article
stringlengths 0
682k
| abstract
stringlengths 146
3.69k
|
|---|---|
polytrauma patients with pelvic fractures challenge the surgeon 's diagnostic, operative, and peri - operative management skills, especially because of the frequent associated injuries to the abdominal viscera. the use of an external fixator for the initial and, in some cases, the definitive fixation of unstable, complex pelvic injuries with hemodynamic instability is effective for multiply injured patients. we present a documented case of small bowel entrapment in a sacral fracture stabilized with an external fixator. a 51-year - old man, with no medical history of note, was in a motorcycle accident. in the emergency room, he presented with hemodynamic instability due to a pelvic fracture and a concomitant catastrophic soft tissue injury involving the scrotum, perineum, and anus with absence of the anal reflex. the pelvis x - ray showed ischiopubic and ileopubic fractures associated with symphyseal disruption (anterior posterior fracture apii, see young and burgess). after the resuscitation phase, the patient underwent full - body computed tomography (ct) [figure 1 ] and was subsequently transferred to the operating theater. the white vertical arrow indicates the sacral fracture pelvis x - ray showing the external screws an exploratory laparotomy was performed to exclude abdominal organ damage, and a loop colostomy was performed for the anal incompetence. then, the patient was admitted to our intensive care unit (icu), where no bowel function was observed for the first 6 post - operative (po) days. on po day 7, the patient presented with abdominal distension, elevated inflammatory indices, and fever, so we performed abdominal ct with oral and intravenous contrast looking for signs of intestinal obstruction. the clinical hypothesis of obstruction was confirmed by the presence of numerous dilated small bowel loops with air / fluid levels ; ct showed an ileum segment trapped in the sacral fracture [figure 3 ]. the white horizontal arrow shows the ileum segment trapped in the sacral fracture the patient underwent an exploratory laparotomy that confirmed the cause of the obstruction ; a small bowel resection and an end - to - end manual anastomosis were thus performed. the second post - operative period was uneventful, and the patient was discharged from the icu to a ward. an evaluation of the rectal sphincter showed normal function ; therefore, after the peroneal wound healed, the colostomy was closed. injured arteries, veins, and bony structures are all likely sources of blood loss. angio - embolization is the accepted method for treating arterial bleeding, while reduction and stabilization with external fixation or other methods are considered the most appropriate for controlling blood loss from veins and bony surfaces. the risk of hemorrhage makes major pelvic fractures one of the most serious skeletal injuries, with substantial mortality. in addition, pelvic fractures are often associated with other major injuries, which can contribute to an increased mortality. the mortality following pelvic fractures has declined radically since introduction of more effective methods of controlling hemorrhages and general trauma management. hemorrhage control, fracture stabilization, and infection prophylaxis in cases of open fracture can be achieved with the placement of schanz screws. post - traumatic bowel entrapment was first described in 1907. since then, there have been only occasional reports in the literature. in a literature review, stubbart and merkley documented 19 similar cases. the diagnosis of entrapment is often difficult and delayed. with the introduction of multi - detector ct and the associated reformatting capabilities patients with pelvic fractures and disruptions have usually sustained high - energy trauma and have myriad other possible reasons for symptoms of ileus, obstruction, perforation, or intra - abdominal problems. bowel injury associated with pelvic fractures or the surgical treatment thereof is relatively rare and is consequently not always ranked highly in the differential diagnosis. as with our case, most cases of distension and nausea post - pelvic fracture are thought to be due to adynamic ileus and not to mechanical obstruction. hurt. stated that such ileus usually lasts 5 days, but can persist longer than 2 weeks. reported cases of bowel entrapment in pelvic fractures, especially in sacral fractures, are exceedingly rare. in most situations, the iliac and psoas muscles serve as buffers between the abdominal contents and posterior pelvic ring injury, protecting the peritoneum from injury and preventing the bowel from communicating with the fracture site. although accurate prediction and prevention of this type of complication might be impossible, earlier recognition and proper treatment are reasonable ways to obtain good results. the diagnosis is often delayed due to the difficulty distinguishing entrapment from the more common adynamic ileus. therefore, all general surgeons who care for patients with pelvic injuries should be conscious of this potential complication and consider it in their workup of patients with post - operative abdominal symptoms after major pelvic trauma or subsequent pelvic surgery, especially in patients treated with a percutaneous technique that prevents direct visualization of the fracture and abdominal or pelvic contents. in conclusion, clinicians and radiologists should be aware of this potentially lethal complication of pelvic fractures treatment. to exclude bowel entrapment, patients with a persistent ileus or sepsis | the use of external fixation for the initial treatment of unstable, complex pelvic injuries with hemodynamic instability remains an effective treatment for multiply injured patients. bowel entrapment within a pelvic fracture is a rarely reported, potentially fatal complication. here, we report a polytrauma patient with pelvic fractures who developed an intestinal obstruction after an external fixation. at an explorative laparotomy, we found an ileum segment trapped in the sacral fracture. reported cases of bowel entrapment in pelvic fractures, especially in sacral fractures, are exceedingly rare. the diagnosis is often delayed due to difficulty distinguishing entrapment from the more common adynamic ileus. in conclusion, clinicians and radiologists should be aware of this potentially lethal complication of pelvic fractures treatment. to exclude bowel entrapment, patients with persistent ileus or sepsis should undergo early investigations. |
falls and fractures are intimately linked and are major causes of morbidity and mortality in older people. previous fall and/or fracture are the most important risk factor for further events;1 therefore, secondary prevention programs for falls and fractures are highly needed. although falls clinics have been established as a model of care for falls management and prevention among the elderly, there is not a widely accepted definition or standard model for a falls clinic in the research literature. specialist multidisciplinary services, which focus on the assessment and management of clients with falls, mobility and balance problems. clinics commonly provide time limited, specialist intervention to the client and advice and referral to mainstream services for ongoing management. they provide education and training to clients, to carers, and to health professionals.2 since the late 1980s, falls clinics have been gaining momentum as an integrated model for falls prevention around the world. the first multidisciplinary falls clinic was set up in melbourne, australia in 1988.2 subsequently, the number of falls clinics has increased substantially since the late 1990s including australia,14 usa,58 uk,9 france,10 denmark,11 spain,12 hong kong,13 canada,14 germany,15 and the netherlands.16 in contrast, in latin america the information related to falls clinics is scarce with reports only from brazil and colombia.17,18 overall, these programs offer a comprehensive assessment and varied interventions focused on falls prevention in older persons without taking into consideration bone health assessment. in fact, until 2000 it was a common practice not to include any assessment to evaluate osteoporosis risk or to perform bone mineral density in falls prevention trials. as a consequence, osteoporosis risk assessment was not considered as part of a major falls prevention guideline.19 in 2001, the national health service in the uk established the national service framework for older people, a comprehensive strategy to ensure fair, high quality, integrated health and social care services for older people. the national service framework set out standards for specialized and integrated falls services to improve care and treatment for those who have fallen and, for the first time, included interventions to prevent and treat osteoporosis in those at high risk. following these guidelines, there was an increasing understanding of the natural association between falls and fractures and thus a proposal to incorporate a routine bone health assessment as part of a comprehensive assessment for falls and fractures risk in older persons was suggested.20 however, little operational guidance was provided until a review and clinical guideline undertaken by the national health service policy body, the national institute for health and clinical excellence (nice), was published in 2004.21 in those guidelines, nice suggested that specialist falls services should be operationally linked to bone health (osteoporosis) services and recommended that an osteoporosis risk assessment should be an essential element of a comprehensive falls assessment.21 since the release of these guidelines, the number of falls clinics that integrates a bone health component has grown exponentially, particularly at university hospitals.13,14,16 however, standardizing these programs and making them efficient in different cultures and practices is still a challenge. another remaining question is whether the model should remain as falls prevention alone or should be combined with fracture prevention. therefore, the aim of this study was to identify similarities and differences between a falls and a falls and fractures clinic in colombia and australia, respectively. characteristics of the services were compared using an internationally agreed taxonomy. here, major similarities as well as easy to unify variations between these complementary models implemented in the two countries are reported. in sydney, australia the falls and fractures clinic at nepean hospital in penrith began operation in october 2008 as an initiative of both the discipline of geriatric medicine at sydney medical school nepean and the department of geriatric medicine at nepean hospital. its primary aim was to reduce falls and falls - related injuries among older people in the western sydney community after suffering one or multiple falls and/or fractures. in manizales, (colombia) the falls, dizziness, and vertigo clinic at the local geriatric hospital was implemented in april 2001 as an initiative of the section of geriatric medicine of the faculty of health at the university de caldas. in addition to the aim of reducing falls among older people in the andes mountains community, this clinic s aim was to ameliorate dizziness symptoms in older fallers. the analysis was designed to explore and compare the organizational structure and clinical operations of both clinics. evaluated items were either taken from prior research on australian falls clinics2 or were developed specifcally for this study with emphasis on falls and fracture assessment and care of patients. the questionnaire assessed characteristics of organization, administration, clients, and interventions provided at both clinics. items that surveyed program organization included : date of commencement, setting of recruitment and assessment, frequency and duration of each assessment session, and referral sources. administration items surveyed the number of attended patients, number of staff, staffing structure, time for initial assessment, waiting time for service, and percentage of attrition. the age, proportion of men and women, and eligibility criteria were surveyed to compare the clients in the two countries. directors were asked to indicate the process of assessment and reassessment procedures and the types of intervention provided. in addition, data was collected on risk status identification, outcomes measured, and postintervention follow - up procedures. it also assessed whether interventions were provided by the local service or by referral to other services, referral routes, and relationships to other local facilities and services. to make the comparison easier and to develop a common language to compare the characteristics of the clinics, the prevention of falls network europe (profane) taxonomy of falls prevention interventions was used.24 the implementation of nice recommendations a summary of organization, administration, clients, and interventions at both clinics is shown in table 1. concerning organization aspects, the setting was an acute hospital in australia and a subacute geriatric hospital in colombia. the programs in the two countries operated with the same frequency and duration (4 hours per week). the most common method of entry into the service was a referral from a health care professional : a general practitioner in australia and a specialist (geriatrician, physiatrist, otolaryngologist, and rheumatologist) in colombia. in addition, both services accepted referrals from acute hospitals, although mostly from emergency department and orthopedic / geriatric wards in australia. in colombia, referrals from nursing care facilities were also accepted. the number of clients attending the program and the number of patients attending per week was higher in the australian program than in colombia (average number of six versus three patients per session). in terms of staff, clinical staff in australia was twice that in colombia. however, in both clinics the staffing structure was a multidisciplinary team composing of a physiotherapist, nurse, occupational therapist, and a physician. at both clinics, members of the interdisciplinary team were engaged in discussions related to assessment tools and program planning over 1-year period prior to