexes. h covalent bond in the grafted molecule (dn h = 1.13) with respect to the isolated one (dn h = 1.02) while at the same time the si o bond with the surface shortens and strengthens (table 2). when two si o ti bonds form between the si headgroup and the surface (figure 7b), the aptes molecule shows similar folding, with the amino group approaching the surface similarly to what was observed with a single si o ti bond. however, in this case, the distance between the n h group and the surface o is higher (1.73). as for the reversed attachment configuration (scheme 2d, figure 7d), the direct interaction between the n of the aptes molecule and a surface oxygen (figure 7d) was taken into account. in this configuration, the aptes molecule is perpendicular to the tio2 surface, showing no interactions between the silane head and the surface. the adsorption of partially hydrolyzed oligomers was also modeled. in this case, as done for the isolated monomers, we performed benchmark calculations on the isolated dimer, as reported in section s5. figure 7c reports the adsorption geometries of a representative aptes dimer at the tio2 surface. when two aptes molecules bond with neighboring surface hydroxyls, the formation of an intermolecular si o si bond results in a 20 tilt of the aptes alkyl chain with respect to the surface. the interaction of the amino group with the surface is still substantial, although the hydrogen - acceptor distance (dho = 1.942.16) is now much longer than in the case of a single monomer (figure 7a, b). moreover, the si o si bond is highly strained, as seen from bond angle values (167). some attempts were also carried out to simulate larger oligomers chemisorbed on the surface, e.g., aptes trimers in various configurations. for example, we tried to simulate an aptes trimer similar to the system shown in scheme 2c, where three r si bonds. however, these calculations invariably led to aptes trimers bound to the surface only through two si o we believe that this evidence is consistent with the high bond strain detected from geometrical bond angles associated with the si center, very far from those expected for an ideal sp geometry. such strain could be related to the reported limited occurrence of covalent interactions between silane headgroups in ordered monolayers and hydroxyl groups on the oxide surface. this high strain might also favor the chemisorption of aptes molecules at the tio2 surface as monomers or very short oligomers. figure 8 reports the density of states (dos) of systems (a d). for the sake of comparison, the corresponding plot for the bare, fully hydroxylated tio2 (101) surface is reported in figure s10. in agreement with previous literature findings, the only effect that hydroxylation has on the anatase band structure is the generation of a few empty states just above the valence band (vb) edge. figure 8a shows that in the single - bonded monomer structure (scheme 2a, figure 7a), oxygen atoms inject new states at the top of the vb, which are likely contributed from the silane moiety, whereas n is close enough to the surface to be able to add shallow midgap empty states just above the fermi level (figure 8a, magenta line). the electronic structure of the double - bonded monomer (scheme 2b, figure 7b), reported in figure 8b, is pretty similar, although the different folding and chemical state of the organic system lead to a few differences. in particular, the amino group is now more distant from the surface (table 2), so n midgap states are less dense, although still significant in terms of the dos intensity. second, the contribution to deep vb states from oxygen increases, as two oxygen atoms are now acting as bridges between si and ti. (a) single - bonded monomer (scheme 2a and figure 7a). (b) double - bonded monomer (scheme 2b and figure 7b). (d) reversed (n o ti) chemisorption (scheme 2d and figure 7d). the vertical dashed blue line represents the fermi energy, which is set as the zero of the energy. light curves are enhanced atom - projected partial doss (pdoss) ; magenta, n ; blue, o atoms bound to si (a c) or n (d) ; green, (a) oxide o interacting with n through the hydrogen bond ; orange, (c) bridging oxygen between two aptes monomers (main text). the pdos of all atoms is enhanced by a factor of 100 in order to aid the interpretation of the results. in the aptes dimer (scheme 2c, figure 7c), it is worth noting, however, that the oxygen atom involved in the si o si bridge (orange line in figure 8c) provides states more deeply buried in the vb with respect to those involved in si finally, as expected, the electronic structure is markedly different when the reversed chemisorption geometry (scheme 2d, figure 7d) is considered. figure 8d shows that two shallow states, due to the overlap of localized states on the bridging n o system, appear in the vicinity of the top of the vb. they are very close in energy (< 1 ev), and indeed they are most likely understandable as a bonding / antibonding couple associated with localized n o orbitals. this implies that the reversed configuration should be immediately destroyed at finite temperature by visible / thermal electron excitation. in conclusion, upon aptes functionalization, both ti 2p and o 1s xps signals shift toward lower b.e. (figure 2), likely because of chemisorption - induced band bending. the silane molecule should act as an electron donor, implying charge transfer to the surface. as a consequence, this is in fairly good agreement with the pw - dft results : all of the si o ti grafted silanes (scheme 2a c) undergo a significant negative charge displacement toward the surface, as can be inferred from the n empty states that invariably appear near the top of the vb. this picture is also consistent with the optimized bond lengths (table 2) calculated for aptes - tio2 hybrids and, in particular, with (i) the significant shortening (lengthening) of the si o (n h) bonds of the silane ; (ii) the presence of very strong nho bonds, with ho distances fully comparable to known cases of charge - assisted hydrogen bonds ; and (iii) the significant rearrangement of the ti o coordination geometry close to the chemisorption site. in this work, bare and aptes - functionalized tio2 was extensively characterized both experimentally (xps, nexafs, afm, ft - ir, hr - tem) and theoretically (pw - dft) to clarify the structure of the organic layer at the tio2 surface. afm, ftir, xps, and nexafs analyses on ex situ solar - irradiated samples at various degrees of reaction extent also provided information on the photoinduced oxidation mechanism of the organic layer. the combined experimental and theoretical evidence suggests that aptes chemisorption on tio2 mainly implies one or two si o ti bonds involving the si headgroup, whereas a tripod configuration seems unfeasible as highly strained. other interaction modes, such as physisorption through terminal amino groups, are expected to be considerably more labile. although dimerization of the silane at the surface through si o si bonds is possible, further polymerization appears to be less probable. chemisorption of individual monomers leaves the aptes terminal amino groups available for hydrogen bonds with surface hydroxyl groups of tio2. these interactions are rather strong because, on the basis of xps and dft results, they are reinforced by a probable charge displacement from the organic molecules toward the surface. in nexafs spectra, the strong c k - edge resonances at normal incidence of the x - rays imply a preferential orientation, where alkyl chains are bent toward the surface. we therefore expect that nho interactions should constitute a preferential aptes substrate secondary mode of interaction, especially at low surface coverage, as in our specimens 40% of the amine groups were estimated to be involved in some kind of strong hydrogen bond. the latter could hamper the availability of the amine as a nucleophilic center for further functionalization of the adsorbed alkylsilane molecules. indeed, under these conditions strong nho interactions pose a kinetic barrier against the chemical availability of the amine. we also found compelling evidence that solar irradiation promotes extensive oxidation of the aptes alkyl chain, rapidly leading to the cleavage of the amino group. on the contrary, the oxidation process does not destroy si head moieties, which remain bound to the titania surface in a higher oxidation state. this implies that the tio2 photocatalyst surface is not pristine at the end of the degradation process. such an effect could hamper the tio2 photocatalytic behavior, with notable implications for applications, but it could also be exploited, for instance, to produce sio2/tio2 composite surfaces for advanced optics as narrow bandpass filters. moreover, amino group availability and lability are both essential factors for further functionalization of the oxide surface. indeed, because of the rapid solar - induced n c cleavage, chemical functionalization of aptes by small - to - medium organic molecules seems to be a suitable step toward the development of effective drug - carrier devices for disease prophylaxis and health care purposes. | the surface functionalization of tio2-based materials with alkylsilanes is attractive in several cutting - edge applications, such as photovoltaics, sensors, and nanocarriers for the controlled release of bioactive molecules. (3-aminopropyl)triethoxysilane (aptes) is able to self - assemble to form monolayers on tio2 surfaces, but its adsorption geometry and solar - induced photodegradation pathways are not well understood. we here employ advanced experimental (xps, nexafs, afm, hr - tem, and ft - ir) and theoretical (plane - wave dft) tools to investigate the preferential interaction mode of aptes on anatase tio2. we demonstrate that monomeric aptes chemisorption should proceed through covalent si o ti bonds. although dimerization of the silane through si o si bonds is possible, further polymerization on the surface is scarcely probable. terminal amino groups are expected to be partially involved in strong charge - assisted hydrogen bonds with surface hydroxyl groups of tio2, resulting in a reduced propensity to react with other species. solar - induced mineralization proceeds through preferential cleavage of the alkyl groups, leading to the rapid loss of the terminal nh2 moieties, whereas the si - bearing head of aptes undergoes slower oxidation and remains bound to the surface. the suitability of employing the silane as a linker with other chemical species is discussed in the context of controlled degradation of aptes monolayers for drug release and surface patterning. |
n - enoxyphthalimides undergo a rh(iii)-catalyzed c h activation initiated cyclopropanation of electron deficient alkenes. the reaction is proposed to proceed via a directed activation of the olefinic c h bond followed by two migratory insertions, first across the electron - deficient alkene and then by cyclization back onto the enol moiety. a newly designed isopropylcyclopentadienyl ligand drastically improves yield and diastereoselectivity. |
|
it dissolves quickly in concentrated acids and in some fluoroalcohols yet its reactivity is low. other relevant properties of this biopolymer are its high molecular weight and porous structure which favors high water absorption [1, 2 ]. on the other hand these associations act as a matrix that interacts with other constituents such as phenolic tannins in insects and minerals in the carapaces of crustaceans [3, 4 ]. deacetylation is the nonenzymatic process whereby chitosan is obtained by removing r - nhcoch3 residue and treating it with strong alkali at high temperatures. when the degree of deacetylation is greater than 50%, the biopolymer becomes soluble in acidic aqueous solutions and behaves as a cationic polyelectrolyte due to the protonation of amine groups in the presence of h ions [5, 6 ]. however, they are not used on an industrial scale owing to the high commercial cost of enzymes (deacetylases) and their low productivity, while nonenzymatic chemical processes are widely used because the cost of doing so is low and the processes are efficient [7, 8 ]. the development of new applications for chitosan is strongly based on the fact that this polymer can be obtained from renewable sources such as fisheries ; it is nontoxic, nonallergenic, biodegradable, and present in antimicrobial activity. studies with planktonic crustaceans such as daphnia longispina resting eggs indicate that these crustaceans can be exploited as a source of chitin due to their high chitin content (23~25%). leptinotarsa decemlineata, also known as the colorado potato beetle, is a major pest of potato crops. the adult and larva have 20% and 7% of chitin content, respectively. however, the chitin from adult colorado potato beetles had a more stable structure than that from the larvae. investigation has indicated that the adult potato beetle is more appropriate as a chitin source, both because of its chitin and chitosan content and because of its antimicrobial and antioxidant activities.. conducted studies on potential sources of chitin in the orthoptera order of insects calliptamus barbarus and found this to be 20.5 0.7% and 16.5 0.7% for oedaleus decorus, the yield of chitosan being 7476%, with a deacetylation degree of 7075%. the insects showed potential as alternative sources of chitin and chitosan on account of their antimicrobial and antioxidant properties for the food / animal feed industry. among the most common applications are their uses as complexing material metal ions, such as edible coatings with antifungal and bactericidal action [1315 ] and as a basic element for making controlled drug delivery matrices. thus, the objective of this study was to investigate the efficiency of different methodologies to obtain chitosan from the waste of litopenaeus vannamei shrimps since this raw material comes from renewable resources and it is economically viable to produce high - value added compounds from it. shrimp residues of the species named as litopenaeus vannamei were washed in running water and a 2.5% hypochlorite solution. thereafter, they were dried at room temperature and then crushed and passed through a 16-mesh knit. the bacteria stenotrophomonas maltophilia (ucp-1600), s. maltophilia (ucp-1601), bacillus subtilis (ucp-1002), and enterobacter cloacae (ucp-1603) were kindly supplied from the culture collection ucp (universidade catlica de pernambuco), recife, pe, brazil. these microorganisms were used in the tests of evaluation of minimum inhibitory concentration (mic) and the minimum bactericidal concentration (mbc). the microorganisms were maintained at 25c in nutrient agar medium (peptone 0.5%, beef extract 0.3%, nacl 0.5%, agar 1.5%, and distilled water, and ph is adjusted to neutral 7.4). the extraction of chitin and chitosan was performed according to the methods described by zamani. (method 1) and arantes (method 2). in order to eliminate the proteins of the residue, naoh solutions 0.5 m (30 : 1 v / m, 90c, 2 h) and 0.3 m (10 : 1 v / m, 80c, 1 h, under agitation), respectively, were used. then, the alkali - insoluble fraction (ifa) was separated by centrifugation at 4000g for 15 minutes and/or by vacuum filtration. subsequently, to demineralize the precipitate obtained, 10% acetic acid (100 : 1 v / m, 60c, 6 h) and 0.55 m hydrochloric acid (10 : 1 v / m, room temperature, 1,5 hours) were used. to obtain purified chitosan, treatments with 1% sulfuric acid (121c/20 min) and 50% naoh (100c, 10 h) two milligrams of chitin and chitosan samples was dried overnight at 60c under reduced pressure ; then, this was homogenized with 100 mg of kbr. discs with the prepared kbr were dried for 24 h at 110c under reduced pressure. the chitin and chitosan samples from shrimp shell (litopenaeus vannamei) waste were analyzed at 4000625 cm using an infrared ray fourier transform spectrometer (ft - ir, bruker mod. a kbr disc was used as reference. to determine the maximum absorption intensity of bands, the baseline was used. the degree of acetylation and deacetylation of chitosan was determined using an infrared ray spectroscopy, ir 22, applying the band a1655/a3450 which was calculated as per (1)ad%=a1655a34501001,33. to evaluate the minimum inhibitory concentration (mic), the serial dilution technique was used with the tested microorganisms, in accordance with qi.. an initial chitosan solution was prepared at 0.5% in 1% acetic acid and ph = 5.0. then, serial dilutions were performed of 1 : 1 to 1 : 512 and decreasing concentrations ranging from 0.00005% to 0.25%. for each microorganism, a standard bacterial suspension 10 l bacterial suspension was transferred to each one in the series of tubes and incubated at 37c for 24 hours. for the evaluation of minimum bactericidal concentration (mbc), a qualitative technique was used according to the method of qi.. the series of chitosan solutions, which determined the mic, were used to evaluate mbc. from the reading of the mic, the tubes that showed no visible turbidity had 10 l plated on blood agar, ph 7.0, and were incubated for 24 h at 37c, and observations were made on whether or not the colonies of microorganisms grew. according to elementary studies and analyses of different crustaceans (shrimp, lobster, and squid), there was great variability of this composition when chitin amounts were varied for squid of approximately 1.8%, pink shrimp 22% (under study), and lobster 36%. hence, there is a need to develop efficient demineralization and deproteinization processes to remove mineral content (2030%) and protein content of approximately 40% in order to obtain chitin that is free of inorganic and protein content. this study showed that different concentrations of naoh and demineralization with hydrochloric acid and acetic acid influenced the yield of the extraction process used to obtain chitin and chitosan. similarly, it was proved that the methods used also had an effect on the degree of deacetylation (table 1). to confirm that the biopolymer was chitosan, the product obtained with the commercial chitosan sigma (sigma aldrich corp., st. louis, mo, usa) was characterized and compared by infrared spectrometry. the residual mass from shrimp exoskeleton after demineralization and deproteinization processes showed well preserved chitin structure as described by stamford. this was higher than the values obtained by tenuta filho and zucas, with 14% of chitin pink shrimp waste (penaeus brasiliensis) and by beaney. with 10% yield of biopolymer from nephrops norvegicus.. found that the chitin content of bat guano species rhinolophus hipposideros collected from karacamal cave was 28%. it was noted the chitosan productivity corresponding to 79% from isolate chitin is superior to our results from l. vannamei using two different methodologies. the results showed the isolation of alpha chitin and were confirmed by infrared spectroscopy, thermogravimetric analysis (tga), x - ray diffraction (xrd), and scanning electron microscopy (sem) techniques. more recently, the production of a new morphology of chitin from the wings of periplaneta americana has been studied by kaya and baran. they showed the surface of the chitin has oval nanopores (230510 nm) without nanofibers. the chitin surface had a pore in the center and six or seven other pores distributed around these, corresponding to structures similar to cell walls. alternatively, studies with chitin content of the structure of the exoskeleton of seven species from grasshopper of the four genera were carried out. the contents of chitin varied between 5.3% and 8.9% and had a low molecular weight (between 5.2 and 6.8 kda). a large amount of waste is formed from invasive and harmful species that have been killed by the use of insecticides, and the authors suggest that these be collected and evaluated as an alternative chitin source. some parameters in the deacetylation reaction are cited as fundamental factors on the end characteristics of chitosan. tsaih and chen studied the influence of temperature and processing time on polymer chitosan characteristics and found that both have a significant effect on the deacetylation degree and molecular weight. the results obtained also showed a higher yield than that found for the chitin extracted from shrimp penaeus brasiliensis, which was 5.3% and 2.5% of chitosan. santos. showed a lower percentage with 5.9 and 5.06% of chitin and chitosan, respectively. thus, the maximum chitosan obtained from chitin deacetylation (57.5%) was similar to the reported value for the extraction from the polymer using the shrimp macrobrachium rosenbergii (~65%). however, the results obtained by battisti and campana - filho showed that 80% of chitin was transformed into chitosan. the spectrophotometric analysis of commercial chitosan (figure 1(a)) and the chitosan obtained by the methods used (figures 1(b) and 1(c)) enabled the bands to be characterized as follows : peak 1 (~1650 cm) corresponded to acetylated residues (nhcoch3) of chitosan ; peak 2 (~1590 cm) identified the nh2 groups present in the deacetylate residues ; and peak 3 (3440 cm) corresponded to the vibration of the oh molecule. analysis by ft - ir estimated the amount of free amine groups present in the molecule of chitosan obtained from the two methodologies, namely, 76% and 81.7%, respectively (table 2). however, the higher deacetylation degree of chitosan is generally controlled by processing the native polymer with alkali and increasing time and temperature. these values are consistent with commercial chitosan, obtained from crustaceans, since this reaches between 75 and 90% deacetylation in industrial processing. in a study proposing a simple and efficient method of deacetylation of chitosan using acetate of 1-butyl-3-methylimidazole, as the reaction catalyst, dd% = 86 was obtained, a value similar to that found in our study in the best condition for producing the biopolymer (dd = 81.7%). santos. determined the degree of deacetylation of chitosan obtained from the shrimp saburica (macrobrachium jelskii), which was approximately dd 76%, using linear potentiometric titration. the results using fourier transform infrared spectroscopy obtained in this study are in agreement with the data in the literature, which may vary from 50 to 92.3% [36, 37 ]. hennig analyzed obtaining chitosan from penaeus brasiliensis and obtained a degree of deacetylation (dd%) of 87%. this value was similar to that reported in the literature for weska. and to those obtained in the best condition. furthermore, it was shown that the chitosan produced has characteristics comparable to commercial chitosan, the degree of deacetylation ranging between 70 and 95% [36, 39 ]. recently, kaya. undertook studies on chitin obtained from insecta (melolontha melolontha) and crustacea (oniscus asellus) and compared their physical and chemical properties. the results showed chitin content for dry weights of m. melolontha and o. asellus corresponding to 13 - 14% and 6 - 7%, respectively. the results observed that chitin nanofibers of o. asellus adhered to each other ; nanofibers of m. melolontha were nonadherent and were considered the more attractive chitin source. studies were carried out with fomitopsis pinicola, a medicinal fungus in asia, and found 30.11% of chitin and yield of 71.75% of chitosan from the dry weight. the chitin showed acetylation of 72.5% and deacetylation of chitosan was 73.1%, and the maximum chitin temperature of degradation was 341c. results clearly revealed a significant deacetylation degree of chitosan from waste shrimp shell litopenaeus vannamei using two methodologies in comparison with deacetylation degree of chitosan determined to f. pinicola. fourier transform infrared spectroscopy (ft - ir), elemental analysis (ea), thermogravimetric analysis (tga), x - ray diffractometry (xrd), and scanning electron microscopy (sem) were used to investigate chitin structure isolated from both sexes of four grasshopper species, and it was observed that the amount of chitin was greater in males than females. the results showed those chitins properties are affected in different parts of the body (head, thorax, abdomen, legs, and wings) of the honey bee related to the extraction method. physical and chemical properties form a parameter involved with taxonomy, and the chitin extracts from different parts of the body are different. the influence of chitosan extracted by the methods proposed on inhibiting the growth of stenothrophomonas maltophilia (ucp-1600/ucp-1601), enterobacter cloacae (ucp-1603), and bacillus subtilis (ucp-1602) is shown in table 2. however, the more acceptable hypothesis is related to a change in the permeability of the cell due to interactions between the biopolymer chitosan, when it is positively charged (ph below 6.5), and the cell membrane of microorganisms when negatively charged. in the present study, the results demonstrated that mic and mbc were more significant in gram - negative bacteria when compared with gram - positive ones but were effective in both cases. these results are in agreement with reports in the literature that have documented antimicrobial activity of chitosan against a large number of microorganisms, the mic ranging between 0.1% and 1% [45, 46 ]. thus, the efficiency of the chemical - physical characteristics is also related, as well as species or strains of bacteria in the same study [47, 48 ]. wang demonstrated that, for bactericidal action of chitosan on e. coli, solutions with concentrations between 0.5 and 1% at 48 hours had to be used, and to obtain the same effect at 24 h, higher concentrations of 1% chitosan were prepared. in addition, tsai and su demonstrated that solutions of chitin and chitosan of high molecular weight and a high degree of deacetylation had a lethal effect on e. coli and shigella dysenteriae when concentrations between 50 and 500 ppm were used. according to chung., the hydrophilicity of the cell wall and the negatively charged cell surface was greater in gram - negative bacteria in relation to gram - positive bacteria. in addition, the distribution of negative charges on their cell surfaces was very different when compared with gram - positive bacteria, thus supporting the results found in this study. in a study conducted to evaluate the bactericidal activity of glucose - chitosan complex of e. coli, pseudomonas, staphylococcus aureus, and bacillus cereus, it was determined that the minimum inhibitory concentration of chitosan was around 0.05%, these results being the same as those found in this study. moreover, on using the chitosan extracted from rhizopus arrhizus and cunninghamella elegans to evaluate the mic and mbc on listeria monocytogenes, staphylococcus aureus, pseudomonas aeruginosa, salmonella enterica, escherichia coli, and yersinia enterocolitica, it was observed that the mic values ranged from 200 gml for e. coli to 500 gml of l. monocytogenes. however, for the mbc, the results were between 400 g and 1000 g / ml, respectively. thus, in this research study, the effect of the chitosan obtained by the proposed methods was proved to be effective as an antimicrobial agent on the microorganisms tested. the previous results recommend method 2 for the chemical reaction as it offers a clean, cheap, and convenient method for extracting chitosan from chitin extracted from shrimp wastes. within the results in this work, the conclusion was reached that shrimp wastes are an excellent source for chitin. the yields and acetylation degree of chitosan decreased the concentration of naoh solution, the temperature, and the length of treatment. different chitosans were tested and markedly inhibited the growth of most bacteria tested ; however, the inhibitory effects differed depending on the types of chitosan and the bacteria tested, there being greater antimicrobial activity against gram - positive bacteria than against gram - negative bacteria. | this research aims to study the production of chitosan from shrimp shell (litopenaeus vannamei) of waste origin using two chemical methodologies involving demineralization, deproteinization, and the degree of deacetylation. the evaluation of the quality of chitosan from waste shrimp shells includes parameters for the yield, physical chemistry characteristics by infrared spectroscopy (ft - ir), the degree of deacetylation, and antibacterial activity. the results showed (by method 1) extraction yields for chitin of 33% and for chitosan of 49% and a 76% degree of deacetylation. chitosan obtained by method 2 was more efficient : chitin (36%) and chitosan (63%), with a high degree of deacetylation (81.7%). the antibacterial activity was tested against gram - negative bacteria (stenotrophomonas maltophilia and enterobacter cloacae) and gram - positive bacillus subtilis and the minimum inhibitory concentrations (mic) and the minimum bactericidal concentration (mbc) were determined. method 2 showed that extracted chitosan has good antimicrobial potential against gram - positive and gram - negative bacteria and that the process is viable. |
. however, the manifestation of shrinkage due to the polymerization process continues to be a major problem. the composite shrinkage creates stresses within the material at the tooth structure interface, which might manifest clinically as cuspal deflection, which in turn compromises the synergism of the bond at the tooth restoration interface possibly leading to bacterial microleakage and ultimately to marginal discoloration, secondary caries, and pulpal inflammation. typical resin composites applied in restorative dentistry exhibit volumetric shrinkage values from less than 1% up to 6%, depending upon the formulation and the curing condition. recently, a new category of resin matrix for dental composite was developed based on ring - opening monomers. this hydrophobic composite is derived from the combination of siloxane and oxirane, and thus has the name silorane. the major advantages of this innovative restorative material are its reduced shrinkage and its mechanical properties comparable to those of methacrylate - based composites. filtek silorane comes with a two - step self - etch adhesive, commercialized as silorane system adhesive (ssa). first, a hydrophilic self - etch primer [silorane system adhesive self - etch primer (ssa - primer) ] is applied and light - cured separately prior to the application of a hydrophobic adhesive resin [silorane system adhesive bond (ssa - bond) ]. ssa - bond is methacrylate - based, and is therefore compatible with conventional methacrylate composites as well. further details on how ssa - bond links to the silorane composite are currently not known, but according to the technical information provided by 3m - espe (australia), ssa - bond contains a hydrophobic bifunctional monomer in order to match the hydrophobic silorane resin. compared to the methacrylate - based restorative materials, the new silorane - based material had the lowest polymerization shrinkage, but an overall mixed mechanical performance. the silorane - based material had relatively higher flexural strength / modules and fracture toughness, but relatively lower compressive strength and microhardness than the methacrylate - based restorative materials. the ring - opening chemistry of the siloranes enables them to have first time shrinkage values lower than 1 vol% and the mechanical parameters such as e - modulus and flexural strength to be comparable to those of clinically well - accepted methacrylate - based composites. the novel resin is considered to have combined the two key advantages of the individual components : low polymerization shrinkage due to the ring - opening oxirane monomer and increased hydrophobicity due to the presence of the siloxane species. the silorane composite polymerizes by a cationic ring - opening process, which is insensitive to oxygen. this overcomes the disadvantage of the oxygen inhibition layer found in methacrylate - based composites. siloranes were also stable and insoluble in biological fluids simulated using aqueous solutions containing either epoxide hydrolase, porcine liver esterase, or dilute hcl. the silorane - based composite revealed decreased water sorption, solubility, and associated diffusion coefficient, compared with conventional methacrylate - based composites. cusp deflection is the result of interactions between the polymerization shrinkage stress of the composite and the compliance of the cavity wall, and is a common biomechanical phenomenon observed in teeth restored with composites. the purpose of this study was to evaluate cuspal deflection in premolar teeth restored with low shrinkable resin composite. the selected teeth were placed 3 mm below the cementoenamel junction in an acrylic mold with dimensions of 15 mm internal diameter, 25 mm external diameter, and 20 mm height. the teeth set in the acrylic mold were fixed with a vice and a large mesiooccluso distal cavity (mod) cavity was prepared [figure 1 ]. the mesio - distal proximal box was extended 0.5 mm bucco - lingually, and the width of the axial and gingival walls of the box was 1 mm. the width and depth of the pulpal wall of the mod cavities was 2 3 mm. the reference point for cavity depth the reference point for measuring the specimens before and after the procedure was two metal tips (cut from dental needle c - k ject, korea, queens singapore) for each specimen (0.5 4 mm) that was fixed (using clearfill se bond) horizontally and perpendicular to the long axis of the specimen at the cusp tip of the tooth, one buccally and the other lingually. the end of this tip was located beyond the buccal and lingual tooth contour by 2 mm in order to be attached to the microscope probes during cusp deflection measurement. the specimens were divided into two main equal groups according to the type of resin composite and then further subdivided into four equal subgroups as follows : subgroup a : using low shrinkable resin composite (filtek p90 silorane shade a2 ; 3 m espe, st paul, mn, usa) with its adhesive system subgroup b : using low shrinkable composite (filtek p90 silorane shade a2 ; 3 m espe) with g - bond (gc, tokyo, japan) subgroup c : using filtek z350 (3 m espe) composite with g - bond (gc) subgroup d : using filtek z350 (3 m espe) composite with adhese (ivoclar vivadent, schaan, liechtenstein) cuspal deflection was detected by universal measuring microscope (carl zeiss, jena, germany) [figure 2 ] and universal horizontal metroscope (universal - langen messer ; carl zeiss) [figure 3 ]. the buccal and lingual cusp movements were recorded for 2000 s and the measured value (as a function of time) was stored on a computer through a data acquisition board. universal measuring microscope universal horizontal metroscope patients consent was obtainedapproval of the ethical committee of al - azhar university, faculty of oral and dental medicine, egypt (under number 490/2013) was obtained. patients consent was obtained approval of the ethical committee of al - azhar university, faculty of oral and dental medicine, egypt (under number 490/2013) was obtained. the difference between groups was statistically analyzed using one - way analysis of variance (anova) followed by pair - wise newman kuels (nk) post - hoc test at the significance level of = 0.05. patients consent was obtainedapproval of the ethical committee of al - azhar university, faculty of oral and dental medicine, egypt (under number 490/2013) was obtained. patients consent was obtained approval of the ethical committee of al - azhar university, faculty of oral and dental medicine, egypt (under number 490/2013) was obtained. the difference between groups was statistically analyzed using one - way analysis of variance (anova) followed by pair - wise newman kuels (nk) post - hoc test at the significance level of = 0.05. inter - cuspal distance test results (mean sd) including cuspal deflection measured in micrometers are summarized in table 1. inter - cuspal distance test results (meansd) and cuspal deflection for all groups after composite insertion it was found that group c recorded the highest cuspal deflection mean value (414 22 m), followed by group d (408 38 m) and then group b (360 31 m). meanwhile, group a recorded the lowest cuspal deflection mean value (138 29 m). cuspal deflection (m) for filtek p90 and filtek z350 are presented in figures 47. changes in cuspal deflection over time of filtek p90 with its adhesive (group a) were 3.5 m at 5.7 min after curing, 0.7 m at 11.5 min, 0.5 m at 17.3 min, 0.4 m at 23 min, 0.2 m at 28.2 min, and 0.8 m at 34.6 min, while those of filtek z350 with adhese adhesive (group d) were 3.4 m at 5.5 min after curing, 4.3 m at 11.18 min, 4.1 m at 16.7 min, 3.9 m at 22.3 min, 5.3 m at 27.9 min, and 6.3 m at 33.5 min. cusp deflection of silorane with its adhesive system cusp deflection of methacrylate with adhese adhesive system cusp deflection of filtek p90 with g - bond adhesive cusp deflection of methacrylate with g - bond adhesive cuspal deflection (m) for filtek p90 and filtek z350 are presented in figures 47. changes in cuspal deflection over time of filtek p90 with g - bond (group b) were 2.9 m at 5.7 min after curing, 3.1 m at 11.5 min, 3.5 m at 17.3 min, 3.9 m at 23 min, and 4 m at 28.2 min, while those of filtek z350 with g - bond (group c) were 2.9 m at 5.5 min after curing, 3.8 m at 11.18 min, 4.1 m at 16.7 min, 9.7 m at 22.3 min, and 9.9 m at 27.9 min. cuspal deflection (m) for filtek p90 and filtek z350 are presented in figures 47. changes in cuspal deflection over time of filtek p90 with its adhesive (group a) were 3.5 m at 5.7 min after curing, 0.7 m at 11.5 min, 0.5 m at 17.3 min, 0.4 m at 23 min, 0.2 m at 28.2 min, and 0.8 m at 34.6 min, while those of filtek z350 with adhese adhesive (group d) were 3.4 m at 5.5 min after curing, 4.3 m at 11.18 min, 4.1 m at 16.7 min, 3.9 m at 22.3 min, 5.3 m at 27.9 min, and 6.3 m at 33.5 min. cusp deflection of silorane with its adhesive system cusp deflection of methacrylate with adhese adhesive system cusp deflection of filtek p90 with g - bond adhesive cusp deflection of methacrylate with g - bond adhesive cuspal deflection (m) for filtek p90 and filtek z350 are presented in figures 47. changes in cuspal deflection over time of filtek p90 with g - bond (group b) were 2.9 m at 5.7 min after curing, 3.1 m at 11.5 min, 3.5 m at 17.3 min, 3.9 m at 23 min, and 4 m at 28.2 min, while those of filtek z350 with g - bond (group c) were 2.9 m at 5.5 min after curing, 3.8 m at 11.18 min, 4.1 m at 16.7 min, 9.7 m at 22.3 min, and 9.9 m at 27.9 min. the effect of polymerization shrinkage of resin - based composite materials on the in vitro cuspal flexure of restored teeth has been reported by numerous investigators. it has been suggested that such contact - displacement measuring methods may provide erroneous results since a suitable reference point on the cusps is difficult to identify. the preparation of large mod cavities from upper premolars in the current study was designed to weaken the remaining tooth structure to favor potential cuspal movement. it might be argued that the weakening of the palatal and buccal cusps through the preparation of large mod cavities in the current study was not clinically relevant since the mod cavities may be too extensive for direct composite fillings. however, the number of resin based composite (rbc) restorations currently placed in clinical practice has increased since the introduction of improved resin chemistry, filler morphology, and associated adhesive systems of modern rbc materials. moreover, the toxicity and aesthetic concerns of amalgam and the increased chairside procedure time and cost of indirect restorations have justified the increased use of rbc materials for large restorations, such as the mod cavities utilized in the current study. the magnitude of cuspal deflection is dependent on several factors, namely, the size and configuration of the cavity, and the mechanical physical properties of the restorative material and the bonding system. deflection of the cusps through light irradiation of the restorative resin - based composite material will only occur if there is sufficient resistance to polymerization shrinkage associated with the adhesive properties at the tooth / restoration interface. in the current study, each cavity with each resin - based composite type exhibited cuspal deflection. the significant increase in cuspal deflection of cavities restored with the methacrylate - based (filtek z350) compared with the silorane (p90) resin - based composites might be attributed to the differences in polymerization reaction (monomer chemistry) between the free radical and cationic species, respectively. irradiation of p90 results in fragmentation of the photoinitiator and it generates a super - acid catalyst with oxonium ions as the reactive species, which subsequently protonates the functional group of the oxirane molecule. after molecular rearrangement, the positively charged species proceeds in three dimensions to form a tightly cross - linked network. the reactive species of p90 do not get extinguished as rapidly as the free radicals throughout the polymerization of filtek z350. the stress developed at the tooth restoration interface remains responsible for the deleterious effects of polymerization shrinkage in vivo and may only be derived from a combination of material properties, restoration geometry, and interfacial adhesive quality of the tooth and filling material. from a clinical perspective, it was proposed that the significant reduction in the cuspal deflection of cavities restored with p90 compared with filtek z350 might be advantageous in terms of clinical longevity. it may be speculated that a decrease in polymerization shrinkage stress and a reduction in the associated deleterious effects, such as microleakage, are manifested as a significant decrease in the polymerization shrinkage of p90 compared with z350. therefore, polymerization shrinkage stress is not only dependent upon the volumetric shrinkage of the restorative material but also on the nature of the interfacial bond between the rbc restorative and the associated tooth structure. the change in the organic matrix or materials formulation of the resin composite using silorane composition, has a positive effect on controlling the cusp deflection. | objectives : this study evaluated cuspal deflection in premolar teeth restored with low shrinkable resin composite.materials and methods : a total of 40 human premolars were used for cuspal deflection evaluation in this study. each group was divided into four equal groups according to the type of resin composite and the adhesive used as follows : group a : using low shrinkable resin composite (silorane) with its adhesive system ; group b : using low shrinkable composite (silorane) with g - bond ; group c : using filtek z350 composite with g - bond ; and group d : using filtek z350 composite with adhese. cusp deflection was detected using universal measuring microscope and laser horizontal metroscope.results:this study was done to investigate the effect of polymerization shrinkage stresses of two resin composite materials (filtek z350 and filtek p90) on cuspal deflection of mesio - occluso - distal restoration. for this study, the extracted non - carious maxillary second premolars were selected. forty teeth that showed no more than 5% variation in their dimensions were used. a significant increase in cuspal deflection of cavities restored with the methacrylate - based (filtek z350) compared with the silorane (p90) resin - based composites was obtained.conclusion:the change in the organic matrix or materials formulation of the resin composite using silorane has a positive effect on controlling the cusp deflection. |
radiation treatments, which include external beam radiation, plaque brachytherapy, proton beam radiation, helium ion radiotherapy, and gamma knife radiotherapy,110 may result in long - term damage to the retinal vascular endothelial cells, causing radiation maculopathy in over 50% of eyes undergoing plaque radiotherapy.2,11 this process involves apoptosis, cell migration, clotting cascades, increased vascular endothelial permeability, aneurysm formation, telangiectasia, and neovascularization.12 other radiation effects on the eye include cataract formation, radiation optic neuropathy, retinal detachment, neovascular glaucoma, nerve - fiber layer infarcts, retinal hemorrhages, and vitreous hemorrhage.3,1315 radiation damage can be detected and classified through clinical examination, fluorescein angiography, or optical coherence tomography (oct).1618 oct classification is gaining popularity in the detection and monitoring of radiation - induced macular edema, and can be graded on a 15 scale.13 this edema grading scale has also been shown to correlate with foveal thickness and visual acuity.13 recent findings utilizing spectral domain oct (sd - oct) to detect intraretinal cystic spaces and photoreceptor loss have demonstrated that these earliest signs of radiation maculopathy manifest as macular edema,19 with average onset of oct - evident edema by 12 months or up to 5 months earlier than clinically detectable radiation maculopathy and as early as 4 months after radiation treatment.2023 the potential reversibility of damage from macular edema can serve as a critical time point for therapeutic intervention.21 antivascular endothelial growth factor (anti - vegf) agents have been proposed for the treatment of radiation - related complications. bevacizumab is a recombinant, humanized, monoclonal immunoglobulin g1, anti - vegf antibody that has demonstrated significant clinical benefit in several solid tumors.24 the antibody binds to vegf, a proangiogenic cytokine that plays a prominent role in the growth of tumor - specific vasculature in solid tumors.28 studies on eyes harboring choroidal melanomas have demonstrated statistically significant increases in the levels of vegf in both aqueous and vitreous samples compared to eyes without tumors.25 of note, tumors previously treated with radiation therapy displayed the highest vegf concentrations. these results have been confirmed and have been shown to correlate with larger basal diameter and tumor height.26,27 recently, intravitreal bevacizumab has been effectively used in multiple retinal diseases, including age - related macular degeneration, retinal vein occlusions, diabetic macular edema, and neovascularization.2833 in mice models, bevacizumab has shown no neuronal toxicity or retinal apoptosis,28 and clinical case series have suggested potential efficacy of these agents for radiation - induced maculopathy.3438 the largest case series to date by finger and chin on 21 patients with iodine-125 brachytherapy - induced radiation maculopathy found that administration of 1.25 mg/0.05 ml bevacizumab lead to decreased macular edema, improved or maintained visual acuity, and reduced hemorrhage and retinal edema.39 although anecdotal evidence in small case series has demonstrated the efficacy of anti - vegf agents for radiation maculopathy, to date there have been no large case series or clinical trials evaluating this treatment.13,40 at bascom palmer eye institute, improvements in bcva from bevacizumab usage have been observed in nearly half of the patients with radiation maculopathy, especially when commenced at the first signs of visual compromise. the institute s efforts lie in maintaining visual acuity and globe salvage for patients suffering visually compromising radiation maculopathy. hence, at bascom palmer eye institute, intravitreal bevacizumab is routinely administered in patients with oct - evidence of radiation maculopathy and a best corrected visual acuity (bcva) of 20/25 or worse. therefore, the purpose of this study was to evaluate the 3-year benefits on visual acuity of intravitreal bevacizumab for treatment of radiation maculopathy in patients that maintained vision of 20/50 or better. inclusion criteria included patients that had maintained 20/50 or better vision after developing radiation maculopathy from iodine-125 plaque brachytherapy for uveal melanoma from 20062009. patients were followed up for a minimum of 6 months and were evaluated with sd - oct (heidelberg engineering gmbh, heidelberg, germany) at 24 month intervals following plaque removal. treatment with intravitreal bevacizumab commenced at the first signs of radiation vasculopathy with bcva of 20/25 or worse, followed by repeat injections for persistent vasculopathic changes and a vision of 20/25 or worse. all patients presenting with posterior uveal melanoma underwent iodine-125 radioactive plaques using standard surgical techniques.4143 a standard collaborative ocular melanoma study (coms) plaque (a silastic implant including integrated iodine-125 seed grooves placed into a gold - backed shield) with iodine-125 plaque seeds designed to deliver 85 gy to the tumor apex was used in all cases. after the plaque was brought into the field, 5 - 0 nylon sutures were used to place the plaque, and the position was tested with intraoperative ultrasound by either the surgeon (tgm) or a registered diagnostic medical ultrasonographer using a contact b - scan instrument (ophthascan s ; alcon surgical inc, irvine, ca or innovative imaging inc, sacramento, ca). echographic studies were performed to acquire both longitudinal and transverse plaque views relative to the tumor.4446 photographic documentation and hard copy records were obtained. if removed, rectus muscles were reattached, and the conjunctiva was closed. the operative eye was patched and covered with a lead shield, and the plaque was removed after a mean of 3 days and 3 hours (range 34 days). patients were evaluated with sd - oct at 24 month intervals following plaque removal, along with complete ophthalmic examination including indirect ophthalmoscopy, echography, and wide - field imaging. treatment with 1.25 mg/0.05 cc intravitreal bevacizumab commenced at the first signs of radiation vasculopathy as detected by sd - oct evidence of macular edema.13 the need for repeat injections for recurrent or persistent vasculopathic changes was associated with a lack of improvement or decline in bcva. cases refractory to bevacizumab alone were given intravitreal injection with 4 mg/0.1 cc triamcinolone acetonide. radiation maculopathy was graded in a blinded fashion using the following classification system : grade 1 indicates extrafoveal, noncystoid edema ; grade 2, extrafoveal cystoid edema ; grade 3, foveal noncystoid edema ; grade 4, mild - to - moderate foveal cystoid edema ; and grade 5, severe foveal cystoid edema.13 the authors also proposed a grade 6 to be added to the oct classification, which indicates severe foveal cystoid edema with subretinal fluid. eyes treated with intravitreal bevacizumab for radiation maculopathy that demonstrated bcva of 20/50 or better were evaluated. numerical values of 20/4000, 20/8000, 20/20,000, and 20/200,000 represented counting fingers, hand movement, light perception, and enucleation, respectively. the proportion of radiation retinopathy patients in the current series that maintained 20/50 or better were compared to the proportion of all patients with plaque in the coms series that maintained 20/50 or better using fisher s two - tailed analysis. inclusion criteria included patients that had maintained 20/50 or better vision after developing radiation maculopathy from iodine-125 plaque brachytherapy for uveal melanoma from 20062009. patients were followed up for a minimum of 6 months and were evaluated with sd - oct (heidelberg engineering gmbh, heidelberg, germany) at 24 month intervals following plaque removal. treatment with intravitreal bevacizumab commenced at the first signs of radiation vasculopathy with bcva of 20/25 or worse, followed by repeat injections for persistent vasculopathic changes and a vision of 20/25 or worse. all patients presenting with posterior uveal melanoma underwent iodine-125 radioactive plaques using standard surgical techniques.4143 a standard collaborative ocular melanoma study (coms) plaque (a silastic implant including integrated iodine-125 seed grooves placed into a gold - backed shield) with iodine-125 plaque seeds designed to deliver 85 gy to the tumor apex was used in all cases. after the plaque was brought into the field, 5 - 0 nylon sutures were used to place the plaque, and the position was tested with intraoperative ultrasound by either the surgeon (tgm) or a registered diagnostic medical ultrasonographer using a contact b - scan instrument (ophthascan s ; alcon surgical inc, irvine, ca or innovative imaging inc, sacramento, ca). echographic studies were performed to acquire both longitudinal and transverse plaque views relative to the tumor.4446 photographic documentation and hard copy records were obtained. if removed, rectus muscles were reattached, and the conjunctiva was closed. the operative eye was patched and covered with a lead shield, and the plaque was removed after a mean of 3 days and 3 hours (range 34 days). patients were evaluated with sd - oct at 24 month intervals following plaque removal, along with complete ophthalmic examination including indirect ophthalmoscopy, echography, and wide - field imaging. treatment with 1.25 mg/0.05 cc intravitreal bevacizumab commenced at the first signs of radiation vasculopathy as detected by sd - oct evidence of macular edema.13 the need for repeat injections for recurrent or persistent vasculopathic changes was associated with a lack of improvement or decline in bcva. cases refractory to bevacizumab alone were given intravitreal injection with 4 mg/0.1 cc triamcinolone acetonide. radiation maculopathy was graded in a blinded fashion using the following classification system : grade 1 indicates extrafoveal, noncystoid edema ; grade 2, extrafoveal cystoid edema ; grade 3, foveal noncystoid edema ; grade 4, mild - to - moderate foveal cystoid edema ; and grade 5, severe foveal cystoid edema.13 the authors also proposed a grade 6 to be added to the oct classification, which indicates severe foveal cystoid edema with subretinal fluid. eyes treated with intravitreal bevacizumab for radiation maculopathy that demonstrated bcva of 20/50 or better were evaluated. numerical values of 20/4000, 20/8000, 20/20,000, and 20/200,000 represented counting fingers, hand movement, light perception, and enucleation, respectively. the proportion of radiation retinopathy patients in the current series that maintained 20/50 or better were compared to the proportion of all patients with plaque in the coms series that maintained 20/50 or better using fisher s two - tailed analysis. of the subset (mean age 63 years) of patients showing improvement in visual acuity after 3 years, the mean maximal base was 13.1 mm (median 14 mm ; range 4.518.5 mm) 0.6 mm smaller than the mean of the entire series, and mean tumor height was 3.2 mm (median 2.9 mm ; range 1.117.1 mm) 0.8 mm smaller than the mean of the entire series of radiation retinopathy patients (table 1). table 2 further characterizes the vision and treatment course for this subset. of 159 patients treated with intravitreal bevacizumab for radiation retinopathy from 20062009, 81 (50.9%) were able to maintain a bcva of 20/50 or better 3 years following plaque brachytherapy. fifteen eyes demonstrated 20/20 vision (18.5%), 18 eyes had 20/25 (22.2%), 18 eyes had 20/30 (22.2%), 26 eyes had 20/40 (32.1%), and four eyes had 20/50 (5%) vision. these 81 patients were given a mean of five injections (range 117) over a mean of 17.6 months (range 154 months), starting at 15.8 months after plaque brachytherapy. mean bcva prior to plaque placement was 20/34. at the time of first detection of radiation maculopathy via sd - oct and thus administration of first intravitreal anti - vegf injection, mean bcva for this subset was 20/43, which improved to 20/31 34.6 months (median 36 months) after plaque brachytherapy (figure 1, table 3). improvement from pretreatment to posttreatment visual acuity was statistically significant (p < 0.001, paired t - test). while no large studies to the authors knowledge serve as a comparative control investigating 3 years of visual acuity in eyes with radiation maculopathy, it is interesting to note that after 36 months follow - up in the coms study, only 30.9% of radioactive plaque patients demonstrated 20/40 or better bcva. in the current series, 81 of 159 radiation maculopathy eyes (50.9%) maintained 20/50 or better vision after 3 years. sixteen of those 81 eyes (19.8%) underwent treatment with additional laser photocoagulation or pars plana vitrectomy for radiation retinopathy compared to 53/159 eyes (33.3%) in the entire series of radiation maculopathy patients. noted complications included neovascular glaucoma requiring topical medication in 12.3% (four eyes) of the subset of patients able to maintain 20/50 or better vision after 3 years and 7.5% (twelve eyes) in the entire series, as well as cataract development in 24.7% (20/81 eyes) of the subset and 36.5% (58/159 eyes) of the entire series, all of which were treated with phacoemulsification therapy seven patients with severe radiation retinopathy that were refractory to treatment with bevacizumab alone underwent treatment with additional triamcinolone therapy, of which one patient was able to maintain 20/50 or better vision at 3 years. for the patients showing improvement in visual function following intravitreal injections of bevacizumab (n = 81), foveal thickness was stabilized with a decrease to 313 m (range 209661 m) after a mean of five injections over the course of 17.6 months (figure 2). for these patients, at the time of radiation maculopathy diagnosis, mean radiation maculopathy grade of 3.3 declined to a mean grade of 1.9 at the final follow - up visit, an improvement which was statistically significant (p < 0.0001). exploring potential therapies for radiation - related complications remains a crucial subject in ocular oncology. reports show that half of all patients treated with iodine-125 plaque brachytherapy lose at least six snellen lines of vision within 3 years, with 43% having visual acuity worse than 20/200 and only 34% of patients demonstrating 20/40 or better vision at the final follow - up.2,13 thus, the need to investigate more effective treatment modalities to preserve and maintain functional vision in patients developing radiation maculopathy is warranted.2,38,47 although various treatment modalities for radiation maculopathy have been investigated, including hyperbaric oxygen,48 laser photocoagulation,49 and triamcinolone acetate,13 there has been limited success regarding the effective treatment of radiation - induced macular edema.13 in a study by finger and kurli, two groups of patients were treated with laser photocoagulation (one with evidence of radiation maculopathy and one high - risk group). in patients with radiation maculopathy, sector laser photocoagulation led to a regression of maculopathy in approximately 65% of patients and only 15% lost three or more lines of vision. interestingly, only 19% of patients treated with prophylactic laser prior to clinically evident disease later developed maculopathy. no patient in the prophylactic laser group lost three or more lines.49 another study by kinyoun showed improved mean final visual acuity by 0.34 logarithm of the minimal angle of resolution logmar after 51 months in 19 patients undergoing grid laser treatment compared to 23 untreated controls.50 a single report by bakri and beer has suggested the beneficial role of verteporfin photodynamic therapy following focal laser for radiation edema, although the potential mechanism of effect is unknown.51 periocular triamcinolone has also been investigated for radiation maculopathy, showing sustained benefit 6 months after treatment.52 triamcinolone administered at the time of plaque removal and at 4-month intervals has demonstrated a decrease in rates of macular edema, as well as moderate to severe vision loss.13 using intravitreal triamcinolone, shields reported a decline in mean foveal thickness from 417 m to 207 m a month following treatment, and a stable or improved visual acuity in 45% of 31 patients by 6 months.53 in the authors experience, triamcinolone is often utilized as a consolidation therapy. for patients with massive macular edema and cystic changes where bevacizumab does not lead to significant improvement, combination treatment with bevacizumab followed by supplemental triamcinolone may often stabilize the macular edema however, these patients often have an altered inner segment / outer segment junction from the chronic macular edema, and despite improvement in the intraretinal fluid and restoration of retinal architecture, visual acuity rarely improves significantly. a limited case series suggested that injections with bevacizumab could stabilize or improve visual acuity in up to 86% of patients,34 and further studies have demonstrated improvement in bcva as early as 1 month after a single administration of bevacizumab.54 in the current study, all patients with visually compromising radiation maculopathy were treated with intravitreal bevacizumab at first signs of vasculopathic changes detected by sd - oct. baseline median visual acuity in the coms study was 20/32, with a substantial decrease in vision at 3 years following plaque treatment to a median of 20/125. of note, the coms series included all 623 patients who received plaque brachytherapy, including those that may not have developed radiation maculopathy. out of these patients, 49% lost six or more lines of vision after 3 years.2 in the current study, the improvement in visual acuity was significantly better (p < 0.0001). it was found that 48.4% of patients with visual compromising radiation maculopathy treated with intravitreal bevacizumab injections maintained 20/40 or better vision at 3 year follow up ; in contrast, the coms study showed that only 30.9% of eyes maintained 20/40 or better vision.2 in addition, a study by char further showed that only 26% of total eyes receiving plaque therapy were able to retain 20/40 or better vision at 23 years following plaque brachytherapy.55 fluorescein angiography utilized within coms was not found to be correlated with early radiation maculopathy as detected by sd - oct in the current study. therefore, fluorescein angiography findings may represent later changes in macular anatomy, and this method was not found to be informative in evaluating patients with early bcva decline associated with sd - oct findings of radiation maculopathy. the current study emphasizes the importance of early identification using sd - oct, and has demonstrated that early treatment with anti - vegf agents may stabilize the retinal vasculature, decreasing vascular permeability, and resulting in a reconstitution of the blood retinal barrier. in addition, anti - vegf treatment may allow for a reduction of the mean macular edema grade that may occur as early as 46 weeks following intravitreal bevacizumab injection.36,54 in patients that maintained 20/50 or better bcva by the final follow - up, evidence of macular edema onset by sd - oct was found as early as 3 months following plaque radiotherapy, with a mean incidence of 15.8 months following plaque brachytherapy. figure 3 shows sd - oct images of patients that demonstrated a significant reduction in macular edema, with an improvement in visual acuity. in the current study, a positive correlation was also observed between initial macular edema grade and final bcva.13 it was also noted that some patients showing persistent macular edema at the final follow - up visit were still able to maintain functional visual acuity. the current study suggests that despite visually significant radiation maculopathy, early treatment with intravitreal bevacizumab and repeated injections may maintain vision for a minimum of 35 months following plaque brachytherapy. of note, the patients that maintained functional vision (20/50 or better) had good preinjection visual acuity (20/43), emphasizing the importance of early identification of macular edema with sd - oct and early treatment prior to substantial vision loss. limitations to the current study include a relatively small sample size (although it is the largest to date), limited follow - up time of 3 years following plaque brachytherapy, its retrospective nature, and the inclusion of only a single institution. furthermore, this study lacked a control group of patients with radiation retinopathy that did not receive any bevacizumab treatment. however, the goal of this study was to focus primarily on the 81 patients that were able to maintain functional visual acuity after treatment with bevacizumab. radiation doses to the fovea were not calculated ; however, similar rates of macular involvement (16% versus 14.5%) when comparing the subset of patients that maintained 20/50 or better vision to the entire series of radiation maculopathy patients were noted. radiation maculopathy complications were found to commence earlier than 3 years which may introduce some lead time bias. additional studies are needed to investigate whether the effects of repeated intravitreal bevacizumab continues to be efficacious at future time points. this study has demonstrated the importance of early identification of radiation maculopathy using sd - oct. while radiation retinopathy can be visually devastating, early treatment of visually - compromising radiation maculopathy with targeted intravitreal bevacizumab shows promise in stabilizing and even improving vision, allowing many patients to maintain 20/50 or better vision. | purpose : to evaluate the benefits of intravitreal bevacizumab in patients with visually compromising radiation maculopathy following iodine-125 plaque brachytherapy for uveal melanoma.methods:in this institutional review board - approved, consecutive, retrospective study from 20062009 of patients maintaining 20/50 or better vision following treatment for visually compromising radiation maculopathy, patients were evaluated with spectral domain optical coherence tomography at 24 month intervals following plaque removal. treatment with intra - vitreal bevacizumab commenced at the first signs of radiation vasculopathy on spectral domain optical coherence tomography with associated decreased best corrected visual acuity, followed by repeat injections for recurrent or persistent vasculopathic changes.results:at 3 years following plaque brachytherapy, 81 of 159 (50.9%) patients treated for radiation maculopathy demonstrated 20/50 or better vision at median follow up of 36 months, which demonstrates significant improvement in vision as compared to the collaborative ocular melanoma study (p < 0.0001). these 81 patients were given a mean of five injections (range 117) over a mean of 17.6 months (range 154 months), starting at 15.8 months (range 350 months) after plaque brachytherapy. for those eyes that maintained 20/50 or better vision at the final follow - up, pretreatment mean best corrected visual acuity of 20/43 improved to 20/31.conclusion : this study demonstrates that spectral domain optical coherence tomography can detect early vasculopathic changes secondary to radiation maculopathy and that prompt treatment with intravitreal bevacizumab may delay vision loss and maintain or possibly improve visual acuity in half of eyes diagnosed with radiation maculopathy. radiation maculopathy remains a therapeutically manageable morbidity associated with radiation therapy for posterior uveal melanoma. |
medicine is based on professional virtues such as self - regulation, autonomy authorisation, specialisation, and adherence to an ethical code of practice. the privilege of self - regulation assumes assurance of the competencies of every practicing doctor, which is gained by standards for education and practice. the amount of expectations of what gps are supposed to have knowledge about is large and ever developing, from the profession itself, from society, and from patients. learning is expected to take place through continuing professional development (cpd), known to achieve the best outcome if integrated within daily clinical practice, performed over time, through a mix of activities and sources of knowledge, and, involving educational meetings [25 ]. it has been suggested that gps need more knowledge regarding social, emotional, and cognitive development of young children. they also need to be able to describe problems within the field to communicate effectively with other professionals in the development of a common language [68 ]. to obtain professional behaviour, knowledge needs to be applicable, and several models have been suggested (e.g., [7, 8 ]). to establish professionalism beyond professional behaviour, identity and idealism need to be included. the inner attitudinal values of professionalism within the individual are, however, difficult to assess. there is, however, an ongoing debate on the assumption that doctors can identify and remedy any decencies in their own knowledge and skills, especially in relation to their status as reflective practitioners. this is particularly true for self - regulating professionals such as gps, for whom cpd and the development of reflective practice are often left almost entirely to the individual. studies of supervision groups for gps have been demonstrated to prove valuable in establishing a shared understanding, in conceptualizing children cases in general practice [11, 12 ]. these kinds of group studies contribute to the called - for development of a common language and a broader understanding of the challenges in general practice while working with children and their families. however, it has not been possible to identify any published work regarding how the individual gp regards and responds to the professional challenges when confronted with clinical questions in supervision. the aim of the paper is to describe the process of professional learning and challenges at the individual level among general practitioners, in this paper exemplified by a study where gps took part in educational peer group supervision focusing on children cases. a practice - based project was set up, in denmark, from 2005 to 2007 by gps with a special interest in child health, with the aim to prevent the neglect of children by early and competent action and to strengthen the professional identity of the participating gps in children cases [11, 12 ]. the specific learning objectives were to strengthen the gps ' competencies in identification (of a child case), referral (of a child to relevant local initiatives or parts of the social and health care system), intervention (relevantly in a child case). a case with a child in need in general practice is defined as a case that directly or indirectly involves problems with a specific child, an as - yet unborn child, or one or both parents of a family, currently or potentially threatening the well - being of the family or the child [11, 12 ]. the main intervention was the participation of 21 gps in three peer groups, meeting regularly for educational supervision over a 2-year period, focusing on cases involving children from the gp 's clinical practices. moreover, a number of other learning tools were offered to the participants : teaching days, written material, and electronic portfolios. the activities and the gps ; learning were followed in a multimethod evaluation by the authors. the original intention was to find supervisors with a gp background, but for pragmatic reasons two groups were led by gps with supervision training background and the third by a clinical psychologist / child expert. therefore, a multiple case study research design was set up focusing on the circumstances, dynamics and complexity among six of the twenty - one participants. the cases were explored in depth, retrospectively over a 2-year period through participant observations, interviews before, midterm, and after the project ended, and using a written evaluation questionnaire (described in). selecting the case unit : one male and one female gp from the three different geographically groups : urban, suburban, and countryside, representing different practice organization forms : solo and shared, part - time and full - time, and number of years ' of experience as gps : 030 were selected before the interventions began. following the suggestions of stake, in bowling [14, page 406 ], the analysis was done in the following four stages : a chronological or biographical description of the cases. the investigators ' approach to understanding and investigating the cases. a description of each, in turn, of the major components of the cases. six cases are presented in table 1 including information regarding gender, age, geography, number of years in practice, practice organization form, previous experience with participation in educational supervision groups as continuous professional development (cpd), and the professional background of the supervisors. each participant was given a new name, and any person - identifiable parameters or information was deleted or changed. each participant described his / her learning objective before the intervention began, self - reported learning halfway and at the end of the project. to analyze the individual learning and the learning objectives of the overall project, we used the two - dimensional theoretical model the revised taxonomies presented in table 2. using this model the overall learning objective for the project was categorized as creation at a metacognitive level (color coded yellow, and represented as a yellow square in the diagrams of table 3). the learning object of identification was defined by the project designers to be obtained to the level of evaluation of conceptual knowledge (represented as a grey square in the diagrams of table 3), the learning objective of referring children to the level of evaluation of metacognitive knowledge (represented as a red square in the diagrams of table 3) whereas the learning objective of intervention was defined to the level of creation of procedural knowledge (represented as a green square in the diagrams of table 3). the coloured circles in the diagrams show the actual level of knowledge expressed by the individual gp within the four learning objectives : overall (yellow), identification (grey), referring (red), and intervention (green). in order to analyze the individual challenges and learning processes, was structured using the individual gps ' own formulated learning objectives before the intervention began, halfway, and finally after the project ended after two years. each individual learning objective was then related to the overall learning objectives of the project and colour - coded according to the revised taxonomies framework. the individual learning processes were each depicted in a table showing the revised taxonomy model. the participants were allowed to describe as many learning objectives for their participation in the project as they wanted. they all defined 2, 3, or 4 learning objectives. at each level of the individual development, the learning objectives were categorized as within the applied taxonomy. if the participant said i want to become better at spotting children in need, this was perceived as working with the project 's learning objective of identification and then categorized according to the taxonomy used. if the learning reached the level of strengthening the medical professional identity within the specific self - identified learning objectives they were working with, it was colour - coded yellow and plotted to the knowledge level they had reached within this specific area. if the gp reached the knowledge level described in the curriculum, this can be seen plotted as a circle within the square of the same colour. quotes from the final interviews with the six participants are included in order to show how the participants expressed their perception of the individual processes of professional learning as taking part in a educational supervision group. ann : when you are sitting in a group and hear that you are not the only one who experiences problems with saying some things and get the consultation going regarding a difficult issue, and that the others dared, or they did not dare for that matter, then i say : so what ? we all have the same problems : it 's not that different among us. i mean, you get time to reflect, that 's what it aims at, and that is really rewarding. when you think of how we work, this is the way we learn. because we work so spread out and at the same time together anyway. claire : i do n't really think it has been good to bring up my own cases, there has been a lot of good things in the other participants ; cases (), but i think i often got advice instead of reflections, and i just ca n't take that. david : to bring up stuff in the group has been connected with a certain element of : have i presented it well enough ? the supervisor has been saying do n't think about how you say it, just say it. but he can do that from here to jerusalem, i would never do that, never. erica : participating in the project has sharpened my attention ; i have a completely new attention on children and families and remember to include the children even if the issue is something else. i now know that some things are not my business and that i as a gp can not save the world ; we do have limitations. you can support the families, bring attention to the problem, and then pass the problem on to a relevant authority and that may be the end of what i can do. fred : i now have an overview of our collaborators and what i can refer to and how to do it. i know what i can use the children ward for, if i get a suspicion i can admit them for observation, and i know what to write. the aim of the paper was to describe the individual processes of professional learning and challenges among gps as they take part in educational peer - group supervision. combining the distinction between developing professional behaviour and professionalism with the applied taxonomy, we have defined the development of professional behaviour as moving towards a gain of factual, conceptual, and procedural knowledge to the level of application. within this definition development of professionalism additionally implies a gain of meta - cognitive knowledge to the level of analysis, evaluation, and creativity. the analysis has shown that all gps developed their professional behaviour and many of them strengthened their professional identity in this domain towards a changed professionalism. most of the participants emphasized the positive experience of sharing their worries with the children and the families themselves, demonstrating that they care for the patients. if you look at the diagrams of learning (table 3), you can see that some of the gps ' learning processes were very linear / convergent (e.g., brian). others had a more complex / divergent learning process, starting with a relatively simple objective but gradually realizing how multifaceted the issue was after the first year, leading to a development of understanding new perspectives or action possibilities at the end of the project (e.g., erica). the new and inexperienced gp (david) and the most experienced gp (claire) did not gain what they had hoped. they both developed, but david seemed to have set his expectations too high or perhaps wished for more complicated learning to happen. being a novice gp, david, expressed the need to develop his own experiences rather than what he described as transferring knowledge from the more experienced gps. claire progressed to more complex competences but still not to the degree she had hoped for. in relation to our definition of professionalism, her application of metacognitive knowledge reached the level of analysis but not evaluation and creativity. two of the gps (fred and erica) spontaneously described their new development of new thinking or professional language. by participating in educational peer - group supervision for two years focusing on child cases, some gps did not gain what they expected and only a few developed their professionalism to the extent to which the project had aimed. we can not be certain about the reasons for different developments among the gps, but one explanation could be the gps ' different experiences, both in terms of clinical experiences and experiences in the use of supervision as a cpd method. another explanation could be that, although the participants received the same intervention, the two from the rural group (erica and fred) were supervised by a clinical psychologist / child expert instead of a gp, leading to potentially different perspectives in the individual supervision sessions. but in the overall evaluation at the end of the study, all participants expressed that they had gained tremendously from the supervision in the development of their professional skills. they felt able to identify children in need, as they felt able to define the specific initiatives these children required but had also gained the understanding of learning within this field as dependent on continuous learning, expressing that they felt in need of more training in identifying and working with partners in care. the project design gave the possibility of following the participants over time, supporting the internal validity, as it is based on longitudinal triangulated data ; not only the participants ' responses in the interview situations, but also data from observations in group interaction, at teaching days, and analysis of the electronic portfolio designed for the project (the evaluation data collected is described in detail in.) in this paper we focus on the process of professional learning and challenges at the individual level. in another paper we have analysed the collective and interactive dimensions in depth making these perspectives more implicit than explicit in the analysis in this paper. the six cases represent different gender, age, practice organization, geography, and previous experience with educational peer - group supervision. the participants, however, can all be described as white middle class, which is likely to have influenced the professional challenges presented. our aim to describe individual learning processes called for the development of an analytical framework based on existing literature on taxonomy as well as medical professionalism. the analytical model we have developed (table 3) and used in this paper to describe the development of professional behaviour and professionalism did not account for the development beyond self - reported change. this model was only used to describe the professionalism and professional behaviour attained as set out for this specific project, focusing on children in need. the revised taxonomies framework we have used might not be appropriate for describing other aspects of a gp 's professionalism [16, 17 ] or other clinical areas. other methods for data collection and analysis could have been used ; for instance, we did not ask the participants to fill in learning style surveys and we could have chosen other parameters used to access adult learning. our choices for data collection and analysis were affected by the overall aim of the project to strengthen the professionalism of the gps working with paediatric cases. finally, we can not predict the gps ' learning processes after the intervention or how the processes would have looked, if the intervention had lasted longer. it has not been possible to identify any articles regarding individual learning processes for gps working with clinical challenges in educational supervision groups. we therefore suggest that this paper is a contribution to an emerging field, demonstrating the need to focus on individual learning trajectories in a group learning context. the study took its point of departure in a project focusing on children in need. it is however our expectation that the mechanisms in the educational peer group, including the individual outcome, is transferable to educational peer supervision groups with other clinical foci. the results of the study suggest that there might be several elements playing a significant role in the development of professional behaviour and professionalism for the individual gp participating in an educational peer supervision group : the composition of the supervision groups in terms of participants ' clinical experiences and experiences with supervision as a cpd method, as well as the professional background of the supervisor. this we hope will be part of the considerations for any course organizer planning future educational supervision as part of cpd. the paper also suggests an analytical framework to describe the individual gps ' development of professional behavior and professionalism when working in educational peer - group supervision. it is our hope that the analytical model we have developed in this paper will encourage other researchers to further studies of the impact of educational peer group supervision at an individual level. | background. research has shown that peer - group supervision can strengthen gps ' professionalism, but little is known about the individual learning processes. to establish professionalism beyond professional behaviour, identity and idealism need to be included. the inner attitudinal values of professionalism within the individual are, however, difficult to assess. aim. on the basis of a multiple case study, this paper describes the process of professional learning and challenges for individual gps, as they take part in supervision groups focusing on children cases. methods and results. by using a two - dimensional theoretical model, it is shown that all gps developed their professional behaviour, and many of them strengthened their professional identity in this domain towards a changed professionalism. most participants emphasized the positive experience of sharing worries with families indicating care and interest. some participants learning processes were very linear / convergent ; others were complex / divergent starting out with a relatively simple objective, realizing how multifaceted the issue was after the first year leading to a final development of new perspectives or action possibilities. conclusion. the composition of supervision groups, as well as the professional background of the supervisor, may play a significant role in the development of professional behaviour and professionalism. |
juvenile idiopathic arthritis (jia) is an autoimmune disease1 whose association with uveitis is established for more than half a century.2,3,4 there are, according to the international league of associations for rheumatologists (ilar), 7 subtypes of jia known as oligoarticular, polyarticular rf(), polyarticular rf(+), enthesitis - related arthritis, psoriatic arthritis, systemic, and undifferantiated.5 the jia - associated uveitis may develop before, at the same time, or after the arthritis onset.2,6 it is typically anterior, chronic, and usually affects both eyes.711 if untreated, serious ocular complications can occur (cataract, glaucoma, band keratopathy, posterior synechiae) causing visual impairment in afflicted children.2,5,12 risk factors for the development of uveitis in children with jia, are early onset of the disease, pauciarticular subtype, antinuclear antibodies (ana) positive titers, female sex, and certain human leukocyte antigen (hla) markers.13,14 all children with jia should have at least one adequate slit lamp examination as soon as possible after diagnosis of the arthritis.7,12 if uveitis is not detected initially, all children with jia should be screened by slit lamp examination as per specific screening criteria2,3,15,16 according to the american academy of pediatrics (table 1). we must mention that the frequency of ophthalmologic examination has been slightly changed, according to updated recommendations,17 where the duration of disease (in years) is also taken into consideration. in the present study we performed a retrospective chart review to study the prevalence, complications, and visual outcome of jia - associated uveitis patients. to identify those with uveitis and related complications a retrospective chart review was performed in 56 consecutive patients that fulfilled the ilar 2001 revised criteria for juvenile rheumatoid arthritis (jra):5 persistent arthritis (swelling of a joint or limitation of motion with heat, pain, or tenderness) of one or more joints for at least 6 weeks after exclusion of infectious, metabolic, traumatic, and neoplastic causes as well as other autoimmune diseases (including psoriatic arthritis, ankylosing spondylitis, inflammatory bowel disease, systemic lupus erythematosus). those patients were referred to the pediatric department of the university hospital of ioannina, greece, between 1995 and 2007 and were examined ophthalmologically in the pediatric ophthalmologic department of our clinic. the pediatric rheumatological database included age, gender, arthritis subgroup, age at onset of arthritis, treatment, arthritis activity, number of swollen or tender joints, and extraarticular manifestations such as the presence of uveitis and uveitis complications. the presence of antinuclear antibodies (ana), hla - b27 antigen, and rheumatoid factor (rf) were documented. the screening intervals met the criteria of the established guidelines, at the time patients were examined.18 the mean follow up time was 7.5 years. all patients underwent a thorough ophthalmologic examination including visual acuity or cycloplegic refraction, slit - lamp biomicroscopy, iop measurement (when possible), and dilated - fundus examination. visual acuity cut - offs of 20/50 or worse (low vision) and 20/200 or worse (legal blindness) were used according to recommendations from the standardization of uveitis nomenclature (sun) working group.19 statistical analysis was performed with statistical package for social sciences (version 14.0 ; spss inc., odds ratios (or) were calculated using chi - square tests or fisher s exact tests where appropriate and p values less than 0.05 were considered statistically significant. thirty - seven (66%) were girls and 19 (34%) were boys. the average age at diagnosis of jia was 65 months (95% confidence interval [ci ] : 5177 months), range : 3161 months, median : 54 months. it was bilateral in 21 (84%) and unilateral in the other 4 (16%) cases. the average age at diagnosis of jia of the children who developed uveitis was 56 months (95% ci : 3675 months), range : 9152 months, median : 36 months. the prevalence was 48% (14 of 29) in the patients seen before january 2000 and 41% (11 of 27) in those seen after january 2000. the diagnosis of uveitis was made within the first 3 years after the diagnosis of jia for the majority of the patients, specifically for 23 (92%) of them. in 13 (52%) of the 25 patients, uveitis was diagnosed at the initial eye examination immediately after diagnosis of jia, while for the remaining 12 (48%) children, the mean interval from the diagnosis of jia to the onset of uveitis was 23 months (95% ci 641 months), range : 389 months, median : 12 months. oligoarticular jra is defined by involvement of 4 or fewer joints ; polyarticular jra is defined by involvement of > 4 joints (usually 1020) ; and systemic - onset jra is defined by quotidian fevers during the first 6 weeks of the illness, almost always associated with a characteristic rash. of the 56 patients with jia, 42 (75%) were classified as having the oligoarticular onset subtype, 10 (18%) as polyarticular and 4 (7%) had the systemic onset subtype. of the 25 patients who developed uveitis, 21 (84%) were classified as having oligoiarticular onset jia, 4 (16%) had polyarticular onset jia and none had systemic jia (table 2). the subtype of jia did not constitute a statistically signigicant risk factor in our study(p - value = 0.17, using the fisher s exact test). of the 56 patients, ana titers were positive in 52 (93%) and negative in only 4 (7%) of them. of the 25 patients with uveitis, 24 (96%) had positive ana titers and only 1 (4%) had negative ana titers (table 3). in this case also, ana positive titers did not constitute a statistically significant risk factor (p - value = 0.62, using the fisher s exact test). visual complications occurred in 7(28%) of the 25 patients with uveitis (figures 14). one patient (suffering from phthisis bulbi, see figure 4) lost vision and two others had loss of vision up to counting fingers. none of the rest 22(88%) patients had visual acuity less than 7/10, while 15(60%) of them had visual acuity equal to 10/10 and 19(76%) equal or more than 9/10. cataract developed in six (treated surgically with implantation of anterior chamber intraocular lens) and glaucoma in one (initially treated with antiglaucomatic drugs and later with trabeculectomy). four patients developed band keratopathy (treated with abrasion and use of edta), one patient had phthisis bulbi, another had hyphema and three developed posterior synechiae (table 4). concerning the therapy, 11 children were treated with methotrexate, three with a combination of methotrexate and methylprednisolone ; 10 children were treated with the use of biological factors, such as the tumor necrosis factor (tnf)-blocking agents etanercept and infliximab ; and the rest were treated with nonsteroidal anti - inflammatory agents. juvenile idiopathic arthritis is an autoimmune disease that can cause great inconvenience in the young patient s life. the prevalence of uveitis at children with jia,8,9 has been found to be between 4% and 24.4%, even though there are sporadic studies showing a much greater prevalence. chronic iridocyclitis accounts for about 90% of the cases and if untreated, serious visual impairment may occur. it is important to consider that up to 80% of all cases of anterior uveitis in childhood are associated with jia, thus rendering it the most common cause of chronic iridocyclitis in children.1921 the prevalence of uveitis in our study was 45%. it is one of the highest observed in most studies, especially given the fact that it concerns all types of jia and not only selectively the oligoarticular. the confusingly different prevalence rates observed in the literature, can be attributed to the different study designs, as some of them concern population - based data and others large rheumatology centers with different selection criteria and follow - up. furthermore, these differences may derive from the social and environmental factors of the patients included in the various studies. we wanted to find out whether this high rate was due to older cases and whether there is a decreasing tendency over the last decade. a similar observation was made by kodsi in 2002.2 a significant characteristic of these children is that they rarely complain of pain or as uveitis progresses and when they begin to complain of visual disturbances, they have already developed serious complications (cataract, glaucoma, band keratopathy, cystoid macular edema etc).23 most patients have seronegative disease for rheumatoid factor while the most common serological finding is the presence of ana antibodies which are detected in 96% of uveitis cases. ana titers constitute a nonspecific finding since they may be present in other autoimmune diseases, malignancies, and aging and they are unassociated with disease activity or severity.24 according to studies, the presence of ana should prove useful in identifying patients with jia at risk for chronic anterior uveitis.2 another significant risk factor is the subtype of jia. 80%90% of cases of jia - associated uveitis suffer from oligoarticular arthritis, 7%14% from polyarticular and 2%6% presents the systemic subtype.19,26 what might be interesting, is the fact that despite the established association of uveitis with the presence of oligoarticular jia and presence of antinuclear antibodies,14,26 in our study oligoarticular onset subtype of jia or ana positive titers did not constitute a statistically significant risk factor (p > 0.05). as in all retrospective studies, our results must be interpreted with caution. a referral bias exists because our institution is a tertiary care medical center, and it is possible that only the most severe cases of jia associated uveitis were referred to our center as suggested by high frequencies of ocular complications and poor visual acuity as well as the long duration of uveitis prior to presentation to our clinic. furthermore, the number of events was small for some outcomes, which may have limited the precision of odds ratios for certain risk factors. despite these limitations, our study suggests that visual impairment still occur frequently in jia - related uveitis, seen in the tertiary care setting. almost equally high rates of oligoarticular onset subtype of jia and ana positive titers were found among children who did not develop uveitis throughout any stage of the follow up. in our study visual complications occurred in 7(28%) of the 25 patients with uveitis. severe visual impairment has been reported in up to 38% of patients.2728 increased severity of ocular disease at the initial examination has been reported as a risk factor for poor visual acuity outcomes at the last follow - up visit, but the follow - up time in these series are variable.29,30 one patient developed uveitis 6 years later and another one almost 7.5 years later. both of them were males, suffering from bilateral uveitis, were ana positive, and hla - b27 negative ; one suffering oligoarticular and the other from polyarticular jia. the range of cumulative incidence of jra - associated uveitis has been reported to be between 1.4%38%.2,3136 our analysis suggested a cumulative incidence of jra - associated uveitis at the high end of the above mentioned rates. as a conclusion, we observed remarkably high prevalence of uveitis and related ocular complications in 7 (28%) of the patients and furthermore the rate of poor visual outcome was almost 12%. the reported rate of visual loss due to jra - related uveitis varies in more recent studies from 3%25%.26 all these documentations may facilitate the optimization of the current guidelines and result in optimization of follow up. immediate ophthalmological examination after the diagnosis of jia and excellent co - operation between the physician and the parents of the children concerning the therapy may help to improve long - term outcome. | objectiveto evaluate the characteristics and visual prognosis of juvenile idiopathic arthritis - associated uveitis (jia).methodsa retrospective review was performed on 56 patients who met the criteria for jia to identify those with uveitis and related complications. patients were referred to and were examined in the pediatric department of the university hospital of ioannina, between 1995 and 2007.resultsthe prevalence of jia - associated uveitis was high. despite this and the related complications, the final visual outcome was satisfactory in the majority of the cases. authors did not observe any correlation between prognosis and sex, age at the onset of uveitis or arthritis, pattern of arthritis, or positivity for antinuclear antibodies (ana).conclusionwe found a remarkably high prevalence of uveitis and related ocular complications in 7 (28%) of the patients, and the rate of poor visual outcome was 12%. |
using cluster sampling, 337 free - living elderly subjects (193 females and 144 males) were entered in a cross - sectional designed study in shiraz (iran). the study population was divided into regional clusters based on regional municipality ; and, a random sample of these clusters was selected. exclusion criteria were dementia, psychotic disorders and inability to participate in anthropometric measurements. demographic questionnaire and 24hour food recall were completed based on interviews performed by a trained dietitian. anthropometric indices, including height, weight, mid - arm circumference (mac), waist circumference, and hip circumference were measured in standard situation and body mass index, waist - hip ratio (whr), waist to height ratio (whtr) were calculated. following structured diagnostic interview by a psychologist, depressive signs were evaluated using the geriatric depression scale (gds). the nutritional status of subjects was determined using mini - nutritional assessment (mna) scores questionnaire via an interview conducted by a trained dietitian. the mna is an internationally validated assessment and screening tool that can be used in elderly subjects to identify malnourished patients and those at risk of malnutrition (1415). in the mna, according to screening segment, if the score of patient is 12 or more, the patient is not at risk of malnutrition and there is no need to complete the rest of the questionnaire. however, if the score is 11 or less, the patient may be at risk and the full mna form should be completed. based on final scores, patients will classify into three groups : at risk of malnutrition, malnourished, and well nourished (16). to screen the elderly patients at risk of depression, this tool has been validated in iran (17). in the gds, according to screening part, if the score of patient is 8 points or less, the patient is not at risk (17). continuous variables are reported as means sds and categorical variables are expressed as frequencies and percentages. differences in nutritional status in various layers of the categorical variables were analyzed by the chi - square test. for comparison of qualitative variables in the two groups (depressed and non - depressed) chi squared test was used. moreover, means of quantitative variables including body mass index, triceps skin folds, mac, waist, calf, and total body fat were compared between the two groups by means of independent sample t - test. pearson correlation coefficients were calculated for linear relations between total gds scores as well as mna scores and continuous variables such as total body fat, measures of bmi, triceps skin - folds, mac, calf, and waist circumference. continuous variables are reported as means sds and categorical variables are expressed as frequencies and percentages. differences in nutritional status in various layers of the categorical variables were analyzed by the chi - square test. for comparison of qualitative variables in the two groups (depressed and non - depressed) chi squared test was used. moreover, means of quantitative variables including body mass index, triceps skin folds, mac, waist, calf, and total body fat were compared between the two groups by means of independent sample t - test. pearson correlation coefficients were calculated for linear relations between total gds scores as well as mna scores and continuous variables such as total body fat, measures of bmi, triceps skin - folds, mac, calf, and waist circumference. total of 337 elderly subjects participated in this study. the participants mean age sd was 63.1 i 8.1 years (64.4 8.0 in male subjects and 62.1 8.1 in females). demographic variables in the study of depression in elderly subjects total number of subjects was 337 elderly anthropometric variables in elderly subjects with depressive symptoms compared to elderly subjects with no depressive symptoms are listed in table 2. anthropometric variables in the elderly with depressive symptoms (based on gds scores) in comparison with the elderly with no depressive symptoms gds : geriatric depression scale for comparison of qualitative variables chi squared test and for comparing means of quantitative variables between two groups independent sample t - test was used. bmi was categorized as normal weight (< 24.0 kg / m2), overweight (24.0 to 27.9 kg / m2), or obese (28.0 kg / m2). mid - upper arm circumference significant differences between two groups (p 0.05) nutritional status (base on mna) in elderly subjects with depressive symptoms in comparison with elderly subjects with no depressive symptoms is demonstrated in table 3. nutritional status (base on mna) in elderly subjects with depressive symptoms (based on gds scores) comparing to elderly subjects with no depressive symptoms mna : mini - nutritional assessment data of nutritional status is missing for three participants. very significant difference between two groups (p 0.0001) according to gds, 43.62% of the subjects were depressed, and women were more depressed than men (27.9% vs. 15%, respectively). people living in urban areas were more depressed than rural areas (39.46% vs. 3.85% respectively). subjects with less than twelve years of education were more depressed than those with more than twelve years of education (31.45% vs. 12.16% respectively). according to mna, forty three percent of women were malnourished or at risk of malnutrition compared to 25.7% of men (p=0.004). percent of malnutrition or risk of malnutrition was higher in urban subjects compared to rural subjects (33.53% vs. 2.07% respectively), and it was also higher among subjects with less than 12 years of education compared to those with more than 12 years of education (25.8% vs. 9.79% respectively). about 48% of the subjects with severe and mild depression were malnourished or at risk of malnutrition. gds had a significant negative dependence with the mna for the entire sample (r=-0.58, p - value<0.0001). moreover, the mean gds scores differed significantly between men and women (p - value<0.05), and the prevalence of depression was higher among women. malnutrition and depression are both complicated and correlated so that depression may lead to appetite loss and under nutrition. on the other hand, malnutrition may deteriorate depression and apathy (13, 1819). it is not well known whether depression cause malnutrition or poor nutritional status leads to depressive disorders. de wit and colleagues (20) reported a significant u - shaped trend in the association between bmi and depression. they found more depression among obese subjects, less depression among normal weigh participants and again higher trends of depression among underweight subjects (20). the mna tool is a well validated and effective way of assessing the nutritional status in old patients. estimation of an individual 's malnutrition risk is the aim of the mna (21). there is unanimity among nutritionists and researchers about the usage of this questionnaire for early detection of malnutrition in elderly subjects (2223). appetite, nutritional behavior and dietary intake are highly affected by depression in elderly population (24). german l. (25) and colleagues found that mna scores were significantly lower among depressed patients as compared with non - depressed, indicating a higher risk for under- nutrition among depressed people. the main difference of the present research with previous works is examining the association of anthropometric indices with depression as a control for mna and nutritional status in old subjects. depression and bmi are inversely associated with each other (26) which reveal greater physiologic, functional and mental preservation from amounts of muscle mass and greater exercise that protect patients against depressive symptoms (27). this is reflected in our study by statistically significant more triceps skin - folds and total body fat in depressed participants. the prevalence of malnutrition and depression in old inpatient population was much more than free living and family supported old subjects (25) which reveal the role of family support on nutritional and mental status (28). in contrary to our results, some studies (2930) have reported that depressive symptoms and malnutrition in rural areas are higher than urban areas. this might be a result of significantly different numbers of urban and rural participants (311 vs. 26 respectively) in our study. as found by previous studies (3133), one rational for this phenomenon is that depression may be induced by incorrect body image and periodic weight loss dieting and/or more eating disorders among women. although the current study was not designed to find any causal relationship between nutritional status and depression, future cohort studies may be able to elucidate this issue. the main limitation of this study was lack of a control group. we highly recommend a case - control designed study in this field. the results of the present study revealed a high prevalence of depression and malnutrition among the elderly. therefore, households and nursing homes that provide care for the female elderly should pay close attention to their nutritional status and depressive disorder at the same time. the mechanism of this association needs further elucidations, and future studies are needed to evaluate the extent these nutritional disturbances are reversible. | objectivemalnutrition and depression are highly prevalent in the elderly and can lead to unfavorable outcomes. the aims of the current study were to determine the association between malnutrition and depression and also to find any correlation of depression with some anthropometric indices in free living elderly.methodin this cross - sectional study, 337 elderly subjects (193 females) were selected using cluster sampling. depressive symptoms and nutritional status were determined by the geriatric depression scale (gds) and the mini - nutritional assessment (mna) scores questionnaires, respectively. anthropometric indices were measured all in standard situations. chi squared test and t - test were used when necessary. pearson correlation coefficients were calculated for linear relations between variables.resultsof all the total subjects, 43.62% were depressed ; and of whom, 48.01% were malnourished or at risk of malnutrition. gds had a significant negative dependence with the mna for the entire sample (r=-0.58, p < 0.0001). however, there was no significant correlation between age and gds or mna scores. moreover, the mean gds scores differed significantly between men and women (p < 0.05), and women were more depressed than men (27.9% vs. 15%, respectively). the elderly subjects living in urban areas were more depressed than those living in rural areas (39.46% vs. 3.85% respectively).conclusionthe results of the present study revealed a high prevalence of depression and malnutrition among old subjects. moreover, depression was associated with worsening of nutritional status. the mechanism of this association needs further study. |
obstructive sleep apnea (osa) is a common disorder with repetitive upper airway obstruction during sleep resulting in intermittent hypoxia and sleep fragmentation. when untreated, it may cause daytime sleepiness, fatigue, and poor quality of life. positive airway pressure (pap) is the first - line treatment for osa ; it reduces obstructive events, daytime sleepiness and improves quality of life, especially in those with excessive daytime sleepiness. in literature and clinical practice, 4 hours of nightly pap usage for 70% of the nights is considered adequate adherence to therapy, corresponding to an average pap usage of 2.8 hours every night. however, despite the benefits of pap treatment, overall acceptance and adherence rates are not fully optimized as the estimated range has been reported to be between 4680%. it has been argued that some patients do not consider osa as a serious health problem. in this context, several educational and intensive support strategies have been proposed. for instance, a recent study reported that having patients view the polysomnography (psg) charts as a part of an educational strategy may improve long - term pap adherence. a recent report demonstrated lower than expected adherence rates in osa patients, of whom only 38% attended follow - up visits. to date, there is no study addressing the impact of implementation of any of the suggested educational strategies in turkey. in our current study, we primarily addressed whether an intensified patient education strategy which included viewing psg charts followed by frequent follow - up would improve the long - term compliance rate of patients with osa in a turkish sleep clinic cohort. this single - center, prospective, randomized, controlled, parallel group study was approved by the institutional review board of the department of clinical investigations at the ltfi krdar education and research hospital (approval nr 89513307/1009/309 ; june 03, 2014), and was carried out in accordance with the principles of the helsinki declaration. we recruited 490 consecutive adult patients (18 years old) with newly diagnosed osa (apnea - hypopnea index 5 events / hour), who were free from upper airway obstructions (evaluated by the ear, nose and throat (ent) specialist), and were offered pap treatment at the sreyyapaa chest diseases and thoracic surgery training and research hospital in istanbul between june 12, 2014 and april 14, 2015 (figure 1). fifteen patients who were not interested in pap treatment were excluded. among the 475 patients undergoing a pap titration night, 360 were further excluded (280 were living outside istanbul, 15 were unable to come to follow - up, and 65 were not interested in the study). the remaining 115 patients were randomly 1 : 1 assigned to standard support (ss) group (general information about osa and pap treatment at baseline), or to educational support (es) group (additional polysomnography chart viewing from both diagnostic and titration nights). participants were randomly assigned in order of appearance (random number table : ss / es) with exception for patients scheduled for weekend treatment, who were included in the ss group. the baseline anthropometrics and medical history in the study population were obtained from medical records. body mass index (bmi) was calculated as weight divided by height squared (kg / m) and obesity was defined as a bmi 30 kg / m). the educational status (primary school [basic level school education for 45 years ], college, or high - school) was documented, and information regarding known concomitant diseases at baseline was based on the self - reported and/or physician diagnosed conditions. epworth sleepiness scale (ess) score was obtained for evaluation of the subjective daytime sleepiness, and categorized as non - sleepiness (ess 0.10 removed). corrected odds ratios (or) were calculated from the regression coefficients, and all ors are presented with their 95% confidence intervals (ci). separately, the short - term cpap hours / night was compared with the long - term cpap hours / night using paired t - test within the groups, and the pearson s correlation for the whole cohort. all statistical tests were two - sided, and a p - value less than 0.05 was considered significant. we recruited 490 consecutive adult patients (18 years old) with newly diagnosed osa (apnea - hypopnea index 5 events / hour), who were free from upper airway obstructions (evaluated by the ear, nose and throat (ent) specialist), and were offered pap treatment at the sreyyapaa chest diseases and thoracic surgery training and research hospital in istanbul between june 12, 2014 and april 14, 2015 (figure 1). fifteen patients who were not interested in pap treatment were excluded. among the 475 patients undergoing a pap titration night, 360 were further excluded (280 were living outside istanbul, 15 were unable to come to follow - up, and 65 were not interested in the study). the remaining 115 patients were randomly 1 : 1 assigned to standard support (ss) group (general information about osa and pap treatment at baseline), or to educational support (es) group (additional polysomnography chart viewing from both diagnostic and titration nights). participants were randomly assigned in order of appearance (random number table : ss / es) with exception for patients scheduled for weekend treatment, who were included in the ss group. the baseline anthropometrics and medical history in the study population were obtained from medical records. body mass index (bmi) was calculated as weight divided by height squared (kg / m) and obesity was defined as a bmi 30 kg / m). the educational status (primary school [basic level school education for 45 years ], college, or high - school) was documented, and information regarding known concomitant diseases at baseline was based on the self - reported and/or physician diagnosed conditions. epworth sleepiness scale (ess) score was obtained for evaluation of the subjective daytime sleepiness, and categorized as non - sleepiness (ess 0.10 removed). corrected odds ratios (or) were calculated from the regression coefficients, and all ors are presented with their 95% confidence intervals (ci). separately, the short - term cpap hours / night was compared with the long - term cpap hours / night using paired t - test within the groups, and the pearson s correlation for the whole cohort. all statistical tests were two - sided, and a p - value less than 0.05 was considered significant. among 115 eligible osa patients (mean age 51.09.3 years ; 75.5% men), 63 were randomized to the ss group and 52 to the es group (figure 1). baseline anthropometrics, educational status, and clinical characteristics did not differ significantly between the groups (table 1). as shown in table 2, there were no significant differences with regard to psg findings at baseline or on pap titration. following the pap titration night, 57.1% in the ss group, and 80.8% in the es group were satisfied (good / very good) with the pap titration (p=0.007). distribution of cpap, apap, and bpap devices was 71.4%, 4.8%, and 23.8%, respectively, in the ss group, and 71.2%, 7.7%, and 21.2%, respectively, in the es group (p=0.65). two patients in the ss group, and two patients in the es group never used their devices, and their cpap usage hours / night was included in the final analysis as 0. the agreement with exact timing of appointments with time of scheduled follow - up appointments was poor in both groups (data not shown). three patients in the ss group, and one patient in the es group did not come to their fifth appointments, and the data from their fourth follow - ups were entered in the final evaluation. in spite of the poor agreement with the scheduled appointments, 58 out of 63 patients in the ss group, and 49 out of 52 patients in the es group completed the five follow - up appointments during the study period. the median time from randomization to first follow - up was 20 days for both groups with an iqr 1727 days for the ss group, and 1626 days for the es group (p=0.89). the median time to last follow - up was 187 days (iqr 170202 days) in the ss group, and 184 days (iqr 173198 days) in the es group (p=0.16). mean pap levels in patients on cpap, and mean inspiratory and expiratory pap levels in patients on bpap did not differ significantly between the groups (data not shown). at short - term follow - up, the average pap usage was 3.62.3 hours / night in the ss group, and 4.12.3 hours / night in the es group (p=0.62). however, pap compliance, defined as the minimum usage of 2.8 hours / night, was achieved in 58.7% of patient s in the ss group, and 76.9% of patients in the es group (p=0.039). ess scores decreased significantly in both groups (from 10.45.9 to 2.32.9 in the ss group ; p<0.001 and from 9.54.2 to 2.53.2 in the es group ; p<0.001). at long - term follow - up, the average pap usage was 4.22.5 hours / night in the ss group, and 5.22.1 hours / night in the es group (p=0.027). pap compliance was achieved among 68.3% in the ss group, and 86.5% in the es group (p=0.021). the increase in pap usage (hours / night) was significant in both groups (p=0.025 in the ss group, and p<0.001 in the es group, [paired t - test ]), and there was a significant linear relationship (r=0.53 ; p<0.001) between short - term pap hours / night and long - term pap hours / night (figure 2). as shown in table 3, the es strategy followed by frequent visits predicted the pap compliance in the multivariate analysis (or 3.6, 95% ci 1.210.6 ; p=0.020). other predictors were obesity (or 3.4, 95% ci 1.29.7 ; p=0.019) and severe osa at baseline (or 4.7, 95% ci 1.217.6 ; p=0.023). in the current study, the intensified patient education strategy with psg charts view followed by frequent follow - up appointments improved the pap compliance in osa patients in this sleep clinic cohort. other significant predictors of pap compliance were obesity and osa severity at baseline, while primary school education level was inversely correlated with the pap compliance. to our knowledge, this is the first study to report the impact of an educational strategy including psg chart view at baseline and after the titration night followed by five pap control appointments during a median follow - up of six months in a sleep clinic cohort. the strengths of the study include the randomized controlled design with similar baseline characteristics of the groups, the frequent follow - up visits, as well as a low dropout rate during the study period. the es strategy seemed to increase the awareness of osa and its risks especially in obese and severe osa patients, and the outcomes were significantly better in the es group, even after adjustment for the baseline educational status of the participants. though the patients did not follow the exact scheduled appointment times, almost all participants returned for five follow - ups during the study period. there was a significant increase in pap usage in hours / night in both groups over time, suggesting the importance of the frequent follow - ups as continuous support in order to increase awareness and pap compliance. in some previous studies, the importance of education on pap adherence was addressed [912 ]. a similar design as ours was recently reported by falcone and colleagues, demonstrating that 93% the participants who viewed their psg charts returned for follow - up at one month and 76% returned at 12 months. at one - month follow - up, 94% of the es group and 69% of the ss group achieved pap usage of at least four hours during 70% of the time period, and these rates were almost similar at one year follow - up. the cpap usage in hours / night was also reported to be higher in the es group already at one month with no further increase at one year follow - up. however, in our study, the initial adherence rates were lower, probably due to the educational level of the patients, but the compliance rates were improved significantly at six - month follow - up, suggesting that the follow - up visits were important for increasing awareness of the disease and improvement of pap compliance, especially in patients with a lower educational level. another previous study by nadeem and colleagues demonstrated that osa patients who viewed their psg charts at baseline without viewing the psg charts on pap titration did not improve their pap adherences, which might reflect the importance of psg chart view of pap titration in the educational strategy. however, in that study, there were no frequent follow - ups and the educational level of the participants was not considered. other educational studies regarding pap adherence have often included multiple simultaneous interventions. in one study, osa patients received home nursing, a 3-night cpap trial, and educational support. in another study, the intensive support included optimizing the equipment with humidifiers and mask fit, together with counseling and educational support. in trials with telephone support, one study reported that the patients who were called by phone regularly for two months had increased adherence ratios. another study reported that there was no difference between sending standardized messages and additional phone calls. salepci and colleagues followed a larger cohort of 648 patients in the same region of istanbul as our hospital, during 2005 to 2011, and reported that only 38% of patients attended the clinical follow - ups, and the required adherence rate was achieved among 65% of the patients attending the follow - ups. the low socio - economic status of the study population and unawareness of the seriousness of the disease were possible explanations of those study results. this suggests that educational support is even more important in cohorts with a low educational level. it should also be emphasized that the current turkish legislation regarding the minimum requirement of pap usage in order to keep the device free of charge as a kind of reinforcement might have influenced our results with better follow - up attendance rates and increased pap compliance over time compared to the results in the study of the salepci and colleagues. however, this information was given to both groups, and the additional benefit of the es strategy seemed to be an effective method in this context. in our study, short - term pap adherence was associated with long - term pap adherence, as was previously suggested. obesity and severe osa (ahi 30 events / hour) were also significant predictors of better pap adherence, which is in line with previous reports. the inverse relationship between educational level of the patients and pap adherence was also reported previously. the patient satisfaction with the pap titration night seems to be important regardless of the es or ss intervention allocation. all patients demonstrated a markedly reduced subjective sleepiness at the short - term follow - up, and we found no relationship between ess severity at baseline and the pap compliance at long - term follow - up in contrast to some of the other studies. neither did we find a relationship between patient sex and pap compliance, as suggested in another recent report. first, it was a single - center study, which limits generalizability of results across geographic regions in turkey. second, only pap adherence rates and pap hours / night were considered as primary outcomes, and the reduction in daytime sleepiness was based on the ess scores. it is possible that there were significant differences in other symptoms, quality of life, and cognitive function. third, the patients not coming to the scheduled follow - up visit were contacted by phone by the sleep physician, which might have reinforced the patients participation. however, the phone calls were done for all participants regardless of the group allocation. this educational procedure with psg chart view does not entail any additional cost except for adding 5 to 10 minutes, twice, to the standard protocol, and thus, it may be easily reproduced in any sleep medicine center. however, the frequent follow - ups are not a routine procedure in turkey, and this should be evaluated in a larger cohort addressing the cost - benefit aspects of the management of osa patients. given the high adherence rates in severe osa patients as shown in our study, new national educational strategies should be developed, especially with more focus on osa patients with a low educational level. in order to overcome the potential limit of the sleep centers with full psgs, the current international guidelines of the management of osa patients with home - monitoring diagnostic and pap - titration procedures should be implemented. patient education with psg chart view, both from the diagnostic and pap titration night, followed by frequent visits increased the long - term compliance with pap treatment. other significant predictors of pap compliance were obesity and osa severity at baseline while primary school education level was inversely correlated with the pap compliance. these findings urge the implementation of the recent guidelines for management of osa patients with home - monitoring systems in turkey in order to reduce the clinical overload. this would allow the clinicians to have more time for the educational support strategies, especially for the patients with a low educational level. | backgroundwe addressed the impact of patient education followed by frequent visits on compliance with positive airway pressure (pap) treatment in patients with obstructive sleep apnea (osa) in a turkish sleep clinic cohort.material/methodsthis single - center, randomized, controlled study was conducted in istanbul, turkey between june 2014 and april 2015. among 115 eligible osa patients (mean age 51.09.3 years ; 75.5% men), 63 were randomized to standard support (ss) group (general information about osa and pap treatment at baseline), and 52 to educational support (es) group (additional polysomnography chart viewing from both diagnostic and titration nights). all patients were scheduled to five pap control visits between two weeks and six months after the pap prescription. primary outcome was the pap compliance (4 hours / night for 70% of all the nights) at the last visit.resultsaverage pap usage was 4.22.5 hours / night in the ss group, and 5.22.1 hours / night in the es group (p=0.027). pap compliance was achieved among 68.3% in the ss group, and 86.5% in the es group (p=0.021). in a multivariate analysis, es strategy followed by frequent visits predicted pap compliance (odds ratio [or ] 3.6, 95% confidence interval [ci ] 1.210.6 ; p=0.020). other predictors were obesity (or 3.4, 95% ci 1.29.7 ; p=0.019) and severe osa (apnea - hypopnea index 30/hour) at baseline (or 4.7, 95% ci 1.217.6 ; p=0.023). primary school education level was inversely related with pap compliance (or 0.3, 95% ci 0.10.9 ; p=0.036).conclusionspatient education with polysomnography chart view followed by frequent visits increased long - term compliance with pap treatment. |
sarcoidosis is a multisystem inflammatory disease of unknown etiology, pathologically characterized by non - caseating epithelioid granuloma (13). a definitive diagnosis of sarcoidosis is still challenging and no gold criteria for diagnosis a set of non - specific clinical features and laboratory findings including hypercalcemia, hypergammaglobulinemia and high levels of angiotensin - converting enzyme (ace), along with pathologic findings such as non - caseating granuloma are all considered to exclude other granulomatous diseases (4). genetic predisposition and exposure to the environmental factors may cause the disease and begin granulomatous reactions (5). access study (a case controlled ethological study in sarcoidosis) has demonstrated five exposures to sarcoidosis include farming, jobs raising birds, moulds and woodworking (6). however, these risk factors can vary in different races and geographical regions due to the genetic predisposition and exposure factors such as m. tuberculosis and mould. for instance, hla - dqb1 06 has been associated with radiographic progression in an african - american cohort with advanced pulmonary disease (9) and uveitis in dutch cohort (10, 11). however, hla - drb1 07, 14 and 15 were closely related to progressive pulmonary disease in a scandinavian cohort (12). meta - analysis studies promote a better understanding of the disease activity and its predictive risk factors. the serum ace (sace), known as a biochemical marker of sarcoidosis, as high level of sace appears to be associated with the active form of the disease (13). relationship between sace level and ace genotype indicates that d / d genotype is related to the highest level and i / i with the lowest level of sace (1418). in african - american cohort study in 1998, the dd genotype was associated with increased risk of sarcoidosis, but was not confirmed by the next following studies in the same population (19). subsequently, there was no link between ace gene polymorphism and risk of sarcoidosis in german, dutch, italian, british, finish and czech populations (15, 18, 20, 21). the aim of this study was to determine the distribution of ace i / d genotype among iranian patients with sarcoidosis in comparison to healthy subjects and to investigate the relationship between serum ace levels and the ace i / d genotype in these patients. this descriptive cross - sectional study included 102 patients with sarcoidosis, from an ongoing sarcoidosis patient registry, who registered or referred to masih daneshvari hospital, a third - level hospital in tehran, iran. sarcoidosis was diagnosed based on clinical and radiological evidences, along with histological and serological findings, and roll out other granulomatous diseases such as tuberculosis. a control group of 192 non - dependent, age and sex matched individuals was recruited. in sarcoidosis patients and controls, those who suffered from diseases that increase or decrease the peripheral blood was collected from the rest of patients and control subjects. the serum ace level at the first visit (before taking any medication) was measured. this study was approved by the bioethics committee protocol of masih daneshvari hospital, tehran, iran. pcr was used to identify i and d alleles, a segment from the intron 16 on ace gene that the size fractionation was detected by electrophoresis. genomic dna was extracted from peripheral blood mononuclear cells (pbmcs) using qiagen dna extraction kit (the qiaamp dna blood mini kit, germany) according to the manufacture structure. in each pcr experiment, micro - tubes were contained of 25 l pcr reaction consisted of 20 pmol/l of each forward and reverse primer : f 5 ctggagaccactcccatcctttct 3 and r 5 gatgtggccatcac - attcg tcagat3, 10 l of 2x master - mix red, 10 l of extracted dna, and 3 l distilled water. pcr condition was as the follows : an initial denaturation step for 2 min at 94 c, followed by 35 cycles of denaturation (30 sec at 94 c), annealing (30 sec at 65 c), extension (30 sec at 72 c), and the final extension step (72 c for 5 min) (abi thermal - cycler 5020) (23, 24). only 10 l of the amplified pcr products were loaded on a 2% agarose gel. the dna bands corresponding to 190bp as deletion and 490 bp as insertion were visualized by a gel doc viber transilluminator (fig. determination of genotypes i d, ii, and dd in sarcoidosis patients on 2% agarose gel : from left to right, gels contain marker followed by seven patients with sarcoidosis. the single lower band in patients a, d, e, f, and g corresponding to 190 bp indicates the dd type. the genotype ii in patient b is also found as a single upper band corresponding to 490 bp. the i d type as a double band, 490 and 190 bps is determined in c. nc= negative control the genotypes ii and i d in control subjects on 2% agarose gel : marker in lane m. the remaining lanes occupied by seven control subjects. the remaining lanes contain double bands as the i d type. nc= negative control characterization of the study population as released as meansd with 95% ci and absolute frequencies for categorical variables were reported., chicago, il, usa) and anova test were conducted to compare the genotypes sace after normalization by homogeneity of variance test. the differences between the mean sace levels in different genotypes based on the normal distribution were analyzed using student s t - test. genotypic and allele distributions in different groups were compared using the chi - square test. the wald test was used to determine statistical significance for each of those independent variables. the hosmer - lemeshow test was used to determine the goodness of fit of the logistic regression model. in all cases, standard this descriptive cross - sectional study included 102 patients with sarcoidosis, from an ongoing sarcoidosis patient registry, who registered or referred to masih daneshvari hospital, a third - level hospital in tehran, iran. sarcoidosis was diagnosed based on clinical and radiological evidences, along with histological and serological findings, and roll out other granulomatous diseases such as tuberculosis. a control group of 192 non - dependent, age and sex matched individuals was recruited. in sarcoidosis patients and controls, those who suffered from diseases that increase or decrease the peripheral blood was collected from the rest of patients and control subjects. the serum ace level at the first visit (before taking any medication) was measured. this study was approved by the bioethics committee protocol of masih daneshvari hospital, tehran, iran. pcr was used to identify i and d alleles, a segment from the intron 16 on ace gene that the size fractionation was detected by electrophoresis. genomic dna was extracted from peripheral blood mononuclear cells (pbmcs) using qiagen dna extraction kit (the qiaamp dna blood mini kit, germany) according to the manufacture structure. in each pcr experiment, micro - tubes were contained of 25 l pcr reaction consisted of 20 pmol/l of each forward and reverse primer : f 5 ctggagaccactcccatcctttct 3 and r 5 gatgtggccatcac - attcg tcagat3, 10 l of 2x master - mix red, 10 l of extracted dna, and 3 l distilled water. pcr condition was as the follows : an initial denaturation step for 2 min at 94 c, followed by 35 cycles of denaturation (30 sec at 94 c), annealing (30 sec at 65 c), extension (30 sec at 72 c), and the final extension step (72 c for 5 min) (abi thermal - cycler 5020) (23, 24). only 10 l of the amplified pcr products were loaded on a 2% agarose gel. the dna bands corresponding to 190bp as deletion and 490 bp as insertion were visualized by a gel doc viber transilluminator (fig. determination of genotypes i d, ii, and dd in sarcoidosis patients on 2% agarose gel : from left to right, gels contain marker followed by seven patients with sarcoidosis. the single lower band in patients a, d, e, f, and g corresponding to 190 bp indicates the dd type. the genotype ii in patient b is also found as a single upper band corresponding to 490 bp. the i d type as a double band, 490 and 190 bps is determined in c. nc= negative control the genotypes ii and i d in control subjects on 2% agarose gel : marker in lane m. the remaining lanes occupied by seven control subjects. characterization of the study population as released as meansd with 95% ci and absolute frequencies for categorical variables were reported. statistical analysis using spss software version 16.0 (spss inc., chicago, il, usa) and anova test were conducted to compare the genotypes sace after normalization by homogeneity of variance test. the differences between the mean sace levels in different genotypes based on the normal distribution were analyzed using student s t - test. genotypic and allele distributions in different groups were compared using the chi - square test. the wald test was used to determine statistical significance for each of those independent variables. the hosmer - lemeshow test was used to determine the goodness of fit of the logistic regression model. in all cases, a 190bp fragment with the deletion (allele d) and a 490bp fragment with the insertion (allele i) for genotypes ii, i d and dd were analyzed in 102 patients and 192 controls (fig. serum ace activity in patients and controls with genotypes separation is described in table 1. the association between sace activity in three geno - types of sarcoidosis patients and the control subjects was significant. dd and i d genotypes in controls and the patients with a maximum of mean value were observed. the significant difference between the mean of sace activity in sarcoidosis patients versus control groups (p dd > ii order in african - american population patients with sarcoidosis. in caucasian population, the i d genotype was most detected in the patients and controls (26). another study from the uk and czech population, the genotype frequencies of i d, dd and ii was 47%, 28% and 25%, respectively in uk population. in czech population, the genotype frequency order was id > ii > dd in the patients with sarcoidosis (20). in turkey cohort, as the same as our study, the predominant genotype was dd (45.7%), i / d genotype (42.8%), and i / i genotype was only seen in 11.4% of the patients. the frequency of d allele is 0.65 (p - value=0.06) that is much more comparable with the present study. thus, the results of current study are very close to turkey report due to genetic affinity in this region, but the genotype frequency varies because of different populations. on the other hand, in turkey study, the frequency of i / d genotype (53.6%) is higher in control subjects (27). therefore, in other studies (16) genotype distribution in patients and controls did not differ, whereas this frequency varies in our study and other studies such as the american cohort in african - american population. the over - representation of d / d genotype in sarcoidosis patients and their families can be seen in comparison to controls (28). on the other hand, attempts to show polymorphism and severity of chronic disease have been done (20). meanwhile, due to the nature of this disease, racial and regional differences in the polymorphism frequency, an association between sace activity and sarcoidosis exists. therefore, to better understanding of the disease activity, its diagnosis and treatment, studies with the appropriate statistical scale from each region should be separately performed. in the current study, we tried to address ace gene polymorphism, serum ace levels and its relationship to sarcoidosis with appropriate sample size. the difference in sace levels in patients with sarcoidosis and controls was significant that is in accordance with previous findings in this field. this level also in dd and i d genotypes showed significant differences between patients and controls. the level of sace was higher in the dd genotype of both patient and control groups (table 1). in a systematic review (29) that is accordance with the present findings, the frequency of i d and dd genotypes in all cases and separately in males and females shows a significant difference (table 2). in this study, weighted mean dd / ii ratio was 1.85 for all studies, 2.01 for caucasians and 1.64 for asians (29). besides, this general finding is theoretically justified. the variation in the results of photometric measurements polymorphism analysis can be considered in cases that sace will be higher than 97.5 percentile for dd or ii genotypes (29). moreover, in the present study, the cases with the high level for sace in ii genotype patients are seen (table 1). the results can be helpful to obtain the sensitivity, specificity and cut - off value for sace and this outcome should be assessed, according to the region and race. at the end, we used binomial logistic regression analysis to show the role of genotype in the development of sarcoidosis. prevalence of dd to ii genotype is 2.1-fold (p=0.05) and this is less than the amount of the i d geno - type to ii genotype (or=0.358). however, in women with the i d genotype versus ii, the risk of disease has decreased 0.3-fold. however, this study has some limitations such as no clinical relationship with the sace level and ace genotype exists. this can be helpful in the interpretation of the relationship between the disease and the sace level, meaning that how disease severity in different genotypes distributed and this fact that either ace genotype only effects on study result or severity of disease is important too. although results of insertion / deletion polymorphisms and sace levels in different geographical areas do not follow the same pattern, these studies improve our knowledge about the i / d polymorphism, s sace levels and sarcoidosis in the future research, we attempt to to determine a cut off value for sace level and sensitivity and specificity of sace level, according to i / d genotype. finally, we will introduce better models for diagnosis and prognosis of sarcoidosis by examining other aspects of genetics and cytokines. ethical issues (including plagiarism, informed consent, misconduct, data fabrication and/or falsification, double publication and/or submission, redundancy, etc.) have been completely observed by the authors. | background : sarcoidosis is a multisystem inflammatory disease of unknown origin with characterization of small granulomas. angiotensin - converting enzyme (ace) is a pathophysiologic marker of sarcoidosis. we present the ace insertion / deletion (i / d) polymorphism in correlation with serum ace level in iranian patients with sarcoidosis.methods:from jan 2014 to jan 2015, 102 iranian patients who histopathologically diagnosed for sarcoidosis and 192 healthy age and sex - matched controls were recruited. pcr was used for detection of i / d polymorphism in ace gene.results:frequency of ii / id / dd genotype in sarcoidosis disease was 17%, 35.5%, and 47.1%, respectively. the frequency of d allele was 0.65. a significant association between i / d genotypes and mean of sace level was seen (dd=85.222.9, p<0.001). more frequent genotype in sarcoidosis patients was dd (47%), i d genotype (45.9%) was found more in controls. logistic regression analysis adjusting age and sex showed that i d to ii (or=0.35, 95%ci=0.170.73, p=0.005) and dd to ii (or=2.11, 95%ci=0.984.54, p=0.05) could be considered as a predictor factor for the disease activity. no significant model for men in sarcoidosis group was seen, while women with ii / id were associated with a reduced risk for the disease.conclusion:although more regional studies with appropriate statistical scale must be done to provide a better diagnosis and prognostic tool for this disease, this study demonstrates that i d and dd genotype could be predictive factors for sarcoidosis. |
it is well established, that more than 90% of low - grade malt lymphomas are associated with h. pylori infection1). indeed, the eradication of h. pylori infection has been associated with the regression of gastric malt lymphoma in 70% to 80% of patients2, 3). additional factors contribute to the development of malt lymphoma such as : environmental, microbial, immune and genetic factors. transformation of malt lymphoma has been described ; there is genetic evidence for a clonal link between low- and high - grade components4). here, we report a case of high - grade hepatic malt lymphoma that occurred six years after achieving complete remission of a low - grade gastric malt lymphoma with h. pylori eradication therapy. although we were unable to obtain cytogenetic evidence, the radiological and pathologic findings suggested that the low - grade malt was transformed to a high - grade hepatic malt lymphoma. a 67-year - old woman visited our hospital with complaints of abdominal discomfort, indigestion and constipation for five days. physical examination and laboratory findings were not specific, and her performance was excellent. gastroscopic examination showed an ulcero - infiltrative lesion at the greater curvature side of the antrum (figure 1). diffuse and nodular aggregates of lymphoid cells were composed of monotonous small to medium - sized lymphocytes with round to cleaved nuclei and clear cytoplasm. in some areas, relatively large atypical lymphoid cells were also present in less than 10% of tumor cells. immunohistochemical stains were positive for cd20 and cd79a, but negative for cd45ro, cd3, cd5, cd23, bcl-2 and cyclin d1 an abdominal ct scan revealed focal wall thickening on the greater curvature side of antrum without any lymph node enlargement. unfortunately, a bone marrow biopsy was not performed, thus staging work - up of the lymphoma was not fully performed. the patient was diagnosed with a low - grade gastric malt lymphoma and treated for h. pylori infection for 14 days with omeprazole 20 mg bid, clarithromycin 500 mg bid and amoxicillin 1,000 mg bid. follow - up gastroscopic examinations, one and three months after h. pylori eradication, showed marked improvement of gastric lesions. h. pylori infection was absent by rapid urease testing and histology, but malt lymphoma was still present on histology evaluation. thereafter the patient was lost to follow - up. four years later, the patient visited our hospital again with complaints of indigestion and constipation. gastroscopy showed diffuse erythematous changes of the antral mucosa with an irregular surface at the site of the previous malt lymphoma that appeared to be a scar. gastric mucosal biopsy showed well preserved foveolar epithelium, and sparsely scattered inflammatory cells in the lamina propria devoid of residual lymphoma. abdominal ct scan showed neither gastric wall thickening nor lymph node enlargement (figure 3). about two years later, the patient returned to our hospital with complaints of general weakness and epigastric discomfort. blood tests on admission showed a hematocrit of 36.1%, a white blood cell count of 4,200/mm, a platelet count of 77,000/mm, a protein of 4.6 g / dl, an albumin of 2.4 g / dl, a total bilirubin of 3.0 mg / dl (0.2 - 1.0 mg / dl), a direct bilirubin of 2.5 mg / dl (0.0 - 0.2 mg / dl), an alkaline phosphatase of 588 u / l (32 - 104 u / l), an alanine aminotransferase of 196 u / l (10 - 36 u / l), an aspartate aminotransferase of 357 u / l (10 - 30 u / l), a lactate dehydrogenase of 1,871 u / l (211 - 423 u / l), and a prothrombin time of 11.8 sec (10 - 14 sec). histological examination revealed only chronic inflammation and intestinal metaplasia with the absence of h. pylori infection and malt lymphoma (figure 4). abdominal sonography and liver mri showed multiple hepatic nodules with multiple celiac and para - aortic lymphadenopathy (figure 5). ultrasonography - guided percutaneous core needle biopsy was performed on the hepatic nodules ; histological examination revealed a patchy infiltration, of atypical lymphoid cells, replacing the liver parenchyma. the composition of the large lymphoid cells, found in the liver biopsy, was significantly increased when compared to the previous gastric malt lymphoma. immunohistochemical stains were positive for cd20, but negative for : cd45ro, cd3, cd5, cd23, bcl-2 and cyclin d1 (figure 6). immunohistochemical stains for ki-67 were performed both on the biopsy from the previous low - grade gastric malt lymphoma and the liver core biopsy. the ki-67 labeling index, from the liver biopsy sample, was much higher (70%) than in the previous gastric biopsy (20%) (figure 7). these pathological findings suggested a hepatic malt lymphoma that represented a transformation from the previously treated low - grade gastric malt lymphoma to a high - grade malt lymphoma. the patient, and her family, refused further treatment and her clinical status deteriorated rapidly ; she died from sepsis one month later. the malt lymphoma was first described as a distinct pathologic entity in 1983.5) in 1988, it became apparent that the gastric malt lymphoma is caused by chronic h. pylori infection ; this triggers lymphoid infiltration and formation of organized lymphoid tissue6, 7). perhaps the strongest evidence is that in approximately two thirds of cases, the lymphoma regresses after treatment of the h. pylori infection2, 3). it is assumed that the initial proliferation of lymphoma cells occurs in an antigen - dependent fashion ; this explains the tendency for these lymphomas to remain anatomically localized and to respond to antibacterial therapy. given that most patients with h. pylori gastritis do not develop malt lymphoma, additional events such as environmental, microbial, immune and genetic factors must play an important role8). our patient was positive for h. pylori infection ; the initial original gastric malt lymphoma completely disappeared after eradication of h. pylori infection. however, the occurrence of transformation to a high - grade lymphoma without evidence of h. pylori re - infection strongly suggests that some other pathological mechanisms, besides h. pylori infection, played a role in disease progression. the understanding of the biology of the gastric malt lymphoma has improved over the past few years. there is a common structural cytogenetic abnormality associated with this disorder, t(11;18)(q21;q21), detected in 21% to 60% of cases8 - 11). this translocation acts to fuse the inhibitors of apoptosis (iap) family api2 with the novel gene malt1. the characterization of another, albeit less frequent recurrent translocation, t(1;14)(p22;q23) has led to the identification of bcl1012, 13). both translocations are known to result in activation of the central transcription factor nf-b14). nf-b induction appears to drive antigen independent growth of the lymphoma cells, promoting disease dissemination and unresponsiveness to h. pylori eradication therapy8). transformation of malt lymphoma has been described, and there is a genetic evidence for a clonal link between low- and high - grade components4). deletion of the p16, mutations of the p53 gene, translocation breakpoint involved in t(6;14)(p21;q32), and bcl-6 have been described to be associated with transformation of the malt lymphoma15 - 17). moreover, numerous investigators have sequenced immunoglobulin heavy chain (igh) genes, and have found frequent somatic mutations that can be ongoing18). somatic hypermutations, together with isotype switch recombination, contributes to b - cell maturation. unfortunately, we could not perform cytogenetic evaluations or igh gene rearrangement analysis in our patient. however, in the pathological findings, the composition of the large lymphoid cells and the expression of the proliferation marker ki-67 were significantly increased in the hepatic nodules compared to the previous gastric malt lymphoma ; these results suggested that the hepatic nodules represented a transformation to a higher grade malignant lymphoma from the prior low - grade gastric malt lymphoma. in addition, the occurrence of high - grade transformation, even after complete remission of the original gastric lesion, its aggressive nature may suggest that our patient had one or more underlying cytogenetic abnormalities. however, the possibility that the hepatic malt lymphoma might be a newly developed and separate lesion, with no relationship to the initial low - grade gastric malt lymphoma, can not be completely excluded. in summary, we report a case of high - grade hepatic malt lymphoma that occurred six years after achieving complete remission of a low - grade gastric malt lymphoma. although we did not perform cytogenetic evaluation, the hepatic malt lymphoma was considered to represent a transformation from the gastric malt lymphoma on the basis of radiological and pathological findings. in addition, these findings suggest that the determination of a complete cure for malt lymphoma based on gastroscopic and histological findings might not be adequate. regular follow - up, even after complete remission of the original lesion, is mandatory, and cytogenetic studies should be considered in certain cases if available. | the mucosa - associated lymphoid tissue (malt) lymphoma, which was first described in 1983, is known to be caused by chronic helicobacter pylori (hp) infection, which triggers lymphoid infiltration and formation of organized lymphoid tissue. in approximately two thirds of cases of malt, the lymphoma has been observed to regress after treatment of h. pylori infection ; this provides strong evidence of a causative role of hp in the etiology of malt. we report a case of a 67-year - old female patient with a high - grade malt lymphoma of the liver ; this occurred six years after complete remission of a low - grade gastric malt lymphoma and after complete eradication of h. pylori. there was no recurrence of the previous low - grade gastric malt lymphoma. based on radiological and pathologic findings, the high - grade malt was considered to result from transformation of the low - grade gastric malt lymphoma. |
the measurement of a deuterium equilibrium isotope effect (eie) for the aryl chcl interaction of anion receptor 1h/1d is reported. computations corroborate the results of solution measurements for a small, normal eie in the full complex (kah / kad = 1.019 0.010). interestingly, isotope effects involving fragments of the anion receptor (urea, aryl ring, etc.) are predicted to produce an inverse effect. this points to an unusual and subtle structural organization effect of the anion receptor complex that changes the nature of the combined interactions to a normal isotope effect. the reversal of eie values suggests that overall architecture of the anion receptor can dramatically impact the nature of bonding in these complexes. |
|
peach is one of the most well - liked fruits in the world because of their flavor, dietary value, attractive color, and medicinal worth. it is enriched with ascorbic acid, flavonoid, and phenolic compounds, which were considered prime sources for antioxidants [1, 2 ]. however, peaches have a very short shelf life because they are highly susceptible to pathogenic infection and physiological deterioration during storage time under ambient temperature. cold storage remains the main method to slow the product deterioration in terms of consumer perception and nutritional value. however, low temperature results in chilling injury symptoms in some peach cultivars during or after cold storage [3, 4 ]. chemical treatments have been used to prevent insect attack and prolong shelf life of postharvest peach. however, the use of chemicals has been minimized for food safety and environmental reasons. many physical methods including modified atmosphere packaging, heat, and uv - c pretreatments are being extensively studied as substitutes for current chemical methods in the commercial applications of peach [58 ]. carbon monoxide (co) is a simple diatomic gas molecule with low water solubility. it easily combines hemoglobin, thus delaying oxygen transport and leading to death of organisms. so in the past, it was considered a toxic gas to environment and biology. however, recent researchers found that, similar to no and h2s, co might serve as a gaseous signal molecule to involve in stomata close regulated by plant guard cell and the formation of lateral root. meanwhile, co may relieve plant tissue oxidation damage caused by a variety of abiotic stresses such as heavy metal, salt, and active oxygen donor [913 ]. it has been reported that exogenous co donor treatment might postpone the senescence of cut flower through regulating active oxygen metabolism and inhibiting lipid peroxidation. our previous study found that exogenous co treatment could restrain the browning of fresh cut lotus root and prolong the shelf life of postharvest jujube [15, 16 ]. at present, there are few reports about the effect of co on plant senescence and fruit preservation, and the physiological mechanism of co on plant senescence stress is still unclear. in this work, the postharvest peaches were fumigated with exogenous co gas at different concentrations, and the presentation quality, nutrients, and antioxidant activity of peaches were determined periodically during the storage time. this research aims to investigate the effect of co treatment on postharvest peach and try to explore a novel method for fresh peach preservation. yanhong) were purchased from an orchard situated in yaodu district, linfen city, shanxi province. peaches with uniform shape, size, and color, as well as no insect pest and mechanical damage, were selected and quickly transported to the laboratory of shanxi normal university in open cartons. co gas with a purity of 99.99% was purchased from beijing huaneng special gases co., ltd. oxalic acid, gallic acid, rutin, potassium ferricyanide, trichloroacetic acid, and sodium hydroxide (analytical grade) were purchased from sinopharm chemical reagent co., ltd. analytical - grade 1,1-diphenyl-2-picrylhydrazyl radical, 2,2-diphenyl-1-(2,4,6-trinitrophenyl) hydrazyl, and 2,6-dichloroindophenol were purchased from sigma (usa). other reagents of analytical grade were purchased from alfa aesar company (tianjin, china). the peaches were fumigated with co gas at different concentrations (0.5, 5, 10, or 20 about 10 kg of peaches were placed into a glass container, and then the container was sealed with lid. the diameter and height of used container are 40 cm. peaches that had not been fumigated with co gas were also sealed in glass container for 2 hours, serving as control sample. after treatment, all samples were then placed in plastic bags and stored under ambient temperature with 90% of relative humidity. each sample was about 180 peaches and the relevant parameters for the analyses of peaches were measured periodically. firmness was determined using a fruit digital sclerometer 8 mm in diameter for the head (gy-4, chendu bsida instrument co., ltd., chendu, china). for each fruit, two readings were taken in the equatorial region of the fruit after the skin was removed. the firmness of six fruits during storage was regularly measured and expressed as kg / cm. it was determined visually in the fruits from three trays and rated as 0 = absent ; 1 = very slight (1% surface 10%) ; 2 = slight (10% surface 25%) ; 3 = moderate (25% surface 50%) ; 4 = severe (50% surface 100%). the decay incidence for the treatment unit was calculated as follows : decay incidence = [(rank quantity)/(4 soluble solids content and titratable acidity were assayed according to the method of mignani with modifications. tissues (50 g) from ten fruits were homogenised and then centrifuged at 8000 g for 20 min using an eppendorf 5417r centrifuge (germany). the supernatant was collected to measure soluble solids content (brix) using a refractometer (wyt - ii, qingyang optical instrument co., ltd., chendu, china). titratable acidity expressed as citric acid on a fresh weight basis was determined by titration with 0.1 mol / l naoh to ph 8.2. the ph of the supernatant was measured using a ph meter (phs-3tc, shanghai leici instrument inc., pal activity was determined as per the method of hussain. with modification. 5 g of sample from six fruits was homogenized in 5 ml of borate buffer (0.05 m, ph 8.0) containing 5 mm -mercaptoethanol and 1 mm edta. about 1.0 ml of enzyme extract was incubated with an assay medium containing 2 ml of 200 mmol / l sodium borate buffer (ph 8.0), 1 ml of distilled water, and 1 ml of 50 mmol / l 1-phenylalanine as substrate at 30c for 1 h. the reaction was terminated by adding 0.2 ml of 6 mol l hcl. one unit was defined as the change 0.01 absorbance at 290 nm per h. vitamin c content was measured through 2,6-dichloriondophenol titration. briefly, tissues (5 g) from 6 fruits were homogenised in 10 ml of 2% oxalic acid solution and then centrifuged at 8000 g for 15 min at 4c. afterwards, 2 ml of the supernatant was titrated to a permanent pink colour using 0.1% of 2,6-dichlorpphenolindophenol. vitamin c concentration was calculated according to the titration volume of 2,6-dichloriondophenol and expressed as g g fresh weight. total polyphenol content was determined using folin - ciocalteu 's phenol reagent via spectrophotometric analysis. tissues (5 g) from 10 fruits were homogenised in 20 ml of 50% aqueous methanol and then centrifuged at 3000 g for 20 min. an aliquot (1 ml) of a standard solution of gallic acid with 0, 10, 20, 30, 40, and 50 mg / l aqueous methanol or supernatant was added to a 25 ml volumetric flask containing 9 ml of water. approximately 1 ml of folin - ciocalteu 's phenol reagent was added to the mixture and then shaken. after 8 min, 2 ml of 7.5% aqueous na2co3 solution was added. the solution was immediately diluted with water to a final volume of 25 ml and thoroughly mixed. after incubation for 30 min at 25c, the absorbance versus the prepared blanks was read at 765 nm. tissues (5 g) from 10 fruits were homogenised in 20 ml of 80% ethanol and then centrifuged at 3000 g for 20 min. an aliquot (1 ml) of a standard solution of rutin with different concentrations (0, 10, 20, 30, 40, and 50 mg / l) or supernatant was added to 10 ml volumetric flasks containing 4 ml of water. at the onset of each experiment immediately, the solution was diluted with water to a final volume of 10 ml and thoroughly stirred. the absorbance of the mixture was determined at 510 nm versus the prepared blanks. total antioxidant activity (taa) was quantified according to the method of sayyari. with modifications, which enables one to determine taa due to both hydrophilic and lipophilic compounds in the same extraction. briefly, for each subsample, tissues (10 g) from 10 fruits were homogenized in 10 ml of 50 mm phosphate buffer, ph 7.8, and 5 ml of ethyl acetate and then centrifuged at 10000 g for 15 min at 4c. the upper fraction was used for taa due to lipophilic compounds (l - taa) and the lower for taa due to hydrophilic compounds (h - taa). in both cases, taa was determined using the 2,2-diphenyl-1-(2,4,6-trinitrophenyl) hydrazyl (dpph) radical scavenging activity and reducing power, respectively. the reducing power of the fruit samples was determined using the method of jayaprakasha.. a 0.2 ml aliquot of the supernatant was mixed with 2.5 ml of phosphate buffer (0.2 m, ph 6.6) and 2.5 ml of 1% potassium ferricyanide in 10 ml test tubes. after incubation, 1 ml of 10% trichloroacetic acid was added to the mixtures, followed by centrifugation at 5000 g for 10 min. the upper layer (2.5 ml) was mixed with 2.5 ml of distilled water and 1 ml of 0.1% ferric chloride. the increase in absorbance of the reaction mixture indicated the reducing power of the samples. h - rp stands for hydrophilic compounds reducing power, and l - rp stands for lipophilic compounds reducing power. dpph radical scavenging capacity was assayed as described by yang. with slight modifications. briefly, 0.2 ml of the supernatant was added to 3 ml of dpph (120 shanghai, china) was used, and the absorbance at 517 nm was after the reaction mixtures were incubated for 1 h at 30c in the dark. the scavenging rate of dpph radicals was calculated as scavenging rate (%) = [1 (a1 as)/a0 ] 100, where a0 is the absorbance of the control solution (3 ml of phosphate - buffered saline in 3 ml of dpph solution), a1 is the absorbance of the supernatant in dpph solution, and as, which is used for error correction arising from unequal colour of the sample solutions, is the absorbance of the sample extract solution without dpph. h - drsc represents the dpph radical scavenging capacity of hydrophilic compounds, and l - drsc represents the dpph radical scavenging capacity of lipophilic compounds. each treatment was repeated three times, and the data were processed by analysis of variance using dps7.05 statistical software (refine information tech. the treatments were compared at p = 0.05 using tukey 's test, which indicates the multicomparison value in each case. pearson correlations were used to determine the relationship among measured variables (physical and physiological responses and antioxidant contents and activity). the cultivar peach of yanhong belongs to melting - flesh fruit and its firmness decreased rapidly with fruit senescence. as shown in figure 1(a), the firmness of postharvest peach decreased quickly during the first 3 days of storage and then declined slowly from 3 to 6 days. when peaches were fumigated with concentration of co (0.510 mol / l), the decrease of firmness became slow with the co concentration enhancement. whereas the peaches were treated with higher concentration co (20 mol / l), the firmness of peaches fumigated with 5 or 10 mol / l co was significantly higher than that of control samples. particularly the peaches treated with 10 mol / l co demonstrated the slowest rate of firmness decline, and its firmness was 2.24 times of control fruit on day 6. as described in figure 1(b), peaches began to rot at day 2, and its decay incidence increased rapidly after 3 days. on day 6, fortunately, co fumigation might restrain the decay of postharvest peaches. during the whole storage time, the decay incidence of all treated samples was lower than that of control fruits. of all these samples, peaches treated with 10 mol / l co showed the lowest increase of decay incidence, and there was significant difference compared to that of control samples (p < 0.01). at day 6, the decay incidence of 10 mol / l co treated peaches was 40.50%, which was only 49.73% of control samples. as shown in figure 2(a), the soluble solids content of postharvest peaches first gradually increased and then slowly decreased during the storage time. both control sample and 0.5 mol / l co treated sample appeared to have the maximum value at day 3, and 20 mol / l co treated peaches displayed the peak value at 2 day. while 5 or 10 mol / l co treated sample exhibited the maximum value on day 4, postponing 1 day compared to that of control sample. from 4 to 6 days, the soluble solids content of 10 mol / l co treated fruits decreased the slowest. therefore, fumigating peaches with 10 mol / l co could effectively reduce the decrease of soluble solids content. the titratable acid of postharvest peaches decreased during storage time (figure 2(b)). / l co treated peaches showed the fastest decrease followed by the control sample and 0.5 mol / l co treated sample. the titratable acid of 5 or 10 mol / l co treated sample decreased the least during storage time, which is higher than that of other samples from 3 to 6 days (p < 0.05). at day 6, the titratable acid content of 10 mol / l co treated peaches was 72.8% higher than that of control samples. the vitamin c of postharvest peaches showed increasing trend in the first two days and then decreased from 2 to 6 days (figure 3(a)). the vitamin c content of 20 mol / l co treated peaches reached the peak value at day 1 and then decreased. it was the lowest during the storage time compared to control and all other treated samples. other samples appeared to have the maximum value of vitamin c at day 2, and the vitamin c contents of treated samples with 0.510 mol / l co were higher than those of control samples. furthermore, the peaches treated with 10 mol / l co showed the highest vitamin c content among all samples during the storage time, and significantly higher than that of control samples (p < 0.01). as described in figure 3(b), the total flavonoid content of peaches first increased and then decreased during the whole storage time. the peaches treated with 0.5 or 20 mol / l co and control sample appeared to have the maximum of total flavonoid content at day 2, and there was no difference among them. 5 or 10 mol / l co exhibited peak value of total flavonoid content at day 3, but the total flavonoid content of peaches treated with 10 mol / l co was significantly higher than that of other samples from 4 to 6 days (p < 0.05). similar to total flavonoid content, the total polyphenol content firstly increased and then decreased as well (figure 3(c)). 0.5 or 20 mol / l co treated peaches appeared to have the peak value of total flavonoid content on day 3, but the total polyphenol content of peaches treated with 20 mol / l co was significantly lower than that of other samples. the total polyphenol content of peaches treated with 5 or 10 mol / l co increased the slowest, and it reached the maximum at day 4. obviously, treating peaches with 5 or 10 mol / l co might restrain the decrease of total polyphenol content of postharvest peaches. as shown in figure 4, the pal activity of postharvest peaches showed an obvious peak value during storage time. the sample treated with 0.5 or 20 mol / l co and control sample appeared to have maximum of pal activity at day 3, but the rising and falling speed of pal activity of peaches treated with 0.5 or 20 mol / l co was lower than that of control sample. peaches treated with 5 and 10 mol / l co demonstrated peak value of pal activity at days 4 and 5, and they were postponed at 1 and 2 days, respectively. apparently, peaches treated with 10 mol / l co maintained higher pal activity during the last storage time. the h - rp and l - rp of postharvest peaches all firstly promptly decreased and then gradually increased during the storage time, but there were some differences between them (figures 5(a) and 5(b)). at 0 day, the h - rp was slightly lower than l - rp. however, it was significantly higher than l - rp during the storage time and was about 2.85.6 times compared to l - rp. moreover, at the end of storage, the h - rp still maintained high level, while the l - rp decreased less 1/6 than that of original level. compared to that of control sample, the h - rp or l - rp in all co treated samples was higher. obviously, exogenous co fumigation was beneficial to maintaining the reducing power of postharvest peach, and 10 mol / l co treatment demonstrated the best effect. as shown in figure 5(c), the h - drsc of postharvest peach began to increase at day 2 and slightly decreased at day 6. all co treated samples showed significantly higher h - drsc between 2 and 6 days compared to that of control sample (p < 0.05). the l - drsc of postharvest peach firstly decreased, then increased, and decreased again during the whole storage period (figure 5(d)). after 2 days, the l - drsc of control sample was lower than that of co treated samples. at day 6, 10 mol / l co treated sample showed the highest dpph radical scavenging activity, which was about 1.6 times of control samples. compared with h - drsc of postharvest peach, the l - drsc was markedly lower, yet it could be significantly improved after the peaches were fumigated with co. peach, a respiratory climacteric fruit, is easy to soften and rot under ambient temperature after harvest. therefore, firmness and decay incidence were important indexes of postharvest peaches. the results showed that the firmness of postharvest peaches rapidly decreased under ambient temperature, from 14.18 kg / cm at day 0 to 2.74 kg / cm at day 3. so the peach used in our experiment belonged to the typical cultivar of melting - flesh type. after exogenous co fumigation, the firmness decrease and decay incidence increase of postharvest peaches were restrained during storage time. furthermore, in low concentration (0.510 mol / l), the firmness of co treated fruit decreased slowly and decay incidence increased slowly as well with co concentration enhancement. mol / l, the firmness of postharvest quickly decreased and accordingly the decay incidence fast increased. as shown in table 1, there were significant negative correlations between firmness variation and decay incidence of postharvest peaches during storage time. the reason was probably that gradual fruit senescence led to the decomposition of intercellular pectin of flesh and cell separations with storage time extension. thus, peaches softening occurred and the integrity of fruit cell wall structure was destroyed. afterward, fruit physiological metabolism was disordered and the resistance to exogenous pathogen was gradually lost. as a result, postharvest peach eventually appeared to have some physiological changes owing to respiratory metabolism and ethylene production during senescence process. these changes included flesh softening, starch degradation, flavor variation, and organic acid content decrease. soluble solids and titratable acid content represented the quality of postharvest peaches, and their ratio was also an important index to reflect the maturity and senescence of postharvest fruit. the soluble solids content of cultivar peach yanhong firstly increased and then decreased during storage period. the amylase of postharvest peaches catalyzed the starch into soluble sugar and soluble solids content increased accordingly. after storage for some time, the starch became less and the sugar production gradually lessened. meanwhile, the physiological metabolism of postharvest peaches continued to consume sugar. as a result, the soluble solids content decreased with storage time extension. 0.510 mol / l exogenous co might inhibit the decrease of titratable acid content, postpone the variation of soluble solids and vitamin c content, and effectively maintain the qualities of postharvest peaches. peach has good flavor and abundant nutrients, preventing many diseases of mankind induced owing to the accumulation of reactive oxygen compounds in organism [30, 31 ]. flavonoid and polyphenol, as main antioxidant substance originating from plant, are important functional phytochemicals of peach fruit. the experimental result showed that co treating could postpone the flavonoid and polyphenol variation of postharvest peach and maintain them in higher level. the correlation coefficients of pal activity relating with total flavonoid, total polyphenol, and total flavonoid + total polyphenol, were 0.48, 0.72, and 0.64, respectively. it catalyzes the deamination of l - phenylalanine to yield ammonia and transcinnamic acid, from which phenolic compounds including flavonoid, phenolic acid, and anthocyanin, are produced. therefore, co probably increased the flavonoid and polyphenol content through heightening pal activity, maintaining the physiological function of postharvest peach. these have hydrogen with activity that causes the hydrogen exchange reaction with free radical and structure of resonance stabilized. research suggested that the antioxidant activity of postharvest peaches closely related with flavonoid and polyphenol content. as shown in table 1, the flavonoid content of postharvest peaches significantly correlated h - drsc (r = 0.89) and moderately correlated t - drsc (r = 0.70). polyphenol content closely correlated h - drsc, l - drsc, and t - drsc, and these correlation coefficients were 0.72, 0.73, and 0.81, respectively. in addition, the content of total flavonoid + total polyphenol also significantly positively correlated with h - drsc and t - drsc (r = 0.87 and r = 0.81). obviously, co treating could increase the flavonoid and polyphenol content of postharvest peach, and accordingly the antioxidant activities of flesh were enhanced in terms of dpph radical scavenging capacity. the experimental result also exhibited that the content of total flavonoid and polyphenol slightly correlated with reducing power including h - rp and l - rp (|r | < 0.5). this probably related with the specific category and property of flavonoid and polyphenol contained in particular peach. table 1 suggested that the decay incidence of postharvest peaches had few correlation with total flavonoid content, total polyphenol content, and drsc, but it had significantly negative correlation with vitamin c content (r = 0.73) and positive correlation with h - rp (r = 0.85). though vitamin c contributed little to antioxidant activities in terms of dpph radical scavenging ability and reducing power, it was related with the enhancement to resist decay incidence. therefore, exogenous co might restrain the decay incidence through maintaining vitamin c content. correlation analysis suggested that firmness was moderately negative correlation with total flavonoid, total polyphenol, and total flavonoid + total polyphenol content, and their correlation coefficients were 0.53, 0.67, and 0.64, respectively ; it was high negative correlation with h - drsc, l - drsc, and t - drsc, and the correlation coefficients were 0.53, 0.67, and 0.64, respectively. therefore, co might maintain the firmness and postpone the shelf life through inducing pal activity of flesh. this result is similar to zhang and li who treated jujube with exogenous co. with research depth, people found that plant could generate co. heme oxygenase oxidation, lipid peroxidation, and ureide metabolism were probably the potential sources of plant co. similar to no and h2s, co takes part in various abiotic stresses and physiological processes such as stomatal movement and lateral root. in plant postharvest physiology, co was used to protect the green of vegetable and inhibit the browning of lotus root slices. our results exhibited that exogenous co might postpone the softening and decay incidence of postharvest peaches, maintain the nutrients and quality, and prolong the shelf life through increasing functional nutrients such as flavonoid, polyphenol, and vitamin c. without doubt, the exact mechanism should be further investigated in future. in general, oxidative regulation is a dynamic balancing process between systems that produce and scavenge ros ; the initial tissue response to stress leads to ros production (step i), and this in turn, triggers antioxidant protection systems to ameliorate ros (step ii) but in case the tissue can no longer cope with stress then subcellular or cellular damage occurs (step iii). protection systems mainly include phenolics, ascorbate, glutathione, peroxidase, ascorbate peroxidase, glutathione peroxidase and reductase, and catalase. in particular, there are many mechanisms by which phenolics can act either as antioxidants (as agents for free radical scavenging, hydrogen donation, singlet oxygen quenching, and metal ion chelation) or as substrates for attack by superoxide. thus, we presumed that co probably indirectly adjusted the oxidative stress of tissue producing during fruit ripening and senescence process through regulating the flesh polyphenol content, thereby delaying fruit ripening and senescence. the antioxidant defense system induced by co comprise of ascorbate peroxidase, glutathione reductase, superoxide dismutase, monodehydroascorbate reductase, ascorbic acid reductase, and so on, regulating reactive oxygen species and restraining oxidative stress through the transcription and expression of these enzymes. in our previous study, a similar result about the effect of co fumigation on the active oxygen metabolism of jujube was acquired (unpublished). therefore, co also probably maintained peach quality through regulating active oxygen [41, 42 ]. as a signal molecule, co of plant similar to no might play a physiological role through cgmp pathway. xuan. found that the growth elongation of wheat root induced by co associated with cgmp signal pathway. many evidences suggest that co controls the response process to abiotic stresses via molecular interaction with other signal moleculars, such as no. currently, the research about co in plant postharvest physiology was limited. since no as a useful gas to preserve fruit had been widely recognized, whether it participates in co regulating plant senescence process and whether co plays a role on plant ripening and senescence via the cgmp pathway need to be further investigated in the future. treating postharvest peaches with co demonstrated dual effect. in low concentration co (0.510 mol / l), exogenous co could delay the decrease of firmness and titrable acid content, restrain the increase of decay incidence, and postpone the variation of soluble solids content, and the positive effect was more obvious with co concentration enhancement. however, treating peaches with high concentration of co (20 mol / l) demonstrated adverse effect. further researches exhibited that exogenous co might induce the pal activity, maintain nutrient contents such as vitamin c, flavonoid, and polyphenol, and enhance antioxidant activity according to reducing power and dpph scavenging ability. this result suggested that treating peaches with appropriate concentration of co was beneficial to quality, nutrients, and antioxidant activity of postharvest peaches during storage period. | peaches (prunus persica cv. yanhong) were fumigated with carbon monoxide (co) at 0, 0.5, 5, 10, and 20 mol / l for 2 hours. the result showed that low concentration co (0.510 mol / l) might delay the decrease of firmness and titrable acid content, restrain the increase of decay incidence, and postpone the variation of soluble solids content, but treating peaches with high concentration co (20 mol / l) demonstrated adverse effects. further research exhibited that exogenous co could induce the phenylalnine ammonialyase activity, maintain nutrient contents such as vitamin c, total flavonoid, and polyphenol, and enhance antioxidant activity according to reducing power and 2,2-diphenyl-1-(2,4,6-trinitrophenyl) hydrazyl radical scavenging activity. treating peaches with appropriate concentration co was beneficial to the quality, nutrients, and antioxidant activity of postharvest peaches during storage time. therefore, co fumigation might probably become a novel method to preserve postharvest peach and other fruits in the future. |
the history of the initial discovery and characterization of proprotein convertase subtilisin / kexin type 9 (pcsk9) has been well described. the seminal discovery in 2003 by abifadel. linked mutations in the gene encoding pcsk9 with autosomal dominant hypercholesterolemia (adh). this finding uncovered a key new player in cholesterol homeostasis and set into motion intensive research in the field of pcsk9 biology. the basic construct places this extracellular secretory protein as a central regulator of plasma low - density lipoprotein (ldl)-cholesterol (ldl - c) concentration. pcsk9, by direct interaction with the hepatic ldl receptor (ldlr), enhances its degradation by targeting it for destruction in the lysosome, disallowing its natural recycling loop. the fundamental observation that pcsk9 is intrinsically linked to ldlr recycling and familial hypercholesterolemia (fh) provided the basis for pursuing it as a therapeutic target. pcsk9 causes degradation of the ldlr, thus inhibiting pcsk9 prolongs the lifespan of the ldlr, which leads to drastic reductions in plasma ldl - c levels. major findings over the last decade have revealed the following : gain - of - function mutations in pcsk9 are a cause of adh.loss-of-function mutations in pcsk9 are associated with low ldl - c levels and markedly reduced cardiovascular risk.therapeutic antagonism of pcsk9 reduces ldl - c levels and, within the context of clinical trials, appears safe, efficacious, and well tolerated. loss - of - function mutations in pcsk9 are associated with low ldl - c levels and markedly reduced cardiovascular risk. therapeutic antagonism of pcsk9 reduces ldl - c levels and, within the context of clinical trials, appears safe, efficacious, and well tolerated. beyond the obvious association of pcsk9-induced ldlr degradation and hypercholesterolemia, emerging studies have uncovered other mechanisms by which pcsk9 may facilitate atherosclerosis development independent of its impact on lipids. what follows is a survey of the literature that provides insight into the impact of pcsk9 on atherosclerosis via lipid and non - lipid pathways. the classic teachings on lipoprotein metabolism place regulation of cholesterol squarely within the cell, with all the components available to sense and react to cholesterol depletion and excess. the discovery and elucidation of pcsk9 has revolutionized our understanding of lipid metabolism and has introduced this secreted circulatory protein as a central actor in this process. comprehensive reviews have described mechanisms by which pcsk9 impacts the ldlr and ultimately plasma ldl - c. complete knockout of pcsk9 in mice results in severe hypocholesterolemia with reductions in ldl cholesterol of up to 80% and reductions in total cholesterol of up to 40%. despite the profound hypocholesterolemia, interestingly, mice that are engineered with liver specific pcsk9 knock down demonstrate a complete absence of plasma pcsk9 corroborating the notion that the liver, despite being only one of several tissues that synthesizes pcsk9, is the primary source of its plasma levels. this observation suggests that pcsk9 produced from extrahepatic tissues may have effects that are either exclusively intracellular, or extracellular but only paracrine, or both. however, even in the complete absence of plasma pcsk9, the liver specific pcsk9 knock down model only demonstrates an approximately 30% reduction in total plasma cholesterol levels, a significantly attenuated phenotype compared to complete knockout of pcsk9. this finding suggests that pcsk9 secreted from the liver exerts a dominant, but not complete, effect on plasma cholesterol levels, and provides impetus to study the role of extrahepatic pcsk9 in wholebody cholesterol homeostasis. murine models incorporating a human pcsk9 transgene under an apoe promoter overexpress pcsk9 and are found to be healthy, with normal reproductive capacity, and display the anticipated severe hypercholesterolemia phenotype. as compared to ldlr knockout (ko) mice, which have a 15-fold increase in plasma ldl - c, this pcsk9 overexpression model exhibits a more modest (5-fold) increase in plasma ldl - c despite the fact that, as in the ldlr ko model, there is no demonstrable ldlr in the liver. this observation again highlights the importance of extrahepatic tissues in cholesterol metabolism and suggests the following : extrahepatic ldlr plays a central role in ldl - c catabolismextrahepatic ldlr is not influenced by plasma pcsk9 extrahepatic ldlr plays a central role in ldl - c catabolism extrahepatic ldlr is not influenced by plasma pcsk9 as new data emerge, it has become evident that the impact of pcsk9 on lipids and atherosclerosis is transduced by mechanisms beyond its effect on plasma ldl clearance. pcsk9 also targets receptors beyond the ldlr, including the vldlr, cd36, apoer2, and lrp1. the extent to which its action on these ldlr family members is significant for cholesterol homeostasis remains unclear, though there are several relevant observations relating to triglyceride - rich lipoprotein (trl) metabolism. given the importance of trl in the initiation and propagation of atherosclerosis, the impact of pcsk9 on these highly atherogenic particles may provide another mechanism by which therapeutic antagonism of pcsk9 may reduce the risk of atherosclerotic cardiovascular disease (ascvd). plasma pcsk9 concentration correlates to fasting triglyceride levels in males and females, though not in the obese. individuals with the pcsk9 s127r gain - of - function mutation demonstrate increased levels of all apob100-containing lipoproteins, including vldl and remnants. furthermore, therapeutic antibodies to pcsk9 reduce plasma triglycerides, though this effect appears to be more modest relative to the ldl - c reduction and as compared to the statin effect on tg vs. ldl - c. since apob turnover is heavily modulated by ldlr - mediated reuptake of many apob - containing lipoproteins, therapeutic pcsk9 inhibition also impacts plasma trl concentrations. a large proportion of newly synthesized apob is degraded within the secretory pathway by diversion to the autophagic compartment. thus, the rate of apob secretion, and hence, vldl secretion, from the liver is determined by the proportion of apob that escapes post - translational degradation. in addition, reuptake of newly secreted lipoproteins also regulates the net output of apob. demonstrated that the ldl receptor influences the posttranslational fate of apob by increasing presecretory apob degradation and mediating reuptake of nascent lipoprotein particles. in this context, pcsk9-mediated degradation of hepatic ldlr can cause hypertriglyceridemia by liberating apob from ldlr - induced intracellular catabolism as well as reducing uptake of nascent apob - containing lipoproteins (eg, vldl). indeed, several experimental models have demonstrated that pcsk9 directly increases hepatic production of apob - containing lipoproteins. acute adenoviral - mediated overexpression of pcsk9 in fasting mice leads to profoundly increased hepatic production of apob and vldl - triglycerides. similarly, chronic hepatic expression of pcsk9 leads to overproduction of vldl in transgenic mice. murine expression of human pcsk9 led to increases in hepatic lipogenesis in both an apoe and ldlr - dependent manner. shunting of trl from plasma to visceral adipose tissue in the absence of pcsk9 may be due to its effects on vldlr and cd36, which are upregulated in the perigonadal fat depots of female pcsk9-knockout mice. absence of pcsk9 leads to preservation of these two surface proteins which in turn facilitates fatty acid uptake into adipose tissue and causes adipocyte hypertrophy. despite these empiric observations, interestingly, a recent study in mice lacking ldlr demonstrated that pcsk9 did not affect the expression of genes and proteins involved in hepatic lipogenesis (both srebp- and non - srebp - mediated), findings that differ from what was seen in the intestine. the intestine is only second to the liver in production of pcsk9 and similarly has an impact on intestinally derived plasma trl, which are produced during meal absorption and contain apob48 as main structural protein. mechanistic studies demonstrated that pcsk9 increases the production and secretion of intestinal trl by both transcriptional and post - transcriptional mechanisms involving both the sterol - regulatory element - binding proteins (srebp) and non - srebp pathways, with subsequent lipid accumulation in enterocytes. in murine knockout models, the absence of pcsk9 was associated with a reduction in apob48 secretion and attenuation of postprandial hypertriglyceridemia. given the significant atherogenic impact of chylomicron remnants, this observation may represent additional therapeutic potential of pcsk9 inhibitors to reduce the risk of ascvd. beyond intestinal trl metabolism, pcsk9 reduces cholesterol absorption by decreasing expression of npc1l1, the main entry point of cholesterol into the enterocytes from the intestinal lumen. furthermore, recent results suggest that pcsk9 increases the intestinal, not the hepatic, contribution to plasma cholesterol and triglyceride levels in the absence of ldlr. lipoprotein(a) [lp(a) ] is a low density lipoprotein (ldl) particle consisting of a molecule of apolipoprotein(a) (a variant protein with a highly heterogeneous number of plasminogen kringle 4 repeats) covalently bound to apolipoprotein b. epidemiological and genetic data have consistently shown lp(a) to be an independent risk factor for ascvd. therapeutic monoclonal antibodies to pcsk9 have been found to reduce lp(a) by about 2530%, irrespective of baseline levels by a yet unidentified mechanism,. this observation is compelling, as lp(a) is a highly atherogenic particle with no specific therapy to lower its plasma levels and thus has generated renewed interest in elucidating the molecular and cellular link between pcsk9, ldlr, and lp(a) metabolism. while many have postulated that the observed lp(a) lowering is due to extreme upregulation and clearance via the ldlr, this is difficult to reconcile in light of seminal work demonstrating that the ldlr is not a physiologically important route of lp(a) catabolism in humans. furthermore, a recent study demonstrated that the effect of pcsk9 on lp(a) is related to reduced secretion rates, rather than its cellular uptake. we previously demonstrated that plasma pcsk9 preferentially associates with lp(a) particles in humans with elevated lp(a). in this context, injection of anti - pcsk9 mabs may lead to the formation of immune complexes on the surface of lp(a) particles that may be cleared by mechanisms unrelated to normal lp(a) clearance routes. pcsk9 induced perturbations of lipid metabolism and ultimately plasma lipid levels are the most obvious mechanism that links pcsk9 to atherosclerosis. a recent line of investigation has sought, however, to determine if pcsk9 itself has a primary role in atherosclerotic plaque development, independent of lipid changes. results of such studies, summarized below, have made it clear that the proatherosclerotic action of pcsk9 is not entirely due to its impact on plasma concentrations of apob containing lipoproteins, at least in the mouse model. several years ago, investigators demonstrated that pcsk9 is expressed in endothelial cells, vascular smooth muscles cells (vsmc), and in other areas of the human atherosclerotic plaque. furthermore, vsmc expression of pcsk9 leads to cleavage of ldlr at the surface of arterial macrophages. additional study revealed that vsmc produce considerably more pcsk9 than do endothelial cells, and that expression is dependent on shear stress, with maximal secretion at the lowest levels of shear stress corresponding to the known correlation between shear and arterial branch points (eg, bifurcations are vulnerable areas). in a pcsk9 murine model of vascular injury, placement of a non - occlusive collar on the carotid artery was associated with reduced neointimal formation and atherosclerotic lesions with reduced vsmc and collagen, though without a difference in macrophage content. an interesting facet of the association between inflammation, pcsk9, and atherosclerosis relates to lox-1, an important receptor for oxidized - ldl (ox - ldl). lox-1 expression is upregulated in the inflammatory state. in ldlr mice fed a high cholesterol diet, atherosclerosis and arterial wall inflammation are reduced with deletion of lox-1. interestingly, the crosstalk between pcsk9 expression and lox-1 in vsmc leads to a feed - forward loop where pcsk9 stimulates transcription of lox-1 and lox-1 activation stimulates pcsk9 expression. whether pcsk9 inhibitors can inhibit atherogenesis by antagonizing lox-1 expression remains to be seen. in murine models of overexpression of either normal or gain - of - function pcsk9, increased atherosclerotic plaque size was observed and explained by the increase in plasma levels of atherogenic lipoproteins,. as might be anticipated, the extent of expression of pcsk9 in ldlr mice has little to no effect on plasma lipids and atherosclerosis. interestingly, while the absence of pcsk9 in apoe mice has a negligible impact on plasma lipids and atherosclerosis, the overexpression of pcsk9 has negligible effects on plasma lipids but is associated with increased atherosclerotic lesion size. in a series of experiments, tavori. investigated the mechanisms of action of human pcsk9 on hepatic lipid and lipoprotein production on atherosclerosis using a previously developed line of transgenic mice expressing human pcsk9 within the normal physiologic range in human plasma (303000 ng / ml). specifically, plasma lipids, hepatic lipogenesis, and atherosclerotic lesion size and composition were evaluated in these transgenic mice expressing human (h) pcsk9 (hpcsk9) on a wild - type (wt), ldlr, or apoe background. plasma apob, cholesterol, and triglyceride levels increased in the wt mice as a result of decreased hepatic ldlr and increased hepatic lipid production. these changes were mediated both transcriptionally and post - transcriptionally by pcsk9 in both an ldlr- and apoe - dependent manner. although in mice expressing hpcsk9 but lacking either ldlr or apoe no significant changes in plasma lipids were seen, hpcsk9 expression increased aortic lesion size in the absence of apoe but not in the absence of ldlr. furthermore, the atheromatous plaque in apoe mice was enriched in hpcsk9 and ly6c (inflammatory) monocytes. these findings establish that pcsk9 significantly affects atherosclerotic lesion size and by mechanisms that are not exclusively related to systemic lipid changes. pcsk9 promotes atherosclerosis directly by modulation of the entry of inflammatory monocytes into the artery wall by pcsk9-ldlr interaction in the plaque. as an extension, this supports the notion that therapeutic antagonism to pcsk9 may improve ascvd outcomes through both lipid and non - lipid pathways. further validation of the role of pcsk9-induced plaque inflammation, independent of plasma lipid changes, comes from studies of apoe and ldlr mice expressing hpcsk9 from bone marrow - derived cells. such a model allows investigation of the direct effect of pcsk9 in the atheroma without confounding by plasma lipoproteins. while these mice manifested similar lipid levels and atherosclerotic lesion size, plaque composition demonstrated an ldlrdependent increase in ly6c monocytes. interestingly, these compositional changes are observed in the background of a very small macrophage contribution to plasma pcsk9 (0.51.5% of total plasma pcsk9), supporting the notion that the plaque may be enriched by macrophage - derived pcsk9 rather than being bathed in plasma pcsk9. additionally, expression of both pro- and anti - inflammatory cytokines was significantly modulated by macrophage hpcsk9 in an ldlr - dependent fashion. specifically, previous work has demonstrated that pro - inflammatory leukocytes modulate atherosclerotic lesion composition and are an important factor in progression of atherosclerosis, despite similar plasma cholesterol levels and lesion size. therefore, based on new experimental observations, one can hypothesize that, even in the absence of changes in lipid levels, hpcsk9 directly contributes to atherogenesis by altering plaque morphology and increasing inflammatory ly6c monocyte infiltration and differentiation in the plaque. it is tempting to speculate that the absence of ldlr should mitigate the negative effect of pcsk9 on inflammation since pcsk9 accumulation in tissues depends on its presence. however, other ldlr family members, such as lrp1, play a role in inflammation and atherogenesis and interact with pcsk9 (fig. 1). pcsk9 leads to degradation of lrp1 in macrophages which may, in part, explain the relationship of pcsk9 and atherosclerosis, as macrophage lrp1 deficiency is associated with increased atherosclerosis and plaque inflammation,. sources and targets of intraplaque pcsk9 pcsk9 can be produced locally within atherosclerotic plaque by endothelial cells, vascular smooth muscle cells, and arterial macrophages. intraplaque pcsk9 exerts paracrine effects on an array of foam cell receptors, including the ldl receptor, lrp1, and cd36. while local production of pcsk9 within the plaque has the potential to modulate atherogenesis independent of plasma concentrations, its impact on each of these foam cell receptors in relationship to atherosclerosis remains unclear. pcsk9 = proprotein convertase subtilisin kexin type 9 ; ldl = low - density lipoprotein ; ldlr = low - density lipoprotein receptor ; lrp1 = low density lipoprotein receptor - related protein 1 ; cd36= cluster of differentiation 36 ; vsmc = vascular smooth muscle cell the experimental studies reviewed above provide mechanistic insight into the relationship of pcsk9 and atherosclerosis. as a first step in translation, a series of atherosclerosis imaging studies have been performed exploring the association between serum pcsk9 and atherosclerotic plaque burden. chan performed carotid intima - media wall thickness (cimt) measurements in 295 asymptomatic subjects from the community. they found a significant association between pcsk9 and cimt that was independent of traditional cardiovascular risk factors, including gender, hypertension, smoking, ldl - c, triglycerides, lp(a), obesity, and biomarkers of inflammation. these findings are in agreement with smaller studies investigating the association of pcsk9 and cimt. on the other hand, a sub - analysis of the fate study (firefighters and their endothelium) evaluated 1,527 middle - aged men free of vascular disease who underwent risk factor assessment, including advanced biomarkers, flow - mediated dilation, and cimt. while pcsk9 concentration was associated with several traditional risk factors, there was no relationship between pcsk9 levels and measures of subclinical atherosclerosis. computed tomography for quantification of coronary artery calcium (cac) has also been used as a tool to evaluate the association of pcsk9 and atherosclerosis. alonso. studied a cohort of 161 genetically confirmed subjects with fh who had plasma measurements of pcsk9 and underwent cac scoring. specifically, serum pcsk9 concentrations were significantly lower and higher in subjects without and with the highest absolute cac scores, respectively. perhaps most interesting, after correction for potential confounders, including age, gender, body mass index, fasting glucose, statin therapy, tobacco use, hypertension, and lipid / lipoprotein parameters, only pcsk9 and apo(a) remained significantly predictive of cac scores in this cohort of asymptomatic fh subjects. utilized a novel approach to see if they could recapitulate experimental findings regarding pcsk9-induced inflammation and atherosclerosis by employing intravascular ultrasound virtual histology (ivus - vh) as a tool in humans. they evaluated the association of serum pcsk9 levels with necrotic core within coronary atherosclerotic lesions in subjects with known cad confirmed at the time of angiography. they found that pcsk9 concentrations were linearly associated with a higher necrotic core fraction in coronary plaque. this observation remained significant in all subgroups, independent of ldl - c levels and use of statins. evaluated the association of serum pcsk9 with progression of carotid plaque as part of the chinese multi - provincial cohort study. the investigators found that among 643 participants from the general population free of cardiovascular disease at baseline, pcsk9 levels were associated with progression of atherosclerosis as reflected by total plaque area, independent of plasma ldl - c concentrations. more recently, the glagov (global assessment of plaque regression with a pcsk9 antibody as measured by intravascular ultrasound) trial evaluated the effects of the pcsk9 inhibitor, evolocumab, on progression of coronary atherosclerosis in statin treated patients using seral ivus. glagov is a multicenter, double - blinded, placebocontrolled trial, which randomized subjects with angiographic coronary artery disease on baseline statin therapy to receive monthly evolocumab (n = 484) or placebo (n = 484). ivus was performed at baseline and then at 76 weeks to assess changes in coronary atherosclerosis. they found a greater decrease in percent atheroma volume (1% difference) in the group that received evolocumab. additionally, treatment with evolocumab was associated with plaque regression in a greater percentage of patients than placebo (64.3%vs 47.3% ; difference, 17.0% ; p <.001). this study demonstrates that pcsk9 inhibition with aggressive ldl - c lowering is associated with a modest degree of plaque regression. whether this finding is related to the aggressive ldl - c lowering (achieved mean, time - weighted ldl - c on evolocumab / statin was 36.6 mg / dl), other non - lipid anti - atherosclerotic effects of pcsk9, or both, remains to be elucidated. given the results from experimental and imaging studies that demonstrate an important relationship between pcsk9 and atherogenic lipids, inflammation, and atherosclerosis, there has been a natural interest in exploring pcsk9 as a biomarker of ascvd risk, both in the context of primary and secondary prevention. as part of the fate study, 1,527 middle aged firefighters who were free of vascular disease at baseline were followed longitudinally for a mean of 7.2 1.7 years to evaluate the ability of pcsk9 concentrations to predict cardiovascular events. while pcsk9 correlated with ldl - c, insulin, and triglycerides, it did not demonstrate a significant relationship with cardiovascular events. performed a nested case - control evaluation from a prospective cohort of 28,000 initially healthy american women, 45 years old and not on statin therapy, who participated in the women 's health study. the investigators measured plasma concentrations of pcsk9 at baseline among 358 cases (mi, ischemic stroke, cv death) and 358 age, smoking, and hormone replacement therapy matched controls (remained free of disease during 17 years of follow - up). the median pcsk9 concentrations were not statistically different amongst cases vs control (304.4 s 299.7), respectively. as expected, there was a modest, positive association between pcsk9 level and apob and triglycerides. while baseline apob predicted the occurrence of first cardiovascular events, baseline levels of pcsk9 did not. more recently, leander. enrolled 4,232 sixty - year old men and women living in stockholm county in a prospective cohort study examining the relationship between pcsk9 and future cardiovascular events (composite primary outcome of fatal or non - fatal myocardial infarction, angina, chronic ischemic heart disease, sudden cardiac death, and fatal or non - fatal ischemic stroke). during the 15 years of follow - up not surprisingly, there was a modest correlation between pcsk9 levels with ldl cholesterol (r = 0.18, p < 0.0001) and triglycerides (r = 0.12, p < 0.0001). they found improved cardiovascular disease event - free survival in subjects in the lowest quartile of pcsk9 and the highest hazard ratios for incident cardiovascular disease in those in the highest quartile of pcsk9. one particularly interesting sub - analysis demonstrated that subjects with discordant pcsk9 and ldl - c levels (high pcsk9 low ldl - c) had the highest future hazard of the primary outcome, even compared to those with high pcsk9 high ldl - c. additionally, the authors demonstrated improved discrimination (modestly improved c - statistic) and net reclassification with the incorporation of pcsk9 levels into their model (though neither was statistically significant). in particular, leander. used a customized elisa assay that found a much lower median pcsk9 levels than the ridker cohort (94.3 ng / ml vs 300 ng / ml, respectively). it must be noted that leander. enrolled a representative sample of men and women from the general swedish population whereas ridker. studied a sub - cohort from a randomized controlled trial in women who were assigned to treatment with aspirin or vitamin e for prevention of cardiovascular disease. in the context of secondary prevention, werner. tested whether fasting pcsk9 serum concentrations predict events in a large cohort of statin - treated patients with well - controlled ldl - c levels and angiographically documented stable coronary artery disease. these subjects were followed prospectively for the primary composite outcome including cardiovascular death, acute coronary syndrome (acs), or unplanned, symptom - induced coronary revascularization. interestingly, while serum pcsk9 levels predicted the primary outcome in subjects on statin therapy and well controlled ldl - c levels, the association was lost when adjusting for fasting triglyceride levels. perhaps this observation is not surprising when taking into account the influence of pcsk9 on other non - ldl atherogenic lipoprotein fractions. studied 616 chinese subjects with stable coronary artery disease for 17 months to evaluate the association of pcsk9 levels with the composite primary outcome of cardiac death, stroke, myocardial infarction, revascularization, and unstable angina. these subjects were not on lipid - lowering therapy prior to enrollment but received medical therapy without or with percutaneous coronary intervention after enrollment. specifically, there were significantly higher pcsk9 levels observed in subjects with a syntax score in the highest vs the lowest tertile. furthermore, at 17 months the event rate was higher in those with higher pcsk9 levels, but evident only among subjects treated medically, and not those who underwent coronary revascularization. the prognostic value of pcsk9 levels has also been studied in patients with acs. the participants were followed up at 30 days and 1 year after the event for the primary endpoint of all - cause death. they observed that pcsk9 concentrations in subjects with acs were associated with measures of inflammation, lipid - lowering therapy, and the clinical onset of acs. clearly, on the basis of the various trials evaluating pcsk9 as a biomarker of ascvd risk, there are discrepant results from which no firm conclusions can be drawn. on that basis, a group of investigators performed a systematic review and meta - analysis of studies evaluating the relationship of pcsk9 levels with the risk of future cardiovascular events. ultimately, 8 studies were included in their analysis, all published very recently, and with 12,081 subjects followed for a mean of 6.6 years. the main finding from this analysis is that pcsk9 levels are modestly but significantly correlated with risk of total cardiovascular events. specifically, high vs. low pcsk9 levels furthermore, an increase in pcsk9 levels by 1 sd corresponds to a 10% increase in total cardiovascular events. based on the available data, acquisition of plasma pcsk9 levels can not be endorsed at this time for clinical use. its association with ascvd events is modest and less robust than other commonly used and more validated biomarkers. however, these analyses highlight the need for standardization and refinements in the methodologies to assay pcsk9. currently, there are two commonly used methods to measure plasma pcsk9, elisa (common and scalable) and mass spectrometry (expensive and cumbersome). importantly, recent lines of experimental evidence have demonstrated that pcsk9 is compartmentalized within the plasma, with approximately 40% of pcsk9 bound to ldl or lp(a) particles and the remainder circulating freely, or at least not associated with lipoproteins. given the stoichiometry between ldl and pcsk9 in plasma, approximately only 1 ldl particle in every 5001000 carries at least one molecule of pcsk9. ldl - bound pcsk9 appears to be the more biologically active from, with free plasma pcsk9 susceptible to furin cleavage, a form that is less biologically active. currently available elisa techniques are not able to discriminate the various forms of plasma pcsk9. development of a practical and reproducible assay that can quantitate the different compartments of plasma pcsk9 may finally herald the birth of pcsk9 as a valuable clinical biomarker. examination of experimental, imaging, and epidemiological studies demonstrates that pcsk9 is inextricably linked to atherosclerosis through both lipid and non - lipid pathways. one important culmination of this work will perhaps be reflected by the results of the clinical trials testing the therapeutic monoclonal antibodies to pcsk9, the first of which is expected to be published in 2017. preliminary analyses suggest that randomized controlled trials are indeed likely to demonstrate that antagonism of pcsk9 is associated with a significant reduction in ascvd events. these trials, of course, can not answer the question as to which and to what relative extent each of these mechanisms of pcsk9 inhibition thwarts atherosclerosis. furthermore, the current clinical approach utilizing antibodies only inhibits plasma (hepatic, secreted, extracellular) pcsk9. novel agents in development have the ability to inhibit production (eg, antisense oligonucleotides, silencing rna) of pcsk9 and therefore may highlight the relative importance of intracellular pcsk9 on inflammation and atherosclerosis. we are still at the dawn of the pcsk9 era, and the future is bright ! dr. fazio has received compensation for advisory activities from the following companies : aegerion, amarin, amgen, kowa, merck, sanofi. shapiro has received compensation for advisory activities from the following companies : alexion, amgen, bracco, ge health care, synta pharmaceuticals. | even though it is only a little over a decade from the discovery of proprotein convertase subtilisin / kexin type 9 (pcsk9) as a plasma protein that associates with both high and low cholesterol syndromes, a rich body of knowledge has developed, and drugs inhibiting this target have been approved in many markets. while the majority of research in recent years has focused on the impact of therapeutic antagonism of this molecule, important lines of investigation have emerged characterizing its unique physiology as it relates to cholesterol metabolism and atherosclerosis. the pcsk9 story is unfolding rapidly but is far from complete. one chapter that is of particular interest is the possible direct link between pcsk9 and atherosclerosis. this review specifically examines this relationship drawing from data produced from experimental models of plaque biology and inflammation, atherosclerosis imaging studies, and observational epidemiology. |