the establishment of the corresponding clinic. the mean length of the initial assessment was similar at both clinics (2 hours per patient). the mean age of clients was higher in australia than in colombia (82 versus 74 years). there were similar proportions of men and women attending the clinics with at least two - thirds being female. the main eligibility criteria for australian clients were falls and/or fractures (at least one episode in the previous year), whereas for colombian clients the criteria were a report of falls and/or dizziness. in terms of interventions although both programs offered similar care plans in terms of falls prevention, the australian program was more likely to prescribe vitamin d supplementation while the colombian program was more likely to indicate individual supervised gentle balance exercises at home. the australian program was directed at managing falls and fractures while the colombian program was focused on managing dizziness and falls. a similar proportion of disciplines was included in the multidisciplinary assessment team and similar assessment tools were employed. while the australian program included bone health assessment, the initial assessment at both clinics consists of a comprehensive fall risk assessment, including a structured algorithm adapted from the assessing care of vulnerable elders (acove) intervention to identify risk factors for falls.23 recommendations for management are generated at an interdisciplinary meeting. each patient also receives education consisting of written materials about falls prevention, physical activity, and home safety. bone fragility fracture risk assessment was performed using the world health organization s fracture risk assessment tool (frax) in australia but not in colombia. high - risk status identification assessment for falling was similar in both programs. if additional interventions were needed, referral to other services was recommended. the postintervention follow - up procedures were similar in both countries with the same interdisciplinary team reassessing the clients. this exploratory comparative analysis of two clinics in australia and colombia has revealed several similarities as well as differences. both programs serve older people who are very similar in terms of age, gender, and geography (mountainous areas). in addition, the multifactorial assessment and intervention model utilized in both countries closely follows previously recommended models for falls clinics.2,3 for identification of high - risk status for falls, both programs use the indicators developed by the acove program.23 the similarity of these findings suggests that both models could become a convergent solution to the problems associated with falling in an aging population. falls are relatively common in both countries with similar prevalence : 28%39% of people aged over 65 years experiencing at least one fall annually and up to 50% experiencing multiple falls.24,25 overall, falls clinics have demonstrated a substantial reduction (35%77%) in falls in high - risk populations and improvements in other outcomes such as balance and mobility, physical functioning, and fear of falling.3 therefore, these clinics represent an approach that provides specialized services for this common geriatric syndrome in developed and in developing countries.6,9,10,15,18 besides the overall similarities, there were1 several differences between the australian and colombian models. the first source of difference was the type of patients seen at each site in terms of race (mostly caucasian in australia and mostly mestizo population in colombia), nutritional status (higher body mass index in australia), and level of education (secondary degree in most of the australian population and in just half of the colombian population).27 another difference was the criteria for eligibility with falling associated or not with a fragility fracture being the priority in australia while falling associated with dizziness being the main focus in colombia. this could be explained by higher access for orthopedic/ geriatric wards in australia as well as the role of the recently implemented orthogeriatric model of care.26 on the other hand, the prevalence of dizziness in colombia was reported to be 15.2% in the older population and associated with more prevalent chronic conditions and physical and sensory impairments.27 therefore, the falls clinic in the colombian program was established in conjoint with an otolaryngology service as interdisciplinary care to solve problems of older people with falls associated with dizziness.18 the second difference was the most common type of intervention prescribed at each clinic. although the multi - component program was similar in both countries, the most common type of intervention differed. although australia has sunny weather for most of the year, it still can not boast a vitamin d - safe population.28 reasons for this are that lifestyles for many older people, particularly women, are increasingly associated with indoor activities and with foods not being fortified for vitamin d in australia. taken together, there is a high prevalence of vitamin deficiency in this particular western sydney population (45%),29 thus a high level of vitamin d supplementation is required in this population. in colombia, the falls clinic prioritized gentle balance exercise interventions at home due to the fact that despite 98% of colombian older adults know about the benefits of exercise only 5% exercise every day.30 nevertheless, despite each clinic prioritizes a particular intervention for their target population, the whole comprehensive approach used at both settings is similar (figure 1) and includes balance exercise, patient education, nutritional supplements, medication review, hearing and vision correction, and home modification. overall, these evidence - based multifactorial interventions31 should constitute the key elements of any secondary prevention program for falls in older persons. in terms of integrating the fracture prevention component, at the australian clinic, fragility fracture risk is evaluated by clear identification of risk factors for fractures, quantification of absolute risk of fracture using frax (a fracture risk assessment tool that is not widely used in colombia), and by bone mineral density measurement. fracture risk assessment is followed by fracture prevention interventions such as osteoporosis treatment, calcium and vitamin d supplementation, and identification and treatment of secondary causes of bone loss. taken together, both programs are using a similar approach to two very prevalent problems in older people. however, components of the suggested models of nice22 and acove23 that are considered the optimal practice for falls and fractures prevention are at different degrees of implementation in both countries. nevertheless, a common evaluation of the processes at both clinics allows a comprehensive revision of the processes and assessment tools and could constitute an initial step to developing an integrated model of secondary prevention of falls and fractures that could be implemented in both developed and developing countries worldwide. based on this comparison, the authors propose that falls clinic services should be operationally linked to osteoporosis services as a falls and fracture prevention clinic, which would facilitate a comprehensive intervention to prevent falls and fractures in older persons. finally, more intensive studies are needed to gain a better understanding of how falls and fractures clinics operate and to identify more precisely their benefits and limitations. finally, further evaluation with a randomized controlled trial is required to confirm the effectiveness and cost - effectiveness of this model of care. | falls and fractures are major causes of morbidity and mortality in older people. more importantly, previous falls and/or fractures are the most important predictors of further events. therefore, secondary prevention programs for falls and fractures are highly needed. however, the question is whether a secondary prevention model should focus on falls prevention alone or should be implemented in combination with fracture prevention. by comparing a falls prevention clinic in manizales (colombia) versus a falls and fracture prevention clinic in sydney (australia), the objective was to identify similarities and differences between these two programs and to propose an integrated model of care for secondary prevention of fall and fractures. a comparative study of services was performed using an internationally agreed taxonomy. service provision was compared against benchmarks set by the national institute for health and clinical excellence (nice) and previous reports in the literature. comparison included organization, administration, client characteristics, and interventions. several similarities and a number of differences that could be easily unified into a single model are reported here. similarities included population, a multidisciplinary team, and a multifactorial assessment and intervention. differences were eligibility criteria, a bone health assessment component, and the therapeutic interventions most commonly used at each site. in australia, bone health assessment is reinforced whereas in colombia dizziness assessment and management is pivotal. the authors propose that falls clinic services should be operationally linked to osteoporosis services such as a falls and fracture prevention clinic, which would facilitate a comprehensive intervention to prevent falls and fractures in older persons. |
the prevalence of obesity has increased dramatically in recent decades both in the united states and abroad. today, it is estimated that as many as 34% of women of reproductive age are obese (bmi 30 kg / m). studies have consistently shown a significant association between obesity and adverse pregnancy outcomes [24 ]. specifically, obesity increases the risk of miscarriage, gestational diabetes, hypertensive complications, infections, postterm pregnancy, and cesarean section delivery [59 ]. additionally, obesity is associated with numerous fetal risks including congenital anomalies, macrosomia, and perinatal morbidity and mortality [6, 7, 1012 ]. however, it remains unclear whether obesity by itself, independent of diabetes and hypertension, is a predictor of adverse pregnancy outcome. a number of studies have provided indirect data suggesting a possible causal association between maternal adiposity and pregnancy complications. endocrine abnormalities associated with obesity, that is, increased levels of insulin, androgens, and leptin, have been incriminated [1316 ]. in fact, adipose tissue appears to be an active endocrine organ that secretes several proinflammatory cytokines, which may result in endothelial dysfunction in the mother and placenta and ultimately lead to adverse pregnancy outcome [1316 ]. have demonstrated that obesity in pregnancy results in an exaggerated inflammatory response in the placenta with accumulation of multiple subsets of macrophages and production of proinflammatory mediators. we hypothesize that the inflammatory and altered endocrine milieu in which the fetus develops may have detrimental consequences on fetal well - being. in this study, we investigate the impact of obesity on fetal well - being, as assessed by fetal blood gas parameters (bgps), in a retrospective cohort of glucose - tolerant and nonhypertensive women. to the best of our knowledge, this is the first systematic assessment of the impact of obesity per se on umbilical artery bgp. we searched our prospectively maintained database for all patients admitted to the labor and delivery department in our institution between january, 2011 and july, 2011. patients with comorbidities (diabetes or hypertension) or conditions that could influence fetal bgp were systematically excluded from the analysis. exclusion criteria were as follows : hypertension or pregnancy - induced hypertension ; preeclampsia ; diabetes, gestational diabetes or impaired glucose tolerance ; active smoking or drug use ; any medical comorbidity including congestive heart failure, chronic kidney disease, or chronic respiratory disease ; placental abruption ; chorioamniointis ; nonreassuring fetal heart rate patterns ; emergency cesarean section delivery ; vacuum extraction delivery ; shoulder dystocia ; multiple pregnancy ; preterm birth ; and congenital abnormality. because the study was designed to compare obese to normal weight patients with regard to bgp, overweight patients (bmi 2529.9 kg / m) were excluded from the analysis. medical charts and laboratory results were carefully reviewed to determine patient 's age, race, bmi, gravity, parity, number of prenatal visits, gestational age at delivery, mode of delivery, number of previous cesarean section deliveries, group b streptococcal colonization, umbilical artery ph, po2, pco2 and base deficit, and apgar score at 1 and 5 minutes. patients were divided into 2 groups based on their prepregnancy bmi as follows : normal weight (< 25 kg / m, n = 50) and obese (30 kg / m, n = 50). gbs colonization was marked as positive if any of the vaginal, anal, or urine cultures were positive at anytime. a comparative analysis of bgp between the normal weight group and the obese group was conducted. data are presented as mean and standard deviation for continuous variables and as frequency for categorical variables. statistical analysis of categorical variables was carried out using chi - square and fisher 's exact tests as appropriate. this study would have 99% power to detect a mean difference of 10 in base excess (type i error 5%) and 70% power to detect a mean difference of 5 (type i error 5%). all statistical analyses including sample size calculation were performed usingspss(ibm corporation, armonk, ny, usa). a total of 100 patients (50 lean and 50 obese) were included in the study. bmi was 20.9 2.1 kg / m on average in the normal weight group and 35.7 5.0 kg / m in the obese group. there were no significant differences between the 2 groups with respect to all baseline characteristics except for parity (table 1). mean age was 25 6.9 years in the normal weight group versus 26.9 6.6 years in the obese group (p = 0.25). hispanic patients accounted for 70% (n = 35) of the normal weight group versus 66% (n = 33) of the obese group (p = 0.67). a cesarean section was performed in 22% (n = 11) of normal bmi patients compared to 28% (n = 14) of obese patients (p = 0.49). eight (16%) lean patients and 9 (18%) obese patients tested positive for gbs (p = 0.79). there were no significant differences in any of the umbilical artery bgp between the two groups. ph and pco2 were, respectively, 7.26 0.06 and 54.61 10.3 mmhg on average in the normal weight group versus 7.26 0.08 (p = 0.95) and 55.12 13.9 mmhg (p = 0.83) in the obese group. mean umbilical artery po2 was 25.7 9.8 mmhg in lean patients versus 23.7 8.9 mmhg in obese patients (p = 0.48). newborns of lean patients had a 3.74 1.8 mmol / l base deficit on average compared with 3.77 2.4 mmol / l for newborns of obese patients (p = 0.79). mean apgar scores at 1 and 5 minutes were, respectively, 8.78 0.5 and 9.08 0.4 for newborns of lean patients versus 8.72 0.6 (p = 0.62) and 9.14 0.4 (p = 0.46) for newborns of obese patients. similarly, pearson 's correlation coefficient did not reveal any significant correlation between bmi and bgp or apgar scores (table 2). it is thought that obesity increases the risk of maternal and fetal complications mainly through its association with diabetes, hypertension, and other comorbid conditions. thus, we excluded these potentially confounding factors from the analysis and investigated the impact of obesity per se on fetal well - being, namely, umbilical artery bgp and apgar scores. furthermore, because overweight is regarded as an intermediate state between normal weight and obesity, such patients were excluded from the analysis. despite a well - matched study population for baseline characteristics, we did not find any significant difference between obese and lean patients with respect to bgp or apgar scores. our results suggest that obesity may not affect fetal well - being in patients with no comorbidities such as gestational diabetes or hypertension. only a few studies have investigated the association between obesity per se and pregnancy outcome. in a recent large study, owens and colleagues examined the impact of obesity on pregnancy outcome in 2329 glucose - tolerant women. they found an increased incidence of cesarean deliveries, hypertensive complications, miscarriages, macrosomia, shoulder dystocia, and congenital malformations in obese women as compared to normal weight women. however, the authors did not assess the impact of bmi on umbilical artery bgp. moreover, patients with hypertension or gestational hypertension were not excluded from the analysis which could have introduced bias into the study, especially given the established association between obesity and hypertension - related pregnancy complications. in another large study, jensen and colleagues assessed the relationship between prepregnancy bmi and pregnancy outcome in 2459 glucose - tolerant danish women. the risk of cesarean section, induction of labor, hypertensive complications, and macrosomia was significantly increased in obese women compared with normal weight women. more importantly, however, the frequencies of shoulder dystocia, preterm delivery, and infant morbidity other than macrosomia were not significantly associated with maternal bmi. these findings are in line with the results of our study and suggest that obesity may not increase infant morbidity in the absence of diabetes or other comorbidities. the effect of obesity on umbilical artery bgp (among other variables) the authors reported no difference between obese and lean patients with regard to umbilical ph or apgar scores. although the results of this study are in line with our findings, patients with diabetes / impaired glucose tolerance or hypertension were not excluded from the analysis which precludes any confident conclusion as to the impact of obesity, as an independent factor, on bgp and apgar scores. the limitations of this study stem primarily from its retrospective design, small sample size, and the absence of randomization. although patients with nonreassuring fetal heart rate patterns (category iii tracing) and vacuum extraction delivery were excluded, the influence of labor on the acid base status of the newborn may not have been completely controlled for in this study. we found no relation between maternal bmi per se and umbilical artery bgp in a retrospective cohort of 100 patients. thus, obese women who are glucose - tolerant and nonhypertensive may not be at increased risk of perinatal morbidity. larger prospective studies are needed to confirm the absence of association between obesity and fetal well - being parameters. | this study was undertaken to assess the impact of obesity on fetal well - being in glucose - tolerant and nonhypertensive women. medical charts of all patients admitted to the labor and delivery department at our institution between january, 2011 and july, 2011 were retrospectively reviewed. patients with diabetes / impaired glucose tolerance or hypertension were excluded. a total of 100 women, 50 lean and 50 obese, were included. umbilical artery blood gas parameters (bgps) were compared in lean (< 25 kg / m2) and obese (30 kg / m2) women. obese and lean women were comparable with respect to all baseline characteristics. there was no difference in any of the bgp or apgar scores between obese and lean patients. pearson 's correlation coefficient found no significant correlation between bmi and bgp / apgar scores. maternal obesity does not seem to affect bgp and fetal well - being in glucose - tolerant and nonhypertensive women. |
vertebrate telomeres are essential nucleoprotein structures that protect chromosome ends from promiscuous dna repair activities and nucleolytic degradation (for review, see de lange, 2005). telomeric dna is composed of repetitive double - stranded ttaggg sequences that extend into a 3 single - stranded overhang on the g - rich strand (moyzis., 1988 ; wellinger., telomeric repeats can be extended by telomerase, a reverse transcriptase that utilizes an associated rna moiety (terc) as a template to add de novo telomeric sequences to the 3 end of the g - rich strand of the telomere (greider and blackburn, 1985 ; shippen - lentz and blackburn, 1990). telomere function is also critically dependent on a complex formed by six telomere - associated proteins, known as shelterin, which comprises trf1 (telomere repeat binding factor 1), trf2 (telomere repeat binding factor 2), pot1 (protection of telomeres 1), tin2 (trf1-interacting nuclear factor 2), rap1 (repressor activator protein 1), and tpp1 (tinf2-interacting protein 2) that function to safeguard chromosome ends from the dna damage response (ddr) and to control telomere maintenance by telomerase (for review, see palm and de lange, 2008). shelterin associates with telomeres by virtue of intrinsic duplex telomeric repeat binding conferred by trf1 and trf2 and binding of the single - stranded telomeric 3 overhang by pot1 (baumann and cech, 2001). while trf1 promotes telomere replication and functions as a negative regulator of telomere length (sfeir., 2009), trf2 plays a crucial role in telomere end protection (van steensel., 1998). consequently, loss of trf1 compromises telomere replication, giving rise to telomere fragility, whereas loss of trf2 results in loss of the 3 overhang and extensive chromosome end - to - end fusions (celli and de lange, 2005 ; sfeir., electron microscopy and stochastic optical reconstruction microscopy have revealed that telomeres can adopt lasso - like configurations called t - loops (doksani., 2013 ; griffith., 1999), which are believed to form as a result of strand invasion of the 3 single - stranded telomeric dna into upstream duplex ttaggg repeats (griffith., 1999 as the 3 end of the telomere is buried within the t - loop, this structure has been proposed to safeguard the chromosome ends against nucleolytic attack or promiscuous dna repair activities (for review, see osullivan and karlseder, 2010). the amino - terminal basic domain of the shelterin component trf2 is important for stabilizing t - loops and acts to protect the structure from unscheduled nucleolytic processing (wang., 2004). trf2 is also essential for t - loop formation in vivo (doksani., 2013), which likely contributes to its key role in end protection. mechanisms must also exist to disassemble t - loops to allow telomerase access to the 3 end and/or to avoid collisions with the replisome during s phase. rtel1 (regulator of telomere length 1) (ding., 2004) is an essential helicase with intrinsic d - loop - disrupting activity that is co - opted to telomeres to dismantle t - loops (uringa., 2012). in the absence of rtel1, t - loops are inappropriately resolved by the slx1-slx4 nuclease complex, leading to catastrophic telomere length changes and loss of the telomere as double - stranded telomere circles (t - circles or tcs) (vannier., 2012). rtel1 also executes a second function to counteract the formation of telomeric guanine quadruplex (g4) dna structures during telomere replication, which are a major source of telomere fragility (vannier., direct binding of rtel1 to proliferating cell nuclear antigen (pcna) is critical for preventing telomere fragility but is dispensable for t - loop disassembly (vannier., 2013). the importance of rtel1 in human disease has been established with the identification of variants that confer increased risk of human brain tumors (shete., 2009 ; wrensch., mutations in rtel1 also give rise to hoyeraal - hreidarsson syndrome (hhs), a severe form of the telomereopathy dyskeratosis congenita (dkc ; for review, see vannier., 2014). hhs is characterized by its similarity to dkc, but patients also present with additional complications including bone marrow failure, microcephaly, and immunodeficiency (vulliamy., 2006). so far, 18 distinct rtel1 mutations have been identified in hhs (for review, see vannier., 2014), but how these mutations impact on the known functions of rtel1 is not known. here, we define the mechanism by which rtel1 is recruited to telomeres to promote t - loop disassembly, which we show is dependent on an s phase - specific interaction with the shelterin component trf2. we demonstrate that the trf2 interaction site in rtel1 maps to an uncharacterized c4c4 metal - binding motif, which is commonly mutated in hhs patients. we establish that the p.r1264h mutation within the c4c4 motif, which has a carrier frequency of 1 in 100 in the ashkenazi jewish population (fedick., 2014), compromises the rtel1-trf2 interaction, leading to catastrophic t - loop resolution accompanied by rapid changes in telomere length, telomere loss, and tc formation. conversely, we identify a single amino acid substitution (p.i124d) within the trfh dimerization domain of trf2 that specifically abolishes rtel1 binding and prevents its recruitment to telomeres. remarkably, the trf2 p.i124d mutation gives rise to rapid changes in telomere length, telomere loss, and tc formation and thereby phenocopies the p.r1264h mutation in rtel1. our results reveal that t - loops are highly dynamic and regulated structures whose assembly and disassembly is coordinated during the cell cycle. rtel1 serves a dual function in telomere integrity ; it suppresses telomere fragility by unwinding telomeric g4 dna and also disassembles t - loops to prevent catastrophic loss of the telomere (vannier., 2012). recently, we have shown that rtel1 s ability to suppress telomere fragility strictly depends on an interaction with pcna. unexpectedly, however, the rtel1-pcna interaction was found to be dispensable for t - loop unwinding (vannier., 2013), suggesting the existence of a separate mechanism for recruiting rtel1 to telomeres. we reasoned that rtel1 could be recruited to telomeres via an interaction with one of the shelterin components, which are the major constituents of vertebrate telomeres. to test this hypothesis, we first modified a human bacterial artificial chromosome (bac) carrying the rtel1 genomic locus by inserting a flap tag (containing gfp and flag) at the n terminus (nflap) of the rtel1 coding sequence using homologous recombination (poser., 2008). extracts from hek293 cells stably expressing nflap - tagged rtel1 at near endogenous levels were subjected to immunoprecipitation for 5 of the 6 endogenous shelterin components and then blotted for rtel1. although known partner shelterin components were present in immunoprecipitates of endogenous trf1, tpp1, or pot1, nflap - tagged rtel1 was not detectable (figure s1a). however, blotting of immunoprecipitates of endogenous trf2, and to a lesser extent rap1, revealed an association with nflap - tagged rtel1 (figure 1a). importantly, these interactions were resistant to benzonase treatment, indicating that the interactions between trf2/rap1 and rtel1 are independent of dna / rna bridging. furthermore, trf2 immunoprecipitated rtel1 from lysates that were mock depleted with igg but not from extracts immunodepleted for nflap - tagged rtel1 with a gfp antibody (figure 1b), thus demonstrating the specificity of the interaction. trf2 was coprecipitated from hek293 cells with nflap - tagged rtel1, but not with irrelevant control protein gfp - alc1 (figure 1c). silencing of rap1 with lentivirus - mediated rna interference (shrna) did not significantly affect binding of rtel1 to trf2 (data not shown), which raised the possibility that rtel1 interacts indirectly with rap1 and directly with trf2. to confirm direct binding of rtel1 to trf2 in vitro, we performed gst pull - down assays with purified full - length and truncated versions of human trf2 and affinity purified nflap - rtel1. western blotting analysis revealed that nflap - rtel1 associates with full - length trf2 protein (gst - trf2) and trf2 lacking the n - terminal basic domain (gst - trf2b), but not with the basic n - terminal domain (gst-b) or gst alone (figure 1d). taken together, these data indicate that rtel1 directly interacts with trf2. since rtel1 only transiently associates with telomeres (uringa., 2012), we next examined whether the association of rtel1 with trf2 varied throughout the cell cycle. to this end we synchronized hek293 nflap - rtel1 cells and rtel1v5 mouse embryonic fibroblasts (mefs), stably expressing myc - tagged trf2, by double thymidine block or by incubation with thymidine followed by nocodazole treatment (figures s1b and s1c). although a low level of