oxidized phospholipids (oxpl) are generated in vivo as a result of the inflammatory response, mitochondrial respiration, xenobiotic metabolism, and other processes that generate oxidants. the fatty acyl group esterified at the 2 position of glycerophospholipds is mono- or polyunsaturated and is sensitive to oxidation to hydroperoxides and cyclic peroxides. the initial oxidation products decompose to a variety of compounds, some of which are reactive electrophiles.(1) these electrophiles either remain esterified to the phospholipid or can be released from the membrane and react with cellular targets. the most well - studied of these electrophiles is the highly reactive,-unsaturated aldehyde, 4-hydroxynonenal (hne), which can diffuse throughout the cell and modify dna and protein molecules. previous work from our laboratory, using mass spectrometry based proteomics and microarray analysis, along with work from other groups, has demonstrated the ability of hne to modulate cellular pathways including the er stress response, the antioxidant response, the dna damage response, the heat shock response, and the induction of apoptosis in human colorectal cancer (rko) cells. hne - like carbonyl groups at the sn-2 position can be generated in the plasma membrane and promote macrophage activation and inflammation.(11) when phospholipids are subjected to oxidative stress, a complex mixture of reactive compounds is formed, and it is often difficult to isolate significant amounts of individual compounds of interest. to evaluate the chemical reactivity and cellular effects of several of these oxidation products, we synthesized a series of electrophiles related to hne and its oxidation product, one (scheme 1). both hne and one can be further oxidized to produce their respective metabolites, hnea and onea, which have also been detected in vivo. the cooh - hne and cooh - one analogues can be formed in vivo by hydrolysis of the 5-hydroxy-8-oxo-6-octenoic acid ester of 2-lysophophatidylcholine (hooa - pc) and the 5-keto-8-oxo-6-octenoic acid ester of lysophosphatidylcholine (kooa - pc), respectively. these forms of oxidized phosphatidylcholine have been identified in oxidized human low - density lipoprotein and are likely hydrolyzed by the enzyme platelet - activating factor - acetylhydrolase (paf - ah) to produce the carboxylic acid derivative.(20) each compound was evaluated for electrophilic reactivity toward n - acetylcysteine and toxicity toward the human colon carcinoma cell line, rko, and the human macrophage cell line, thp-1. hne and oxpls are known to inhibit the synthesis of pro - inflammatory cytokines, including il-6, il-12, and tnf, in lps - activated monocytic cell lines. therefore, we performed further analysis in differentiated thp-1 macrophages to assess changes in macrophage activation and pro - inflammatory signaling in response to various lipid electrophiles. several of the hne- and one - analogues significantly inhibit the thp-1 macrophage production of il-6, il-1, and tnf after challenge with lps and interferon gamma (ifn). additionally, it was found that hne and one could inhibit thp-1 macrophage activation as measured by the extent of phagocytosis, under the same conditions as those that inhibit cytokine production. purification by column chromatography was carried out on silica gel, and tlc plates were visualized with phosphomolybdic acid. although hne is commercially available, the purity was sometimes questionable, and therefore, we chose to synthesize it. the synthesis of hne (1), its ester precursor 7, and sulfinate 8 has been previously described in the literature. dess - martin periodinane (1.8 g, 4.3 mmol) was added to a solution of 1 (0.52 g, 3.3 mmol) in ch2cl2 (16 ml). after 30 min, the reaction mixture was concentrated and purified by column chromatography (10% etoac / hexanes). the product (0.37 g) was isolated as a yellow oil in 72% yield. the nmr data was consistent with the literature.(25)h nmr (cdcl3) 9.74 (d, 1h, j = 7.0 hz), 6.85 (d, 1h, j = 16.2 hz), 6.73 (dd, 1h, j = 7.0, 16.3 hz), 2.65 (t, 2h, j = 7.3 hz), 1.62 (m, 2h), 1.301.27 (m, 4h), 0.86 (t, 3h, j = 6.8 hz) ; c nmr (cdcl3) 2 00.1, 193.4, 144.9, 137.2, 41.1, 31.2, 23.3, 22.3, 13.8. aqueous naoh (0.25 g, 6.3 mmol, 3 ml) was added to a solution of 7 (0.50 g, 2.5 mmol) in meoh (12 ml). after stirring overnight, the reaction mixture was acidified with 10% hcl, saturated with nacl, and extracted with etoac. the product (0.25 g, 58%) was isolated as a colorless oil after purification by column chromatography (50% etoac / hexanes). the nmr data was consistent with the literature.(26)h nmr (cdcl3) 7.02 (dd, 1h, j = 4.7, 15.6 hz), 6.36 (br s, 1h), 6.01 (d, 1h, j = 15.6 hz), 4.31 (dt, 1h, j = 5.1, 5.9 hz), 1.55 (m, 2h), 1.341.22 (m, 6h), 0.86 (t, 3h, j = 5.9 hz) ; c nmr (cdcl3) 171.5, 152.7, 119.3, 71.0, 36.4, 31.6, 24.8, 22.5, 13.9. a solution of cro3 (1.0 g, 10 mmol) in h2o (9 ml) and h2so4 (1 ml) was added to a solution of 1 (0.43 g, 2.8 mmol) in acetone (14 ml). after 30 min, the reaction mixture was poured into h2o, saturated with nacl and extracted with etoac. purification by column chromatography (50% etoac / hexanes) yielded 4 (0.19 g, 40%) as a white powder. the nmr data was consistent with the literature.(27)h nmr (cdcl3) 10.3 (br s, 1h), 7.11 (d, 1h, jn = 15.9 hz), 6.64 (d, 1h, j = 15.8 hz), 2.62 (t, 2h, j = 7.3 hz), 1.62 (m, 2h), 1.301.25 (m, 4h), 0.87 (t, 3h, j = 7.3 hz) ; c nmr (cdcl3) 199.8, 170.7, 141.0, 129.7, 41.6, 31.2, 23.3, 22.3, 13.8. a solution of 3,4-dihydro-2h - pyran (11 ml, 0.12 mol) in ch2cl2 (100 ml) was added dropwise to a milky solution of 1,10-decanediol (21 g, 0.12 mol) and p - toluenesulfonic acid (4.6 g, 0.20 mol) in ch2cl2 (300 ml). after 3 h, the reaction mixture was washed with saturated nahco3 and dried over mgso4. purification by column chromatography (20% etoac / hexanes) yielded the product (13 g, 41%) as a colorless liquid. pyridinium chlorochromate (16 g, 0.074 mol) was added to a solution of 10-(tetrahydro-2h - pyran-2-yloxy)decan-1-ol (13 g, 0.049 mol) in ch2cl2 (200 ml). after 1 h, the reaction mixture was diluted with ether and filtered through celite. the product was purified by column chromatography (10% etoac / hexanes) and isolated as a colorless liquid (10 g, 81%). the nmr data was consistent with the literature.(28)h nmr (cdcl3) 9.73 (t, 1h, j = 1.9 hz), 4.54 (t, 1h, j = 2.8 hz), 3.83 (m, 1h), 3.69 (dt, 1h, j = 6.9, 9.5 hz), 3.46 (m, 1h), 3.34 (dt, 1h, j = 6.6, 9.5 hz), 2.38 (dt, 2h, j = 1.9, 7.3 hz), 1.801.68 (m, 4h), 1.561.50 (m, 6h), 1.1.351.25 (m, 10h) ; c nmr (cdcl3) 202.9, 98.8, 67.6, 62.3, 43.8, 30.7, 29.7, 29.32, 29.28, 29.2, 29.1, 26.1, 25.4, 22.0, 19.6. piperidine (5.0 ml, 0.051 mol) was added to a solution of sulfinate 8 (7.4 g, 0.033 mol) and 10-(tetrahydro-2h - pyran-2-yloxy)decanal (10 g, 0.039 mol) in ch3cn. after stirring overnight the product (8.9 g) was isolated in 79% yield after purification by column chromatography (20 to 30% etoac / hexanes). h nmr (cdcl3) 6.90 (dd, 1h, j = 5.0, 15.7 hz), 5.98 (dd, 1h, j = 1.6, 15. hz), 4.53 (t, 1h, j = 2.7 hz), 4.24 (m, 1h), 4.15 (q, 2h, j = 7.1 hz), 3.82 (m, 1h), 3.68 (dt, 1h, j = 6.8, 9.5 hz), 3.45 (m, 1h), 3.33 (dt, 1h, j = 6.6, 9.5 hz), 2.12 (br d, 1h, j = 4.6 hz), 1.791.70 (m, 2h), 1.541.47 (m, 8h), 1.301.26 (m, 10h), 1.25 (t, 3h, j = 7.1 hz) ; c nmr (cdcl3) 166.5, 150.3, 120.0, 98.8, 71.0, 67.6, 62.3, 60.4, 36.6, 30.7, 29.6, 29.4, 29.3, 26.1, 25.4, 25.1, 19.6, 14.2, 14.1 ; hrms (esi) calculated 365.2304 (m + na), observed 365.2285. tbdmscl (4.8 g, 0.032 mol) and imidazole (2.7 g, 0.040 mol) were added to a solution of 9 (8.9 g, 0.026 mol) in dmf (65 ml). after stirring overnight, the product was purified by column chromatography (10% etoac / hexanes) and isolated as a colorless liquid (9.6 g, 81%). h nmr (cdcl3) 6.88 (dd, 1h, j = 4.7, 15.5 hz), 5.92 (dd, 1h, j = 1.7, 15.5 hz), 4.54 (t, 1h, j = 2.7 hz), 4.25 (m, 1h), 4.16 (dq, 2h, j = 1.7, 7.2 hz), 3.83 (m, 1h), 3.69 (dt, 1h, j = 6.9, 9.5 hz), 3.46 (m, 1h), 3.34 (dt, 1h, j = 6.6, 9.6 hz), 1.73 (m, 2h), 1.561.47 (m, 8h), 1.301.27 (m, 10h), 1.26 (t, 3h, j = 7.1 hz), 0.87 (s, 9h), 0.02 (s, 3h), 0.0 (s, 3h) ; c nmr (cdcl3) 166.7, 151.1, 119.6, 98.8, 71.5, 67.6, 62.3, 60.2, 37.3, 30.7, 29.7, 29.5, 29.40, 29.35, 26.2, 25.8, 25.6, 25.4, 24.7, 19.6, 18.1, 14.2, 4.7, 5.0 ; hrms (esi) calculated 479.3177 (m + na), observed 479.3165. to a solution of this product (9.6 g, 0.021 mol) in diethyl ether (100 ml) after 6 h, the reaction mixture was diluted with h2o and extracted with etoac. the organic layer was washed with brine, dried over mgso4 and purified by column chromatography (20 to 30% etoac / hexanes). the product (5.2 g) was isolated as a colorless liquid in 66% yield. h nmr (cdcl3) 6.88 (dd, 1h, j = 4.7, 15.5 hz), 5.92 (dd, 1h, j = 1.7, 15.5 hz), 4.25 (m, 1h), 4.15 (dq, 2h, j = 1.6, 7.1 hz), 3.59 (t, 2h, j = 6.6 hz), 1.541.45 (m, 4h), 1.301.26 (m, 10h), 1.25 (t, 3h, j = 7.1 hz), 0.87 (s, 9h), 0.01 (s, 3h), 0.00 (s, 3h) ; c nmr (cdcl3) 166.8, 151.1, 119.6, 71.5, 62.9, 60.3, 37.2, 32.7, 29.44, 29.38, 29.3, 25.8, 25.6, 24.7, 18.1, 14.2, 4.7, 5.0 ; hrms (esi) calculated 373.2769 (m + h), observed 373.2771. bleach (30 ml, 0.024 mol) was added to a rapidly stirring solution of 10 (5.2 g, 0.014 mol), tempo (0.20 g, 0.0013 mol), nabr (1.1 g, 0.010 mol), bu4nbr (0.90 g, 0.003 mol), and nahco3 (3.0 g, 0.035 mol) in ch2cl2 (50 ml) and h2o (20 ml). the reaction mixture turned orange as the bleach was added, then the color dissipated. if the reaction was not complete within 30 min, additional bleach was added. the reaction mixture was acidified with 10% hcl, saturated with nacl, and extracted with etoac. purification by column chromatography (30% etoac / hexanes) yielded 11 (4.1 g) in 75% yield. h nmr (cdcl3) 6.87 (dd, 1h, j = 4.7, 15.5 hz), 5.92 (dd, 1h, j = 1.7, 15.5 hz), 4.25 (m, 1h), 4.16 (dq, 2h, j = 1.6, 7.1 hz), 2.30 (t, 2h, j = 7.4 hz), 1.57 (m, 2h), 1.46 (m, 2h), 1.301.26 (m, 8h), 1.25 (t, 3h, j = 7.1 hz), 0.86 (s, 9h), 0.01 9s, 3h), 0.01 (s, 3h) ; c nmr (cdcl3) 179.6, 166.8, 151.1, 119.6, 71.5, 60.3, 37.2, 33.9, 29.3, 29.0, 28.9, 24.6, 24.5, 18.1, 14.2, 4.7, 5.0 ; hrms (esi) calculated 387.2561 (m + h), observed 387.2551. dibal - h (1 m / toluene, 35 ml, 0.035 mol) was added slowly to a solution of 11 (4.1 g, 0.011 mol) and et3n (2.3 ml, 0.017 mol) in ch2cl2 (55 ml) at 0 c. after 30 min, the reaction mixture was slowly quenched with 10% hcl and saturated with nacl. the product was purified by column chromatography (50% etoac / hexanes) and isolated as a pale yellow liquid (1.7 g, 48%). h nmr (cdcl3) 5.755.59 (m, 2h), 4.124.05 (m, 3h), 2.30 (t, 2h, j = 7.4 hz), 1.58 (m, 2h), 1.43 (m, 2h), 1.301.25 (m, 8h), 0.85 (s, 9h), 0.01 (s, 3h), 0.01 (s, 3h) ; c nmr (cdcl3) 179.1, 134.4, 128.1, 72.7, 63.1, 38.1, 34.0, 29.2, 29.0, 28.7, 25.9, 25.8, 24.8, 24.6, 18.2, 14.2, 4.3, 4.9 ; hrms (esi) calculated 367.2275 (m + na), observed 367.2253. dess - martin periodinane (1.8 g, 4.2 mmol) was added to a solution of 12 (1.1 g, 3.3 mmol) in ch2cl2 (16 ml). after 1.5 h, the reaction mixture was diluted with etoac and washed with h2o and brine, and dried over mgso4. purification by column chromatography (30% etoac / hexanes) yielded 13 as a colorless oil (0.64 g, 57%). h nmr (cdcl3) 9.50 (d, 1h, j = 8.0 hz), 6.75 (dd, 1h, j = 4.5, 15.5 hz), 6.20 (ddd, 1h, j = 1.5, 8.0, 15.5 hz), 4.35 (m, 1h), 2.28 (t, 2h, j = 7.4 hz), 1.561.50 (m, 4h), 1.301.20 (m, 8h), 0.85 (s, 9h), 0.00 (s, 3h), 0.03 (s, 3h) ; c nmr (cdcl3) 193.8, 179.9, 160.4, 130.5, 71.5, 37.0, 33.9, 29.2, 29.0, 28.8, 25.7, 24.6, 24.5, 18.1, 4.8, 5.0 ; hrms (esi) calculated 343.2299 (m + h), observed 343.2286. aqueous hf (1 ml, 5% v / v) was added to a solution of 13 (0.64 g, 1.9 mmol) in ch3cn (18 ml). after 1.5 h, the reaction mixture was adjusted to ph 4 with saturated nahco3, saturated with nacl, and extracted with etoac. note : the solution should not be concentrated to dryness, or decomposition of the product will result if trace amounts of hf are still present. the product was purified by column chromatography (50% etoac / hexanes) and isolated as a white powder (0.17 g, 40%). h nmr (cdcl3) 9.54 (d, 1h, j = 7.9 hz), 6.80 (dd, 1h, j = 4.7, 15.7 hz), 6.27 (ddd, 1h, j = 1.4, 7.9, 15.7 hz), 4.39 (m, 1h), 2.31 (t, 2h, j = 7.4 hz), 1.611.56 (m, 4h), 1.351.25 (m, 8h) ; c nmr (cdcl3) 193.8, 179.5, 159.2, 130.6, 71.0, 36.3, 33.9, 29.1, 28.9, 28.8, 25.0, 24.5 ; hrms (esi) calculated 229.1434 (m + h), observed 229.1426. dess - martin periodinane (0.15 g, 0.35 mmol) was added to a solution of 5 (0.067 g, 0.29 mmol) in ch2cl2 (2 ml). after 1 h, the reaction mixture was concentrated and purified by column chromatography (50% etoac / hexanes). h nmr (cdcl3) 9.76 (d, 1h, j = 6.9 hz), 6.86 (d, 1h, j = 16.2 hz), 6.75 (dd, 1h, j = 6.6, 16.2 hz), 2.67 (t, 2h, j = 7.2 hz), 2.33 (t, 2h, j = 7.4 hz), 1.661.59 (m, 4h), 1.351.28 (m, 6h) ; c nmr (cdcl3) 200.0, 193.4, 178.7, 144.9, 137.4, 41.1, 33.7, 29.0, 28.83, 28.78, 24.6, 23.5 ; hrms (esi) calculated 249.1097 (m + na), observed 249.1085. this procedure was carried out using the mini diazald diazomethane generator from aldrich (st. a solution of diazald (1.6 g, 7.5 mmol) in ether (35 ml) was added dropwise to a solution of koh (1.4 g, 25 mmol) in h2o / etoh (45 ml, 1:1) at 65 c. the ch2n2 was condensed into a reaction flask containing a solution of 12 (1.6 g, 4.7 mmol) in ether (20 ml) at 0 c. after the addition was complete, the reaction mixture was stirred for 30 min to dissipate any unreacted ch2n2. the solution was concentrated, and purification by column chromatography (20% etoac / hexanes) yielded 14 (1.2 g, 69%). 4.124.05 (m, 3h), 3.63 (s, 3h), 2.27 (t, 2h, j = 7.4 hz), 1.58 (m, 2h), 1.43 (m, 2h), 1.301.20 (m, 8h), 0.86 (s, 9h), 0.01 (s, 3h), 0.01 (s, 3h) ; c nmr (cdcl3) 174.3, 135.2, 128.2, 72.6, 63.1, 51.4, 38.1, 34.0, 29.3, 29.1, 29.0, 25.8, 25.0, 24.8, 18.2, 4.3, 4.8 ; hrms (esi) calculated 381.2432 (m + na), observed 381.2424. dess - martin periodinane (1.4 g, 3.4 mmol) was added to a solution of 14 (1.0 g, 2.8 mmol) in ch2cl2 (14 ml). after 1 h, the reaction mixture was concentrated and purified by column chromatography (10 to 20% etoac / hexanes) yielding the product (0.80 g, 81%) as a colorless liquid. h nmr (cdcl3) 9.53 (d, 1h, j = 8.0 hz), 6.76 (dd, 1h, j = 4.5, 15.5 hz), 6.21 (ddd, 1h, j = 1.5, 8.0, 15.5 hz), 4.36 (m, 1h), 3.62 (s, 3h), 2.26 (t, 2h, j = 7.4 hz), 1.601.52 (m, 4h), 1.301.20 (m, 8h), 0.87 (s, 9h), 0.02 (s, 3h), 0.01 (s, 3h) ; c nmr (cdcl3) 193.6, 174.2, 160.2, 130.6, 71.5, 51.4, 37.0, 34.0, 29.3, 29.0, 28.9, 25.7, 24.8, 24.7, 18.1, 4.7, 5.0 ; hrms (esi) calculated 379.2275 (m + na), observed 379.2287. to a solution of this aldehyde (0.80 g, 2.2 mmol) in ch3cn (14 ml) was added aqueous hf (0.6 ml, 5% v / v). after 1 h, the reaction mixture was neutralized with saturated nahco3 and extracted with etoac. the product was isolated as a pale yellow liquid (0.41 g, 76%) after purification by column chromatography (30% etoac / hexanes). h nmr (cdcl3) 9.54 (d, 1h, j = 7.9 hz), 6.79 (dd, 1h, j = 4.7, 15.7 hz), 6.27 (ddd, 1h, j = 1.5, 7.9, 15.7 hz), 4.40 (m, 1h), 3.63 (s, 3h), 2.27 (t, 2h, j = 7.4 hz), 1.621.56 (m, 4h), 1.351.25 (m, 8h) ; c nmr (cdcl3) 193.6, 174.3, 159.1, 130.6, 71.0, 51.5, 36.4, 34.0, 29.2, 29.0, 28.9, 25.1, 24.8 ; hrms (esi) calculated 265.1410 (m + na), observed 265.1396. dess - martin periodinane (0.43 g, 1.0 mmol) was added to a solution of 15 (0.20 g, 0.84 mmol) in ch2cl2 (4 ml). after 1 h, the reaction mixture was concentrated and purified by column chromatography (20% etoac / hexanes). h nmr (cdcl3) 9.73 (d, 1h, j = 7.0 hz), 6.84 (d, 1h, j = 16.2 hz), 6.72 (dd, 1h, j = 7.0, 16.2 hz), 3.61 (s, 3h), 2.64 (t, 2h, j = 7.3 hz), 2.25 (t, 2h, j = 7.4 hz), 1.621.54 (m, 4h), 1.351.25 (m, 6h) ; c nmr (cdcl3) 200.0, 193.4, 174.2, 144.8, 137.3, 51.4, 41.1, 33.9, 28.9, 28.8, 28.7, 24.7, 23.4 ; hrms (esi) calculated 263.1254 (m + na), observed 263.1266. human colorectal carcinoma (rko) cells were obtained from american type culture collection (atcc) (manassas, va) and maintained in hepes buffered dmem + glutamax medium from invitrogen (carlsbad, ca), supplemented with 10% fetal bovine serum (fbs) from atlas biologicals (fort collins, co), 1 mem vitamins from mediatech (herndon, va), and 1 antibiotic / antimycotic (invitrogen), and harvested / lysed as described previously.(4) human monocytic leukemia (thp-1) cells were obtained from atcc and maintained in rpmi 1640 medium (invitrogen) supplemented with 10% fbs (atlas biologicals), 1 mm l - glutamine, 1 antibiotic / antimycotic (invitrogen), and 1 mem vitamins from (mediatech). cells from suspension cultures were plated at approximately 10 cells / plate in 150 mm plates and treated with 100 nm phorbol myristate acetate (pma) from sigma - aldrich (st. cells adhered to the plates and were challenged with various concentrations of lipid electrophile or vehicle control. all lipid electrophiles were prepared as a 1000 stock in dmso and diluted into cell culture medium, which unless otherwise stated, contained fbs for treatment. thirty minutes postexposure, cells were washed twice with phosphate buffered saline (pbs) and treated with 50 ng / ml of lps (sigma) and 10 u / ml ifn for various times. cells were harvested by scraping and were pelleted at 1,000 rpm for 5 min at 4 c. cells were washed twice in ice cold pbs and brought up in 0.2 ml / plate of m - per extraction buffer from thermo scientific (rockford, il) + 1% protease inhibitor cocktail (sigma) for mammalian tissue culture. samples were left on ice for 20 min and then centrifuged at 10,000 g for 15 min, whereupon the supernatant was collected, and protein concentration was determined using the bca assay (thermo scientific). rko cells were maintained as described previously and seeded into 96-well plates (7.5 10 cells / well). after 24 h, cells were challenged with various concentrations of lipid electrophile (0500 m) in the presence of serum. for serum free experiments, rko cells were seeded normally for 24 h, but electrophile treatment was done with dmem medium lacking fbs. following a 2448 h treatment, the cells were washed with pbs and incubated with 2 m calcein - am from molecular probes (carlsbad, ca) for 30 min. in live cells, calcein - am is cleaved by an endogenous esterase to produce the fluorescent calcein (abs= 494 ; em = 517). fluorescence was monitored using a spectramax multiwell plate reader (molecular devices, silicon valley, ca), and cell viability was correlated with fluorescent intensity. thp-1 cells were maintained as described previously, seeded into 96-well plates (3 10 cells / well), and treated with 100 nm pma for 7296 h to differentiate. following differentiation, cells were challenged with the lipid electrophile for 24 h before being read using the calcein am assay (described above). the half - lives for the series of hne and one analogues was determined by the reaction of each compound with n - acetyl cysteine (nac) at 37 c. the consumption of the electrophile was monitored by uv (hne at 225 nm, one at 230 nm), which was fitted with a circulating bath to maintain the temperature of the sample holder at 37 c. stock solutions of the electrophiles (34 mm) and n - acetyl cysteine (56 mm) were made up in meoh or sodium phosphate buffer (50 mm, ph 7.4), respectively. nac (55 l) was added to phosphate buffer (3 ml) in a quartz cuvette and used as the blank. to this solution, which was pre - equilibrated at 37 c, the final concentrations were 0.056 mm electrophile and 1 mm nac, maintaining pseudofirst - order conditions. the absorbance of the hne analogues was measured every 5 min for 2 h, long enough for complete reaction. measurements of the one analogues were taken every 3 s for 5 min, with the exception of onea. since this compound was considerably slower than the other one analogues, measurements were taken every 5 min for 2 h. this experiment was carried out in quadruplicate with fresh stock solutions of nac. the stability of each compound to the reaction conditions was measured in the same manner but in the absence of nac. the uv measurement at each time point was corrected for background absorbance based on the absorbance reading upon complete reaction of the electrophile (at least 5 half - lives). a plot of ln(at / a0) versus time gives a linear correlation for early time points (prior to the consumption of the electrophile). the first order rate constant was determined from the slope, which was then converted to a half - life. the max for hnea shifted from 225 to 210 nm as compared to the parent hne compound. since it was possible that nac or products could absorb in this region, the reaction of hnea with nac was also monitored by hplc. the sample was made up as described above, with the addition of cinnamyl alcohol (0.1 mm) as an internal standard. the reaction was monitored by reverse - phase hplc (c18 column) using 9:1 meoh / h2o (0.05% tfa) at a flow rate of 1 ml / min. the amount of hnea relative to the internal standard was measured at 210 nm every 10 min for 90 min. a plot of the amount of hnea remaining versus time showed no reaction of the hnea with nac, consistent with the uv experiment described above. the second - order rate constant was determined under the conditions described above except that the reaction was carried out in 100 mm phosphate buffer (ph 7.4). the higher concentration of buffer was necessary to maintain the ph at 7.4 at the higher concentrations of nac. the consumption of the hne analogues and onea was measured at varying concentrations of nac ranging from 0.46 to 4.6 mm. since the one analogues react much faster with nac, these experiments were carried out under more dilute conditions (0.0840.84 mm nac) so that the consumption could be more accurately measured. the first order rate constant was determined as described above, then plotted versus the [nac ]. the slope of the latter plot was used to determine the second order rate constant (figure s3, supporting information). thp-1 cells were grown, differentiated, treated with lipid electrophiles and lps, and harvested as described above. samples were quantified by the bca assay, and 10 g / well of each sample was run on a 12% (tris - hcl) sds gel from biorad (hercules, ca). gels were transferred onto a 0.45 m nitrocellulose membrane (biorad), the membrane was blocked for 1 h using 5% nonfat dry milk in 1 ttbs (0.1% tween 20 + tris buffered saline), and then reacted with appropriate target antibodies [1:2501:1000 dilutions in 1 ttbs + 1% nonfat dry milk from abcam (cambridge, ma) ] overnight at 4 c. the blot was washed 4 time for 15 min in 1 ttbs, incubated with secondary antibody [1:1,000 dilution from santa cruz (santa cruz, ca) ] for 1 h at room temperature, and washed 3 times for 15 min in 1 ttbs. blots were visualized using supersignal west pico chemiluminescent substrate ecl reagent (thermo scientific) and developed on chemiluminescent - xposure clear blue x - ray film (thermo scientific). all reagents and buffers for the elisa plate assay were obtained from bd biosciences (san jose, ca). for acute exposure experiments, thp-1 cells were treated with dmso, hne (0200 m), one (0200 m), hnea (0200 m), or onea (0200 m) for 30 min, washed twice with pbs, and challenged for various times with lps (in the absence of electrophiles). for continuous exposure experiments, the experimental design was the same as that with acute exposure ; however, lipid electrophiles remained in the media concurrent with lps activation. all samples were diluted 1:50 or 1:10 in standard / sample diluent buffer and processed as per bd opteia human il-6/il-1/tnf elisa kit ii (# 550799, # 557966, and # 550610) specifications. samples were quantified using a cytokine specific standard curve (standards provided) that was prepared in parallel. cytokine levels were determined by measuring absorbance at 450 nm on a spectramax multiwell plate reader. thp-1 cells were seeded at 1.5 10 cells / well onto glass coverslips (vwr, west chester, pa) in 6-well tissue culture plates. cells were differentiated with 100 nm pma for 72 h, washed, and treated with 10 m hne, 0.5 m one, or vehicle for 30 min. following 30 min of incubation, cells were washed twice with pbs and exposed to opsonized 2.0 m fluorescent polystyrene latex beads (fluoresbrite yg microspheres 2.00 m, # 18338 - 5 ; polysciences inc., warrington, pa) in media for 3 or 6 h. one drop (20 l) of beads was opsonized by incubation with 10% fbs for 60 min at 37 c. following exposure to the beads, cells were washed twice with pbs and fixed for 15 min in a 2.5% paraformaldehyde solution. beads were visualized using a zeiss axioplan fluorescence microscope with a green fluorescent protein (gfp) filter. the synthesis of hne and its ester precursor (7) has been previously described.(2) the more highly oxidized analogues, one and onea, were synthesized from hne employing either a dess - martin periodinane or jones oxidation, respectively (scheme 2). the carboxy analogues were synthesized utilizing the same strategy as that in hne synthesis (scheme 3). protecting group manipulation followed by a tempo - mediated oxidation yielded the carboxy ester 11. this intermediate was used for the synthesis of the carboxy - analogues as well as their corresponding methyl esters. deprotection with aqueous hf yielded cooh - hne and further oxidation yielded cooh - one. other common oxidation conditions, such as swern and pcc, resulted in lower yields of the desired product. in addition, after screening several deprotection conditions, hf deprotection resulted in minimal decomposition of the aldehyde moiety. attempts to esterify using acidic methanol resulted in low yields due to allylic substitution. the same oxidation and deprotection conditions described above reagents : (a) dess - martin periodinane, ch2cl2 ; (b) naoh, h2o / meoh ; (c) cro3, h2o / h2so4, acetone. reagents : (a) 10-(tetrahydro-2h - pyran-2-yloxy)decanal, piperidine, ch3cn ; (b) tbdmscl, imidazole, dmf ; (c) mgbr2-et2o, ether ; (d) bleach, tempo, nabr, bu4nbr, nahco3, ch2cl2/h2o ; (e) dibal - h, et3n, ch2cl2 ; (f) dess - martin periodinane, ch2cl2 ; (g) hfaq, ch3cn ; (h) diazald, koh, h2o / etoh, ether. the cytotoxicity of each lipid electrophile was determined by performing a cell viability assay and generating a concentrationresponse curve. cell viability was measured following a 2448 h incubation with the compound, using the fluorogenic substrate, calcein - am. in live cells, calcein - am is cleaved by an endogenous esterase to produce the fluorescent molecule, calcein. ic50 values were calculated from a plot of log of concentration versus the percent of fluorescence as compared to vehicle - treated cells (figure 1). each lipid electrophile was assayed for toxicity in two cell types, human colorectal carcinoma, rko, cells and human acute monocytic leukemia, thp-1, cells. the rko cells were used in order to compare compound toxicity with previous electrophile studies from our laboratory, and the thp-1 cells were used to focus on the ability of lipid electrophiles to modulate the inflammatory process. thp-1 cell viability assay for select lipid electrophiles. thp-1 cells were treated with various concentrations of lipid electrophiles for 24 h, and cell viability was assayed using the fluorescent substrate calcein - am. ic50 values were determined from a plot of log of electrophile concentration versus percent of live cells as compared to a vehicle (dmso) control. the ic50 values reported in table 1 indicate that hne, one, onea, and coome - hne / one all have similar potency with regards to cellular toxicity (ic50 = 2047 m) in rko cells. previous studies from our laboratory demonstrated the activation of caspase-3 and parp cleavage, indicative of the induction of apoptosis, at similar concentrations of hne and one.(33) onea demonstrates greater than 10-fold higher toxicity than its counterpart hnea. additionally, cooh - one shows much greater toxicity than its hydroxy hne analogue cooh - hne. conversion of cooh - hne / one to a carboxy - methyl ester led to a decrease in ic50 values for the coome derivatives with a more pronounced effect in the hne derivatives as compared to the one derivatives. increased toxicity of the coome derivatives is most likely due to an increased uptake of the neutral molecules, as the charged carboxylic acid moiety can inhibit diffusion across the cell membrane. rko cells were seeded into 96-well plates (7.5 10 cells / well). after 24 h, cells were challenged with various concentrations of the lipid electrophile (0500 m) in the presence of serum. following a 2448 h treatment, the cells were washed with pbs and incubated with 2 m calcein - am. fluorescence was monitored at 517 nm, and cell viability was correlated with fluorescent intensity. thp-1 cells were seeded into 96-well plates (3 10 cells / well) and treated with 100 nm pma for 7296 h to differentiate. following differentiation, cells were challenged with the lipid electrophile for 24 h before being read using the calcein am assay (described above). the overall trend for the viability assays is that the one analogues are more toxic than the hne analogues. these data corroborate previous literature reports, which argue that one is more reactive than hne. however, in our hands the parent compounds themselves, one versus hne, show little difference in toxicity. prior reports indicate that hne and one are equitoxic in rko cells or that one is 5-fold more toxic than hne in human neuroblastoma cells. to address this issue, we repeated the viability assay for hne and one in the absence of serum to determine if one s apparent toxicity was lowered because of its higher reactivity with serum proteins, as compared to hne. in rko cells treated in the absence of serum, hne and one both exhibited greater toxicity with ic50 values of 5 and 9 m, respectively (data not shown) however, hne and one exhibit similar toxicity in the absence of serum suggesting that serum reactivity does not explain why two electrophiles with very divergent chemical reactivity have nearly identical toxicities. the ic50 values in thp-1 cells show remarkable concordance with those values obtained for the rko cells. the toxicity data in thp-1 recapitulates the overall trend observed in the rko cells with the one analogues being more toxic than their respective hne analogues. in order to determine the relative reactivity of the lipid electrophiles, the reaction of each compound with n - acetyl cysteine (nac) was investigated. since the reactive moiety of most of the compounds was essentially unchanged from the parent hne and one, we anticipated that these compounds would also undergo a michael addition with nac. upon reaction, the characteristic chromophore due to the,-unsaturated carbonyl the reaction of each electrophile with nac was carried out in phosphate buffer (ph 7.4) at 37 c under pseudofirst - order conditions. in addition, the stability of each electrophile to the reaction conditions was investigated in the absence of nac. the reaction of the electrophile was monitored by uv at 225 or 230 nm for hne or one, respectively. upon reaction with nac, the reaction was continued until at least 5 half - lives had been reached (see supporting information). in most cases, some background absorbance remained ; therefore, the data were corrected for this residual absorbance. the uv absorbance for most of the analogues was similar to those of their parent compound. however, the max for hnea was shifted from 225 to 210 nm. since it is possible that the nac or michael adducts could also absorb in that region, the reaction of hnea with nac was also analyzed by hplc. the sample was made up in phosphate buffer as described above, with the addition of an internal standard. all of the compounds were stable to the reaction conditions, represented by the open symbols in the figure. upon addition of nac, all of the electrophiles except hnea reacted, resulting in a decrease in the uv absorbance (closed symbols). coome - hne and coome - one (squares) exhibited reactivities similar to those of their parent compounds (triangles), while cooh - hne and cooh - one (circles) were slightly less reactive. substitution of the aldehyde moiety with a carboxylic acid had a significant impact on the reactivity of the hnea and onea with nac. although the onea reacted with nac, its reactivity was much slower than that of one and was comparable to that of the hne analogues. stability (open symbols) and reactivity (closed symbols) of hne and one analogues. (a) hne with (filled red triangle) and without (open red triangle) nac, cooh - hne with (filled blue circle) and without (open blue circle) nac, coome - hne with (filled black square) and without (open black square) nac ; (b) one with (filled red triangle) and without (open red triangle) nac, cooh - one with (filled blue circle) and without (open blue circle) nac, coome - one with (filled black square) and without (open black square) nac ; (c) hnea with (filled blue circle) and without (open red triangle) nac ; (d) onea with (filled blue circle) and without (open red triangle) nac. reactions were carried out with 0.056 mm electrophile and 1 mm nac in phosphate buffer (50 mm, ph 7.4) at 37 c. the consumption of the electrophile was monitored by uv absorbance at 225 and 230 nm for hne and one, respectively. first - order plots (see supporting information) of the data in figure 2 were used to calculate the half - lives for the series of hne and one analogues at 1 mm nac. the second - order rate constant for each electrophile was determined from plots of the k1 at varying concentrations of nac (data presented in supporting information). the half - lives and second - order rate constants for each electrophile are presented in table 2. half - life determined in the presence of 1 mm nac in phosphate buffer (50 mm, ph 7.4) at 37 c. rate constant determined in the presence of varying concentrations of nac in phosphate buffer (100 mm, ph 7.4) at 37 c. previous literature reports have shown that low concentrations of hne (110 m) can inhibit the production of various pro - inflammatory cytokines, il-6, tnf, and il-1, in several macrophage cell lines. to recapitulate these experiments in our model system, thp-1 macrophages were pretreated with various concentrations of hne for 30 min before the addition of lps / ifn and 6 h of activation. medium was collected from the treated cells and assayed by elisa for the expression of the pro - inflammatory cytokines il-1 and il-6. under continuous hne exposure, il-1 exhibited a biphasic decline of expression whereby at low concentrations of hne (0.010.5 m), there was a gradual loss of cytokine expression to about 80% of dmso control. at higher concentrations, there was a dramatic loss in il-1 expression with complete inhibition at concentrations greater than 25 m (figure 3a). measurement of il-6 expression showed similar results with minimal loss of il-6 expression at low concentrations of hne (0.11 m) followed by a sharp decline in cytokine expression above 5 m hne (figure 3b). the sharp decline in cytokine expression at doses exceeding 5 m hne previous studies from our laboratory evaluating hne induction of apoptosis as measured by parp cleavage and caspase-3 activation showed no evidence of apoptosis up to 8 h after treatment with 45 m hne.(33) effect of continuous vs transient hne treatment on cytokine expression during lps / ifn challenge. thp-1 cells were pretreated with various concentrations of hne for 30 min, followed by either leaving in or washing out (w.o.) the electrophile, and 6 h of lps challenge. hne was assayed for its ability to inhibit il-1 (a) and il-6 (b) expression. although no evidence of cell death was found which could account for the loss of cytokine expression during continuous hne exposure, we chose to modify our protocol to eliminate any potential for toxicity during the course of the experiment. to this end, all cytokine experiments were conducted by treating thp-1 cells for short periods of time with various concentrations of lipid electrophile, washing with pbs to remove any electrophile, and then challenging the cells with lps / ifn. we monitored the cytokines il-6, il-1, and tnf because of their key role in the progression / activation of the macrophage inflammatory response and because of previous literature reports which indicate a role for hne and oxpls in their inhibition. elisas specific for each of the pro - inflammatory cytokines were used to analyze the conditioned medium from thp-1 macrophages treated with various concentrations of hne, one, and vehicle control. briefly, the assay was a solid phase sandwich elisa in which a monoclonal antibody, specific to the cytokine of interest, was coated on a 96-well plate. any target protein in the conditioned medium was immobilized by binding to the antibody on the plate. the plate was then washed and developed by adding a second biotinylated antibody and a streptavidinhorseradish peroxidase conjugate. the elisa is sensitive for an individual cytokine and utilizes a standard curve for quantification of the specific cytokine. preliminary studies using both elisas and western blotting were used to assay thp-1 macrophages exposed to subcytotoxic doses of hne and one for varying periods of time (5 min1 h) before washout and lps / ifn challenge. from this work, it was determined that subcytotoxic doses of electrophiles could efficiently inhibit cytokine production in as little as 30 min of pretreatment (data not shown). therefore, 30 min of pretreatment with electrophile was used for our cytokine inhibition experiments. after 30 min of pretreatment with 5 or 10 m hne or one followed by washout, there was a 2060% decrease in the levels of il-6 in the medium following 6 h of lps challenge (figure 4a). it is interesting to note that one afforded less cytokine inhibition than hne at both the 5 and 10 m concentrations, even though both compounds exhibit similar toxicity profiles. under similar conditions, hne inhibited lps - induced tnf by 30% at 5 m and 40% at 10 m (figure 4c). hne was also assayed for its ability to inhibit il-1 over a 24 h time course. hne repressed lps induction of il-1 expression by up to 80% 24 h after hne pretreatment and washing (figure 4b). these data suggest that hne works rapidly to modify a putative target(s), which mediates the inhibition of il-1 expression. these data indicate that hne has the strongest inhibitory effect on il-1 production, followed by il-6, and to a lesser extent tnf. inhibition of cytokine expression by hne and one. il-6 elisa of conditioned media from thp-1 macrophages pretreated with hne or one (30 min), washed, and challenged with lps / ifn for 6 h (a). il-1 (b) or tnf (c) elisa of media from thp-1 cells pretreated with hne for 30 min, washed, and challenged with lps for the times indicated (6 h lps challenge for tnf elisa). a doseresponse curve was generated for il-1 and il-6 expression using the 30 min electrophile treatment protocol to compare with the doseresponse curve resulting from continuous hne exposure (figure 3a and b). unlike continuous hne exposure, the il-1 levels in the acute hne treatment condition showed no decrease at low concentrations (0.010.5 m) of hne. however, at higher concentrations of hne there was comparable loss of cytokine expression between the continuous and transient treatment conditions. transient hne exposure produced a similar curve for the inhibition of il-6 synthesis as compared to continuous exposure whereby lower concentrations of hne (0.015 m) afforded minimal inhibition of expression, and higher concentrations (10 m or higher) produced a steep decline in levels of il-6. viability assays were performed using comparable conditions to 30 min of electrophile treatment to determine if cell death caused the cytokine inhibition. thp-1 macrophages were treated for 30 min with hne, washed, and their viability assayed after a 24 h incubation. no toxicity was observed at 510 m hne and less than 25% cell death was observed at concentrations of hne > 100 m. therefore, cell death during the 6 h of lps activation can not account for the dramatic decrease in cytokine expression that is observed with higher concentrations of hne (data not shown). elisa assays measure only secreted proteins ; therefore, it was necessary to recapitulate these results by using western blot to assay cytokines from cell lysates. thp-1 cells were treated with hne at concentrations of 010 m for 530 min time periods before being removed by washing twice with pbs. cells were then challenged with lps / ifn for 6 h to induce an inflammatory response. western blots were used to probe cell lysates for lipid electrophile - mediated changes in the pro - inflammatory cytokine, il-6. partial inhibition of il-6 induction by lps was observed at the 5 m dose of hne, and complete inhibition was observed at the 10 m dose for 30 min (figure 5). these results confirm that the changes in il-6 cytokine levels, seen in the elisa assays, are due to the inhibition of cytokine expression rather than the electrophile - mediated inhibition of cytokine secretion. il-6 western blot of cell lysate from thp-1 macrophages pretreated with hne, washed, and challenged with lps for 6 h. the lysate was probed with either anti - il-6 or antiactin antibodies. to examine whether the effect of hne on cytokine inhibition was transient, thp-1 macrophages were treated with 10 m hne or vehicle control for 30 min, and then, the electrophile was washed out. the cells were either immediately challenged with lps / ifn or incubated for 30 min or 3 h before challenge. after 6 h of lps treatment, the cell lysate was examined by western blot for levels of il-6. when cells were pretreated with hne, washed, and immediately challenged with lps for 6 h, there was a complete repression of il-6 expression. however, if lps challenge was delayed for 30 min there was a 50% reduction in il-6 repression, and after delaying lps challenge for 3 h, there was no observable repression of il-6 synthesis (figure 6). cells were pretreated with 10 m hne or the vehicle control for 30 min followed by washing with pbs. following washout of the electrophile, cells were challenged with lps / ifn- after an incubation time of 0, 0.5, or 3 h. the cell lysate was probed with either anti - il-6 or anti - actin antibodies. to test whether there was a correlation between electrophile reactivity and cytokine inhibition, several pairs of hne / one analogues were assayed for their ability to inhibit cytokine synthesis over a broad concentration range. the most divergent pair of analogues in terms of reactivity, hnea and onea, were assayed for their ability to inhibit il-1, il-6, and tnf. thp-1 macrophages were treated with hnea / onea for 30 min, the compounds were removed by washing, and then the cells were challenged for 6 h with lps / ifn. at low concentrations, 01 m hnea or onea, there was a decrease in il-1 levels to approximately 40% of the vehicle control (figure 7 a). however, at concentrations of 5 m and above the compounds diverge in terms of their ability to inhibit il-1 production. increasing concentrations of onea led to a complete loss of il-1 expression at a concentration of 50 m, whereas increasing concentrations of hnea showed no effect as il-1 returned to control levels. levels of il-6 remained relatively unaffected by both hnea and onea at concentrations of 01 m (figure 7b). at concentrations of onea greater than 5 m, there was a decline in il-6 expression with a complete loss of expression at 200 m. no change in il-6 expression was apparent with concentrations of hnea up to 200 m. at low concentrations of hnea (01 m), tnf expression was inhibited in a manner similar to that in il-1, with loss of expression to approximately 50% of the control (figure 7c). however, at higher concentrations of hnea (> 5 m) there was no apparent inhibition of tnf expression. onea afforded no inhibition of tnf at concentrations up to 50 m but produced a steep decline in expression at concentrations above 50 m. for these two compounds, there seems to be a correlation between electrophile reactivity and cytokine inhibition. at concentrations of 5 m and greater, the reactive onea had a greater inhibitory effect on pro - inflammatory cytokines as compared to hnea, which exhibited little cytokine inhibition and no reactivity. il-1 elisa (a), il-6 elisa (b), and tnf elisa (c) of conditioned media from thp-1 macrophages pretreated with hnea or onea (30 min), washed, and challenged with lps / ifn for 6 h. coome - one is approximately 100-fold more reactive than its analogue coome - hne. however, both compounds display reactivity and toxicity nearly identical to those of their respective parent compounds. therefore, these compounds were assayed for their ability to inhibit cytokine synthesis to determine if their inhibitory properties mimicked their respective parent compounds and to determine if there was a similar correlation between reactivity and cytokine inhibition as seen with the hnea and onea compounds. with the exception of tnf, the coome - hne and coome - one compounds gave similar cytokine inhibition profiles. there was minimal loss of cytokine expression (less than 20%) at concentrations of 010 m, and at higher concentrations, there was a steep decline in cytokine expression whereby cytokine expression was nearly zero at concentrations of electrophile greater than 25 m (figure 8a and b). in the case of tnf, coome - hne was more active than coome - one and afforded greater than 40% inhibition at concentrations of 0.5 m and higher, while coome - one required 10-fold higher concentrations to produce a similar effect (figure 8c). strictly on the basis of reactivity profiles, there does not appear to be any correlation between reactivity and cytokine inhibition as the coome - one is 100-fold more reactive than coome - hne, but both compounds exhibit similar cytokine inhibitory properties. additionally, both the coome derivatives are less effective at inhibiting cytokines as compared to their respective parent compounds under comparable conditions. at 10 m hne, cytokine inhibition for all three cytokines is 4060%, whereas at 10 m coome - hne, there is only 1020% cytokine inhibition. taken as a whole, these data suggest that there is no simple correlation between electrophile reactivity, toxicity, or anti - inflammatory activity. il-1 elisa (a), il-6 elisa (b), and tnf elisa (c) of conditioned media from thp-1 macrophages pretreated with coome - hne or coome - one (30 min), washed, and challenged with lps / ifn for 6 h. cytokine expression is only one method of assessing macrophage activation and the inflammatory response ; therefore, we also analyzed changes in the ability of thp-1 macrophages to phagocytose fluorescent beads following pretreatment with hne or one. phagocytosis is critical to the activation of the immune response because it leads to antigen presentation on the cell surface of the ingesting macrophage and subsequent activation of other macrophages and immune cells. macrophage activation was assayed by using fluorescence microscopy to visualize the phagocytosis of fluorescent beads by differentiated thp-1 macrophages following 30 min of lipid electrophile treatment and removal (figure 9 a). hne and one inhibited phagocytosis by 2040% after 3 h ; however by 6 h, inhibition of phagocytosis was observed only in those cells pretreated with hne (figure 9 b). importantly, the conditions of electrophile dosage and treatment duration used in these experiments are identical to those conditions found to inhibit cytokine production. fluorescent microscopy images (gfp filter) of thp-1 macrophage phagocytosis following 30 min of pretreatment with the dmso vehicle, 10 m hne, or 0.5 m one and washout with pbs. quantification of fluorescent bead uptake by thp-1 macrophages following pretreatment with electrophiles, washout, and exposure to fluorescent beads for 3 or 6 h (b). p - value < 0.05 ; p - value < 0.01 as compared to the 3 h and 6 h vehicle (dmso) control, respectively. lipid electrophiles, produced enzymatically or under conditions of oxidative stress, are significant mediators of intracellular signaling. the best characterized of these electrophile mediators is hne, which activates and inhibits complex networks of cell signaling and gene expression, induces the intrinsic and extrinsic pathways of apoptosis, and modulates the inflammatory response at the cellular level. hne has been shown to inhibit production of the pro - inflammatory cytokines, tnf, il-1, and il-6 in several monocytic / macrophage cell lines. here, we defined the toxicity profile, the relative reactivity, and the anti - inflammatory properties of a number of previously uncharacterized hne analogues resulting from phospholipid oxidation. additionally, we characterized the anti - inflammatory properties of another reactive electrophile, one, and its analogues. viability data for hne, one, and their analogues indicate that with the exception of the parent compounds, the one series of derivatives are more toxic than their respective hne analogues. hnea exhibited no toxicity under any conditions, which is consistent with previous studies in neuroblastoma cells where the compound did not produce cell death when used in concentrations exceeding 300 m.(18) in contrast, onea had toxicity comparable to that of the parent compound one. this loss of toxicity results from the replacement of the aldehyde with the more electron - rich carboxylate anion, which deactivates the c2=c3 double bond of hnea toward michael additions with thiol or amino groups.(36) onea is less affected by this substitution because it retains an,-unsaturated ketone which serves as a michael acceptor.(19) cooh - hne and cooh - one exhibit a similar divergence in toxicity as compared to the hnea / onea analogues. both compounds exhibit lower toxicity overall relative to the parent compounds, primarily due to the charge on the carboxylic acid moiety, which inhibits entry of the compounds into the cell. while it is unclear whether charge state completely explains the divergence in toxicity or if the difference in toxicity is due to cooh - one mediating its toxicity via a unique mechanism at the cell surface, there is strong evidence that charge state plays a critical role in compound toxicity as the methyl ester derivatives of one and hne have toxicity similar to that of each other and the parent compounds. the reactivity profiles for each electrophile with n - acetyl cysteine followed trends similar to those of the toxicity data and are consistent with those values reported in the literature. in general, the one compounds were both more reactive and toxic than their hne analogues. additionally, the coome - hne / one derivatives demonstrated comparable reactivity to those of the parent compounds, which is in agreement with the similarity in toxicity data between these analogues. hnea exhibited no measurable activity with nac, which is also consistent with its lack of toxicity and previous data showing that hnea does not form protein adducts.(18) the one main inconsistency between the toxicity data and the relative reactivity data is for the parent compounds, hne and one. one is greater than 100-fold more reactive than hne, and yet both compounds are identical in terms of ic50 values. previous work in neuroblastoma cells has shown one to be as much as 31 times more reactive with proteins than hne and has also demonstrated 45 times greater toxicity with one as compared to hne.(34) the higher reactivity but similar toxicity of one to hne in our system could be caused by a number of factors. it has been suggested that one is highly reactive such that its effective concentration could be reduced (i.e., by reacting with fbs in the media) before ever entering the cell. viability assays conducted in our laboratory using rko cells treated with hne and one in the presence or absence of serum demonstrate that this is not the case, as both hne and one treated cells exhibit a similar 5-fold decrease in their ic 50 values in the absence of serum, suggesting that serum reactivity does not account for differences in reactivity but similarities of toxicity. other possible explanations for these results are (1) one is removed more effectively by detoxifying mechanisms within the cell, such as spontaneous or catalyzed reactions with glutathione or via electrophile metabolizing enzymes. there is precedent in the literature for detoxifying enzymes such as aldehyde dehydrogenase that demonstrate selectivity in their ability to neutralize reactive electrophiles.(39) (2) in any lipid electrophile - mediated signaling event, the biological activity represents the rate - limiting step. for many signaling events, the reaction of hne and one with a given protein, while a 100-fold different in rate, is likely to occur more rapidly than the expression of transcription factors and changes in downstream gene expression. thus, the rate - limiting step in the cellular response is likely to be biological rather than chemical. (3) one and hne have greater than 100-fold difference in reactivity toward cysteine residues. however, this difference in the ratio of reactivity is less dramatic when considering reactivity with histidine and lysine residues. additionally, there is no correlation between rapid electrophileprotein residue reactivity and toxicity.(40) the toxicity is dependent more on what role the modified residue has in the proper folding and functioning of the protein.(40) all of the electrophiles assayed (with the exception of hnea) were able to inhibit the production of the pro - inflammatory cytokines il-1, il-6, and tnf to varying degrees. these data are consistent with literature reports that describe inhibition of the production of the same cytokines in lps - activated monocytes treated with hne or oxpls. there was also a general trend toward greater cytokine inhibition in cells treated with the more toxic / reactive electrophiles (i.e., hne, onea, and coome - one). with regards to individual cytokines, il-1 expression was most affected by treatment with lipid electrophiles, whereas tnf expression was least affected by electrophile treatment. inhibition of il-1 expression could be observed with lower concentrations of the electrophile, as in the cases of onea, hne, and coome - one where 2060% inhibition was observed following treatment with 1 m or less of the compound. taken as a whole, these data that characterize diffusible lipid electrophiles provide an interesting contrast to membrane bound oxidized phospholipids, which can promote pro - inflammatory signaling. oxidized pls with hne / one - like carbonyl groups at the sn-2 position can be generated in the plasma membrane and promote macrophage activation and inflammation. these oxpls undergo a conformational change that shifts hydrophobic portions of their fatty acyl chains from the interior lipid bilayer to the external aqueous environment. oxpl whiskers may permit an interaction with macrophage cd36 scavenger receptors leading to their activation and a pro - inflammatory response. at this time, it is unclear whether the pro- vs anti - inflammatory behavior of lipid peroxidation products is related to their location in the membrane or ability to diffuse throughout the cell. doseresponse curves were generated to assay cytokine expression in response to acute or chronic hne exposure. consistent with our other findings, il-1 expression shows the most sensitivity to electrophile treatment conditions (acute vs chronic). under conditions of continuous treatment with the electrophile, there appear to be two phases in the concentration dependence for inhibition of cytokine production, one at lower concentrations (0.011 m) and another at higher concentrations (greater than 5 m) that is not seen with transient treatment conditions or with il-6 under transient or continuous conditions. these data suggest the possibility of hne reversibly binding to a high - affinity target associated with il-1 inhibition. such binding / inhibition could be readily reversible and thereby be lost upon removal of electrophile during washing. at higher concentrations of hne, a second lower affinity and more slowly reversible target may be accessed which could play a greater role in inhibiting il-1 expression. the fact that hnea inhibits cytokine expression at low concentrations, especially for tnf expression, suggests that covalent modification of a protein target may not be essential to inhibit expression. for transient hne exposure, il-6 cytokine expression is impacted by the duration of incubation between electrophile washout and lps challenge. loss of il-6 repression by delaying lps challenge suggests that the hne - protein adduct(s) responsible for the inhibition of il-6 have a short half - life. whether this short half - life is due to active removal / degradation of the hne - protein adduct by cellular machinery or rapid reversibility of the hne - protein adduct is unclear. there are several unanswered questions that need to be explored relating to the mechanism(s) by which lipid electrophiles mediate the inhibition of pro - inflammatory cytokines and whether individual electrophiles mediate their effects by activating the same cellular signaling pathways. to address these issues, we and our collaborators are using a click chemistry based approach whereby thp-1 cells are treated with alkynylated electrophiles and reacted with an azido compound containing an affinity tag to enrich for protein targets of individual electrophiles. this method will allow us to generate an inventory of proteins that are modified by individual electrophiles. inventories from electrophiles with different biological properties may provide insights into the molecular targets responsible for their biological activities. | electrophile - mediated disruption of cell signal - ing is involved in the pathogenesis of several diseases including atherosclerosis and cancer. diffusible and membrane bound lipid electrophiles are known to modify dna and protein substrates and modulate cellular pathways including er stress, antioxidant response, dna damage, heat shock, and apoptosis. herein we report on a structureactivity relationship for several electrophilic analogues of 4-hydroxynonenal (hne) and 4-oxononenal (one) with regard to toxicity and anti - inflammatory activity. the analogues studied were the oxidation products of hne and one, hnea / onea, the in vivo hydrolysis products of oxidized phosphatidylcholine, cooh - hne / cooh - one, and their methyl esters, coome - hne / one. the reactivity of each compound toward n - acetylcysteine was determined and compared to the toxicity toward a human colorectal carcinoma cell line (rko) and a human monocytic leukemia cell line (thp-1). further analysis was performed in differentiated thp-1 macrophages to assess changes in macrophage activation and pro - inflammatory signaling in response to each lipid electrophile. hne / one analogues inhibited thp-1 macrophage production of the pro - inflammatory cytokines, il-6, il-1, and tnf, after lipopolysaccharide (lps)/ifn activation. inhibition of cytokine production was observed at submicromolar concentrations of several analogues with as little as 30 min of exposure. phagocytosis of fluorescent beads was also inhibited by lipid electrophile treatment. lipid electrophiles related to hne / one are both toxic and anti - inflammatory, but the anti - inflammatory effects in human macrophages are observed at nontoxic concentrations. neither toxicity nor anti - inflammatory activity are strongly correlated to the reactivity of the model nucleophile, n - acetylcysteine. |
respiratory complications are 3 times more common during endotracheal extubation than during tracheal intubation or induction of anaesthesia (4.6% vs. 12.6%). a smooth tracheal extubation without coughing, bucking or haemodynamic changes is one of the anaesthetic goals during any general anaesthetic procedure especially in neurosurgical, interventional neuro - radiological, otolaryngological, and ophthalmological patients or with patients having coronary artery disease. on extensive literature search, it has been observed that various authors have advocated the exchange of the endotracheal tube (ett) with laryngeal mask airway (lma) prior to the emergence from anaesthesia. this ett / laryngeal mask (lm) exchange procedure is easy and superior to use of an oropharyngeal airway. there is a natural hesitancy to perform ett / lm exchange and this maybe because the procedure involves jeopardizing a secure airway. secondly, the surgeries where exchange is often required, the patients may have some significant coexisting disease. majority of studies had used classic laryngeal mask airway (clma) (with the index finger introduction method) as exchange for ett immediately before extubation while inhalational anaesthesia was still continued. however, there is no study where ambu laryngeal mask (alm) was used in such situation, which is introduced using pencil technique. the present study evaluated the effect of exchange of ett with clma versus alm for haemodynamic changes, ease of placement, correct placement of clma and alm as per fibre - optic examination, coughing / bucking during removal of lma, incidence of post - operative sore throat and any other complication. after approval from hospital ethical committee, 100 american society of anaesthesiologist (asa) i and ii female patients between age range of 20 years and 50 years and weighing 40 - 60 kg, undergoing elective laparoscopic cholecystectomy, who gave informed consent for participating in the study were selected. these patients were randomly divided into two groups of 50 patients each on the basis of type of lma device used for exchange, using random computerized tables. the two groups were as follows : group i : clma was used for ett / lm exchange, clma was placed by the index finger method group ii : alm was used for ett / lm exchange (alm was placed unaided, pencil technique). pre - medication included injection midazolam 0.025 mg / kg iv, injection fentanyl 2 mcg / kg iv, injection ondansetron 0.1 mg / kg iv 15 min prior to induction of anaesthesia. anaesthesia was induced with injection propofol 2 mg / kg iv and neuromuscular blockade was achieved with vecuronium bromide 0.1 mg / kg iv. after achieving adequate relaxation, trachea was intubated and anaesthesia was maintained with a step - down technique of propofol infusion (10 mg / kg / h for 1 15 min, 8 mg / kg / h for the next 15 min, and thereafter 5 mg / kg / h iv via syringe pump, till the conclusion of surgery). in addition, all patients received 66% n2o in o2 and muscle relaxant top - up doses as per peripheral nerve stimulator. after the conclusion of surgery, n2o was discontinued, but propofol was continued to run at the rate of 5 mg / kg / h. in group i and ii, clma and alm (size 3, both) were placed respectively, but the cuff remained un - inflated. residual neuromuscular block was now reversed using a mixture of neostigmine (2.5 mg) and glycopyrrolate (0.4 mg). adequate reversal of neuromuscular block was confirmed by a train - of - four ratio > 0.9 and return of adequate tidal volume. the cuff of lm (clma or alm) was now inflated with 20 ml air and the breathing system connected to lm. an adequate and smooth spontaneous respiration was re - confirmed clinically and by capnography. if inadequate, lm was removed and reinserted. fibreoptic bronchoscopy was then performed via diaphragm of the swivel port to record the correct placement of clma /alm. propofol was now discontinued and the patient continued to breathe 100% o2 until full awakening. patient 's response to lm removal was recorded. during this period of exchange ett / lm exchange, patient 's heart rate (hr) and systolic blood pressure (sbp) were recorded just prior to lm placement, post - lm placement, pre - extubation, post - extubation and thereafter at 3 and 5 min and immediately after lm removal and after 3 and 5 min. placement was successful in the first attempt, grade ii, if more than one attempt was required to place it, grade iii, if we failed to place the clma /alm. attempt was considered unsuccessful if it took greater than 20 s or if the lm was removed from the patient 's mouth. if complete glottis was visualised through fiberscope, it was graded as grade i, partial glottis with or without seeing epiglottis was grade ii, and if only epiglottis was visualised, it was labelled as grade iii. any episode of coughing / bucking during lm placement, ett and lm coughing was graded as grade i if there was no coughing / bucking, grade ii, if there was mild coughing / bucking (5 cough). sore throat was noted by an independent blind observer post - operatively after 1 h. absence of sore throat was recorded as grade i. sore throat, which was less severe than common cold / mild sore throat was grade ii, and which was similar to that noted with common cold / moderate sore throat was grade iii. sore throat, which was more severe than common cold / severe sore throat was graded as grade iv. we conducted a pilot study with seven patients in each group and presuming the difference in the haemodynamic parameters and effect size obtained to be true, calculated that 41 patients in each group would be required for the study with power of 0.8 and significance of 0.05. data within the groups have been analysed using paired t - test while those between the groups were analysed using unpaired t - test. it was used to analyse grades of ease of lm placement, verification of glottic view by fiberscope, coughing during removal of lm and post - operative sore throat. we conducted a pilot study with seven patients in each group and presuming the difference in the haemodynamic parameters and effect size obtained to be true, calculated that 41 patients in each group would be required for the study with power of 0.8 and significance of 0.05. data within the groups have been analysed using paired t - test while those between the groups were analysed using unpaired t - test. it was used to analyse grades of ease of lm placement, verification of glottic view by fiberscope, coughing during removal of lm and post - operative sore throat. the sbp and hr in both groups in pre - lm placement time was nearly identical (p>0.05). as lm was placed, sbp and hr increased in both the groups [tables 1 and 2 ], but reached the level of statistical significant only in group i as compared to pre - lm placement values (p0.05) rise as the tracheal tube was being removed [tables 1 and 2 ]. changes in sbp during peri - extubation period changes in hr during peri - extubation period before ett removal, lm could be placed in first attempt (grade i) in 72% of group i patients as compared to 84% of group ii patient. there was no significant difference of proportion during placement of the lm (z1.96) in group ii (96%) as compared to group i (76%) [table 4 ]. incidence of different grades of glottic view by fiberscope none of the patients of both the study groups had coughing or bucking during placement of lm as well as during removal of ett. the incidence of smooth removal of lm, i.e., with no coughing and bucking (grade 1) was 84% in group ii patients as compared to 72% in group i, which is statistically insignificant (z0.05) rise as the tracheal tube was removed. thereafter, the fall in both parameters continued towards control value. to the best of our knowledge, there has been no reported study on haemodynamic changes during ett / lma exchange manoeuvre, so far. we have shown that between clma and alm, though both provide good haemodynamic control during ett / lma exchange, still latter has significantly better haemodynamic control during lma insertion. minimal changes in sbp and hr following removal of clma or alm in this study is in accordance to previous findings that removal of an lma is associated with significantly reduced cardiovascular responses. and ng., also reported insignificant difference in first attempt insertion between these two devices. lpez., studied 200 patients and compared four different lma regarding ease of insertion and placement. they concluded that alm and lma unique were easier to insert by inexperienced residents and were less traumatic for patients. however shariffuddin and wang, found that first insertion attempt was significantly better with the alm compared than with clma. alm 's design unlike clma does not have epiglottic bars, which allow easier access for flexible fibreoptic examination. a significantly superior glottic view (grade i) with alm (96%) as compared to clma (76%) may be attributed to its in - built curved shape that allowed its bowl to take a better periglottic position after tracheal extubation. though alm had significantly superior glottic view as compared with clma, the patients had adequate spontaneous respiration on lm and none required reinsertion of lm. it has been seen that even when the epiglottis blocks fibreoptic visualization of the glottis (as seen from the airway tube), a satisfactory clinical airway is usually established. none of the patients in both the study groups had coughing or bucking during placement of lmas. this might be due to use of propofol for maintenance of anaesthesia in our study, which has known ability to suppress the cough reflex during upper airway manipulation. in contrast, takita., recorded 33.3% incidence of coughing / bucking during placement of clma, using variable concentration of sevoflurane for maintenance of anaesthesia. it was observed that 28% patients of group i and 16% patients of group ii had mild coughing and bucking during removal of clma. none of the patients in both the groups presented with airway obstruction or laryngospasm. koga., reported that out of 20 patients, one patient had difficulty in ventilation via lm after extubation and three patients coughed during emergence from anaesthesia. dob., reported one case of coughing out of 26 patients in lma group during emergence. costa e silva and brimacombe, reported that no patient out of 10 coughed during emergence or removal of lma. the findings of this study are in agreement with the above observations that an occasional patient may cough during removal of lm. however, the present study noted that removal of clma was more prone to coughing as compared to alm. this could possibly be secondary to a more anatomical design and a softer cuff material of alm compared to clma. incidence of post - operative sore throat was similar in both groups. ett is known to cause more post - operative sore throat than lm. in our series, both ett and lm were used in all patients yet the incidence of post - operative sore throat was less than what has been reported for ett alone. this might be attributed to the fact that extubation of ett was performed over lm and thus avoided straining on the tube, which is most often cause of post - operative sore throat. ng., reported lower incidence of sore throat with alm as compared to clma. post - operative sore throat is also dependent upon the number of attempts taken to place lm, duration of insertion and cuff pressure. in our study, there was no significant difference in number of attempts for lm placement between both groups, but we did nt measure duration of insertion and cuff pressure in our study. pharmacological agents though are effective in controlling haemodynamic changes are costly and are unable to suppress the cough reflex during extubation. on the other hand, clma which is reusable after autoclaving is an economical solution to the problem. however, there is risk of infection with prion disease in reusable devices, which has promoted the use of alm. there were certain limitations in our study. the effect was seen in asa i / ii patients, but the usefulness will be of immense help in high - risk cardiac patients, whom we could not study due to the absence of advanced cardiac set - up at our institute. effect of ett / lm exchange can be further studied in asa iii / iv cardiac or neurosurgical patients, where good haemodynamic control is required. we did not measure duration of insertion and cuff pressure in our study, which may have a bearing on post - operative sore throat. placement of alm prior to tracheal extubation is associated with reduced haemodynamic changes and better glottic view through fibrescope. | background and aim : exchanging endotracheal tube (ett) with classic laryngeal mask airway (clma) prior to emergence from anaesthesia is a safe technique to prevent the coughing and haemodynamic changes during extubation. we had compared clma and ambu laryngeal mask (alm) during ett / laryngeal mask (lm) for haemodynamic changes and other parameters.methods:a total of 100 american society of anesthesiologist grade i and ii adult female patients undergoing elective laparoscopic cholecystectomy under general anaesthesia were selected and randomly divided into two groups of 50 patients each. in group i, clma and in group ii, alm was placed prior to tracheal extubation. haemodynamic parameters were recorded during ett / lm exchange. glottic view was seen through the lm using flexible fibrescope. coughing / bucking during removal of lm, ease of placement and post - operative sore throat for both groups were graded and recorded.statistical analysis : data within the groups was analysed using paired t - test while between the groups was analysed using unpaired t - test. chi - square test was used to analyse grades of glottic view, coughing, and post - operative sore throat.results:in group i, there was a significant rise in systolic blood pressure and heart rate in contrast to insignificant rise in group ii. glottis view was significantly better in group ii. incidence of coughing, ease of placement and post - operative sore throat was identical between both groups.conclusion : alm is superior to clma for exchange of ett before extubation due to greater haemodynamic stability during exchange phase and is better positioned. |
alzheimer disease (ad), a progressive neurodegenerative disorder, is the most common cause of dementia among the elderly. prevalence increases with age from 1% in the 6064-year age group, to 24 - 33% in those aged > 85 years.1 the neuropathological hallmarks of ad are the presence in the brain of extracellular senile plaques and intracellular neurofibrillary tangles, along with neuronal loss. senile plaques mainly consist of fibrils of 39 - 42(43) amino acid -amyloid (a) peptide that are surrounded by dystrophic neurites and reactive glial cells. the a peptide itself is derived from the processing of a larger precursor protein known as the amyloid precursor protein (app).2 the dysfunction of app metabolism and the consequent accumulation of a peptides and their aggregation in the form of senile plaques in the brain parenchyma of individuals with ad, have been considered crucial for neurodegeneration in the disease. this is the so - called amyloid cascade hypothesis.3,4 however, more recently, soluble oligomers of a peptide have been correlated with synaptic loss in the brain of ad subjects.5 - 7 neurofibrillary tangles contain hyperphosphorylated and aggregated forms of tau, a microtubule - associated protein that normally promotes the assembly and stability of microtubules in neuronal cells.2 abnormally hyperphosphorylated tau in ad brain accumulates in neurons into paired helical filaments, which in turn aggregate into neurofibrillary tangles leading to neuronal death.8 therefore, the neuropathological hallmarks of ad induce progressive neuronal dysfunction and degeneration, resulting in severe brain atrophy and decline of memory and other cognitive functions.2 although not a criterion for diagnosis of ad, the deposition of a in the cerebral vasculature, named cerebral amyloid angiopathy (caa), can be detected in 90% of patients with ad.9 however, caa can occur in the absence of ad pathology and vice versa.10 most cases of ad occur sporadically in people over 65 years old, and are not genetically inherited. roughly 5% of patients with ad have familial alzheimer disease (fad), an uncommon form that tends to strike sooner, and is related to a genetic predisposition, including mutations in the app gene on chromosome 21, presenilin 1 (ps1) gene on chromosome 14, and presenilin 2 (ps2) gene on chromosome 1.1 the etiology of ad is unclear and at present there is no effective treatment. given the prevalence and poor prognosis of the disease, the development of animal models has been a research priority to understand pathogenic mechanisms and to test therapeutic strategies. the discovery of genes for familial forms of ad has allowed transgenic models to be created that reproduce many critical aspects of the disease. initially, before the discovery of fad mutations, attempts were made to overexpress wild - type app in transgenic mice by pronuclear injection. however, none of these efforts produced anything that resembled an a plaque or any other recognizable ad - type pathology. after the discovery of fad mutations in app, a number of groups turned their attention to making ad models based on the overexpression of transgenes containing fad mutations using a variety of promoters.11 this review describes the main transgenic mouse models of ad which have been adopted in ad research, and discusses the insights into ad pathogenesis from studies in transgenic models. mutations in app linked to fad include dutch (e693q),10 london (v717i),12 indiana (v717f),13 swedish (k670n / m671l),14 florida (i716v),15 iowa (d694n),16 and arctic (e693g)17 mutations. to date, more than 160 mutations in ps1 linked to fad have been discovered (see http://www.molgen.ua.ac.be/admutations). mutations in a related gene, now called ps2, were soon linked to fad as well.18 most of fad mutations cause aberrant app processing toward the longer, more amyloidogenic a1 - 42 species.19 the a is located partially within the ectodomain (n - terminal portion) and partly within the transmembrane domain (c - terminal portion) of app. at least three enzymes are responsible for the processing of app and have been called -, - and -secretases. the processing pathway by -secretase, called non - amyloidogenic, cleaves app within the a domain in the c - terminal portion of the sequence of this peptide, producing soluble app, which has neurotrophic and neuroprotective effects. the processing pathway by - and -secretases, called amyloidogenic, cleaves app in the n- and c - terminal portions of the a region, respectively, producing a peptide. -secretase cleaves app at various adjacent sites to form species of a containing 39 to 43 amino acids.20 presenilins contribute to the catalytic activity of the -secretase complex.1 processing of app by -, - and -secretases is illustrated in figure 1. the swedish mutation, which is located just outside the n - terminus of the a domain of app, favors -secretase cleavage in vitro21 and is associated with an increased level and deposition of a1 - 42 in ad brain.22 the dutch and iowa mutations, which are located in the a domain of app, accelerate a1 - 40 fibril formation in vitro.23,24 the dutch mutation is associated with cerebrovascular a deposition that is, caa, resulting in cerebral hemorrhages and dementia in patients with ad,10 whereas the iowa mutation is associated with severe caa, widespread neurofibrillary tangles, and unusually extensive distribution of a1 - 40 in plaques in ad brain.16 the arctic mutation, which is also located inside the a domain, makes app less available to -secretase cleavage and increases -secretase processing of app thus favoring intracellular a production in vitro.25,26 the arctic mutation is associated with severe caa in the absence of hemorrhage, abundant parenchymal a deposits, and neurofibrillary tangles in ad brain.27 the london mutation, which is located in the transmembrane domain of app, as well as the ps1 and ps2 mutations alter -secretase cleavage and increase the a1 - 42 level and/or the a1 - 42/a1 - 40 ratio in vitro.28 - 30 the london mutation is associated with extensive parenchymal a deposition and abundant senile plaques and neurofibrillary tangles, as well as moderate caa in ad brain.31,32 the indiana mutation, which is also located in the transmembrane domain of app, is associated with large number of neurofibrillary tangles and senile plaques, as well as mild caa in ad brain.33 the florida mutation, which is also located in the transmembrane domain of app, affects -secretase cleavage causing an increased a1 - 42 concentration and a1 - 42/a1 - 40 ratio in vitro.15,30 games reported the first transgenic ad model, termed pdapp mice, which overexpress a human app transgene containing the indiana mutation (v717f) under the control of the platelet - derived growth factor- promoter. a1 - 42 constituted 27% of the a present in the brain of young pdapp mice, and this percentage increased to 89% in 12-month - old animals. the mice developed senile plaques that were primarily composed of a1 - 42.35 pdapp mice showed age - related a deposition in cortical and limbic regions that began at 8 months and progressed to cover 20 - 50% of the neuropil in the cingulate cortex, entorhinal cortex, and hippocampus of 18-month - old animals. a deposition was associated with dystrophic neurites and extensive gliosis (reactive astrocytes and activated microglia), however, there was no overt neuronal loss in the entorhinal cortex, hippocampal ca1 field, or cingulate cortex through 18 months of age in pdapp mice.36 dystrophic neurites immunoreactive for hyperphosphorylated tau were observed near a plaques after 14 months of age, although no paired helical filaments and neurofibrillary tangles were identified.37 pdapp mice showed significant and age - dependent synaptic loss, and a rather marked hippocampal atrophy was observed as early as 3 months of age in these mice.38 young pdapp mice showed deficits in spatial learning and memory, which worsened with increasing age and a burden.39 similarly, hsiao.40 overexpressed in mice a human app transgene containing the swedish mutation (k670n / m671l) driven by a hamster prion protein promoter. these mice, termed tg2576 mice, have been the most widely studied ad transgenic model. tg2576 mice exhibited age - dependent increase of a1 - 40 and a1 - 42 levels and a deposition, resulting in senile plaques similar to those found in ad. a plaques were first clearly seen by 11 - 13 months, eventually becoming widespread in cortical and limbic structures.40 a deposits were associated with prominent gliosis and neuritic dystrophy, without overt neuronal loss in the hippocampal ca1 field or apparent synapse loss in the hippocampal dentate gyrus.41 tg2576 mice exhibited deficits in synaptic plasticity in the hippocampal ca1 field and dentate gyrus, decreased dendritic spine density in the dentate gyrus, and impaired spatial memory and contextual fear conditioning months before significant a deposition, which was detectable at 18 months of age.42,43 a decrease in spine density was detected as early as 4 months of age, and synaptic dysfunction and memory impairment were observed by 5 months. moreover, an increase in the ratio of soluble a1 - 42/a1 - 40 was first observed at these early ages that is, at 4 - 5 months of age.43 tg2576 mice also showed increased intraneuronal a1 - 42 accumulation with aging, and this accumulation was associated with abnormal synaptic morphology before a plaque pathology.44 subsequently, many other transgenic lines were developed with approaches similar to those used to develop pdapp and tg2576 mice, typically relying on strong promoters to drive overexpression of app transgenes containing single or multiple fad mutations. for example, tgcrnd8 mice, which express multiple human app mutations that is, swedish and indiana mutations driven by the prion protein promoter, exhibited an aggressive neuropathology with onset of parenchymal a deposition and cognitive deficits as early as 3 months of age, and with dense a plaques and neuritic dystrophy evident from 5 months of age. tgcrnd8 mice exhibited an excess of brain a1 - 42 over a1 - 40, and the high - level production of a1 - 42 was associated with spatial learning impairment at 6 months of age. neurofibrillary tangles and neurodegeneration were absent.45 the formation of plaques was concurrent with the appearance of activated microglia and shortly followed by the clustering of activated astrocytes around plaques at 3.5 months of age in tgcrnd8 mice.46 doubly transgenic mice which express human app with the swedish mutation driven by the platelet - derived growth factor- promoter combined with a ps1 mutation (m146l) under the control of the prion protein promoter, termed app / ps1 mice, developed large numbers of fibrillar a deposits in the cerebral cortex and hippocampus that resembled compact a plaques. these mice showed a selective increase in a1 - 42 in their brains and reduced performance in a spatial memory task before substantial a deposition was apparent.47 the fibrillar a deposits were associated with dystrophic neurites and activated astrocytes and microglia in app / ps1 mice.48 app23 mice, which express human app with only the swedish mutation driven by a thy1 promoter, showed neuronal overexpression of app. at 6 months of age, app23 mice showed first rare a deposits, which increased with age in size and number and occupied a substantial area of the neocortex and hippocampus in 24-month - old mice. the a plaques were surrounded by gliosis (activated microglia and astrocytes) and dystrophic neurites that were immunoreactive for hyperphosphorylated tau despite the lack of neurofibrillary tangles.49 determination of plaque - associated a1 - 42 peptides in brain revealed a fivefold increase in app23 mice at 6 months. in addition, app23 mice showed an age - dependent decline of spatial memory from the age of 3 months, and locomotor activity and exploratory behavior deficits at 6 months. spatial memory deficits preceded plaque formation and the increase in plaque - associated a1 - 42 peptides, but correlated negatively with brain soluble a concentration in 3-month - old app23 mutants.50 app23 mice have often been used to study caa pathogenesis. significant deposition of a in the cerebral vasculature that is, caa was described in aging app23 mice. caa in these mice was associated with local neuronal loss, synaptic loss, microglial activation, and microhemorrhage.51,52 transgenic mice expressing human app with the dutch (e693q) and iowa (d694n) mutations combined with the swedish mutation under the control of the thy1.2 promoter, termed tg - swdi mice, developed largely diffuse, a plaque - like deposits in the brain parenchyma starting at 3 months of age with high association with a accumulation in the cerebral microvasculature. a1 - 40 peptides are largely the predominant species that accumulates in these mice.53 tg - swdi mice were impaired in the performance of a spatial learning and memory task at 3, 9, and 12 months of age.54 appdutch mice, expressing human app with only the dutch mutation regulated by the thy1 promoter, showed neuronal overexpression of app and increased ratio of a1 - 40/a1 - 42 in the brain that resulted in extensive vascular a deposition with essentially no parenchymal deposition.55 these researchers also developed a transgenic line that expresses human app - dutch mutation crossed with mutant ps1 (g384a), termed appdutch / ps1 mice. these mice, with about half the a1 - 40/a1 - 42 ratio of appdutch mice brain, developed parenchymal a plaques with little vascular deposition. by contrast, young transgenic mice harboring human app with the arctic mutation (e693 g) combined with app - swedish and app - indiana mutations directed by the platelet - derived growth factor- promoter, termed happ - arc mice, developed prominent parenchymal a plaque deposits with little caa despite a reduced proportion of a1 - 42/a1 - 40.56 tg - arcswe mice with both app - swedish and app - arctic mutations driven by the thy1 promoter were developed by two independent groups.57,58 tg - arcswe mice exhibited an age - dependent increase in intraneuronal a accumulation and deficits in spatial memory and contextual fear conditioning, starting at the age of 6 months, before the onset of a plaque formation as well as caa.57 - 59 the cognitive impairments correlated inversely with soluble a levels in tg - arcswe mice.59 recently, a mouse model expressing human app with only the arctic mutation under the control of the thy1 promoter, termed apparc mice, was reported by rnnbck.60 apparc mice showed an age - dependent progression of parenchymal and vascular a deposition, starting in the subiculum and spreading to the thalamus, and deficits in hippocampus - dependent spatial learning and memory test. in contrast to transgenic models with both the swedish and arctic mutations,57,58 apparc mice did not show any punctate intraneuronal a immunoreactivity.60 app transgenic mouse models have been troubled by the difficulty of inducing the characteristic cytoskeletal pathology of ad. for example, in pdapp mice, phosphorylated tau sites do accumulate within dystrophic neurites in animals of 14 months of age or older, but there are no paired helical filaments and no neurofibrillary tangle - like lesions.37 other models have been similar in their lack of any neurofibrillary tangle - like pathology, such as tgcrnd845 and app23 mice.49 transgenic mice that exhibit neurofibrillary tangle - like lesions and a plaques have been produced by combining fad mutations with mutant forms of tau found in a distinct form of dementia known as frontotemporal dementia and parkinsonism linked to chromosome 17 (ftdp-17).61 lewis.62 first crossed tg2576 mice with a transgenic line known as jnpl3, which expresses p301l mutant tau associated with ftdp-17, generating a bigenic transgenic model referred to as tapp mice. singly transgenic jnpl3 mice were known to develop neurofibrillary tangle - like lesions, and tapp mice exhibited both neurofibrillary tangles and a plaques. tapp mice aged 8 months and older displayed more neurofibrillary pathology in limbic regions, most notably the amygdala, than age - matched jnpl3 mice. later, oddo.63 generated a triple transgenic model of ad, termed 3xtg - ad mice, which expressed human app - swedish (k670n / m671l) and ftdp-17 tau (p301l) mutations from exogenous transgenes regulated by the thy1 promoter combined with a ps1 mutation (m146v) from the endogenous mouse gene. there was a progressive increase in a formation as a function of age in the 3xtg - ad brain and a particularly pronounced effect on a1 - 42 levels. in 3xtg - ad mice, intraneuronal a accumulation was apparent between 3 and 4 months of age in the neocortex, and at 6 months of age in the hippocampal ca1 field and amygdala. extracellular a deposits first became apparent in 6-month - old mice in the frontal cortex and were readily evident by 12 months in other cortical regions and in the hippocampus. a plaques preceded tau pathology, which was not evident until about 1 year of age.63,64 tau was conformationally altered and hyperphosphorylated at multiple residues in the brain of 3xtg - ad mice in an age - related manner. tau - reactive dystrophic neurites were also evident in older 3xtg - ad brain. functionally, 3xtg - ad mice developed age - dependent synaptic plasticity deficits, but before a plaque and neurofibrillary tangle pathologies ; synaptic dysfunction correlated with the accumulation of intraneuronal a1 - 42.63 in addition, these mice manifested earliest retention impairment in spatial memory at 4 months of age that correlated with the accumulation of intraneuronal a1 - 42. at 6 months of age, 3xtg - ad mice showed retention deficits in spatial memory and contextual fear conditioning tasks.64 another problem with the ad transgenic mouse models has been the general difficulty of producing neuronal loss. for example, neither pdapp nor tg2576 mice, despite having extensive a deposition, exhibit significant neuronal loss.36,41 app23 mice show only modest losses of pyramidal cells in hippocampal ca1 field (about 15%), losses that are far less than those observed in ad. no quantitative evidence of neuronal loss was observed in the neocortex as a whole.65 more substantial neuronal loss has been reported in mice expressing multiple app and ps1 mutations.66 - 68 one model showing massive neuronal loss is appsl / ps1 mice, which express human app with the swedish and london (v717i) mutations driven by the thy1 promoter and human ps1 with the m146l mutation under the control of the hmg - coa - reductase promoter. in appsl / ps1 mice, intraneuronal a1 - 40 and a1 - 42 stainings preceded a plaque deposition, which started at 3 months of age. a was observed in the somatodendritic and axonal compartments of neurons in the subiculum, hippocampal ca1 field, as well as in cortical areas.66 the a1 - 42/a1 - 40 ratio was increased in appsl / ps1 mice.69 a substantial loss (about 30%) of pyramidal neurons in the hippocampal ca1 - 3 fields was detected in 17-month - old appsl / ps1 mice. the loss of neurons was observed at sites of a aggregation and surrounding astrocytes but, most importantly, was also clearly observed in areas of the parenchyma distant from a plaques.70 furthermore, appsl / ps1 mice displayed severe age - related synaptic loss within hippocampal dentate gyrus and ca1 - 3 fields at 17 months of age, even in regions free of extracellular a deposits.69 another model showing marked neuronal loss expresses human app - swedish and app - london mutations driven by the thy1 promoter together with two ps1 knock - in (ki) mutations (m233t / l235p) in the murine ps1 gene, and is referred to as app / ps1ki mice. the app / ps1ki model is so far the model with the most aggressive pathology. these animals showed early extracellular a deposition at the age of 2.5 months, which was preceded by strong intraneuronal a accumulation in the hippocampal ca1/2 fields. at 6 months of age, widespread and numerous a deposits were found within the hippocampal, cortical, and thalamic areas. a1 - 42 was the predominant (85%) a isovariant produced in app / ps1ki mice, and a1 - 42 oligomers were highly abundant in the app / ps1ki brain.67 further pathological features starting at the age of 6 months included severe axonal degeneration, as well as reduced ability to perform working memory and motor tasks.71,72 at this time point also synaptic dysfunction and loss became evident in app / ps1ki brain. in addition, at 6 months of age, a loss of 33% of hippocampal ca1 pyramidal neurons was demonstrated, together with a decreased volume of the ca1 pyramidal cell layer of 30%, and an atrophy of the entire hippocampus of 18%.73 analysis of the frontal cortex revealed an early loss of cortical neurons starting at the age of 6 months which correlated with the transient intraneuronal a accumulation in contrast to extracellular a plaque pathology.74 at 10 months of age, an extensive neuronal loss (> 50%) was present in the pyramidal cell layer of hippocampal ca1/2 fields that correlated with strong accumulation of intraneuronal a but not with extracellular a deposits in app / ps1ki mice. a very significant astrogliosis developed in the area of strong intraneuronal a accumulation and neuronal loss.67 finally, 5xfad mice expressing human app with the swedish, florida (i716v) and london mutations together with mutant ps1 (m146l / l286v) regulated by the thy1 promoter were generated, and robust neuronal loss was observed. 