association between rtel1 and trf2 was detected throughout the cell cycle, the rtel1-trf2 interaction is significantly increased at the g1-to - s transition and peaked in s phase (figures 1e and s1d). similarly, we observed that the rtel1-trf2 interaction is significantly enhanced in s phase rtel1v5 mouse cells as determined by proximity ligation assay pla (figures 1f and s1e) and is unaffected by inhibiting dna replication (figure s2). these results establish that the rtel1-trf2 interaction occurs predominantly during s phase and does not require active dna replication. to determine the minimal trf2 interaction site within rtel1, we conducted a peptide array binding experiment, as previously described (ward., 2010). we reasoned that the trf2 interaction site was unlikely to map to the n - terminal helicase motif and so focused our attention on the c terminus of rtel1, which contains three recognizable motifs : a pip box (pcna binding), a harmonin n - like domain (faure., 2014), and a c4c4 motif (unknown function). binding of gst - trf2 to a 20-mer peptide - scanning array encompassing the c - terminal region of rtel1 identified a single trf2-binding peptide that overlapped with the uncharacterized c4c4 motif (figure 2a). to confirm that the c4c4 motif of rtel1 is sufficient to confer binding to trf2 and to determine if this interaction requires metal coordination, we generated recombinant gst and gst - c4c4 motif fusions and performed pull - downs of endogenous trf2 from hek293 cell extracts in the absence (edta) or presence (+ edta) of edta. as shown in figure 2b (lane 2), the lower isoform of endogenous trf2 is specifically pulled down from whole - cell extract by gst - c4c4, but not with gst alone (figure 2b ; lane 1). addition of edta to the pull - down, which is predicted to abolish metal coordination of the c4c4 motif, resulted in the complete loss of trf2 binding (figure 2b ; lane 4). these results reveal that the c4c4 motif of rtel1 is sufficient for binding to trf2, and this requires metal coordination. to assess the biological importance of the c4c4 domain for rtel1 activities, we introduced c4c4 mutations by site - directed mutagenesis into the human and mouse versions of rtel1 (see map in figure 2c). the rtel1 (human)/rtel1 (mouse) mutation corresponds to the hhs disease - causing mutation (ballew., 2013) and is located between the second and third metal - coordinating pair of cysteines (kellenberger., 2005). we also generated two cysteine - to - alanine substitutions (rtel1 in human or rtel1 in mouse) that are predicted to disrupt the fourth pair of cysteines coordinating a second metal ion (kellenberger. first, we evaluated whether the mutations within the c4c4 motif affect the rtel1-trf2 interaction. to this end u2os cells stably expressing empty vector, wild - type (wt) myc - c4c4 (an equivalent to the human rtel112341292 region), or two c4c4 mutants, myc - c4c4 and myc - c4c4, were analyzed by immunoblotting with anti - myc antibody. the decreased steady - state abundance of the mutated human c4c4 motif suggests that the mutations might impact on its stability (figure s3a). to account for the reduced expression, we compensated myc - c4c4 protein levels of both mutants in immunoprecipitation experiments. western blotting analysis revealed that endogenous trf2 was efficiently immunoprecipitated with wt myc - c4c4 peptide but not with either mutant (figure s3b). we also introduced the c4c4 motif mutations into the full - length human rtel1 and found that endogenous trf2 interacted exclusively with wt flag - rtel1, whereas mutations within the c4c4 motif abolished rtel1 s ability to bind trf2 (figure 2d). these results were also confirmed by an in vitro gst pull - down experiment, in which we observed robust interaction of gst - trf2 with full - length flag - tagged wt rtel1, but not with rtel1 or double - mutant rtel1 (figure 2e). finally, we examined the interaction of trf2 with rtel1 in normal bj human fibroblasts and in patient - derived msk-41 cells harboring inherited homozygous rtel1 hhs disease - causing mutations (ballew., 2013). as shown in figure 2f, the endogenous rtel1-trf2 interaction is undetectable in msk-41 cells (lane 1) but is readily detectable in normal bj human fibroblasts (figure 2f, lane 2). an interaction between endogenous trf2 and rap1, which served as a positive control, was observed by pla assay in bj fibroblasts, retinal - pigmented epithelial rpe1 cells, and in the patient - derived msk-41 fibroblasts (figure 2 g). in contrast, the rtel1-trf2 interaction was only detectable by pla assay in bj fibroblasts and rpe1 cells but not in the msk-41 fibroblasts (figure 2h). these results establish that the interaction of rtel1 and trf2 is compromised by the rtel1 p.r1264h mutation in hhs. to investigate the impact of c4c4 motif mutations on the telomere functions of rtel1, we complemented conditional rtel1 mefs with retroviruses expressing either empty vector, full - length wt v5-rtel1, single - mutant v5-rtel1, or double - mutant v5-rtel1. transient expression of cre recombinase in the transduced rtel1 mefs resulted in the expected loss of the floxed rtel1 alleles and concomitant elimination of the endogenous rtel1 protein within 96 hr, leaving the v5-rtel1 wt or mutants as the only source of rtel1 protein (figures 3a and 3b). conditional deletion of rtel1 in mefs leads to rapid accumulation of tcs as a consequence of processing of persistent t - loops by the slx1/4 nuclease (vannier., cells expressing empty vector and mefs complemented either with v5-rtel1 or v5-rtel1 exhibited very high levels of tcs after eliminating the rtel1 floxed alleles. in contrast, rtel1-deficient cells expressing wt v5-rtel1 exhibited low levels of tcs, comparable to control virus - infected cells (figure 3c). next, we examined the levels of telomere fragility and telomere loss in complemented rtel1 mefs by fluorescent in situ hybridization (fish) using telomere - specific probes. as expected, inactivation of rtel1 in rtel1 mefs, 96 hr after cre infection, resulted in high levels of fragile telomeres, which manifest as multiple spatially distinct telomere fish signals (figure 3d). however, inactivation of rtel1 in rtel1 mefs complemented with either wt v5-rtel1, v5-rtel1, or v5-rtel1 did not result in significant induction of telomere fragility when compared to cells complemented with an empty vector control (figure 3d). strikingly, inactivation of rtel1 in rtel1 mefs expressing v5-rtel1 or v5-rtel1 resulted in a significant increase in telomere loss, corresponding to 6.2 2.8 and 5.8 3.3 telomeres that lacked a telomere fish signal on one or both sister chromatid ends, which is comparable to the levels observed in rtel1 null cells (7.5 3.2) and significantly different from wt v5-rtel1-complemented cells that present 2.7 1.4 ends lacking detectable telomeric signals in wt v5-rtel1-complemented cells (figure 3e). these results establish that a functional c4c4 motif in rtel1 is essential for suppressing tcs and telomere loss, but is dispensable for preventing telomere fragility. we next evaluated how loss of the rtel1-trf2 interaction might affect the ddr at telomeres. to this end we quantified the number of dysfunctional telomeres by scoring for 53bp1 colocalization with telomeres. conditional deletion of rtel1 in rtel1 mefs expressing v5-rtel1 or v5-rtel1 resulted in enhanced telomere - dysfunction - induced foci (tifs), corresponding to 7.2% 0.5% and 8.3% 1.3% foci per nucleus compared to 2.5% 1.6% tifs per nucleus in the cells expressing wt v5-rtel1 (figures 3f and s4). thus, disrupting the trf2 binding site on rtel1 causes a mild ddr that resembles the phenotype of rtel1 deletion. to determine whether loss of the rtel1-trf2 interaction induces telomere recombination, we employed chromosome orientation (co)-fish to monitor the frequency of telomere sister chromatid exchange (t - sces). inactivation of rtel1 in rtel1 mefs expressing v5-rtel1 or v5-rtel1 resulted in a 3-fold increase in the number of t - sces when compared to wt v5-rtel1-complemented cells (figure 3 g). collectively, these results lead us to propose that recruitment of rtel1 to telomeres by trf2 is important for t - loop disassembly and prevents catastrophic loss of the telomere, but is dispensable for efficient telomere replication. given that a functional c4c4 motif and rtel1-trf2 interaction is required for t - loop disassembly but is dispensable for preventing telomere fragility, we wished to determine the impact of c4c4 motif mutations on genome - wide replication dynamics using the molecular combing method (michalet., 1997). as previously described (vannier., 2013), the progression of sister replication forks, 96 hr after inactivation of rtel1, in rtel1 mefs is significantly reduced relative to wild - type cells and is associated with increased fork asymmetry and elevated origin usage. in contrast, rtel1 mefs complemented with v5-rtel1 or v5-rtel1 exhibited comparable replication fork dynamics to that of v5-rtel1 wt cells (figures 4a and 4b). these results predict that mutations in the c4c4 motif should not affect the rtel1-pcna interaction, which we first examined using in situ pla. as expected, loss of rtel1 abolished the rtel1-pcna interaction detectable by pla in rtel1 mefs complemented with empty vector (figures 4c and 4d). in contrast, rtel1-depleted cells complemented with v5-rtel1 and v5-rtel1 c4c4 mutations retained the rtel1-pcna interaction, which corresponded to 13.4 2.9 and 11.6 2.0 pla foci per nucleus when compared to 11.5 2.1 foci per nucleus in rtel1 mefs expressing wt v5-rtel1 (figures 4c and 4d). similar results were obtained in coimmunoprecipitation experiments from the same cells (figure 4e). we suggest that the c4c4 motif is dispensable for the rtel1-pcna interaction and does not contribute to the global and telomere replication functions of rtel1 in cells. to identify the region of trf2 that interacts with rtel1, we synthesized peptide arrays of overlapping 20-mer peptides (offset by a single amino acid) that comprised 150 amino acids of trf2, equivalent to human trf243183. we found that gst - tagged full - length human rtel1 but not gst alone interacted with a peptide corresponding to human trf2106125 (figure s5a), which is located within the trfh dimerization domain at the helix1-helix2 boundary (figure 5a). to confirm this result, we purified untagged human trf2trfh, a 6xhis - sumo - c4c4 motif (human rtel112341292), and 6xhis - sumo control. 6xhis - sumo - c4c4 but not control bound to trf2trfh at both low and high salt concentrations as confirmed by coomassie staining of the eluted material and resolution on sds - page gels (figure 5b). consistent with our previous result that the binding of trf2 to the c4c4 motif is dependent on metal coordination (figure 2b), we found that the interaction of trf2trfh with 6xhis - sumo - c4c4 is greatly reduced by the addition of edta (figure s5b). to identify key residues in trf2 that are necessary for the trf2-rtel1 interaction, we generated a substitution peptide array in which the human trf2106125 peptide was systematically substituted (one amino acid substitution at a time) with each of the 20 natural amino acids. probing this array with 6xhis - sumo - c4c4 revealed that several amino acid substitutions at isoleucine 121 severely reduced the interaction (figure 5c). in contrast, a purified 6xhis - sumo control peptide did not bind to any spot within the trf2106125 substitution peptide array, confirming specificity of the interaction (data not shown). to test if the trf2 p.i121 mutation compromises the rtel1 interaction in vivo, we introduced the corresponding mutation (p.i124d) into full - length mouse trf2, which was used to stably transduce hek293 flap - tagged rtel1 cells and rtelv5 mefs with retroviruses along with controls (figure s6). strikingly, we found that the p.i124d mutation completely abolished binding of trf2 to flag - rtel1 or v5-rtel1 (figure 5d). thus, isoleucine 124 within the trf2trfh domain is critical for the trf2-rtel1 interaction in vivo. to examine how the p.i124d mutation affects trf2 activities at telomeres, we subjected whole - cell extracts of hek293 flap - tagged rtel1 cells stably expressing an empty vector, wt myc - trf2, or myc - trf2 to immunoprecipitation with anti - myc or control igg. while the trf2 mutation specifically abolished the trf2-rtel1 interaction (figure 5d), it did not measurably affect its ability to interact with the shelterin proteins trf1 and rap1 (figure 5e). since trf2 is not in close proximity to the tin2 binding site, which is separate from the trfh domain, and maps to residues 352365 (chen., 2008, 2011), it is unlikely that this mutation affects interaction with tin2. next, we examined whether the trf2 mutant affects telomere binding of itself or other shelterin components by chromatin immunoprecipitation (chip). complemented trf2 cells were crosslinked with formaldehyde and dna slot blots were hybridized with a ttaggg probe to determine relative levels of protein - associated telomeric dna (figure 5f). as expected, cre - mediated deletion of trf2 in cells expressing empty vector resulted in a severe reduction in telomeric binding of trf2 accompanied by a 5-fold reduction of trf1 and rap1 associated with telomeres (figure 5 g). importantly, trf2 cells complemented with myc - trf2 or myc - trf2 retained wt or mutant trf2 as well as endogenous shelterin proteins at telomeres (figure 5 g). these results suggest that the trf2 mutant does not compromise the ability of trf2 to associate with telomeres and does not measurably impact on telomeric binding by trf1 and rap1. to gain further insight into the impact of the trf2 mutant at telomeres, we conducted tc amplification assays and telomere fish experiments to examine telomere stability and telomere length changes in these cells. we first examined trf2 mefs complemented with empty vector, myc - trf2, or myc - trf2 for the presence of tcs. strikingly, inactivation of trf2 in trf2 mefs complemented with myc - trf2 resulted in a 3-fold induction of tcs when compared to cells complemented with wt myc - trf2 (figure 6c). intriguingly, this result is comparable to the tc ratio observed between wt and c4c4 motif mutants expressed in rtel1 mefs (figure 3c). as previously described (celli and de lange, 2005), cre - mediated deletion of trf2 in trf2 mefs complemented with empty vector results in chromosome end - to - end fusions with telomeric dna signals evident at the junction of each fusion (figure 6d). in contrast, trf2 mefs complemented with either wt myc - trf2 or myc - trf2 did not present with telomere fusions (figure 6d). since loss of tin2 gives rise to telomere fusions (takai., 2011), these data further suggest that the trf2 mutation does not impact on trf2-tin2 binding. while we found no evidence that the trf2 mutation is associated with telomere fusions or fragility (figures 6d and 6e), we did observe a high incidence of telomere loss following inactivation of trf2 in trf2 mefs complemented with myc - trf2. telomere fish analysis revealed that disruption of the rtel1-trf2 interaction, associated with the trf2 mutation, resulted in the loss of a telomere signal on 13 7.7 chromosome ends per metaphase. this contrasted with the loss of 5.1 2.8 telomeres per metaphase in cells expressing wt myc - trf2 (figure 6f). to address whether the trf2 mutation gives rise to telomere length heterogeneity, we conducted quantitative fluorescence in situ hybridization (q - fish) to measure the intensity of the telomere signal from images of fish - stained metaphases. analysis of trf2 mefs expressing myc - trf2, performed 96 hr after cre introduction, revealed increased telomere length heterogeneity when compared to cells with wt myc - trf2 (figure 6 g). interestingly, these changes in the mean telomere length, which included a statistically significant increase in both short and long telomeres, resembled rtel1 deficiency, and more specifically the defect associated with mutations in the c4c4 motif (vannier., 2012). to examine the impact of the trf2 mutation on the ddr, we quantified the number of 53bp1 foci that colocalize with telomeric dna. tif analysis revealed that conditional deletion of trf2 in trf2 mefs expressing empty vector control resulted in 71% of telomeres with tifs. in contrast, deletion of trf2 in trf2 mefs complemented with either wt myc - trf2 or myc - trf2 mutant diminished the percentage of tif foci at telomeres by 10.5-fold and 6.1-fold, respectively (figures 6h and s7). these results suggest that loss of the trf2-rtel1 interaction, which compromises the recruitment of rtel1 to telomeres, elicits a mild telomere - associated ddr, which is comparable in severity to the ddr observed at telomeres in rtel1-deficient cells or associated with the rtel1 mutation. finally, we performed co - fish analysis to examine the frequency of recombination at telomeres induced by the loss of the trf2-rtel1 interaction. inactivation of trf2 in trf2 mefs complemented with myc - trf2 resulted in a greater than 5-fold induction in the frequency of t - sces with preferential addition of lagging telomere dna when compared with cells expressing wt myc - trf2 (figure 6i). these results indicate that the recruitment of rtel1 to telomeres via its interaction with trf2 protects against telomeric recombination. overall, these results establish that trf2 recruits rtel1 to telomeres to facilitate t - loop disassembly. telomeres are dependent on two distinct activities of rtel1 to maintain the integrity of chromosome ends : rtel1 disassembles t - loops and also counteracts the formation of g4-dna secondary structures to prevent telomere loss and telomere fragility, respectively (vannier., 2012). our previous study established that rtel1 interacts with the replisome through a pip - box - dependent interaction with pcna, which is important for the replication functions of rtel1 (vannier., 2013). surprisingly, however, the rtel1-pcna interaction is dispensable for t - loop disassembly, which suggested the existence of a distinct mechanism for recruiting rtel1 to telomeres to promote t - loop unwinding. here, we establish that rtel1 is transiently recruited to telomeres to promote t - loop unwinding through an s phase - specific interaction with the shelterin component trf2 (see figure 7 for a model). failure to disassemble t - loops has severe consequences for telomere integrity, which may reflect the need to avoid collisions between t - loops and the replication fork, allow telomerase access to the 3 end of the telomere, and/or counteract the formation of t - loops in trans between sister telomeres. rtel1 s ability to interact directly with trf2 is mediated by a cysteine - rich c4c4 motif, which is predicted to bind two zinc ions to form a cross - braced structure (kellenberger. the finding that addition of edta is sufficient to abolish the trf2-rtel1 interaction underscores the importance of c4c4 metal coordination for this association. of direct clinical relevance is the recent discovery of mutations within the c4c4 motif that are causal for the telomeropathy hhs, including rtel1 and rtel1 mutations (ballew., 2013 ; le guen., 2013). strikingly, the carrier frequency of the rtel1 mutation within the ashkenazi orthodox jewish and general ashkenazi jewish populations is 1% and 0.45%, respectively, which has prompted the need for urgent screening to identify heterozygous carriers (ballew., 2013 ; fedick., 2014 we demonstrate here that the rtel1-trf2 interaction is compromised by the p.r1264h mutation in hhs patient - derived cells and in rtel1 mutant mefs. in contrast to the rtel1 pip - box mutation, which eliminates binding to pcna and specifically affects the replication functions of rtel1, the c4c4 mutations have no measurable impact on normal replication dynamics, telomere fragility, or the interaction with pcna. instead, the c4c4 mutation conferred rapid accumulation of tcs concomitant with telomere length changes and telomere loss, which we attribute to the inappropriate resolution of the t - loop by the slx1/4 nuclease complex (figure 7 and vannier., 2012). thus, we propose that the pip - box and c4c4 motif convey distinct and genetically separable functions, which impact on the targeting of rtel1 to replication forks and telomeres, respectively. our analysis of the rtel1 binding sites in trf2 identified a single point mutation, trf2, located in helix2 of the trf2trfh dimerization domain (fairall., 2001), which abolishes the rtel1-trf2 interaction. importantly, trf2 is not in close proximity to the binding sites for tin2 or rap1 (chen., 2008, 2011) and does not affect its interaction with trf1 or rap1, nor its ability, or the ability of other shelterin components, to bind to telomeres. furthermore, unlike loss of trf2, which gives rise to telomere de - protection, telomere end - to - end fusions, and a massive induction of the ddr at telomeres, the trf2 mutation gives rise to a phenotype that is remarkably similar to that observed for the rtel1 mutation. both trf2 and rtel1 mutant cells present with high levels of tcs, telomere length heterogeneity, telomere loss, increased telomere sces, and a moderate induction of the ddr at telomeres, which we have previously attributed to the inappropriate resolution of persistent t - loops by the slx1/4 nuclease complex (vannier., 2012). thus, we propose that the phenotypes of the trf2 and rtel1 mutations reflect a failure to recruit rtel1 to telomeres during s phase, which is necessary to transiently disassemble t - loops. given the phenotypic similarity of trf2 and rtel1 mutations, our results also raise the possibility that trf2 coordinates both the assembly and disassembly of t - loops during the cell cycle. previous studies have established that the n - terminal basic domain of trf2 binds to and protects telomeric holliday junctions (hj)/d - loop structures from cleavage by endonucleases, which may play a role in the formation and protection of t - loops (poulet., 2009 ; wang., 2004). the n - terminal basic domain of trf2 could also be used to target rtel1 to the telomere hj / d - loop during s phase, which must be unwound to release the 3 telomere end to disassemble the t - loop. it is intriguing to note that the rtel1 interaction site within the trfh domain of trf2 is adjacent to the n - terminal basic domain of trf2 that confers telomere hj / d - loop binding (fouch. given their close proximity, it will be important to determine if the binding of rtel1 to trf2 induces an allosteric change in the adjacent basic domain, which could alter hj / d - loop association to facilitate unwinding by rtel1 to dismantle the t - loop. in future studies it will be important to further define how the rtel1-trf2 interaction is controlled during the cell cycle and how this is limited to s phase cells. while active replication is not required for the rtel1-trf2 interaction, it is intriguing to note that trf2 is a likely cdk substrate and could be subject to cell cycle - dependent modification. indeed, trf2 contains numerous potential cdk phosphorylation sites and can be phosphorylated by a cyclin a - cdk2 complex in vitro (chi., however, the importance of these putative cdk sites in trf2 and whether or not they contribute to the rtel1-trf2 interaction remains unclear. in addition, trf2 is detected as two closely migrating bands (bilaud., 1997). how and why rtel1 preferentially binds to the lower isoform is unclear, but may reflect differences in post - translational modifications (ptms) that could be determinants of the interaction. finally, it is also important to consider that rtel1 may be subject to ptms during the cell cycle, but this remains ill defined and warrants future investigation. an improved understanding of the cell cycle control of rtel1 and trf2 is likely to provide important insights into the assembly and disassembly of t - loops and its contribution to the end protection problem. trf2 (celli and de lange, 2005 ; a gift from titia de lange, the rockefeller university), rtel1v5, and rtel1v5 (vannier., 2013) mefs were cultured in dulbecco s modified eagle s medium (dmem) supplemented with 15% fetal bovine serum (invitrogen), l - glutamine, and penicillin - streptomycin. bj - htert, rpe-1, patient - derived msk-41 fibroblasts, and u2os osteosarcoma cells were kept in dmem with 10% fbs. production of retro- and lentiviral supernatants was performed as described earlier (sarek., 2010). rtel mefs were transduced with pbabe - puromycin retroviruses expressing an empty vector, mouse v5-tagged wt, or mutant rtel1. trf2 mefs were infected with plpc - puromycin retroviruses expressing control vector, mouse wt, or mutant myc - tagged trf2. the human u2os cells were transduced with plpc - puromycin retroviruses carrying myc - tagged wt or mutant alleles of the c4c4 domain. hek293 cells were infected with phage - pgk - puromycin lentiviral constructs to express wt or mutants of human flag - tagged rtel1. transduced cells were selected with puromycin (3 g / ml) for 26 days. deletion of floxed alleles in rtel and trf2 mefs was carried out with ad - gfp - cre adenovirus (vector biolabs), and cells were genotyped by pcr at 96 hr post - infection as described earlier (celli and de lange, 2005 ; vannier., 2012). cells were plated on coverslips at density 5 10 in 24-well plates and left in culture conditions overnight. the next day cells were pre - extracted in csk buffer (10 mm pipes [ph 6.8 ], 100 mm nacl, 300 mm sucrose, 3 mm magnesium chloride, 1 mm egta, and 0.5% triton x-100) fixed with 5% formaldehyde (thermo scientific) for 10 min, permeabilized with pbs containing 0.5% (v / v) np-40 for 5 min, and blocked for 30 min with goat serum (5%) in pbs. pla was performed following the manufacturer s instructions using the duolink anti - mouse minus and anti - rabbit plus in situ pla probes and the duolink in situ detection reagents red (olink bioscience). images were acquired with a zeiss axio imager m1 microscope equipped with an orca - er camera (hamamatsu) and using the volocity 4.3.2 software (improvision). | summarythe helicase rtel1 promotes t - loop unwinding and suppresses telomere fragility to maintain the integrity of vertebrate telomeres. an interaction between rtel1 and pcna is important to prevent telomere fragility, but how rtel1 engages with the telomere to promote t - loop unwinding is unclear. here, we establish that the shelterin protein trf2 recruits rtel1 to telomeres in s phase, which is required to prevent catastrophic t - loop processing by structure - specific nucleases. we show that the trf2-rtel1 interaction is mediated by a metal - coordinating c4c4 motif in rtel1, which is compromised by the hoyeraal - hreidarsson syndrome (hhs) mutation, rtel1r1264h. conversely, we define a trf2i124d substitution mutation within the trfh domain of trf2, which eliminates rtel1 binding and phenocopies the rtel1r1264h mutation, giving rise to aberrant t - loop excision, telomere length heterogeneity, and loss of the telomere as a circle. these results implicate trf2 in the recruitment of rtel1 to facilitate t - loop disassembly at telomeres in s phase. |