5xfad mice exhibited dramatically higher levels of a1 - 42 than those of a1 - 40, and rapidly accumulated massive amounts of cerebral a1 - 42 at young ages. a deposition began at 2 months of age in deep cortical layers and in the subiculum. as mice aged, a deposits spread to fill much of the cerebral cortex, subiculum, and hippocampus. a plaques were also observed in the thalamus, brainstem, and olfactory bulb in older mice, but deposits were less numerous in these brain regions. astrogliosis and microgliosis were proportional to a1 - 42 levels and a deposition in 5xfad brain and began at approximately the time when plaques initially appeared. intraneuronal a1 - 42 accumulated in 5xfad brain starting at 1.5 months of age, just before the first appearance of a deposits at 2 months. synaptic loss started already at 4 months of age and was significant from 9 months in 5xfad brain, and large pyramidal neurons in cortical layer 5 and subiculum were visibly reduced in number at 9 months of age.68 5xfad mice developed deficits in spatial memory tasks and also exhibited impairments in trace and contextual fear conditioning tests at 4 - 6 months of age.68,75 data on the characteristics of the main transgenic mouse models of ad are summarized in table 1. although none of the ad transgenic models fully replicates the human disease, they have suggested new insights into the pathophysiology of a toxicity, particularly with respect to the effects of different a species and the possible pathogenic role of a oligomers.11 in the 1980s it was debated whether a deposits, and in particular caa at the cerebral vessel walls, had a central nervous system or a peripheral source.11 studies in app23 mice, which developed a similar degree of both a plaques and caa, provided the first evidence that a neuronal source of app / a is sufficient to induce cerebrovascular a and associated neurodegeneration.51 accordingly, studies in transgenic mice with almost exclusive neuronal central nervous system expression of app, like appdutch mice, which develop almost only caa, strongly suggest that neuronal a produced in the brain generates cerebrovascular a neuropathology. in addition, although a1 - 42 may be needed as a seed for a deposition in either compartment (parenchyma and vasculature), studies in appdutch and appdutch / ps1 mice suggest that a1 - 40 promotes vascular deposition, whereas a1 - 42 shifts deposition toward parenchymal a.55 moreover, studies in happ - arc mice, with app - arctic mutation (e693 g) combined with app - swedish and app - indiana mutations, suggest that some property of the app e693 g mutation, besides its effect on the a1 - 40/a1 - 42 ratio, may also influence parenchymal deposition versus vascular deposition.56 therefore, the existing ad transgenic mouse models have shown considerable utility in deciphering the pathobiology of caa. analyses of the brain of app transgenic mouse models in which large amounts of a have accumulated in plaques but no neurodegeneration has developed, such as pdapp,35,36 tg2576,40,41 tgcrnd8,45 and app2365 mice, provide no or very sparse support for the well - established amyloid cascade hypothesis. this hypothesis supports the idea that increased a production and extracellular accumulation in plaques leads to neurotoxicity, resulting in widespread neuronal loss and dementia.76 some reasons for this have been discussed. perhaps the neurotoxicity is sparse in app mouse models because murine neurons might be devoid of the downstream pathways necessary for a to induce toxicity, such as the processes leading to tau aggregation and neurofibrillary tangle formation in ad brain.11 interestingly, subsequent to the original amyloid hypothesis, it became clear that a plaque counts correlate relatively poorly with the level of cognitive decline in ad and that the number of neurofibrillary tangles correlates more strongly with the degree of dementia.77 perhaps only certain species of a (a1 - 40, a1 - 42, or truncated a) are neurotoxic, and by using mutations linked to familial ad we poorly replicate the processes of a production and aggregation in sporadic ad brain.11 curiously, truncated a peptides were demonstrated in ad brain more than 10 years ago,78,79 but the observations were partially ignored. today it is well established that only a fraction of a in postmortem ad brain is full - length a1 - 40 or a1 - 42 ; n - terminally truncated variants of a (a3 - 42 and a11 - 42) are prevalent in senile plaques of ad brain.80,81 unlike the classical amyloid cascade hypothesis, it was subsequently shown that soluble oligomers of a1 - 42 and not plaque - associated a correlate best with cognitive dysfunction in ad.6,82 there is now a great interest in identifying which a species (a1 - 40, a1 - 42, or truncated a) and form (oligomers or deposits) would be responsible for neurotoxicity, and in understanding the relationship between a and tau pathologies.11 app transgenic mice have provided strong evidence for the toxicity of soluble a oligomers in vivo by showing that many pathological and functional changes in mice occur before the appearance of a plaque pathology. for example, studies in pdapp mice demonstrated that loss of volume in the hippocampus, predominantly localized to the dentate gyrus, was present in 100-day - old mice well before a deposition in plaques.83 in addition, loss in total dendritic length was evident in the dentate gyrus of 90-day - old pdapp mice well before a accumulation occurs.84 tg2576 mice exhibited increased ratio of soluble a1 - 42/a1 - 40, deficits in synaptic plasticity in the hippocampal ca1 field and dentate gyrus, loss of dendritic spines in the dentate gyrus, and impaired spatial and contextual memory months before significant a deposition.42,43 in app23 mice, spatial memory deficits preceded plaque formation and the increase in plaque - associated a1 - 42 peptides, but correlated negatively with soluble a concentration.50 tg - arcswe mice exhibited robust deficits in spatial memory and contextual fear conditioning before the onset of a deposition,57 - 59 and the cognitive impairments correlated inversely with soluble a levels.59 3xtg - ad mice developed age - dependent synaptic plasticity deficits and spatial memory impairment before a plaque and neurofibrillary tangle pathologies but instead in correlation with soluble a1 - 42.63,64 finally, app / ps1 mice, which exhibit large numbers of compact a plaques in the cerebral cortex and hippocampus, showed a selective increase in a1 - 42 in their brains and reduced performance in a spatial memory task in the period preceding overt a deposition.47 these studies are consistent with the more critical role of a1 - 42 in the pathogenesis of ad and suggest a neurotoxic effect of soluble forms of a. since the discovery that truncated a3 - 42 represents a major species in senile plaques of ad brain,80,81 this peptide has received considerable attention. in comparison with a1 - 42, a3 - 42 has stronger aggregation propensity and increased toxicity in vitro.85 - 87 recently, a new transgenic mouse model (tba2) was generated,88 which expressed only truncated a3 - 42 in neurons without any of the other a peptides, and it was demonstrated for the first time that this peptide is neurotoxic in vivo, inducing neuronal loss and concomitant neurological deficits characterized by loss of motor coordination and ataxia. in the past, a has been regarded as acting extracellularly, whereas recent evidence points to toxic effects of a in intracellular compartments. first reports showing that a is initially deposited in neurons before occurring in the extracellular space date back roughly 20 years.89,90 more recently, it has been shown that neurons in ad - vulnerable regions accumulate a1 - 42 and it has been further suggested that this accumulation precedes extracellular a deposition and neurofibrillary tangle formation.91 consecutively, a variety of reports has been published demonstrating a in neurons of ad brain.92 - 95 curiously, soluble a oligomers, which have been suggested as the most toxic species, are formed, preferentially, intracellularly within neuronal processes and synapses rather than extracellularly.96,97 in all transgenic mouse models in which marked neuronal loss has been so far reported, this was preceded by considerable amounts of intraneuronal a peptides.98 for example, in app / ps1ki mice, which developed severe learning deficits correlating with ca1 field neuronal loss and hippocampal atrophy, increased intraneuronal a1 - 42 and not plaque - associated a coincided well with neuronal loss ; the intraneuronal n - truncated a3 - 42 species was also increased, however, the dominant species was a1 - 42 in the app / ps1ki model.67,73 in agreement with this study, investigations in tba2 mice showed for the first time that intraneuronal a3 - 42 accumulation is sufficient for triggering neuronal death and inducing an associated neurological phenotype. although the tba2 model lacks important ad - typical neuropathological features like tangles and hippocampal degeneration, it clearly demonstrated that intraneuronal a3 - 42 is neurotoxic in vivo.88 intraneuronal a1 - 42 accumulation has also been reported in several transgenic mouse models with no overt neuronal loss, including tg2576,44 3xtg - ad,63 and 5xfad.68 these studies indicate that intraneuronal soluble a is a pathological feature of ad that has long been neglected and is turning out to be the key factor leading to neuronal loss in the disease before the extracellular a deposition. loss of neuronal synaptic density and synapse number represents another invariant feature of ad that appears to precede overt neuronal degeneration.99,100 notably, it has been shown that the loss of synaptic terminals correlates better with cognitive decline than plaque and tangle load or neuronal loss, leading to the concept that losing synapses is one of the key events leading to cognitive dysfunction in ad.37,101 - 104 there is accumulating evidence from ad transgenic mice that intraneuronal a1 - 42 triggers not only early neuronal loss but also synaptic deficits. for example, tg2576 mice showed increased intraneuronal a1 - 42 accumulation with aging, and this accumulation was associated with abnormal synaptic morphology before a plaque pathology.44 3xtg - ad mice developed age - dependent synaptic plasticity deficits, but before a plaque and neurofibrillary tangle pathologies ; synaptic dysfunction correlated with the accumulation of intraneuronal a1 - 42.63 intraneuronal a1 - 42 accumulated in 5xfad brain starting at 1.5 months of age, just before the first appearance of a deposits at 2 months. synaptic loss started already at 4 months of age and was significant from 9 months in 5xfad brain, whereas local neuronal loss first became apparent at 9 months of age.68 the development of the appsl / ps1 mice, which exhibit intraneuronal a1 - 42 accumulation, offered for the first time the possibility to address the question of whether alterations in synaptic integrity precede neuronal loss in a transgenic animal model of ad, and the data indicated that loss of neurons was of limited impact on age - related synaptic loss and that at least part of synaptic loss seen in regions free of a deposits was due to elevated levels of soluble a oligomers.69 regarding the interaction between a and tau pathologies, although a plaque development is almost certainly driven by the app and ps1 fad mutations, whereas the tangle - like pathology is driven by the tau mutations, it does appear that such mutations interact, as suggested by studies in transgenic mouse models with tau mutation. for example, bigenic tapp mice (expressing k670n / m671l mutant app and p301l mutant tau) have enhanced neurofibrillary pathology in limbic regions, most notably the amygdala, in comparison with transgenic jnpl3 animals (expressing singly p301l mutant tau), suggesting that the formation of tau inclusions might be influenced by increasing the level of app or a peptides.62 additionally, intracerebral injections of anti - a antibodies into the hippocampus of 3xtg - ad mice not only reduced a accumulation but also resulted in clearance of early - stage, but not late - stage, hyperphosphorylated tau aggregates. whereas a deposits were cleared within 3 days, the tau lesions required a slightly longer time and were not reduced until 5 days after injection. thus, a was cleared first, followed by the clearance of tau localized in the somatodendritic compartment. conversely, by 30 days after injection, a deposits reemerged, although the tau pathology was not apparent at this time point.105 these studies thus show that modulating a affects tau pathology and suggest that tau pathology may be downstream of a generation. mutations in app linked to fad include dutch (e693q),10 london (v717i),12 indiana (v717f),13 swedish (k670n / m671l),14 florida (i716v),15 iowa (d694n),16 and arctic (e693g)17 mutations. to date, more than 160 mutations in ps1 linked to fad have been discovered (see http://www.molgen.ua.ac.be/admutations). mutations in a related gene, now called ps2, were soon linked to fad as well.18 most of fad mutations cause aberrant app processing toward the longer, more amyloidogenic a1 - 42 species.19 the a is located partially within the ectodomain (n - terminal portion) and partly within the transmembrane domain (c - terminal portion) of app. at least three enzymes are responsible for the processing of app and have been called -, - and -secretases. the processing pathway by -secretase, called non - amyloidogenic, cleaves app within the a domain in the c - terminal portion of the sequence of this peptide, producing soluble app, which has neurotrophic and neuroprotective effects. the processing pathway by - and -secretases, called amyloidogenic, cleaves app in the n- and c - terminal portions of the a region, respectively, producing a peptide. -secretase cleaves app at various adjacent sites to form species of a containing 39 to 43 amino acids.20 presenilins contribute to the catalytic activity of the -secretase complex.1 processing of app by -, - and -secretases is illustrated in figure 1. the swedish mutation, which is located just outside the n - terminus of the a domain of app, favors -secretase cleavage in vitro21 and is associated with an increased level and deposition of a1 - 42 in ad brain.22 the dutch and iowa mutations, which are located in the a domain of app, accelerate a1 - 40 fibril formation in vitro.23,24 the dutch mutation is associated with cerebrovascular a deposition that is, caa, resulting in cerebral hemorrhages and dementia in patients with ad,10 whereas the iowa mutation is associated with severe caa, widespread neurofibrillary tangles, and unusually extensive distribution of a1 - 40 in plaques in ad brain.16 the arctic mutation, which is also located inside the a domain, makes app less available to -secretase cleavage and increases -secretase processing of app thus favoring intracellular a production in vitro.25,26 the arctic mutation is associated with severe caa in the absence of hemorrhage, abundant parenchymal a deposits, and neurofibrillary tangles in ad brain.27 the london mutation, which is located in the transmembrane domain of app, as well as the ps1 and ps2 mutations alter -secretase cleavage and increase the a1 - 42 level and/or the a1 - 42/a1 - 40 ratio in vitro.28 - 30 the london mutation is associated with extensive parenchymal a deposition and abundant senile plaques and neurofibrillary tangles, as well as moderate caa in ad brain.31,32 the indiana mutation, which is also located in the transmembrane domain of app, is associated with large number of neurofibrillary tangles and senile plaques, as well as mild caa in ad brain.33 the florida mutation, which is also located in the transmembrane domain of app, affects -secretase cleavage causing an increased a1 - 42 concentration and a1 - 42/a1 - 40 ratio in vitro.15,30 games reported the first transgenic ad model, termed pdapp mice, which overexpress a human app transgene containing the indiana mutation (v717f) under the control of the platelet - derived growth factor- promoter. a1 - 42 constituted 27% of the a present in the brain of young pdapp mice, and this percentage increased to 89% in 12-month - old animals. the mice developed senile plaques that were primarily composed of a1 - 42.35 pdapp mice showed age - related a deposition in cortical and limbic regions that began at 8 months and progressed to cover 20 - 50% of the neuropil in the cingulate cortex, entorhinal cortex, and hippocampus of 18-month - old animals. a deposition was associated with dystrophic neurites and extensive gliosis (reactive astrocytes and activated microglia), however, there was no overt neuronal loss in the entorhinal cortex, hippocampal ca1 field, or cingulate cortex through 18 months of age in pdapp mice.36 dystrophic neurites immunoreactive for hyperphosphorylated tau were observed near a plaques after 14 months of age, although no paired helical filaments and neurofibrillary tangles were identified.37 pdapp mice showed significant and age - dependent synaptic loss, and a rather marked hippocampal atrophy was observed as early as 3 months of age in these mice.38 young pdapp mice showed deficits in spatial learning and memory, which worsened with increasing age and a burden.39 similarly, hsiao.40 overexpressed in mice a human app transgene containing the swedish mutation (k670n / m671l) driven by a hamster prion protein promoter. these mice, termed tg2576 mice, have been the most widely studied ad transgenic model. tg2576 mice exhibited age - dependent increase of a1 - 40 and a1 - 42 levels and a deposition, resulting in senile plaques similar to those found in ad. a plaques were first clearly seen by 11 - 13 months, eventually becoming widespread in cortical and limbic structures.40 a deposits were associated with prominent gliosis and neuritic dystrophy, without overt neuronal loss in the hippocampal ca1 field or apparent synapse loss in the hippocampal dentate gyrus.41 tg2576 mice exhibited deficits in synaptic plasticity in the hippocampal ca1 field and dentate gyrus, decreased dendritic spine density in the dentate gyrus, and impaired spatial memory and contextual fear conditioning months before significant a deposition, which was detectable at 18 months of age.42,43 a decrease in spine density was detected as early as 4 months of age, and synaptic dysfunction and memory impairment were observed by 5 months. moreover, an increase in the ratio of soluble a1 - 42/a1 - 40 was first observed at these early ages that is, at 4 - 5 months of age.43 tg2576 mice also showed increased intraneuronal a1 - 42 accumulation with aging, and this accumulation was associated with abnormal synaptic morphology before a plaque pathology.44 subsequently, many other transgenic lines were developed with approaches similar to those used to develop pdapp and tg2576 mice, typically relying on strong promoters to drive overexpression of app transgenes containing single or multiple fad mutations. for example, tgcrnd8 mice, which express multiple human app mutations that is, swedish and indiana mutations driven by the prion protein promoter, exhibited an aggressive neuropathology with onset of parenchymal a deposition and cognitive deficits as early as 3 months of age, and with dense a plaques and neuritic dystrophy evident from 5 months of age. tgcrnd8 mice exhibited an excess of brain a1 - 42 over a1 - 40, and the high - level production of a1 - 42 was associated with spatial learning impairment at 6 months of age. neurofibrillary tangles and neurodegeneration were absent.45 the formation of plaques was concurrent with the appearance of activated microglia and shortly followed by the clustering of activated astrocytes around plaques at 3.5 months of age in tgcrnd8 mice.46 doubly transgenic mice which express human app with the swedish mutation driven by the platelet - derived growth factor- promoter combined with a ps1 mutation (m146l) under the control of the prion protein promoter, termed app / ps1 mice, developed large numbers of fibrillar a deposits in the cerebral cortex and hippocampus that resembled compact a plaques. these mice showed a selective increase in a1 - 42 in their brains and reduced performance in a spatial memory task before substantial a deposition was apparent.47 the fibrillar a deposits were associated with dystrophic neurites and activated astrocytes and microglia in app / ps1 mice.48 app23 mice, which express human app with only the swedish mutation driven by a thy1 promoter, showed neuronal overexpression of app. at 6 months of age, app23 mice showed first rare a deposits, which increased with age in size and number and occupied a substantial area of the neocortex and hippocampus in 24-month - old mice. the a plaques were surrounded by gliosis (activated microglia and astrocytes) and dystrophic neurites that were immunoreactive for hyperphosphorylated tau despite the lack of neurofibrillary tangles.49 determination of plaque - associated a1 - 42 peptides in brain revealed a fivefold increase in app23 mice at 6 months. in addition, app23 mice showed an age - dependent decline of spatial memory from the age of 3 months, and locomotor activity and exploratory behavior deficits at 6 months. spatial memory deficits preceded plaque formation and the increase in plaque - associated a1 - 42 peptides, but correlated negatively with brain soluble a concentration in 3-month - old app23 mutants.50 app23 mice have often been used to study caa pathogenesis. significant deposition of a in the cerebral vasculature that is, caa was described in aging app23 mice. caa in these mice was associated with local neuronal loss, synaptic loss, microglial activation, and microhemorrhage.51,52 transgenic mice expressing human app with the dutch (e693q) and iowa (d694n) mutations combined with the swedish mutation under the control of the thy1.2 promoter, termed tg - swdi mice, developed largely diffuse, a plaque - like deposits in the brain parenchyma starting at 3 months of age with high association with a accumulation in the cerebral microvasculature. a1 - 40 peptides are largely the predominant species that accumulates in these mice.53 tg - swdi mice were impaired in the performance of a spatial learning and memory task at 3, 9, and 12 months of age.54 appdutch mice, expressing human app with only the dutch mutation regulated by the thy1 promoter, showed neuronal overexpression of app and increased ratio of a1 - 40/a1 - 42 in the brain that resulted in extensive vascular a deposition with essentially no parenchymal deposition.55 these researchers also developed a transgenic line that expresses human app - dutch mutation crossed with mutant ps1 (g384a), termed appdutch / ps1 mice. these mice, with about half the a1 - 40/a1 - 42 ratio of appdutch mice brain, developed parenchymal a plaques with little vascular deposition. by contrast, young transgenic mice harboring human app with the arctic mutation (e693 g) combined with app - swedish and app - indiana mutations directed by the platelet - derived growth factor- promoter, termed happ - arc mice, developed prominent parenchymal a plaque deposits with little caa despite a reduced proportion of a1 - 42/a1 - 40.56 tg - arcswe mice with both app - swedish and app - arctic mutations driven by the thy1 promoter were developed by two independent groups.57,58 tg - arcswe mice exhibited an age - dependent increase in intraneuronal a accumulation and deficits in spatial memory and contextual fear conditioning, starting at the age of 6 months, before the onset of a plaque formation as well as caa.57 - 59 the cognitive impairments correlated inversely with soluble a levels in tg - arcswe mice.59 recently, a mouse model expressing human app with only the arctic mutation under the control of the thy1 promoter, termed apparc mice, was reported by rnnbck.60 apparc mice showed an age - dependent progression of parenchymal and vascular a deposition, starting in the subiculum and spreading to the thalamus, and deficits in hippocampus - dependent spatial learning and memory test. in contrast to transgenic models with both the swedish and arctic mutations,57,58 apparc mice did not show any punctate intraneuronal a immunoreactivity.60 app transgenic mouse models have been troubled by the difficulty of inducing the characteristic cytoskeletal pathology of ad. for example, in pdapp mice, phosphorylated tau sites do accumulate within dystrophic neurites in animals of 14 months of age or older, but there are no paired helical filaments and no neurofibrillary tangle - like lesions.37 other models have been similar in their lack of any neurofibrillary tangle - like pathology, such as tgcrnd845 and app23 mice.49 transgenic mice that exhibit neurofibrillary tangle - like lesions and a plaques have been produced by combining fad mutations with mutant forms of tau found in a distinct form of dementia known as frontotemporal dementia and parkinsonism linked to chromosome 17 (ftdp-17).61 lewis.62 first crossed tg2576 mice with a transgenic line known as jnpl3, which expresses p301l mutant tau associated with ftdp-17, generating a bigenic transgenic model referred to as tapp mice. singly transgenic jnpl3 mice were known to develop neurofibrillary tangle - like lesions, and tapp mice exhibited both neurofibrillary tangles and a plaques. tapp mice aged 8 months and older displayed more neurofibrillary pathology in limbic regions, most notably the amygdala, than age - matched jnpl3 mice. later, oddo.63 generated a triple transgenic model of ad, termed 3xtg - ad mice, which expressed human app - swedish (k670n / m671l) and ftdp-17 tau (p301l) mutations from exogenous transgenes regulated by the thy1 promoter combined with a ps1 mutation (m146v) from the endogenous mouse gene. there was a progressive increase in a formation as a function of age in the 3xtg - ad brain and a particularly pronounced effect on a1 - 42 levels. in 3xtg - ad mice, intraneuronal a accumulation was apparent between 3 and 4 months of age in the neocortex, and at 6 months of age in the hippocampal ca1 field and amygdala. extracellular a deposits first became apparent in 6-month - old mice in the frontal cortex and were readily evident by 12 months in other cortical regions and in the hippocampus. a plaques preceded tau pathology, which was not evident until about 1 year of age.63,64 tau was conformationally altered and hyperphosphorylated at multiple residues in the brain of 3xtg - ad mice in an age - related manner. tau - reactive dystrophic neurites were also evident in older 3xtg - ad brain. functionally, 3xtg - ad mice developed age - dependent synaptic plasticity deficits, but before a plaque and neurofibrillary tangle pathologies ; synaptic dysfunction correlated with the accumulation of intraneuronal a1 - 42.63 in addition, these mice manifested earliest retention impairment in spatial memory at 4 months of age that correlated with the accumulation of intraneuronal a1 - 42. at 6 months of age, 3xtg - ad mice showed retention deficits in spatial memory and contextual fear conditioning tasks.64 another problem with the ad transgenic mouse models has been the general difficulty of producing neuronal loss. for example, neither pdapp nor tg2576 mice, despite having extensive a deposition, exhibit significant neuronal loss.36,41 app23 mice show only modest losses of pyramidal cells in hippocampal ca1 field (about 15%), losses that are far less than those observed in ad. no quantitative evidence of neuronal loss was observed in the neocortex as a whole.65 more substantial neuronal loss has been reported in mice expressing multiple app and ps1 mutations.66 - 68 one model showing massive neuronal loss is appsl / ps1 mice, which express human app with the swedish and london (v717i) mutations driven by the thy1 promoter and human ps1 with the m146l mutation under the control of the hmg - coa - reductase promoter. in appsl / ps1 mice, intraneuronal a1 - 40 and a1 - 42 stainings preceded a plaque deposition, which started at 3 months of age. a was observed in the somatodendritic and axonal compartments of neurons in the subiculum, hippocampal ca1 field, as well as in cortical areas.66 the a1 - 42/a1 - 40 ratio was increased in appsl / ps1 mice.69 a substantial loss (about 30%) of pyramidal neurons in the hippocampal ca1 - 3 fields was detected in 17-month - old appsl / ps1 mice. the loss of neurons was observed at sites of a aggregation and surrounding astrocytes but, most importantly, was also clearly observed in areas of the parenchyma distant from a plaques.70 furthermore, appsl / ps1 mice displayed severe age - related synaptic loss within hippocampal dentate gyrus and ca1 - 3 fields at 17 months of age, even in regions free of extracellular a deposits.69 another model showing marked neuronal loss expresses human app - swedish and app - london mutations driven by the thy1 promoter together with two ps1 knock - in (ki) mutations (m233t / l235p) in the murine ps1 gene, and is referred to as app / ps1ki mice. the app / ps1ki model is so far the model with the most aggressive pathology. these animals showed early extracellular a deposition at the age of 2.5 months, which was preceded by strong intraneuronal a accumulation in the hippocampal ca1/2 fields. at 6 months of age, widespread and numerous a deposits were found within the hippocampal, cortical, and thalamic areas. a1 - 42 was the predominant (85%) a isovariant produced in app / ps1ki mice, and a1 - 42 oligomers were highly abundant in the app / ps1ki brain.67 further pathological features starting at the age of 6 months included severe axonal degeneration, as well as reduced ability to perform working memory and motor tasks.71,72 at this time point also synaptic dysfunction and loss became evident in app / ps1ki brain. in addition, at 6 months of age, a loss of 33% of hippocampal ca1 pyramidal neurons was demonstrated, together with a decreased volume of the ca1 pyramidal cell layer of 30%, and an atrophy of the entire hippocampus of 18%.73 analysis of the frontal cortex revealed an early loss of cortical neurons starting at the age of 6 months which correlated with the transient intraneuronal a accumulation in contrast to extracellular a plaque pathology.74 at 10 months of age, an extensive neuronal loss (> 50%) was present in the pyramidal cell layer of hippocampal ca1/2 fields that correlated with strong accumulation of intraneuronal a but not with extracellular a deposits in app / ps1ki mice. a very significant astrogliosis developed in the area of strong intraneuronal a accumulation and neuronal loss.67 finally, 5xfad mice expressing human app with the swedish, florida (i716v) and london mutations together with mutant ps1 (m146l / l286v) regulated by the thy1 promoter were generated, and robust neuronal loss was observed. 5xfad mice exhibited dramatically higher levels of a1 - 42 than those of a1 - 40, and rapidly accumulated massive amounts of cerebral a1 - 42 at young ages. a deposition began at 2 months of age in deep cortical layers and in the subiculum. as mice aged, a deposits spread to fill much of the cerebral cortex, subiculum, and hippocampus. a plaques were also observed in the thalamus, brainstem, and olfactory bulb in older mice, but deposits were less numerous in these brain regions. astrogliosis and microgliosis were proportional to a1 - 42 levels and a deposition in 5xfad brain and began at approximately the time when plaques initially appeared. intraneuronal a1 - 42 accumulated in 5xfad brain starting at 1.5 months of age, just before the first appearance of a deposits at 2 months. synaptic loss started already at 4 months of age and was significant from 9 months in 5xfad brain, and large pyramidal neurons in cortical layer 5 and subiculum were visibly reduced in number at 9 months of age.68 5xfad mice developed deficits in spatial memory tasks and also exhibited impairments in trace and contextual fear conditioning tests at 4 - 6 months of age.68,75 data on the characteristics of the main transgenic mouse models of ad are summarized in table 1. games reported the first transgenic ad model, termed pdapp mice, which overexpress a human app transgene containing the indiana mutation (v717f) under the control of the platelet - derived growth factor- promoter. a1 - 42 constituted 27% of the a present in the brain of young pdapp mice, and this percentage increased to 89% in 12-month - old animals. the mice developed senile plaques that were primarily composed of a1 - 42.35 pdapp mice showed age - related a deposition in cortical and limbic regions that began at 8 months and progressed to cover 20 - 50% of the neuropil in the cingulate cortex, entorhinal cortex, and hippocampus of 18-month - old animals. a deposition was associated with dystrophic neurites and extensive gliosis (reactive astrocytes and activated microglia), however, there was no overt neuronal loss in the entorhinal cortex, hippocampal ca1 field, or cingulate cortex through 18 months of age in pdapp mice.36 dystrophic neurites immunoreactive for hyperphosphorylated tau were observed near a plaques after 14 months of age, although no paired helical filaments and neurofibrillary tangles were identified.37 pdapp mice showed significant and age - dependent synaptic loss, and a rather marked hippocampal atrophy was observed as early as 3 months of age in these mice.38 young pdapp mice showed deficits in spatial learning and memory, which worsened with increasing age and a burden.39 similarly, hsiao.40 overexpressed in mice a human app transgene containing the swedish mutation (k670n / m671l) driven by a hamster prion protein promoter. these mice, termed tg2576 mice, have been the most widely studied ad transgenic model. tg2576 mice exhibited age - dependent increase of a1 - 40 and a1 - 42 levels and a deposition, resulting in senile plaques similar to those found in ad. a plaques were first clearly seen by 11 - 13 months, eventually becoming widespread in cortical and limbic structures.40 a deposits were associated with prominent gliosis and neuritic dystrophy, without overt neuronal loss in the hippocampal ca1 field or apparent synapse loss in the hippocampal dentate gyrus.41 tg2576 mice exhibited deficits in synaptic plasticity in the hippocampal ca1 field and dentate gyrus, decreased dendritic spine density in the dentate gyrus, and impaired spatial memory and contextual fear conditioning months before significant a deposition, which was detectable at 18 months of age.42,43 a decrease in spine density was detected as early as 4 months of age, and synaptic dysfunction and memory impairment were observed by 5 months. moreover, an increase in the ratio of soluble a1 - 42/a1 - 40 was first observed at these early ages that is, at 4 - 5 months of age.43 tg2576 mice also showed increased intraneuronal a1 - 42 accumulation with aging, and this accumulation was associated with abnormal synaptic morphology before a plaque pathology.44 subsequently, many other transgenic lines were developed with approaches similar to those used to develop pdapp and tg2576 mice, typically relying on strong promoters to drive overexpression of app transgenes containing single or multiple fad mutations. for example, tgcrnd8 mice, which express multiple human app mutations that is, swedish and indiana mutations driven by the prion protein promoter, exhibited an aggressive neuropathology with onset of parenchymal a deposition and cognitive deficits as early as 3 months of age, and with dense a plaques and neuritic dystrophy evident from 5 months of age. tgcrnd8 mice exhibited an excess of brain a1 - 42 over a1 - 40, and the high - level production of a1 - 42 was associated with spatial learning impairment at 6 months of age. neurofibrillary tangles and neurodegeneration were absent.45 the formation of plaques was concurrent with the appearance of activated microglia and shortly followed by the clustering of activated astrocytes around plaques at 3.5 months of age in tgcrnd8 mice.46 doubly transgenic mice which express human app with the swedish mutation driven by the platelet - derived growth factor- promoter combined with a ps1 mutation (m146l) under the control of the prion protein promoter, termed app / ps1 mice, developed large numbers of fibrillar a deposits in the cerebral cortex and hippocampus that resembled compact a plaques. these mice showed a selective increase in a1 - 42 in their brains and reduced performance in a spatial memory task before substantial a deposition was apparent.47 the fibrillar a deposits were associated with dystrophic neurites and activated astrocytes and microglia in app / ps1 mice.48 app23 mice, which express human app with only the swedish mutation driven by a thy1 promoter, showed neuronal overexpression of app. at 6 months of age, app23 mice showed first rare a deposits, which increased with age in size and number and occupied a substantial area of the neocortex and hippocampus in 24-month - old mice. the a plaques were surrounded by gliosis (activated microglia and astrocytes) and dystrophic neurites that were immunoreactive for hyperphosphorylated tau despite the lack of neurofibrillary tangles.49 determination of plaque - associated a1 - 42 peptides in brain revealed a fivefold increase in app23 mice at 6 months. in addition, app23 mice showed an age - dependent decline of spatial memory from the age of 3 months, and locomotor activity and exploratory behavior deficits at 6 months. spatial memory deficits preceded plaque formation and the increase in plaque - associated a1 - 42 peptides, but correlated negatively with brain soluble a concentration in 3-month - old app23 mutants.50 app23 mice have often been used to study caa pathogenesis. significant deposition of a in the cerebral vasculature that is, caa was described in aging app23 mice. caa in these mice was associated with local neuronal loss, synaptic loss, microglial activation, and microhemorrhage.51,52 transgenic mice expressing human app with the dutch (e693q) and iowa (d694n) mutations combined with the swedish mutation under the control of the thy1.2 promoter, termed tg - swdi mice, developed largely diffuse, a plaque - like deposits in the brain parenchyma starting at 3 months of age with high association with a accumulation in the cerebral microvasculature. a1 - 40 peptides are largely the predominant species that accumulates in these mice.53 tg - swdi mice were impaired in the performance of a spatial learning and memory task at 3, 9, and 12 months of age.54 appdutch mice, expressing human app with only the dutch mutation regulated by the thy1 promoter, showed neuronal overexpression of app and increased ratio of a1 - 40/a1 - 42 in the brain that resulted in extensive vascular a deposition with essentially no parenchymal deposition.55 these researchers also developed a transgenic line that expresses human app - dutch mutation crossed with mutant ps1 (g384a), termed appdutch / ps1 mice. these mice, with about half the a1 - 40/a1 - 42 ratio of appdutch mice brain, developed parenchymal a plaques with little vascular deposition. by contrast, young transgenic mice harboring human app with the arctic mutation (e693 g) combined with app - swedish and app - indiana mutations directed by the platelet - derived growth factor- promoter, termed happ - arc mice, developed prominent parenchymal a plaque deposits with little caa despite a reduced proportion of a1 - 42/a1 - 40.56 tg - arcswe mice with both app - swedish and app - arctic mutations driven by the thy1 promoter were developed by two independent groups.57,58 tg - arcswe mice exhibited an age - dependent increase in intraneuronal a accumulation and deficits in spatial memory and contextual fear conditioning, starting at the age of 6 months, before the onset of a plaque formation as well as caa.57 - 59 the cognitive impairments correlated inversely with soluble a levels in tg - arcswe mice.59 recently, a mouse model expressing human app with only the arctic mutation under the control of the thy1 promoter, termed apparc mice, was reported by rnnbck.60 apparc mice showed an age - dependent progression of parenchymal and vascular a deposition, starting in the subiculum and spreading to the thalamus, and deficits in hippocampus - dependent spatial learning and memory test. in contrast to transgenic models with both the swedish and arctic mutations,57,58 apparc mice did not show any punctate intraneuronal a immunoreactivity.60 app transgenic mouse models have been troubled by the difficulty of inducing the characteristic cytoskeletal pathology of ad. for example, in pdapp mice, phosphorylated tau sites do accumulate within dystrophic neurites in animals of 14 months of age or older, but there are no paired helical filaments and no neurofibrillary tangle - like lesions.37 other models have been similar in their lack of any neurofibrillary tangle - like pathology, such as tgcrnd845 and app23 mice.49 transgenic mice that exhibit neurofibrillary tangle - like lesions and a plaques have been produced by combining fad mutations with mutant forms of tau found in a distinct form of dementia known as frontotemporal dementia and parkinsonism linked to chromosome 17 (ftdp-17).61 lewis.62 first crossed tg2576 mice with a transgenic line known as jnpl3, which expresses p301l mutant tau associated with ftdp-17, generating a bigenic transgenic model referred to as tapp mice. singly transgenic jnpl3 mice were known to develop neurofibrillary tangle - like lesions, and tapp mice exhibited both neurofibrillary tangles and a plaques. tapp mice aged 8 months and older displayed more neurofibrillary pathology in limbic regions, most notably the amygdala, than age - matched jnpl3 mice. later, oddo.63 generated a triple transgenic model of ad, termed 3xtg - ad mice, which expressed human app - swedish (k670n / m671l) and ftdp-17 tau (p301l) mutations from exogenous transgenes regulated by the thy1 promoter combined with a ps1 mutation (m146v) from the endogenous mouse gene. there was a progressive increase in a formation as a function of age in the 3xtg - ad brain and a particularly pronounced effect on a1 - 42 levels. in 3xtg - ad mice, intraneuronal a accumulation was apparent between 3 and 4 months of age in the neocortex, and at 6 months of age in the hippocampal ca1 field and amygdala. extracellular a deposits first became apparent in 6-month - old mice in the frontal cortex and were readily evident by 12 months in other cortical regions and in the hippocampus. a plaques preceded tau pathology, which was not evident until about 1 year of age.63,64 tau was conformationally altered and hyperphosphorylated at multiple residues in the brain of 3xtg - ad mice in an age - related manner. functionally, 3xtg - ad mice developed age - dependent synaptic plasticity deficits, but before a plaque and neurofibrillary tangle pathologies ; synaptic dysfunction correlated with the accumulation of intraneuronal a1 - 42.63 in addition, these mice manifested earliest retention impairment in spatial memory at 4 months of age that correlated with the accumulation of intraneuronal a1 - 42. at 6 months of age, 3xtg - ad mice showed retention deficits in spatial memory and contextual fear conditioning tasks.64 another problem with the ad transgenic mouse models has been the general difficulty of producing neuronal loss. for example, neither pdapp nor tg2576 mice, despite having extensive a deposition, exhibit significant neuronal loss.36,41 app23 mice show only modest losses of pyramidal cells in hippocampal ca1 field (about 15%), losses that are far less than those observed in ad. more substantial neuronal loss has been reported in mice expressing multiple app and ps1 mutations.66 - 68 one model showing massive neuronal loss is appsl / ps1 mice, which express human app with the swedish and london (v717i) mutations driven by the thy1 promoter and human ps1 with the m146l mutation under the control of the hmg - coa - reductase promoter. in appsl / ps1 mice, intraneuronal a1 - 40 and a1 - 42 stainings preceded a plaque deposition, which started at 3 months of age. a was observed in the somatodendritic and axonal compartments of neurons in the subiculum, hippocampal ca1 field, as well as in cortical areas.66 the a1 - 42/a1 - 40 ratio was increased in appsl / ps1 mice.69 a substantial loss (about 30%) of pyramidal neurons in the hippocampal ca1 - 3 fields was detected in 17-month - old appsl / ps1 mice. the loss of neurons was observed at sites of a aggregation and surrounding astrocytes but, most importantly, was also clearly observed in areas of the parenchyma distant from a plaques.70 furthermore, appsl / ps1 mice displayed severe age - related synaptic loss within hippocampal dentate gyrus and ca1 - 3 fields at 17 months of age, even in regions free of extracellular a deposits.69 another model showing marked neuronal loss expresses human app - swedish and app - london mutations driven by the thy1 promoter together with two ps1 knock - in (ki) mutations (m233t / l235p) in the murine ps1 gene, and is referred to as app / ps1ki mice. the app / ps1ki model is so far the model with the most aggressive pathology. these animals showed early extracellular a deposition at the age of 2.5 months, which was preceded by strong intraneuronal a accumulation in the hippocampal ca1/2 fields. at 6 months of age, widespread and numerous a deposits were found within the hippocampal, cortical, and thalamic areas. a1 - 42 was the predominant (85%) a isovariant produced in app / ps1ki mice, and a1 - 42 oligomers were highly abundant in the app / ps1ki brain.67 further pathological features starting at the age of 6 months included severe axonal degeneration, as well as reduced ability to perform working memory and motor tasks.71,72 at this time point also synaptic dysfunction and loss became evident in app / ps1ki brain. in addition, at 6 months of age, a loss of 33% of hippocampal ca1 pyramidal neurons was demonstrated, together with a decreased volume of the ca1 pyramidal cell layer of 30%, and an atrophy of the entire hippocampus of 18%.73 analysis of the frontal cortex revealed an early loss of cortical neurons starting at the age of 6 months which correlated with the transient intraneuronal a accumulation in contrast to extracellular a plaque pathology.74 at 10 months of age, an extensive neuronal loss (> 50%) was present in the pyramidal cell layer of hippocampal ca1/2 fields that correlated with strong accumulation of intraneuronal a but not with extracellular a deposits in app / ps1ki mice. a very significant astrogliosis developed in the area of strong intraneuronal a accumulation and neuronal loss.67 finally, 5xfad mice expressing human app with the swedish, florida (i716v) and london mutations together with mutant ps1 (m146l / l286v) regulated by the thy1 promoter were generated, and robust neuronal loss was observed. 5xfad mice exhibited dramatically higher levels of a1 - 42 than those of a1 - 40, and rapidly accumulated massive amounts of cerebral a1 - 42 at young ages. a deposition began at 2 months of age in deep cortical layers and in the subiculum. as mice aged, a deposits spread to fill much of the cerebral cortex, subiculum, and hippocampus. a plaques were also observed in the thalamus, brainstem, and olfactory bulb in older mice, but deposits were less numerous in these brain regions. astrogliosis and microgliosis were proportional to a1 - 42 levels and a deposition in 5xfad brain and began at approximately the time when plaques initially appeared. intraneuronal a1 - 42 accumulated in 5xfad brain starting at 1.5 months of age, just before the first appearance of a deposits at 2 months. synaptic loss started already at 4 months of age and was significant from 9 months in 5xfad brain, and large pyramidal neurons in cortical layer 5 and subiculum were visibly reduced in number at 9 months of age.68 5xfad mice developed deficits in spatial memory tasks and also exhibited impairments in trace and contextual fear conditioning tests at 4 - 6 months of age.68,75 data on the characteristics of the main transgenic mouse models of ad are summarized in table 1. although none of the ad transgenic models fully replicates the human disease, they have suggested new insights into the pathophysiology of a toxicity, particularly with respect to the effects of different a species and the possible pathogenic role of a oligomers.11 in the 1980s it was debated whether a deposits, and in particular caa at the cerebral vessel walls, had a central nervous system or a peripheral source.11 studies in app23 mice, which developed a similar degree of both a plaques and caa, provided the first evidence that a neuronal source of app / a is sufficient to induce cerebrovascular a and associated neurodegeneration.51 accordingly, studies in transgenic mice with almost exclusive neuronal central nervous system expression of app, like appdutch mice, which develop almost only caa, strongly suggest that neuronal a produced in the brain generates cerebrovascular a neuropathology. in addition, although a1 - 42 may be needed as a seed for a deposition in either compartment (parenchyma and vasculature), studies in appdutch and appdutch / ps1 mice suggest that a1 - 40 promotes vascular deposition, whereas a1 - 42 shifts deposition toward parenchymal a.55 moreover, studies in happ - arc mice, with app - arctic mutation (e693 g) combined with app - swedish and app - indiana mutations, suggest that some property of the app e693 g mutation, besides its effect on the a1 - 40/a1 - 42 ratio, may also influence parenchymal deposition versus vascular deposition.56 therefore, the existing ad transgenic mouse models have shown considerable utility in deciphering the pathobiology of caa. analyses of the brain of app transgenic mouse models in which large amounts of a have accumulated in plaques but no neurodegeneration has developed, such as pdapp,35,36 tg2576,40,41 tgcrnd8,45 and app2365 mice, provide no or very sparse support for the well - established amyloid cascade hypothesis. this hypothesis supports the idea that increased a production and extracellular accumulation in plaques leads to neurotoxicity, resulting in widespread neuronal loss and dementia.76 some reasons for this have been discussed. perhaps the neurotoxicity is sparse in app mouse models because murine neurons might be devoid of the downstream pathways necessary for a to induce toxicity, such as the processes leading to tau aggregation and neurofibrillary tangle formation in ad brain.11 interestingly, subsequent to the original amyloid hypothesis, it became clear that a plaque counts correlate relatively poorly with the level of cognitive decline in ad and that the number of neurofibrillary tangles correlates more strongly with the degree of dementia.77 perhaps only certain species of a (a1 - 40, a1 - 42, or truncated a) are neurotoxic, and by using mutations linked to familial ad we poorly replicate the processes of a production and aggregation in sporadic ad brain.11 curiously, truncated a peptides were demonstrated in ad brain more than 10 years ago,78,79 but the observations were partially ignored. today it is well established that only a fraction of a in postmortem ad brain is full - length a1 - 40 or a1 - 42 ; n - terminally truncated variants of a (a3 - 42 and a11 - 42) are prevalent in senile plaques of ad brain.80,81 unlike the classical amyloid cascade hypothesis, it was subsequently shown that soluble oligomers of a1 - 42 and not plaque - associated a correlate best with cognitive dysfunction in ad.6,82 there is now a great interest in identifying which a species (a1 - 40, a1 - 42, or truncated a) and form (oligomers or deposits) would be responsible for neurotoxicity, and in understanding the relationship between a and tau pathologies.11 app transgenic mice have provided strong evidence for the toxicity of soluble a oligomers in vivo by showing that many pathological and functional changes in mice occur before the appearance of a plaque pathology. for example, studies in pdapp mice demonstrated that loss of volume in the hippocampus, predominantly localized to the dentate gyrus, was present in 100-day - old mice well before a deposition in plaques.83 in addition, loss in total dendritic length was evident in the dentate gyrus of 90-day - old pdapp mice well before a accumulation occurs.84 tg2576 mice exhibited increased ratio of soluble a1 - 42/a1 - 40, deficits in synaptic plasticity in the hippocampal ca1 field and dentate gyrus, loss of dendritic spines in the dentate gyrus, and impaired spatial and contextual memory months before significant a deposition.42,43 in app23 mice, spatial memory deficits preceded plaque formation and the increase in plaque - associated a1 - 42 peptides, but correlated negatively with soluble a concentration.50 tg - arcswe mice exhibited robust deficits in spatial memory and contextual fear conditioning before the onset of a deposition,57 - 59 and the cognitive impairments correlated inversely with soluble a levels.59 3xtg - ad mice developed age - dependent synaptic plasticity deficits and spatial memory impairment before a plaque and neurofibrillary tangle pathologies but instead in correlation with soluble a1 - 42.63,64 finally, app / ps1 mice, which exhibit large numbers of compact a plaques in the cerebral cortex and hippocampus, showed a selective increase in a1 - 42 in their brains and reduced performance in a spatial memory task in the period preceding overt a deposition.47 these studies are consistent with the more critical role of a1 - 42 in the pathogenesis of ad and suggest a neurotoxic effect of soluble forms of a. since the discovery that truncated a3 - 42 represents a major species in senile plaques of ad brain,80,81 this peptide has received considerable attention. in comparison with a1 - 42, a3 - 42 has stronger aggregation propensity and increased toxicity in vitro.85 - 87 recently, a new transgenic mouse model (tba2) was generated,88 which expressed only truncated a3 - 42 in neurons without any of the other a peptides, and it was demonstrated for the first time that this peptide is neurotoxic in vivo, inducing neuronal loss and concomitant neurological deficits characterized by loss of motor coordination and ataxia. in the past, a has been regarded as acting extracellularly, whereas recent evidence points to toxic effects of a in intracellular compartments. first reports showing that a is initially deposited in neurons before occurring in the extracellular space date back roughly 20 years.89,90 more recently, it has been shown that neurons in ad - vulnerable regions accumulate a1 - 42 and it has been further suggested that this accumulation precedes extracellular a deposition and neurofibrillary tangle formation.91 consecutively, a variety of reports has been published demonstrating a in neurons of ad brain.92 - 95 curiously, soluble a oligomers, which have been suggested as the most toxic species, are formed, preferentially, intracellularly within neuronal processes and synapses rather than extracellularly.96,97 in all transgenic mouse models in which marked neuronal loss has been so far reported, this was preceded by considerable amounts of intraneuronal a peptides.98 for example, in app / ps1ki mice, which developed severe learning deficits correlating with ca1 field neuronal loss and hippocampal atrophy, increased intraneuronal a1 - 42 and not plaque - associated a coincided well with neuronal loss ; the intraneuronal n - truncated a3 - 42 species was also increased, however, the dominant species was a1 - 42 in the app / ps1ki model.67,73 in agreement with this study, investigations in tba2 mice showed for the first time that intraneuronal a3 - 42 accumulation is sufficient for triggering neuronal death and inducing an associated neurological phenotype. although the tba2 model lacks important ad - typical neuropathological features like tangles and hippocampal degeneration, it clearly demonstrated that intraneuronal a3 - 42 is neurotoxic in vivo.88 intraneuronal a1 - 42 accumulation has also been reported in several transgenic mouse models with no overt neuronal loss, including tg2576,44 3xtg - ad,63 and 5xfad.68 these studies indicate that intraneuronal soluble a is a pathological feature of ad that has long been neglected and is turning out to be the key factor leading to neuronal loss in the disease before the extracellular a deposition. loss of neuronal synaptic density and synapse number represents another invariant feature of ad that appears to precede overt neuronal degeneration.99,100 notably, it has been shown that the loss of synaptic terminals correlates better with cognitive decline than plaque and tangle load or neuronal loss, leading to the concept that losing synapses is one of the key events leading to cognitive dysfunction in ad.37,101 - 104 there is accumulating evidence from ad transgenic mice that intraneuronal a1 - 42 triggers not only early neuronal loss but also synaptic deficits. for example, tg2576 mice showed increased intraneuronal a1 - 42 accumulation with aging, and this accumulation was associated with abnormal synaptic morphology before a plaque pathology.44 3xtg - ad mice developed age - dependent synaptic plasticity deficits, but before a plaque and neurofibrillary tangle pathologies ; synaptic dysfunction correlated with the accumulation of intraneuronal a1 - 42.63 intraneuronal a1 - 42 accumulated in 5xfad brain starting at 1.5 months of age, just before the first appearance of a deposits at 2 months. synaptic loss started already at 4 months of age and was significant from 9 months in 5xfad brain, whereas local neuronal loss first became apparent at 9 months of age.68 the development of the appsl / ps1 mice, which exhibit intraneuronal a1 - 42 accumulation, offered for the first time the possibility to address the question of whether alterations in synaptic integrity precede neuronal loss in a transgenic animal model of ad, and the data indicated that loss of neurons was of limited impact on age - related synaptic loss and that at least part of synaptic loss seen in regions free of a deposits was due to elevated levels of soluble a oligomers.69 regarding the interaction between a and tau pathologies, although a plaque development is almost certainly driven by the app and ps1 fad mutations, whereas the tangle - like pathology is driven by the tau mutations, it does appear that such mutations interact, as suggested by studies in transgenic mouse models with tau mutation. for example, bigenic tapp mice (expressing k670n / m671l mutant app and p301l mutant tau) have enhanced neurofibrillary pathology in limbic regions, most notably the amygdala, in comparison with transgenic jnpl3 animals (expressing singly p301l mutant tau), suggesting that the formation of tau inclusions might be influenced by increasing the level of app or a peptides.62 additionally, intracerebral injections of anti - a antibodies into the hippocampus of 3xtg - ad mice not only reduced a accumulation but also resulted in clearance of early - stage, but not late - stage, hyperphosphorylated tau aggregates. whereas a deposits were cleared within 3 days, the tau lesions required a slightly longer time and were not reduced until 5 days after injection. thus, a was cleared first, followed by the clearance of tau localized in the somatodendritic compartment. conversely, by 30 days after injection, a deposits reemerged, although the tau pathology was not apparent at this time point.105 these studies thus show that modulating a affects tau pathology and suggest that tau pathology may be downstream of a generation. to study ad, a variety of transgenic mouse models has been generated through the overexpression of the app and/or the presenilins harboring one or several mutations found in familial ad.34,40,45,49,53, although none of the ad transgenic mice models reproduces the human condition exactly, the ability to study similar pathological processes in living animals has provided valuable insights into disease mechanisms and opportunities to test therapeutic approaches.11 the ad mouse models have been key to understanding the roles of soluble a oligomers in disease pathogenesis, as well as of the relationship between a and tau pathologies. data obtained from the comparison of different ad mouse lines indicate that the onset and the severity of the a deposits are directly linked to the level of soluble a1 - 42 peptide.42,43,47,58,59,63,64,83,84 there is accumulating evidence from ad transgenic mice that intraneuronal a1 - 42 triggers early neuronal loss as well as synaptic deficits.63, studies in a transgenic animal model of ad that exhibits marked neuronal and synaptic loss indicate that alterations in synaptic integrity precede neuronal loss,69 which is in accordance with the hypothesis that synaptic loss is one of the earliest events in ad pathogenesis.37,101 - 104 furthermore, evidence from ad transgenic mouse models supports the notion that a may directly or indirectly interact with tau to accelerate neurofibrillary tangle formation.62,105 finally, the ad transgenic models may allow to define and evaluate potential drug targets and to develop therapeutic strategies that might interfere or delay the onset of ad.106 | alzheimer disease is the most common cause of dementia among the elderly, accounting for 60 - 70% of all cases of dementia. the neuropathological hallmarks of alzheimer disease are senile plaques (mainly containing -amyloid peptide derived from amyloid precursor protein) and neurofibrillary tangles (containing hyperphosphorylated tau protein), along with neuronal loss. at present there is no effective treatment for alzheimer disease. given the prevalence and poor prognosis of the disease, the development of animal models has been a research priority to understand pathogenic mechanisms and to test therapeutic strategies. most cases of alzheimer disease occur sporadically in people over 65 years old, and are not genetically inherited. roughly 5% of patients with alzheimer disease have familial alzheimer disease that is, related to a genetic predisposition, including mutations in the amyloid precursor protein, presenilin 1, and presenilin 2 genes. the discovery of genes for familial alzheimer disease has allowed transgenic models to be generated through the overexpression of the amyloid precursor protein and/or presenilins harboring one or several mutations found in familial alzheimer disease. although none of these models fully replicates the human disease, they have provided valuable insights into disease mechanisms as well as opportunities to test therapeutic approaches. this review describes the main transgenic mouse models of alzheimer disease which have been adopted in alzheimer disease research, and discusses the insights into alzheimer disease pathogenesis from studies in such models. in summary, the alzheimer disease mouse models have been the key to understanding the roles of soluble -amyloid oligomers in disease pathogenesis, as well as of the relationship between -amyloid and tau pathologies. |
colorectal cancer (crc) is one of the most common cancers in the world. crcs usually progress from adenomatous polyps, and the morphological and genetic progression of crcs in an adenoma - adenocarcinoma sequence has been well described.1,2 a hyperplastic polyp (hp) is the most common histological type found among colorectal polyps, but they have been considered to have no malignant potential. however, recent studies have demonstrated that some hps can develop into crcs, especially in patients diagnosed with hyperplastic polyposis syndrome (hps).3,4 recent studies have proposed that hps arising in hps progress toward adenocarcinoma through a " serrated neoplastic pathway " and that a b type raf kinase (braf) proto - oncogene mutation is one of the early genetic events in the initiation of this serrated pathway.4 - 6 braf mutations have recently been found in 5% to 15% of crcs.7 - 9 we present a case of a 34-year - old young woman with hps who had a braf mutation. she had no family or personal history of colorectal carcinoma or other bowel diseases. however, she underwent a fine - needle aspiration biopsy (fnab) for incidentally discovered thyroid nodules 2 months previous. her complete blood count showed no abnormal findings, and other laboratory tests and thyroid function tests were within the normal range. 0.2 to 0.7-cm - sized polyps were seen in the body and antrum of the stomach (fig. however, no lesions were observed in the bulb or secondary portion of the duodenum. during the colonoscopy, numerous 0.2 to 1.0-cm - sized polyps we removed 48 and 70 polyps from the stomach and colorectum, respectively. a histological examination of the resected polyps revealed hps (fig. we performed a braf and k - ras mutation analysis as well as a microsatellite analysis on the representative hps of the colon. was a missense mutation at codon 600, exon 15 replacing gtg (valine) with gag (glutamic acid). a k - ras mutation and microsatellite instability (msi), however, were not detected. sporadic hps are of a benign nature and are usually small in size, multiply, increase with old age, and are mainly distributed in the sigmoid colon and rectum. however, crcs arising in colorectal hps or serrated adenomas (sas), especially in patients diagnosed with hps have been reported.10 - 14 additionally, recent studies proposed the hp - sa - carcinoma sequence as an alternative pathway for colorectal carcinogenesis.4,15,16 hps is an uncommon syndrome characterized by a diverse range of polyp types including multiple, large hps and smaller numbers of sas, traditional adenomas, and admixed hyperplastic / adenomatous polyps in the colon and rectum. in the world health organization (who) hps diagnostic criteria, burt and jass17 defined hps as at least five histologically diagnosed hps occurring proximal to the sigmoid colon and of which more than two are greater than 1 cm in diameter, or more than 30 hps in the whole colon and rectum, or any number of hps proximal to the sigmoid colon in an individual who has a first - degree relative diagnosed with hps. in such patients, polyps are usually sessile and 1 - 7 mm in diameter, but larger and/or pedunculated hps may also be observed. some patients had adenomas or crcs.18 - 20 hps of hps progress to crcs through the serrated pathway and a braf mutation is a key genetic event in the initiation of the serrated neoplastic pathway in the development of crc.4 - 6 the risk of malignant changes in hps seems much higher when the hps have histologically dysplastic features such as admixed polyps and sas or when they are large, numerous, located on the right - sided colon, and present in younger patients.21,22 genetic and epigenetic alterations in colorectal carcinoma are present in hps. these alterations in clude braf or k - ras protooncogene mutations and msi.14,23,24 braf makes a protein called b - raf which is one of the members of the raf family of serine/ threonine kinases. b - raf mediates cellular responses to growth signals through the ras - raf - mek (mitogen - activated protein / extracellular signal - regulated kinase)-erk (extracellular signal - regulated kinase)-map (mitogen - activated protein) kinase pathway.25,26 braf mutations have been found in various human cancers including crcs and melanomas.7,9,27 - 30 they have also been found in sporadic hps and in sas from patients with hyperplastic polyposis.6,31,32 braf mutations are frequent in crcs with a high level of msi, but uncommon in microsatellite - stable crcs.27 - 30 the frequency of braf mutations is much higher in hps, especially younger patients and patients with large and right - sided polyps than in sporadic hps which are predominantly present in the left - sided colon or rectum.23 in contrast, k - ras mutations are infrequent in hps, but frequent in sporadic hps.14 unlike braf, k - ras mainly plays a key role in the development of crc through the classical adenoma - adenocarcinoma sequence, allowing the growth and progression of adenomatous colorectal polyps.33 some reports have demonstrated that braf and k - ras mutations are strongly inversely correlated.7 - 9 it is rare that both braf and k - ras mutations are present in different polyps from the same patient.24 therefore, molecular data such as braf or k - ras can help in diagnosing hps. in our case, the 34-year - old young woman had 48 and 70 0.2 to 1.0-cm - sized hps in the stomach and large bowel respectively. a case of hps identified with a braf mutation has been reported in only one case in korea until now.34 furthermore, hps with multiple gastric hps is very rare. we think that genetic alterations such as braf mutations in hps may be frequently seen in patients who have hyperplastic polyposis in the stomach, colorectum or both. although our case had no adenomatous or malignant changes, such patients may more frequently be accompanied with adenomatous or malignant changes in polyps. because hps with a braf mutation may carry a high risk for crc, colonoscopic surveillance should be indicated. endoscopic surveillance is recommended every 1 to 3 years for patients with hyperplastic polyposis.18 this endoscopic surveillance interval may be modified by other risk factors such as age, family or personal history of crc, histology of polyps, and genetic mutations such as braf, and so on.35 | hyperplastic polyposis syndrome (hps) is a rare condition characterized by the presence of numerous hyperplastic polyps (hps) in the colon and rectum. patients with hps have an increased risk of colorectal cancer. this link is associated with gene mutations, especially b type raf kinase (braf). however, a case of hps associated with gene mutations has seldom been reported in korea. here, we describe a case of hps in which a braf mutation was present in a 34-year - old woman. she had more than 110 hps in the stomach and colorectum, which we removed. all of the polyps were diagnosed histologically as hps, and no adenomatous or malignant changes were noted. we performed a braf and k - ras mutation analysis as well as a microsatellite analysis on the resected colon polyps. braf mutations were found in the resected colon polyps, but there was no evidence of k - ras mutation or microsatellite instability. |
there are several lower urinary tract dysfunctions (lutd) that are more prevalent in women than men including interstitial cystitis, recurrent urinary tract infections, and incontinence [1, 2 ]. the inner most tissue layer of the bladder wall, the mucosa (urothelium), is intimately associated with lower urinary tract function. the mucosa is the first line of defense against bladder infections and the penetration of urine solutes into the bladder tissue. the glycosaminoglycan coating of the mucosal surface presents a nonadherent surface to most strains of bacteria and an impermeable barrier to urinary solutes [47 ]. we believe that incontinence, recurrent urinary tract infections, and interstitial cystitis are related directly to estrogen levels. low estrogen can induce a significant decrease in blood flow to the bladder especially in the mucosa resulting in free radical generation (oxidative stress) and a breakdown in mucosal integrity [810 ]. the etiology of these dysfunctions involves an increase in urothelial permeability and the movement of urinary solutes such as ions and other caustic substances from the urine into the mucosa, submucosa, and muscle. this results in both the increased permeability and free radical damage to cellular and subcellular membranes including the mitochondria, sarcoplasmic reticulum, and synaptic membranes [11, 12 ]. beneath the urothelium and sometimes protruding through the basal laminae is a rich network of capillaries, the suburothelial capillary plexus. our current studies, and those of others, show that urothelial function is severely compromised by both ischemia and hypoxia [3, 10, 14 ]. furthermore, in vitro and in vivo rabbit models have demonstrated that bladder distention in the presence of mild hypoxia and ischemia causes increased mucosal permeability and the generation of reactive oxygen species of free radicals (ros) and reactive nitrogen species of free radicals (rns). these factors together suggest that mucosal permeability is related to relative changes in oxygen tension and reduced blood flow. there is a significant reduction in local blood flow to the mucosa in patients with interstitial cystitis (ic) when compared with non - ic patients especially during bladder distention [17, 18 ]. clinically, the symptoms of pain and urgency of patients with ic are induced by distention and relieved by voiding of the bladder. we believe this is because ischemia and hypoxia of the bladder can affect sensory nerve membranes which lead to pain activation. these data are consistent with the hypothesis that bladder distention induces relative mucosal ischemia which increases mucosal permeability and the generation of free radicals. as mentioned above, alterations in estrogen levels can significantly affect bladder blood flow to the lower urinary tract as it does to the vagina and uterus. estrogen has been shown to increase blood flow to the bladder and urethra, while low estrogen reduces blood flow below normal inducing ischemia and hypoxia [9, 10, 14 ]. studies have demonstrated that ovariectomy in rabbits results in a significant decrease in blood flow to the bladder detrusor smooth muscle and mucosa. this caused increased mucosal permeability, increased free radical generation, decreased bladder and urethral contraction, and decreased bladder function [8, 19 ]. however, estrogen administration to ovariectomized rabbits resulted in the relief of mucosal and detrusor hypoxia, mucosal hyperplasia, and restoration of the mucosal permeability barrier as well as reduced oxidative stress [9, 10, 14 ]. we utilize two in vitro models of oxidative damage. in the first model of ischemia / reperfusion (i / r), isolated strips of bladder are subjected to ischemic conditions by exposure to media equilibrated with nitrogen instead of oxygen and without glucose for a period of time. the strips are then allowed to recover in the presence of oxygen and glucose to simulate reperfusion. the second model involves the direct exposure of isolated bladder strips to hydrogen peroxide (h2o2). this would occur physiologically if the activity of superoxide dismutase (sod) increased above the ability of catalase to neutralize the product of sod activity, which is h2o2. our specific aim of the current study is to directly compare the effects of exposure to h2o2 to that of i / r. all methods were approved by the institutional animal care and use committee of the stratton va medical center, albany, ny, usa. six adult female new zealand white rabbits (approximately 3.5 kg each) were divided into two groups of three rabbits each. the bladder was rapidly removed and weighed and the rabbit euthanized with 2 ml fatal plus euthanasia fluid iv. five strips of the bladder body and three strips of the base urethra from each bladder were taken for physiological testing. the balance of the bladder and urethra was separated by blunt dissection and frozen under liquid nitrogen and stored at 80c for biochemical analyses. full thickness, longitudinal strips of the bladder body, and base - urethra were mounted in individual 15 ml baths containing oxygenated tyrode 's solution at 37c. contractility studies on strips were performed as follows (in vitro i / r experiment). each strip was set at 2 g passive tension and stimulated with field stimulation (fs : 2 hz, 8 hz, 32 hz, 1 ms duration for 20 seconds with 3 minutes in between stimulations). carbachol (20 m) was then individually administered to each strip for a 3-minute exposure followed by three washes 5 minutes apart with fresh buffer. field stimulation was used to mimic neurotransmitter stimulation of muscle contraction through neurohumoral receptors. after control stimulations, the bath was then changed to tyrode 's solution without glucose and equilibrated with 95% nitrogen and 5% carbon dioxide for 1 hour with stimulation at 32 hz every 5 minutes. the buffer was then changed back to normal, oxygenated tyrode 's with glucose, and the strips were allowed to recover for two hours. the strips were then stimulated as originally described and then cut, weighed, and frozen in liquid nitrogen for biochemical analyses. a sample of physiological buffer (1 ml) was taken after each stimulation and before and after the ischemic period. contractility studies on strips from the remaining three rabbit bladders were performed as follows (in vitro h2o2 experiment). the tissues were stimulated by field stimulation (fs : 2 hz, 8 hz, 32 v, 1 ms duration for 20 seconds with 3 minutes in between stimulations) and carbachol (20 m) individually administered to each strip for a 3-minute exposure. after carbachol, the strips were washed two times at 10-minute intervals with fresh, oxygenated tyrode 's solution. after the second wash, 0.1% h2o2 was added for a ten - minute incubation, and the tissues were stimulated again by fs and carbachol. this process was repeated for 0.2%, 0.4%, and 0.8% h2o2. a sample of physiological buffer (1 ml) was taken after each carbachol stimulation and frozen under liquid nitrogen for further biochemical analyses. total antioxidant levels of the tissue, experimental strips, and physiological buffer samples were quantified by the cupric ion reducing antioxidant capacity (cuprac) assay [22, 23 ]. malondialdehyde levels of the tissue and experimental strips were quantified using a tba - based assay [24, 25 ]. one - way analysis of variance was used to determine if significant differences were present among the groups, and the tukey test was used to compare individual groups. the contractile responses of the bladder body and base - urethra tissue are presented in figure 1. the responses of the base - urethral strips to 8 and 32 hz were significantly higher than the responses of the bladder body strips for each stimulation. figure 2 shows the contractile responses after recovery from ischemia / reperfusion (i / r) as the percent of the control response (before i / r). whereas the recovery of the strips to field stimulation reached only 20% of the control response, the recovery of carbachol reached 60% of control. the recovery of the base - urethral strips was significantly higher to field stimulation than were the bladder body strips. figures 3 and 4 show the responses of the bladder body (figure 3) and base - urethra (figure 4) to h2o2. h2o2 produced a progressive decrease to all forms of stimulation to approximately the same level for both tissues except for the 32 hz stimulation which was less sensitive to h2o2 than all other forms of stimulation. interestingly, carbachol was more sensitive to hydrogen peroxide than it was to i / r. malondialdehyde (mda) is a biomarker for peroxidative damage to lipids [24, 26, 27 ]. in both in vitro i / r and h2o2 experiments, mda levels were significantly elevated in the experimental strips compared to control tissue with higher levels seen in the oxidized base - urethra compared to the bladder body. significantly, higher levels were seen in the h2o2 experiments than in the i / r experiments (figure 5). the total antioxidant activity levels (aa) for all tissue in both experiments did not differ significantly. the data has been normalized to control = 100 to allow for a better view of the effect of oxidation on the aa (figure 6). it should be noted however that aa of the h2o2 oxidized tissues were significantly lower than the aa of the oxidized i / r tissues. the aa of the organ bath buffer were elevated in the in vitro h2o2 experiment when the concentration of h2o2 was increased above 0.2%. the aa at 0.4% and 0.8% h2o2 for both bladder body and urethra - base were significantly higher than the control levels (figure 7). the aa of the organ bath buffers from the i / r experiment were not significantly higher than control (figure 8). the specific aim of the current study was to directly compare the two models of in vitro oxidative damage. the data from our contractility studies revealed that the two models have very different effects on the contractile responses to fs and to carbachol. the response to fs was inhibited to a significantly greater degree than to carbachol in the i / r experiment than the h2o2 experiment. h2o2 produced a similar decrease in bladder tissue contractility response to both carbachol and field stimulation. the significance of this is that i / r targets the synapse and synaptic transmission to a greater extent than it does the muscarinic receptor or the cell membrane, whereas h2o2 targets the synapse equally to the muscarinic receptor. furthermore, our biochemical analyses revealed that mda levels were significantly higher for both bladder body and base - urethra in the hydrogen peroxide experiment when compared to those of the i / r experiment. mda is a biomarker for oxidative damage and a product of fatty acid lipid peroxidation induced by reactive oxygen species [24, 26, 27 ]. interestingly, in the h2o2 experiment the generation of mda in the base - urethra tissue was significantly higher than the body tissue. in the i / r experiment, the mda response was approximately the same for the two tissues showing another difference in the responses to the two forms of oxidative stress that were utilized. since the h2o2 is added to the organ bath in the contractile studies, the intracellular oxidative effects can not be directly compared to the i / r induced oxidative stress. physiologically, superoxide dismutase (sod) will metabolize superoxide to hydrogen peroxide (h2o2), which in turn will be converted to o2 and h2o by catalase. pathological conditions can significantly alter the concentrations of sod and catalase and thus result in the accumulation of h2o2 which is a strong oxidant capable of causing oxidative damage. both models have been utilized in experimental models of oxidative stress in the bladder [29, 30 ]. it should also be noted that at higher concentrations of h2o2 (above 0.2%), total antioxidant levels (aa) were elevated in the organ bath buffers, while levels in the i / r experiments remained constant. the fact that the aa of the oxidized tissues from the h2o2 experiments was significantly higher than the aa of the oxidized tissue from the i / r experiment is consistent with the leakage of the aa from the tissue to the bath in the h2o2 experiments. consistent with this is the demonstration that in the h2o2 experiments, the aa concentrations of the oxidized tissues were significantly lower than the oxidized tissues of the i / r experiment. both forms of in vitro oxidative stress resulted in significant decreases in contractility and increased lipid peroxidation. however, the results clearly demonstrate that i / r and h2o2 act significantly differently on the bladder and thus should not be used interchangeably. in general, since in vivo models of bladder dysfunction such as partial outlet obstruction inhibit field - stimulated contraction to a significantly greater degree than carbachol and kcl inhibit, it shows that in vitro ischemia / reperfusion would be closer to obstructive bladder dysfunction than h2o2. | introduction. there are several bladder dysfunctions that are associated with oxidative stress to the urinary bladder. two experimental models are known to cause this type of bladder damage. the first is direct oxidative damage caused by hydrogen peroxide (h2o2). the second is oxidative damage caused by ischemia followed by reperfusion (i / r). the specific aim of this study is to directly compare these two models of oxidative stress. methods. six adult female nzw rabbits were divided into two groups of three rabbits each. eight full thickness strips from three rabbit bladders were taken for in vitro ischemia / reperfusion physiological analysis, while eight strips from three rabbit bladders were taken for in vitro h2o2 physiological analysis. all tissue was analyzed for total antioxidant activity (aa) and malondialdehyde (mda) levels. in addition, samples of the water baths were also analyzed for aa. results. in vitro i / r reduced the response to field stimulation (fs) to a significantly greater extent than the inhibition of the response to carbachol. in vitro h2o2 decreased all responses to approximately the same degree. total aa levels at higher concentrations of h2o2 for all bath fluids were significantly higher than controls. mda levels were significantly elevated in both models of oxidative stress. |
ventricular enlargement following head injury is a frequent finding but cases that require shunt operation are relatively rare.2) hydrocephalus following traumatic brain injury (tbi) or post - traumatic hydrocephalus (pth) is not just a ventricular enlargement but an active and progressive disorder of cerebrospinal fluid (csf) accumulation in the ventricular system, causing compression of the brain parenchyme.4) it increases the rates of morbidity and mortality in tbi patients, but it is a treatable complication of tbi.11420) most patients with pth underwent shunt operation have had favorable outcomes.20) many studies have reported various incidences and risk factors, under different diagnostic criteria, but few studies have focused on factors influencing outcome of shunt operation for pth. in this study, we analyzed the incidence, major clinical injuries prior to shunt operation, and factors influencing outcome of shunt operation for patients diagnosed with hydrocephalus following tbi at our institution. from january 2007 to december 2012, the subjects were the 1,142 consecutive patients suffering from tbi. the main diseases / conditions were skull fracture, cerebral contusion (including diffuse axonal injury) or traumatic intracerebral hematoma (t - ich), epidural hematoma (edh), subdural hematoma (sdh), and traumatic subarachnoid hemorrhage (t - sah). 23 patients underwent shunt operations. the presenting symptoms or syndrome for considering shunt operation were mental deterioration during improvement, failure to improve (neurologic plateau) for unconscious patients, decline in functions of daily living, headache, gait disturbance, urinary incontinence, confusion, and emotional lability etc. all patients were checked or followed up serially by brain computed tomography (ct), brain magnetic resonance imaging (mri), radionuclide isotope (ri) cisternography, and serial lumbar drainage (20 to 40 cc per drainage, 1-day to 1-week intervals, more than twice). indicated brain ct findings were ventricular enlargement with periventricular low density, cortical sulci effacement, and basal cistern obliteration. the outcomes of shunt operation were evaluated with the glasgow outcome score (gos) (table 1). evaluation times were just before the shunt operation, and at 14 days, 3 months, and 6 months after the shunt operation. the 23 (2.01%) analyzed subjects were those who underwent shunt operation among 1,142 tbi patients. thus, males were about three times more common than females, but this did not differ from the whole tbi patient group (2.6:1). for the main clinical disease, sdh was the most common (56.5%), followed by t - sah (21.7%), and t - ich or cerebral contusions (17.4%), in that order (table 2). among the 23 pth patients, 16 had undergone open cranial operation for the removal of hematomas before the shunt operation (figure 1). one was ventriculoperitoneal and the other was shunt malfunction. the interval between trauma and shunt operation was analyzed : 2 within 1 month, 7 in a 1 - 2 months (most common), 3 in 3 months, 4 in 4 months, 2 in 5 months, 1 in 6 months, and 4 after over 6 months. among them, 1 patient was followed for 1 to 2 years and underwent shunt operation (figure 2). in the analysis of outcomes related the interval time of shunt operation, 2 of 2 who underwent shunt operation within 1 month improved, 8 of 9 who underwent the operation in 1 to 3 months improved, and 10 of 12 who underwent the operation after 3 months also improved. thus, it seemed that the interval time between shunt operation and trauma had no effect (p>0.05). outcomes related to csf pressure at lumbar spinal tapping prior to shunt operation were analyzed. the group was divided into two : csf pressure above and below 160 mmh2o.13) of 15 patients who showed csf pressures below 160 mmh2o, 13 improved, as did 7 of 8 patients who had csf pressures above 160 mmh2o (p=0.955). thus, intracranial pressure (icp) prior to the shunt operation also seemed to have no significant relationship with prognosis. the glasgow coma scale (gcs) score at admission was classified as gcs 5 to 8, 9 to 12, and 13 to 15 groups. two of 4 (8.7%) in the gcs 5 to 8 group, 7 of 8 (4.4%) in the gcs 9 to 12 group, and all patients in the 13 to 15 group improved (p=0.039, which is statistically significant). thus, initial gcs score would seem to be related to the outcome of shunt operation. the interval between trauma and shunt operation was analyzed : 2 within 1 month, 7 in a 1 - 2 months (most common), 3 in 3 months, 4 in 4 months, 2 in 5 months, 1 in 6 months, and 4 after over 6 months. among them, 1 patient was followed for 1 to 2 years and underwent shunt operation (figure 2). in the analysis of outcomes related the interval time of shunt operation, 2 of 2 who underwent shunt operation within 1 month improved, 8 of 9 who underwent the operation in 1 to 3 months improved, and 10 of 12 who underwent the operation after 3 months also improved. thus, it seemed that the interval time between shunt operation and trauma had no effect (p>0.05). outcomes related to csf pressure at lumbar spinal tapping prior to shunt operation were analyzed. the group was divided into two : csf pressure above and below 160 mmh2o.13) of 15 patients who showed csf pressures below 160 mmh2o, 13 improved, as did 7 of 8 patients who had csf pressures above 160 mmh2o (p=0.955). thus, intracranial pressure (icp) prior to the shunt operation also seemed to have no significant relationship with prognosis. the glasgow coma scale (gcs) score at admission was classified as gcs 5 to 8, 9 to 12, and 13 to 15 groups. two of 4 (8.7%) in the gcs 5 to 8 group, 7 of 8 (4.4%) in the gcs 9 to 12 group, and all patients in the 13 to 15 group improved (p=0.039, which is statistically significant). thus, initial gcs score would seem to be related to the outcome of shunt operation. pth as a clinicopathologic entity has been recognized since dandy and blackfan 's report6) in 1964. the incidence rates of symptomatic pth in the literature vary widely, ranging from 0.7% to 29%.3912) if the ct criterion of ventriculomegaly is used, the reported incidence ranges from 30% to 86%.1018) gudeman.10) reported the incidence of ventricular enlargement after tbi between 1.5% to 29%, when evaluated by ct. but the incidence rate of pth requiring shunt operation was only 1% to 4%.2) in the present study, 1,142 patients were admitted to our institution following significant head trauma. of them, tribl and oder20) reported that out of 3,426 severe head - injury patients, 48 (1.4%) underwent implantation of ventricular shunt. risk factors for pth are not yet fully identified but data suggested severity of injury, age, duration of coma, and decompressive craniectomy (dc) increased the risk.5) previous studies suggested that factors such as altered icp dynamics, mechanical blockage, and inflammation of the arachnoid granulation by postsurgical debris may induce pth.781721) waziri.21) suggested that dc may play a role in the flattening of the normally dicrotic icp waveform in patients having the procedure, due to the transmission of the pressure pulse out through the open cranium. the size of dc and repeated operation may promote pth in severe head trauma patients who undergo dc.4) in the present study, 16 (70%) patients underwent decompressive operation before shunt operation. general risks related to shunt surgery include infection, bleeding, csf leakage, seizures, and neurological deficits. there is an estimated 3% to 4% risk for intracerebral hemorrhage and an estimated 1% to 2% risk for coma and mortality.14) in contrast, tribl and oder20) reported that 15 (31.3%) patients showed postoperative complication. reasons for the low incidence of complications may be affected by the small number of patients and short follow - up period. sah has been cited as the most important pathology leading to the development of pth.1314) we found sdh in 13 (56.5%) patients and sah in 5 (21.7%). of the 23 patients, 22 (96%) had intradural pathology. for skull fracture patient sdh was the most commonly found issue in initial ct scans in pth patients who underwent shunt operation. the reason that sdh is the most common preceding injury for shunt operation suspected that sdh is the largest number of intradural lesion in our tbi pool (table 2). one of the predictive parameters for outcome after shunt implantation appeared to be pre - operative clinical status. patients in better clinical condition generally had a better outcome.1420) in the gcs 13 - 15 group, 11 (100%) patients showed improved outcomes. however, in the gcs 5 to 8 group, 2 (50%) patients showed improved outcomes. his patients in a better pre - operation level of gos 3 improved in 63.3% of cases, whereas 36.7% did not improve. however, only one - third of patients with gos 2 before shunt implantation improved within 3 months ; two - thirds did not. all current neurosurgical and neurocritical care interventions target the delayed effects of secondary injuries and secondary insults. more severe brain injury occurred more often after the development of pth. even though the csf flow disorder was treated by the shunt surgery, so, higher gcs patients improved after the shunt operation. in our study, all patients were evaluated by brain ct and ri cisternography. the initial lumbar csf pressures were divided two groups, less than 160 mmh2o (15 patients) and higher than 160 mmh2o (8 patients).13) in the less than 160 mmh2o group, 13 (56.2%) patients showed improved outcomes. in the higher than 160 mmh2o group, 7 (30.4%) patients showed improved outcomes. this result is consistent with the results reported by kim.14) they reported outcomes of 64 pth patients requiring shunt. symptoms improved after shunt operation in 46 patients (90%) with normal pressure hydrocephalus. this outcome was better than the improvement seen in only 6 (46.1%) patients who had higher than 180 mmh2o of spinal pressure before the shunt operation. the timing of treatment also remains controversial.11) pth can present acute, subacute, and syndrome of normal pressure hydrocephalus. kishore.15) reported that more than 93% of cases of ventriculomegaly presented within 2 weeks post - injury. marmarou.16) suggested that most cases of ventriculomegaly will present by 1 month post - injury. most of our patients received shunt operation within 6 months after trauma. in this study, interval time and postoperative improvement showed no correlation. on the other hand, this result showed that most patients were improved after shunt operation, regardless of the operation interval time. wood.22) insisted that patients with clinical symptoms of hydrocephalus for less than 6 months had a better prognosis. however, sheffler.19) presented a case of pth that improved with a shunting procedure after having clinical symptoms of pth for 11 months after a closed head injury. brain injury patients commonly have other severe injuries (e.g., long bone fracture, intestine organ rupture). for these patients, we often found pth in patients with head trauma during the follow - up period. in these cases, contrary to assuming a poor prognosis due to the possibility of delayed shunt surgery, we suggest to do shunt operation regardless of the interval time with trauma. finally, this study has the limitations of being a retrospective study with a small sample size and lack of natural history of pth. however, we found no correlation between the outcome of shunt operation and initial lumbar csf pressure or the interval time of the shunt operation after the trauma. | objectiveventricular enlargement following head injury is a frequent finding but cases requiring shunt operation are rare. the incidence and developing factors of post - traumatic hydrocephalus (pth) have been variously reported, but studies for factors influencing outcomes of shunt operation for pth are rare. the incidence of pth requiring shunt operation, causing injuries, and factors influencing outcome of shunt operation need to be identified.methodsin total, 1,142 patients suffering from traumatic brain injury (tbi) between january 2007 and december 2012 were admitted to our department. of them, 23 patients underwent shunt operation for diagnosed pth. in this clinical study, we reviewed retrospectively our tbi database and in the 23 patients, we evaluated outcomes with glasgow outcome score just before the operation, at 14 days, 3 months, and 6 months according to initial glasgow coma scale (gcs) score, interval time between shunt operation and trauma, and lumbar cerebrospinal fluid (csf) pressure.resultsthe incidence of pth treated with shunt operation was 2.01%. subdural hematoma (sdh) was the most common preceding head injury. the outcomes of shunt operation were not related with lumbar csf pressure or interval time from trauma, but initial gcs score correlated with the outcome.conclusionin present study, 2.01% of tbi patients underwent shunt operation. sdh was the most common preceding injury. admission gcs score was related to the outcome of shunt operation. however, there were no correlation between the outcome of shunt operation and initial lumbar csf pressure or interval time of shunt operation after the trauma. |