myxoglobulosis, a term coined by von hansemann in 1914, is described as a variant of mucocele. it is associated with the formation of opaque globules varying in diameter from 0.1 cm - 1.0 cm and lying in a clear mucous. mucous retention cyst is a true cyst, pathogenesis of which can be due to ductal dilatation, secondary to ductal obstruction, leading to increased intraluminal pressure. extravasation mucocele is a common lesion of the oral mucosa that results from rupture of a salivary gland duct, often the result of local trauma, and spillage of mucin into the surrounding connective tissue. it is most frequently seen in association with the minor salivary glands with a site predilection for the lower lip. the lumen contains extravasated mucin and is surrounded by granulation tissue wall with no epithelial lining. our present case report reveals extravasation mucocele with unique intraluminal globules resembling those usually seen in appendix a 24-year - old female patient presented an asymptomatic swelling of lower lip which had gradually increased over a period of 6 months and measured about 1 cm 2 cm. the swelling was dome - shaped, smooth - surfaced, soft in consistency and without discharge of any fluid. histopathological examination of the excised tissue revealed a well demarcated cystic lumen in the sub - mucosa, surrounded by compressed granulation tissue forming the wall of the lumen with overlying atrophic epithelium [figure 1 ]. the cystic lumen showed a few muciphages and numerous globules (approximately 100 in number). the size of each globule varied, ranging from small to large (88 m to 416 m). each globule exhibited a central, eosinophilic, amorphous and acellular core, surrounded by mucinous substance [figures 2 and 3 ]. the peripheral globules of the cystic lumen were in contact with the surrounding compressed granulation tissue wall, while some globules were also seen within the granulation tissue wall and the latter were more cellular compared to the centrally located globules in the lumen [figure 4 ]. the granulation tissue forming the cystic wall was vascular, fibrous and cellular, comprising of fibroblasts, endothelial cells and chronic inflammatory cells, of which, muciphages were predominant. the adjacent minor mucous salivary glands showed varying stages of degeneration like loss of architecture of acini, and mild chronic sialoadenitis [figure 5 ]. photomicrograph showing cystic lumen in the submucosa with numerous globules, surrounded by granulation tissue wall and overlying epithelium (h and e stain, 15) photomicrograph showing cystic lumen with globules having central eosinophilic, amorphous and acellular core surrounded by mucinous substance (h and e stain, 200) photomicrograph showing cystic lumen, containing numerous globular organizations, spherical to polygonal in shape, with central eosinophilic, amorphous and acellular core surrounded by mucinous substance (h and e stain, 100) photomicrograph showing some peripheral globules of the cystic lumen in contact with surrounding granulation tissue wall, and some within the granulation tissue wall. the globules within the granulation tissue wall are more cellular (h and e stain, 100) photomicrograph showing cystic lumen, containing globular organizations surrounded by the granulation tissue wall, and minor mucous salivary glands showing varying stages of degeneration like loss of architecture of acini, and mild chronic sialoadenitis (h and e stain, 100) a 40-year - old male patient reported to our hospital with a chief complaint of painless swelling of lower lip near the right angle of mouth of 5 months duration with a history of local trauma. no relevant medical history was elicited. on clinical examination, the swelling measured approximately 2 cm 1.5 cm in size, was pale in color, sessile, dome - shaped, soft in consistency, smooth - surfaced and fluctuant. treatment included surgical excision of the lesion under local anesthesia and its submission for routine processing. histopathological examination of the tissue revealed a cystic lumen in the submucosa containing mucin, few muciphages and a few unique mucinous globular organizations. these globules were spherical to polyhedral in shape, 5 in number, with each globule having a central, amorphous, acellular area surrounded by mucin. in 3 of these globules, two of these globules were connected to the surrounding granulation tissue wall that formed the capsule. the granulation tissue was highly cellular, comprising of chronic inflammatory cells (lymphocytes, macrophages and muciphages), plump fibroblasts, proliferating endothelial cells and numerous dilated and congested vascular channels [figures 6 and 7 ]. photomicrograph showing cystic lumen containing globular organization that are spherical with surrounding cellular and vascular granulation tissue wall (h and e stain, 100) photomicrograph showing cystic lumen containing globular organizations in contact with surrounding granulation tissue wall(h and e stain, 100) a 24-year - old female patient presented an asymptomatic swelling of lower lip which had gradually increased over a period of 6 months and measured about 1 cm 2 cm. the swelling was dome - shaped, smooth - surfaced, soft in consistency and without discharge of any fluid. histopathological examination of the excised tissue revealed a well demarcated cystic lumen in the sub - mucosa, surrounded by compressed granulation tissue forming the wall of the lumen with overlying atrophic epithelium [figure 1 ]. the cystic lumen showed a few muciphages and numerous globules (approximately 100 in number). the size of each globule varied, ranging from small to large (88 m to 416 m). each globule exhibited a central, eosinophilic, amorphous and acellular core, surrounded by mucinous substance [figures 2 and 3 ]. the peripheral globules of the cystic lumen were in contact with the surrounding compressed granulation tissue wall, while some globules were also seen within the granulation tissue wall and the latter were more cellular compared to the centrally located globules in the lumen [figure 4 ]. the granulation tissue forming the cystic wall was vascular, fibrous and cellular, comprising of fibroblasts, endothelial cells and chronic inflammatory cells, of which, muciphages were predominant. the adjacent minor mucous salivary glands showed varying stages of degeneration like loss of architecture of acini, and mild chronic sialoadenitis [figure 5 ]. photomicrograph showing cystic lumen in the submucosa with numerous globules, surrounded by granulation tissue wall and overlying epithelium (h and e stain, 15) photomicrograph showing cystic lumen with globules having central eosinophilic, amorphous and acellular core surrounded by mucinous substance (h and e stain, 200) photomicrograph showing cystic lumen, containing numerous globular organizations, spherical to polygonal in shape, with central eosinophilic, amorphous and acellular core surrounded by mucinous substance (h and e stain, 100) photomicrograph showing some peripheral globules of the cystic lumen in contact with surrounding granulation tissue wall, and some within the granulation tissue wall. the globules within the granulation tissue wall are more cellular (h and e stain, 100) photomicrograph showing cystic lumen, containing globular organizations surrounded by the granulation tissue wall, and minor mucous salivary glands showing varying stages of degeneration like loss of architecture of acini, and mild chronic sialoadenitis (h and e stain, 100) a 40-year - old male patient reported to our hospital with a chief complaint of painless swelling of lower lip near the right angle of mouth of 5 months duration with a history of local trauma. the swelling measured approximately 2 cm 1.5 cm in size, was pale in color, sessile, dome - shaped, soft in consistency, smooth - surfaced and fluctuant. treatment included surgical excision of the lesion under local anesthesia and its submission for routine processing. histopathological examination of the tissue revealed a cystic lumen in the submucosa containing mucin, few muciphages and a few unique mucinous globular organizations. these globules were spherical to polyhedral in shape, 5 in number, with each globule having a central, amorphous, acellular area surrounded by mucin. in 3 of these globules, two of these globules were connected to the surrounding granulation tissue wall that formed the capsule. the granulation tissue was highly cellular, comprising of chronic inflammatory cells (lymphocytes, macrophages and muciphages), plump fibroblasts, proliferating endothelial cells and numerous dilated and congested vascular channels [figures 6 and 7 ]. photomicrograph showing cystic lumen containing globular organization that are spherical with surrounding cellular and vascular granulation tissue wall (h and e stain, 100) photomicrograph showing cystic lumen containing globular organizations in contact with surrounding granulation tissue wall(h and e stain, 100) mucoceles are the common non - neoplastic lesions of the oral minor salivary glands, of which, the majority are mucous extravasation cysts. mucoceles develop due to the disruption of the flow of saliva from the secretory apparatus of the salivary glands. the lesions are most often associated with extravasation of mucus into the adjacent soft tissues caused by a traumatic ductal insult. in our present cases, the clinical features and histopathological findings are suggestive of an extravasation mucocele. although diagnosis of extravasation mucoceles is non - challenging to the pathologists, the intraluminal globular organizations of mucin surrounded by the granulation tissue capsule are histologically very unusual. the etiology and pathogenesis of these globular organizations are still unclear. probstein and lassar stated that in myxoglobulosis of the intestine or appendix, the speculative etiological factors are bacteria and necrotic epithelial debris which may act as nidus for concentric deposition of mucin. lubin and berle proposed that the core of the globules represents an organizing mass of mucin by granulation tissue originated from the appendical wall. li. stated that the globules represent an attempt to organize the mucin by the granulation tissue capsule, which is then extruded into the lumen due to chronic frictional or mechanical forces. ide and kusama stated that localized changes in the microenvironment may act as predisposing factors for formation of these florid globules. myxoglobulosis of salivary mucocele probably occurs as a consequence of exuberant reparative process of the capsular granulation tissue wall in response to intraluminal accumulation of mucin. lubin and berle reported 2 cases of myxoglobulosis of the appendix, which is a rare variant of extravasation mucocele. histologically, the lesions consist of intraluminal globules which measure about 0.2 cm to 1.0 cm in diameter, and consist of granulation tissue, mucin, varying degrees of secondary focal calcifications and cholesterol clefts. in our present cases, the globules are similar to myxoglobulosis of appendix, except for their smaller size (ranging from 88 m to 416 m), absence of calcification and cholesterol clefts. the globules in both of our cases are almost similar in size, shape and contents, but the number of globules seen in case 1 are more and the surrounding granulation tissue wall is moderately cellular and vascular. but in our case 2, the globules are fewer in number and the surrounding granulation tissue wall is highly cellular and vascular. in the present case reports, the globules in the granulation tissue wall are cellular but the globules in the lumen are acellular, which is in accordance with ka shah, who stated that it is a time related phenomenon, with earlier globules being more cellular. we conclude that these present cases represent a unique organization of mucin by granulation tissue wall as an exaggerated reparative response and release of the globules into the lumen due to chronic mechanical forces. a somewhat similar analogy is seen in collagenous spherulosis that is frequently seen in benign and malignant salivary gland tumors, proliferative lesions of breast ductal epithelium, chondroid syringomas and schwannomas. differentiating collagenous spherulosis from myxoglobulosis is comparatively easy, as the globules in collagenous spherulosis are seen at the tissue level, are myoepithelial in origin, acellular in nature, and almost always seen in association with epithelial and myoepithelial cells. they are generally positive for collagen, p63 and basement membrane, and generally negative for mucin stains, whereas globules in myxoglobulosis are seen mostly in the lumen, are hyalinized, discrete, of variable cellularity and associated with granulation tissue wall. their origin is from connective tissue and stains positive for acidic mucin and periodic acid schiff stain. thus, it can be said that collagenous spherulosis and myxoglobulosis are the only morphologically related reaction patterns. prognosis of this variant of extravasation mucocele will be better than other types of mucoceles with low recurrence rate due to good host response and globular organizations of mucin. however, follow - up of these cases and more such cases is required to confirm the prognosis. study of many cases is needed to confirm the etiology, pathogenesis and biologic nature of this variant. | in this paper, we present two case reports of myxoglobulosis, in a 24-year - old female and a 40-year - old male patient who came to our hospital with a chief complaint of painless swelling of the lower lip of approximately 6 months duration. a study of two case reports has been given here. in these patients, histological examination of the surgically excised tissue was carried out. histopathological examination showed an extravasation mucocele with the lumen exhibiting unique globular organizations of mucin surrounded by granulation tissue capsule and lacking an epithelial lining. our two cases are possibly an analogue of myxoglobulosis, a rare variant of the appendical mucocele. thus, though rare, the possibility of occurrence of myxoglobulosis in cystic lesions of the lip should be considered. the prognosis is regarded better as compared to the other types of mucoceles with low recurrence rate due to good host response and globular organizations of mucin. however, follow- up of these cases and more such cases is required to confirm the prognosis. the need for study of many such cases to confirm the etiology, pathogenesis and biologic nature of this variant is being felt. |
the spectrum of chronic hbv infection ranges from asymptomatic infection to chronic hepatitis with progression to cirrhosis, end - stage liver disease and hepatocellular carcinoma. a 30-year - old man presented with recent hypertension, severe headache and lethargy on a background of recently diagnosed hbv infection. urine microalbumin / creatinine ratio was 31.6 mg / mmol of creatinine (< 2.5 mg / mmol) with a urine protein excretion of 350 mg / day. other abnormal investigations included alanine transaminase 108 u / l (5 - 55), aspartate transaminase 76 u / l (5 - 55) and erythrocyte sedimentation rate 46 mm / h (030 mm / h). hbsag and hepatitis b e antigen (hbeag) were positive, while igm hepatitis b core antibody was negative. hepatitis b viral dna was quantitated at 364 million iu / ml. electrophoresis of serum and urine were negative for paraprotein. antinuclear antibody, antineutrophil cytoplasmic antibody, extractable nuclear antigen, complements and anti - double - stranded dna were negative. three months after diagnosis, he continued to have high viral load suggesting a chronic hbv infection. mol / l with an estimated glomerular filtration rate (egfr) of 57 ml / mt. glomeruli were normal on light microscopy with evidence of tubulointerstitial nephritis (figure 1a). there was interstitial oedema and dense mononuclear cell infiltrate comprising lymphocytes, plasma cells and occasional eosinophils. trace deposits of granular iga (< 1 +) were seen on immunofluorescence microscopy. nuclear abnormalities in the form of condensed chromatin and round structures with a dense core surrounded by a clear halo were observed in some of the tubules (figure 1b and c). (a) light microscopy view from the first renal biopsy showing degeneration of tubular epithelium (arrows) and associated interstitial nephritis (lhs of image) 20 ; (b) electron microscopy showing necrosis of tubular epithelium cells (asterisk), (c) virus - like particles in the nucleus of a tubular epithelial cell. tubulo interstitial nephritis (tin) was attributed to chronic hbv infection, and he was initiated on entecavir 0.5 mg twice a day. although the viral dna load decreased significantly over the next 4 weeks (429 copies / ml, 58 iu / ml), renal function deteriorated (serum creatinine rose 210 mol / l egfr 35 ml / mt). on a repeat renal biopsy, nine months after initiation of entecavir, egfr improved to 45 ml / mt (serum creatinine 165 extra hepatic manifestations associated with chronic hbv infection can be varied with renal, skin, joint and nervous system manifestations. the renal manifestations of chronic hbv infection usually include glomerulonephritis, essential mixed cryoglobulinaemia and polyarteritis nodosa (pan). the most characteristic presentation is nephrotic syndrome, with membranous nephropathy being the most common pathological finding. children have a good prognosis with up to 95% achieving clinical resolution within 7 years. adults, in contrast, may have a relentless course with 30% progressing to renal failure and 10% eventually requiring haemodialysis. pan is a rare complication of chronic hbv infection, occurring in 1% to 5% of patients. human immunodeficiency virus, cytomegalovirus, epstein barr virus, hanta virus, polyoma and adenovirus are some of the viruses associated with tin. we are not aware of any published report of hbv associated tin in the english literature. the renal biopsy findings of tin in our patient were quite unexpected as the usual renal manifestation of hbv nephritis is glomerular. however, the electron microscopic findings of viral structures akin to hbv along with positive immunohistochemical staining for hbv antigen in the tubules, and a progressively worsening renal function with increasing viral load further strengthened our belief of hbv infection as the cause of tin. although the majority of patients spontaneously clear the viraemia, active treatment was initiated considering progressive renal impairment. entecavir, a potent nucleoside analogue with low risk of antiviral resistance, was chosen, as lamivudine and interferon were considered to be less effective in the presence of very high viral load. improvement of egfr with prolonged entecavir treatment further supports our view that hbv infection is the cause of tin in this patient. an interplay of host, virus and other environmental factors is necessary for nephropathy to develop. this is supported by the observation that only few patients with chronic hbv infection have renal disease. much of the available evidence points to a direct cytopathic effect by virus, immune complex deposition, viral induced cytokine injury or a specific immunological effector mechanism induced by hbv as probable explanations for renal injury. in summary, we conclude that, in our patient, tin was associated with chronic hbv infection. we suggest that tin should be considered as a possible cause of renal impairment in hbv - infected patients. our case exemplifies that aggressive antiviral treatment in such patients would stabilize and improve renal function. the exact pathogenesis of tin in association with hbv infection needs to be elucidated by future experimental work and further clinical observations. | hepatitis b viral infection is usually a self - limiting disease in immunocompetent individuals. chronic infection can be seen in up to 5% of infected patients. renal manifestations of chronic hbv infection are usually glomerular. we describe here an uncommon presentation of a patient with chronic hbv infection with very high viral load and rapidly progressive renal failure. renal biopsy showed features of tubulointerstitial nephritis and tubular epithelial inclusion bodies suggestive of hbv infection. entecavir treatment slowed down the progression of his renal disease. tubulointerstitial nephritis should be considered as a part of the differential diagnosis in patients with hbv infection. early antiviral treatment may halt the progression of renal disease. |
hematopoietic stem - cell transplantation (hsct) is an important therapeutic option for many malignant and nonmalignant disorders. since the first report of bone marrow (bm) transplantation, steady - state bm (ss - bm) has been the only stem - cell source for hsct. in recent years, granulocyte colony - stimulating factor (g - csf)-mobilized peripheral blood stem - cells (g - pbsc) have become an alternative stem - cell source. g - pbsc is even preferred in adults receiving human leucocyte antigen (hla)-identical sibling transplantation. although g - pbsc are enriched in progenitor cells as compared to ss - bm, which allows a faster engraftment, the use of g - pbsc will increase the incidence of chronic graft - versus - host disease (cgvhd). to take advantage of g - pbsc while decrease the risk of cgvhd, recently, g - bm has been an attractive option for hla - haploidentical / mismatched donor transplantation. however, g - bm does not seem to be considered an alternative to ss - bm in hla - identical hsct due to nonsignificant improvement in survivals, although its feasibleness, safety, well - engraftment and limited incidence of gvhd have been demonstrated. the conclusions from previous studies on hla - identical transplantation with g - bm might be limited due to the number of patients, underlying diseases, disease status at the time of transplantation, g - csf schedules, conditioning regimens, and gvhd prophylaxis. in this study, we conducted a retrospective nonrandomized controlled study to evaluate the clinical outcomes of g - bm, ss - bm, and g - pbsc in hla - identical sibling hsct in our center. the results suggested that g - bm was an excellent stem - cell source in hla - identical sibling hsct. a total of 226 early stage myeloid leukemia patients, including de novo acute myelogenous leukemia (aml) (complete remission 1 [cr1 ]) and chronic myelogenous leukemia (cml) (chronic phase 1 [cp1 ]), with hla - identical sibling donor, were enrolled in this study (march 2004march 2009). the main clinical characteristics of patients at the time of hsct were listed in table 1. 43, 60, and 123 patients were enrolled in the g - bm, ss - bm, and g - pbsc groups, respectively. patient characteristics ss - bm : steady - state bone marrow ; g - pbsc : g - peripheral blood stem cell ; g - bm : g - csf - primed bone marrow ; aml : acute myelocytic leukemia ; cml : chronic myelocytic leukemia ; tbi : total body irradiation. this study was approved by the ethics committee of the affiliated hospital of academy of military medical sciences. informed consents were obtained from all patients, donors, or their legal guardians. in the g - pbsc group, donors received g - csf at 8.0 g kg d divided in two subcutaneous injections for 5 consecutive days (day 3 to day + 1), and pbsc was harvested on day 0 and day + 1. in the g - bm group, donors received g - csf at 5.0 g kg d by a single subcutaneous injection for 3 consecutive days (day 3 to day 1), and g - bm was harvested on day 0. in the ss - bm group, bm bms was harvested from donors based on a target volume of 20 ml / kg. the median total nucleated cells infused into recipients were 4.2 10/kg (g - bm, range : 2.2 10 8.1 10/kg), 7.7 10/kg (g - pbsc, range : 1.8 10 22.7 10/kg), and 2.5 10/kg (ss - bm, range : 1.8 104.4 10/kg) of recipient weight, respectively. plasma or red cell depletion of the grafts was performed if any abo incompatibility was presented before infusions. all recipients received the standard preparative regimen involving cyclophosphamide (60 mgkgd 2, day 4, day 3) and total body irradiation (tbi) (5 gy / day 2, day 2, day 1). the gvhd prophylaxis included cyclosporin a (csa) and the short - term methotrexate (mtx). neutrophil recovery was defined as having occurred after the first of 3 days with an absolute neutrophil count > 500/l after the post - transplant nadir. platelet recovery was defined as the first of 7 consecutive days with a platelet count > 50,000/l without platelet transfusions. transplant - related mortality (trm) was defined as death from any cause except relapse. leukemia - free survival (lfs) was defined as the time interval from transplantation to the first event (either relapse or death). the cumulative incidence curves of gvhd, trm, lfs, and os were plotted using the kaplan meier method, and the long - rank test was used for independence comparison between variables. for all analysis, p 500/l after the post - transplant nadir. platelet recovery was defined as the first of 7 consecutive days with a platelet count > 50,000/l without platelet transfusions. transplant - related mortality (trm) was defined as death from any cause except relapse. leukemia - free survival (lfs) was defined as the time interval from transplantation to the first event (either relapse or death). overall survival (os) was calculated from the time of transplantation to death. the cumulative incidence curves of gvhd, trm, lfs, and os were plotted using the kaplan meier method, and the long - rank test was used for independence comparison between variables. for all analysis, p 0.05). iv agvhd in the g - bm group ([4.7 3.2]%) was significantly lower than that in the ss - bm group ([17.5 5.0]%, p 0.01), while there was significant differences between the g - bm and g - pbsc group ([28.4 7.80]% vs. [64.4 5.1]%, p 0.1) [figure 3d ]. a total of 33 of 60 patients (55%) died due to a variety of factors (leukemia relapse, gvhd, infections, interstitial pneumonia / idiopathic pneumonia syndrome, graft rejection, etc.) in the ss - bm group. in contrast, only 25.6% (11/43) of the g - bm group and 26.0% (32/123) of the g - pbsc group died due to the same reasons. agvhd : acute graft - versus - host disease ; cgvhd : chronic graft - versus - host disease ; hvod : hepatic veno - occlusive disease ; g - pbsc : g - peripheral blood stem cell ; g - bm : g - csf - primed bone marrow. meanwhile, there was no significant difference between aml and cml on os ([59.8 5.0]% versus [67.7 4.7]%, p > 0.05), lfs ([57.3 5.1]% vs. [66.0 4.8]%, p > 0.05), and trm ([23.7 4.4]% versus [24.1 4.4]%, p > 0.05). however, aml is associated with more leukemia relapse compared to cml ([27.7 5.1]% versus [16.4 4.2]%, p 0.05). iv agvhd in the g - bm group ([4.7 3.2]%) was significantly lower than that in the ss - bm group ([17.5 5.0]%, p 0.01), while there was significant differences between the g - bm and g - pbsc group ([28.4 7.80]% vs. [64.4 5.1]%, p 0.1) [figure 3d ]. (b) leukemia - free survival. (c) transplant - related mortality. a total of 33 of 60 patients (55%) died due to a variety of factors (leukemia relapse, gvhd, infections, interstitial pneumonia / idiopathic pneumonia syndrome, graft rejection, etc.) in the ss - bm group. in contrast, only 25.6% (11/43) of the g - bm group and 26.0% (32/123) of the g - pbsc group died due to the same reasons. agvhd : acute graft - versus - host disease ; cgvhd : chronic graft - versus - host disease ; hvod : hepatic veno - occlusive disease ; g - pbsc : g - peripheral blood stem cell ; g - bm : g - csf - primed bone marrow. meanwhile, there was no significant difference between aml and cml on os ([59.8 5.0]% versus [67.7 4.7]%, p > 0.05), lfs ([57.3 5.1]% vs. [66.0 4.8]%, p > 0.05), and trm ([23.7 4.4]% versus [24.1 4.4]%, p > 0.05). however, aml is associated with more leukemia relapse compared to cml ([27.7 5.1]% versus [16.4 4.2]%, p < 0.05). steady - state bone marrow, g - pbsc, and g - bm are the main stem - cell sources in allogeneic hsct. a number of groups have reported on the clinical outcomes of patients who received g - bm, g - pbsc, or ss - bm during hla - identical sibling hsct. these studies show that g - bm and g - pbsc resulted in significantly faster neutrophil and platelet recovery than ss - bm, which is consistent with the results presented here. however, previous studies indicated that g - bm appeared to have no advantage in survivals when compared to ss - bm. in this study, compared with patients treated with ss - bm, those patients who were treated with g - bm and g - pbsc had significantly higher os [figure 3a ] and lfs [figure 3b ]. as to trm and iii - iv grade agvhd, the incidences of patients treated with g - bm were significantly lower chance to develop agvhd and greater chance of survival than those treated with ss - bm [figure 2a and b ]. interestingly, g - bm could significantly decrease the incidences of cgvhd and extensive cgvhd, compared with g - pbsc [figures 2c and d ], which was consistent with a previous study. however, g - bm did not increase the incidences of leukemia relapse [figure 2d ]. these results clearly indicated that g - bm shared the advantages of both g - pbsc and ss - bm, which was characterized by fast engraftment, low incidences of very severe agvhd / cgvhd / trm, and high incidences of lfs / os. this report was the first study that included all three main stem - cell sources (g - bm, g - pbsc, ss - bm), and we concluded that g - bm was an excellent stem - cell source for hla - identical sibling hsct. many groups have compared the different clinical outcomes of g - bm with ss - bm or g - pbsc in hla - identical sibling hsct, however, the results have been very controversial, especially regarding the os. our study indicated that g - bm was superior to ss - bm and g - pbsc, and that a significant improvement in os was observed in the g - bm group. previous reports studied fewer patients (22, 48, and 50 patients) with shorter follow - up duration (the median time < 12 months). we have conducted the current study with more patients (226) and longer follow - up time (median time, g - bm : 60 months ; g - pbsc : 30 months ; ss - bm : 40 months), which could reach a sufficient statistical power. the second was the g - csf