the reported frequency of patients with obstructive colon cancer has ranged from 8% to 29% (3). left - sided colon malignancies are more prone to obstruct the colon lumen than are the right - sided malignancies. this is because the diameter of the left colon is smaller than that of the right colon. ct is a sensitive imaging modality for detecting bowel obstruction, and the multiplanar reconstruction images can provide additional information on the transition point in problematic cases (1). identifying the transitional zones and an obstructing lesion on ct, and these usually appear as irregular circumferential thickening of the colon, is important to differentiate this entity from other benign conditions such as adynamic ileus, colonic pseudoobstruction and stercoral colitis, and all these maladies can present with colonic dilatation. because of the relatively larger diameter of the cecal lumen, cecal adenocarcinomas have a tendency to grow without displaying clinical manifestations for a long time (4) therefore, cecal cancer only infrequently presents as bowel obstruction ; as the initial manifestation, distal small bowel obstruction has been reported to occur in 1.5 - 8.1% of the patients with cecal cancer (5). additionally, adenocarcinoma developing near the ileocecal valve area can cause distal small bowel obstruction even though the tumor is small (fig. ct is also useful for examining cecal cancer patients who present with small bowel obstruction. careful inspection of the cecum on the ct, and especially the ileocecal valve area, is needed to diagnose this rare condition. closed - loop obstruction is a unique form of mechanical obstruction in which two points of a bowel segment are occluded, and this most frequently occurs in the small bowel (6). on rare occasion an obstructing colon cancer with a competent ileocecal valve can lead to the condition in which the intraluminal pressure of the colon proximal to the obstructing mass increases due to failure of decompression through the ileocecal valve ; this produces effects that are similar to those of a closed - loop obstruction in the small bowel (7). on ct, this condition can be identified as an obstructive colon mass that causes severe dilatation of the proximal colon (fig. the affected colon is usually filled with fecal material, and the small bowel is not dilated due to a competent ileocecal valve. radiologists and surgeons should be aware of a closed - loop obstruction associated with colon cancer because this is an urgent surgical situation that can lead to a perforated colon. perforation occurs in 2.5 - 10% of the patients with colon cancer (8, 9). perforated colon cancer can present as a free perforation with peritoneal spillage or as a localized perforation with an abscess or fistula formation (9) (figs. 3, 4). in addition, perforation can occur at the site of the colon cancer secondary to tumor necrosis or the adjacent inflammation, or it can occur at the proximal portion of the colon cancer due to the increased pressure proximal to the tumor (3) (figs. 3, 4). perforated colon cancer can occasionally cause fistula formation between the colon and the adjacent organs such as the urinary bladder, the female genital tract or the bowel. the various potential causes of colonic perforation include malignant neoplasm, diverticulitis, trauma, ischemia, inflammatory bowel disease and stercoral colitis (10). perforation of the colon that is induced by these causes can be diagnosed by ct with the demonstration of a focal defect in the colon wall that may be accompanied by a fluid - density abscess, free air or stranding of the pericolic fat. in order to differentiate colonic perforation that is caused by cancer from that caused by various benign conditions, identifying the irregular wall thickening of the adjacent colon is critical for making the diagnosis of an underlying colon cancer. ct has been reported to be an effective modality for detecting perforated colorectal cancer because it reveals pericolic inflammatory changes and abscess formation, as well as a colorectal mass (8). however, in some cases, identification of severe pericolic inflammation with a large abscess or peritoneal spillage may make it difficult to make an accurate diagnosis because these situations can mimic various conditions that cause perforation of the colon. although it is still a matter of debate whether perforation can cause peritoneal seeding, making an early, accurate diagnosis and administering aggressive treatment might improve patient survival (3). abscess formation associated with colon cancer is a rare complication that occurs in 0.3 - 4% of the patients with colon cancer (11). perforation of the colon, fistula formation between the colon and adjacent structures, or direct tumor invasion can result in the formation of an abscess. the most common location for abscess formation is the peritoneal cavity, including the paracolic space and the pelvic cavity (figs. 3, 5) ; however, fistula formation or inflammation that spreads along the tissue planes may lead to abscesses in unusual locations such as the retroperitoneum, the abdominal wall, the perirectal space, the psoas muscle and the thigh (11 - 13) (figs. 6, 7). in the cases that present with these unusual clinical findings, making the accurate diagnosis of an underlying colon cancer may be more difficult. further, abscess - forming colon cancers that occur in the right lower quadrant or the pelvic cavity can be mistaken for inflammatory conditions, including diverticulitis, appendicitis with perforation and pelvic inflammatory disease. relatively severe pericolic fat stranding adjacent to a thickened colon wall is generally the most significant ct finding for differentiating inflammatory diseases from colon cancer that is without perforation or abscess (4, 14). however, if perforation or abscess is present in patients with colon cancer, then physicians can be faced with diagnostic uncertainty with a ct finding of severe pericolic fat stranding. evaluation and characterization of a thickened bowel wall is needed in this situation ; marked asymmetric wall thickening with loss of stratified enhancement that involves a short segment of the colon favors the diagnosis of an underlying malignancy, while preserved layering of a thickened bowel wall is an important feature favoring the diagnosis of benign inflammatory conditions (4, 14). moreover, an abrupt transition from a normal to an abnormal bowel wall is characteristic of malignancy, whereas a smooth, gradual, long transition is usually present in benign conditions (4). the presence of pericolic lymphadenopathy is more commonly found in colon cancer than it is in benign conditions (4, 14). therefore, in cases that display the confusing manifestations of severe pericolic fat stranding, the physician must perform a morphologic analysis of the abnormal bowel, including determining the enhancement pattern, the length of the abnormal bowel, the wall thickness at the site of interest and the transition from a normal wall to an abnormal wall. in patients with mucinous carcinoma of the colon or appendix, the hypoattenuated areas caused by extracellular mucin components can sometimes mimic the appearance of an abscess. it has also been reported that for colon cancer patients who present with an abdominal wall abscess, many cases were a mucinous carcinoma, and this is thought to be due to the tumor characteristics ; mucinous carcinomas have a tendency to grow slowly and to spread by direct extension (12). the presence of intratumoral calcification and the relative absence of pericolic fat stranding can be useful for differentiating a mucinous carcinoma from an abscess (fig. yet the overlap in the imaging appearances often complicates differentiating an abdominal wall abscess from abdominal wall invasion by a mucinous carcinoma (fig. cecal cancer infrequently presents as an acute appendicitis with or without abscess formation (11, 15). cecal cancer has been found to be a cause of acute appendicitis in 10 - 25% of elderly patients and in only 3% of the patients between the ages of 20 and 40 years (11, 15). making an accurate preoperative diagnosis can be difficult because the affected patients clinically present with acute abdominal symptoms that are compatible with an acute appendicitis. therefore, identifying the cecal wall thickening with a loss of the layered enhancement patterns in patients with the clinical and imaging findings of an acute appendicitis should raise a suspicion for an underlying cecal cancer as the cause of the appendicitis (fig. 10). in patients with acute appendicitis and who do not have cecal cancer, the appendiceal wall inflammation can occasionally extend directly to the cecum, resulting in cecal wall thickening. cecal wall thickening that appears as focal wall thickening at the cecal apex contiguous with the appendix has been reported to be present in 80% of the patients with acute appendicitis (16). colonic wall thickening proximal to a colon mass is known as ischemic or obstructive colitis, and this had been reported to be present in 1 - 11% of the patients with obstructive colon cancer (17, 18). although bowel ischemia induced by bowel distention is generally regarded as the mechanism that is involved in the development of colon wall thickening, this can occur in patients who are without obstruction of the colon. moreover, one report showed that many of these changes in the colon were pathologically confirmed to be submucosal edema rather than frank bowel ischemia (18). colon ischemia or submucosal edema can manifest on ct as smooth, annular wall thickening with a homogeneous or layered enhancement pattern that is frequently contiguous with an irregularly thickened tumorous segment (17, 18). some patients (10 - 30%) occasionally have intervening normal mucosa between the tumor and the ischemic segment ; this can be explained by the laplace law ; the tension applied to the bowel wall increases proportionately to an increase in both the intraluminal pressure and the wall diameter (17, 18) (fig.. a segmental distribution of colon wall thickening that is distal to a large fungating mass can also be present in approximately 10% of patients with colon cancer, and this pathologically corresponds to edema or colitis (19) (fig. 12). because bowel ischemia or edema commonly occurs in cases that have obstructing or large fungating masses, this secondary ischemic change can be easily distinguished from primary ischemic colitis although intussusception is rare in adults, the majority of adult intussusceptions are caused by lead points (20), and more than half of the patients with colon intussusceptions are related to malignant lesions such as adenocarcinoma, lymphoma or metastatic lesions (20). adenocarcinoma of the colon is the most common lead mass for colon intussusceptions, and it can present as the ileocolic or colocolic forms (figs. 13, 14). the ct demonstration of a bowel - within - bowel configuration with or without contained mesenteric fat or mesenteric vessels is considered pathognomonic for intussusceptions. a colon cancer can usually be identified as an enhancing mass within intussusceptions ; however, identification of a lead mass is not always possible due to an edematous bowel wall (4, 20). in a previous study that used a multidetector - row ct scanner, the investigators reported that a lead mass could be distinguished from an edematous bowel in approximately 70% of the cases (21). in addition, they found that those intussusceptions with a lead point tended to be longer and larger in diameter as compared with the intussusceptions without a lead point ; mechanical obstruction and pericolic infiltration were also valuable signs for determining the presence of a lead point (21). an accurate preoperative diagnosis of these conditions is critical to ensure that prompt, proper, treatment is administered. a variety of complicated situations can obscure making the diagnosis of underlying colon cancer, and the imaging features of colon cancer overlap with those imaging features of other pathological conditions. being knowledgeable of the potential imaging findings of complicated colon cancers can help physicians arrive at an accurate diagnosis and then administer the appropriate treatment. | a broad spectrum of colonic complications can occur in patients with colon cancer. clinically, some of these complications can obscure the presence of underlying malignancies in the colon and these complications may require emergency surgical management. the complications of the colon that can be associated with colon cancer include obstruction, perforation, abscess formation, acute appendicitis, ischemic colitis and intussusception. although the majority of these complications only rarely occur, familiarity with the various manifestations of colon cancer complications will facilitate making an accurate diagnosis and administering prompt management in these situations. the purpose of this pictorial essay is to review the ct appearance of the colonic complications associated with colon cancer. |
allogenic blood transfusion (abt) is a life - saving procedure in many clinical situations. however, abt can result in unpredictable clinical consequences and risks despite technical improvements to reduce such problems. a study evaluated transfusion management procedures in elective orthopedic surgeries, particularly hip and knee arthoplasties, and identified the benefits of autologous blood transfusions over abt. several recent reports have indicated that perioperative erythropoietin in conjunction with intravenous iron sucrose supplementation is an effective alternative to abt. however, there are no guidelines for its dosage and safety limits. preoperative autologous blood donation with high dose erythropoietin, although clinically optimal, is quite costly further, individual perioperative blood loss is unpredictable and therefore concerns regarding the cost - effectiveness and the safety of autologous blood donations exist. we present a case in which we managed unexpected and severe bleeding after a total hip replacement arthroplasty (thr) without a blood transfusion. we used a combination of high dose intravenous iron sucrose and moderate to low doses of erythropoietin as previously described. an 80-year - old woman presented to our clinic with intractable left hip pain and magnetic resonance imaging (mri) revealed avascular necrosis of the femoral head. a total hip arthroplasty was recommended. the patient refused to donate blood for an autologous blood transfusion as a result of her religious beliefs. other laboratory results including complete blood count, aspartate aminotransferase, alanine transaminase, blood urea nitrogen, creatinine, prothrombin time and activated partial thromboplastin time were all within normal range. a chest radiograph showed left pleural adhesions and regional parenchymal fibrotic changes, which were most likely sequelae from prior pulmonary tuberculosis. electrocardiogram, 2-d echocardiography, and carotid doppler studies revealed no significant findings except for aging changes in the aortic valve and relaxation abnormalities. despite her age, elective total hip arthroplasty was scheduled because of her good general health, lack of anemia, and lack of risk factors contributing to ischemic complications. aprotinin was administered perioperatively from the procedure induction to 6 hours postoperatively until there was no significant drainage from the surgical site. however, massive blood loss put the patient in a hypovolemic and hypotensive status postoperatively despite efforts to minimize bleeding. postoperative hemoglobin decreased to 6.4 g / dl from the preoperative measurement of 12.2 g / dl. the patient refused an allogenic blood transfusion and therefore intravenous iron sucrose (venoferum, choongwoe co., seoul, korea) administration was initiated. a dose of 100 mg of iron sucrose diluted in 100 ml of normal saline was administered intravenously over 1 hour twice per day up to 700 mg of cumulative dosage from the day of surgery to the third postoperative day. additionally, 2,000 iu of recombinant erythropoietin (recormon, choongwoe co.) was injected every other day with a daily supply of iron sucrose vitamin b12, vitamin c, and folic acid. dalteparin was administered at a dose of 5,000 iu per day to prevent deep vein thrombosis. hemoglobin level decreased to 5.3 g / dl on the fourth postoperative day (table 1). further injection of 200 mg of iron sucrose in 200 ml of normal saline was administered twice per day on the fourth and fifth postoperative days. a total of 1,500 mg of iron sucrose was administered intravenously for 6 consecutive days. the patient complained of mild chest discomfort and dyspnea after the last dose of iron sucrose, and this was most likely a side effect of intravenous iron sucrose which resolved with a 50 mg hydrocortisone injection. on the seventh postoperative day, the patient had a hemoglobin of 6.4 g / dl on and was able to walk with assistance. there were no significant complications or residual side effects of high dose intravenous iron sucrose or erythropoietin therapy. the final dose of erythropoietin was administered on the twelfth postoperative day with a hemoglobin of 8.5 g / dl (fig. 1), a corrected reticulocyte count of 2.64%, a transferrin saturation of 30%, and a ferritin level of 906 ng / ml. total dose of erythropoietin was 12,000 iu which was equivalent to 40 iu / kg for a single dose and 240 iu / kg for the cumulative dose. the patient was discharged in good condition with oral doses of vitamin b12, vitamin c and folic acid. the patient presented for follow - up on the twentieth postoperative day with a hemoglobin of 11.2 g / dl and no clinical complications. studies have demonstrated the safety of intravenous iron sucrose over intravenous iron sucrose dextran. the dextran molecule, which acts as a carbohydrate antigen, causes severe transfusion reactions and even fatalities. recent reports have suggested the role of perioperative intravenous iron sucrose in enhancing the safety of allogenic blood transfusions. intravenous iron sucrose doses did not exceed 400 mg perioperatively with single injection doses of erythropoietin as high as 40,000 iu in previous studies. we reported relatively high doses of parenteral iron sucrose and low doses of erythropoietin in the management of an anemic patient who refused an allogenic blood transfusion. the typical dose of parenteral iron sucrose can be as high as 200 mg without significant side effects in surgical or dialysis patients and these patients received recombinant erythropoietin at single doses of 300 iu / kg or cumulative doses of 40,000 iu / wk. clinical conditions such as inflammation result in inadequate erythropoietin production and function. however, additional reservoirs of erythropoietin in the patient with normal renal function are stimulated in hypoxic conditions. therefore, conditions which result in relative erythropoietin deficiency might benefit from the administration of low dose erythropoietin. this low dose erythropoietin could correct anemia and prove to be cost - effective with an adequate supplement of available iron sucrose in the acute clinical setting. the inflammatory status of the postoperative patient affects iron sucrose metabolism and is mediated by several cytokines. the cytokine hepcidin, which is important in familial hemochromatosis, plays a chief role in the impairment of iron sucrose utilization in the clinical setting. it is a negative regulator for both iron sucrose absorption in the gut and iron sucrose release from macrophages in its role in anemia of chronic illness. physiologic reduction of serum iron sucrose could serve as a protective strategy against bacteria since limitation of available iron sucrose creates an inhospitable environment in bacterial infection. however, hepcidin limits iron sucrose utilization and enhances iron sequestration, and therefore baseline exogenous iron supplementation would not result in adequate levels of available iron for bone marrow erythropoiesis, particularly if stimulated by exogenous erythropoietin. further, both decreased gut absorption of iron and sequestration of iron mediated by hepcidin suggest a particular benefit of parenteral iron as compared with oral iron supplementation. erythropoietin accelerates the erythropoiesis in its role as an anti - apoptotic cytokine and is involved in protection against ischemic insults including strokes or renal injuries. erythropoietin receptors are located in the bone marrow, heart, brain, and kidney, which explains the nonhematologic effects of erythropoietin. there may be a role for erythropoietin in the management of the hypovolemic and ischemic patients because of its protective and anti - ischemic activity. erythropoietin could serve as a bridge to maintain hematocrit from the time gap between blood loss and hemoglobin increase. although it is not indicated in general critical cases, it may have a role as an adjunct therapy in the management of the anemic patient to reduce the rate of abt. vitamin c has an active role in the release of sequestrated iron from reticuloendothelial cells and therefore facilitates the erythropoietin response. favorable effects of parenteral iron treatment combined with vitamin c administration also suggest that vitamin c contributes to decreased oxidative stress as an antioxidant, may reduce iron - overload toxicity, and may decrease the total body iron requirement. we believe that the administration of vitamin c in our patient, even at a minimal dosage, contributed to accelerated hematopoiesis. aprotinin is a polypeptide extracted from bovine lung tisse and has anti - fibrinolytic and anti - kallikrein activity. there are several reports revealing the efficacy and safety of aprotinin in orthopedic surgeries. however, its association with thrombosis and renal failure limits its use in clinical practice. preoperative autologous blood donation, perioperative blood salvage systems, and intraoperative hemodilution all serve to reduce the abt rate in major orthopedic surgeries. however, the patient in this case report refused all blood products and, as a result, all of the aforementioned procedures. preoperative erythropoietin with intravenous iron sucrose without autologous blood donation would have been the primary option in this case. in conclusion, aggressive high dose intravenous iron sucrose with low dose erythropoietin was successful in our postoperative management of a severely anemic patient. | erythropoietin combined with parenteral iron sucrose therapy is an alternative to blood transfusion in anemic patients. it was shown to be effective in surgical patients in several previous studies when used in conjunction with other methods. however, there are no guidelines about safety limits in dosage amounts or intervals. in this study, we report a case of significant postoperative hemorrhage managed with high dose parenteral iron sucrose, low dose erythropoietin, vitamin b12, vitamin c, and folic acid. an 80-year - old female patient presented for severe anemia after a total hip arthroplasty and refused an allogenic blood transfusion as treatment. the preoperative hemoglobin of 12.2 g / dl decreased to 5.3 g / dl postoperatively. she received the aforementioned combination of iron sucrose, erythropoietin, and vitamins. a total of 1,500 mg of intravenous iron sucrose was given postoperatively for 6 consecutive days. erythropoietin was also administered at 2,000 iu every other day for a total of 12,000 iu. the patient was discharged in good condition on the twelfth postoperative day with a hemoglobin of 8.5 g / dl. her hemoglobin was at 11.2 g / dl on the twentieth postoperative day. |
by the end of 2011, more than 90% of the 34 million people infected with hiv worldwide were living in low- or middle - income countries. 16.8 $ billion was invested globally into hiv in 2011 and, in low- and middle - income countries, 89% of the investment was allocated to treatment care and support of hiv infected people. one of the most important aims of the medical care of hiv patients is to initiate antiretroviral therapy (art) before the development of hiv - related complications and to allow immunological recovery by maintaining long - term virological suppression. despite important advances in the rollout of art worldwide, 1.7 million people died of hiv - related pathologies in 2011. this high mortality could be explained by many factors including late presentation of hiv [25 ], poor engagement in medical care [69 ], poor retention in pre - art care [1012 ], late or no initiation of art [1315 ], high levels of attrition from care after art initiation [16, 17 ], and poor virological suppression in patients on art. when designing programmes aimed at providing treatment, care, and support to people living with hiv, it is important to understand the contributions of these factors to the overall hiv mortality, in order to improve the efficiency of hiv spending. to date, the majority of hiv research and funding have focused on the reduction of mortality and morbidity after art initiation. however, research also suggests that inadequate engagement in pre - art care may result in fewer people receiving art and may increase the proportion of patients initiating art late. most research about the retention in hiv programmes comes from the united states and sub - saharan africa [17, 1921 ]. despite 2.4 million hiv infected people estimated to be living with hiv in india in 2009, only 486,173 were receiving art under the national programme in january 2012. this study describes the engagement and retention in care of a large cohort of patients in anantapur, india. in particular, we studied the proportion of patients who entered and were retained in care from the point of hiv diagnosis to hiv virological suppression. we aimed to estimate what stages were more important for reducing the mortality of people living with hiv. the study was performed in anantapur, a district situated in the south border of andhra pradesh, india, with a high prevalence of hiv infection in antenatal clinics. the hiv epidemic in anantapur is largely driven by heterosexual transmission and is characterized by poor socio - economic conditions and high levels of illiteracy in the hiv population. rural development trust (rdt) is a nongovernmental organization that provides medical care to hiv infected people free of cost, including medicines, consultations, hospital admission charges, cd4 cell count enumeration, and hiv viral load. the vicente ferrer hiv cohort study (vfhcs) is an open cohort study of all hiv infected patients who have attended rdt hospitals since june 2006. the characteristics of the cohort have been described in detail elsewhere. for this study, we selected hiv infected adults (> 15 years) living in anantapur and diagnosed with hiv between january 1st 2007 and november 4th 2011. the selection of patients from the database was executed on september 14th 2012. during this period, art was available free of cost in the district, and the cd4 cell count threshold for initiating art was 250 cells/l in accordance with the 2006 world health organization (who) guidelines [2628 ]. patients who were lost to followup (ltfu) were actively searched by phone calls and home visits by outreach workers, and in those patients who had died, relatives were asked about the date of death of the patient. to assess the hiv care before art initiation, we divided the pre - art care into three stages according to recent recommendations based on the experience of studies performed in sub - saharan africa [19, 29 ]. to describe the entry into pre - art care, we calculated the time between the hiv diagnosis and the first determination of the cd4 count (stage 1). for hiv infected patients who were not eligible for art at the first assessment, to describe the retention in pre - art care of these patients (stage 2), we calculated the number of completed semesters that patients had a cd4 count determination during the period starting at three months after the first cd4 count determination and finishing at the first cd4 cell count determination 250 cells/l in the last 12 months of followup, they were considered retained in pre - art care regardless of the number of previous semesters without cd4 count determinations. to be included in the stage 2 analysis, patients should have had at least a follow - up period of six months (one complete semester after three months from the first cd4 count determination). for example, for a patient who had the first cd4 count determination on october 1st, 2009 and died on january 15th, 2011, we checked whether the patient had a cd4 count determination from january 1st, 2010 (three months after the first cd4 count determination) to june 30th, 2010 (first semester) and from july 1st, 2010 to december 31th, 2010 (second semester). if he had cd4 count determinations during the first and second semesters, the patient was considered retained in care. if he had a cd4 count determination only in one semester, he did not meet criteria for being considered retained in pre - art care. however, if the same patient had a cd4 lymphocyte count > 250 cells/l in the last 12 months of followup, he was considered retained in care even if he did not have cd4 count determinations in all the semesters of followup. to describe the promptness of art initiation, we calculated the time from the first cd4 count 250 cells/l in the last 12 months of followup. hence, 65.3% (n = 1108) were considered as retained in pre - art care according to study criteria. patients who were retained in pre - art care had lower mortality than patients who were not retained in pre - art care (p = 0.0043). the estimated five - year mortality difference between the two groups was 11.7% (95% ci, 2.720.6). however, when comparing mortality by cd4 count at entry into care (figures 2(c) and 2(d)), we did not observe significant differences in patients having cd4 count > 350 cells/l (p = 0.1053). of 4105 patients eligible for art, 67.3% (n = 2761) initiated art within three months of becoming eligible. patients who initiated art within three months had lower mortality than patients who did not (p 3 months of followup (i.e., did not die or were not ltfu within three months of becoming eligible for art), which was 19.9% (95% ci, 1326.7). of 3169 patients who initiated art, 15% (n = 480) died, 15% (n = 474) were ltfu, and 0.7% (n = 23) stopped art. of 1946 patients who had a viral load determination after six months of art initiation, 81.8% (n = 1591) achieved virological suppression (6 months after art initiation, i.e., 45.4%) ; (iii) the proportion of patients who did not achieve the objectives for stages 1, 2, 3, and 5 (table 1). some patients who died within three months of art eligibility did not initiate art because they were too sick and early initiation of art would not have improved their prognosis. thus, with the intention of being conservative in our calculations, we used the five - year mortality difference between patients who did and did not initiate art within three months of art eligibility who had > 3 months of followup to estimate the potential impact of improving stage 3 in hiv programmes. nevertheless, the highest potential impact for reducing the mortality in hiv programmes was observed at stage 3 (3.38%, 95% ci 2.214.54) followed by stage 1 (2.23%, 95% ci 1.243.23), stage 2 (1.47%, 95% ci 0.342.59), and stage 5 (0.72%, 95% ci 0.191.24). in this cohort study, we found that less than one - third of people diagnosed with hiv followed all stages of care from diagnosis to the achievement of virological suppression after art initiation, and that attrition was higher in pre - art stages than after art initiation. although the study is limited to a small area of india and comparisons among studies are difficult because of different operational definitions, our results are in accordance with other studies performed in resource - limited settings. in two systematic reviews of the retention in care in sub - saharan africa, less than one third of patients were retained in care prior to art initiation, and only 65%, of those who initiated art, were retained in care after three years of followup [17, 19 ]. in a meta - analysis of the pre - art attrition in sub - saharan africa, the attrition in stage 1 was 22.4% and the attrition in stage 3 was 37.1%. in a single site cohort study in south africa, the cumulative retention in care of art eligible patients from hiv diagnosis to 612 months after art initiation was 36.9%. although these studies differ in some of the stage definitions and follow - up periods, the rates of attrition are similar to our study, suggesting comparable rates of attrition in sub - saharan africa and india. despite notable achievements, governments in low- and middle - income countries are making efforts to reduce this high mortality, but resources and monitoring are focused more on patients on art than on pre - art stages of care. however, the results of this study show that improving pre - art stages of care can have greater impact on reducing hiv mortality than achieving virological suppression. moreover, previous studies have shown that interventions to improve engagement in care can be cost - effective [3436 ]. these data indicate that stakeholders and donors should consider placing more emphasis on promoting research and implementing evidence - based interventions to improve entry and retention in pre - art care [37, 38 ]. to our knowledge, this is one of the first studies to follow patients from the diagnosis of hiv to the achievement of virological suppression in a resource - limited setting. in the united states, it is estimated that 80% of hiv infected patients have been diagnosed with hiv ; 77% of patients diagnosed with hiv enter into care within 3 - 4 months of diagnosis ; 66.2% of patients linked to care are retained in care ; and 77% of patients on art achieve virological suppression. in our cohort, 70.3% of patients diagnosed with hiv entered into care within three months ; 46.5% of patients linked to care were retained in care ; and 81.8% of patients on art achieved virological suppression. the total number of people diagnosed with hiv in the district is not known, but in 2011 it is estimated that the number of people living with hiv was 26,800, and by november 2011, 14,395 patients were registered in government art centres [22, 3941 ]. therefore, only 54% of the estimated hiv infected people in the district entered into care, which compares unfavourably with the 61.6% hiv infected patients who enter into care in the united states. a similar observation is made with the difference in cd4 counts at entry into care in our cohort (216 cells/l, iqr 106398) compared with the united states and canada (317 cells/l, iqr 135517). these data suggest that, compared to north america, in our setting a lower proportion of patients enter into care, initial cd4 counts are lower, there is more attrition (mortality and loss to follow up) after engagement in care, and similar proportions of patients achieve virological suppression. in our study, there was no significant increase in mortality among patients who had an initial cd4 count > 350 cells/l and poor retention in pre - art care. in the 2010 who guidelines, the cd4 count threshold for initiating art has been raised to 350 cells/l. thus, the proportion of patients who will become eligible for art soon after the hiv diagnosis will increase considerably. previous studies have shown a reduction in mortality and loss to follow up when art is initiated with cd4 > 200 cells/l [4244 ]. therefore, it is likely that the implementation of the 2010 who guidelines will reduce both the mortality due to poor retention in pre - art care and attrition after art initiation. to define the stages of pre - art care, we used the date of collection of the cd4 count sample, rather than the date patients are informed of their cd4 count result. although the cd4 count notification date has been recommended by some authors, most patients are informed of their results at the next clinical visit, which for patients in pre - art care may occur many months later [11, 32 ]. using the cd4 count sample date to monitor the performance of hiv programmes in pre - art stages can encourage these programmes to implement effective strategies (e.g., phone calls, home visits, etc.) aimed at informing art eligible patients of the need for prompt initiation of therapy. the proportion of patients diagnosed with hiv who never entered into care is likely to be underestimated. hiv testing is performed in different locations, and patients diagnosed in other healthcare facilities and never entered into care were not identified. we estimated the proportion of art - ineligible patients who were not retained in pre - art care, but not all of them were followed up until becoming eligible for art. therefore, it is possible that longer follow - up periods may result in higher rates of stage 2 attrition. moreover, patients ltfu at any stage may not be lost forever, as they may reengage in the future or enroll in other art centres. patients ltfu are more likely to initiate art with low cd4 counts or may die before attending other healthcare facilities. this study shows that less than one third of patients diagnosed with hiv in our setting follow all the stages of care up to the achievement of virological suppression after art initiation. most attrition occurs in pre - art stages, and the mortality attributable to pre - art attrition is considerably higher than the mortality due to lack of virological suppression after art initiation. considering that other studies in low- and middle - income countries had similar results, it should be recommended that hiv programmes monitor their performance in pre - art stages of care. implementing new strategies to improve the link between hiv testing and pre - art care and timely initiation of art would help reduce the mortality of people living with hiv in resource - limited settings. | hiv treatment, care, and support programmes in low- and middle - income countries have traditionally focused more on patients remaining in care after the initiation of antiretroviral therapy (art) than on earlier stages of care. this study describes the cumulative retention from hiv diagnosis to the achievement of virological suppression after art initiation in an hiv cohort study in india. of all patients diagnosed with hiv, 70% entered into care within three months. 65% of patients ineligible for art at the first assessment were retained in pre - art care. 67% of those eligible for art initiated treatment within three months. 30% of patients who initiated art died or were lost to followup, and 82% achieved virological suppression in the last viral load determination. most attrition occurred the in pre - art stages of care, and it was estimated that only 31% of patients diagnosed with hiv engaged in care and achieved virological suppression after art initiation. the total mortality attributable to pre - art attrition was considerably higher than the mortality for not achieving virological suppression. this study indicates that early entry into pre - art care along with timely initiation of art is more likely to reduce hiv - related mortality compared to achieving virological suppression. |
attempts have been made to introduce technologies associated with ltp at atmospheric pressure into medical practice for various situations, and ltp s feasibility for use has been demonstrated in hemostasis, wound care, and anti - cancer therapy. translational studies of the basic technology for ltp at atmospheric pressure have remarkably proceeded at the max planck institute for extraterrestrial physics (gerching, germany), leibniz institute for plasma science and technology greifswald e.v. (inp greifswald e.v ; greifswald, germany), the national institute of advanced industrial science and technology (aist) of japan, nagoya university, and drexel university. now, its commercial viability has been studied at companies such as terraplasma gmbh, neoplas tools gmbh, and cinogy technologies gmbh. relevant products are steriplas formerly known as microplaster manufactured by adtec plasma technology co., ltd. an example describing the clinical benefit of steriplas is that it can be used to control bacterial infection in chronic wounds and to eradicate infected microorganisms, providing new clues for solving issues related to the increase in bacteria that are resistant to multiple antibiotics. for hemostasis, different types of ltp equipment are being developed by aist, nagoya university and drexel university that will be used for clinical trials. indeed, the discovered advantages of ltp use may have an impact on changing the basic approaches to and concepts for hemostasis and minimally invasive surgery. this review describes the clinical benefits of ltp for hemostasis and ltp s underlying mechanisms. increasing the safety of surgery is closely linked with the availability of energy devices for hemostasis, such as high - frequency coagulation equipment (hfce), laser coagulation equipment, ultrasonic coagulation equipment, and high temperature plasma coagulation equipment. their basic mechanism of inducing hemostasis is tissue ablation due to generated heat, and bleeding point shrinkage is induced by cauterized tissue. many efforts have been made to reduce the occurrence of associated the heat injuries, such as nerve paralysis and cartilage damage, which occur near the cauterized tissue with hemostatic electro - surgical equipment. however, based on the general concept of energy devices, it can be hard to establish new hemostatic instruments that do not cause heat injury. because ltp can stop blood flow by sealing the bleeding point without inducing heat injuries, it can be distinguished as a new energy device in surgery. importantly, the mechanism by which ltp stops bleeding is analogous to that of surgical hemostats, which is why it is feasible to use it to reduce heat injury, resulting in decreased invasiveness (table 1). based on results from a series of basic studies in plasma science, we have succeeded in developing ltp coagulation equipment that has a minimal risk for burn injury by reducing the plasma current that flows through the tissue. because the basic safety and essential performance requirements of a ltp coagulator are different from those of other energy devices, we are working with a group to make a consensus document for low - energy ionized gas coagulation equipment. the mechanisms underlying blood coagulation by ltp treatment were revealed by a series of studies by aist, nagoya university, drexel university, and others. we have summarized the effects on ltp equipment developed by each institute. an essential point is whether blood coagulation is confined to the blood coagulation system or extended to other blood components with or without hemolysis. drexel university reported that their equipment forms blood clots as a result of the coagulation of platelets and clotting proteins (table 2 category i), while the nagoya and aist equipment formed clots from the other serum proteins such as albumin, fetuin, and immunoglobulin (table 2 category ii). moreover, the aist equipment formed a membrane like clots from all of the blood components, including erythrocytes (table 2 category iii). ltp treatment with the nagoya and aist equipment extended to other blood components in the coagulation system, in contrast to ltp equipment by drexel university and surgical hemostats that activate coagulation proteins. indeed, results of an experiment with albumin and immunoglobulin showed that the nagoya and aist equipment allowed protein aggregation. blood is composed of erythrocytes, leukocytes, platelets, and plasma. the difference between serum and plasma is based on the presence or absence (decrease) of coagulation proteins (fibrinogen, prothrombin, factor v, factor viii), and they have in common that they contain proteins not involved in coagulation, such as albumin and immunoglobulin (albumin comprises about 65% [w / w ] of serum, and immunoglobulin comprises less than 20% [w / w ] of serum). furthermore, ltp treatment can form clots that more stable than those formed by the activation of the coagulation system because of the coagulation materials from red blood cells. the vulnerability of clots is based on leaking the liquid components of red blood cells (more than 45% of the blood s volume) upon hemolysis, while they are stable when coagulated to membrane like clots by ltp treatment. we sought to establish a control method for blood clot formation in order to develop ltp coagulation equipment. our most recent studies demonstrated that the efficiency of clot formation was linked to the current flowing through the solution, described as the plasma current. albumin aggregation appeared where the ltp flare touches, over the threshold of the plasma current. based on this information, we then sought to determine the plasma current that could form a stable clot from protein solutions without rupturing (fig. 2). every second, so values that are too small can be brought to a suitable value by adjusting the discharge voltage. results from a series of experiments demonstrate that the plasma current value depends on the value of the discharge voltage and that the current value can be controlled arbitrarily by adjusting the discharge voltage. additionally, immobilization is dependent on a length of 10 mm between the sample and discharge tube ; a helium gas flow rate of 2 l / min ; and a 50 mg / ml sample of albumin (sigma - aldrich, st. interestingly, an aggregation formed during plasma treatment returned into a solution when the discharge voltage was stopped at 6.3 kv (fig. 3-a1 to -a6 and -b1 to -b6), while the aggregation maintained its form when the discharge voltage was stopped at 7.4 kv (fig. 3-e1 to -e6 and -f1 to -f6). these results suggest that, when using albumin at a concentration of 50 mg / ml, a threshold value for clot formation exists between 6.3 kv and 7.4 kv. it is important to note that various proteins and concentrations have their own discharge voltage thresholds to form stable clots. we are developing a new plasma equipment system that will establish the ideal clot formation by measuring the plasma current and providing feedback so that the user can adjust the discharge voltage. we expect that the new system will be used in the field of surgical hemostasis, regenerative medicine, and/or drug development in the future. | low temperature plasma (ltp) coagulation equipment, which avoids causing burn injuries to patients, has been introducing into minimally invasive surgery. the mechanism by which this equipment stops bleeding is to directly occupy the injury with the formed blood clots, and different from the mechanism of the common electrical hemostatic devices that cauterize the tissues around the bleeding to stem the blood flow. a noteworthy point is that ltp treatment with our equipment is not confined only to the blood coagulation system, but it has significant effects on the other blood components to form clots with or without hemolysis, and that there is a plasma current threshold that determines whether the treatment makes stable clots. in this review, we introduce the clinical benefits of ltp current and describe the clot formation it facilitates. |
inflammatory myfibroblastic tumor (imt) is rare and may be grouped within the family of fibroinflammatory disorders. this tumor affects predominantly children and young adults, but patients of any age and sex can be affected.1 its clinical symptoms are also diverse according to the location of the lesion. a mass, fever, weight loss, malaise, pain, and site - specific symptoms were the most common presenting complaints or manifestations.1 however, imt seldom presents in the colon and intussusception is a rare complication of this tumor. a 7-year - old girl was admitted with abdominal pain to our center. on physical examination, abdominal ultrasound showed a solid mass which was 6 5 4 cm, hypervascular and partly calcified areas in the center. the white blood cell count was 7,300/mm, hemoglobin 6.8 g / dl, platelet count 554,000/mm, c - reactive protein 154 mg / l, erythrocyte sedimentation rate 27 mm / h, biochemical values were normal. immunoglobulin (ig) a was 222 mg / dl (normal, 70312 mg / dl), ig m was 114 mg / dl (normal, 56352 mg / dl), igg was 1,030 mg / dl (normal, 6391,349 mg / dl). patient was operated and colocolic intussusception was found. involved segment was beginning from 4 cm distal of the ileocecal valve and including a polipoid mass. resection of the involved segment of the ascending colon was done with end - to - end anastomosis. the polipoid mass was 5.5 4.5 3.5 cm wide, sessile, sticking to the mucosa with an area of 3.5 3 cm macroscopically. 1). the tumor composed of fibroblast / myofibroblast - like cells which were spindle, vesicular nuclei, some places with prominent nucleoli, and unclear boundaries of the cytoplasm. immunohistochemistry was positive for actin and negative for cd117, desmin, s-100, pancytokeratin, bcl-2, and anaplastic lymphoma kinase (alk) (fig. the surface seems ulcerated and cut surface exhibits solid, white, fibrous texture. a fascicular pattern in which the lesional spindle cells were arranged in moderately cellular with intersecting fascicles with a heavy infiltrate of lymphoplasmacytic cells in the background. their nuclei were elongated with occasional small nucleoli (hematoxylin and eosin stain ; 10). the expression of smooth muscle actin by immunohistochemistry in the spindle cells (antismooth muscle actin ; 10). after surgery, we are following up the patient with biochemical examinations and abdominal scanning closely for tumor recurrence. myofibroblastic cells admixed with inflammatory infiltrate.1 independent of the location, imt is more common in children and young adults, but patients of any age and sex can be affected.1 imt is rare and may be grouped within the family of fibroinflammatory disorders. this benign tumor typically resides in the lung ; however, multiple extrapulmonary manifestations have been reported.2 3 sites of extrapulmonary imt may include the upper respiratory tract, mesentery / omentum, genitourinary tract, gastrointestinal tract, mediastinum, retroperitoneum, pelvis, trunk, extremities, head, neck, spleen, brain, pancreas, and liver.4 the etiologic factors responsible for development of imt are not clearly established. some investigators believe it is a true neoplasm, and the others believe that it represents an immunologic response to an infectious or noninfectious agent.1 5 but the etiology of the mechanism still remains unclear. imt is typically considered as benign lesion, but a spectrum including locally destructive variants is expectable. biselli demonstrated that chromosomal aberrations may be present in imt.6 cessna describes abnormalities of chromosome 2p23 with expression of p80 and alk1 in up to 40% of imts.7 these studies have added molecular credence to the clinical observation that there is a spectrum of aggressiveness among imts, and some may exhibit aggressive local behavior and rarely metastasis. up to 71% are positive for alk1, and approximately 50% have clone rearrangement involving the alk locus on chromosome 2p23 that provides support for the neoplastic nature of imt. the alk gene encodes a receptor tyrosine kinase that has strong oncogenic activity when constitutively activated.7 8 9 however, as a predictor, alk expression has not demonstrated a clear relationship with prognosis. on the one hand, alk1-negative tumors occur in older patients and display greater nuclear pleomorphism and atypical mitoses ; in two recent series, metastatic imts were confined to alk1-negative lesions.8 10 whereas on the other hand, positive alk1 status may be more frequent in younger males and associated with a higher recurrence rate.11 in our young case, we were unable to demonstrate alk cytogenetic analysis, alk immunohistochemistry analysis was found negative and there was no atypia or recurrence. an imt consists of the proliferation of spindled to epithelioid myofibroblasts with admixed inflammatory cells, predominantly of mononuclear type. tumor cells without atypia or hyperchromatism can invade the muscularis propria and even the adventitia. for final diagnosis of an imt, tumor cells are characteristically positive for vimentin and do not express cd117 and cd34 in imt.1 12 the cells are positive for smooth muscle actin (sma) with or without desmin expression and s100 positivite.13 in our case, tumor cells were common positive for actin, negative for s100, alk, and there was no desmin, cd117, cd34 expression. bonnet reported that imt cases documented in the mesentery / omentum were in fact mostly located in the mesentery of the small bowel.14 clinical presentation of imt varies markedly, depending on the site at which the tumors originated. at the intestinal location, the onset may be insidious or rapid and may be accompanied by weight loss, malaise, a mass, and a variety of laboratory abnormalities.5 childhood imt cases with an intramural location of the tumor have interestingly presented with diarrhea and intestinal obstruction.15 rarely, the presentation may be a complicated picture such as intestinal obstruction and intussusception.16 17 colonic imt is a rare condition in abdominal imt and the most common site has been the right colon. colonic imt can be served as a lead point for intussusception.18 19 there are few pediatric cases of colonic imt with intussusception in the literature. the incidence of local recurrence has been reported to be 15 to 37% in large series of children presenting with imt of mesentery and retroperitoneum.1 we evaluated our case through colonoscopy for this recurrence risk and no recurrence was detected in the colon. patients may have hypochromic microcytic anemia, thrombocytosis, polyclonal hyperglobulinemia, and elevated erythrocyte sedimentation rate in imt. however, following a complete resection abnormal laboratory tests recover rapidly.20 hyperglobulinemia was not observed in our case. she has hypochromic microcytic anemia, elevated erythrocyte sedimentation rate, and elevated platelet count. surgical excision should be the primary therapy for cases with imt.17 complete resection is associated with less than 10% risk of local recurrence. we have performed surgical excision of the mass in our patient and no recurrence has occurred yet. chemotherapy has been reserved for patients in whom resection is morbid, impossible or in patients who have incomplete resections. there is no evidence to prove that chemotherapy is effective when used singly, however, it may play a role following complete resection. there is little evidence within the literature regarding chemotherapy for imt, and the majority of data are within the pediatric population.4 radiation is typically reserved for palliation, to alleviate the mass effect of the imt, or in conjunction with chemotherapy for cure in patients who are not suitable to resection. radiation treatment has been shown to be of some benefit in pulmonary imt.21 as with chemotherapy, there is currently no evidence to support routine use of radiotherapy in patients who have complete resection. steroids may be added to reduce surrounding inflammation if deemed necessary, particularly in cases that involve the central nerves system. nonsteroidal anti - inflammatory drugs (nsaids) have been successful in the treatment of imts when resectability is limited due to the tumor invading vital structures.22 chemotherapy combined with oral nsaids may be an effective therapeutic option for patients with unresectable imt.23 in conclusion, colonic imt is a rare condition and intussusception is a rare complication of this tumor. therefore, presentation of this case is very important for the literature. because of recurrence risk | inflammatory myfibroblastic tumor (imt), also known as inflammatory pseudotumor is unusual, benign solid tumor. this tumor is commonly reported in the lungs but can be present in extrapulmonary sites as well. we present the case of a 7-year - old girl with imt in an unusual location. the patient was admitted with abdominal pain, and ultrasound showed a solid mass in the abdomen. she was operated and colocolic intussusception secondary to a mass was found. histologic evaluation of mass revealed imt. |
osteoarthritis (oa) is one of the most frequent joint diseases and is a major cause of pain and locomotor disability for people in advanced age. balneotherapy (bt) is one of the most commonly used nonpharmacological approaches for oa. bt, in its most general sense, is used for bathing in thermal or mineral water. however, the exact definitions bt and spa therapy are frequently confused and the terms are generally used interchangeably. bt employs thermal mineral water from natural springs but also natural gases (co2, h2 s, and rn), peloids for prevention, treatment, and rehabilitation. bt is usually practiced in spas with their special therapeutic atmosphere as part of a complex therapy program. while the physical properties of water are on the forefront in hydrotherapy, which is one of the most significant components of bt, the chemical properties of water also play a role in bt applications. the types of water used in bt are classified as being low mineralized (0.6 - 2 g / l). also, water temperature is defined as cold (30 - 40 c), and or hyperthermal (> 40 c). the effect of bt on the cardiovascular system depends fundamentally on its hydrostatic pressure and heat effect. bt increases the hydrostatical pressure by means of significantly rising venous circulation ; this, in turn, increases the stroke volume and heart rate. some clinical studies indicate that bt results in acute and remarkable changes in body temperature, pulse rate, and diastolic and systolic blood pressures. there are various comorbidities associated with bt applications, the most common of which is hypertension (ht). in a study conducted with a turkish population, it was found that the prevalence of ht among those aged 35 - 64 years was 42.3%, with the incidence increasing with advanced age, similar to oa. the common presence of comorbid ht in people with oa is one of the most significant factors in designing a treatment plan targeting oa. no matter how safe bt seems in oa treatment, some studies have indicated some controversial findings revealing cardiovascular complications. the presence of these findings has resulted in discussions pertaining to the safety of bt treatment for patients with oa. in the related literature, the number of clinical studies focusing on the effects of bt on the cardiovascular system is relatively limited. although there are some studies investigating the acute effects of bt, there is no study evaluating the effects of long - term bt treatment. revealing the effect of long - term bt treatment on the cardiovascular system during the treatment course will be valuable information for physicians administering bt. the aim of the present study is to investigate the effects of 3-week bt on the blood pressure of patients with no ht and controlled or uncontrolled ht. the approval of the human ethics committee of our university and informed consent were obtained from all the participants. for the present study, the patients with oa of the lumbosacral region, hip, and knee were enrolled in the period from october 2012 to july 2013. at the beginning of the study, 270 consecutive patients who had a diagnosis of oa according to the american college of rheumatology criteria of both the sexes were included in the study. all patients underwent a general medical evaluation and rheumatologic examination by the same physician before the beginning of the treatment. patients with oa were further categorized into subgroups according to the region, that is, lumbosacral, hip and knee. the study included patients with ht who reported being on a regular diet consisting of 6 g and less salt consumption and complied with dietary approaches to stop hypertension, and who had also used antihypertensive medications for at least a 1-year prior to hospitalization. these patients with ht received antihypertensive medications at the same dose in intervals throughout the physical therapy for oa after admission to the research team 's institution. exclusion criteria were the presence of severe comorbidity of cardiovascular diseases (aortic stenosis, unstable angina, severe orthostatic hypotension, or any history of recent myocardial infraction, pacemaker), lung, liver, cerebrum, hypo- or hyperthyroidism, acute illness, systemic blood diseases, neoplasms, and pregnancy or nursing. the three groups comprised patients with oa nonaccompanied by ht, patients with oa accompanied by controlled ht, and patients with oa accompanied by uncontrolled ht. while systolic blood pressure was 150 mmhg and/or diastolic blood pressure > 90 mmhg in ht patients without diabetes mellitus (dm) or chronic kidney disease (ckd), and systolic blood pressures > 140 mmhg and/or diastolic blood pressure greater than 90 mmhg in those with dm or ckd were defined as uncontrolled ht. all the groups received bt in the therapy facilities of our university hospital at the same time every day (10:00 - 11:30 am) for 10 min per day, 5 days per week, for a total duration of 15 days. the patients in all the groups of bt therapy immersed their bodies in the xiphoid process during the treatment. all patients in all groups stayed in the water (received bt) for exactly 10 min. the thermomineral water, the threshold value of which was not above acceptable levels for any mineral, was at 40 1c, with 623 mg / l concentration. the blood pressure and pulse rates of the patients were measured and recorded on a daily basis for a period of 15 days, 5 min before and after the bt in a sitting position. following the therapy sessions, prior to the measurements, the patients were dried, and then they spent 10 min in a sitting position at normal room temperature. the measurements of the blood pressure were recorded by means of erkameter 3,000 desktop mercury sphygmomanometer (erka, bad tlz, germany). the measurements were obtained from the average of the last two measurements from both arms in the form of three measurements with two minutes intervals after a 5-min resting in the upright sitting position with back support without allowing the patients to speak. the patients were not allowed to take any form of caffeine and nicotine in the last 1 h prior to the measurements. all the results were expressed as mean standard deviation (sd). for parameters with normal distribution, comparisons between the groups were performed using two - way analysis of variance (anova) followed by tukey 's test or t - test for post hoc pairwise comparisons. data analysis was performed with international business machines (ibm) statistical package for the social sciences (spss) statistics, version 22 (ibm corp., armonk, ny, usa). the approval of the human ethics committee of our university and informed consent were obtained from all the participants. for the present study, the patients with oa of the lumbosacral region, hip, and knee were enrolled in the period from october 2012 to july 2013. at the beginning of the study, 270 consecutive patients who had a diagnosis of oa according to the american college of rheumatology criteria of both the sexes were included in the study. all patients underwent a general medical evaluation and rheumatologic examination by the same physician before the beginning of the treatment. patients with oa were further categorized into subgroups according to the region, that is, lumbosacral, hip and knee. the study included patients with ht who reported being on a regular diet consisting of 6 g and less salt consumption and complied with dietary approaches to stop hypertension, and who had also used antihypertensive medications for at least a 1-year prior to hospitalization. these patients with ht received antihypertensive medications at the same dose in intervals throughout the physical therapy for oa after admission to the research team 's institution. exclusion criteria were the presence of severe comorbidity of cardiovascular diseases (aortic stenosis, unstable angina, severe orthostatic hypotension, or any history of recent myocardial infraction, pacemaker), lung, liver, cerebrum, hypo- or hyperthyroidism, acute illness, systemic blood diseases, neoplasms, and pregnancy or nursing. the three groups comprised patients with oa nonaccompanied by ht, patients with oa accompanied by controlled ht, and patients with oa accompanied by uncontrolled ht. while systolic blood pressure was 150 mmhg and/or diastolic blood pressure > 90 mmhg in ht patients without diabetes mellitus (dm) or chronic kidney disease (ckd), and systolic blood pressures > 140 mmhg and/or diastolic blood pressure greater than 90 mmhg in those with dm or ckd were defined as uncontrolled ht. all the groups received bt in the therapy facilities of our university hospital at the same time every day (10:00 - 11:30 am) for 10 min per day, 5 days per week, for a total duration of 15 days. the patients in all the groups of bt therapy immersed their bodies in the xiphoid process during the treatment. all patients in all groups stayed in the water (received bt) for exactly 10 min. the thermomineral water, the threshold value of which was not above acceptable levels for any mineral, was at 40 1c, with 623 mg / l concentration. the blood pressure and pulse rates of the patients were measured and recorded on a daily basis for a period of 15 days, 5 min before and after the bt in a sitting position. following the therapy sessions, prior to the measurements, the patients were dried, and then they spent 10 min in a sitting position at normal room temperature. the measurements of the blood pressure were recorded by means of erkameter 3,000 desktop mercury sphygmomanometer (erka, bad tlz, germany). the measurements were obtained from the average of the last two measurements from both arms in the form of three measurements with two minutes intervals after a 5-min resting in the upright sitting position with back support without allowing the patients to speak. the patients were not allowed to take any form of caffeine and nicotine in the last 1 h prior to the measurements. the blood pressure and pulse rates of the patients were measured and recorded on a daily basis for a period of 15 days, 5 min before and after the bt in a sitting position. following the therapy sessions, prior to the measurements, the patients were dried, and then they spent 10 min in a sitting position at normal room temperature. the measurements of the blood pressure were recorded by means of erkameter 3,000 desktop mercury sphygmomanometer (erka, bad tlz, germany). the measurements were obtained from the average of the last two measurements from both arms in the form of three measurements with two minutes intervals after a 5-min resting in the upright sitting position with back support without allowing the patients to speak. the patients were not allowed to take any form of caffeine and nicotine in the last 1 h prior to the measurements. all the results were expressed as mean standard deviation (sd). for parameters with normal distribution, comparisons between the groups were performed using two - way analysis of variance (anova) followed by tukey 's test or t - test for post hoc pairwise comparisons. data analysis was performed with international business machines (ibm) statistical package for the social sciences (spss) statistics, version 22 (ibm corp., the selected clinical data of no ht, controlled ht, and uncontrolled ht groups can be seen in table 1. the ages of patients in the controlled ht group and uncontrolled ht group were significantly higher compared to the no ht group [p 0.05). selected clinical data of study groups figures 13 present the systolic and diastolic blood pressures and pulse rates of the three groups as measured before and after bt. we compared the systolic and diastolic blood pressures and pulse rates with the repeated measures anova test with tukey 's test as post hoc test after the study group (no ht, controlled ht, and uncontrolled ht) and measurement time (before and after) were given as two factors. data are expressed as mean + sd diastolic blood pressures of study groups as measured before and after balneotherapy. data are expressed as mean + sd pulse rates of study groups as measured before and after balneotherapy. data are expressed as mean + sd considering the systolic blood pressure and pulse rate, the factor of the study group presented a significant effect on the systolic blood pressure (p 0.05). overall, in all the study groups, after comparison of systolic and diastolic blood pressures and pulse rates measured both before and after bt, we found that the systolic and diastolic blood pressures and pulse rates measured from day 1 to day 15 did not present a meaningful change as increase or decrease although there were some fluctuations, especially in the uncontrolled ht group. overall, the systolic blood pressures of the study groups measured before and after bt were found to be comparable (p > 0.05). overall, the diastolic blood pressures of the no ht and controlled ht groups measured before and after bt were not statistically significant although after bt diastolic blood pressure presented a decrease in some days throughout the study period (p > 0.05) ; however, in the uncontrolled ht group, the diastolic blood pressure showed a decreasing trend after bt (p < 0.05). in the present study, we compared the pulse rate, systolic and diastolic blood pressure of the patients with no ht, controlled ht, and uncontrolled ht before and after bt administration for 15 days. although the systolic and diastolic blood pressures and pulse rate in the uncontrolled ht group were higher compared to the other groups, overall, we did not observe any meaningful change in the systolic blood pressure measured before and after bt during the study period. in the uncontrolled ht group, overall, the diastolic blood pressure had a decreasing trend after bt although this was not a very significant finding in the measurements of systolic blood pressure. although we found that the pulse rates after bt increased in all the study groups compared to those before bt, these differences did not signify an important characteristic for these patients. there were fluctuations in the measurements of systolic and diastolic blood pressures and pulse rates before and after bt from day 1 to day 15. for years, bt has been successfully used in the treatment of various diseases such as disorders of musculoskeletal system, dermatologic diseases, and cardiovascular diseases. cardiovascular load is intense, if hyperthermal pools are used in the bt ; and the cardiovascular load tends to decrease comparatively if thermo indifferent and hypothermal pools are used. a more positive cardiovascular effect can be attained in bt through the use of co2 gas pools in comparison to co2 liquid pools. some studies demonstrated that hydrotherapy and bt decrease blood pressure and provide positive effects on cardiac functions. however, there are also a few case reports noting that bt increases cardiovascular risk particularly in patients with ht. until recently, the number of studies investigating the acute effects of bt is relatively limited and the findings emerging from these studies show variations in connection to temperature of the water in bt and the immersion level of the patients. in a study conducted in 1998, paran. applied bt to two groups of oa patients, one with ht and the other who were normotensive for a 2-week period in thermomineral water. they recorded a significant reduction in systolic and diastolic blood pressures in the normotensive group. moreover, thermomineral water had an additional lowering effect on the blood pressure of the patients who were normotensive but the systolic blood pressure of hypertensive patients increased, which tended to decrease within 10 days after the beginning of the treatment. however, the findings of the paran study turn out to be have some inconsistency with the findings of the present study because we found that the increase in the systolic blood pressure did not show any decreases during the 15-day treatment period. the use of hyperthermal water in bt may have resulted in the absence of decrease in systolic blood pressure in the present study. in a study conducted on oa patients in thermomineral water, cimbiz. recorded an increase in heart rate and a decrease in diastolic blood pressure after treatment and reported no significant changes in systolic blood pressure, which is consistent with the findings of the present study. in a retrospective study on 2,090, found that while there were decreases in the systolic and diastolic blood pressure in patients with ht and who were normotensive, the decrease in the diastolic blood pressure in patients with ht was recorded to be greater and more significant. shani., in a study on the diastolic and systolic blood pressures of 1,366 samples consisting of hypertensive and normotensive psoriatic patients treated at the dead sea for a period of 4 weeks found that both diastolic and systolic blood pressures of both the groups significantly decreased. the differences in blood pressure measurements between the findings of the different studies might be related to the immersion level of the patients. while most trials report about the head being out of water during immersion, in the present study, the patients were immersed to the xiphoid. so it may well be that the cardiovascular response to immersion was so small in the present study because of the immersion level of the patients. it has been known for a long time that the presence of ht as a comorbid factor in rheumatic disease may alter the options of treatment. for these patients, bt has still been used as a safe and effective treatment method. the fact that bt decreases the diastolic blood pressure effectively might be seen as a positive factor in the decrease of the comorbid load of the patients with oa. it has been thought that the decreasing effect in blood pressure might be related to the effect of thermal water on the vasodilation of the venous system, the decrease in peripheral resistance, the antioxidant effect of thermal water, and cardiovagal baroreflex effect. hyperthermia triggered by bathing may decrease carotid arterial stiffness. thus increasing the cardiovagal baroreflex, which naturally results in a decrease in blood pressure. the limitation of the present study is the fact that the cardiovascular hemodynamic variables were not measured during the immersion process of bt. the measurement of blood pressure during the immersion process of bt might yield more objective results. another limitation of the present study is that the ht follow - ups of the patients were not conducted in 24-h intervals after bt. in summary, bt for oa can be safely used without resulting in any meaningful fluctuation in systolic and diastolic blood pressures in patients with normal and controlled ht except for a decrease in the diastolic blood pressure of patients with uncontrolled ht. even so, there is a need for further clinical studies investigating the effects of bt on blood pressure during the immersion process of bt. | background : balneotherapy (bt) is a treatment modality that uses the physical and chemical effects of water, including thermomineral, acratothermal, and acratopegal waters. it has many effects on cardiovascular system.aim:the aim of the study is to investigate the effects of 3-week bt on blood pressure of osteoarthritis (oa) patients with no hypertension (ht), and controlled or uncontrolled ht.materials and methods : the oa patients (n = 270) were divided into three groups : no ht, controlled ht, and uncontrolled ht. all the groups received bt in the facilities of our university hospital at the same time every day (10:00 - 11:30 am) for 10 min per day, 5 days per week, for a total duration of 15 days in a 3-week period. systolic and diastolic blood pressures and pulse rates were measured before and after bt on daily basis.results:overall, (1) the pulse rates of study groups measured after bt were significantly increased compared to before bt ; (2) the systolic blood pressures of study groups measured before and after bt were found as comparable ; and (3) the diastolic blood pressures of no ht and controlled ht groups measured before and after bt were not statistically significant (p > 0.05) ; however, in the uncontrolled ht group, the diastolic blood pressure showed a decreasing trend after bt (p < 0.05).conclusions : in patients with oa, bt can be safely used without resulting in any meaningful changes in systolic and diastolic blood pressures in patients with normal and controlled ht but a decrease in diastolic blood pressure of patients with uncontrolled ht. this may be an advantage in oa patients having ht as comorbid disease. |
ion mobility spectrometry (ims) has been a tool for the analysis of gases for a long time. famous for their small device size in the centimeter range, their fast response times in the ms range, and their very high sensitivity in the lower ppbv range, ims detectors can be found in a number of quite different locations and applications. much younger is the scientific application of ims in order to characterize the structure of analytes. already in 2004 a review stated that ims has matured enough to become a mainstream research methodology for structural analysis, especially in combination with mass spectrometry. applications in gas phase peptide ion structure analysis can be found, for example, in, where ims measurements combined with molecular modeling allowed for the determination of folding structures and backbone orientations. an overview over the variety of structure analysis based on ims can be found in, for example,. a detailed description of the different mathematical approaches employed in order to calculate the most important parameter for structural information, the collision cross section (which furthermore determines the ions ' mobility), can be found in. basically, there are three methods available to calculate the collision cross section from model structures and thus the ion mobility [68 ]. the method known for delivering the best results and which is also the mathematically most demanding (and thus leading to the longest calculation times) is the trajectory method. in this method, the angle between the incoming trajectory and outgoing trajectory of a particle colliding with the analyte is used to determine the collision cross section : (1)tm=18202d0dsin02d8kbt30dgeg2/2kbtg50db2b1cos,,,b.the variables,, and are the euler - angles for the collision geometry between analyte and drift gas, (,,, b) is the scattering angle, g is the relative velocity of the drift gas, b is the impact parameter defining how far the drift gas atom is positioned from the x - axis, is the reduced mass, kb is the boltzmann constant, and t is temperature in kelvin. the standard approach is that model structures are optimized (typically with help of quantum - chemical calculations), and then their collision cross section is calculated, from which finally the ion mobility can be calculated [9, 10]:(2)k=316qn1m+1m0.52kbt0.51tm.m and m are the masses of the (neutral) drift gas and the analyte, q is the analyte 's charge, and n is the number density of the drift gas. this mobility value is directly available from flight time measurements in an ion mobility spectrometer : (3)k = l2tdu.here l is the length of the drift tube, u is the voltage drop over the whole drift tube length, and td is the analyte 's drift time directly obtainable in the measurements. to calculate the (optimized) geometry, a lot of options exist regarding the mathematical approach. for smaller molecules, density functional theory (dft), dft takes too long, and thus other approaches such as force field calculations and/or molecular modeling are used. for smaller molecules, on which the focus lies in this paper, dft allows choosing from a variety of functionals, which can be combined with a variety of basis sets, in order to optimize the structure. all these combinations represent again different compromises between accuracy and calculation speed. from dft calculations, the calculation of the collision cross section requires further information in the form of the partial charge distribution over the analyte molecule 's atoms. the most well - known method to calculate this distribution is the mulliken approach, which basically distributes partial charges according to how many atom orbital functions contribute to molecular orbital representations. this information is mathematically directly obtained during the structure optimizations, and thus the mulliken charges are easy and fast to calculate. however, their magnitude is sometimes unrealistic, and much more important, their magnitude depends strongly on the before mentioned basis set and its size. correspondingly, further approaches have been developed to avoid this dependence on the basis set. what is problematic for all these approaches is that there is no clear definition where an atom begins and where it ends in a molecule, so it is difficult to assign partial charges to the atoms. another also well - known method is the merz - kollman - singh (mk,) scheme. this scheme belongs to a family of techniques where the reproduction of the electrostatic potential around an atom by assigning partial charges is the goal. the different schemes in this family differ by the way they fit the charges to the potential, that is, in the number and distribution of fit points. a third, similarly well - known technique is the hirshfeld population analysis. here the atoms ' partial charges are calculated by assuming that the electron density in a certain point of the molecule 's space is shared among the surrounding atoms. each atom contributes in a magnitude proportional to the free - electron density and distance to the nuclei. these different approaches normally yield completely different numerical values for the partial charges (but always summing up to the total charge of the molecule). in recent studies, there have been different results regarding which partial charge scheme is better suited, for example, when compared with experimental values. when different basis sets were used for the calculation of the molecular structures, hirshfeld behaved quite stably, while mulliken behaved unstably and showed a large variation of the computed charges when increasing the basis set size. hirshfeld on the other hand showed often significantly different values. when calculating, for example, charge transfers in organic dyes, mulliken and mk showed the least variations, while hirshfeld showed inconsistent results ; for larger molecules, mulliken provided poor results. another more recent example is the calculation of dipole moments of diheteroaryl ketones and thioketones. there mk was the best approach, followed by mulliken, and hirshfeld was the worst ; in contrast to this, when reproducing tendencies for a larger group of conformers, hirshfeld showed better results, followed by mk and mulliken. in this paper, we have analyzed how well the trajectory method can reproduce the experimental ion mobilities that we measured for small molecules. thus, we have calculated minimum structures with the help of dft and different partial charge methods and calculated with this data the ion mobility using an application called mobcal in a version which has been improved for calculations with n2 as drift gas. after a short description of the experimental and computational procedures, the paper will show direct comparisons of the calculated and the measured mobilities for analytes of different sizes. the experimental mobilities have been obtained with a commercial ims spectrometer which has been described thoroughly in previous publications so that here only a short summary is given. the ims device has three distinct sections : an ionization region, a drift region, and a collector region. the ionization region has a length of 0.5 cm ; the drift region 's length is 5.5 cm (diameter 2 cm), followed by the collector region of 2 mm length with the detector, a faraday cup, located at its end. in the ionization region, positively charged reactant ions are created in ambient air with the help of free electrons emitted by an electron gun. the analyte ions are injected from the ionization region into the drift region by an electric field of strength 1000 v / cm. the drift times are in this set - up ca. 6 ms and longer. the humidity level is kept relatively low (water concentration at 292 k below 200 ppbv, dew point of 181.1 k). the quantum - chemical calculations have been performed using the gaussian software suite (version 9 d.01). the b3lyp functional together with the 6 - 311+g(d) basis set has been used for the structure optimizations and the partial charge calculations according to mulliken, mk, and hirshfeld. although b3lyp is only a general purpose functional with limited precision, we assume that the errors introduced by the trajectory method are larger and thus did not choose a more refined functional. a similar argumentation led to the choice of the basis set, which, however, is considered to be large enough in order to get a good estimation for the charges. the program used for the calculation of the collision cross section and the theoretic ion mobilities is mobcal in the extended version for n2 drift gas and heavier atoms. although our measurements were using ambient dry air as drift gas, we consider the calculated mobilities suitable for such a comparison since, according to the generally valid blanc 's law of ion mobilities [20, 21 ], the difference between mobilities in air and in nitrogen should be small. with help of the langevin polarization limit expression, the difference between measurements in oxygen and nitrogen can be calculated as (4)ko2=kn2m+mo2/mdo21m+mn2/mdn21,where ko2/n2 are the mobility constants in the corresponding medium, do2/n2 and mo2/n2 are the dielectric constants and the molecular masses of the corresponding medium, and m is the molecular mass of the analyte. thus, the corrections between mobility in oxygen and nitrogen are small. according to blanc 's law of ion mobilities these have to be weighted by the molar composition of air with respect to these two gases in order to get the mobility in air, leading to a total difference of mobilities in nitrogen and air of a few percent (but depending on the analyte 's mass). the analyte substances have been acquired from sigma aldrich (http://www.sigmaaldrich.com/) with a purity of at least 95%. the first group of molecules to be discussed is the water clusters that form the analyte ionizing reactant ions in ims. these are of the form (h3o)(h2o)n with n depending on the temperature and the humidity level in the device. typical values are zero to five ; under standard conditions, a significant number of molecules can be found for n between three and five. the ims peak obtained from these reactant ions (called rip,) is thus a mixture of different ions that can not be separated with ims alone. we thus compare our mobcal calculations with values obtained by another theoretical approach that could successfully calculate with high confidence the flight time distribution measured in ims experiments. in that approach, particle tracing together with statistical diffusion simulation and a monte carlo based reaction simulation (involving the concentration of the reaction partners, here the water clusters of different size, and their reaction constants) has been used to simulate rip spectra. table 1 shows the corresponding comparison. for smaller clusters, the calculated mobilities are smaller than those calculated by ; for larger clusters, they are actually too large., the value calculated with mulliken partial charges is in between those calculated with the other two approaches, the variations being below ten percent. the mean unsigned error (mue) when compared with the values calculated in is for all three approaches around 11% ; however, for the largest clusters, the error is as large as 20%. the mk approach shows here values with the smallest error, and also the maximum error is less than that for the other partial charge methods. in particular, for the larger clusters the difference approaches 10%, so for this case the mk method clearly outperforms the other two. in summary, however, it seems that only for larger clusters (n = 4, mass 91 dalton) the trajectory method seems to be able to calculate values close to the ones successfully used in to reproduce experimental values. both substances were investigated by our group in the past, and under those conditions it appeared that the ionization mechanism is not the typical protonation, but electron abstraction. this is more common when using as low humidity levels as we have in our set - up. for such structures, we measured a mobility of 1.94 cmvs (peak center ; the peak width determines the device 's resolving power, which has in our set - up a value of ca. the calculated value, however, was 2.20 cmvs for mk charges (2.22 cmvs for hirshfeld charges) and thus showed a large error. however, it is known in ims that the analytes form clusters with h2o after ionization, the degree again depending on temperature and humidity level. figure 1 shows the corresponding ims spectra together with the calculated values represented as bars. when using the aromatic compound clustered with water, the calculated values are much closer to the measured values. the interesting question is if this can be seen as a clear indication that the measured signal is indeed caused by the analyte clustered with water. one common way to measure this experimentally is the hyphenation of ims with mass spectrometry (ms) ; but since ims work at atmospheric pressure and mass spectrometers at vacuum, an interface has to be used in order to separate these two pressure areas. this normally means an opening with very small diameter in the 100 s of micrometer range, where additional clustering of all molecules in the gas stream can be observed, but also declustering. the masses obtained by ims - ms do not necessarily represent the substances in the ims ; in the case of clustering, further calculations have to show if theoretic mobility calculations can help here. regarding the partial charges, the mulliken charges yield for both benzene and toluene the best result. for benzene the hirshfeld charges are better for benzene where the error is comparable to that of the mulliken charges but with opposite sign, but much worse in the case of toluene where the mk charges are better. here the trend that with increased analyte mass the calculated mobilities are closer to the experimental ones could not be observed. the third group to be presented here is n - alkanes ranging from n - hexane with a mass comparable to benzene to n - decane which has a mass comparable to pharmaceutically interesting analytes such as acetaminophen. these alkanes have the problem that, due to their charge symmetry, the ionization via protonation is not possible (no attachment point for the proton). it has been found out in the past that electron abstraction leads to ionization in ims (for details, see). here we have again investigated clusters formed with one water molecule, which has been attached to the center of each alkane. when using the mulliken partial charge approach, the calculated mobilities are all too low. while the experimental values show a tendency towards lower mobility for higher chain length, the mobilities calculated using mulliken charges do not show that tendency (n - octane and n - heptane have the same mobility ; n - decane has a lower mobility than n - octane but higher than n - nonane). when using the mk partial charges or the hirshfeld partial charges, the deviations are much less. both show an increase in mobility from n - heptane to n - octane which is experimentally not observed (mulliken charges showed here identical mobilities), but apart from that point the experimental mobilities are quite well reproduced by the calculations. in two cases, both partial charge approaches actually yield the same mobility ; in the case of n - nonane, the difference is less than one percent. the error is in general less for longer chains, and the error for mk charges is slightly smaller than that for hirshfeld charges. the average error is much less, especially for the mk and hirshfeld charges, where it is near 5%. this error is in the same range as errors published, for example, in a study of biomolecules with much larger mass. in, where molecules with masses ranging from 122 dalton to 603 dalton have been investigated, what becomes interesting is the influence of the partial charges. while for the water clusters mulliken charges yield comparable errors, they are much worse in the case of n - alkanes. mk and hirshfeld perform in a similar manner, with mk charges yielding slightly lower errors in all cases. from this study, it can be concluded that, for smaller molecules with a maximum mass of 160 dalton, the mobcal extended version is capable or reproducing experimental values with errors not much different from those known from other studies. the error is in the range of below 10% when using advanced partial charge calculations like mk or hirshfeld but can be much higher when using mulliken partial charges. in this paper, it was shown how well calculated ion mobilities compare with experimental values in the case of benzene, toluene, and n - alkanes. under the assumption that these substances cluster with one water molecule, the calculated mobilities (for b3lyp//6 - 311g+(d) optimized structures) are close to the experimental values (difference below 5%) when using mk or hirshfeld partial charges. these error values are comparable to those obtained for larger molecules investigated in other studies. further investigations have to show how well this comparison can be extended to other molecule types typically found in ims. while the structures shown here are all investigated in the positive mode (where positively charged analyte ions are formed by protonation or electron abstraction), it would be interesting to see how compounds investigated in the negative mode (formed by proton abstraction or electron capture) behave regarding their calculated mobilities. similarly, the often observed dimer formation in both modes has not been investigated. but based on the data available so far it becomes already clear that the available approaches allow in many cases (here additionally shown for small molecules below 160 dalton) calculating mobilities from model structure with good confidence and thus supporting structural elucidation of unknown substances. | ion mobility spectrometry is a well - known technique for analyzing gases. examples are military applications, but also safety related applications, for example, for protection of employees in industries working with hazardous gases. in the last 15 years, this technique has been further developed as a tool for structural analysis, for example, in pharmaceutical applications. in particular, the collision cross section, which is related to the mobility, is of interest here. with help of theoretic principles, it is possible to develop molecular models that can be verified by the comparison of their calculated cross sections with experimental data. in this paper, it is analyzed how well the ion trajectory method is suitable to reproduce the measured ion mobility of small organic molecules such as the water clusters forming the positively charged reactant ions, simple aromatic substances, and n - alkanes. |
intramedullary cavernomas (imc) are rare lesions especially in children, in whom they represent 1% of all intramedullary lesions. as such, less than 20 symptomatic cases have been reported in the english literature [1, 2, 6, 9, 10, 16, 1820, 2325 ] and predominantly in boys (table 1). these invariably presented with an acute, severe neurological deficit followed by rapid deterioration due to hematomyelia. confronted with such a dramatically affected patient, the attending neurosurgeon, due to the rarity of the condition, finds no guidelines in the literature and has to decide if and when to operate on a case - by - case basis, based on the child s clinical presentation, magnetic resonance (mr) findings, and his or her personal preference. table 1clinical characteristics of children with intramedullary cavernoma in the literatureauthorsgenderage (years)imc anatomical levelimc multiple levelsodom. f12t11nopresent studyf7c5nof10t9t10noc cervical, f female, imc intramedullary cavernoma, m male, t thoracic clinical characteristics of children with intramedullary cavernoma in the literature c cervical, f female, imc intramedullary cavernoma, m male, t thoracic we report two girls presenting with hematomyelia (one cervical, one thoracic) and an acute, severe neurological deficit. we present their clinical and radiological details as well as our surgical strategy and outcome. finally, as one of the girls turned out to have a familial autosomal cavernous malformation syndrome, we review the pertinent literature as well. a 10-year - old girl complaining about dorsalgia for several days suddenly developed lower body dysesthesias and a paraparesis. an l1 sensory - motor level, lower limb hyperreflexia including babinski s signs, and decreased rectal sphincter tone were noted. emergency mr demonstrated hematomyelia (t8t11), intramedullary edema (t6l1), and an imc at t9t10 (fig. within 2 h after admission, paraparesis progressed to paraplegia, and therefore, the girl was operated immediately. 1a1a3 preoperative sagittal t1, t2, and t2 ffe (fast field echo) mr images revealing a markedly swollen cord, including intramedullary edema (t6l1), hematomyelia (t8t11), and an imc at t9t10 ; b1b3 3 months postoperative sagittal t1, t2, and axial t2 mr images confirming complete resection ; c1c3 2 years postoperative sagittal t1, t2, and axial t2 mr images demonstrating a thin spinal cord without evidence of local recurrence ; d1, d2 2 years postoperative anteroposterior and lateral spinal x - rays to monitor kyphoscoliosis a1a3 preoperative sagittal t1, t2, and t2 ffe (fast field echo) mr images revealing a markedly swollen cord, including intramedullary edema (t6l1), hematomyelia (t8t11), and an imc at t9t10 ; b1b3 3 months postoperative sagittal t1, t2, and axial t2 mr images confirming complete resection ; c1c3 2 years postoperative sagittal t1, t2, and axial t2 mr images demonstrating a thin spinal cord without evidence of local recurrence ; d1, d2 2 years postoperative anteroposterior and lateral spinal x - rays to monitor kyphoscoliosis we had no time to localize the lesion preoperatively. consequently, we removed three thoracic laminae and two more after durotomy revealing insufficient exposure of the lesion, which appeared as a dark blue clot shining through the pia mater. after midline myelotomy, the hematoma presented itself, and the cavernoma was gently mobilized and resected. the girl slowly recovered, regaining minimal voluntary movement after 10 days, continence after 9 months, and independent ambulation after 12 months. 1b), whereas 2 years postoperative mr shows a thin spinal cord without evidence of local recurrence (fig. one day after a fall during skating, a 7-year - old girl suddenly developed cervicalgia and severe paresis of her left arm and leg (grades 12 out of 5 according to the american spinal injury association). her paresis improved to a grade 4, and at 3 months, her residual deficit was minimal. 2a1a3 preoperative sagittal t1, t2, and axial t2 mr images revealing a markedly swollen cord, including hematomyelia at c4c6 and a left anterolateral imc at c5 ; b1, b2 3 months postoperative sagittal t2 and axial t2 ffe (fast field echo) mr images, note multiple small cerebral cavernomas ; c1, c2 2.5 years postoperative sagittal and axial t2 mr images, the cord still appears swollen ; d1, d2 3.5 years postoperative sagittal and axial t2 mr images, the cord now appears less swollen and the child is asymptomatic a1a3 preoperative sagittal t1, t2, and axial t2 mr images revealing a markedly swollen cord, including hematomyelia at c4c6 and a left anterolateral imc at c5 ; b1, b2 3 months postoperative sagittal t2 and axial t2 ffe (fast field echo) mr images, note multiple small cerebral cavernomas ; c1, c2 2.5 years postoperative sagittal and axial t2 mr images, the cord still appears swollen ; d1, d2 3.5 years postoperative sagittal and axial t2 mr images, the cord now appears less swollen and the child is asymptomatic at that time, she was operated using a c3c7 laminoplastic technique and motor evoked potential monitoring. the cord at c4c5 was clearly swollen, and the exact position of the cavernoma was determined using ultrasonography (fig. subtle subpial yellow - blue discoloration was apparent after sectioning the left c4c5 denticulate ligament and gently rotating the spinal cord to the right (fig. after lateral myelotomy, the hematoma presented itself ; however, mobilizing and resecting the cavernoma was difficult due to a rather limited lateromedial view inside the spinal cord. 3a macroscopic intraoperative image at c4c5 (left dorsolateral view, one denticulate ligament sectioned) showing subtle subpial yellow - blue discoloration at the lateral surface of the spinal cord. b ultrasonic intraoperative image at c3c6 (sagittal view) specifying the exact location of the cavernoma in the swollen cord segment a macroscopic intraoperative image at c4c5 (left dorsolateral view, one denticulate ligament sectioned) showing subtle subpial yellow - blue discoloration at the lateral surface of the spinal cord. b ultrasonic intraoperative image at c3c6 (sagittal view) specifying the exact location of the cavernoma in the swollen cord segment the girl did well after the operation showing no new neurological deficits. multiple small cerebral cavernomas and a familial autosomal cavernous malformation syndrome were diagnosed with mutation of the mgc4607/malcavernin / ccm2-gen (fig. the following 1.5 years, she complained of intermittent cervicalgia and left brachial dysesthesias, with mr suggesting active residual cavernoma (fig. 2c). mr after 3.5 years shows minimal cord swelling no longer suggesting active residual cavernoma (fig. a 10-year - old girl complaining about dorsalgia for several days suddenly developed lower body dysesthesias and a paraparesis. an l1 sensory - motor level, lower limb hyperreflexia including babinski s signs, and decreased rectal sphincter tone were noted. emergency mr demonstrated hematomyelia (t8t11), intramedullary edema (t6l1), and an imc at t9t10 (fig. within 2 h after admission, paraparesis progressed to paraplegia, and therefore, the girl was operated immediately. 1a1a3 preoperative sagittal t1, t2, and t2 ffe (fast field echo) mr images revealing a markedly swollen cord, including intramedullary edema (t6l1), hematomyelia (t8t11), and an imc at t9t10 ; b1b3 3 months postoperative sagittal t1, t2, and axial t2 mr images confirming complete resection ; c1c3 2 years postoperative sagittal t1, t2, and axial t2 mr images demonstrating a thin spinal cord without evidence of local recurrence ; d1, d2 2 years postoperative anteroposterior and lateral spinal x - rays to monitor kyphoscoliosis a1a3 preoperative sagittal t1, t2, and t2 ffe (fast field echo) mr images revealing a markedly swollen cord, including intramedullary edema (t6l1), hematomyelia (t8t11), and an imc at t9t10 ; b1b3 3 months postoperative sagittal t1, t2, and axial t2 mr images confirming complete resection ; c1c3 2 years postoperative sagittal t1, t2, and axial t2 mr images demonstrating a thin spinal cord without evidence of local recurrence ; d1, d2 2 years postoperative anteroposterior and lateral spinal x - rays to monitor kyphoscoliosis we had no time to localize the lesion preoperatively. consequently, we removed three thoracic laminae and two more after durotomy revealing insufficient exposure of the lesion, which appeared as a dark blue clot shining through the pia mater. after midline myelotomy, the hematoma presented itself, and the cavernoma was gently mobilized and resected. the girl slowly recovered, regaining minimal voluntary movement after 10 days, continence after 9 months, and independent ambulation after 12 months. 1b), whereas 2 years postoperative mr shows a thin spinal cord without evidence of local recurrence (fig. a 10-year - old girl complaining about dorsalgia for several days suddenly developed lower body dysesthesias and a paraparesis. an l1 sensory - motor level, lower limb hyperreflexia including babinski s signs, and decreased rectal sphincter tone were noted. emergency mr demonstrated hematomyelia (t8t11), intramedullary edema (t6l1), and an imc at t9t10 (fig. within 2 h after admission, paraparesis progressed to paraplegia, and therefore, the girl was operated immediately. 1a1a3 preoperative sagittal t1, t2, and t2 ffe (fast field echo) mr images revealing a markedly swollen cord, including intramedullary edema (t6l1), hematomyelia (t8t11), and an imc at t9t10 ; b1b3 3 months postoperative sagittal t1, t2, and axial t2 mr images confirming complete resection ; c1c3 2 years postoperative sagittal t1, t2, and axial t2 mr images demonstrating a thin spinal cord without evidence of local recurrence ; d1, d2 2 years postoperative anteroposterior and lateral spinal x - rays to monitor kyphoscoliosis a1a3 preoperative sagittal t1, t2, and t2 ffe (fast field echo) mr images revealing a markedly swollen cord, including intramedullary edema (t6l1), hematomyelia (t8t11), and an imc at t9t10 ; b1b3 3 months postoperative sagittal t1, t2, and axial t2 mr images confirming complete resection ; c1c3 2 years postoperative sagittal t1, t2, and axial t2 mr images demonstrating a thin spinal cord without evidence of local recurrence ; d1, d2 2 years postoperative anteroposterior and lateral spinal x - rays to monitor kyphoscoliosis consequently, we removed three thoracic laminae and two more after durotomy revealing insufficient exposure of the lesion, which appeared as a dark blue clot shining through the pia mater. after midline myelotomy, the hematoma presented itself, and the cavernoma was gently mobilized and resected. the girl slowly recovered, regaining minimal voluntary movement after 10 days, continence after 9 months, and independent ambulation after 12 months. 1b), whereas 2 years postoperative mr shows a thin spinal cord without evidence of local recurrence (fig. one day after a fall during skating, a 7-year - old girl suddenly developed cervicalgia and severe paresis of her left arm and leg (grades 12 out of 5 according to the american spinal injury association). her paresis improved to a grade 4, and at 3 months, her residual deficit was minimal. 2a1a3 preoperative sagittal t1, t2, and axial t2 mr images revealing a markedly swollen cord, including hematomyelia at c4c6 and a left anterolateral imc at c5 ; b1, b2 3 months postoperative sagittal t2 and axial t2 ffe (fast field echo) mr images, note multiple small cerebral cavernomas ; c1, c2 2.5 years postoperative sagittal and axial t2 mr images, the cord still appears swollen ; d1, d2 3.5 years postoperative sagittal and axial t2 mr images, the cord now appears less swollen and the child is asymptomatic a1a3 preoperative sagittal t1, t2, and axial t2 mr images revealing a markedly swollen cord, including hematomyelia at c4c6 and a left anterolateral imc at c5 ; b1, b2 3 months postoperative sagittal t2 and axial t2 ffe (fast field echo) mr images, note multiple small cerebral cavernomas ; c1, c2 2.5 years postoperative sagittal and axial t2 mr images, the cord still appears swollen ; d1, d2 3.5 years postoperative sagittal and axial t2 mr images, the cord now appears less swollen and the child is asymptomatic at that time, she was operated using a c3c7 laminoplastic technique and motor evoked potential monitoring. the cord at c4c5 was clearly swollen, and the exact position of the cavernoma was determined using ultrasonography (fig. subtle subpial yellow - blue discoloration was apparent after sectioning the left c4c5 denticulate ligament and gently rotating the spinal cord to the right (fig. after lateral myelotomy, the hematoma presented itself ; however, mobilizing and resecting the cavernoma was difficult due to a rather limited lateromedial view inside the spinal cord. 3a macroscopic intraoperative image at c4c5 (left dorsolateral view, one denticulate ligament sectioned) showing subtle subpial yellow - blue discoloration at the lateral surface of the spinal cord. b ultrasonic intraoperative image at c3c6 (sagittal view) specifying the exact location of the cavernoma in the swollen cord segment a macroscopic intraoperative image at c4c5 (left dorsolateral view, one denticulate ligament sectioned) showing subtle subpial yellow - blue discoloration at the lateral surface of the spinal cord. b ultrasonic intraoperative image at c3c6 (sagittal view) specifying the exact location of the cavernoma in the swollen cord segment the girl did well after the operation showing no new neurological deficits. multiple small cerebral cavernomas and a familial autosomal cavernous malformation syndrome were diagnosed with mutation of the mgc4607/malcavernin / ccm2-gen (fig. the following 1.5 years, she complained of intermittent cervicalgia and left brachial dysesthesias, with mr suggesting active residual cavernoma (fig. 2c). mr after 3.5 years shows minimal cord swelling no longer suggesting active residual cavernoma (fig. one day after a fall during skating, a 7-year - old girl suddenly developed cervicalgia and severe paresis of her left arm and leg (grades 12 out of 5 according to the american spinal injury association). her paresis improved to a grade 4, and at 3 months, her residual deficit was minimal. 2a1a3 preoperative sagittal t1, t2, and axial t2 mr images revealing a markedly swollen cord, including hematomyelia at c4c6 and a left anterolateral imc at c5 ; b1, b2 3 months postoperative sagittal t2 and axial t2 ffe (fast field echo) mr images, note multiple small cerebral cavernomas ; c1, c2 2.5 years postoperative sagittal and axial t2 mr images, the cord still appears swollen ; d1, d2 3.5 years postoperative sagittal and axial t2 mr images, the cord now appears less swollen and the child is asymptomatic a1a3 preoperative sagittal t1, t2, and axial t2 mr images revealing a markedly swollen cord, including hematomyelia at c4c6 and a left anterolateral imc at c5 ; b1, b2 3 months postoperative sagittal t2 and axial t2 ffe (fast field echo) mr images, note multiple small cerebral cavernomas ; c1, c2 2.5 years postoperative sagittal and axial t2 mr images, the cord still appears swollen ; d1, d2 3.5 years postoperative sagittal and axial t2 mr images, the cord now appears less swollen and the child is asymptomatic at that time, she was operated using a c3c7 laminoplastic technique and motor evoked potential monitoring. the cord at c4c5 was clearly swollen, and the exact position of the cavernoma was determined using ultrasonography (fig. subtle subpial yellow - blue discoloration was apparent after sectioning the left c4c5 denticulate ligament and gently rotating the spinal cord to the right (fig. after lateral myelotomy, the hematoma presented itself ; however, mobilizing and resecting the cavernoma was difficult due to a rather limited lateromedial view inside the spinal cord. 3a macroscopic intraoperative image at c4c5 (left dorsolateral view, one denticulate ligament sectioned) showing subtle subpial yellow - blue discoloration at the lateral surface of the spinal cord. b ultrasonic intraoperative image at c3c6 (sagittal view) specifying the exact location of the cavernoma in the swollen cord segment a macroscopic intraoperative image at c4c5 (left dorsolateral view, one denticulate ligament sectioned) showing subtle subpial yellow - blue discoloration at the lateral surface of the spinal cord. b ultrasonic intraoperative image at c3c6 (sagittal view) specifying the exact location of the cavernoma in the swollen cord segment multiple small cerebral cavernomas and a familial autosomal cavernous malformation syndrome were diagnosed with mutation of the mgc4607/malcavernin / ccm2-gen (fig. the following 1.5 years, she complained of intermittent cervicalgia and left brachial dysesthesias, with mr suggesting active residual cavernoma (fig. 2c). mr after 3.5 years shows minimal cord swelling no longer suggesting active residual cavernoma (fig. imc are rare lesions in adults but even more in children, representing 5% and 1%, respectively, of all intramedullary lesions at tertiary referral centers [5, 23 ]. as such, less than 20 symptomatic children have been reported in the english literature [1, 2, 6, 9, 10, 16, 1820, 2325 ] (table 1), invariably presenting with an acute, severe neurological deficit followed by rapid deterioration due to hematomyelia. adults, on the other hand, present with slowly progressive deficits or an acute deficit followed by a slow, stepwise deterioration with episodes of some clinical improvement, caused by repeated microhemorrhage followed by gliosis or iterative thrombosis within the cavernoma [8, 15, 19 ]. our first patient complained about dorsalgia for several days and then suddenly developed lower body dysesthesias and a paraparesis, which within 2 h after admission progressed to paraplegia. our second patient suddenly developed cervicalgia and severe paresis of her left arm and leg 1 day after a fall. the acute presentation in both cases is in line with the literature ; however, the second patient remained in stable clinical condition over the following days and therefore did not require emergency surgery. the clinical presentation of imc in general is quite variable, often including both sensory and motor symptoms, resulting in pain and paresis. as such, zevgaridis. distinguished three major patterns in the clinical course of 117 symptomatic imc in patients between 12 and 88 years old. group a (30%) suffered multiple episodes of discrete neurological deterioration and varying degrees of recovery in between. group c (26%) suffered sudden onset of symptoms and rapid decline over hours or days (c1, 16%), which is common in children [10, 18 ], or a little slower over several weeks (c2, 10%). most clinical series deal mainly or exclusively with adult patients and demonstrate a higher bleeding risk (regardless of age) for imc as compared to their cerebral counterparts : the annual bleeding risk for cerebral cavernomas is believed to be about 0.71.3% [3, 13, 21 ], for brainstem cavernomas about 2.7%, and for imc about 1.64.5% [18, 19, 22 ]. moreover, the potential that hemorrhage may cause significant morbidity is higher for imc than for their cerebral counterparts because of the confined parenchymatous space in which imc are located. deutsch. postulated that adult imc are equally distributed among both sexes ; however, a female predisposition in those presenting with hemorrhage (female / male ratio 2:1) may be attributable to a hormonal effect increasing the risk of hemorrhage. more recently, santoro. performed an extensive literature review and calculated a female / male ratio of 1.1:1. in contrast, a male predisposition is reported in children (female / male ratio 1:2), and the mean age they present with hematomyelia is 9.1 years (range 7 months17 years) according to scott. or 13.2 years (range 817 years) according to noudel.. in this regard, some authors believe that hormonal factors may influence the clinical onset of cavernomas in puberty. our report adds two girls to the literature and challenges the reported male predisposition in children (table 1). mr is the golden standard to diagnose cavernomas in any location, as myelography and computed tomography are much less sensitive and cavernomas are angiographically occult. imc typically have a mixed signal intensity on mr scans, including a hyperintense core lesion and a rim of low signal intensity caused by hemosiderin deposition around the cavernoma on t2-weighted images. their size varies from 0.85.4 cm (mean 1.41.7 cm) [3, 5, 10, 15 ], and typically, they are small, round, or ovoid well - defined lesions [5, 10 ] situated dorsolaterally in the spinal cord where they may reach the surface. the imc in our patients were of intermediate size and situated dorsomedially (case 1) and left (dorso)laterally (case 2). the extent of hematomyelia (t8t11) and intramedullary edema (t6l1) in the former patient, however, made an exact delineation of the cavernoma difficult. according to the literature, imc in adults are more common in the thoracic cord, whereas imc in children are equally distributed in the cervical and thoracic cord [18, 19 ] (table 1). as such, our first patient had a cavernoma at t9t10 and our second patient at c5. importantly, imc may occur in association with cerebral or systemic lesions [1, 10 ]. multiple lesions are typically seen in the so - called inherited cerebral cavernous malformation disorder, which was diagnosed in our second patient. to date, three loci have been identified for this disorder : ccm1 on chromosome arm 7q, ccm2 on 7p (our second patient), and ccm3 on 3q, which may be responsible for approximately 4050%, 1020%, and 40% of inherited cases, respectively [4, 7 ]. in fact, as many as 1240% [5, 10 ] of patients and especially children and young adults with imc have other cavernomas in their central nervous system (table 1). complete neuraxis imaging in all patients and particularly in the younger age group is therefore mandatory [10, 27 ]. few cases have been reported with multifocal (intramedullary and cerebral) cavernomas yet without a positive family history, and several theories have been proposed to explain their occurrence : a neoplast - like process with hormonal influence during pregnancy, the possible seeding of a lesion along a biopsy track, the intralesional presence of endothelial cell expressing proliferating cell nuclear antigen, the occurrence of cavernomas in areas previously irradiated, and an incomplete penetrance or even a misdiagnosis of the disease [17, 23, 28 ]. some authors recommend resection for every patient with symptomatic imc and even for those who have minimal symptoms [10, 24 ]. they argue that once symptoms and signs caused by hemorrhage have appeared, the patient will likely experience future neurological decline, whereas after microsurgical resection by experienced hands, a stable or improved functional status is achieved in 9294% of patients [10, 29 ] independent of age, gender, and lesion location. on the other hand, kharkar. recently evaluated the natural history of conservatively managed symptomatic imc and did not observe a significant, permanent neurological decline in a cohort of ten patients during a mean follow - up period of 80 months. of note, all but one were adult patients who may have a different clinical course as previously outlined, and the study design was retrospective nonrandomized (conservatively managed patients presenting mainly with paresthesias, surgically managed patients presenting mainly with pain and paresis). the authors carefully conclude that they may have identified a distinct subgroup of patients with symptomatic imc that may have a much lower risk of rehemorrhage. most neurosurgeons would agree that dissection must be confined to the thin layer of hemosiderin laden gliosis surrounding the imc to limit damage to the normal adjacent spinal cord tissue. according to some authors, this would even obviate the use of neurophysiological monitoring which they consider time - consuming and of debated reliability. others including us prefer neurophysiological monitoring for every elective intramedullary resective procedure [6, 10, 14 ]. furthermore, intraoperative ultrasound typically shows a hypointense signal at the site of recent hemorrhage, helps to localize the lesion if not readily visible on the cord surface, and helps to determine the optimal entry point to approach the lesion. there is considerably more debate regarding the optimal timing for resection, which is simply not known, and factors such as severity of the patients clinical condition, presence (or absence) of clinical progression, anatomical level of the lesion, and attending surgeons experience would be taken into account. some authors propose 4 to 6 weeks after hemorrhage as an optimal time to operate, as during such time interval, a gliotic plane would have formed around the cavernoma, enabling the surgeon to safely separate cavernoma from surrounding cord tissue [10, 12, 29 ]. this is exactly what we did in case 2, who remained in stable clinical condition initially and then gradually recovered until she was operated 3 months after hemorrhage. in case 1 who rapidly progressed to paraplegia, we did not hesitate to operate immediately, and fortunately, the girl demonstrated remarkable recovery regaining continence and independent ambulation over the following months. in fact, in such situation, there may be imminent spinal cord infarction due to a steep pressure rise in the spinal cord, which is lined by nonelastic pia mater. therefore, rapid pressure relief may be the only way to prevent irreversible spinal cord infarction. it is essential to achieve radical removal during the first operation because any imc residue may lead to further hemorrhage, and a second operation may present greater surgical difficulties. rebleeding risk may be as high as 17.6% according to vishteh. or even 66% according to sandalcioglu. and may cause recurrent myelopathy (9%). whereas our first patient clearly has no residual cavernoma on postoperative mr scans, our second patient seemed to have an actively leaking residual cavernoma on initial follow - up mr scans and complained of intermittent cervicalgia and left brachial dysesthesias for approximately 1.5 years postoperatively. mr after 3.5 years shows minimal cord swelling no longer suggesting active residual cavernoma. little if anything is found in the literature concerning the difficult dilemma between follow - up and reoperation in case of residual cavernoma, especially in the setting of multiple cavernomas in children who have a long life expectancy and are otherwise doing fine. it is generally believed subtotally resected lesions and/or syndromal cases tend to recur [1, 10, 12, 18, 24, 26 ]. in this regard, scott. have suggested that central nervous system cavernomas may frequently bleed silently, producing low - pressure small - volume hemorrhages which are radiologically invisible. such hemorrhages may not be of a critical volume or may not be in a critical location and therefore may not be life threatening ; however, they may expand with time and irritate the spinal cord, which may become gliotic and edematous [10, 24 ]. on the other hand, one should keep in mind that especially early postoperative mr images may be misleading and therefore misinterpreted, as low - intensity signals of postoperative scar tissue may be misdiagnosed for residual cavernoma and that mr images may become more reliable at least 6 months postoperatively. clearly, definitive answers await more cases with longer follow - up, and until then, surgical decisions have to be made on a case - by - case basis. finally, therapeutic indications remain controversial for asymptomatic imc in sporadic as well as nonsporadic cases. some recommend surgical resection for readily accessible imc [5, 6, 22 ], whereas others recommend an expectant policy and regular clinicoradiological follow - up for deeper lesions [13, 10, 12 ]. reported delayed complications in four of 17 patients (23.5%) with surgically treated imc. these complications were mainly symptomatic rehemorrhage as a result of incomplete resection, or less frequently symptomatic spinal cord tethering. clinical symptoms of spinal cord tethering include severe headaches, neck pain, arm or leg pain irresponsive to medical therapy, and/or progressive neurological deficit, which are all related to the level of spinal cord tethering. surgical detethering is indicated in patients who develop new or progressive symptoms in the late postoperative period and are radiographically suspect for tethering. in children, spinal deformity is another potential complication after multilevel laminectomy. as children may develop delayed spinal deformity and/or spinal cord tethering during longitudinal growth, regular radiological follow - up imc are rare lesions in adults but even more in children, representing 5% and 1%, respectively, of all intramedullary lesions at tertiary referral centers [5, 23 ]. as such, less than 20 symptomatic children have been reported in the english literature [1, 2, 6, 9, 10, 16, 1820, 2325 ] (table 1), invariably presenting with an acute, severe neurological deficit followed by rapid deterioration due to hematomyelia. adults, on the other hand, present with slowly progressive deficits or an acute deficit followed by a slow, stepwise deterioration with episodes of some clinical improvement, caused by repeated microhemorrhage followed by gliosis or iterative thrombosis within the cavernoma [8, 15, 19 ]. our first patient complained about dorsalgia for several days and then suddenly developed lower body dysesthesias and a paraparesis, which within 2 h after admission progressed to paraplegia. our second patient suddenly developed cervicalgia and severe paresis of her left arm and leg 1 day after a fall. the acute presentation in both cases is in line with the literature ; however, the second patient remained in stable clinical condition over the following days and therefore did not require emergency surgery. the clinical presentation of imc in general is quite variable, often including both sensory and motor symptoms, resulting in pain and paresis. as such, zevgaridis. distinguished three major patterns in the clinical course of 117 symptomatic imc in patients between 12 and 88 years old. group a (30%) suffered multiple episodes of discrete neurological deterioration and varying degrees of recovery in between. group c (26%) suffered sudden onset of symptoms and rapid decline over hours or days (c1, 16%), which is common in children [10, 18 ], or a little slower over several weeks (c2, 10%). most clinical series deal mainly or exclusively with adult patients and demonstrate a higher bleeding risk (regardless of age) for imc as compared to their cerebral counterparts : the annual bleeding risk for cerebral cavernomas is believed to be about 0.71.3% [3, 13, 21 ], for brainstem cavernomas about 2.7%, and for imc about 1.64.5% [18, 19, 22 ]. moreover, the potential that hemorrhage may cause significant morbidity is higher for imc than for their cerebral counterparts because of the confined parenchymatous space in which imc are located. deutsch. postulated that adult imc are equally distributed among both sexes ; however, a female predisposition in those presenting with hemorrhage (female / male ratio 2:1) may be attributable to a hormonal effect increasing the risk of hemorrhage. more recently, santoro. performed an extensive literature review and calculated a female / male ratio of 1.1:1. in contrast, a male predisposition is reported in children (female / male ratio 1:2), and the mean age they present with hematomyelia is 9.1 years (range 7 months17 years) according to scott. or 13.2 years (range 817 years) according to noudel.. in this regard, some authors believe that hormonal factors may influence the clinical onset of cavernomas in puberty. our report adds two girls to the literature and challenges the reported male predisposition in children (table 1). mr is the golden standard to diagnose cavernomas in any location, as myelography and computed tomography are much less sensitive and cavernomas are angiographically occult. imc typically have a mixed signal intensity on mr scans, including a hyperintense core lesion and a rim of low signal intensity caused by hemosiderin deposition around the cavernoma on t2-weighted images. their size varies from 0.85.4 cm (mean 1.41.7 cm) [3, 5, 10, 15 ], and typically, they are small, round, or ovoid well - defined lesions [5, 10 ] situated dorsolaterally in the spinal cord where they may reach the surface. the imc in our patients were of intermediate size and situated dorsomedially (case 1) and left (dorso)laterally (case 2). the extent of hematomyelia (t8t11) and intramedullary edema (t6l1) in the former patient, however, made an exact delineation of the cavernoma difficult. according to the literature, imc in adults are more common in the thoracic cord, whereas imc in children are equally distributed in the cervical and thoracic cord [18, 19 ] (table 1). as such, our first patient had a cavernoma at t9t10 and our second patient at c5. importantly, imc may occur in association with cerebral or systemic lesions [1, 10 ]. multiple lesions are typically seen in the so - called inherited cerebral cavernous malformation disorder, which was diagnosed in our second patient. to date, three loci have been identified for this disorder : ccm1 on chromosome arm 7q, ccm2 on 7p (our second patient), and ccm3 on 3q, which may be responsible for approximately 4050%, 1020%, and 40% of inherited cases, respectively [4, 7 ]. in fact, as many as 1240% [5, 10 ] of patients and especially children and young adults with imc have other cavernomas in their central nervous system (table 1). complete neuraxis imaging in all patients and particularly in the younger age group is therefore mandatory [10, 27 ]. few cases have been reported with multifocal (intramedullary and cerebral) cavernomas yet without a positive family history, and several theories have been proposed to explain their occurrence : a neoplast - like process with hormonal influence during pregnancy, the possible seeding of a lesion along a biopsy track, the intralesional presence of endothelial cell expressing proliferating cell nuclear antigen, the occurrence of cavernomas in areas previously irradiated, and an incomplete penetrance or even a misdiagnosis of the disease [17, 23, 28 ]. some authors recommend resection for every patient with symptomatic imc and even for those who have minimal symptoms [10, 24 ]. they argue that once symptoms and signs caused by hemorrhage have appeared, the patient will likely experience future neurological decline, whereas after microsurgical resection by experienced hands, a stable or improved functional status is achieved in 9294% of patients [10, 29 ] independent of age, gender, and lesion location. on the other hand, kharkar. recently evaluated the natural history of conservatively managed symptomatic imc and did not observe a significant, permanent neurological decline in a cohort of ten patients during a mean follow - up period of 80 months. of note, all but one were adult patients who may have a different clinical course as previously outlined, and the study design was retrospective nonrandomized (conservatively managed patients presenting mainly with paresthesias, surgically managed patients presenting mainly with pain and paresis). the authors carefully conclude that they may have identified a distinct subgroup of patients with symptomatic imc that may have a much lower risk of rehemorrhage. most neurosurgeons would agree that dissection must be confined to the thin layer of hemosiderin laden gliosis surrounding the imc to limit damage to the normal adjacent spinal cord tissue. according to some authors, this would even obviate the use of neurophysiological monitoring which they consider time - consuming and of debated reliability. others including us prefer neurophysiological monitoring for every elective intramedullary resective procedure [6, 10, 14 ]. furthermore, intraoperative ultrasound typically shows a hypointense signal at the site of recent hemorrhage, helps to localize the lesion if not readily visible on the cord surface, and helps to determine the optimal entry point to approach the lesion. there is considerably more debate regarding the optimal timing for resection, which is simply not known, and factors such as severity of the patients clinical condition, presence (or absence) of clinical progression, anatomical level of the lesion, and attending surgeons experience would be taken into account. some authors propose 4 to 6 weeks after hemorrhage as an optimal time to operate, as during such time interval, a gliotic plane would have formed around the cavernoma, enabling the surgeon to safely separate cavernoma from surrounding cord tissue [10, 12, 29 ]. this is exactly what we did in case 2, who remained in stable clinical condition initially and then gradually recovered until she was operated 3 months after hemorrhage. in case 1 who rapidly progressed to paraplegia, we did not hesitate to operate immediately, and fortunately, the girl demonstrated remarkable recovery regaining continence and independent ambulation over the following months. in fact, in such situation, there may be imminent spinal cord infarction due to a steep pressure rise in the spinal cord, which is lined by nonelastic pia mater. therefore, rapid pressure relief may be the only way to prevent irreversible spinal cord infarction. it is essential to achieve radical removal during the first operation because any imc residue may lead to further hemorrhage, and a second operation may present greater surgical difficulties. rebleeding risk may be as high as 17.6% according to vishteh. or even 66% according to sandalcioglu. and may cause recurrent myelopathy (9%). whereas our first patient clearly has no residual cavernoma on postoperative mr scans, our second patient seemed to have an actively leaking residual cavernoma on initial follow - up mr scans and complained of intermittent cervicalgia and left brachial dysesthesias for approximately 1.5 years postoperatively. mr after 3.5 years shows minimal cord swelling no longer suggesting active residual cavernoma. little if anything is found in the literature concerning the difficult dilemma between follow - up and reoperation in case of residual cavernoma, especially in the setting of multiple cavernomas in children who have a long life expectancy and are otherwise doing fine. it is generally believed subtotally resected lesions and/or syndromal cases tend to recur [1, 10, 12, 18, 24, 26 ]. in this regard, scott. have suggested that central nervous system cavernomas may frequently bleed silently, producing low - pressure small - volume hemorrhages which are radiologically invisible. such hemorrhages may not be of a critical volume or may not be in a critical location and therefore may not be life threatening ; however, they may expand with time and irritate the spinal cord, which may become gliotic and edematous [10, 24 ]. on the other hand, one should keep in mind that especially early postoperative mr images may be misleading and therefore misinterpreted, as low - intensity signals of postoperative scar tissue may be misdiagnosed for residual cavernoma and that mr images may become more reliable at least 6 months postoperatively. clearly, definitive answers await more cases with longer follow - up, and until then, surgical decisions have to be made on a case - by - case basis. finally, therapeutic indications remain controversial for asymptomatic imc in sporadic as well as nonsporadic cases. some recommend surgical resection for readily accessible imc [5, 6, 22 ], whereas others recommend an expectant policy and regular clinicoradiological follow - up for deeper lesions [13, 10, 12 ]. vishteh. reported delayed complications in four of 17 patients (23.5%) with surgically treated imc. these complications were mainly symptomatic rehemorrhage as a result of incomplete resection, or less frequently symptomatic spinal cord tethering. clinical symptoms of spinal cord tethering include severe headaches, neck pain, arm or leg pain irresponsive to medical therapy, and/or progressive neurological deficit, which are all related to the level of spinal cord tethering. surgical detethering is indicated in patients who develop new or progressive symptoms in the late postoperative period and are radiographically suspect for tethering. in children, as children may develop delayed spinal deformity and/or spinal cord tethering during longitudinal growth, regular radiological follow - up is indicated until they have reached adult stature (fig. less than 20 children with imc have been reported in the english literature ; however, cases with an unfavorable outcome may be underreported. we report two girls presenting with an acute, severe neurological deficit due to hematomyelia, thereby challenging the male predominance in this age group. mr of the entire neuraxis is mandatory, as these children are more likely to harbor a familial autosomal cavernous malformation syndrome. with adequate surgical treatment either in the acute phase or after clinical recuperation definitive answers await more cases with longer follow - up especially after subtotal resection ; however, as long as patients remain in stable condition, careful clinical and radiological follow - up may be an alternative to reoperation. | introductionless than 20 children with intramedullary cavernoma (imc) have been reported in the english literature ; however, cases with an unfavorable outcome may be underreported. whereas these are predominantly boys, we report two girls who presented with hematomyelia (one cervical, one thoracic) and an acute, severe neurological deficit.case materiala 10-year - old girl complaining about lower thoracic pain for several days suddenly developed lower body dysesthesias and paraparesis. magnetic resonance (mr) demonstrated hematomyelia (t8t11), intramedullary edema (t6l1), and an imc at t9t10. within an hour, she progressed to paraplegia and was therefore operated immediately. she slowly recovered regaining independent ambulation and continence. mr after 2 years shows no recurrence. a 7-year - old girl suddenly developed cervicalgia and paresis of her left arm and leg. mr demonstrated hematomyelia and an imc at c4c6. she gradually recovered with minimal residual deficit at 3 months and was subsequently operated uneventfully. multiple cerebral cavernomas and a familial autosomal cavernous malformation syndrome were diagnosed. the following 1.5 years, she complained of intermittent cervicalgia and left brachial dysesthesias, with mr suggesting active residual cavernoma. interestingly, her complaints gradually disappeared, and she is currently asymptomatic. mr after 3.5 years shows minimal cord swelling no longer suggesting active residual cavernoma.conclusionwith adequate surgical treatment either in the acute phase in case of dramatic deterioration or after clinical recuperation, prognosis of symptomatic imc may be surprisingly good. however, subtotally resected lesions and/or syndromal cases may recur, requiring further treatment. definitive answers await more cases with longer follow - up. |
transcutaneous electrical nerve stimulation (tens) is widely used in western and developed countries to relieve a wide range of painful conditions, including non - malignant acute and chronic pain and pain resulting from cancer and its treatment [13 ]. tens can be self administered by patients following simple training and because there is no potential for toxicity, patients can titrate the dosage on an as - needed basis. during tens pulsed electrical currents are generated by a small battery operated tens device that can be kept in the pocket or attached to the user 's belt. currents from the tens device are delivered through the skin by two self - adhering electrode pads (figure 1). a standard tens device. maximal pain relief is achieved when tens generates a strong non - painful electrical sensation beneath the electrodes. pain relief is usually rapid in onset and stops shortly after tens is turned off. for this reason patients are encouraged to deliver tens for as long as needed, which may be for hours at a time and throughout the day., tens devices can be purchased without prescription, although this is not the case in some european countries. tens devices, including electrode leads, pads and battery, retail for approximately 30gbp although bulk buying can markedly reduce cost. interestingly, tens does not appear to be widely available for patient use in developing countries. in this review the basic science behind tens will be discussed, the evidence of its effectiveness in specific clinical conditions will be provided and a case for its use in pain management in developing countries will be made. the ancient egyptians are usually acknowledged as the first people who used electrogenic fish to apply electricity for pain relief. yet, the first documented use of this kind of pain relief is of a roman physician in 46 ad. in 1786, luigi galvani, an italian doctor, demonstrated that the leg of a frog contained electricity. this observation and other advancements in generating electricity lead to a resurgence in the use of electricity to treat different illnesses and relieve pain. however, increased use of pharmacological agents to manage pain resulted in the decline of the electrotherapy at the end of the 19th century. in 1965, ronald melzack from mcgill university in montreal canada and patrick wall from university college london uk, published their seminal paper which proposed a gating mechanism in the central nervous system to regulate the flow of nerve signals from peripheral nerves en - route to the brain. according to this gate - control theory of pain, activity in large diameter low threshold mechanoreceptive (touch - related) nerve fibers could inhibit the transmission of action potentials from small diameter higher threshold nociceptive (pain - related) fibers through pre and post synaptic inhibition in the dorsal horn of spinal cord. because nociceptive fibers (a - delta and c - fibers) have a higher threshold of activation than mechanoreceptive fibers (a - beta fibers) melzack and wall proposed that it would be possible to selectively stimulate mechanoreceptive fibers by titrating the amplitude of electrical currents delivered across the surface of the skin (ie tens). this would prevent signals from nociceptive fibers from reaching higher centres of the brain, thus reducing pain (figure 2). diagrammatic representation of the principle of conventional tens. by selectively activating a - beta fibers, tens shuts the pain gate on a - delta and c fibers preventing pain - related signals reaching the brain. in addition to interrupting nociceptive signals, at spinal cord dorsal horn, we now know that tens analgesia also involves a descending inhibitory mechanism that could be partially prevented by spinalization. activity in nerve fibers descending from the brain can also block onward transmission of peripheral nerve signals within the spinal cord. humans utilise this mechanism whenever they mentally distract themselves to not feel pain despite the presence of tissue damage (figure 2) evidence gathered from animal studies suggested that low frequency tens effects may be due to release of endogenous opioids. this explains why analgesia may persist for hours after electrical stimulation has stopped because endorphins have long lasting effects in the central nervous system. the released opioids may generate their analgesic action at peripheral, spinal and supraspinal sites [7, 8 ]. however, other neurochemicals have been implicated in tens analgesia including gaba, acetylcholine, 5-ht, noradrenaline and adenosine. in health care the term tens refers to the delivery of currents using a standard tens device (table 1). however, there are a variety of devices that deliver electrical currents through the skin but have technical output characteristics that differ from a standard tens device. we have previously described these as tens - like devices and include trancutaneous spinal electroanalgesia, interferential therapy, microcurrent stimulation and pain gone pens (see [3, 14, 15 ] for a review of these devices). low - intensity pulsed currents are administered at high - frequencies (between 10200 pulses per second, pps) at the site of pain. the user experiences a strong, non - painful tens sensation often described as tingling or pleasant electrical paraesthesiae. physiologically, conventional tens activates large diameter non - noxious afferents which has been shown to close the pain gate at spinal segments related to the pain. another technique, which is used less often is acupuncture - like tens (al - tens) using high - intensity and low - frequency (less than 10pps, usually 2pps) administered over muscles, acupuncture and trigger points. the purpose of al - tens is to activate small diameter afferents which has been shown to close the pain gate using extra - segmental mechanisms. tens can also be used as a counter - irritant, termed intense tens, using high - intensity and high - frequency currents (table 2, figure 3). the user can control the amplitude (intensity), duration (width), frequency (rate) and pattern (mode) of the pulsed electrical currents. in western clinical practice tens has been shown to have a role in pain management. there are many systematic reviews on tens although evidence is often inconclusive because of shortcomings in rct methodology. early systematic reviews suggested that tens was of limited benefit as a stand alone pain therapy for acute pain. judged there to be no benefit of tens for postoperative pain because 15 of 17 rcts found no differences in pain relief between active and placebo tens. re - assessed the evidence and concluded that tens reduced post - operative analgesic consumption if tens was applied using adequate tens technique. systematic reviews have also concluded that there was no evidence for tens producing beneficial analgesic effects during childbirth [19, 20 ] and insufficient evidence to determine the effectiveness of tens in reducing pain associated with primary dysmenorrhoea. rcts suggest that tens is effective for acute orofacial pain, painful dental procedures, fractured ribs and acute lower back pain (for review see. previously, systematic reviews suggested that tens may be of benefit for chronic pain but definitive conclusions were hindered by shortcomings in rct methodology [23, 24 ]. reviews on rheumatoid arthritis of the hand, whiplash and mechanical neck disorders, chronic low back pain, poststroke shoulder pain and chronic recurrent headache were inconclusive. in contrast, systematic reviews have demonstrated tens efficacy for knee osteoarthritis and chronic musculoskeletal pain. rcts have also demonstrated effects for a range of other chronic pain conditions including localized muscle pain, post - herpetic neuralgia, trigeminal neuralgia, phantom limb and stump pain and diabetic neuropathies (for review see. a recent cochrane review by robb. concluded that there is insufficient available evidence to determine the effectiveness of tens in treating cancer - related pain [32, 33 ]. the international association for the study of pain (iasp) speculate that the prevalence of most types of pain may be much higher in developing countries than in developed countries, although epidemiological evidence is lacking. it is known that there is a higher incidence of pain conditions associated with epidemics such as hiv / aids in the developing world. an iasp developing countries task force, which included africa and the middle east reported that pain management in the general population was inadequate, although there was considerable variations between regions. limited resources, ignorance by health care professionals and a lack of pain specialists were contributing factors. this has impacted significantly on pharmacological therapy with many drugs commonly used in the developed world being unavailable to the general public because of the weak economy and limited purchasing power of citizens. in addition, drugs even when available may be fake, adulterated, passed their expiry date or perished due to inadequate storage. the cost of a tens device is 30gbp, although devices are available for less than 15gbp if bought in bulk. once purchased a tens device will not perish or deteriorate and devices in the developed world are used for many decades without the need for further servicing or repair. often clinics purchase tens devices in bulk and loan them to patients for short and long term use, on the proviso that the patient returns the device to the clinic when it is no longer needed. manufacturers recommend that individual pads have longevity of one month on daily use, although patients often use them for far greater lengths of time, especially if they take care to store them carefully. electrode costs can be reduced by using carbon rubber electrodes which are smeared with electrode gel and attached to the skin with micropore tape, rather than using self adhering electrodes. in general, tens has no known drug interactions and so can be used in combination with pharmacotherapy to reduce medication, medication - related side effects and medication costs. tens has very few side effects with no incidents of serious or adverse events reported in the literature. tens has a rapid onset of action, unlike medication, and there is no potential for toxicity or overdose. clearly, there is a case to use tens for pain management in the developing world. however, research is needed to determine the feasibility of tens use in developing countries. perhaps health promotion authorities should alert the public and heath care practitioners to the role of tens as an important aid in the fight against pain. | transcutaneous electrical nerve stimulation (tens) refers to the delivery of electrical currents through the skin to activate peripheral nerves. the technique is widely used in developed countries to relieve a wide range of acute and chronic pain conditions, including pain resulting from cancer and its treatment. there are many systematic reviews on tens although evidence is often inconclusive because of shortcomings in randomised control trials methodology. in this overview the basic science behind tens will be discussed, the evidence of its effectiveness in specific clinical conditions analysed and a case for its use in pain management in developing countries will be made. |
a 40-year - old african american woman with a medical history of anorexia nervosa, depression, and a documented history of iron overload syndrome presented to the emergency department with a self - reported weight loss of 150 lbs, confusion, ambulatory dysfunction, and generalized weakness, all of which progressed over a period of 1 year. approximately 5 months earlier, she had been hospitalized for 8 weeks, having presented at that time with weakness, weight loss (stated her baseline weight was 234 lbs and at that time weighed 118 lbs) and dysphagia, and was diagnosed with vitamin d deficiency, niacin deficiency, myopathy, as well as esophageal ulceration, gastritis, and duodenal ulcer which were demonstrated on esophagogastroduodenoscopy (egd). she had been discharged home with planned follow - up in 3 weeks ; however, she did not present for follow - up. she stated she was eating an unrestricted oral diet ; however, she had previously received both enteral and parenteral nutrition due to the severity of her malnourishment. further review of systems revealed absent menses for the past 3 years. aside from her personal history of alcohol abuse disorder, she denied abuse of licit or illicit substances including tobacco, and was in remission from alcoholism at the time of presentation for more than 6 months. on general examination, she appeared emaciated and cachectic despite being within normal range of body weight for her height, suggesting underlying obesity with marked weight loss and malnutrition. she weighed 97 lbs and was 5 feet tall, with a body mass index of 18.9 (based on her self - reported baseline weight, this is a 137 lb weight loss). vital signs demonstrated only mild sinus tachycardia with heart rate of 105 without orthostatic changes noted. abdominal examination initially revealed only a well - healed percutaneous endoscopic gastrostomy (peg) scar. neurologic exam disclosed decreased muscle tone and evidence of cognitive decline (slums [saint louis university mental status ] score was 20/30), consistent with dementia. laboratory studies revealed macrocytic anemia (hemoglobin 7.8 g / dl mcv [mean corpuscular volume ] 125 fl, reticulocyte 2.3%, red blood cell [rbc ] 1.8210/l, with normal white blood cell [wbc ] and platelet counts, normal folate and vitamin b12, normal iron and transferrin studies, and elevated ferritin being 1,491 ng / ml [normal 15200 ng / ml ]). total 25 hydroxy vitamin d was extremely low at 4 ng / ml, deficient range < 20 ng / ml. thyroid studies were within normal limits. hepatic profile demonstrated a normal total protein of 7.1 g / dl, low albumin of 2.4 g / dl, slightly elevated total bilirubin of 1.2 mg / dl, elevated aspartate transaminase of 94 u / l (normal range 032 u / l), and elevated alkaline phosphatase of 167 u / l (normal range 35104 serum ammonia was measured due to her confused status and history of hepatic disease, which was slightly above normal range at 54 mol / l (normal range 1151 mol / l). subsequent direct bilirubin measured 2 days later was 0.4 mg / dl (normal range 0.00.3 mg / dl) indicating a primarily indirect hyperbilirubinemia. a viral hepatitis profile demonstrated hepatitis a igm antibody positivity, indicative of active hepatitis a infection. neurologic investigation initially included structural neuroimaging specialty consultation with neurology and psychiatry services, as well as evaluation of systemic etiologies (lyme disease, wilson 's disease, b12 and/or folate deficiency, syphilis, vasculitides and rheumatologic disease, etc.). a non - contrast ct of the head at the time of admission showed age - inappropriate diffuse cerebral atrophy. magnetic resonance imaging (mri) with fluid attenuated inversion recovery (flair), in addition to age - inappropriate atrophy already demonstrated on ct, showed a few scattered foci of increased t2 and flair (fig. erythrocyte sedimentation rate (esr) was significantly elevated at 130 mm / h (normal range 020 mm / h), and rheumatoid factor was positive with a titer above 1:4, suggesting an inflammatory or possibly autoimmune process. other biomarkers including anti - nuclear antibodies (ana), lyme titer, rpr, folate, vitamin b12, serum copper and ceruloplasmin, as well as human immunodeficiency virus (hiv) 1 and 2 elisa were non - reactive. electromyelography (emg) with nerve conduction studies (ncs) demonstrated bilateral lower extremity myopathy without evidence of demyelinating disease. single photon emission computer tomography (spect) imaging was done, but revealed no additional diagnostic findings. 2) was obtained, which demonstrated marked ascites with anasarca, and a small fatty liver. further laboratory studies included serum alpha - fetoprotein, human hemochromatosis protein (hfe) gene, ceruloplasmin, anti - liver kidney muscle (anti - lkm) antibody, and serum prealbumin, all of which were unremarkable except low prealbumin (14 mg / dl [normal=1845 mg / dl ]), which is a more specific marker of protein malnutrition than albumin. further research into the patient 's medical chart from her previous hospitalization at another facility revealed that a liver biopsy had been done. histologic examination had not revealed any additional diagnosis, and the hepatic iron index was 1.9 (hepatic iron index above 1.9 in a patient without liver failure suggests hemochromatosis given the abnormalities noted in hepatic function, an index of 1.9 was not considered diagnostic for hemochromatosis). the folate, vitamin b12, and normal thyroid studies were all normal, and the patient reported being completely abstinent from alcohol in the recent past ; therefore, the etiology was unclear. during the hospitalization, her anemia became increasingly severe, falling below 7 and requiring transfusion of packed rbcs. bone marrow histopathology and flow cytometry revealed infiltration by gelatinous substance, fat atrophy and marrow hypocellularity (fig. 3), with normal female karyotype and no evidence of occult malignancy. axial ct and sagittal mri of the brain show significant age - inappropriate diffuse cerebral atrophy. pathologic examination of bone marrow demonstrating focal gelatinous substance (arrows), consistent with she was hydrated intravenously until she became euvolemic and was able to achieve adequate oral intake of fluids. she received megestrol, which works through various hormonal pathways including glucocorticoid and gonadotropic stimulation, and at doses between 400 and 800 mg daily has been shown to improve appetite and oral intake in patients with anorexia. there was significant improvement in her appetite, and she tolerated a calorically adequate oral diet, which was supplemented by multivitamins, zinc, folic acid, and vitamin d. she was also treated pharmacologically with sertraline 100 mg daily, and non - pharmacologically with physical therapy and counseling. once she became medically stable, she was transferred to the psychiatric unit, as her depression and severe cognitive deficits had only minimally improved and was not suitable for discharge. over the next month and a half, she slowly improved, and appropriate outpatient support services were arranged. her treatment was properly maintained for the next 6 months, and her follow - up examination at this time demonstrated marked clinical improvement, significant resolution of her neurocognitive deficits, as well as a rise in hemoglobin to 11.5 g / dl with normalization of rbc indices (i.e., mcv). the above case represents a young female with severe malnutrition presenting with hypoproliferative macrocytic anemia, as well as hepatic disease and neuropsychiatric impairment.. however, she did apparently lose 137 lbs in less than a year (53% weight loss). a small retrospective study published in 2002 correlating bone marrow changes and clinical factors in patients with eating disorders found that the amount of weight loss alone correlated with bone marrow changes, with no correlation found between bone marrow changes and other clinical factors (9). whether gmt was fully or partially responsible for any components of the patient 's hematologic, hepatic, or neurocognitive presentation is unknown. her liver disease certainly could have been related to a self - limited hepatitis a infection, as well as being a manifestation of her severe protein malnutrition. macrocytic anemia has been described in the literature as associated with gmt ; however, causality versus association has not been clearly elucidated. nevertheless, gmt is a very rare finding, and typically occurs in young adult males with severe malnutrition (1, 4). while still unclear, the purported pathophysiology involves deposition of gelatinous substance in bone marrow to replace adipose cells which are systemically depleted due to severe catabolism (1, 3, 5). mucopolysaccharides enriched with hyaluronic acid comprises this gelatinous substance deposition, rendering the bone marrow microenvironment unfavorable for erythropoiesis, (3, 5, 6) although degree of gmt and severity of anemia have not been shown to be concordant (1, 2). though the lesion is mostly associated with chronic wasting diseases, few patients with malnutrition develop gmt, therefore, additional factors likely play a role in its pathogenesis (1, 3). while the condition should theoretically reverse upon adequately treating the underlying cause (1, 2, 4, 5, 7), few cases of successful reversal of gmt have been published. the authors have not received any funding or benefits from industry or elsewhere to conduct this study. | gelatinous bone marrow transformation (gmt), also known as starvation marrow, represents a rare pathological entity of unclear etiology, in which bone marrow histopathology demonstrates hypoplasia, fat atrophy, and gelatinous infiltration. the finding of gelatinous marrow transformation lacks disease specificity ; rather, it is an indicator of severe illness and a marker of poor nutritional status, found in patients with eating disorders, acute febrile illnesses, acquired immunodeficiency syndrome, alcoholism, malignancies, and congestive heart failure. we present a middle - aged woman with a history of alcoholism, depression, and anorexia nervosa who presented with failure to thrive and macrocytic anemia, with bone marrow examination demonstrative of gelatinous transformation, all of which resolved with appropriate treatment. to our knowledge, there are very few cases of gmt which have been successfully treated ; thus, our case highlights the importance of proper supportive management. |
ssireum is a traditional korean sport in which two athletes hold on to a satba (a cloth - sash tied around the waist and the thigh of the right leg) and use strength and various skills to throw their opponent to the ground1. the weight classifications depend on the level of ssireum such as gyungjang, sojang, chungjang, yongjang, yongsa, yeoksa, and jangsa1. many previous studies have suggested that different sports require athletes to have different physical characteristics according to the way in which the sport is played2,3,4,5. for example, judo athletes have a robust skeleton (that is, strong bone density) and well - developed muscles to enable them to withstand and transmit the forces applied during the fight6. likewise, ssireum athletes have special physical characteristics such as higher weight, muscle mass, and body fat in order to enhance their physical performance1. in recent years, an isokinetic muscle test has begun to be used in sports science for the assessment of muscle performance and injury prevention in athletes7,8,9. athletes may develop significant muscle imbalance that is specific to the style of the sport they play. muscle strength imbalance is assessed by comparing the strength of the right muscle group with that of the left muscle group, as well as by determining the agonistic and antagonistic balance relationship. muscle strength imbalance as it relates to injuries in athletes has been studied, and bilateral imbalance of muscle strength has been suggested as a risk factor for injury in many sports10,11,12,13. many previous studies about injury in athletes have shown that imbalance in the hamstring - to - quadriceps peak torque ratio (h : q ratio) is correlated with a greater incidence of lower extremity injury7, 14, 15. overall muscle imbalance can be estimated through not only muscle strength but also through muscle architecture. a previous study suggested that bilateral structural imbalance of the muscles is related to lower extremity injuries in professional basketball players16. muscle structure imbalance can be estimated through the use of a body composition analyzer, which can analyze lean body mass (lbm), fat - free mass (ffm), fat mass (fm), body fat (bf), and lean mass of each limb4. although many studies on muscle imbalance in different types of sports activities have been conducted, research on ssireum athletes has rarely been performed. therefore, our study provides information regarding the muscle conditions of ssireum athletes for the purpose of informing decisions related to training and rehabilitation. the present study enrolled 25 elite ssireum athletes with no physical or psychological conditions who provided voluntary written informed consent to participate in this study. the seven weight categories were as follows : gyungjang (up to 75 kg), sojang (up to 80 kg), chungjang (up to 85 kg), yongjang (up to 90 kg), yongsa (up to 95 kg), yeoksa (up to 110 kg), and jangsa (up to 150 kg)1. the subjects were asked to complete a questionnaire administered by individual in - depth interviews that took about 30 min per person. the protocol for the study was approved by the committee of ethics in research of the university of yongin, in accordance with the terms of resolution 5 - 1 - 20, december 2006. in the present study, the modified somatotype method for the analysis of body type was used1, 5, 17,18,19,20. to confirm body composition, lbm, ffm, fm, bf, and lean mass of both limbs of participants were measured using a precision body composition analyzer (inbody 720 ; biospace, korea). measurements were taken with the participants wearing only ssireum pants in a standing position with slight abduction of both arms1. to measure the isokinetic peak torque of the elbow and knee flexion / extension on both sides, we used an isokinetic muscle strength dynamometer (isomed 2000 ; isomed, germany). for elbow joint testing, participants were positioned sitting on the dynamometer chair and stabilized using straps across the chest and pelvis. the shoulder joint was positioned in 45 abduction with 30 flexion, and the forearm was supine. the mechanical rotation axis of the dynamometer was aligned with the lateral humeral epicondyle and the established range of motion was 20 to 110. for examination of the knee joint, the participants were positioned sitting on the dynamometer chair and stabilized by straps across the chest and pelvis and femoral region. the mechanical axis of rotation of the dynamometer was aligned to the femoral lateral epicondyle. resistance was applied immediately above the ankle joint, and the established range of motion was 20 to 90 of knee flexion. tests were performed in the reciprocal concentric mode and composed of three repetitions at 60/s velocity to measure peak torque. prior to testing, the subjects performed three sub - maximal contractions for familiarization. the examiner verbally encouraged the subjects during the test to help bring forth maximal efforts. statistical analyses were conducted using pasw statistics version 18.0 (spss / ibm ; armonk, ny, usa) to calculate averages and standard deviations. the significance level was set to =0.05 when performing a paired t - test. table 1table 1.general characteristics of the korean ssireum athletes included in the studyvariablemean standarderror / n (%) age (yrs)21.6 0.7gendermale (%) /female (%) 25 (100.0)/ - (-)height (cm)/weight (kg)178.0 1.0/98.1 4.1bmi (kg / m)30.5 1.1weight divisiongyungjang 5 (20.0)sojang 3 (12.0)chungjang 4 (16.0)yongjang 3 (12.0)yongsa 3 (12.0)yeoksa 3 (12.0)jangsa 4 (16.0)career (yr)10.4 0.5dominant sideupper limbright / left24 (96.0)/1 (4.0)lower limbright / left24 (96.0)/1 (4.0)body compositionlbm (kg)/ffm (kg)40.6 2.6/74.3 2.2fm (kg)/bf (%) 21.6 3.8/20.7 2.3somatotypeendomorphy -mesomorphy 23 (92.0)ectomorphy2 (8.0)central -endo. c0.7 0.1bmi : body mass index ; lbm : lean body mass ; ffm : fat - free mass ; fm : fat mass ; bf : body fat ; endo. c : ectomorphic component shows the general characteristics and somatotypes of the korean ssireum athletes. the lbm of the left upper limb was significantly higher than that of the right upper limb. however, the lbm of the left lower limb was significantly lower than that of the right lower limb (table 2table 2.differences in the lean mass of the limbs on both sides in the korean ssireum athletesvariablelimb sideright sideleft sideupper limb (kg)4.4 0.24.6 0.2lower limb (kg)11.0 0.310.9 0.2all data are presented as the mean standard error. p < 0.01.). the peak torque for left elbow flexion was significantly higher than that for right elbow flexion. conversely, the peak torque for left elbow extension was significantly lower than that for right elbow extension. furthermore, the peak torque for the left knee was significantly lower than that for the right knee for both flexion and extension (table 3table 3.difference in the isokinetic muscle strength of the limbs on both sides in the korean ssireum athletesvariablelimb sideright sideleft sideelbowpt - flex (nm)68.4 3.073.7 3.5pt - ext (nm)67.2 2.858.0 3.0pt / bw - flex (%) 74.6 3.678.7 4.2pt / bw - ext (%) 71.8 3.462.3 3.4kneept - flex (nm)139.2 7.4126.2 6.7pt - ext (nm)224.7 13.7205.7 10.5pt / bw - flex (%) 150.0 7.4133.4 5.7pt / bw - ext (%) 236.4 11.8211.7 7.4h : q ratio (%) 63.4 2.162.0 1.9all data are presented as the mean standard error. p < 0.05, p < 0.01. pt - flex : peak torque of flexion ; pt - ext : peak torque of extension ; pt / bw - flex : peak torque / body weight of flexion ; pt / bw - ext : peak torque / body weight of extension ; h : q ratio : hamstring - quadriceps ratio). the peak torque / body weight (pt / bw) ratio for both, elbows and knees showed a similar pattern to the respective peak torques (table 3). however, the h : q ratio was not significantly different between the knee joints (table 3). bmi : body mass index ; lbm : lean body mass ; ffm : fat - free mass ; fm : fat mass ; bf : body fat ; endo. c : ectomorphic component all data are presented as the mean standard error. p < 0.01. all data are presented as the mean standard error. p < 0.05, p < 0.01. pt - flex : peak torque of flexion ; pt - ext : peak torque of extension ; pt / bw - flex : peak torque / body weight of flexion ; pt / bw - ext : peak torque / body weight of extension ; h : q ratio : hamstring - quadriceps ratio in the present study, body composition results showed that the lean mass of the upper limbs was higher on the left side than on the right ; for the lower limbs, lean mass was higher on the right side. unexpectedly, peak torque and the pt / bw ratio for elbow extension was higher on the left side than on the right. many previous studies have suggested that muscle strength would be higher on the dominant side than on the non - dominant side in athletes irrespective of whether the upper or lower limbs were evaluated7, 10,11,12, 21, 22. according to previous studies, brazilian national handball players have significantly stronger throwing - side shoulders than non - dominant - side shoulders, and elite karate athletes have greater elbow strength on the dominant side21, 22. however, even though almost all participants in our study were right - handed, body lean mass and peak flexor torque were higher for the left upper limb. this can probably be explained by the nature of ssireum. during a ssireum match, athletes face their right shoulders ; they grab the close waist s satba with the right hand and the far leg s satba with the left hand. using this position this technique of ssireum may result in superior left elbow compared to right elbow flexor strength, possibly because the left hands are farther from what they are reaching for during this pulling motion. the risk of bilateral muscle imbalance is greater in the lower limbs than in the upper limbs7, 10,11,12. bilateral muscle imbalance of the lower limbs was suggested as a risk factor for hamstring and anterior cruciate ligament injuries. a previous study suggested that there is an increased rate of injury in cases of a difference of 15% or more in knee flexor or hip extensor strength in collegiate athletes14. in addition, an imbalance in the h : q ratio was shown to correlate with a higher incidence of lower extremity injury. the typical h : q ratio of a healthy knee ranges from 50 to 80% ; it is commonly accepted that an h : q ratio of 60% or higher is desirable in rehabilitation8, 15, 23. in this study, ssireum athletes experienced no issues with respect to h : q ratios in their knee joints. the bilateral muscle strength of the lower limbs in ssireum athletes was imbalanced ; thus, ssireum athletes have a potential risk of knee injuries. according to our previous study on injuries in combat sports, although other factors are definitely contributory, this result may be evidence of muscle strength imbalance leading to knee joint injuries in ssireum athletes24. balance training exercises, which may involve the use of resistance or unstable surfaces, can decrease lower limb asymmetry with the aim of reducing the risk of injury25. we suggest that ssireum athletes undertake balance training exercise to reduce the risk of injury to their knees. in conclusion, this study revealed a bilateral imbalance in muscle condition in ssireum athletes, suggesting that more studies are needed to assist in proper training, injury prevention, and rehabilitation. | [purpose ] the purpose of the present study was to elucidate the muscle conditions such as the isokinetic muscle of korean ssireum athletes. [subjects and methods ] this study enrolled 25 elite ssireum athletes. we measured body composition and peak torque at an angular speed at 60/s using an isokinetic muscle strength dynamometer. [results ] the lean body mass of the left upper limb was significantly higher than that of the right upper limb. however, the lean body mass of the left lower limb was significantly lower than that of the right lower limb. the peak torque for left elbow flexion was significantly higher than that for right elbow flexion. conversely, the peak torque for left elbow extension was significantly lower than that for right elbow extension. furthermore, the peak torque for the left knee was significantly lower than that for the right knee for both flexion and extension. [conclusion ] the data from this study elucidate in part the muscle conditions of korean ssireum athletes, which can be used to establish a reference for the scientific study of sports physiotherapy. |
spinal giant cell tumors (sgcts) are locally aggressive benign bone tumors that can occur anywhere along the spine. sgcts account for approximately 2 to 3% of all giant cell tumors (gcts). its incidence is higher in females, the sacral region, and patients aged 20 to 40 years.1 2 sgcts are usually discovered at enneking stage 2 (fully osteolytic lesion with well - defined borders) and stage 3 (ill - defined border lesion eroding and extending beyond cortex into the surrounding soft tissue).3 donthineni reported that 13.7% of sgcts eventually metastasize to the lung, a higher rate compared with extremity gct.4 the goals of sgct treatment are tumor removal, spinal stability, and neural tissue decompression. the choices of operative treatment are en bloc vertebrectomy (ev) or intralesional resection (ir).5 6 because of the proximity of vital structures to the vertebrae, ev may be too damaging to undertake in some cases. therefore, ir might be the alternative choice in selected cases.7 numerous adjuvant therapies can be employed with either of these two surgical strategies. because previous studies have provided inconclusive results, we compared the overall recurrence rates and complications between ir with or without adjuvant therapy against ev in patients with sgct from published case series. two independent reviewers (p.l., w.s.) performed a search in october 2015 of all peer - reviewed relevant literature in human patients using embase and pubmed for studies comparing ir versus ev treatment in patients with sgct. the following search terms were used : ((giant cell tumo) and ((((((spine) or spinal) or vertebral) or vertebra) not sacrum) not craniocervical)) and ((recurrence) or complicatio). additional searches were performed by using the reference lists from the retrieved studies that were relevant to sgct. the preferred reporting items for systematic reviews and meta - analyses protocol was followed for data selection and analysis. the inclusion criteria were randomized controlled trials, observational studies, or case series in patients with primary sgct (excluding the sacrum), intervention (ir), comparator (ev), and outcomes that reported local recurrence or incidence of postoperative complications. studies were excluded if they had fewer than three patients, multiple gct lesions, less than 6 months ' follow - up, recurrent tumors, previous surgical resections, mixed reports with other tumor types, or lack of specificity for time points of recurrence or complications. then, thorough full - paper readings were performed of the studies that might meet the inclusion criteria to determine final inclusion. the rates of local recurrence and postoperative complications were extracted directly from the original studies to calculate risk ratios. the methodological quality of the included studies was independently assessed by the two reviewers using the methodological index for nonrandomized studies (minors) scale that allocates a maximum of 24 points for comparability, exposure, quality of selection, and outcome of study participants.8 we performed a meta - analysis using review manager software (revman version 5.1 ; nordic cochrane center, copenhagen, denmark). risk ratios (rrs) and 95% confidence intervals (cis) were used to evaluate the dichotomous outcomes of incidence of local recurrence and complications. statistical heterogeneity was assessed using the cochrane q test, with a p value set at 0.1 for significance. heterogeneity between trials was evaluated based on an assigned i value and substantial heterogeneity was represented by an i value greater than 50%. the fixed - effects model was used when the effects were assumed to be homogenous. in the presence of heterogeneity, we used a random - effect model. a funnel plot with the test of begg and mazumdar was used to evaluate publication bias.9 10 11 sensitivity analysis was performed by rejecting the studies with higher statistical heterogeneity. two independent reviewers (p.l., w.s.) performed a search in october 2015 of all peer - reviewed relevant literature in human patients using embase and pubmed for studies comparing ir versus ev treatment in patients with sgct. the following search terms were used : ((giant cell tumo) and ((((((spine) or spinal) or vertebral) or vertebra) not sacrum) not craniocervical)) and ((recurrence) or complicatio). additional searches were performed by using the reference lists from the retrieved studies that were relevant to sgct. the preferred reporting items for systematic reviews and meta - analyses protocol was followed for data selection and analysis. the inclusion criteria were randomized controlled trials, observational studies, or case series in patients with primary sgct (excluding the sacrum), intervention (ir), comparator (ev), and outcomes that reported local recurrence or incidence of postoperative complications. studies were excluded if they had fewer than three patients, multiple gct lesions, less than 6 months ' follow - up, recurrent tumors, previous surgical resections, mixed reports with other tumor types, or lack of specificity for time points of recurrence or complications. then, thorough full - paper readings were performed of the studies that might meet the inclusion criteria to determine final inclusion. the rates of local recurrence and postoperative complications were extracted directly from the original studies to calculate risk ratios. the methodological quality of the included studies was independently assessed by the two reviewers using the methodological index for nonrandomized studies (minors) scale that allocates a maximum of 24 points for comparability, exposure, quality of selection, and outcome of study participants.8 we performed a meta - analysis using review manager software (revman version 5.1 ; nordic cochrane center, copenhagen, denmark). risk ratios (rrs) and 95% confidence intervals (cis) were used to evaluate the dichotomous outcomes of incidence of local recurrence and complications. statistical heterogeneity was assessed using the cochrane q test, with a p value set at 0.1 for significance. heterogeneity between trials was evaluated based on an assigned i value and substantial heterogeneity was represented by an i value greater than 50%. the fixed - effects model was used when the effects were assumed to be homogenous. in the presence of heterogeneity, we used a random - effect model. a funnel plot with the test of begg and mazumdar was used to evaluate publication bias.9 10 11 sensitivity analysis was performed by rejecting the studies with higher statistical heterogeneity. there were 507 abstracts (172 from pubmed and 335 from embase) identified through the database search. of these, 122 publications were duplicates and thus a total of 385 unique abstracts were screened. eighty - six abstracts were selected for full review after 299 nonrelevant abstracts were removed. eighty - two reports were excluded for following reasons : 3 had unclear data, 17 had multiple tumor types reported, 7 had no surgery, 10 did not compare ir / ev, 4 had recurrent tumors, 2 had multiple lesions, and 39 were nonqualifying publications (review article, case report, technical note, correspondence). the reviewers selected a total of four studies for systematic review and meta - analysis of sgct recurrence (fig. abbreviations : c, cervical spine ; ev, en bloc vertebrectomy ; ir, intralesional resection ; l, lumbar spine ; na, no mention ; pae, preoperative arterial embolization ; rt, radiotherapy ; s, sacrum ; t, thoracic spine. only mobile spine counted. all four studies selected for meta - analysis of recurrence were retrospective case series that showed lower rates of recurrence and postoperative complications with ev as compared with ir.2 5 12 13 however, ev was not performed prior to 1991 in the series by boriani.2 the follow - up period ranged from 19 to 328 months. most of the patients having ir received postoperative radiation therapy ranging from 30 to 50 gy in 10 to 20 fractions.2 both the series by boriani and the series by junming had one patient death in the early postoperative period ; these patients were not included in their analyses because local recurrence could not be assessed.2 13 we excluded one case in the series of junming of an sgct lesion located solely in the posterior elements of c7. in total, the included series contained 91 patients with primary sgct. of these patients, 42 underwent ev and 49 underwent ir. overall recurrence rates for sgct treated with ir versus ev were 36.7% (18 of 49 patients) versus 9.5% (4 of 442 patients), respectively. the pooled rr for tumor recurrence was 0.22 (95% ci 0.09 to 0.52 ; p = 0.0006 ; homogeneity i 0%), suggesting that ir was associated with a higher rate of recurrence (fig. 2). forest plot to illustrate risk ratio in recurrence between vertebrectomy and intralesional resection. abbreviations : ci, confidence interval ; m - h, mantels - haenszel methods. two of these studies also qualified for meta - analysis of postoperative complications, for a total of 29 patients.12 13 in the ir group, 4 of 11 patients experienced complications (including screw loosening, graft fracture, intrathoracic hematoma, and respiratory failure) versus 2 of 18 patients in the ev group (including intraoperative bleeding / abdominal wall weakness and postoperative cerebrospinal fluid leakage). junming reported an intraoperative unilateral vertebral artery injury in two patients in the ev group that required unilateral ligation ; however, these patients experienced no postoperative deficits and were not counted as postoperative complications in the analysis.13 the rates of postoperative complications for sgct treated with ir versus ev were 36.4% (4 of 11) versus 11.1% (2 of 18), respectively. the pooled rr for postoperative complications was 0.34 (95% ci, 0.07 to 1.52 ; p = 0.16 ; homogeneity i = 0% ; fig., there was a lower rate of postoperative complications associated with ev compared with ir, but without statistical significance. forest plot to illustrate risk ratio in postoperative complications between en bloc vertebrectomy and intralesional resection. abbreviations : ci, confidence interval ; m - h, mantels - haenszel methods. the mean minors scores of the included studies were 14.75 1.50 (table 2). funnel plotting for bias demonstrated that all four studies fell within the funnel, all near the midline (fig. 4). funnel plot for the publication bias test of the four eligible studies. scored 0 (not reported), 1 (reported but inadequate), or 2 (reported and adequate). gcts of the mobile spine are classified as locally aggressive benign tumors, but they have a high overall reported rate of recurrence (11 to 45%).14 15 16 case series have been reported, suggesting that total tumor removal must be performed to prevent local recurrence and pulmonary metastases. many single case reports showed no local recurrence after vertebrectomy in the cervical, thoracic, and lumbar regions.17 18 19 20 21 however, because of the complexity of spinal anatomy and the proximity to neural elements, vertebrectomy may require sacrifice of vital structures causing significant and permanent postoperative morbidity. other series have reported the efficacy of ir with adjuvant therapy for preventing local recurrence, a technique that arguably would produce lower complication rates and less morbidity.22 23 24 most of these studies had limited numbers of patients. therefore, our objective was to systematically review studies comparing the efficacy of sgct operative treatment and to increase statistical power by performing a meta - analysis. ev has reported local recurrence rates of 0 to 14%, and ir has recurrence rates of 0 to 71%.2 5 12 13 17 18 19 20 21 25 26 27 our meta - analysis produced pooled local recurrence rates of 9.5% for ev and 36.7% for ir, a statistically significant fourfold higher recurrence rate. postoperative complication rates have been reported for up to 24% of patients after ev,2 5 12 13 and up to 80% after ir.2 5 12 13 16 22 25 26 this study demonstrated that patients having ir had a higher rate of postoperative complications (36.4%) compared with patients having ev (11.1%), but this difference did not reach significance. there were many factors that affected postoperative complications including comorbidities, severity of disease, follow - up period, adjuvant therapy, and tumor location. explanations as to why ev had a lower complication risk than ir may include selective bias (surgeons preferred ev in patients with fewer comorbidities, less - extensive tumor extension, and younger age), exclusion of studies (several studies were excluded because they only reported ir results), or underreporting of complications in the ev group. none of the included studies reported details of comorbidities. there were no differences in overall follow - up duration or tumor location, but the use of adjuvant radiation varied in the two studies reporting its use in ir.2 13 there was no difference in the local recurrence rate between patients having ir receiving radiation (35%) and those not undergoing radiation (21%). because the use of adjuvant radiation was in part determined by the surgeons ' decision the methodological quality of the included studies demonstrated minors scores between 14 and 17, slightly higher than the mean reported scores for nonrandomized surgical studies. our assessment of bias demonstrated that all the included studies fell within the funnel plot, although the relatively small number of studies did not result in a wide distribution within the funnel. first, no randomized controlled trials of sgct have been conducted because of the relative rarity of sgct, ethical issues, tumor proximity to surrounding neural structures, and high technical skill and experience required to perform ev. second, only a few cases series met the inclusion criteria for the meta - analysis, and all were retrospective ; only two studies reported the postoperative complication rates. third, there likely was a physician selection bias in choosing the type of operation because less aggressive lesions in healthier patients were perhaps more likely to be treated with ev. conversely, physicians may have preferred ir in patients who had severe comorbidities or extensive lesions. ev in the cervical spine can be a significant challenge because of surrounding vital anatomy and neurologic risk. ir may be selected in these cervical tumors in an attempt to prevent devastating complications and severe disability. fourth, different adjuvant therapy protocols were used in the patients having ir, including radiotherapy and preoperative embolization. additionally, in the series by martin and mccarthy, two patients having ev had follow - up periods less than 1 year (6 and 10 months, respectively). both of them had no recurrence at the final evaluation. because of the short follow - up time, the incidence of local recurrence may be underestimated in this report. thus, the meta - analysis does not provide any data regarding which adjuvant treatments are more efficacious when used with ir. xu reported on factors influencing the recurrence risk in 102 patients with sgct. their multivariate analysis found that ir had a hazard ratio of 3.02 when compared with ev (p = 0.02). however, their report does not specifically state the recurrence - free intervals for the patients in each surgical treatment group, and thus we could not include their patients in our meta - analysis. however, their report provides informative findings on a relatively large series of patients, and their results mirror ours.28 in conclusion, this meta - analysis demonstrated that ev for gcts of the mobile spine was associated with a significantly reduced risk for future recurrence. in addition, ev had a lower postoperative complication risk, although this finding did not reach significance. further multicenter prospective cohort studies are needed to strengthen the evidence for how best to treat these challenging tumors. surgeons must carefully evaluate patients with sgct on a case - by - case basis, weighing the morbidity of the surgery and the overall health of the patient with a decision to perform ev. | study design systematic review and meta - analysis. objective to compare the recurrence and perioperative complication rate of en bloc vertebrectomy (ev) and intralesional resection (ir) in the giant cell tumor of the mobile spine (sgct). methods we systematically searched publications in the pubmed and embase databases for reports of sgcts, excluding the sacrum. two reviewers independently assessed all publications. a meta - analysis was performed using local recurrence and postoperative complications as the primary outcomes of interest. results there were four articles reporting recurrence and two articles reporting postoperative complications. all included articles were case series. in all, 91 patients were included ; 49 were treated with ir and 42 were treated with ev. local recurrence rates were 36.7 and 9.5% in the ir and ev groups, respectively. rates of postoperative complications were 36.4% with ir and 11.1% with ev. overall, patients treated with ev not only had a lower recurrence rate (relative risk [rr ] 0.22 ; 95% confidence interval [ci ] 0.09 to 0.52) but also had a lower postoperative complication rate (rr 0.34 ; 95% ci 0.07 to 1.52) compared with ir. conclusions based on the limited data obtained from systematic review, sgct patients treated with ev had a lower recurrence rate and fewer postoperative complications than those treated with ir. |
suction blister epidermal grafting (sbeg) is a simple and effective way of surgical repigmentation in cases of vitiligo, especially when areas such as lip and eyelids are involved. the major problem faced during the procedure is the time taken for the formation of blisters. temperature at the suction site is one of the factors affecting the blister formation time. unna was the first to observe and document blistering of intact skin with suction cups. the first in - vitro separation of epidermis from dermis using suction was done by blank and miller in 1950. the first in - vivo suction blister formation was demonstrated by slowey and leider in 1961. falabella first used this technique for transplantation of viable epidermis in achromic lesions of the skin. gupta. developed a modified suction device using 5 ml, 10 ml and 20 ml syringes with a three - way stop cock and a latex tubing from the drip set to connect the suction syringe with the negative pressure producing syringe of 50 ml. this was in turn attached to a manometer on the third vent of the three - way. subsequently, in another study, gupta. demonstrated the usefulness of the modified suction apparatus without using a manometer, where they standardised the height of the pressure column of the suction syringe with the amount of negative pressure generated [figure 1 ]. wood 's lamp and infrared lamp have been used previously for faster induction of suction blister formation. we have used a hair dryer to raise the surface temperature at the site of suction blistering and to reduce the blister formation time. (a) suction apparatus, (b) hair dryer, (c) infrared thermometer total seven patients with vitiligo involving both the angles of mouth and adjacent lower lip, without the involvement of other body areas were enrolled. all the patients had stable vitiligo lesions, i.e., patients reporting no new lesions, no progression of existing lesions and absence of koebner phenomenon during the past 1 year. the patients having progressive lesions, active herpes labialis, keloidal tendency and those on corticosteroids or psoralen plus ultraviolet a (puva) therapy 2 weeks prior to the surgery were excluded. after taking consent, suction syringes were applied on both the thighs of all the patients. on the right thigh, blisters were raised as per the procedure standardised by gupta. without using a manometer. on the left thigh, similar procedure was used, but a hair dryer (philips hp 8100, 1000 w) was used additionally to raise the surface temperature of the skin to 44c. the minor operation theatre room where surgeries were performed the hair dryer was blown, once every 10 min, for 1 min from a distance of 1 feet to raise the surface temperature to the desired level. the surface temperature was recorded using an infrared thermometer once in 10 min (i.e., after blowing hair dryer) from the intervening skin between two suction syringes. the time taken for the formation of the recipient site was dermabraded including 23 mm of perilesional normal skin till punctate papillary bleeding was observed. the blisters were cut along their borders with curved iris scissors parallel to the skin surface. the roof was everted over a glass slide in such a way that the dermal surface faced upward. then, it was placed and spread over the recipient site. for graft fixation, surgical glue, all the patients were started on topical puvasol (topical psoralen application followed by solar exposure as a source of ultraviolet a) after sbeg and followed up after 2 months. the patients were instructed to apply diluted (1:20) topical 8-methoxy psoralen followed by a sun exposure of 56 min every day between 9 and 11 am. total seven patients with vitiligo involving both the angles of mouth and adjacent lower lip were studied [table 1 ]. there were four females and three males. two patients had a family history of vitiligo. the mean time taken for formation of blister on the right thigh (without raising the surface temperature) was 121.1 6.2 min and the mean time taken for blister formation on the left thigh (surface temperature raised with the help of a hair dryer) was 69.6 5.4 min. the clinical pictures taken after 55 min showed partial blister formation on the right thigh whereas the left thigh showed well - formed, unilocular, dome - shaped blisters at the same time with few haemorrhagic blisters most likely due to heat - induced vasodilation [figure 2 ]. the decrease in blister formation time on the left thigh, where surface temperature was raised with the help of a hair dryer was statistically significant as compared to the right thigh. profile of patients and the time taken for the formation of blisters blister formation on both the thighs after 55 min all the patients were started on topical puvasol after sbeg and followed - up for 2 months. all of them showed uniform repigmentation of the grafted sites, with no colour mismatch from the surrounding skin [figure 3 ]. baseline and follow - up pictures there were no adverse effects noted during the procedure apart from heat - induced mild discomfort while blowing the hair dryer. in none of the patients, the procedure had to be abandoned because of any adverse event. total seven patients with vitiligo involving both the angles of mouth and adjacent lower lip were studied [table 1 ]. there were four females and three males. two patients had a family history of vitiligo. the mean time taken for formation of blister on the right thigh (without raising the surface temperature) was 121.1 6.2 min and the mean time taken for blister formation on the left thigh (surface temperature raised with the help of a hair dryer) was 69.6 5.4 min. the clinical pictures taken after 55 min showed partial blister formation on the right thigh whereas the left thigh showed well - formed, unilocular, dome - shaped blisters at the same time with few haemorrhagic blisters most likely due to heat - induced vasodilation [figure 2 ]. the decrease in blister formation time on the left thigh, where surface temperature was raised with the help of a hair dryer was statistically significant as compared to the right thigh. profile of patients and the time taken for the formation of blisters blister formation on both the thighs after 55 min all the patients were started on topical puvasol after sbeg and followed - up for 2 months. all of them showed uniform repigmentation of the grafted sites, with no colour mismatch from the surrounding skin [figure 3 ]. baseline and follow - up pictures there were no adverse effects noted during the procedure apart from heat - induced mild discomfort while blowing the hair dryer. in none of the patients, the procedure had to be abandoned because of any adverse event. as this is a left - right comparison study, i.e., self - controlled study, the time - independent confounding variables are eliminated. one of the major drawbacks of suction blister grafting is the time taken for the formation of blister. they are size of the suction cups or diameter of the suction syringe, site of blister formation, age of the patient, negative pressure, intradermal injection of saline, temperature at the suction site, pathological variations due to underlying disease states such as cutis laxa, ehler - danlos syndrome (eds) and corticosteroid therapy as well as other manoeuvres such as starting puva therapy 2 weeks before the suction blistering procedure. gupta and kumar used 2, 5, 10, 20 and 50 ml syringes as suction cups and noted the difference in suction blister induction time. they concluded that suction blister induction time is directly proportional to the diameter of the suction syringe / cup. koga found abdomen and thighs as the most suitable donor sites though the blister formation time was approximately 45 hr. gupta. observed the blister formation time to be the least when anterolateral thigh was taken as the donor site. another study showed that there is no significant difference in the suction blister formation time over the flexor aspect of the forearm and the anterolateral thigh. blister formation is more time - consuming and difficult in young patients as compared to the elderly patients because of weak dermoepidermal adherence in the latter. gupta and kumar demonstrated that the suction syringes with larger diameter require lower negative pressure (ideally 300 to 400 mmhg) and if the size of suction syringe is 1 cm, then the negative pressure can be raised up to 500 mmhg. intradermal injection of normal saline or local anaesthetic can reduce the blister formation time by causing intradermal oedema thereby hastening the accumulation of fluid at dermoepidermal junction. pathological conditions such as cutis laxa and eds require longer time for suction blister induction, whereas atrophy induced by corticosteroid therapy may reduce the suction blister induction time by weakening the dermoepidermal junction. other manoeuvres such as pre - treatment of suction blister site with puva for about 2 weeks, increases the suction blister induction time by causing photosclerosis and thereby reducing the extensibility of the skin. van der leun first reported the facilitating effect of temperature on the formation of blister. the optimum temperature described for formation of blister in various studies is 40c 45c. he stated that the optimal temperature for maximal activity and stability of tyrosinase are 35c45c and at higher temperatures it becomes inactive. demonstrated faster blister formation using infrared lamp of 150 w to achieve a surface temperature of 40c which reduced the blister induction time by 55%. selected anterolateral aspect of bilateral thighs as the donor site and exposed one of the thighs of each patient to a wood 's lamp for 20 min, without the ultraviolet tubes touching the skin. this improved the speed as well as quality of blister formation, possibly by increasing the surface temperature at suction site. we took the help of a hair dryer to raise the surface temperature of the suction site and an infrared thermometer to read the surface temperature of the skin. heat - induced protein denaturation and influence of temperature on viscosity are the possible mechanisms by which heat reduces the blister formation time. highly viscous bond is present in the lamina lucida and constitutes the weakest link in the structures of dermoepidermal junction, thus facilitating separation at this level. hair dryer is a very simple instrument, easily available, and well affordable and the time saved during the procedure is quite significant. suction blister grafting has a high success rate of repigmentation in vitiligo involving the angles of the mouth but the time taken for the formation of blisters is a major roadblock. external application of controlled heat with a simple and low cost device like hair dryer can reduce the blister formation time significantly without any significant adverse effects and compromise in the final pigmentary outcome. | background : suction blister epidermal grafting (sbeg) is a simple and effective way of surgical repigmentation in vitiligo. the major problem faced is the time taken for the formation of blisters. temperature at the suction site is one of the factors affecting the blister formation time.aims and objectives : to reduce the blister formation time in sbeg by increasing the surface temperature to 44c.materials and methods : this is a left - right comparison study. total seven patients with lip vitiligo involving both the angles of lips were enrolled. suction syringes were applied on both the thighs of all the patients. on the right thigh, blisters were raised as per the procedure standardised by gupta. on the left thigh, similar procedure was used, but a hair dryer was used additionally to increase the surface temperature of the skin to 44c. the time taken for the formation of well - formed, dome - shaped, unilocular blister was noted.results:the mean time taken for the formation of blister on the right thigh was 121.1 6.2 min and on the left thigh was 69.6 5.4 min. all the seven patients were started on puvasol after sbeg. there was complete repigmentation of the grafted sites in all the patients after 2 months.conclusion:hair dryer is easily available, affordable and simple to use and the time saved during the procedure is quite significant. |
bone scans have become a key tool in assessing musculoskeletal pathology [1, 2 ]. use of single photon emission computerized tomography (spect) is becoming more common over the years as well. use of spect allows a three - dimensional assessment of the isotope dispersed in the subjects body, as compared with a two - dimensional assessment with planar regular scintigraphy. the perfusion phase, assessed at 30 to 60 seconds following injection, the blood - pool phase assessed at 2 to 5 minutes following injection, and the late phase at 2 to 5 hours following injection. the use of polyphosphate compounds with the isotope tc and mainly tc - mdp allows differentiating between pathologies within soft tissues surrounding the bone and those within the bone in the perfusion phase and that found in the late phase which is attributed to the chemical reaction of the polyphosphate compounds and the hydroxyappetite crystals within bone. planar scintigraphy of complex or large structures within the skeletal system does not relay an accurate three - dimensional anatomic image, while use of spect mapping allows for spatial localization of the pathology in the mapped organ. the most common etiologies are osteoarthritis, osteonecrosis, and degenerative tears of the menisci. knee pain may be referred from the hip or lumbar spine, and vascular malformations of the lower limbs have been attributed to knee pain as well. use of diagnostic aids allows for improved anatomical localization of pathology in the knee. osteoarthritis is the most common joint disease and afflicts the knees of 30% to 40% of those over 65 years of age suffering from it. local degenerative changes in weight bearing joints appear from the second decade of life. by the age of 40, degenerative processes within weight bearing joints may be detected in up to 90% of the population, although these are generally asymptomatic. in 1994, the world health organization and the american academy of orthopedic surgeons defined osteoarthritis as the result of both mechanical and biologic events that destabilize the normal coupling of degradation and synthesis of articular cartilage and subchondral bone. the subchondral bone has an important role in the development of chondral pathology. in 1986, radin and rose suggested that the cartilage within the joint is susceptible to shearing forces at points of decline or rise in subchondral bone density and cartilage fibrilation appears at these sights. recurrent microtrauma, even in a healthy joint, brings about reorganization of the subchondral bone and thus transitional areas of changing subchondral bone density. an important tool in assessment of knee osteoarthritis is planar scintigraphy performed following instillation of marked technitium. in these patients an enhanced uptake in subarticular bone during the late phase may precede the roentgenogrphic changes by many years and relays the changes in local vascularity and the osteoblastic actitivity which mark the initial stages of osteoarthritis. a good correlation was found between pathological roentgenograms and bone scintigraphy in osteoarthritic patients and these changes may be predicted by scintigraphic findings [1214 ]. a diffuse uptake was correlated with pain and osteophyte formation, whereas localized uptake was correlated to subchondral bone sclerosis. 2-to-5 minutes following instillation of the isotope containing fluid to the circulation the blood pooling phase of the scan is elicited. assessment at this stage elicits inflammatory changes within the skeleton and soft tissues surrounding it [14, 16 ], due to concentrations of the isotope containing fluid in areas of hyperemia and neovascularization. during periods rendered as active osteoarthritis, synovitis may be seen as an exaggerated pooling during the blood pool phase, which is positively correlated to osteoarthritic knee pain. collier and johnson found spect to be superior to planar scintigraphy in patellofemoral osteoarthritis when concomitant involvement of one of the other knee compartments was evident as well, which was attributable to its ability to distinguish between the compartments which overlie each other in the planar view [12, 18, 19 ]. both spect and planar scintigraphy were found inadequate in assessing the lateral compartment, although spect was superior to planar scintigraphy to some extent. as far as the medial compartment is concerned no advantage in the use of spect over planar scintigraphy was found in assessing osteoarthritis, although a pathological reading in the spect mapping may point to early subchondral changes in articular cartilage. the typical presenting symptom is pain along the medial articular aspect which is greater than that usually accompanying osteoarthritis. osteonecrosis typically afflicts the older population with predominance in women and may progress to osteoarthritic changes secondary to the disease. in the early stages of the disease, increased uptake the image of localized uptake in the medial femoral condyle in the spect mapping usually appears before that in planar scintigraphy [15, 18 ]. the patient will describe a locking or giving way sensation of the knee. at times, excess joint fluids and localized tenderness over the articular crease may be appreciated as well. in the younger patient population meniscal tears are usually traumatic in origin whereas in the elderly they are attributed to degenerative processes within the joint. a number of clinical tests may be elicited in the knee with meniscal pathology with localized tenderness over the articular crease, and positive mcmurry and appley tests being the most widely accepted. fowler and lubliner found the mcmurry sign to be specific in meniscal tear associated with a limitation in knee extension, whereas others found limitations in the use of this test. as to the appley test, the literature attributes a low predictive value to this test in predicting meniscal pathology. localized tenderness over the articular crease is of high sensitivity and specificity in lateral meniscal tears whereas in medial meniscal tears these values are considerably lower. it should be pointed out that these findings are mainly from a relatively young patient population with a traumatic meniscal injury pattern, which may very well affect the clinical presentation in such cases. meniscal tears appear in spect mappings as localized uptake in a semicircular form in the vicinity of the suspected tibial plateau [3, 22, 23 ]. the orthopedist is often faced with the question which is the best diagnostic modality suitable for affirming his clinical diagnosis. often, the roentgenographic appearance does not add to the confirmation of the suspected diagnosis since changes are late in most clinical pictures that is, osteoarthritic changes, avascular necrosis, and meniscal tears. in his effort to afford an objective finding to the elderly patients ' knee pain, a growing number of diagnostic tests are performed, planar scintigraphy and spect becoming ever so popular. this study was performed in an effort to correlate findings in physical assessment of the knee with those in planar and spect scintigraphy, in an effort to better delineate the clinical value of each of these studies in the elderly with knee pain. 116 patients were prospectively enrolled in this study. the patient population included 68 patients who complained of chronic knee pain and a control patient group which included 48 patients asymptomatic as to knee pain. patient recruitment was performed at both sourasky medical center in tel - aviv and at assaf harofeh medical center in zerifin, israel. the study was authorized by the local helsinki committee. following patient informed consent to enroll in the study, each patient inclusion criteria for enrollment in the study included : age over 50 years, patient willingness to undergo both planar and spect scintigraphy of both knees, agreement to undergo physical examination, fill in questionnaires and pain response scales, and patient health was considered good by the examining physician that is, patient was mobile without use of assistance or devices and was able to take part in the study. patients were excluded from the study if trauma involving the knees occurred in the previous two months, if pregnant or suspected to be so, patients with a known allergy to technetium or its derivatives, and patients with history of gout, rheumatoid arthritis, psoriatic arthritis, or other known inflammatory disease. the patient incurred a fracture to one of his knees in the past or a surgical procedure involving either of his knees in the last six months. patient participation in another clinical trial during participation within this trial was an exclusion criterion as well. these were a visual analogue pain scale (vas) and the western ontario and mcmaster universities osteoarthritis index (womac). these are well accepted in the evaluation of knee pain. through interpretation of the patient responses to the questionnaires they were divided into a study (patient rendered symptomatic as to chronic knee pain) and control group. the evaluation included the following measures ; observation : angulation of the joint (varus versus valgus), the degree of freedom in rotation of the joint, and periarticular edema. palpation : synovial fluid bulging, medial, lateral, patellofemoral, and popliteal sensitivity. stability of the joint and specific physical signs assessed included the mcmurry test, appley test, compression & traction test, bounce home test, anterior and posterior drawer signs, and medio - lateral stability. all patients underwent planar and spect scintigraphy according to the following protocol. following intravenous instillation of 25 mci of technetium mdp-99 m, a dynamic assessment of five seconds per scan per minute was performed, and then a blood pool assessment was performed with collection of 500 k counts in an anterior view of the lower limbs. the planar scintigraphy was performed utilizing an anterior view with accumulation of 700 k counts. spect was performed up to a 180 degree angle with step angle of 3 degrees. matrix was set as 64 64 and a zoom of 1.28 at a speed of eighteen seconds per step. reconstruction was performed utilizing the filtered back projection method with a 3.10 mz filter, so a transaxial, saggittal, and coronal as well as a three - dimensional reconstruction was formed. scintigraphies were assessed in order to relay local concentrations and there intensity with respect to knee anatomy. both physical and radiological assessments were performed without the physicians performing them aware to which study group the patient belongs. analysis was performed on ninety - six knees (48 patients) in the control asymptomatic group of patients and on one hundred and thirty two knees in the symptomatic trial group (68 patients). chi - square probability values were calculated utilizing the frequency procedure or in some cases the anova procedure. for continuous variables such as range of motion forty - eight patients were assigned to the control group and sixty - eight were assigned to the study - symptomatic group. the average patient age of those assigned to the study group was 64.735 years with a standard deviation of 10.316 and that of the control group was 66.354 with a standard deviation of 10.771. the study - symptomatic group of patients was comprised of 42 women (62%) and 26 men (38%) while the control - asymptomatic group was comprised of 17 women (35%) and 31 men (65%). the gender differences between the groups were statistically significant (p < 0.001)percentage of women within the study group was 62% compared to a mere 35% in the control group. the average vas response in the study group was 77.15 with a standard deviation of 42.7 and that of the control group was 1.23 with a standard deviation of 3.4 which was found to be statistically significant (p < 0.001). the average womac response in the study group was 745.26 with a standard deviation of 634.9 and that of the control group was 13.96 with a standard deviation of 29.7 which was found to be statistically significant (p < 0.001) as well. planar and spect scintigraphy results were assessed according to the localization and intensity of the mapping in the respective compartments of the knee. the lateral compartment was divided into areas rendered as the lateral femoral condyle and lateral tibial plateau. the medial compartment was divided into areas rendered as the medial femoral condyle and medial tibial plateau. the patellofemoral compartment was divided into areas rendered patellomedial and patellolateral, whilst in the spect scans an area rendered retropatellar was assigned. when the blood pooling phase was assessed, the scans were evaluated according to their uptake patterns rather than according to the different knee compartments. the following tables contain data relevant to correlations between the different mapping methods and findings during the patients ' physical examination. the values in bold are those with statistically significant chi - square probability values. in order to prevent skewing of the radiological findings ' interpretation it was decided that a correlation rendered relevant to statistical analysis would be between positive findings on physical examination and in both localization and amount of uptake in the examined scan. a correlation between physical assessment findings and the results during the blood pool phase such a correlation was found for physical findings such as excessive joint fluid, synovial inflammation, patellofemoral tenderness, and a restricted range of motion in both flexion and extension. it should be noted that in the control group probability values were not calculated for the joint rotation examination, bounce home test, mcmurry and appley meniscal tests, the compression & traction test, the posterior drawer test, and lateral stability tests. this was due to the fact that no positive tests were found within the control group of patients. due to the same reason, chi - square probability for the joint rotation test and posterior drawer sign the following tables present chi - square probability for physical assessment findings correlated with findings on both planar scintigraphy and spect, within the different knee compartments and study populations. in tables 2, 3, 4, 5, 6, and 7 the bolded values are chi - square probability values of statistical significance (p < 0.01). here too, in order to prevent skewing of the radiological findings ' interpretation it was decided that a correlation rendered relevant to statistical analysis would be between positive findings on physical examination and in both localization and amount of uptake in the examined scan. in the study - symptomatic patient group we found physical findings of excessive joint fluid, synovial thickening, limited joint range of motion, and positive patellar grinding tests to be associated with pathological findings in both planar scintigraphy and spect. when compared with table 1, it is notable that all these physical findings but a positive patellar grinding test were correlated with excessive uptake during the blood pool phase. it should be noted that when the symptomatic patients were evaluated using spect a significant correlation was found between excessive tenderness at the medial joint crease and patellofemoral compartment on physical examination with positive findings on the spect examination. a number of additional differences were found between the assessments of patients using the spect compared with planar scintigraphy. while planar scintigraphy findings showed a correlation between findings of excessive joint fluid and synovial proliferation with excessive uptake on planar scintigraphy at both the medial femoral condyle and the medial tibial plateau, these findings correlated with excessive uptake only at the medial tibial plateau when spect was used. it was also found that a restricted range of knee flexion correlated well with a finding of excessive uptake at the medial femoral condyle on planar scintigraphy whereas spect correlated this finding with excessive retropatellar uptake. limited extension of the knee correlated with excessive uptake at the lateral and medial femoral condyles and the medial tibial plateau in both planar scintigraphy and spect. a positive patellar grinding test correlated with excessive uptake at the medial tibial plateau on planar scintigraphy and at both the medial tibial plateau and the lateral femoral condyle when evaluated using spect. a number of physical findings did not correlate with either excessive uptake on planar scintigraphy or in the use of spect. these findings were knee alignment, q angle, lateral joint crease tenderness, tenderness over baker 's cyst, or in the vicinity of the pes anserinus, meniscal tests and tests for knee joint instability. it should be noted that for knee joint rotation and posterior drawer sign chi - square probability values were not calculated, due to the absence of participants with pathological findings. in the control - asymptomatic patient group a number of physical findings correlated with planar scintigraphy. these included excessive medial joint crease tenderness with excessive uptake at the lateral femoral condyle, patellofemoral tenderness and excessive uptake at the lateral femoral condyle and tenderness at the vicinity of the pes anserinus, and uptake at the medial tibial plateau. when evaluated by spect, a correlation was found between tenderness to palpation of the lateral joint crease or at the patellofemoral compartment with excessive uptake at the lateral femoral condyle was noted. a positive appley test correlated with excessive uptake at the medial femoral condyle. previously published studies stated that spect scintigraphy is superior to planar scintigraphy when osteoarthritis of the patellofemoral compartment is present concomitantly with osteoarthritis in the medial or lateral compartments of the knee [1, 16, 17 ]. it was also stated in previous studies that spect has no advantage over that of planar scintigraphy in assessing the medial compartment of the knee. our findings show an advantage of use of spect over planar scintigraphy in delineation of pathology in both the medial and lateral compartments of the knee. we did not find a correlation between localized lateral compartment sensitivity in neither planar nor spect scintigraphy. these findings do align with those of a previous study by yang. which found both methods to be of poor clinical value in evaluation of the lateral compartment of the knee. when reviewing the results the physical findings of intraarticular fluid, synovial proliferation, limitations in range of motion, and the positive patellar grinding test were found to correlate positively with both planar and spect scintigraphy as well as a pathological reading during the blood pool phase. previous studies have found pathological readings during the blood pool phase to be correlated with an inflammatory condition in the localized area of the skeletal system. thus, objective findings in scintigraphy which were correlated with the above physical findings further corroborate our assumption that within the symptomatic patient population the knee pain stems from osteoarthritic changes. this may be further strengthened when reemphasizing that patients enrolled in the study did not suffer from trauma or undergo surgical intervention prior to enrollment in the study. spect was superior to planar scintigraphy in correlating localized medial articular crease and patellofemoral tenserness with uptake in the medial tibial plateau. further advantages incurred through use of the spect mapping were probably due to its ability to better define anatomic areas and delineate localized uptake. for example, synovial proliferation with a finding of excess intra - articular fluid were found to correlate positively to excess uptake at both the medial femoral and tibial condyles on planar scintigraphy whereas spect findings were limited to the tibia alone. a similar scenario, but of greater clinical impact was found when correlating limited flexion of the knee with planar scintigraphy findings which resulted in excessive uptake in the vicinity of the medial femoral condyle while spect correlated with excessive uptake at the patellofemoral joint that is, where pathological findings would be expected in patients suffering from osteoarthritic changes and a flexion contracture. of interest is the fact that in the control group, which contained patients rendered asymptomatic as to knee pain, a positive correlation was found between tenderness at the lateral articular crease and patellofemoral compartment with excessive uptake in the lateral femoral condyle (tables 8 and 9). this may be explained by changes in subchondral bone which may appear prior to articular chondral damage and thus does not eliminate knee pain in these patients. a positive appley test correlated positively with excessive uptake in the medial femoral condyle in spect scintigraphy, as well. we could not find an acceptable explanation to this finding, whilst moreover other meniscal tests such as the bounce home and mcmurry tests failed to show any significant correlation whatsoever. it is of note that a positive correlation was found in planar scintigraphy between localized tenderness at the patellofemoral junction and excess uptake at the lateral femoral condyle which may be explained by localized overlapping and inferior capability of planar scintigraphy to differentiate uptake emanating from the patellofemoral compartment from that of a true lateral articular joint nature. this study was aimed at comparing planar and spect scintigraphy while correlating them to physical assessment findings in patients suffering from chronic knee pain and those asymptomatic as to knee pain. one of the difficulties encountered within the scope of this study was the absence of a clinically proven entity for knee pain in the symptomatic patient group. this could be coped with by performing a concomitant assessment of patients by knee arthroscopy which was not done within the scope of this study. our working diagnosis in most, if not all, symptomatic patients assessed within the scope of this study, was that they suffer from osteoarthritis of the knee as indicated by their complaints and physical assessment. it should be noted that the symptomatic and asymptomatic patient populations differed significantly (p < 0.01) as to gender and were not of equal size, facts which may very well bring about a statistical sway in the study results. our findings suggest spect scintigraphy to be superior to planar scintigraphy when correlated to physical assessment findings in elderly patients suffering from chronic knee pain. when tenderness localized to the medial articular crease or the patellofemoral compartment was found during physical assessment these findings correlated positively with spect scintigraphy, whereas planar scintigraphy findings lacked any correlation. in an age when unicondylar knee arthroplasty is readily available as a treatment for unicompartmental osteoarthritis of the medial or lateral compartments of the knee [25, 26 ], an advantage exists in the ability to delineate sequestered compartmental involvement in the human knee. we believe a finding of tenderness at the medial articular crease or of the patellofemoral compartment of the knee should be considered an indication for the use of spect scintigraphy rather than planar scintigraphy as a diagnostic aid in assessing the elderly with chronic knee pain. | chronic knee pain is a common complaint among the elderly and appears in 30%40% of the population over the age of 65. this study was performed in order to evaluate correlation between clinical presentation of chronic knee pain and the imaging findings of spect and planar bone scintigraphy. methods. we prospectively recruited 116 patients over the age of 50 who had neither knee surgery nor trauma. patients were divided into symptomatic and asymptomatic groups. all patients were examined by an experienced orthopedic surgeon ; on the same day imaging was performed. statistical analysis was performed to correlate physical examination findings with planar scintigraphy and spect findings and blood pool images. results. in symptomatic patients, planar scintigraphy correlated significantly (p < 0.01) with the presence of excessive joint fluid, synovial condensation, and decrease in range of motion as measured in extension and flexion and patellar grinding test. spect findings correlated with all of the above tests as well as with medial and patellofemoral joint tenderness. conclusions. we believe a finding of tenderness at the medial articular crease or of the patellofemoral compartment of the knee should be considered an indication for the use of spect scintigraphy rather than planar scintigraphy. |
the thyroid gland (lat.glandula thyroidea) is located in the neck in front of the larynx (lat.larinx), and consists of two lobes (lat.lobus) connected by narrowing (lat.isthmus). seen from the front has the shape of a letter h or a butterfly with its wings outstretched. thyroid gland is odd endocrine gland that secretes two important hormones : thyroxine (t4) and triiodothyronine (t3) (1, 2, 3, 4, 5). their secretion is controlled by thyroid - stimulating hormone (tsh), secreted by the anterior lobe of the pituitary gland. as a prelude to the release of hormones from the thyroid gland into the blood and to convert them in circulation, this process occurs through the effect of the enzyme (proteinase and peptidase), which are normally present in the thyroid. thyroxin and triiodine - tironin thus separating the molecules of thyroglobulin and then as free hormones released into the blood (6, 7, 8, 9, 10). of the hormones that are secreted in the blood about 90% is the thyroxine, and 10% triiodine - tironin but triiodine - tironin is four times more potent than thyroxine. in contrast effect of thyroxine takes about four times longer than the active triiodine - tironin. therefore, the effect of each of these hormones in the period in which it operates, expressed per unit mass of hormones, probably equal. once it enters the peripheral cells, mainly thyroxine loses iodine and creates triiodine - tironin. therefore it is considered that the true intracellular hormone mainly triiodine - tironin rather than thyroxine. released t3 and t4 crossing the blood bind to its specific protein carriers with firm but reversible bond. these carriers are : globulin (tbg), prealbumin, albumin and those obtained by bonding characteristics of macromolecules, which affects their metabolism and distribution in the body. less than 1% of the released hormones are free hormones, that is not tied to carriers and only this fraction of free hormone is available to tissues and has metabolic effects (1, 3, 5). t3 and t4 are general metabolic stimulants which act on virtually all tissues of the body. their most important effects are : a) strengthening the metabolism of lipids, proteins, and carbohydrates ; b) reinforcement of growth and development ; c) the regulation of water and electrolyte transport ; d) stimulation of the cardiovascular system ; e) stimulation of the central nervous system. there are two main modes of action of thyroid hormone in the body : a) increase in overall metabolism ; b) promote growth in children. thyroid hormones increase the metabolic activity in virtually all tissues of the body (except the brain, retina, testicles and lungs). basal metabolism may increase by as much as 60 - 100% above normal values if secrete large amounts of hormones. mental processes become more intense and the activity of most endocrine glands often becomes larger. some of the mechanisms of action of thyroid hormones are : a) increased protein synthesis ; b) increasing the amount and activity of enzyme systems ; c) increased volume and number of mitochondria and d) the effect on the active transport of ions (1, 3). most likely, the main effect of thyroid hormones is their ability to activate transcription process in the cell nucleus, which leads to increased production of proteins. thyroid hormones act on the following processes in the human body : the metabolism of carbohydrates promote metabolism;the metabolism of fat fat mobilization from adipose tissue, which leads to a greasy stock exhaustion, while increasing the concentration of free fatty acids in plasma;the metabolism of vitamins increase the need for vitamins, increasing the amount of many enzymes, which are essential ingredients and vitamins;the basal metabolism increase basal metabolism 60 - 100% above normal;the weight large quantities of the hormone leads to weight loss and vice versa, reducing the secretion of hormones will result in weight gain;the cardiovascular system increasing blood flow and an increase in cardiac output, increased heart rate, increases the strength of heart muscle (up to a certain limit), changes in blood pressure;the respiratory system increasing the frequency and depth of breathing;the digestive tract increase appetite and nutrient absorption, and intestinal motility;cns speed up the brain;on muscle function the stimulation of muscle function;on sleep if the increased amount of the hormone occurs insomnia and vice versa if is reduced, there is a strong drowsiness;the other endocrine glands increases secretion of other glands, but the need tissues for these hormones increases;sexual function (6, 7, 8, 9, 10, 11, 12, 13). the metabolism of carbohydrates promote metabolism ; the metabolism of fat fat mobilization from adipose tissue, which leads to a greasy stock exhaustion, while increasing the concentration of free fatty acids in plasma ; the metabolism of vitamins increase the need for vitamins, increasing the amount of many enzymes, which are essential ingredients and vitamins ; the basal metabolism increase basal metabolism 60 - 100% above normal ; the weight large quantities of the hormone leads to weight loss and vice versa, reducing the secretion of hormones will result in weight gain ; the cardiovascular system increasing blood flow and an increase in cardiac output, increased heart rate, increases the strength of heart muscle (up to a certain limit), changes in blood pressure ; the respiratory system increasing the frequency and depth of breathing ; the digestive tract increase appetite and nutrient absorption, and intestinal motility ; cns speed up the brain ; on muscle function the stimulation of muscle function ; on sleep if the increased amount of the hormone occurs insomnia and vice versa if is reduced, there is a strong drowsiness ; the other endocrine glands increases secretion of other glands, but the need tissues for these hormones increases ; sexual function (6, 7, 8, 9, 10, 11, 12, 13). the thyroid gland is controlled by the pituitary gland and its hormone tsh (thyroid stimulating hormone or thyrotropin), which depend on the production and release of thyroid hormone levels. in other words, when the level of t3 and t4 decreases, the pituitary gland is activated and begins to secrete tsh and its concentration in the blood increases. tsh stimulates the thyroid gland to produce and secrete t3 and t4, increasing their levels in the blood and leads to normalization of the situation. it is a part of the brain that produces trh (thyroid releasing hormone). trh stimulates the pituitary gland to secrete tsh (14, 15, 16). general classification of diseases of the thyroid gland looks like this : hyperthyroidism hyperactivity of the thyroid gland (thyrotoxicosis);hypothyroidism hypo function of the thyroid gland (cretinism myxedema innate acquired disease);thyroiditis inf lammation of the thyroid gland (hashimoto, subacute de quervain, and chronic silent);goiter enlargement (diffuse simple and multinodular toxic or non - toxic),the nodes nodes (functional, non - functional, solitary and multiple);tumors of the thyroid gland (benign adenomas, malignant cancer : papillary, follicular, medullary, and anaplastic). hyperactivity of the thyroid gland (thyrotoxicosis) ; hypothyroidism hypo function of the thyroid gland (cretinism myxedema innate acquired disease) ; thyroiditis inf lammation of the thyroid gland (hashimoto, subacute de quervain, and chronic silent) ; goiter enlargement (diffuse simple and multinodular toxic or non - toxic), the nodes nodes (functional, non - functional, solitary and multiple) ; tumors of the thyroid gland (benign adenomas, malignant cancer : papillary, follicular, medullary, and anaplastic). hypothyroidism is a condition which occurs due to decreased production, distribution disruption or lack of action of thyroid hormones. disruption of production caused by disease or disorder of the thyroid gland controls the pituitary or hypothalamus function. resistance to peripheral effects of thyroid hormone is a rare condition with an image of hypothyroidism and increased levels of circulating iodine tironine. hypothyroidism is traditionally divided into primary, caused by insufficiency of thyroid function, secondary, due to the absence of pituitary stimulation of thyrotropin, tertiary, due to insufficient secretion tiroliberina and quaternary because peripheral resistance to thyroid hormones. hypothyroidism, therefore, can arise due to disturbances in glandular disorders or monitoring mechanisms in higher brain structures. causes of primary hypothyroidism may include : a) the reduction of thyroid tissue ; b) normal or hyperplastic glands ; c) decreased stimulation of the thyroid gland and d) peripheral resistance to thyroid hormones. iodine deficiency is a major cause of hypothyroidism in the world. in countries with sufficient iodine in food, autoimmune disease dominated in 90% of cases (70% hashimoto and basedow 20%) as a cause of hypothyroidism, thyroid surgery followed. application tirosupressants during pregnancy (propylthiouracil, metamizol), antithyroid drugs (tionamidi) and other agents such as lithium, amiodarone recombined cytokines in tumor treatment (ifn-, il-2), p - aminosalicylic acid, aminoglutethimide, beta - carotene, contrast agents are the main causes transient iatrogenic hypothyroidism. subclinical hypothyroidism (sh) is a disorder that is defined as a condition with elevated serum levels of thyroid stimulating hormone tsh and normal serum concentrations of thyroid hormones by the absence of clinical signs and symptoms (canaris gj). by compensatory tsh elevation sh or mild thyroid failure is a common problem for the population, as indicated by the prevalence of 4 - 10%. the prevalence increases with age, with females compared to male up to 5 times, as evidenced by data on the prevalence of 20% among women older than 60 years. the incidence of overt hypothyroidism is about 1 - 2% in women and 0.1% in men. progression from subclinical to overt hypothyroidism is expected in 5 - 18% of cases (canaris gj). if tsh > 10 miu / l, the risk of crossing the sh to mh will be higher. antithyroid antibodies were detected in 80% of the sh, and 80% of these patients had serum tsh 10 miu / l, the risk of crossing the sh to mh will be higher. antithyroid antibodies were detected in 80% of the sh, and 80% of these patients had serum tsh 4.2 miu / l and normal levels of t3 and t4) and who were treated with low doses of l - thyroxine. all the tests were repeated 6 months aft er introduction of l - thyroxine therapy. the control group consisted of 50 patients with subclinical hypothyroidism that was not treated with l - thyroxine. excluded from the study were subjects with subclinical hypothyroidism of iatrogenic origin (all states after surgical intervention on the thyroid gland or after treatment with radioactive iodine). for each patient, a detailed history was taken and analyzed clinical and laboratory parameters. statistical analysis was performed using the computer soft ware specific to this type of problem. basic tables with calculated percentages are done in winword 2007 and testing of significance between mean differences of quantitative variables was done using the student t - test in the statistical package spss. the results shown in figure 1 indicate that the disorder of glycemic control was present in 58 (58%) of patients with subclinical hypothyroidism. in our sample, there were 20 patients with prediabetes (20%) and 38 with diabetes (38%). table 1 shows mean values of thyroid hormones in patients with prediabetes and diabetes prior treatment with l - thyroxine. it is evident that the patients with diabetes had significantly higher mean values of all thyroid hormones in relation to the group of patients with prediabetes. the results presented in table 2 indicate that the patients after 6 months of treatment with l - thyroxine had normal tsh (3.540.55 vs. 5.850.92, p=0.009) and normal values for total thyroid hormones. tables 3 and 4 show the values of lipid profile in the two groups before and after treatment with l - thyroxine. it is obvious that in the group with diabetes had increased values of all lipid fractions or the values of total cholesterol, triglycerides, ldl - cholesterol while reducing hdl - cholesterol compared to the group of patients with prediabetes. patients treated with l - thyroxine had decreased basal insulin values (114.6424.14 vs. 96.4417.26, p=0.01) and the value of basal c - peptide (1120.58299.17 vs. 883.58213.14, p=0.0005) compared to the group that was not treated with l - thyroxine. the results of correlation between tsh and hba1c were obtained through statistical analysis of coefficients of these parameters of our patients and are presented graphically as follows. (table 5) the results shown in figures 2 and 3 show that the tsh and hba1c signifi cantly correlated in both groups (r = 0.46 and r=0.29, p 0.05 (figure 4). the results shown in figure 5 show that the statistically significant positive correlation between tsh and fasting glucose in subjects treated with l - thyroxine (r=0.39, p<0.01). the results presented in figure 6 show that tsh significantly correlated with postprandial glucose in patients not treated with l - thyroxine (r=0.34, p<0.05). the results presented in figure 7 shows that the tsh highly significantly correlated with postprandial glucose in patients treated with l - thyroxine (r=0.41, p<0.01). the results presented in figures 8 and 9 show that tsh positively correlated with c - peptide, but not statistically significant in both groups (r=0.16 and r=0.19, p<0.05). the prevalence of subclinical hypothyroidism is 8 - 10%, even 15% of women and 3% of men. thyroid hormones regulate metabolic processes throughout the body and affect the supply of sugar in the blood. in hypothyroidism there is the slow absorption of carbohydrates from the digestive system, the slower emptying of the stomach, but increased sensitivity to insulin. the prevalence of thyroid disease in patients with diabetes mellitus is approximately 10 - 15% (1, 3). already slight subclinical hypothyroidism can cause outbursts of sensitive functions, such as left ventricular diastolic dysfunction, lack of ovulation, expression of ldl receptors increase ldl and decrease hdl - cholesterol while the total cholesterol is still normal. the slowdown of all processes leading to the loss of both their mutual balance of thyroid hormones regulate metabolic processes throughout the body and affect the supply of sugar in the blood. in hypothyroidism slowed reabsorption carbohydrates from the digestive system, the slower emptying of the stomach, but increased sensitivity to insulin. the absence of symptoms in patients with subclinical hypothyroidism and the serious health consequences, including cognitive disorders, stress the importance of timely diagnosis of subclinical hypothyroidism and adequate treatment of patients with small doses of l - thyroxine. subclinical hypothyroidism can progress to manifest, especially in patients with circulating antibody thyroid gland. determining the level of tsh is accurate, accessible, safe and inexpensive test to diagnose subclinical hypothyroidism. determining the level of tsh can be used to define the risk of the occurrence of various complications (osteoporosis, cardiovascular disease, depression) for different intervals between tsh. as a result, the decision on the introduction of replacement therapy will be made not only on the level of tsh, but based on additional factors, such as gender, age, smoking, hypertension, cholesterol levels, diabetes. type 1 diabetes is more common in young people, especially in puberty. even at the beginning of diabetes, the laboratory is detected elevated tsh, and thyroid hormones (t3 and t4) are normal. disease progression is towards development of manifest hypothyroidism, except when reduced thyroid hormones, there are problems. patients usually have fatigue, malaise, lethargy, cold intolerance, and get fat if you often have increased appetite, then i have stomach bloating and constipation, sweating and weak often feel pain in your chest. subclinical hypothyroidism independently increases the risk for decreased insulin sensitivity, especially in the adipose tissue and muscle. the concept of insulin resistance in patients with subclinical hypothyroidism has been further complicated by selective tissue sensitivity or order selective activity within the tissue that is resistant to its effect. subclinical hypothyroidism and insulin resistance via its numerous mechanisms involved in the disruption of glycemic control. most professionals who deal with these clinical entities believed to be of great importance to keep in mind what kind and what is the impact of treatment on l - thyroxine glycemic control in patients with subclinical hypothyroidism. thyroid hormones affect the cardiovascular system of direct action on the heart and blood vessels, as well as the influence on lipid profile and atherogenesis. in overt hypothyroidism, cardiovascular function, there is a disorder of systolic and diastolic function of the left and right ventricles. the latest research in the world speak of the existence of a positive correlation between serum tsh and total and ldl - cholesterol. specifically, subclinical hypothyroidism is a risk indicator for atherosclerosis and coronary heart disease which was written by several authors. chronically elevated crp levels also indicates the existence of long - term subclinical inflammation that exposes an individual s to risk of developing hypertension and other cardiovascular damage, leading to loss of elasticity of the arterial wall. some authors believe that crp is not only a marker of risk for hypertension, but it induces formation of hypertension. also, demonstrated a correlation between crp and markers of endothelial dysfunction in patients with diabetes mellitus, which suggests a link between the activation of the endothelium and chronic inflammation in diabetic patients. chronic subclinical inflammation is considered to be important for the initiation and / or progression of atherosclerosis in patients with diabetes mellitus. the results of our study showed decrease in total cholesterol (5.390.57 vs. 6.100.67), a reduction in triglycerides (1.690.37 vs. 2.220.49), hdl cholesterol (1.160.14 vs. 1.030.15) and ldl cholesterol (3.790.64 vs. 4.370.77). further, the results clearly showed that the concentration of crp in the serum of patients who were not treated with lthyroxine increased compared to the group of patients who were treated with l - thyroxine (2.270.8 vs. 3.321.1). also, changes were found in the level of postprandial glucose (7.452.0 vs. 8.482.35) in basal insulin levels (96.4417.26 vs. 114.6424.11) as well as the level of the basal c - peptide (883.58213.14 vs. 1.120299.17). the results we obtained in our study agree with the results reached by other authors. but it is important to note that this is a problem that is increasingly attracting the attention of world endocrinologist to keep it alive in their research. statistically significant correlation was obtained for tsh and hba1c values in patients treated with l - thyroxine (r=0.46, p<0.05), tsh and fasting glucose (r=0.39, p<0.05), tsh and postprandial glucose (r=0.41, p<0.05). statistically significant correlation was obtained for tsh and hba1c values in patients treated with l - thyroxine (r=0.46, p<0.05), tsh and fasting glucose (r=0.39, p<0.05), and tsh with postprandial glucose (r=0.41, p<0.05). hypothyroidism is one of the most common diseases of the endocrine system and is mostly of subclinical character. in most cases normalization of tsh levels leads to a reduction in postprandial glucose levels, crp, hba1c and lipids. this indicates a significant effect of treatment with l - thyroxine on glycemic control in patients with subclinical hypothyroidism. in our study, patients with subclinical hypothyroidism exhibited elevated levels of atherogenic parameters (hyperinsulinemia, total cholesterol, ldl - cholesterol). determination of tsh is accurate, accessible, safe and inexpensive test to diagnose subclinical hypothyroidism. determining the level of tsh can be used to define the risk of the occurrence of various complications (osteoporosis, cardiovascular disease, depression) for different intervals between tsh. adequate diagnosis requires : conducting extensive laboratory tests other than routine as the tsh test. monitoring of body temperature and careful monitoring of clinical signs, then well taken case history helps to faster and easier detection of this disease in medical practice. | goal : to investigate the correlation between tsh and hba1c in the treatment of l - thyroxine in the process of glycemic control in patients with subclinical hypothyroidism.patients and methods : the sample consisted of 100 patients, mean age 51.753.23 years, bmi=27.974.52 kg / m2, with sh (tsh>4.2 mu / l and normal serum t3 and t4). laboratory diagnosis included the determination of free t3, free t4, thyroid antibodies, tg, insulin, c - peptide and glucose during the ogtt, hba1c, crp and lipid levels. 20 patients with sh had prediabetes and 38 patients had dm. all patients were treated with low doses of l - thyroxine (25 - 50ug) and all were physically active.results:after 6 months of treatment with l - thyroxine, the patients had normal or decreased tsh (5.850.92 vs. 3.540.55 mu / l), insulin levels (114.6424.11 vs. 96.4417.26 pmol / l) significantly reduced hba1c (6.741.01 vs. 6.261.12) is reduced.conclusion:the correlation between tsh and hba1c was positive and significant (r=0.46). this indicates a significant effect of treatment with l - thyroxine on glycemic control in patients with subclinical hypothyroidism. |
early reperfusion is the modality of choice for treating stemi (st elevation myocardial infarction) 2. primary pci (percutaneous coronary intervention) is the preferred method of reperfusion when it can be performed in a timely fashion by experienced operators 3. there is a significant thrombus burden in nearly 30% of patient presenting with stemi 4. management of thrombus during pci for acute myocardial infarction could include aspiration thrombectomy, however, routine rheolytic thrombectomy has not shown clinical benefit 3. we present here the case of a young african male presenting late with a large anterior and inferior wall myocardial infarction. he was found to have massive extensive grade iv intracoronary thrombi 5 that was managed with dual antiplatelet agents and rivaroxaban. we present the case of a 39-year - old african male who presented to lutheran medical center in arusha, tanzania more than 12 hours after the onset of chest pain with anterior and inferior wall stemi. he had no known risk factors for coronary artery disease, no history of drug abuse, or medical illness in the past. since there was no cardiac catheterization facility available in the area, he was managed medically without fibrinolysis with aspirin, enoxaparin, and atenolol, and discharged home in 2 days. two days after discharge he came to the aga khan hospital in dar es salaam, tanzania for coronary angiogram with possible pci. on arrival, the ecg showed evolved anteroseptal and inferior wall myocardial infarction with persistent st elevation in the anterior leads. because of the ecg evidence of anterior as well as inferior myocardial infarction it was felt that the patient probably had a large wrap around lad (left anterior descending artery) which caused his index event. he received aspirin 300 mg, clopidogrel 600 mg, and atorvastatin 80 mg orally, and coronary angiography was performed the next day. the procedure was carried out by the right femoral approach, using six french sheath, six french judkins coronary catheters, and six french pigtail catheter for left ventriculogram. at the end of the procedure, the lca (left coronary artery) showed a large caliber left main trunk without stenosis. the lad was of large caliber with a filling defect near the ostium which appeared to be a retrograde propagation from the proximal thrombus present at the site of probable ruptured plaque (fig. distal lad wrapped around the apex and continued as the pda (posterior descending artery), which also appeared to have diffuse intraluminal thrombus (fig. the lcf (left circumflex) consisted essentially of a large posterolateral branch without stenosis. left ventriculogram showed akinesia of left ventricular apex and adjoining distal anterolateral, and inferior walls with estimated ejection fraction (lvef) of 3035%. (a) rao caudal view of lca (left coronary artery) showing lad (left anterior descending artery) ostial thrombus (white arrow), proximal thrombus, and ruptured plaque (black arrow). (b) rao cranial view of lca showing distal and apical lad with linear thrombus (white arrows). the lad wraps around the apex and continues into pda (posterior descending artery) which also has thrombi (black arrows). (c) rao caudal view of lca during the follow - up angiogram showing complete resolution of lad thrombi. (d) rao cranial view of lca during the follow - up angiogram showing complete resolution of lad and pda thrombi. because of the massive thrombus burden in the lad extending up to the ostium it was felt that the catheter aspiration extraction may not completely remove the thrombus and would carry a risk of embolization into the ramus and lcf. moreover, the infarct appeared to be completed. hence, it was decided to manage the patient conservatively and at a later date when the thrombus had cleared, pci for any residual significant stenosis could be considered. on the same day of the coronary angiogram, a 2-d echocardiogram showed normal lv chamber size with dyskinetic apex, akinetic anterior wall, and anterior interventricular septum. the patient was placed on daily oral dose of aspirin 75 mg, clopidogrel 75 mg, spironolactone 12.5 mg, and atorvastatin 80 mg as well as carvedilol 3.125 mg twice a day. for anticoagulation, rivaroxaban 20 mg a day was chosen because anticoagulation with warfarin is problematic given the general difficulty and reliable monitoring of inr, as well as patient compliance with any complex warfarin dosing regimen. he had complaint of mild chest discomfort when walking fast but no symptoms of heart failure. ecg showed further evolution of anteroseptal and inferior wall myocardial infarctions with less st elevation and more t - wave inversions in precordial leads (fig. repeat coronary angiogram was carried out via right femoral approach using six french sheath and catheters. the proximal lad was also of larger caliber without filling defect or stenosis with mild plaque and some swirling of contrast (fig. 2c). the mid, distal lad and the pda were patent without stenosis or filling defect (fig. echocardiogram showed hypokinesia of apical septum, apical lateral wall, and mid - interventricular septum with estimated lvef about 40%. the patient was discharged home on same medications except to stop rivaroxaban when the remaining 1 week supply of the medication was finished. st elevation myocardial infarction is generally caused by a coronary artery plaque rupture, platelet aggregation at the site of rupture followed by clot formation resulting in occlusion of a culprit coronary vessel. primary pci performed promptly in an experienced center is currently the preferred method of reperfusion of the occluded artery 3. management of thrombus during pci for acute myocardial infarction could include aspiration thrombectomy, however, routine rheolytic thrombectomy has not shown clinical benefit 3. during the performance of the pci, occasionally the culprit vessel is found to have massive thrombus burden. the optimal management of massive thrombus burden is not known and the treatment is usually individualized. if the thrombus burden is very large as in the case of a saphenous vein graft occlusion, there is higher rate of acute failure (8.2%) 7. for saphenous vein grafts, fibrinolytic therapy is no longer used for thrombus - containing lesions, but rheolytic or manual aspiration thrombectomy is sometimes employed 8. when extensive thrombi are seen in aneurysmal coronary arteries, they have been variously managed. they have been treated with intracoronary thrombolysis followed by heparin and warfarin 9, aspiration thrombectomy followed by prolonged intravenous infusion of a glycoprotein iib / iiia inhibitor 10, guide catheter aspiration together with the use of distal protection devices, withdrawal of a distal filter vascular protection device together with adjunct glycoprotein iib / iiia inhibitor 11. recently in patients with large acute anterior wall stemi, aspiration thrombectomy was not found to significantly reduce infarct size 12. in our case, the risk of thrombectomy of massive thrombus burden outweighed potential benefit especially since the lad had timi grade 3 flow despite the clots. although there was a potential danger of recurrent occlusion from thrombus propagation, it was felt that medical management would be more prudent. since the thrombus genesis has both platelet and the coagulation factor components, a triple anticoagulant therapy was chosen. in this part of the world, the use of warfarin and adjusting its dose to a therapeutic inr range is particularly challenging because of inconsistencies in laboratory results and lack of reliability of patient compliance. hence, in addition to the guidelines recommended therapy of acute myocardial infarction including dual antiplatelet agents of asa and clopidogrel, we chose to use rivaroxaban after confirming normal renal function. rivaroxaban is approved for use in nonvalvular atrial fibrillation for the prevention of stroke and systemic embolism, treatment of pulmonary embolism, as well as treatment and prevention of dvt (deep vein thrombosis). in patients with a recent acute coronary syndrome, low - dose rivaroxaban was found to reduce the risk of the composite end point of death from cardiovascular causes, myocardial infarction, or stroke 13. because of the massive thrombus, we arbitrarily used the recurrent pulmonary embolism and dvt prophylaxis dose of this newer oral anticoagulant. rivaroxaban, because of its potent factor xa inhibition reduces clotting. besides its anticlotting activity, in experimental study it was shown to modify fibrin network with thicker fibers and larger pores, which resulted in greater permeation of flow through the clots 14. incidentally, there was also resolution of left ventricular apical intramural thrombus which has been reported previously with the use of rivaroxaban 15. although it can not be proven, it is plausible that rivaroxaban may have contributed to the resolution of the coronary thrombus through the naturally occurring intrinsic thrombolysis. management of massive intracoronary thrombus burden is challenging despite the availability of various interventional and pharmacologic tools. in our case, a conservative approach of triple therapy with aspirin, clopidogrel, and rivaroxaban produced the desired outcome of resolution of extensive thrombus in the lad without reocclusion. | key clinical messagemanagement of intracoronary thrombus in patients presenting more than 12 hours after the onset of st elevation myocardial infarction is challenging. we present such a case which had massive thrombus in left anterior descending artery. it was managed successfully with dual antiplatelet agents and factor xa inhibitor rivaroxaban administered orally. |
childhood and adolescent obesity is associated with insulin resistance, abnormal glucose metabolism, hypertension, dyslipidemia, inflammation, liver disease, and compromised vascular function.15 as with obesity, these impairments could track into young adulthood, which increases the risk of cardiometabolic diseases and even certain types of cancer independent of adult weight.6,7 the detrimental effects of adolescent obesity on subsequent risk of cardiovascular disease are partly mediated by the presence of cardiometabolic risk factors.8 cardiovascular disease is the leading cause of morbidity and mortality worldwide with an estimate of 17.3 million deaths in 2008, and by 2030 this number could reach up to 23.3 million.9 it is widely believed that atherosclerosis begins in childhood and progresses into adulthood.10,11 as the number of cardiovascular disease risk factors increases in childhood, so does the severity of both coronary and aortic atherosclerosis in young adulthood.3 in the netherlands, two - thirds of obese children and adolescents had more than one cardiovascular disease risk factor in one study.12 in germany and switzerland, around 50% of obese children had at least one cardiometabolic risk factor in one study.13 the presence of obesity in childhood and adolescence is also related to the development of fatty liver or steatosis, which is the most common liver abnormality in this age group.14 steatosis can be present with or without elevated liver enzymes (aminotransferases).15 for the long term, the ramifications of having persistently elevated liver enzymes and steatosis are important and could lead eventually to the development of cirrhosis.14,16 in two previous studies of obese adolescents in kuwait, we observed that their health - related quality of life was unimpaired compared with nonobese peers,17 and that their engagement with therapy to treat obesity was poor.18 it is possible that knowledge of the presence of cardiometabolic risk factors in obese adolescents may increase the engagement of adolescents and their families with efforts to treat obesity. the aim of the present study was therefore to estimate the prevalence of cardiometabolic risk factors in obese adolescents in order to provide evidence that might be useful to future obesity treatment. in the present study, we carried out assessments of obesity - related cardiometabolic risk factors that could impair vascular health and liver function. these included lipid profile (cholesterol, low - density lipoprotein [ldl ], very low - density lipoprotein, high - density lipoprotein [hdl ], triglycerides [tg ]), interleukin-6 (il-6), intracellular adhesion molecule (icam), c - reactive protein (crp), adiponectin, liver function tests (alanine aminotransferase [alt ], aspartate aminotransferase [ast ], gamma glutamyltransferase [ggt ]), and insulin resistance by homeostasis model assessment (homa - ir). the study was the baseline element of an intervention to treat adolescent obesity using a randomized controlled trial, the national adolescent treatment trial for obesity (natto).18 we recruited 80 obese adolescents participating in the natto in kuwait city18 at the preintervention stage of the trial. they were all at or above the age- and sex - adjusted 95th body mass index (bmi) percentile, which defines obesity.19 age ranged from 10 years to 14 years. all participants underwent physical examination including anthropometric assessment (weight, height, bmi, waist circumference) and had no medical or surgical history. the study was approved by the medical research committee of the ministry of health kuwait. blood samples were drawn for analysis for fasting blood glucose (fbg), fasting insulin, cholesterol, ldl, hdl, tg, alt, ast, ggt, crp, il-6, icam, and adiponectin. insulin resistance was measured by homa - ir (fasting insulin fasting glucose/22.5).20 blood pressure was measured when the participant was sitting quietly in the upright position, with the correct cuff size applied to the right arm. the reading was repeated three times, and the average of the three readings was taken. cholesterol, tg, hdl, sensitive crp, alt, ast, and ggt assays were assessed using a c311 roche analyzer ; sensitive crp immunotubidimetric assays with cholesterol, tg, hdl, alt, ast, and ggt being enzymatic colorimetic. il-6, icam, adiponectin, and insulin analysis (enzyme - linked immunosorbent assays) was assessed using kits supplied by r&d systems europe ltd (oxford, uk) and mercodia ab. there are two commonly used cutoff points for fbg (mmol / l), the world health organization (who) normal cutoff 3.16.20 keskin found that homa - ir was the most sensitive and most specific of three proxies for defining insulin resistance, and the cutoff point for insulin resistance diagnosis based on homa - ir was 3.16,20 so that definition was used in the present study. assessment of lipid profile for the participants included fasting tg, fasting cholesterol, fasting ldl, and fasting hdl. jolliffe and janssen29 developed age- and sex - specific percentiles for lipoproteins and cholesterol, starting from age 12 years to age 20 years. however, our participants were aged 1014 years, and it was not possible to use these lipoprotein percentiles for the whole sample. therefore, the reference values for these parameters were taken from the national cholesterol education program, with fixed cutoff points for normal, borderline, and high values regardless of sex and age.30 liver function tests were obtained in all participants and included alt, ast, and ggt. the upper limit for alt and ast in adults differs between populations, and differences exist between males and females.31 however, in studies examining the prevalence of abnormal alt, ast, and ggt in adolescents, the most commonly used cutoff points were > 40 u / l, > 40 u / l, and > 35 u / l, respectively.15,32,33 therefore, these were the values that we used as cutoff points in our study. markers of inflammation were assessed in all participants, including crp.34 generally, normal and abnormal levels of crp were developed for the adult population,34,35 and some studies found that the normal range in healthy adults was from 0.08 mg / l to 6.1 mg / l.36 our study used the cutoff points set by the american heart association and the centers for disease control and prevention.34 the inflammatory cytokine il-6 has an age - related variability with peak physiological elevation around age 4 years and 15 years in relation to cartilage and bone development.37 in the literature, precise reference ranges for il-6 vary greatly depending on the age, weight status, and sex of the participants tested.3739 in the present study, we used the reference range of the control group (healthy controls n=37) from a study by makni (> 3.9 pg / ml). inflammatory plasma soluble adhesion molecules (icam) were also measured in all of the participants.41 the literature shows that icam values are age related, and when applying the cutoff point for our study we chose a study by andrys to establish reference range for serum soluble adhesion molecules in healthy children and adolescents aged 615 years, defined by values between the fifth and 95th percentiles for each inflammatory marker. the normal cutoff range for those aged 610 years was 206.8486.8 ng / ml, and for those aged 1115 years was 184.1355.0 ng / ml.42 the anti - inflammatory adipokine adiponectin was measured in all participants in the fasting state. it is normally present in plasma concentrations of 220 g / ml.43 most studies comparing adiponectin concentration in obese adolescents with its concentration in healthy controls referred to low levels when adiponectin concentration was 10 g / ml.4446 therefore, in the present study, we used the same cutoff points. hypertension was defined as a systolic and or diastolic blood pressure 95th percentile for age, sex, and height, measured on three separate occasions.47 metabolic syndrome (mets) was defined according to the international diabetes federation (idf) definition48 and the third adult treatment panel (atp iii) definition.49 participants were classified as having mets if they had a waist circumference 90th percentile plus two or more of the following criteria according to the idf definition : tg 1.7 3.16.20 keskin found that homa - ir was the most sensitive and most specific of three proxies for defining insulin resistance, and the cutoff point for insulin resistance diagnosis based on homa - ir was 3.16,20 so that definition was used in the present study. assessment of lipid profile for the participants included fasting tg, fasting cholesterol, fasting ldl, and fasting hdl. jolliffe and janssen29 developed age- and sex - specific percentiles for lipoproteins and cholesterol, starting from age 12 years to age 20 years. however, our participants were aged 1014 years, and it was not possible to use these lipoprotein percentiles for the whole sample. therefore, the reference values for these parameters were taken from the national cholesterol education program, with fixed cutoff points for normal, borderline, and high values regardless of sex and age.30 liver function tests were obtained in all participants and included alt, ast, and ggt. the upper limit for alt and ast in adults differs between populations, and differences exist between males and females.31 however, in studies examining the prevalence of abnormal alt, ast, and ggt in adolescents, the most commonly used cutoff points were > 40 u / l, and > 35 u / l, respectively.15,32,33 therefore, these were the values that we used as cutoff points in our study. markers of inflammation were assessed in all participants, including crp.34 generally, normal and abnormal levels of crp were developed for the adult population,34,35 and some studies found that the normal range in healthy adults was from 0.08 mg / l to 6.1 mg / l.36 our study used the cutoff points set by the american heart association and the centers for disease control and prevention.34 the inflammatory cytokine il-6 has an age - related variability with peak physiological elevation around age 4 years and 15 years in relation to cartilage and bone development.37 in the literature, precise reference ranges for il-6 vary greatly depending on the age, weight status, and sex of the participants tested.3739 in the present study, we used the reference range of the control group (healthy controls n=37) from a study by makni (> 3.9 pg / ml). inflammatory plasma soluble adhesion molecules (icam) were also measured in all of the participants.41 the literature shows that icam values are age related, and when applying the cutoff point for our study we chose a study by andrys to establish reference range for serum soluble adhesion molecules in healthy children and adolescents aged 615 years, defined by values between the fifth and 95th percentiles for each inflammatory marker. the normal cutoff range for those aged 610 years was 206.8486.8 ng / ml, and for those aged 1115 years was 184.1355.0 ng / ml.42 the anti - inflammatory adipokine adiponectin was measured in all participants in the fasting state. it is normally present in plasma concentrations of 220 g / ml.43 most studies comparing adiponectin concentration in obese adolescents with its concentration in healthy controls referred to low levels when adiponectin concentration was 10 g / ml.4446 therefore, in the present study, we used the same cutoff points. hypertension was defined as a systolic and or diastolic blood pressure 95th percentile for age, sex, and height, measured on three separate occasions.47 metabolic syndrome (mets) was defined according to the international diabetes federation (idf) definition48 and the third adult treatment panel (atp iii) definition.49 participants were classified as having mets if they had a waist circumference 90th percentile plus two or more of the following criteria according to the idf definition : tg 1.7 mmol / l, hdl 3.1620 was found in 67.5% (54/80) of participants. out of the 80 participants, 27.5% (22/80) had a high tg level, 33.8% (27/80) had a high total cholesterol level, 20% (16/80) had a low hdl level, and 35% had a high ldl level. liver function tests showed high alt in 26.3% (21/80) of participants, high ast in 88.8% (71/80) of participants, and high ggt level in 17.5% (14/80) of participants. crp level was high in 42.5% (34/80) of participants, il-6 level was high in 7.5% (six of 80) of participants, icam level was high in 66.3% (53/80) of participants, and adiponectin level was normal in all participants. table 2 shows the results of waist circumference, tg, hdl, fbg, systolic blood pressure, and diastolic blood pressure measurements using idf and atp iii criteria. seventeen of the 80 participants (21.3%) met the diagnosis of mets by the idf definition and 24 of the 80 participants (30%) met the diagnosis of mets by the atp iii definition. table 1 shows the mean and standard deviation (sd) of all measured parameters for the participants (n=80). twenty - six out of the 80 participants (32.5%) had systolic and/or diastolic blood pressure 95th percentile for age, sex, and height. hyperglycemia and hyperinsulinemia were present in 2.5% (two of 80) and 43.8% (35/80) of participants, respectively. insulin resistance as defined by homa - ir value > 3.1620 was found in 67.5% (54/80) of participants. out of the 80 participants, 27.5% (22/80) had a high tg level, 33.8% (27/80) had a high total cholesterol level, 20% (16/80) had a low hdl level, and 35% had a high ldl level. liver function tests showed high alt in 26.3% (21/80) of participants, high ast in 88.8% (71/80) of participants, and high ggt level in 17.5% (14/80) of participants. crp level was high in 42.5% (34/80) of participants, il-6 level was high in 7.5% (six of 80) of participants, icam level was high in 66.3% (53/80) of participants, and adiponectin level was normal in all participants. table 2 shows the results of waist circumference, tg, hdl, fbg, systolic blood pressure, and diastolic blood pressure measurements using idf and atp iii criteria. seventeen of the 80 participants (21.3%) met the diagnosis of mets by the idf definition and 24 of the 80 participants (30%) met the diagnosis of mets by the atp iii definition. the current study is the first to estimate the prevalence of cardiometabolic risk factors and mets in a group of obese kuwaiti adolescents. the main finding of this study was the high prevalence of multiple cardiometabolic risk factors. out of the 16 risk factors measured, eight were high in 30% of the participants (table 1). the cardiometabolic risk factors with the highest prevalence of abnormal values included ast (88.7% of the sample), homa - ir (67.5% of the sample), icam (66.5% of the sample), fasting insulin (43.5% of the sample), crp (42.5% of the sample), ldl (35.0% of the sample), cholesterol (33.5% of the sample), and systolic blood pressure (30.0% of the sample) ; 96.3% (77/80) of participants had at least one cardiometabolic risk factor as well as obesity. as mentioned previously, participants of this study were recruited from the baseline stage of a randomized controlled trial of an office - based treatment trial for adolescent obesity in kuwait (natto). one of the findings of the natto was poor engagement with treatment, as evidenced by the poor attendance of families in both the intervention and control arms of the trial.18 therefore, findings from the present study might have been useful to demonstrate to the adolescents and their families that their obesity was a medical problem, and so possibly persuade them to engage more with treatment. moreover, all of the measured parameters in the present study, except for adiponectin, are readily accessible by physicians working in the ministry of health kuwait in the clinical setting, so their measurement could be part of any treatment protocol for adolescent obesity in the future. risk factors for cardiovascular disease and type 2 diabetes mellitus have extended their roots to reach children and adolescents.6,7,10,5054 in a study from iran55 on 5,528 adolescents aged 1018 years assessing the relationship between multiple cardiometabolic risk factors (total cholesterol, tg, ldl, hdl, blood pressure, and fbg) with bmi, low physical activity, and an unhealthy diet, bmi had the greatest direct effect on total cholesterol, ldl, tg, fbg, and blood pressure and an inverse relationship with hdl, more than that contributed by inactivity and an unhealthy diet. kelishadi called for immediate interventions to tackle pediatric obesity and its associated cardiometabolic risk factors in order to prevent future risk of mets and chronic noncommunicable diseases in iran. kardas compared the levels of cholesterol, ldl, tg, hdl, fbg, blood pressure, vitamin d, and adiponectin between obese (n=63) and nonobese (n=51) turkish adolescents aged 1016 years. obesity was defined as bmi > 90th percentile for an age- and sex - specific turkish reference population. cholesterol, ldl, tg, fbg, and blood pressure were significantly higher in the obese group compared with the nonobese group. adiponectin, vitamin d, and hdl were significantly lower in the obese group compared with the nonobese group. mean adiponectin value for the obese group was 3.3 (0.89) ng / ml and in the nonobese group the mean value was 6.0 (1.4) ng / ml. in the netherlands, inpatient children and adolescents (n=80, aged between 8 years and 19 years) diagnosed with severe obesity (defined as bmi sds 3 or bmi sds 2.3 with comorbidities according to the growth percentiles of the fourth dutch growth study) were evaluated for the presence of multiple cardiometabolic risk factors, namely blood pressure, fasting insulin, fbg, homa - ir, cholesterol, ldl, tg, hdl, and crp,57 as part of an inpatient treatment trial for their obesity. data showed that 80% of the participants had at least one impaired cardiometabolic risk factor as well as severe obesity. in comparison with our study, 90% of our participants had at least one impairment with regards to the same cardiometabolic risk factors assessed. in the present study, almost a third of the participants had mets according to the atp iii definition.58 in a study done in kuwait on apparently healthy female adolescents (n=431, age 1019 years) to assess the prevalence of mets using the same definitions that we applied to our study, it was found that mets was present in 9.1% by the atp iii definition and 14.8% had mets when the idf definition was used.59 in saudi arabia, the prevalence of mets using the idf definition was 18% among 180 obese 9- to 12-year - olds.60 also using the idf definition in lebanese adolescents, nasreddine found that 21.2% of the 104 obese adolescents (mean age 161.3 years) had mets, 3.8% of the 78 overweight adolescents (mean age 16.41.4 years) had mets, and 1.2% of the 81 healthy weight adolescents (mean age 16.8 years) had mets. in iran, according to the atp iii definition, mets has been found in 3.3% of iranian adolescents (n=450, age 1518 years).62 in a sample of 321 overweight, obese, and extremely obese adolescents from brazil (obesity defined using the centers for disease control and prevention 2000 definition,19 mets was found in around 18% of the 10- to 16-year - old adolescents using the idf definition.63 similarly, in the us,64 it was found that > 50% of obese children and adolescents (n=439, aged 420 years) had mets according to definitions modified from atp iii and who.24 in summary, global studies suggest that, as in the present study, mets is relatively common among obese adolescents. the present study had a number of strengths. our participants were generally a fairly homogenous group of kuwaiti adolescents living in kuwait city and recruited from three state schools who were examined for the presence of cardiometabolic risk factors, including mets. the use of traditional markers for cardiovascular disease (ie, lipid profile and blood pressure), multiple markers for inflammation (ie, crp, il-6, and icam), and, for the first time, adiponectin in a sample of kuwaiti adolescents, assessment of insulin resistance as well as liver function, all add to the novelty of our study. however, our study had a number of limitations. first, it was not possible to conduct tanner staging, due to social / cultural and practical reasons. second, the optimal cutoff to define abnormality for a number of the cardiometabolic risk factors is unclear, but widely used cutoffs were chosen for the present study. third, no data on changes in cardiometabolic risk factors during obesity treatment were available. nonetheless, the relatively high prevalence of abnormal values for cardiometabolic risk factors found in the present study could be a useful aid to engage more families into participating in adolescent obesity treatment in future, and might also increase the level of commitment to participation by those who do take part. the present study suggests that a number of cardiometabolic risk factors and mets are prevalent in obese kuwaiti adolescents. this observation might provide impetus to future strategies to treat pediatric obesity and to prevent or delay the appearance of cardiovascular disease and diabetes mellitus in the future adult generation. | backgroundchildhood and adolescent obesity is associated with insulin resistance, abnormal glucose metabolism, hypertension, dyslipidemia, inflammation, liver disease, and compromised vascular function. the purpose of this pilot study was to determine the prevalence of cardiometabolic risk factor abnormalities and metabolic syndrome (mets) in a sample of obese kuwaiti adolescents, as prevalence data might be helpful in improving engagement with obesity treatment in future.methodseighty obese kuwaiti adolescents (40 males) with a mean (standard deviation) age of 12.3 years (1.1 years) participated in the present study. all participants had a detailed clinical examination and anthropometry, blood pressure taken, and assessment of fasting levels of c - reactive protein, intracellular adhesion molecule, interleukin-6, fasting blood glucose, insulin, liver function tests (alanine aminotransferase, aspartate aminotransferase, gamma glutamyltransferase), lipid profile (cholesterol, low - density lipoprotein cholesterol, high - density lipoprotein cholesterol, triglycerides), insulin resistance by homeostasis model assessment, and adiponectin. mets was assessed using two recognized criteria modified for use in younger individuals.resultsthe cardiometabolic risk factors with highest prevalence of abnormal values included aspartate aminotransferase (88.7% of the sample) and insulin resistance by homeostasis model assessment (67.5%), intracellular adhesion molecule (66.5%), fasting insulin (43.5%), c - reactive protein (42.5%), low - density lipoprotein cholesterol (35.0%), total cholesterol (33.5%), and systolic blood pressure (30.0%). of all participants, 96.3% (77/80) had at least one impaired cardiometabolic risk factor as well as obesity. prevalence of mets was 21.3% according to the international diabetes federation definition and 30% using the third adult treatment panel definition.conclusionthe present study suggests that obese kuwaiti adolescents have multiple cardiometabolic risk factor abnormalities. future studies are needed to test the benefits of intervention in this high - risk group. they also suggest that prevention of obesity in children and adults should be a major public health goal in kuwait. |
with a production surpassing 100 billion liters per year, biofuels have become an important part of the motor fuel consumption in the world, where ethanol continues to be the most common biofuel worldwide. because of its high energy density, ethanol has also been considered one of the most important renewable resources for the production of hydrogen for transportation and stationary power fuel cell applications. the steam reforming reaction in which ethanol reacts with water (c2h5oh + 3h2o 2co2 + 6h2) has been the subject of study during the past decade as a promising mechanism to produce hydrogen. although these studies have focused on the search for catalysts that minimize the formation of undesirable intermediates and maximize the conversion of ethanol, the presence of water in biofuels also poses the question of how the effectiveness of additives in fuels containing organic substances is affected. a crucial step toward an answer is to improve our understanding of the interaction between the organic molecules (the fuel and the additive), water, and metallic surfaces (the fuel pump, the combustion chamber, etc.). for this purpose, various theoretical approaches, such as density functional theory (dft), have proven to be useful as they have been able to calculate adsorption energies as well as configurations of various combinations of organic molecules on metallic surfaces. during the past decade, several functionals have been developed to take van der waals (vdw) forces into account and additional studies have shown that it is necessary to use dft functionals that include nonlocal correlation in order to describe the adsorption process correctly. only a few theoretical studies have analyzed the effects of water on the adsorption of organic molecules, including a rigorous treatment of the van der waals interactions. on an ab initio level, the effects of a water layer on the adsorption of methanol and formaldehyde on pt(111) was studied by bonski and lpez, and more recently, a density functional investigation of the adsorption of a water ethanol mixture on pt(111) was carried out by tereshchuk and da silva. these studies considered a platinum surface because of its catalytic potential ; however, in many industrial and technological applications where the lubrication additives in fuels play an important role, the involved metallic surface is often iron or some alloy derived from it. in gasolines, several types of organic compounds may be present, such as alcohols, organic acids, and branched alkanes. the interaction between iron and water is a complex chemical process that may lead to dissociation of the water molecule. however, earlier experiments and theoretical calculations suggest the presence of adsorbed molecular water at high water coverages. to investigate the effect of water on the adsorption of molecules present in fuels and its additives, we simulated the adsorption of isooctane (2,2,4-trimethylpentane), ethanol, and acetic acid [with chemical formulas (ch3)3cch2ch(ch3)2, ch3ch2oh, and ch3cooh, respectively ] on a water - covered fe(100) surface via first - principles calculations. these adsorbates were selected because isooctane is a representative aliphatic gasoline compound, ethanol can be found in gasoline as a biocomponent as well as in many other relevant products, and acetic acid may be introduced into fuels as a possible trace contaminant of ethanol. furthermore, the interaction between the acetic acid and the iron surface is representative of the one occurring between fatty acids, commonly found in fuels as lubricity additives, and metallic surfaces. therefore, the choice of acetic acid minimizes the effect of vdw forces between aliphatic chains and solely focuses on interactions with the surface. the various functional groups contained in the selected molecules facilitate the investigation of their distinct effects on the adsorption process. the fe(100) surface, besides being present in systems of industrial interest, has been considered in various previous studies that investigate the adsorption of water on iron. therefore, the selection of this surface is advantageous for comparing and validating our results. a formal description of van der waals interactions as implemented in the optb86b - vdw functional, which is limited to pairwise interactions but it is otherwise independent of external input parameters, is applied. the approaches that go beyond the pairwise additivity and include the vdw energy very accurately, such as the random phase approximation combined with the adiabatic connection and fluctuation dissipation theorem, are computationally prohibitive for the systems treated in this work. this paper describes the changes in the adsorption energy and equilibrium geometries induced by a water layer and discusses these alterations on the basis of the electronic density. to perform our simulations, we carried out spin - polarized first - principles calculations within the framework of density functional theory using the vienna ab initio simulation package (vasp). vasp produces an iterative solution of the kohn sham equations using a plane - wave basis and employing periodic boundary conditions. the projector augmented wave (paw) method was applied to describe the interaction between the core and the valence electrons. the vdw interactions were taken into account via the optimized becke86 van der waals (optb86b - vdw) exchange correlation functional,1where n is the electronic density in the ground state, eoptb86b(x)[n ] is a reparametrized version of the becke86 exchange functional, elda(c)[n ] is a local - density approximation (lda) correlation, and enl(c)[n ] is a nonlocal correlation term that approximates the vdw interactions. to model the adsorption of various molecules on an fe(100) surface, we constructed a slab consisting of 10 layers of body - centered cubic (bcc) fe and a corresponding molecule placed on one side of the slab at a distance d above it. in modeling the adsorption of water molecules, (1 1), (2 1), and (2 2) surface cells were studied, placing one, two, and four water molecules, respectively. this allows for more flexibility in determining the water layer structure by analyzing various possible scenarios, such as those where all the water molecules are constrained to the same geometry [(1 1) cell ] and either two [(2 1) cell ] or four [(2 2) cell ] different orientations of the water molecules are allowed. in the adsorption of organic molecules a (the vacuum spacing in the z - direction between repeated iron slabs was 29.73. the z axis is perpendicular to the metallic surface and starts at the bottom layer of the iron slab. this setup accurately models a bcc fe(100) surface, avoids slab slab interactions, and, in the cases were a single molecule was adsorbed, also avoids intermolecular interactions. the lattice constant of 2.83 used to construct the iron slab was obtained from a bulk calculation for bcc iron using the pbe functional, where the calculation parameters were chosen to keep the accuracy consistent with the rest of the computations. this value is in good agreement with the experimental lattice constant of 2.86. the distance d was defined as the vertical distance between the atom of the molecule with lowest z coordinate and the closest atom to it, whether it is an atom belonging to the water layer (if present) or to the iron surface. for the dissociated acetic acid, the distance d is measured between the acetate and the metallic surface. to ensure sufficiently accurate total energies and forces, we carefully selected and tested our calculation parameters. a tight convergence criterion of 10 ev on the total energy in the self - consistency cycle was used and a cutoff energy of 400 ev was applied for the plane - wave basis set. for the calculations involving a (4 4) surface cell, the k - space integrations were performed using a 2 2 1 monkhorst pack mesh. for the smaller cells used to model the adsorption of water molecules, a corresponding mesh that generates the same k - point density was applied. the tetrahedron method with blchl corrections was employed for the static calculations and a gaussian smearing with a width of 0.2 ev for the relaxations. test calculations with smaller widths were carried out to ensure that the selected value leads to the ground - state geometry. the conjugate gradient algorithm was used to relax most of the structures, allowing the ions to move until an energy convergence criterion of 10 ev was fulfilled. for those cases where the starting guess was unreliable, a damped molecular dynamics algorithm was preferred. during relaxations, the ions in the top four layers of the slab and the ones constituting the molecule and the water layer (if present) were allowed to move in all directions, while the atoms in the six remaining layers of the slab were frozen at bulklike positions. due to the complexity of the system, only the relaxations involving the water molecules and the iron slab were verified by performing a simulated annealing. the simulation started at a temperature of 300 k and the temperature was gradually decreased to 0 k in 10 ps (10 000 time steps). to produce an accurate description of the interaction between the organic molecules treated in this work and the iron surface, we calculated the potential energy curves by varying d and subsequently computing the total energy of the resulting system via static calculations. these curves will aid in the fitting of potentials required for classical molecular dynamic simulation, allowing the study of these systems in a different time and length scale. the equilibrium distance was considered to be the value of d that minimizes the total energy of the system. we stress that this equilibrium distance is obtained from a finite set of energy points calculated for various values of d, and therefore, its accuracy depends on the step size (d) between those values. to obtain a first estimate of the equilibrium structure, the potential energy curves of different configurations and adsorption sites were calculated with moderate values of d. the adsorption energies were calculated according to the equation2where etotmol+fe(100) is the total energy of the products adsorbed on the fe(100) slab at the equilibrium distance, etotfe(100) is the total energy of the clean fe(100) slab, and etotmol is the total energy of the isolated gas - phase educts calculated using a cubic box with 15 side length. in the presence of a water layer,3was used instead. in this latter equation etoth2o+fe(100) is the total energy of the water - covered fe(100) slab, etotmol+h2o+fe(100) is the total energy of the products adsorbed on the water - covered fe(100) surface at the equilibrium distance, and etotmol is the energy of the gas - phase educts as indicated above. because of the magnitude of the step size, the adsorption energies and equilibrium distances obtained in this way are only an approximation, and thus, they will be referred to as such in the rest of this paper. the resulting most favorable configuration of this analysis was relaxed and used as an input to calculate a more accurate adsorption energy and equilibrium distance using a smaller value of d. in the equilibrium configuration, the isooctane molecule is oriented with its longest continuous chain of carbon atoms parallel to the fe(100) surface (figure 1a c). a similar result was found in our previous investigation, where the effects of vdw interactions on the adsorption of isooctane and ethanol on the same surface were analyzed. in the present study, however, the adsorption geometry plays a more important role, and therefore, we analyzed three orientations of the isooctane molecule (figure 1a, c, d) in addition to the ones considered in ref (12). for comparison purposes, we included in our calculations the orientation of the isooctane molecule in the previously determined equilibrium configuration (figure 1b). in each configuration, we studied the isooctane molecule adsorbed on the top, bridge, and hollow sites. the difference between the estimated adsorption energies of configurations 13 (070 mev) indicates that any of these may be reached at room temperature (25 mev) and that no particular adsorption site is preferred (see the supporting information). in contrast, the adsorption energies of configuration 4 are at least 162 mev lower than those calculated for the other configurations, although among them they did not show a preference for an adsorption site either. this is to be expected since, as we have shown, the binding of the isooctane molecule to the metallic surface is dominated by dispersion forces, and thus, an orientation that maximizes the number of atoms in proximity to the surface is favored. we selected the adsorption configuration analyzed in our previous study, namely, configuration 2 with isooctane adsorbed on the top site, to carry out the rest of this study, because it is among the possible configurations existing at room temperature and also because we can apply our previous findings of the adsorption process. the lowest energy configuration (configuration 1), the isooctane molecule is adsorbed at a distance d 2.25 and orients its main c its branches constituted by methyl groups are positioned away from the iron slab and above their parent chain (figure 1a). configurations considered for the adsorption of an isooctane molecule on an fe(100) surface, here displayed with the molecule on the top adsorption site at a distance d = 2.00. the top row displays the top view of the system, while the bottom row shows the side view. the atom marked with an x symbol in the top view of configuration 1 is used as a reference to orient the molecule on the top, bridge, and hollow sites, indicated in the same figure with a circle, triangle, and square, respectively. when ethanol is adsorbed on an fe(100) surface, the hydroxyl group of the molecule orients parallel to the surface, while the remaining atoms of the molecule arrange accordingly (figure 2a, c). just as with isooctane, we extended our previous study by considering three additional configurations of an ethanol molecule adsorbed on an fe(100) surface (figure 2a, b, d). as before, we included the orientation of the ethanol molecule found in ref (12) (figure 2c) and we considered the molecule adsorbed on the top, hollow, and bridge sites in all configurations. in contrast to isooctane, the calculated adsorption energies are distributed among a larger energy range, and with the exception of configuration 4, there is notable energy difference between the adsorption sites (see the supporting information). the largest adsorption energy is achieved when the ethanol molecule is adsorbed on the top site and is oriented as in configuration 3, in agreement with our previous finding. our calculations show that this configuration is degenerate in energy with configuration 1 when the ethanol molecule is adsorbed on the top site. for the rest of the study, we considered configuration 2 in addition to these equilibrium structures, since a strong interaction between the hydroxyl group and the water molecules is expected. configurations considered for the adsorption of an ethanol molecule on an fe(100) surface, here presented analogously to figure 1. the atom marked with an x symbol in the side view of configuration 1 (the oxygen atom of the hydroxyl group, colored in green) is used as a reference to orient the molecule in the adsorption sites. if the carboxylic hydrogen of the acetic acid dissociates, the resulting acetate radical is adsorbed in a bidentate configuration. experimental studies have suggested that the carboxylic hydrogen of the acetic acid molecule gets easily detached in the vicinity of clean metal, and metal oxide, surfaces. for the dissociated molecule, these studies together with theoretical calculations for the adsorption on ge(001) and fe(110) surfaces have proposed monodentate and bidentate adsorption configurations. moreover, in the latter study, no appreciable adsorption of the nondissociated acetic acid on an fe(110) surface was found because dispersion forces were not included in the calculations. on the basis of these results, we considered the bidentate (figure 3b) and the monodentate (figure 3c) configurations for the adsorption of acetate, and since we are employing a vdw density functional for all computations, we also included the adsorption of the nondissociated acetic acid (figure 3a). as was done with the previous compounds, the adsorption energies of the molecule adsorbed on the top, hollow, and bridge sites in each configuration were calculated. depending on the nature of the carboxylic hydrogen dissociation, an acetate radical (homolytic cleavage) or an acetate anion (heterolytic cleavage) can be formed. a previous investigation on the adsorption of acetic acid on an fe(110) surface showed that, in the adsorbed state, the acetate radical is energetically favored over the anion. the results of our calculations show that this is also valid for the adsorption on the fe(100) surface. the estimated adsorption energy of the acetic acid of 452 mev indicates that the molecule binds to the surface. this binding is nevertheless weak in comparison to those of the dissociated acetic acid species (table 1). the highest adsorption energy is reached when the acetate radical is adsorbed in the bidentate configuration on the top site of the fe(100) surface (see the supporting information), and thus, we selected this configuration to carry out further calculations. configurations considered for the adsorption of acetic acid and acetate on an fe(100) surface, here presented analogously to figure 1. the atom with an x symbol in the side view of configuration 1 is used as a reference to orient the molecule on the adsorption sites. the two initial positions considered for the dissociated hydrogen are indicated as h1 (top) and h2 (hollow). before introducing the water layer, a better approximation to the equilibrium structures and adsorption energies was obtained by relaxing the selected configuration of each system mentioned in this section. each resulting structure was then used to calculate the potential energy curve by displacing the molecule in smaller steps. no large variations from the relaxed structure are expected at separations equal to or greater than the equilibrium distance. indeed, further relaxations carried out for a few selected distances (d) to verify this assumption show variations on the order of 10 in bond lengths and 10 deg in angles. since after the extended analysis no new configuration of isooctane and ethanol with a considerably higher adsorption energy was found, here we simply repeat the previously reported equilibrium distances and adsorption energies (table 1) calculated in a previous study. this facilitates the comparison of these values with those calculated in the presence of a water layer. after relaxing the acetate system, the oxygen atom on the top adsorption site is displaced by 0.08 toward the bridge site (moving the rest of the molecule accordingly) and the distance between the oxygen atoms is reduced by 0.03. the iron atoms situated directly below the two oxygen atoms of the acetic acid are displaced 0.05 in the direction of the molecule. in equilibrium, the molecule is adsorbed on the slab at a distance of 2.00, with an energy of 4.49 ev. at first sight, our results may suggest that the slab (and not the molecule) determines the equilibrium distance, since all the molecules are adsorbed at a distance of 2.00. however, as mentioned before, these distances are an approximation that depends on the length of the step in d used for the static calculations. if the energy varied rapidly with d, we used a value of d = 0.125 ; otherwise, we set d = 0.25. to study the dissociated acetic acid, the adsorption of the acetate radical considered so far is useful for the construction of potentials that can be applied in classical molecular dynamics calculations, as stated before. this molecule fragment, however, does not exist under ordinary experimental conditions, and therefore, the hydrogen atom can not be neglected. in a recent study, where the adsorption of acetic acid on tio2 was analyzed, it is indicated that there are three possible reaction paths for the dissociated hydrogen : formation of hydrogen gas, adsorption on the substrate, or reaction with a third substance. other possible phenomena, such as the diffusion of hydrogen into the bulk (hydrogen embrittlement), are outside the scope of the present study, and thus, they are not discussed further. the formation of hydrogen gas was considered by introducing a h2 molecule in the supercell shown in figure 3b, followed by a relaxation of the ionic positions. in the equilibrium geometry, the hydrogen molecule is adsorbed on a top site with its molecular axis parallel to the surface. the adsorption of the dissociated hydrogen on the substrate was simulated by introducing a single hydrogen atom at the positions h1 and h2 marked on figure 3b (one at a time) and relaxing the cell afterward. the hydrogen atom, initially in the h1 position, was displaced to a bridge site during the relaxation, while the one initially on the h2 position remained close to the hollow site, with a displacement of 0.4 away from the molecule. with an energy difference of 0.09 ev, the h atom on the bridge site is energetically more favorable than on the hollow site. depending on the availability of a second hydrogen atom, the dissociated hydrogen of the acetic acid may be adsorbed on the substrate or released as hydrogen gas. the comparison between the binding energies (table 1) of these systems suggests that the adsorption of hydrogen on the substrate is favored over the formation of molecular hydrogen. the adsorption energy, 2.15 ev, shown in table 1, was calculated by assuming that each h atom comes from a dissociated acetic acid molecule (i.e., 2ch3cooh 2ch3coo + h2). to facilitate the comparison with the other adsorption energies, the resulting value is reported in electronvolts per acetic acid molecule. if, however, we assume that a h atom is freely available (i.e., ch3cooh + h ch3coo + h2), the adsorption energy increases to 4.79 ev. on a clean surface, a hydrogen atom can be first adsorbed on the substrate. in this case, in order for the formation of a h2 molecule to take place, the energy gained from the formation of the h h bond (4.52 ev) and the adsorption of the resulting h2 molecule has to outmatch the energy of the fe h bonds (2.60 ev). since the absorption of h2 is weak (0.11 ev) and two fe this idea was further investigated by constructing a supercell with the acetate, as in figure 3b, and two hydrogen atoms, one on the h2 position and a second one in the closest bridge site to it. during the relaxation of this system the distance between these two hydrogens increased until both atoms were adsorbed on hollow positions. moreover, the total energy of this system is 0.55 ev lower than the energy of the acetate + h2 system, indicating, once again, that in this case the adsorption of h on the metallic surface is favored over the formation of hydrogen gas. on the other hand, if a second hydrogen is available at a relatively low energy cost, for example, from a hydronium cation, the considerable adsorption energy mentioned above indicates that the formation of hydrogen gas is plausible. the calculated adsorption energy strongly depends on the source of h. see the text for further details. for the adsorption of molecular water on an fe(100) surface, the formation of a monolayer where the water molecules alternate orientations to form a zigzag pattern (figure 4a) is energetically favorable. the water molecules are adsorbed on the top sites of the metallic surface (but slightly shifted toward the bridge site), in agreement with previous studies where the adsorption of a single water molecule was considered. this suggests that the adsorption site preference is not modified by this high water coverage. this may be caused by the reasonably good match between the calculated lattice constant of bcc fe (2.83) and the average distance between oxygens in water (2.81). in this configuration there are two nonequivalent water molecules, one with both o h bonds nearly parallel to the surface (from here on, referred to simply as parallel) and the other with one o h bond pointing to the slab (referred to as upward). for the former, the distance between the oxygen and the closest iron atom is 2.28 and for the latter, 3.35. besides the orientation, the only additional difference between the upward and parallel water molecule is the bond angle. the parallel water molecule has a bond angle of 105.36, and in the upward molecule, the bond angle is equal to 104.20. to determine this structure, several configurations (figure 4) were relaxed with diverse algorithms. in these configurations, the orientation of the water molecules and their respective adsorption sites were varied. in a different approach, a simulated annealing in a supercell containing four water molecules adsorbed in a (2 2) surface cell results in an almost zigzag configuration which is, nonetheless, higher in energy (+ 266 mev). the main differences in geometry are a higher distance between the slab and the upward water molecules (4.30) as well as the tilting of one o some of the various configurations considered for the water layer and their difference in energy with respect to the lowest energy configuration. the various supercells employed for the simulations are here replicated along the axes parallel to the surface to facilitate their comparison. in the proposed equilibrium water layer (figure 4a), the average adsorption energy of each water molecule is 0.51 ev. the average adsorption energy per molecule was calculated according to the following equation4where etoth2o+fe(100) is the total energy of the water molecules adsorbed on the fe(100) slab, etotfe(100) is the total energy of the clean fe(100) surface, and etoth2o is the total energy of the isolated water molecule. the difference between the average adsorption energy per water molecule of this layer and the one calculated for the single water molecule with gga (0.39 ev) can be attributed to the lateral intermolecular interactions and to the fact that dispersion forces are included in our calculation. the previously found equilibrium geometry of isooctane (figure 1b) was placed on top of the fe(100) + zigzag water system (figure 4a). because of the alternating orientation of the water molecules in the zigzag layer, there exists two possible top adsorption sites, one covered with a parallel water molecule and the other with an upward water molecule. the difference in unrelaxed adsorption energies (75 mev) between these sites shows no significant preference for one site over the other. nevertheless, the equilibrium geometry of isooctane adsorbed on a water - covered fe(100) surface was obtained by positioning the longest continuous carbon chain of the molecule along the slightly more stable site, which in this case is the one covered with a parallel water molecule, and relaxing the system afterward. the resulting equilibrium structure (figure 5) exhibits small geometrical changes in the isooctane molecule. the variation of bond lengths are on the order of 10, and in angles the largest changes are of the order of 10 deg. there is, however, a more notable displacement of the water layer and the first layer of the slab away from the molecule (0.15 and 0.10, respectively). calculated adsorption energy of the isooctane and ethanol molecules adsorbed on an fe(100) surface (with and without a water layer) as a function of the vertical distance. a water layer reduces the adsorption energy of isooctane on fe(100) by 0.19 ev (table 1). in the absence of a water layer, the isooctane molecule induces a nonisotropic accumulation of charge between the slab and the molecule and a deficit of charge in the region surrounding the molecule (figure 7a). the forces arising from this redistribution of charge lead to binding. with the introduction of a water layer, the charge redistribution in the slab caused by the proximity of the isooctane molecule is considerably reduced (figure 7b). the water molecules the interaction between them, and consequently, the region surrounding the molecule also presents a lesser charge deficit, leading to weaker binding. the lesser charge redistribution in the water layer combined with its screening effects allows the isooctane molecule to form a shorter bond to the water layer than to the clean iron surface (figure 6). comparison of the charge density difference (diff) of isooctane adsorbed on the bcc fe(100) surface at the equilibrium distance with and without a water layer. in the absence of a water layer, the charge density difference is defined as diff = (isooctane + fe(100)), where denotes the charge density of the isooctane adsorbed on fe(100), while isooctane and fe(100) represent the charge densities of the isolated molecule and clean fe(100) slab, respectively. in the presence of a water layer, the definition changes to diff = (isooctane + fe(100)+wl), where fe(100)+wl is the charge density of the water - covered fe(100) slab. the charge difference is plotted in a plane perpendicular to the surface for values between 5 10 electrons / (solid blue, deficit) and 5 10 electrons / (solid red, accumulation). the presence of a water layer favors a different adsorption configuration of the ethanol molecule (figure 8). since a relatively strong interaction between the hydroxyl group of the ethanol and the water layer is expected, an adsorption analysis was carried out taking configurations 13 (figure 2a c) into account. the ethanol molecule of each configuration was placed above a water - covered fe(100) surface and subsequently relaxed (figure 9). in all cases the top adsorption site covered with a parallel water molecule was preferred. in the presence of water, the adsorption energy of configuration 2 is approximately 5 mev larger than the corresponding one for configuration 3, which is one of the equilibrium configurations in the absence of water. the stabilization of this structure is likely caused by the hydrogen bond between the oxygen of the water molecules and the hydroxyl group of ethanol. the small energy difference suggests, nevertheless, that no particular orientation is favored at room temperature. configurations considered for the adsorption of an ethanol molecule on a water - covered fe(100) surface, here displayed with the molecule on the top adsorption site at a distance d = 2.00. the top row displays the top view of the system, while the bottom row is the side view. the adsorption energy of ethanol on fe(100) decreases by 0.51 ev in the presence of a water layer (table 1). a previous study showed that ethanol binds to the fe(100) surface via dispersion forces and a weak electrostatic interaction between the oxygen of the hydroxyl group and the fe(100) surface. these interactions, together with the pauli repulsion, lead to a charge redistribution, where the electron density in a region surrounding the hydroxyl changes (figure 10a). with the introduction of a water layer, the size of this region decreases significantly (figure 10b). furthermore, since the redistribution of charge in the top layer of the slab was mainly caused the hydroxyl group of the ethanol molecule, the water layer screens its effect more efficiently. as a consequence, only the iron atom directly below the hydroxyl group feels the interaction. the combination of these effects results in a weaker bond. comparison of the charge density difference (diff) of ethanol adsorbed on the bcc fe(100) surface at the equilibrium distance with and without a water layer. the charge density difference is defined and plotted analogously to figure 7. with the introduction of a water layer, the adsorption configuration of the acetate molecule is moderately changed (figure 11). as a first approximation to determine the preferred adsorption site, the energy of acetate adsorbed on the top site covered with a parallel water molecule is 0.21 ev lower than the one covered with an upward water molecule. relaxing the more stable structure produced notable changes in both the acetate molecule and the water layer. o angle is reduced by 0.17, and the c c bond is tilted by 12.13 with respect to the surface normal. on the water layer, h bonds to point toward the closest oxygen of the acetate molecule. this can be attributed not only to the tendency of hydroxyl and oxygen to form hydrogen bonds but also to the higher chemical reactivity of the acetate caused by the odd number of valence electrons. equilibrium structure of acetate adsorbed on a water - covered fe(100) surface. a water layer covering an fe(100) surface increases the adsorption energy of the acetate molecule by 0.69 ev (table 1). without the water layer, the region surrounding the oxygen atoms of the acetate molecule accumulates a significant amount of charge (figure 12a) while decreasing the charge in the region above the slab. the attractive forces produced by the formation of regions of accumulation and deficit of charge are responsible for the binding between the acetate and the fe(100) surface. the binding mechanism remains essentially the same after introducing the water layer, with the only difference being that the region where the charge is decreased now lies on the water molecules below the acetate molecule (figure 12b). moreover, the introduction of a water layer allows the formation of hydrogen bonds between the oxygen atoms of the acetate and the hydroxyl group of the water molecules, which may account for the increase in the adsorption energy and decrease in the equilibrium distance (figure 14). comparison of the charge density difference (diff) of acetate adsorbed on the bcc fe(100) surface at the equilibrium distance with and without a water layer. the charge density difference is defined and plotted analogously to figure 7 but with the charge density difference between values of 5 10 and 5 10 electrons /, which are 1 order of magnitude larger than the plotted diff of isooctane and ethanol. equilibrium structure of the dissociated acetic acid adsorbed on a water - covered fe(100) surface. calculated adsorption energy of acetate adsorbed on an fe(100) surface (with and without a water layer) as a function of the vertical distance. the presence of a water layer increases the binding energy of the dissociated acetic acid and promotes the formation of hydrogen gas. to study the acetic acid, fe(100) system described above and placed on top of an upward water molecule on the position analogous to h1 in the water - free system (figure 3b). during the relaxation of this system, the dissociated hydrogen and a hydrogen of its closest parallel water molecule (in direction away from the acetate) react to produce hydrogen gas. this considerable amount of energy and the fact that this equilibrium state was reached through an ionic relaxation indicate that other reaction paths for the dissociated hydrogen are questionable. the resulting adsorption energy is 0.70 ev larger than the corresponding system without the water layer (table 1), where the dissociated hydrogen is adsorbed on the metallic surface. the water molecules of the layer help to stabilize the resulting acetate and hydroxyl group by reorienting themselves to facilitate the formation of hydrogen bonds with them (figure 13). the effect of a water layer on the adsorption of organic molecules on an fe(100) surface strongly depends on the type of bond between them. in those molecules, where dispersion forces contribute significantly to the binding mechanism, the water layer has a stronger screening effect. additionally, this effect can be enhanced by the presence of polar functional groups in the molecule. the type of functional group plays also an important role in defining the geometry of the equilibrium configurations ; if they contribute to the formation of hydrogen bonds, a different adsorption geometry may be stabilized through them, as in the case of ethanol, and an increase in the adsorption energy can take place like for acetic acid. with the introduction of a water layer, there is a moderate reduction of the adsorption energy of isooctane on fe(100) but no significant change in the equilibrium geometries. in comparison, ethanol exhibits a larger decrease of the adsorption energy and a change in the adsorption configuration. on the other hand, the adsorption energy of acetic acid is increased and there is a moderate change in the equilibrium geometry.. for instance, as long as the same corresponding binding mechanism takes place, alkanes, alcohols with short carbon chains, and (short chain) carboxylic acids may exhibit similar effects in the adsorption energies and equilibrium geometries with the introduction of a water layer as isooctane, ethanol, and acetic acid, respectively. the increase in production and use of fuels containing biocomponents has triggered a considerable amount of research focused on improving their combustion efficiency. as our results demonstrate, it is also important to consider how these substances interact with surfaces and how they affect such interactions of components already present in conventional fuels. in particular, we showed that the presence of water may have an undesirable (or desirable) impact for substances whose usefulness is directly related to their adsorption properties, as in the case of lubricity additives. we anticipate that the potential energy curves produced will aid in the fitting of accurate surface lubricant interaction potentials used by other methods, such as classical molecular dynamics simulations, where the influence of additional variables can be analyzed to improve our description and understanding of these lubricated systems. | the presence of water in biofuels poses the question of how it affects the frictional performance of additives in fuels containing organic substances. to investigate the effect of water on the adsorption of molecules present in fuel and its additives we simulated within the framework of density functional theory the adsorption of ethanol, isooctane (2,2,4-trimethylpentane), and acetic acid on a bare and a water - covered fe(100) surface. van der waals interactions are taken into account in our computations. in those molecules, where dispersion forces contribute significantly to the binding mechanism, the water layer has a stronger screening effect. additionally, this effect can be enhanced by the presence of polar functional groups in the molecule. thus, with the introduction of a water layer, the adsorption energy of isooctane and ethanol is reduced but it is increased in the case of the acetic acid. the adsorption configuration of ethanol is changed, while the one of acetic acid is moderately, and for isooctane only very slightly altered. therefore, the effect of a water layer in the adsorption of organic molecules on an fe(100) surface strongly depends on the type of bond and consequently, so do the tribological properties. |
the creation of a hybrid layer or resin - infiltrated dentin - layers (ridls) is considered as the most efficient mechanism of adhesion in recent dentin bonding agents (dbas). however, controversy exists regarding the role of collagen fibrils on resin adhesion and sealing efficiency of dbas. nanoleakage, a microscopic leakage inside the thickness of ridl, was first described by sano., collagen matrix degradation occurs either by the breakdown of the polymer phase or collagen fibrils in the hybrid layer. also, exposure of collagen matrix of dentin by acid etching may activate matrix metalloproteinase (mmp). in order to prevent this biodegradation, various techniques have been employed such as the demineralized collagen removal and the use of mmps inhibitors. the use of sodium hypochlorite (naocl) to deproteinize acid - etched dentin has several disadvantages. it forms a fragility zone and is cytotoxic with a bad taste and odor. as the dentinal depth increases, the negative impact of naocl increases. newer techniques for removing collagen network include deproteinizing enzymes such as collagenase or bromelain enzyme. bromelain is a proteolytic enzyme (proteases) which belongs to a group of protein - digesting enzymes obtained commercially from the fruit or stem of pineapple. the function of proteases is to catalyze the hydrolysis of proteins to give amino acids. bromelain enzyme can reduce nanoleakage after collagen removal as compared to naocl but there has not been a study to see its effectiveness in improving the bond strength. therefore, the aim of this study was to assess the deproteinizing effect of bromelain enzyme and compare it with 5% naocl on shear bond strength before application of the adhesive system. thirty extracted human premolar teeth were taken and stored in 0.1% thymol solution until they were subjected to use. samples were wet ground on the occlusal surface using a series of silicon carbide discs to prepare flat superficial dentin. group 1 : teeth were etched with 37% phosphoric acid (scotchbond multi - purpose etchant, 3 m) for 15 s and then rinsed with water and blot dried. group 2 : teeth were etched with 37% phosphoric acid for 15 s, rinsed with water, blot dried and deproteinized with bromelain enzyme (bangalore sales corporation) for 1 min. group 3 : teeth were etched with 37% phosphoric acid for 15 s, rinsed with water, blot dried and deproteinized with 5% naocl (nice chemicals pvt. ltd.) for 1 min. fifth generation dba, adper single bond 2 (3 m espe), was applied according to manufacturer 's instructions. upon completion of the adhesive procedures, the resin composite filtek z-250 (3 m espe) was inserted into the plastic tube and light - polymerized. all specimens were stored at 37c in water for 24 h before testing, to simulate the oral environment. after storage, the specimens were transferred to the universal testing machine individually and then subjected to shear bond strength analysis at a crosshead speed of 1.0 mm / min. data were statistically analyzed using one - way analysis of variance for mean comparison among groups and unpaired t - test for mean comparison of shear bond strength between groups at a significance level of 0.05. the statistical analysis was performed using spss version 12.0.1 for windows (spss inc., data were statistically analyzed using one - way analysis of variance for mean comparison among groups and unpaired t - test for mean comparison of shear bond strength between groups at a significance level of 0.05. the statistical analysis was performed using spss version 12.0.1 for windows (spss inc., the bond strength results were significantly influenced by the application of bromelain enzyme (p < 0.05) as shown in table 1. statistically significant differences were not demonstrated in control group and naocl treated group as shown in table 2. mean value of shear bond strength in mpa of all three tested groups (n = 30) mean comparison of shear bond strength (mpa) between groups adhesion to tooth structure depends on various factors including the type of the adhesive system, tooth structure, load cycling, and surface contaminations. inadequate adhesion of composite resin restorations to dentin results in reduced retention, microleakage, and finally recurrent caries. progressive loss of bond strength of etch - and - rinse adhesives has been demonstrated in some studies. one of the factors that is responsible for this degradation is incomplete infiltration of resin monomers into unsupported collagen networks after acid etching with strong acids which produces a zone of collagen without any support of either minerals or resins in the base of the hybrid layer. questions have been raised whether bond strength tests can predict the clinical behavior of adhesively bonded composite resin restorations since they do not represent the complex clinical failure mechanism. in micro tensile tests, the fracture does not start at the weakest part of the bond, but always at the insertion point of the load. the preference for the conventional shear test instead of micro shear test is justified because they are easy to perform, requiring minimal equipment, and specimen preparation. also, a comparative bond strength study involving three adhesive systems has shown similarities between macro and micro counterparts regarding material ranking. numerous studies have evaluated the effects of naocl on adhesion process, and different results have been achieved. this decrease in bond strength can be attributed to the generation of oxygen after the disintegration of naocl into nacl and o2. these reactive residual free radicals in naocl - treated dentin compete with the propagation of vinyl - free radicals generated during light activation of the adhesive system, resulting in premature chain termination and incomplete polymerization. however, naocl may exert different effects on bond strength depending on the chemical structure of the adhesive system and the type of the initiator in the adhesive system used. in this present study, bromelain enzyme performed better which could be because of reduced nanoleakage as shown by the previous study. it has better effectiveness in removing unsupported collagen matrix as compared to naocl, and lower nanoleakage is seen. this could be because of the depletion of collagen from the surface of acid - etched dentin resulting in increased permeability of dentin substrate due to the enlargement of dentinal tubules near the outer dentin surface. the surface energy of the dentin is improved, because the hydroxyapatite has a high surface energy substrate while collagen has a low energy surface, and this leads to enhanced diffusion of adhesive monomers through dentin. also, the dentin is very porous and rough with many lateral branches of tubules which are detectable in main tubules, which may contribute to the increase in the spreading of adhesive monomers through dentin. within the limitations of the present study, it was concluded that removal of unsupported collagen fibers with bromelain enzyme after acid etching results in improved bond strength. | aims : to assess the deproteinizing effect of bromelain enzyme and compare it with 5% sodium hypochlorite (naocl) on shear bond strength before application of the adhesive system.materials and methods : a total of 30 extracted human premolars were divided into three groups, each one consisted of 10 teeth. the occlusal surface was wet ground to expose superficial dentin. in group 1, teeth were etched ; in group 2, teeth were etched and deproteinized with bromelain enzyme ; in group 3, teeth were etched and deproteinized with 5% naocl. upon completion of the adhesive procedures, resin composite was inserted into the plastic tube and light - polymerized. all specimens were stored at 37c in water for 24 h, and the specimens were transferred to the universal testing machine, and then subjected to shear bond strength analysis at a crosshead speed of 1.0 mm / min.statistical analysis used : data were statistically analyzed using one - way analysis of variance and unpaired t - test at a significance level of 0.05. the statistical analysis was performed using spss version 12.0.1 for windows (spss inc., chicago, il, usa).results : the bond strength results were significantly influenced by the application of bromelain enzyme. statistically significant differences were not demonstrated in control group and naocl - treated group. the highest bond strength was seen in bromelain enzyme - treated group.conclusions:within the limitations of the present study, it was concluded that removal of unsupported collagen fiber with bromelain enzyme after acid etching results in improved bond strength. |
current standards in root canal treatment are based on cleaning and shaping the root canal prior to filling.1 an important innovation that has a major impact on these procedures has been the introduction of rotary nickel - titanium (niti) instruments.2,3 a considerable number of rotary niti instruments with particular design characteristics (cross - section, cutting angle, helical angle, radial grooves / edge, flutes, etc.) have been introduced in the market over the last years4 - 7 and previous studies have been listed the main advantages of their use in the preparation of curved root canals, such as : maintain working length (wl), allowing root canal preparation to be more centered and better tapered, creating fewer procedural errors when compared to stainless steel instruments, in addition to being faster.2,3,5,6 several methods have been proposed to evaluate the performance and quality of root canal preparation with niti rotary instruments, such as histological, radiographic, sectional anatomical, scanning electron microscopy and computed tomography.3,7 - 12 however, the destruction of the specimens may impede the simultaneous investigation of different parameters of root canal preparation, and place limitations on these methods.8,13,14 cone beam computed tomography (cbct) has been used for several clinical and investigational purposes in endodontics, such as study of root canal configuration, evaluation of root canal preparation and filling, retreatment, three - dimensional (3d) simulation of internal and external tooth structures and diagnosis and treatment of bone lesions.15 - 21 its ability to reduce or eliminate the superimposition of surrounding structures makes cbct superior to conventional periapical films.15 compared with medical tomography, cbct has some advantages : lower radiation dose, higher scanning resolution and more accuracy of volume measuring in different directions due to voxels being isotropic which make them different.16 possible procedural errors that may affect the prognosis of the root canal treatment should be considered and evaluated before choosing a new endodontic instrument to be used.22 thus, the purpose of the present study was to evaluate procedural errors occurred during root canal preparation using rotary niti instruments employing cbct imaging method. this study was approved by the research ethics committee of the federal university of gois, brazil (protocol number 042 - 2011), and written informed consent was obtained from all patients. a total of 100 extracted human mandibular molars were obtained from the dental urgency service of the school of dentistry of the federal university of gois, brazil. the teeth were stored in 0.2% thymol solution and then immersed in 5% sodium hypochlorite (naocl) (fitofarma, lt. preoperative radiographs of each tooth were taken to confirm the absence of calcified root canals, previous root canal treatment, prosthetic pins and internal and external resorption, and the presence of a fully formed root apex. radiographic images were acquired using a spectro x70 electronic x - ray unit (dabi atlante, ribeiro preto, sp, brazil), 0.8 mm 0.8 mm tube focal spot, kodak insight film - e (eastman kodak co, rochester, ny, usa) and paralleling technique. a radiographic platform was used to standardize all radiographs. all films were processed in an automatic processor, and images were evaluated in a dark room using a light box under a magnifying glass. only three - canalled teeth were used in the study (mandibular molars with distal, mesiobuccal and mesiolingual root canals). all teeth were shorter than 22 mm, and mesial roots had a moderate curvature (r > 4 and 8 mm). the root curvature radius (r) was determined according estrela.23 after taking periapical radiographs, standard access cavities were made by an endodontist using round diamond burs (# 1013, # 1014 ; kg sorensen, barueri, sp, brazil) and endo z bur (dentsply - maillefer, ballaigues, switzerland), with a high - speed hand piece and air - water spray cooling. the wl was determined using # 10 and # 15 k - flexofiles (dentsply - maillefer, ballaigues, switzerland), which were introduced into the root canals until being visible at the apical foramen. the root canals were randomly divided into five experimental groups of 20 teeth each, and prepared using the following instruments : g1 - biorace (fkg dentaire, la chaux - de - fonds, switzerland) ; g2 - k3 (sybronendo, orange, ca, usa) ; g3 - protaper universal (dentsply - maillefer, ballaigues, switzerland) ; g4 - mtwo (sweden - martina, padova, italy) ; g5 - hero shaper (micro mega, besancon, france). the root canals were shaped at a rotational speed of 300 rpm (x - smart, dentsply - maillefer) and 2.9 ncm torque. in g1, br0 (# 25/0.08), br1 (# 15/0.05), br2 (# 25/0.04), br3 (# 25/0.06), br4 (# 35/0.04) and br5 (# 40/0.04) were used. in g2, the sequence used was # 25/0.06 and # 25/0.04 (to prepare of cervical and middle thirds), # 25/0.02, # 30/0.02, # 35/0.02 and 40/0.02 (to prepare of apical third). in g3, sx were used for the cervical root preparation, and s1, s2, f1, f2, and f3 were used until the wl. in g4, the sequence used until the wl was # 10/0.04, # 15/0.05, # 20/0.06, # 25/0.06, # 30/0.05, # 35/0.04 and # 40/0.04 and in g5, the sequence used was # 25/0.06 and # 25/.04 (to prepare of cervical and middle thirds), # 25/0.02, # 30/0.02, # 35/0.02 and 40/0.02 (to prepare of apical third). two endodontist with more than 5 years of experience, registered at the brazilian dentistry association (goinia, go, brazil), prepared the root canals. the operators had an 8 h theoretical course on rotary instrumentation associated with clinical applications. during preparations, the root canals were irrigated at each change of instrument with 3 ml of 1% naocl solution using a syringe with a 30-gauge needle (injecta, diadema, sp, brazil). root canals were dried and filled with 17% ethylenediaminetetraacetic (ph 7.2) (biodinmica, ibipor, pr, brazil) for 3 min to remove the smear layer. (san mateo, ca, usa), thickness : 0.100 mm (dimensions 1.170 mm 1.570 mm 1.925 mm, fov : 56.00 mm, voxel 0.100 mm, 33.5 s (1.024 views). exposure time was 33.5 s. images were examined with the scanner s proprietary software prexion 3d viewer (terarecon inc., foster city, ca, usa) in a pc workstation running windows xp professional sp-2 (microsoft corp., redmond, wa, usa), with processor intel core 2 duo-6300 1.86 ghz (intel corp., santa clara, ca, usa), nvidia geforce 6200 turbo cache videocard (nvidia corporation, santa clara, ca, usa), and monitor eizo - flexscan s2000, resolution 1600 1200 pixels (eizo nanao corp. a total of 2 examiners (a radiologist and an endodontist) were calibrated using 20% of the specimens, and all images were evaluated to detect the presence or absence of fractured instruments, root perforations (coronal, middle or apical thirds) and deviation from the original trajectory of the root canal (apical transportation). when a consensus was not reached by the two examiners that interpreted the procedural errors using cbct, a third observer (an endodontist) made the final decision. procedural errors detected using cone beam computed tomography images ; canal transportation (a), instrument fracture, (b) and perforation (c). data were analyzed using the ibm spss for windows 21.0 (ibm corporation, somers, ny, usa), including frequency distribution and cross - tabulation. comparative statistical analysis was performed using chi - square test, and the level of statistical significance was set at 5%. a total of 100 extracted human mandibular molars were obtained from the dental urgency service of the school of dentistry of the federal university of gois, brazil. the teeth were stored in 0.2% thymol solution and then immersed in 5% sodium hypochlorite (naocl) (fitofarma, lt. preoperative radiographs of each tooth were taken to confirm the absence of calcified root canals, previous root canal treatment, prosthetic pins and internal and external resorption, and the presence of a fully formed root apex. radiographic images were acquired using a spectro x70 electronic x - ray unit (dabi atlante, ribeiro preto, sp, brazil), 0.8 mm 0.8 mm tube focal spot, kodak insight film - e (eastman kodak co, rochester, ny, usa) and paralleling technique. all films were processed in an automatic processor, and images were evaluated in a dark room using a light box under a magnifying glass. only three - canalled teeth were used in the study (mandibular molars with distal, mesiobuccal and mesiolingual root canals). all teeth were shorter than 22 mm, and mesial roots had a moderate curvature (r > 4 and 8 mm). the root curvature radius (r) was determined according estrela.23 after taking periapical radiographs, standard access cavities were made by an endodontist using round diamond burs (# 1013, # 1014 ; kg sorensen, barueri, sp, brazil) and endo z bur (dentsply - maillefer, ballaigues, switzerland), with a high - speed hand piece and air - water spray cooling. the wl was determined using # 10 and # 15 k - flexofiles (dentsply - maillefer, ballaigues, switzerland), which were introduced into the root canals until being visible at the apical foramen. the root canals were randomly divided into five experimental groups of 20 teeth each, and prepared using the following instruments : g1 - biorace (fkg dentaire, la chaux - de - fonds, switzerland) ; g2 - k3 (sybronendo, orange, ca, usa) ; g3 - protaper universal (dentsply - maillefer, ballaigues, switzerland) ; g4 - mtwo (sweden - martina, padova, italy) ; g5 - hero shaper (micro mega, besancon, france). the root canals were shaped at a rotational speed of 300 rpm (x - smart, dentsply - maillefer) and 2.9 ncm torque. in g1, br0 (# 25/0.08), br1 (# 15/0.05), br2 (# 25/0.04), br3 (# 25/0.06), br4 (# 35/0.04) and br5 (# 40/0.04) were used. in g2, the sequence used was # 25/0.06 and # 25/0.04 (to prepare of cervical and middle thirds), # 25/0.02, # 30/0.02, # 35/0.02 and 40/0.02 (to prepare of apical third). in g3, sx were used for the cervical root preparation, and s1, s2, f1, f2, and f3 were used until the wl. in g4, the sequence used until the wl was # 10/0.04, # 15/0.05, # 20/0.06, # 25/0.06, # 30/0.05, # 35/0.04 and # 40/0.04 and in g5, the sequence used was # 25/0.06 and # 25/.04 (to prepare of cervical and middle thirds), # 25/0.02, # 30/0.02, # 35/0.02 and 40/0.02 (to prepare of apical third). two endodontist with more than 5 years of experience, registered at the brazilian dentistry association (goinia, go, brazil), prepared the root canals. the operators had an 8 h theoretical course on rotary instrumentation associated with clinical applications. during preparations, the root canals were irrigated at each change of instrument with 3 ml of 1% naocl solution using a syringe with a 30-gauge needle (injecta, diadema, sp, brazil). root canals were dried and filled with 17% ethylenediaminetetraacetic (ph 7.2) (biodinmica, ibipor, pr, brazil) for 3 min to remove the smear layer. another 3 ml of 1% naocl solution was used for final irrigation. (san mateo, ca, usa), thickness : 0.100 mm (dimensions 1.170 mm 1.570 mm 1.925 mm, fov : 56.00 mm, voxel 0.100 mm, 33.5 s (1.024 views). exposure time was 33.5 s. images were examined with the scanner s proprietary software prexion 3d viewer (terarecon inc., foster city, ca, usa) in a pc workstation running windows xp professional sp-2 (microsoft corp., redmond, wa, usa), with processor intel core 2 duo-6300 1.86 ghz (intel corp., santa clara, ca, usa), nvidia geforce 6200 turbo cache videocard (nvidia corporation, santa clara, ca, usa), and monitor eizo - flexscan s2000, resolution 1600 1200 pixels (eizo nanao corp. a total of 2 examiners (a radiologist and an endodontist) were calibrated using 20% of the specimens, and all images were evaluated to detect the presence or absence of fractured instruments, root perforations (coronal, middle or apical thirds) and deviation from the original trajectory of the root canal (apical transportation). instruments fractures during preparation were also detected (figure 1). when a consensus was not reached by the two examiners that interpreted the procedural errors using cbct, a third observer (an endodontist) made the final decision. procedural errors detected using cone beam computed tomography images ; canal transportation (a), instrument fracture, (b) and perforation (c). data were analyzed using the ibm spss for windows 21.0 (ibm corporation, somers, ny, usa), including frequency distribution and cross - tabulation. comparative statistical analysis was performed using chi - square test, and the level of statistical significance was set at 5%. in a total of 300 root canals prepared, 43 (14.33%) procedural errors were detected (table 1). the frequency of procedural errors detected using cbct according to niti systems is described in table 1. the root canals prepared with biorace had significantly less procedural errors compared with those instrumented with other instruments (p 4 and r 8 mm). a total of 300 root canals were prepared in this study and 43 procedural errors were identified (14.33%). these results confirm the low frequency of procedural errors during root canal preparation using rotary niti instruments.12,22 the frequency of procedural errors according to the instrument used was statistically significant (p < 0.05). the root canals prepared with biorace had significantly less procedural errors (n = 2 ; 0.67%) (table 1). this result is similar to that observed by alves.,22 which found low frequency of operative errors made by undergraduate students with the use of biorace. higher number of procedural errors was observed in the groups instrumented with mtwo (n = 15 ; 5.00%) and protaper (n = 14 ; 4.67%) rotary niti instruments, root perforations were the main operative procedural error in both groups. bonaccorso.27 compared the shaping ability of protaper, mtwo, biorace and biorace + s - apex instruments in simulated canals and observed that protaper instruments caused more pronounced canal transportation in the apical curvature than the others instruments and that the use of biorace + s - apex resulted in significantly fewer canal aberrations. for the authors the occurrence of operative accidents (ledges, zips / elbows and instrument failures) in teeth prepared with protaper and mtwo might be explained by the increase in the taper 0.04 (s2) to 0.07 (f1) in the protaper system and by the fewer spirals per unit length in the mtwo files. the overall frequency of fractured instrument, in this study, was found to be 6.57% (n = 17). it was found a significant difference in the number of fractured instruments between the rotary niti instruments systems (table 1). the same was observed by bonaccorso.27 de alencar.12 reported a rotary instrument breakage rate of 3.33% while alves.22 of 3.88%. the instrument fracture may be associated with operator s knowledge, experience and technique and instrument s design and surface treatment.28 panitvisai.29 determined, by a systematic review and meta - analysis, the impact of a retained instrument on root canal treatment outcome. two case - control studies were identified and included, covering 199 cases. weighted mean healing for teeth with a retained instrument fragment was 91%. the two studies were homogeneous, with the risk difference of the combined data of 0.01, indicating that a retained fragment did not significantly influence healing. for spili.30 in the hand of experienced operators, endodontic instrument fracture had no adverse influence on the outcome of root canal treatment and retreatment and the presence of preoperative periapical radiolucency is a more clinically significant prognostic indicator. interestingly, in the present study, just one canal transportation was identified (k3 group). this result contrasts with the results observed in previous studies,10,31,32 which reported higher levels of canal transportation. zer32 compared the shaping ability (apical transportation and straightening) of 3 niti rotary instruments (protaper universal, hero 642 apical and flexmaster) in curved root canals using cbct and observed that apical transportation occurred with all the instruments despite their non - cutting tips. using a similar method, oliveira.31 identified 26 canals transportations. most of them were observed after mechanical preparation with nitiflex and k - flexofiles activated by reciprocating system. the small number of canal transportation identified in the present study may be explained by not achievement of the root filling procedure. canal transportations are best viewed when the root canals are filled.22 despite the existence of one ever - present risk factor, the root canal preparation outcome with rotary niti instruments is mostly predictable. further researches should be conducted with the purpose of adding knowledge that will produce answers to questions, as the best instrument. | background : this study investigated procedural errors made during root canal preparation with nickel - titanium (niti) instruments, using cone beam computed tomography (cbct) imaging method.materials and methods : a total of 100 human mandibular molars were divided into five groups (n = 20) according to the niti system used for root canal preparation : group 1 - biorace, group 2 - k3, group 3 - protaper, group 4 - mtwo and group 5 - hero shaper. cbct images were obtained to detect procedural errors made during root canal preparation. two examiners evaluated the presence or absence of fractured instruments, perforations, and canal transportations. chi - square test was used for statistical analyzes. the significance level was set at a=5%.results : in a total of 300 prepared root canals, 43 (14.33%) procedural errors were detected. perforation was the procedural errors most commonly observed (58.14%). most of the procedural errors were observed in the mesiobuccal root canal (48.84%). in the analysis of procedural errors, there was a significant difference (p < 0.05) between the groups of niti instruments. the root canals instrumented with biorace had significantly less procedural errors.conclusions:cbct permitted the detection of procedural errors during root canal preparation. the frequency of procedural errors was low when root canals preparation was accomplished with biorace system. |
a 64-year - old male patient with a smoking history of 46 pack - years was diagnosed with peripheral tumour of the left upper lobe of the lung and underwent typical left upper lobectomy. as the upper lobe had near the primary tumour slight adhesions to the sixth segment, the upper lobe was resected anatomically and from the lower lobe atypically as one specimen. resection lines were macroscopically and microscopically cancer free and squamocellular cancer g2, in some areas g3 (fig. tnm (tumour, node, metastasis) diagnosis after the specimen and resection line inspection was pt2n0m0r0 g2 stage ib. 34 months later, on the sixth postoperative visit, a recurrent tumour of the left lung was diagnosed radiologically (ct scan). after removal of the cancer, the previous resection line in the middle of the tumour (fig. the recurrence had anaplastic cancer features with a very low differentiation grade (g4 ; fig. 1b2) and differed from the primary tumour mainly in its lack of tissue pattern and in immunohistochemical features (ck5/6 negative). 15 months after the second operation, a metastasis - like tumour of the right upper lobe was diagnosed radiologically (fig. tumour histology and stage were estimated according to the who / iaslc histological classification of lung and pleural tumours and tnm staging according to the uicc (international union against cancer) classifications, respectively. control samples for the gene expression analysis were obtained from the same cancer patient at a site distant from the tumour and were approved as control samples by the pathologist. histological evaluation was carried out on formalin - fixed, paraffin - embedded tumour specimens. postsurgical tissue specimens for gene expression analysis were immediately cut to an appropriate size and submerged in rnalaterh (ambion, catalog no. total cellular rna from tissue specimens of 50 mg was extracted and purified using ribopure kit (ambion, catalog no. rna quantity and quality were assessed using the nanodrop-1000 spectrophotometer and the agilent bioanalyzer lab - on - a - chip technology (agilent rna 6000 nano kit, catalog no. amplifications were carried out according to the manufacturer 's instructions using 300 ng of total rna as a template. the illuminah beadchip platform and the corresponding whole - genome humanht-12 v3 expression beadchip were used for the gene expression analysis. illumina internal controls and beadstudio software were used for data consistency and quality control of the hybridization raw data. gene ontology (go) enrichments were calculated using the g : profiler web toolkit. the go analysis was performed with the gene lists representing at least 2-fold change of expression between the samples. as the gene expression difference between the primary control (obtained during the primary resection) and the recurrent cancer control (obtained during the supposed metastasis resection) samples was minimal, the further gene analyses were based on the comparison of samples of interest with the primary tumour control gene expression values. the highest number of up- and downregulated genes (2,577 genes altogether) was identified between the locally recurrent cancer and the control sample (table 1). surprisingly, the number of deregulated genes in the supposed metastasis sample (1,710) was substantially smaller than in primary cancer (2,095). the go analysis of 676 up- and 769 downregulated genes (at least 2-fold difference in expression was applied) between the supposed metastasis and primary cancer samples were performed in order to uncover the biological processes hindered within. as a result of the analysis, the biological processes associated with system and organ development, adhesion, oxidative stress, homeostasis as well as ossification came forth in the supposed metastasis sample. the known biological hallmarks of metastasis - associated processes like dedifferentiation, extensive metabolism, dna synthesis and inflammation were not noted. go analysis of genes downregulated in supposed metastasis revealed deactivation of processes like cellular localization, cytoskeleton and organelle organization, glucose catabolism and locomotion indicative of the more active nature of primary cancer compared with metastasis. altogether these gene expression - based go analyses did not support the hypothesis of metastasis. the molecular phenotype of the supposed metastasis was only minimally different from the primary cancer sample and the go analysis revealed no activation of processes like matrix remodelling, metastasis, dedifferentiation, mitosis, etc., which are characteristic of metastatic cancers. therefore, the evolvement of new primary cancer instead of metastasis is more probable. to visualize the gene expression data, a correlation heatmap (fig. the correlation analysis as well as pca revealed similar behaviour of the genes of the primary tumour control and the supposed metastasis control samples although there were 2 chemotherapy treatments between the sample collections. this indicates relatively minor changes in the gene expression profiles of histologically normal lung tissues collected prior to and after chemotherapy treatment. in the pc1/pc2 analysis, the recurrent cancer samples were most distant from controls and the supposed metastasis sample located in the middle section. interestingly, the difference that can be measured as distance in the pca between the control and the supposed metastasis samples is significantly smaller than distances between the control and the primary cancer samples as well as between the control samples and the recurrent cancer sample. thus, according to the molecular profiles, one could suggest to reevaluate the status of the metastasis to a second primary cancer that should also be less aggressive than a primary and locally revived one. the results of pc2/pc3 analysis show that the supposed metastasis sample has the most distinct pattern. a 64-year - old male patient with a smoking history of 46 pack - years was diagnosed with peripheral tumour of the left upper lobe of the lung and underwent typical left upper lobectomy. as the upper lobe had near the primary tumour slight adhesions to the sixth segment, the upper lobe was resected anatomically and from the lower lobe atypically as one specimen. resection lines were macroscopically and microscopically cancer free and squamocellular cancer g2, in some areas g3 (fig. tnm (tumour, node, metastasis) diagnosis after the specimen and resection line inspection was pt2n0m0r0 g2 stage ib. 34 months later, on the sixth postoperative visit, a recurrent tumour of the left lung was diagnosed radiologically (ct scan). after removal of the cancer, the previous resection line in the middle of the tumour (fig. the recurrence had anaplastic cancer features with a very low differentiation grade (g4 ; fig. 1b2) and differed from the primary tumour mainly in its lack of tissue pattern and in immunohistochemical features (ck5/6 negative). 15 months after the second operation, a metastasis - like tumour of the right upper lobe was diagnosed radiologically (fig. tumour histology and stage were estimated according to the who / iaslc histological classification of lung and pleural tumours and tnm staging according to the uicc (international union against cancer) classifications, respectively. control samples for the gene expression analysis were obtained from the same cancer patient at a site distant from the tumour and were approved as control samples by the pathologist. histological evaluation was carried out on formalin - fixed, paraffin - embedded tumour specimens. postsurgical tissue specimens for gene expression analysis were immediately cut to an appropriate size and submerged in rnalaterh (ambion, catalog no. total cellular rna from tissue specimens of 50 mg was extracted and purified using ribopure kit (ambion, catalog no. were assessed using the nanodrop-1000 spectrophotometer and the agilent bioanalyzer lab - on - a - chip technology (agilent rna 6000 nano kit, catalog no. amplifications were carried out according to the manufacturer 's instructions using 300 ng of total rna as a template. the illuminah beadchip platform and the corresponding whole - genome humanht-12 v3 expression beadchip were used for the gene expression analysis. illumina internal controls and beadstudio software were used for data consistency and quality control of the hybridization raw data. gene ontology (go) enrichments were calculated using the g : profiler web toolkit. the go analysis was performed with the gene lists representing at least 2-fold change of expression between the samples. as the gene expression difference between the primary control (obtained during the primary resection) and the recurrent cancer control (obtained during the supposed metastasis resection) samples was minimal, the further gene analyses were based on the comparison of samples of interest with the primary tumour control gene expression values. the highest number of up- and downregulated genes (2,577 genes altogether) was identified between the locally recurrent cancer and the control sample (table 1). surprisingly, the number of deregulated genes in the supposed metastasis sample (1,710) was substantially smaller than in primary cancer (2,095). the go analysis of 676 up- and 769 downregulated genes (at least 2-fold difference in expression was applied) between the supposed metastasis and primary cancer samples were performed in order to uncover the biological processes hindered within. as a result of the analysis, the biological processes associated with system and organ development, adhesion, oxidative stress, homeostasis as well as ossification came forth in the supposed metastasis sample. the known biological hallmarks of metastasis - associated processes like dedifferentiation, extensive metabolism, dna synthesis and inflammation were not noted. go analysis of genes downregulated in supposed metastasis revealed deactivation of processes like cellular localization, cytoskeleton and organelle organization, glucose catabolism and locomotion indicative of the more active nature of primary cancer compared with metastasis. altogether these gene expression - based go analyses did not support the hypothesis of metastasis. the molecular phenotype of the supposed metastasis was only minimally different from the primary cancer sample and the go analysis revealed no activation of processes like matrix remodelling, metastasis, dedifferentiation, mitosis, etc. the correlation analysis as well as pca revealed similar behaviour of the genes of the primary tumour control and the supposed metastasis control samples although there were 2 chemotherapy treatments between the sample collections. this indicates relatively minor changes in the gene expression profiles of histologically normal lung tissues collected prior to and after chemotherapy treatment. in the pc1/pc2 analysis, the recurrent cancer samples were most distant from controls and the supposed metastasis sample located in the middle section. interestingly, the difference that can be measured as distance in the pca between the control and the supposed metastasis samples is significantly smaller than distances between the control and the primary cancer samples as well as between the control samples and the recurrent cancer sample. thus, according to the molecular profiles, one could suggest to reevaluate the status of the metastasis to a second primary cancer that should also be less aggressive than a primary and locally revived one. the results of pc2/pc3 analysis show that the supposed metastasis sample has the most distinct pattern. approximately 7% of all cancer patients experience a new primary cancer later in life. in the current case we have analysed and compared the histology and whole - genome mrna expression levels within primary, recurrent and supposed metastatic lung cancer specimens. pca and go analysis were applied to reveal the molecular variance and activities of the tissues. as the histological patterns, clinical manifestation and performance of the patient were unexpected, clinically, the supposed metastasis had no common histological signs of previous chemotherapy like vacuolization, increased amount of apoptotic cells or inflammatory infiltration but had clear upregulation of genes as a response to a chemical stimulus which can be explained with previous chemotherapy (see online suppl. the fact that supposed metastasis followed by chemotherapy was more similar to the primary tumour makes second primary cancer more likely. as a result of pca of gene expression data, a clear distinction of recurrent cancer was seen, whereas similarities between supposed metastases and the primary tumour were noted. the recurrence sample was histologically classified as undifferentiated and the clear distinction was also seen in pca. in comparison of primary tumour and local recurrence samples, upregulation of processes like neural development, axonogenesis, neural degeneration processes and the difference between the primary tumour and local recurrence could be explained by micrometastasis and the cancer stem cell phenomenon. in the current case, we have shown the correlation of gene expression - based analysis with the histology of different control and cancer samples of one patient. the gene expression profiles supported the hypothesis of second primary squamous cell cancer of the lung. for 1 year and 10 months, since the third operation, the patient has had a good performance and recurrence - free life as controlled by ct scan, which is uncommon in everyday practice. the exclusion of the metastasis possibility is crucial in choosing the optimal treatment strategy and also results in a better prognosis of the patient. the up- and downregulated genes between different samples analysed click here for additional data file. | a 64-year - old male patient was diagnosed with 3 consecutive non - small cell lung carcinomas (nsclc). in the current study, we applied whole - genome gene expression analysis to control, primary and locally recurrent cancer, and supposed metastasis samples of a single patient. according to our knowledge, there are no published papers describing the gene expression profiles of a single patient 's squamous cell lung cancers. as the histology and differentiation grade of the primary cancer and the supposed metastasis differed minimally, but local recurrence was poorly differentiated, molecular profiling of the samples was carried out in order to confirm or reject the hypothesis of second primary cancer. principal component analysis of the gene expression data revealed distinction of the local recurrence. gene ontology analysis showed no molecular characteristics of metastasis in the supposed metastasis. gene expression analysis is valuable and can be supportive in decision - making of diagnostically complicated cancer cases. |
to stent or not to stent is a point debated since long time. this assumes importance in children and infants requiring intervention for ureteropelvic junction obstruction (upjo). although literature supports stentless pyeloplasty, in laparoscopic pyeloplasty particularly, it is a common practice to stent the anastomosis. the advantages and disadvantages of both the approaches are well known. in infants, the urethra is narrow and runs the risk of injury and subsequent strictures with surgical manipulations. in addition, the stent - related morbidities which include dysuria and infections may make the postoperative course of the infant unpleasant. in the days of open surgery, it was our policy to employ the technique of open insertion of stent along with a nephrostomy, just prior completion of the anastomosis. this served the purpose of nephrostomy acting as a safety valve prior to removal of splint. in this article, we describe the technique of ante grade access of the ureter, thus potentially avoiding the urethral manipulations and the associated complications. a 7.5mhz (b k medical, denmark) ultrasound probe with puncture attachment is used. a pediatric probe is used for this purpose [figure 1 ]. a 18 gauge echotip disposable two part trocar needle (cook urological inc, indiana, usa) which is available as a two part needle was used. a 0.035 guide wire or alternatively a terumo glide wire (terumo corporation, tokyo, japan)with alken two part metallic needle helps simultaneously passing two guide / glide wires [figure 1 ]. the dilatation is done with angiotech one step dilator (pbn medicals, denmark), a14 fr nephrostomy tube (devon innovations (p) ltd, parwanoo, hp, india) with a 5 fr open end ureteric catheter (devon innovations (p) ltd, bangalore, india) is used. the armamentarium (a) telescopic metal two part needle (b) pediatric ultrasound probe the first step involves positioning the patient in a prone position, although the same can be done in supine position. line diagram (a) and picture (b) illustrating ultrasound - guided calyceal puncture the needle is housed in the needle attachment of the ultrasound probe and the posterior calyx identified [figure 2 ]. the key for a successful ultrasound puncture is that the needle should be seen throughout the trajectory which includes the skin, subcutaneous tissue, cup of the calyx and the calyx in concern [figure 3 ]. technique of ultrasound - guided access (a) an egress of clear fluid suggesting entry in the pelvicalyceal system (b) a successful ultrasound puncture - the needle should be seen throughout the trajectory which includes the skin, subcutaneous tissue, cup of the calyx and the calyx in concern an egress of clear fluid suggests entry in the pelvicalyceal system which can further be confirmed with a contrast study [figure 3 ]. next a guide wire is parked in a distant calyx and the tract dilated up to 14 fr using a screw dilator. an alken needle, which is a two part needle, helps in passing a second guide wire after removing the inner stylet [figure 4 ]. once both guide wires are in place, one wire is used for passing a ureteric catheter and the second one is used for placing a nephrostomy tube [figure 5 ]. the salient feature of our technique is that all steps of percutaneous access which include access and dilation are done solely using ultrasound guidance. (a) the needle and guide wire are clearly seen in real time ultrasound, thus avoiding bowel injury (b) (line diagram) and c (picture):-two glide wires passed into the renal pelvis through the telescopic metal two part needle after removing the inner stylet (a) line diagram showing completed anastomosis with nephrostomy and ureteric catheter (splint) in situ, (b) laparoscopic pyeloplasty performed after the ureteric catheter and percutaneous nephrostomy is in place c) opened up renal pelvis showing presence of both malecot catheter and ureteric catheter in pelvis (d) ultrasound showing flower of malecot catheter opened in pelvis after the ureteric catheter and percutaneous nephrostomy is in place, the laparoscopic pyeloplasty is performed. once the pelvis is opened and the ureter spatulated, the ureteric catheter which is already coiled in the pelvis is passed under direct vision into the ureter after the posterior layer is completed following which the anastomosis is completed [figure 6 ]. placement of ureteric splint under vision once the posterior wall is completed, the ureteric catheter is passed into the ureter under vision ureteric catheter is removed on the 3 post operative day and nephrostomy is clamped. the modified technique was successfully done in five patients aged less than one year old. a 7.5mhz (b k medical, denmark) ultrasound probe with puncture attachment is used. a pediatric probe is used for this purpose [figure 1 ]. a 18 gauge echotip disposable two part trocar needle (cook urological inc, indiana, usa) which is available as a two part needle was used. a 0.035 guide wire or alternatively a terumo glide wire (terumo corporation, tokyo, japan)with alken two part metallic needle helps simultaneously passing two guide / glide wires [figure 1 ]. the dilatation is done with angiotech one step dilator (pbn medicals, denmark), a14 fr nephrostomy tube (devon innovations (p) ltd, parwanoo, hp, india) with a 5 fr open end ureteric catheter (devon innovations (p) ltd, bangalore, india) is used. the armamentarium (a) telescopic metal two part needle (b) pediatric ultrasound probe the first step involves positioning the patient in a prone position, although the same can be done in supine position. line diagram (a) and picture (b) illustrating ultrasound - guided calyceal puncture the needle is housed in the needle attachment of the ultrasound probe and the posterior calyx identified [figure 2 ]. the key for a successful ultrasound puncture is that the needle should be seen throughout the trajectory which includes the skin, subcutaneous tissue, cup of the calyx and the calyx in concern [figure 3 ]. technique of ultrasound - guided access (a) an egress of clear fluid suggesting entry in the pelvicalyceal system (b) a successful ultrasound puncture - the needle should be seen throughout the trajectory which includes the skin, subcutaneous tissue, cup of the calyx and the calyx in concern an egress of clear fluid suggests entry in the pelvicalyceal system which can further be confirmed with a contrast study [figure 3 ]. next a guide wire is parked in a distant calyx and the tract dilated up to 14 fr using a screw dilator. an alken needle, which is a two part needle, helps in passing a second guide wire after removing the inner stylet [figure 4 ]. once both guide wires are in place, one wire is used for passing a ureteric catheter and the second one is used for placing a nephrostomy tube [figure 5 ]. the salient feature of our technique is that all steps of percutaneous access which include access and dilation are done solely using ultrasound guidance. (a) the needle and guide wire are clearly seen in real time ultrasound, thus avoiding bowel injury (b) (line diagram) and c (picture):-two glide wires passed into the renal pelvis through the telescopic metal two part needle after removing the inner stylet (a) line diagram showing completed anastomosis with nephrostomy and ureteric catheter (splint) in situ, (b) laparoscopic pyeloplasty performed after the ureteric catheter and percutaneous nephrostomy is in place c) opened up renal pelvis showing presence of both malecot catheter and ureteric catheter in pelvis (d) ultrasound showing flower of malecot catheter opened in pelvis after the ureteric catheter and percutaneous nephrostomy is in place, the laparoscopic pyeloplasty is performed. once the pelvis is opened and the ureter spatulated, the ureteric catheter which is already coiled in the pelvis is passed under direct vision into the ureter after the posterior layer is completed following which the anastomosis is completed [figure 6 ]. placement of ureteric splint under vision once the posterior wall is completed, the ureteric catheter is passed into the ureter under vision ureteric catheter is removed on the 3 post operative day and nephrostomy is clamped. the modified technique was successfully done in five patients aged less than one year old. the indications for stenting are well known, they include pyeloplasty in the presence of solitary functioning kidney, infection, or a previous failed procedure. placing a stent in a retrograde fashion involves urethral manipulation and the attendant complications ; in addition, this involves an additional procedure for removal of the stent. the advantages of stent placement following pyeloplasty include decreased risk of collection or edema, maintaining ureteric alignment woo., in their study on the impact of internal stenting on the surgical outcome of dismembered pyeloplasty in infants under the age of 12 months with the open approach. they observed statistically significant increase in urinary leaks, length of hospital stay and need for repeat pyeloplasty in non stented versus the stented group. a variety of techniques have been described to place a stent or a splint antegrade thus avoiding the need for cystoscopy during insertion or removal. taveres describe a technique for inserting an internal - external nephroureteral antegrade stent during laparoscopic pyeloplasty which can be removed in clinic as outpatient. the advantages of the technique we have described are the following : 1)the ureteral access can be gained with ultrasound guidance. this minimizes the risk of bowel injury as well radiation in these patients.2)the nephrostomy tube acts as a safety valve and can be clamped to confirm the integrity of the anastomosis prior to its removal.3)if needed, the ureteric catheter can act as conduit to negotiate a ureteral stent across the anastomosis. the nephrostomy tube acts as a safety valve and can be clamped to confirm the integrity of the anastomosis prior to its removal. if needed, the ureteric catheter can act as conduit to negotiate a ureteral stent across the anastomosis. we acknowledge that there are a few disadvantages with this technique and the most significant is the need for additional equipment and expertise for gaining percutaneous renal access. in addition, at times, repeated attempts for gaining access lead to extravasation and oozing, which might hamper the vision and the anastomosis. in infants with pelviureteric junction obstruction when undergoing laparoscopic pyeloplasty ; ultrasound - guided antegrade nephroureteric, ureteric catheter placement is a safe technique. it avoids need for urethral manipulation for insertion and removal of stent, decreases radiation exposure to infant. furthermore, nephrostomy tube acts as a safety valve to confirm the integrity of anastomosis and ureteric catheter may act as conduit to put another ureteric stent if necessary at later date. this technique requires some additional equipments and expertise to get percutaneous renal access which can be mastered with practice. | background : access to urethras and ureters of infants may be hazardous and injurious through an endoscopic route. placement and removal of stents in infants requires anaesthesia and access through these small caliber urethras. we describe our technique of placing antegrade splint during a laparoscopic pyeloplasty in these infants.materials and methods : an ultrasound - guided percutaneous renal access is obtained. telescopic metal two part needle is passed into the kidney over a guide wire. a second guide wire is passed through the telescopic metal two part needle. the tract is dilated with 14 fr screw dilator. over one guide wire, a 5 fr ureteric catheter is passed and coiled in the renal pelvis. over the other wire, a 14 fr malecot catheter is placed as nephrostomy. laparoscopic pyeloplasty is then done. during pyelotomy, the ureteric catheter is pulled and advanced through the ureter before the pyeloplasty is completed. the ureteric catheter thus acts as a splint across the anastomosis. ureteric catheter is removed on the 3rd post operative day and nephrostomy is clamped. nephrostomy is removed on 4th post operative day if child is asymptomatic. the modified technique was successfully done in five patients aged less than one year old. all patients tolerated the procedure well. post operative period was uneventful in all.conclusion:ultrasound-guided ante grade nephroureteral ureteral splint for infant laparoscopic pyeloplasty is safe. it avoids the need for urethral instrumentation for insertion and removal of stents in these small patients. |
the incidence in pregnant reproductive age women is reported to be 8 patients per 100 000 per year. the most common cause of primary hyperparathyroidism in pregnancy, as in the general population, is a single adenoma. in 1938, friedrichsen described symptomatic hypocalcemia in an infant unmasking the mother 's hyperparathyroidism. since this initial anecdotal publication, there have been fewer than 20 published cases of similar presentations of neonatal hypocalcemia leading to a diagnosis of maternal hyperparathyroidism. neonatal hypocalcemia, while fortunately rare, can be physiologic in origin and generally resolves shortly after birth. late - onset or symptomatic hypocalcemia, however, can cause seizures in infants and warrants investigation of both the child and the mother. during the third trimester of pregnancy, calcium parathyroid hormone (pth) and calcitonin, on the other hand, do not cross the placental barrier and serum calcium of a neonate is often higher than that of the mother at birth. after birth, serum calcium regulation of the child is no longer dependent on the mother. within the first 48 h, this is a normal transition phase due to the new dependence on their own immature pth secretion, limited dietary calcium intake, immature renal reabsorption, minimal skeletal calcium stores and vitamin d status. other causes of hypocalcemia are abnormalities of vitamin d metabolism, hyperphosphatemia, hypomagnesemia and hypercalcitonemia, which typically occur within 1224 h of life. hypocalcemia can result in convulsions, arrythmias, tetany and/or paresthesias in the hands, feet and perioral regions. additionally, hypocalcemia may result in petechiae, hyperactive reflexes, prolonged qt waves and laryngospasms. while most patients with hyperparathyroidism are diagnosed outside of pregnancy, neonatal manifestations of hypocalcemia can be a rare initial presentation of maternal hyperparathyroidism. here, we present a case of a female with multiglandular hyperparathyroidism diagnosed only after her newborn child presented with seizures due to severe hypocalcemia. a 7-day - old male infant born to a healthy 33-year - old female at 37 weeks of gestation presented to the local emergency department (ed) with sudden - onset tonic clonic seizures. he was healthy at birth, with no prenatal complications, and was stable at discharge following birth. laboratory testing revealed extreme hypocalcemia (ionized calcium of 3.2 mg / dl) and undetectable pth (< 10 pg / ml). concomitant evaluation of the mother revealed both elevated ionized calcium (5.9 mg / dl) and pth (116 pg / ml). upon further review, the mother reported a history dating back several years with vague symptoms of constipation, labile mood and fatigue during and prior to her pregnancy. she denied any history of bone pain, kidney stones or abdominal pain, and denied any family history of calcium disorders. with a diagnosis of primary hyperparathyroidism, in - office ultrasound revealed an essentially normal thyroid with only a small subcentimeter nodule in the right inferior pole. evaluation of the surrounding tissue for parathyroid abnormalities revealed a large 2- to 3-cm, hypodense area inferior to the right inferior thyroid pole. this area lacked blood flow but was not classic for parathyroid adenoma due to the almost anechoic appearance. evaluation of the left side of the neck revealed similar hypodense changes in the lower neck but nothing as significant as seen on the right. a parathyroid nuclear scan was performed showing two sites of sestamibi hyperconcentration, slow washout and discordance in the left neck. the patient was diagnosed with primary hyperparathyroidism likely due to multiglandular disease and was prepared for parathyroidectomy. after an extensive exploration, three significantly enlarged cystic glands were identified and removed (fig. 1). intraoperative pth levels dropped appropriately after parathyroidectomy, thyroid lobectomy and cervical thymectomy from a baseline of 104 pg / ml to a final value of 41.1 pg / ml. pathology noted three hypercellular, cystic parathyroid glands with mucoid degeneration weighing 6.200, 1.846 and 0.110 g as well as a separate 3 mm focus of hypercellular parathyroid tissue in the pretracheal tissue. given the cystic appearance, age of the patient and presence of multiglandular disease, evaluation for familial cystic parathyroid adenomatosis (hyperparathyroidism - jaw bone - tumor syndrome) and men 1 were undertaken, both of which were normal. he returned to the ed with seizures at 1 month of age. after increasing calcium supplementation appropriately, he has since been maturing well with no further seizure activity and normal calcium levels. this represents a unique case of undiagnosed maternal primary hyperparathyroidism manifesting with intrauterine parathyroid suppression and hypocalcemic seizures in the newborn. after ruling out multiple syndromes contributing to our patient 's hyperparathyroidism, it was concluded that our patient suffered from isolated multiglandular primary hyperparathyroidism. fortunately, the infant in our case was able to recover parathyroid function over the course of 9 months of calcium supplementation. not all cases of intrauterine parathyroid suppression are able to recover and wean from supplemental calcium. undiagnosed maternal hyperparathyroidism can lead to disastrous complications for infants and therefore must be considered in both hypercalcemic pregnant patients and hypocalcemic neonates. after 2448 h, a child presenting with symptomatic hypocalcemia can represent a potentially fatal condition indicating severely suppressed parathyroid function and an underlying maternal hyperparathyroidism. this potentially fatal presentation of the disease highlights the importance of diagnosis and treatment of hypercalcemia in the pregnant patient. we recommend considering surgery at the time of diagnosis, even during pregnancy, to minimize dangers to both mother and infant. | a 7-day - old male infant born to a healthy 33-year - old female at 37 weeks of gestation was brought to the local emergency department (ed) with sudden - onset tonic clonic seizures. laboratory testing revealed extreme hypocalcemia (ionized calcium of 3.2 mg / dl) and undetectable parathyroid hormone (pth < 10 pg / ml). concomitant evaluation of the mother revealed both elevated ionized calcium (5.9 mg / dl) and pth (116 pg / ml). the mother underwent preoperative ultrasound localization and sestamibi scan, followed promptly by parathyroidectomy. given the cystic appearance and presence of multiglandular disease, evaluation for familial cystic parathyroid adenomatosis (hyperparathyroidism - jaw bone - tumor syndrome) and men 1 were undertaken. the infant was stabilized and discharged home. he returned to the ed with seizures at 1 month of age. after increasing calcium supplementation appropriately, he was monitored with weekly office visits. this represents a unique case of undiagnosed maternal primary hyperparathyroidism manifesting with intrauterine parathyroid suppression and hypocalcemic seizures in the newborn. |
on august 5, 2011, a community hospital laboratory contacted the minnesota department of health to submit for identification a bacillus sp. cdc typed the isolate as gt59 using multiple - locus variable - number tandem repeat analysis specific for 8 loci (8). the isolate was related to strains with genotypes generally associated with imported animal products and most closely related to a strain obtained from a 1965 investigation of a case of cutaneous anthrax in a worker at a new jersey gelatin factory, which used bone imported from india (9,10). the patient, a 61-year - old florida resident, had begun a 3-week trip with his wife on july 11, 2011. they drove through north dakota, montana, wyoming, and south dakota, where animal anthrax is sporadic or enzootic (figure). while traveling, they walked in national parks, collected loose rocks, and purchased elk antlers. on july 29, they drove through herds of bison and burros, frequently stopping while animals surrounded their vehicle. the man was hospitalized on august 2, following onset of illness while he was en route to minnesota. his condition was treated with antimicrobial drugs, according to published recommendations, supplemented with anthrax immune globulin, and he fully recovered (11). route traveled by anthrax case - patient in the united states, july 11, 2011 to august 2, 2011. the couple had no contact with dead animals, but reported dusty conditions while driving through the herds. the patient had not traveled abroad during the past year or been exposed to tanneries, wool or goat hair mills, bone meal, african drums, or illicit drugs. he crafted metal and stone jewelry and knives with elk - antler handles in a home workshop. one month before illness onset, he had constructed fishing flies using hair from a healthy elk he hunted in kentucky 8 months previously. because his wife may have experienced the same exposure, postexposure prophylaxis was provided, including a 60-day course of oral antimicrobial drugs and a 3-dose series of anthrax vaccine adsorbed (emergent biosolutions, lansing, mi, usa), under an investigational new drug protocol. symptoms of anthrax did not develop ; however, she was unable to provide blood for serologic testing before starting postexposure prophylaxis. environmental sampling of the entire trip route was not feasible because the travel route involved several thousand miles over 3 weeks, specific suspected exposure locations were lacking, and recovering b. anthracis from environmental samples (12), particularly soil (13), gives variable results and is inefficient. to identify an exposure source and focus the environmental investigation, investigators obtained targeted samples from the vehicle and personal items where spores were likely to be found. from the patient s vehicle and contents, 47 environmental samples were collected, and 18 environmental samples were obtained from his home workshop and garage (table), following procedures of the national institute for occupational safety and health and the environmental protection agency (14). all samples were processed and cultured by using cdc s laboratory response network culture and pcr methods at the minnesota department of health and the florida department of health. multiple agencies, including cdc, state public and animal health departments of minnesota, north dakota, montana, wyoming, south dakota, and florida, and other federal and state partners, conducted enhanced retrospective surveillance to identify other possible human or animal anthrax cases during june 1august 31, 2011. infection preventionists, medical examiners, and coroners were asked if they were aware of cases of unexplained death or fulminant illness potentially caused by anthrax. the us department of agriculture veterinary services and wildlife services / animal and plant health inspection service, the southeastern cooperative wildlife disease study, the us geological survey national wildlife health center, the national park service, and state wildlife and veterinary agencies were asked to report unexplained animal die - offs and animal deaths consistent with anthrax. in addition, 450 laboratory response network and 7 national animal health laboratory network laboratories in the participating states, the national veterinary services laboratories, and other veterinary and wildlife laboratories were asked to review records for non - hemolytic bacillus spp. a single bovine case was reported in aurora county, south dakota, in august 2011 ; however, the isolate was determined to be of an unrelated genotype (gt3). no other anthrax - associated die - offs in wildlife or domestic animals were identified, and no other suspected or confirmed human cases of anthrax were identified or reported during this period. we did not find a specific exposure associated with anthrax infection for this case - patient and no other human or related animal cases. the clinical isolate genotype and sequence closely matched several previous environmental sample isolates from north america, however, no epidemiologic links were identified. the case - patient was exposed to airborne dust while traveling through areas where anthrax was enzootic ; however, testing of vehicle air filters in which the dust was concentrated was negative for b. anthracis. nonetheless, the patient may have been exposed through contact with an unidentified contaminated item. this investigation was limited by the poor sensitivity expected for soil sampling and lack of data to guide additional focused environmental sampling, precluding widespread random sample collection and testing along the route traveled. it is unusual for inhalation anthrax case - patients to have no identified exposure source (5,9,15). inhalation of spore - contaminated soil has been suggested as a possible source of infection for bison in anthrax outbreaks in canada (16). a heavy equipment operator acquired inhalation anthrax during a bison outbreak in canada, where he dragged carcasses to burial sites and was exposed to airborne dust during operations (2). chronic pulmonary disease or immunosuppression may increase a person s susceptibility to inhalation anthrax (9,15). this case - patient had a decades - long history of chemical pneumonitis, and although he reported no respiratory difficulties, perhaps his risk was increased. he also had a history of mild diabetes ; diabetes has been observed in other anthrax patients (9). this report highlights the challenges of investigating cases of anthrax when no specific suspected source exists. anthrax, either naturally - occurring or bioterrorism - related, is a major public health concern, and timely recognition is critical. clinicians and public health professionals should be cognizant that naturally acquired anthrax can occur in the united states and take appropriate steps to rapidly diagnose and investigate such cases. | inhalation anthrax occurred in a man who vacationed in 4 us states where anthrax is enzootic. despite an extensive multi - agency investigation, the specific source was not detected, and no additional related human or animal cases were found. although rare, inhalation anthrax can occur naturally in the united states. |
there are symptoms common to both chronic heart failure (chf) and pulmonary arterial hypertension (pah). pulmonary abnormalities play an important role in the evaluation and prognosis of chf and pah. the differences of pulmonary function in chronic left heart failure and chronic right heart failure are not fully understood. cardiopulmonary exercise testing (cpx) is considered the criterion standard for studying cardiovascular, pulmonary, and metabolic adaptations to exercise in heart disease. pulmonary abnormalities occur in both chf and chronic right heart failure secondary to pah [19 ]. left heart failure with cardiac enlargement causes restrictive lung disease, interstitial edema, alveolar - capillary hydrostatic injury, and fatigue of respiratory muscles, which contributes to pulmonary abnormalities. pah can cause ventilation / perfusion (v / q) inequality secondary to pulmonary vascular bed damage. we hypothesized that pulmonary function is different in patients with left heart failure and right heart failure secondary to pah. this study may help understand relationships between pulmonary abnormalities and different types of heart failure. a single cardiologist evaluated 120 patients with clinically stable chf, including 60 patients with chronic left heart failure and 60 patients with chronic right heart failure. left heart failure was diagnosed using the american college of cardiology foundation (accf)/american heart association (aha) guidelines for heart failure. pah was defined as who group1 ph according to the accf / aha expert consensus document on pulmonary hypertension. we excluded patients with group 2, 3, 4, or 5, associated with congenital heart disease, portal hypertension, significant venous or capillary involvement, or persistent pulmonary hypertension of the newborn. right heart failure was defined as pah and cardiac index (ci) 65% at rest. the document was approved and recorded by the institutional ethics committee of fuwai hospital, china. pulmonary function testing at rest was performed using a closed - circuit spirometer (cosmed, italy) according to the american thoracic society (ats) recommendations. dead space volume / tidal volume (vd / vt)=(paco2 peco2 mean)/paco2 [vd (machine)/vt ] where paco2 = arterial co2 tension, peco2 = the partial pressure of expired co2. minute ventilation / co2 production (ve / vco2) ratio was defined as ve / vco2 = 863/[paco2 (1-vd / vt) ]. physician - supervised cpx was performed on a bicycle ergometer with a breath - by - breath system (cosmed, italy) according to the ats / american college of chest physicians (accp) statement on cpx. exercise - induced right - to - left shunt (eis) was performed according to criteria described by sun. breathing reserve (br) was defined as : br = (mvv - peak ve)/mvv 100% where mvv = maximal voluntary ventilation. change in cpx parameter from rest to peak exercise was defined as : measure = (peak measure - rest measure)/rest measure 100%. two - dimensional echocardiography and doppler ultrasound (philips ie33, netherlands) examinations were performed on the same day before cpx. left ventricular ejection fraction (lvef) was determined according to the recommendations of the european association of echocardiography. pulmonary capillary wedge pressure (pcwp) and mean pulmonary artery pressure (mpap) were determined with balloon flotation catheter (edwards lifesciences, usa). multivariate linear regression was used to determine pulmonary function differences and the changes in cpx parameters between the 2 groups. to correct for demographic differences between the 2 groups of patients, variables that were either biologically plausible and/or significantly different between groups in univariate analysis a single cardiologist evaluated 120 patients with clinically stable chf, including 60 patients with chronic left heart failure and 60 patients with chronic right heart failure. left heart failure was diagnosed using the american college of cardiology foundation (accf)/american heart association (aha) guidelines for heart failure. pah was defined as who group1 ph according to the accf / aha expert consensus document on pulmonary hypertension. we excluded patients with group 2, 3, 4, or 5, associated with congenital heart disease, portal hypertension, significant venous or capillary involvement, or persistent pulmonary hypertension of the newborn. right heart failure was defined as pah and cardiac index (ci) 65% at rest. the document was approved and recorded by the institutional ethics committee of fuwai hospital, china. pulmonary function testing at rest was performed using a closed - circuit spirometer (cosmed, italy) according to the american thoracic society (ats) recommendations. peco2 mean)/paco2 [vd (machine)/vt ] where paco2 = arterial co2 tension, peco2 = the partial pressure of expired co2. minute ventilation / co2 production (ve / vco2) ratio was defined as ve / vco2 = 863/[paco2 (1-vd / vt) ]. physician - supervised cpx was performed on a bicycle ergometer with a breath - by - breath system (cosmed, italy) according to the ats / american college of chest physicians (accp) statement on cpx. exercise - induced right - to - left shunt (eis) was performed according to criteria described by sun. breathing reserve (br) was defined as : br = (mvv - peak ve)/mvv 100% where mvv = maximal voluntary ventilation. change in cpx parameter from rest to peak exercise was defined as : measure = (peak measure - rest measure)/rest measure 100%. two - dimensional echocardiography and doppler ultrasound (philips ie33, netherlands) examinations were performed on the same day before cpx. left ventricular ejection fraction (lvef) was determined according to the recommendations of the european association of echocardiography. pulmonary capillary wedge pressure (pcwp) and mean pulmonary artery pressure (mpap) were determined with balloon flotation catheter (edwards lifesciences, usa). multivariate linear regression was used to determine pulmonary function differences and the changes in cpx parameters between the 2 groups. to correct for demographic differences between the 2 groups of patients, variables that were either biologically plausible and/or significantly different between groups in univariate analysis patients with left heart failure were older, had a higher proportion of men and smokers, and had a higher bmi. the anaerobic threshold (at) was detectable in all patients. among the patients with right heart failure, 21 showed eis. patients with right heart failure had lower oxygen uptake (vo2), vt, fev1, fvc, mvv, and petco2, and higher end - tidal partial pressure of o2 (peto2) and ve / vco2 at rest. right heart failure patients had lower peak vo2, peak ve, peak vt, and peak petco2, and had higher peak vd / vt, peak peto2, peak ve / vco2, and ve / vco2 slope during exercise. right heart failure patients had lower vo2, ve, petco2, and ve / vco2, from rest to exercise. patients with right heart failure had lower petco2, and higher peto2 and ve / vco2 at rest. right heart failure patients had a lower peak petco2, and higher peak vd / vt, peak peto2, peak ve / vco2, and ve / vco2 slope during exercise. right heart failure patients had lower petco2 and ve / vco2, from rest to exercise. figure 1a shows the result of vd / vt ratio versus ve / vco2 at rest. the curves show patients with right heart failure had higher ve / vco2 and lower petco2 at any given vd / vt ratio at rest. the abrupt curve of right heart failure was suggestive of eis in the right heart failure patients during exercise. most right heart failure patients had higher ve / vco2 slope and peak vd / vt at any given peak petco2. figure 1c shows the result of peak vd / vt ratio versus ve / vco2 slope. the curves show that most right heart failure patients had a lower petco2 and higher vd / vt ratio at any given. patients with right heart failure had lower petco2, and higher peto2 and ve / vco2 at rest. patients with right heart failure showed a higher peak vd / vt, peak peto2, peak ve / vco2, and ve / vco2 slope, and a lower petco2 during exercise. patients with right heart failure had more changes in petco2 and ve / vco2 from rest to exercise. these results show that patients with right heart failure had worse pulmonary function at rest and exercise. pulmonary function changes compatible with restrictive lung disease are observed in most patients with severe chf, and findings compatible with airway obstruction are common in patients with right heart failure caused by idiopathic pulmonary arterial hypertension (ipah). right heart failure patients had a lower petco2 (table 3, figure 1a). figure 1a shows that right heart failure patients had a lower petco2 at any given vd / vt. these results demonstrate that patients with right heart failure had more ventilation at given co2 discharge. considering there was no difference in respiratory frequency or ve, the lower petco2 was due to hyperventilation in alveolus with well - perfusion and hypoperfusion of well ventilated alveolus in patients with right heart failure. the lower petco2 could explain the higher ve / vco2 in patients with right heart failure. the higher ve / vco2 showed that right heart failure patients had lower ventilation efficiency. this result means that there was no difference in v / q mismatching at rest in the 2 groups. petco2 was lower in both chf and pah, reflecting the ventilation impairment [3,8,2025 ]. we found that right heart failure patients had a lower petco2 during exercise (table 3). the reason for the lower peak petco2 during exercise in patients with right heart failure was similar to the reason for lower petco2 at rest. sun. found that patients with pah had an eis resulting in abrupt decreased petco2, had increased peto2, and increased ve / vco2 ratio during exercise. the abrupt curve of right heart failure demonstrated that patients with right heart failure had eis (figure 1b). we found that patients with right heart failure had significantly higher peak vd / vt ratio (table 3). figure 1c shows that most patients with right heart failure had a lower peak petco2 and a higher ve / vco2 slope. these results demonstrate that patients with right heart failure had severe v / q mismatching at peak exercise. this means that primary pulmonary vesicular damage played a greater role in v / q mismatching during exercise than did pulmonary congestion. moreover, the eis was involved in the higher vd / vt in patients with right heart failure. ve / vco2 and ve / vco2 slope are important to reflect disease severity and prognosis in chf and pah, and reflect v / q mismatching in pah. we found that peak ve / vco2 and ve / vco2 slope were higher in patients with right heart failure. these results demonstrate that patients with right heart failure had more severe ventilation inefficiency and gas exchange abnormality compared to patients with left heart failure. these results were due to lower peak petco2 and higher peak vd / vt in right heart failure patients. we found that patients with right heart failure had higher absolute values of petco2 and ve / vco2 from rest to peak exercise (table 2 and 3). these results show that right heart failure patients had larger changes of pulmonary function from rest to exercise. the larger change of petco2 demonstrates that patients with right heart failure had more severe hyperventilation from rest to exercise. this should be attributed to more complex ventilation drive in pah, including exercise - induced hypoxia and eis. we found that patients with right heart failure had worse ventilation efficiency, severe v / q mismatching, and gas exchange abnormality, even without differences in peak vo2. it was a single - center study and demographic differences were detected between the 2 groups. the etiology of heart failure in the 2 groups resulted in differences of sex and age. because there was no control group, we could not confirm a normal breathing pattern at rest. we could not perform invasive hemodynamic testing in all patients, which influenced our evaluation of left heart failure. we merged the 4 disease classes into 2 groups because there were not enough patients with class iv nyha right heart failure. pulmonary function changes compatible with restrictive lung disease are observed in most patients with severe chf, and findings compatible with airway obstruction are common in patients with right heart failure caused by idiopathic pulmonary arterial hypertension (ipah). right heart failure patients had a lower petco2 (table 3, figure 1a). figure 1a shows that right heart failure patients had a lower petco2 at any given vd / vt. these results demonstrate that patients with right heart failure had more ventilation at given co2 discharge. considering there was no difference in respiratory frequency or ve, the lower petco2 was due to hyperventilation in alveolus with well - perfusion and hypoperfusion of well ventilated alveolus in patients with right heart failure. the lower petco2 could explain the higher ve / vco2 in patients with right heart failure. the higher ve / vco2 showed that right heart failure patients had lower ventilation efficiency. this result means that there was no difference in v / q mismatching at rest in the 2 groups. petco2 was lower in both chf and pah, reflecting the ventilation impairment [3,8,2025 ]. we found that right heart failure patients had a lower petco2 during exercise (table 3). the reason for the lower peak petco2 during exercise in patients with right heart failure was similar to the reason for lower petco2 at rest. sun. found that patients with pah had an eis resulting in abrupt decreased petco2, had increased peto2, and increased ve / vco2 ratio during exercise. the abrupt curve of right heart failure demonstrated that patients with right heart failure had eis (figure 1b). we found that patients with right heart failure had significantly higher peak vd / vt ratio (table 3). figure 1c shows that most patients with right heart failure had a lower peak petco2 and a higher ve / vco2 slope. these results demonstrate that patients with right heart failure had severe v / q mismatching at peak exercise. this means that primary pulmonary vesicular damage played a greater role in v / q mismatching during exercise than did pulmonary congestion. moreover, the eis was involved in the higher vd / vt in patients with right heart failure. ve / vco2 and ve / vco2 slope are important to reflect disease severity and prognosis in chf and pah, and reflect v / q mismatching in pah. we found that peak ve / vco2 and ve / vco2 slope were higher in patients with right heart failure. these results demonstrate that patients with right heart failure had more severe ventilation inefficiency and gas exchange abnormality compared to patients with left heart failure. these results were due to lower peak petco2 and higher peak vd / vt in right heart failure patients. we found that patients with right heart failure had higher absolute values of petco2 and ve / vco2 from rest to peak exercise (table 2 and 3). these results show that right heart failure patients had larger changes of pulmonary function from rest to exercise. the larger change of petco2 demonstrates that patients with right heart failure had more severe hyperventilation from rest to exercise. this should be attributed to more complex ventilation drive in pah, including exercise - induced hypoxia and eis. we found that patients with right heart failure had worse ventilation efficiency, severe v / q mismatching, and gas exchange abnormality, even without differences in peak vo2. it was a single - center study and demographic differences were detected between the 2 groups. the etiology of heart failure in the 2 groups resulted in differences of sex and age. because there was no control group, we could not confirm a normal breathing pattern at rest. we could not perform invasive hemodynamic testing in all patients, which influenced our evaluation of left heart failure. we merged the 4 disease classes into 2 groups because there were not enough patients with class iv nyha right heart failure. the differences in pulmonary function at rest were due to different breathing patterns and worse gas exchange in patients with right heart failure. the differences during exercise were due to severe v / q mismatching, eis, alveolar ventilation disorder, and oxygenation dysfunction secondary to pulmonary vascular damage in patients with right heart failure. | backgroundpulmonary abnormalities are found in both chronic heart failure (chf) and pulmonary arterial hypertension (pah). the differences of pulmonary function in chronic left heart failure and chronic right heart failure are not fully understood.material/methodswe evaluated 120 patients with stable chf (60 with chronic left heart failure and 60 with chronic right heart failure). all patients had pulmonary function testing, including pulmonary function testing at rest and incremental cardiopulmonary exercise testing (cpx).resultspatients with right heart failure had a significantly lower end - tidal partial pressure of co2 (petco2), higher end - tidal partial pressure of o2 (peto2) and minute ventilation / co2 production (ve / vco2) at rest. patients with right heart failure had a lower peak petco2, and a higher peak dead space volume / tidal volume (vd / vt) ratio, peak peto2, peak ve / vco2, and ve / vco2 slope during exercise. patients with right heart failure had more changes in petco2 and ve / vco2, from rest to exercise.conclusionspatients with right heart failure had worse pulmonary function at rest and exercise, which was due to severe ventilation / perfusion (v / q) mismatching, severe ventilation inefficiency, and gas exchange abnormality. |
amyotrophic lateral sclerosis (als) is a slowly progressive neurodegenerative disorder with no known curative treatments. respiratory insufficiency is a critical problem, and earlier administration of non - invasive ventilation (niv) prolongs the survival of als patients (1). diaphragm pacing (dp), which was initially developed for patients with spinal cord injury (2), was considered to be useful and safe as niv for als patients (3). pre - clinical studies suggested an acceptable tissue response with full - time stimulation that would present a minimal risk to patients (4). we herein present a 63-year - old japanese autopsy - proven als patient who underwent electrical dp. the patient, who had no remarkable past or family history, was a 60-year - old man. he noticed mild weakness in his left arm followed by a weakness in his right arm and atrophy of the right hypothenar muscle. at 62 years of age, he developed left leg weakness and was diagnosed with definite als according to the world federation of neurology el escorial criteria. we administered riluzole and implanted the neurx ra/4 diaphragm pacing system (neurx, synapse biomedical, oberlin, oh, usa) laparoscopically under general anesthesia according to previous reports (5,6). namely, the diaphragm was exposed, the phrenic nerve motor point was mapped, pacing electrodes were implanted, and finally the wires were routed to the external pulse generator. two pacing electrodes were placed on the motor points of the diaphragm on each side and intraperitoneal electrodes had sufficient length to prevent them from being accidentally removed. spontaneous breathing and diaphragm contraction with pacing were independent because neurx does not trigger spontaneous breathing. the implantation of neurx was approved by the review board of tokushukai medical alliance, and the patient provided written informed consent in accordance with the declaration of helsinki before implantation. the patient did not desire other niv or feeding through gastrostomy throughout the course. despite dp, he died at 63 years of age, 43 months from the onset and 338 days (11.1 months) after dp implantation, due to respiratory failure. stimulation parameters were set at : frequency, 12 hz ; pulse width, 150 sec ; and intensity, 17 ma (fig. the patient s respiratory function deteriorated with co2 accumulation despite dp (mip : maximal inspiratory pressure). the prefixed brain weighed 1,510 g, while the spine weighed 55 g without any apparent abnormal appearance except for moderate atherosclerotic changes in the basilar artery. there were no marked abnormalities in the trachea or lungs, however, the diaphragm showed severe atrophy. several adhesions between the dp electrodes and diaphragm were observed adjacent to the tip of the dp electrodes (fig. a microscopic examination revealed a marked loss of motor neurons in the anterior horn, particularly in the upper cervical cord, and primary motor cortex with glial proliferation. cytoplasmic inclusions of phosphorylated tar dna - binding protein of 43 kda (tdp-43) were observed in the primary motor cortex, medulla oblongata, cervical cord, and lumbar cord. mild hyalinization and a few multinucleated giant cells were present around the electrode tracks in the diaphragm. however, the infiltration of mononuclear cells around the tracks was not observed (fig. several localized adhesions of electrodes are indicated (arrows ; bar=10 mm), b : hematoxylin and eosin staining of the diaphragm (magnification 100). a multinucleated giant cell was detected (arrow), however, the infiltration of mononuclear cells around the track was not observed. the prefixed brain weighed 1,510 g, while the spine weighed 55 g without any apparent abnormal appearance except for moderate atherosclerotic changes in the basilar artery. there were no marked abnormalities in the trachea or lungs, however, the diaphragm showed severe atrophy. several adhesions between the dp electrodes and diaphragm were observed adjacent to the tip of the dp electrodes (fig. a microscopic examination revealed a marked loss of motor neurons in the anterior horn, particularly in the upper cervical cord, and primary motor cortex with glial proliferation. cytoplasmic inclusions of phosphorylated tar dna - binding protein of 43 kda (tdp-43) were observed in the primary motor cortex, medulla oblongata, cervical cord, and lumbar cord. mild hyalinization and a few multinucleated giant cells were present around the electrode tracks in the diaphragm. however, the infiltration of mononuclear cells around the tracks was not observed (fig. several localized adhesions of electrodes are indicated (arrows ; bar=10 mm), b : hematoxylin and eosin staining of the diaphragm (magnification 100). a multinucleated giant cell was detected (arrow), however, the infiltration of mononuclear cells around the track was not observed. according to the results of a multicenter study (7), the us food and drug administration approved neurx for humanitarian device exemption in 2011 (8). the pilot study in the us concluded that dp with neurx for als patients did not show any safety issues and positively influenced the movement of the diaphragm and the survival (3). contrary to previous reports in the us (3,7), a randomized, -controlled trial in the uk concluded that the combination of niv and dp with neurx was less effective than niv alone for the survival (9). the period from dp to death of our patient was longer than the dp alone group in the uk study and similar with that of the niv plus dp group (table). however, as our patient did not use other niv, the concomitant use of niv, such as bipap, could prevent co2 accumulation to extend the period from dp to death. on the other hand, the heterogeneity of clinical features and course of als might influence the different results observed in these clinical trials. the strong need for new international guidelines for clinical trials of als was recently proposed (10). a post - mortem pathological study in als patients with neurx has not yet been reported. to the best of our knowledge, this is the first autopsied case of an als patient who underwent dp with neurx. our pathological findings suggested that dp with neurx might have no safety issues regarding the adjacent diaphragm tissue. as adhesions in the diaphragm were limited, they would not likely cause significant respiratory failure. however, we might have to use absorbable adhesion barriers to reduce the incidence and severity of postoperative adhesions because they could restrict the movement of the diaphragm (11). the clinical efficacy of dp with neurx for als patients has not yet been elucidated. further pathological evaluations in more patients are warranted to verify the safety and efficacy of dp with neurx for als patients. | respiratory insufficiency is a critical problem in amyotrophic lateral sclerosis (als) patients. we herein present the case of an autopsied patient with sporadic als who underwent diaphragm pacing (dp). the pathology showed several localized adhesions with a markedly atrophied diaphragm. a marked loss of motor neurons with bunina bodies and phosphorylated tdp-43 positive inclusions was found in the spinal cord and primary motor cortex. mild hyalinization and a few multinucleated giant cells were present around the electrode tracks in the diaphragm. however, no infiltration of inflammatory cells was detected. our findings suggest that full - time dp might not cause severe damage to adjacent diaphragm tissue. |
Subsets and Splits
No saved queries yet
Save your SQL queries to embed, download, and access them later. Queries will appear here once saved.