priming schedules. previous studies have shown that g - csf stimulation caused a 1.41.7-fold increase in cd34 + cell count, a 3-fold increase in colony - forming cells, and 5090-fold increase in short - term repopulating cells in g - bm, when compared to ss - bm. however, different priming schedules (doses and duration of g - csf administration) might cause controversial results regarding the engraftment capability of g - bm, which would in turn cause different treatment outcomes. the dose of g - csf for bm priming ranged from 5 gkgd to 12.1 gkgd and the length of g - csf treatment ranged from 2 to 5 days. in the present study, all donors received a uniformed g - csf priming schedule, which was 5.0 gkgd for 3 consecutive days. in addition, the disease status before the transplantation would have an impact on the outcome. to rule out the interference of disease status, we only included patients with de novo aml (cr1) and cml (cp1). we found that aml patients had higher leukemia relapse rates than cml, which suggested that different underlying disease before transplantation might play a role in the treatment effect of hsct. finally, the preparative regimens, the gvhd prophylaxis, and the supportive care might play a role in the outcome. we used the classic cy routine combined with fractionated tbi as preparative regimens and standard csa plus short - term mtx as prophylactic measures to prevent gvhd in all patients. the uniform management could reduce the interferences of these factors and give more credible results. further investigation is needed to address how these factors influenced the treatment effects in hsct. despite the availability of many new immune suppressive drugs and antibodies, gvhd still remained the most serious complications in hsct. to obtain the optimal results, we need to decrease the gvhd while enhance the graft - versus - leukemia (gvl) effect. to effect, a lot of approaches have been developed to minimize the gvhd, such as the depletion of t - cells in vitro and in vivo, and the introduction of suicide gene into t - cells. these approaches could decrease the incidence of gvhd, but the lower gvhd rates might be due to using of anti - thymocyte globulin, depletion of t - cells, or other factors. in this study, we found that the gvl effect in g - bm was superior to g - pbsc and ss - bm. as presented in this study, g - bm could remarkably lower the risk of gvhd (iii - iv grade gvhd, cgvhd, extensive cgvhd), and accordingly improve the survival. however, the incidence of leukemia relapse did not increase, suggesting that g - bm might be an alternative way to enhance gvl effect and lower the risk of gvhd. meanwhile, the use of g - bm in hsct might be a simple and low prices approach to separate gvhd and gvl effects which did not require additional immunosuppression drugs or special measurements. this was the first retrospective report on hla - identical sibling hsct that was conducted in a single center with all three main grafts (g - bm, g - pbsc, ss - bm). compared with previous studies, the overall clinical outcomes of g - bm, g - pbsc, and ss - bm in this study might be more credible because the number of patients was higher and the treatments (preparative regimens, gvhd prophylaxis, and supportive care) were uniform. recently, a phase 3, randomized trial comparing g - bm and ss - bm is ongoing, and another randomized multicenter study comparing g - pbsc and g - bm in patients receiving hla - identical sibling hsct is also being conducted in canada. although the corresponding results are not released yet, we believe that these studies will further illuminate the advantages of g - bm in hsct. this study has several limitations including the retrospective nature, the heterogeneous patient cohorts, and lacking of molecular typing. however, the results are remarkable because of a comparatively large number of patients with a long follow - up as well as uniform data collection. in summary, our study has provided sufficient data to conclude that g - bm is an excellent stem - cell source in hla - identical sibling hsct. g - bm transplant is characterized by fast engraftment, low incidence of severe agvhd / cgvhd, and improved survival. we recommend g - bm rather than g - pbsc or ss - bm for patients receiving hla - identical sibling hsct. meanwhile, g - bm is potentially a good stem - cell source in unrelated and haploidentical hsct, which need to be further investigated in the future. | background : steady - state bone marrow (ss - bm) and granulocyte colony - stimulating growth factor - primed bm / peripheral blood stem - cell (g - bm / g - pbsc) are the main stem - cell sources used in allogeneic hematopoietic stem - cell transplantation. here, we evaluated the treatment effects of ss - bm and g - bm / g - pbsc in human leucocyte antigen (hla)-identical sibling transplantation.methods:a total of 226 patients (acute myelogenous leukemia - complete remission 1, chronic myelogenous leukemia - chronic phase 1) received ss - bm, g - bm, or g - pbsc from an hla - identical sibling. clinical outcomes (graft - versus - host disease [gvhd ], overall survival, transplant - related mortality [trm ], and leukemia - free survival [lfs ]) were analyzed.results:when compared to ss - bm, g - bm gave faster recovery time to neutrophil or platelet (p 0.05).conclusions : g - csf - primed bone marrow shared the advantages of g - pbsc and ss - bm. we conclude that g - bm is an excellent stem - cell source that may be preferable to g - pbsc or ss - bm in patients receiving hla - identical sibling hematopoietic stem - cell transplantation. |
the seeding of tumor through cerebrospinal fluid (csf) from primary intracranial tumors is very rare, often goes undetected, and is usually identified only on autopsy. csf cytology along with magnetic resonance imaging constitutes the standard approach of diagnosing this grave condition. use of fluoro-2-deoxyglucose positron emission tomography / computed tomography (pet / ct) in indentifying spinal metastases from primary intracranial malignancies is very limited and has been reported in patients with metastatic glioblastoma multiforme and medulloblastomas. we present a rare case of metastatic anaplastic ependymoma to show the potentially clinically utility of pet / ct in diagnosing leptomeningeal or the so - called drop metastases. |
|
many urologists routinely use transrectal ultrasound (trus) for the diagnosis and staging of localized prostate cancer. however, with the widespread use of prostate - specific antigen (psa) screening, there has been a shift to earlier stages and smaller volumes at the time of diagnosis. furthermore, trus is limited in the detection of hypoechoic lesions and therefore shows a low predictive value. the probability that a hypoechoic lesion contains prostate cancer varies from 3% to 52%. most research to date has focused on the diagnostic value of hypoechoic lesions on trus, and little is known about the biological significance of hypoechoic lesions in prostate cancer. there are reports that the presence of hypoechoic lesions is associated with a higher stage on presentation, such as extracapsular invasion. however, no study currently exists on the use of hypoechoic lesion status as an independent prognostic factor. in this study, therefore, we investigated the prognostic value of the presence of hypoechoic findings on trus in patients with localized prostate cancer and evaluated biochemical progression - free survival (bpfs) rates according to the presence of hypoechoic lesions. a total of 71 patients diagnosed with pt2n0m0 disease following radical prostatectomy (rp) between january 2002 and december 2008 were enrolled in the study. of the 71 patients, the enrollment was confined to patients with pt2 disease to eliminate the impact of pathologic stage on different outcomes. patients who had undergone other treatments such as radiation therapy or hormonal therapy before or after surgery were also excluded from the subject population. patients with positive surgical margins were excluded to eliminate the confounding effects of a positive surgical margin and to identify the prognostic effects of other factors being considered. patients were divided into two groups according to the presence of hypoechoic lesions on preoperative trus as interpreted by a single experienced radiologist. the group with hypoechoic lesions was labeled group 1, whereas the group without hypoechoic lesions was labeled group 2. preoperative and postoperative characteristics including pathologic t2 substage, preoperative serum psa levels, gleason scores on biopsy, and prostatectomy specimens were compared between the two groups. microscopic extension of malignant cells, tumor involvement percentage, and perineural invasion were also examined. the pathological stage was recorded on the basis of american joint committee on cancer prostate cancer staging, 7th edition. patients were followed up and the psa level was assessed at regular intervals of about 3 months after rp during the first 2 years. biochemical failure was defined as the first occurrence of two consecutive rises in the psa level of more than 0.2 ng / ml. each variable was compared by using student 's t - test for continuous data and the chi - square test for categorical data. univariate and multivariate cox proportional hazard analyses were used to determine relevant prognostic indicators of biochemical progression. in these analyses, patients were stratified according to the psa level (9 or < 9 ml). cutoff points for the variable psa level were chosen to separate the patient populations by a median value. the bpfs rate was estimated by using the kaplan - meier curve, which compared each potential prognostic factor by using the log - rank test. among the 71 enrolled patients, 35 had hypoechoic lesions and 36 had nonhypoechoic lesions on trus. nonhypoechoic lesions consisted of either isoechoic regions or unidentifiable lesions, and hyperechoic lesions were excluded. preoperative baseline characteristics were identical between the two groups (table 1). when group 2 was divided according to clinical stage, 14 of the 36 patients had clinical t2 disease (38.88%), and the others had clinical t1 disease. as for postoperative parameters such as the gleason score of the prostatectomy specimen, the percentage of tumor involvement, and the presence of perineural invasion, there were no significant differences between the two groups (table 2). the median follow - up period was 44.49 months in group 1 and 38.81 months in group 2. the bpfs rate over the first 24 months was 97.0% in group 1 and 97.1% in group 2. however, divergence after 48 months significantly widened, to 75.3% vs. 91.7%, respectively. group 1 had an overall shorter progression - free survival period than did group 2 (fig. 1). during the follow - up period, clinical failure was observed in 4 cases. in group 1, l - spine metastasis was observed in two cases at 45 and 54 months after the operation and urethrovesical anastomosis site recurrence was observed in one case at 35 months after rp. one case of l - spine metastasis was observed at 38 months after the operation in group 2. to assess the prognostic value of each variable, univariate and multivariate analyses were carried out with the cox proportional hazard model. in the univariate analysis, preoperative psa level and the presence of hypoechoic lesions had prognostic significance (table 3). age, body mass index, prostate volume, pathologic gleason score, and pt2 substage did not have prognostic significance. as shown in table 3, however, preoperative psa level and presence of hypoechoic lesions, which were shown to be significant in the univariate analysis, were not of statistical significance in the multivariate analysis. few studies have examined the potential utility of hypoechogenicity, a trus - related indicator of potentially cancerous lesions in the prostate, as a prognostic factor. we chose to focus on the prognostic value of hypoechoic lesions because, considering that only 3% to 52% of prostate cancers show hypoechoic lesions, its value as a diagnostic marker is limited, and we thought it appropriate to focus instead on its value for evaluation of disease progression. furthermore, ohori. noted that hypoechoic cancers were more likely to show extraprostatic extension, to have a poorly differentiated component, and to be nondiploid compared with isoechoic cancers. however, these studies showed only that hypoechoic lesions were related to more advanced stage disease and did not focus on its value as a prognostic factor. we restricted the subject population to patients with stage pt2n0m0 disease ; furthermore, to control the effects of bpfs, patients with positive postsurgical margins were excluded.. showed no significant difference in bpfc for t1c tumors that were visible on sonography. however, they included all hypoechoic, isoechoic, and hyperechoic lesions that were visible on sonography as cases and thus did not exclusively examine hypoechoic lesions, as was done in the present study. preoperative psa, gleason score, and tumor - node - metastasis stage are well - known prognostic parameters [7 - 9 ]. caso., in their study on postprostatectomy biochemical recurrence in each of the substages in pathologically confirmed t2 lesions, stated that the substages of t2 were of significance only on univariate analysis and that the most important factors were psa and the status of the surgical margins. however, in our study, the univariate analysis differed in that only preoperative psa and the presence of hypoechoic lesions were correlated with the prognosis of prostate cancer. as shown in fig. 1, no significant difference in bpfs was observed 30 months after the operation, but a subsequent divergence in bpfs became evident later. considering that gleason 's score and other parameters such as perineural invasion and the percentage of tumor involvement did not differ significantly between the two groups during this period, it is possible that there are other factors yet to be isolated. we assume the reason prostate cancer with hypoechoic lesions has a worse prognosis than other prostate cancers may be because hypoechoic prostate cancers have molecular markers related to prognosis and nondiploid dna. a recent study showed that cases positive for the antibodies s0456, ep1972 - 1, s0725 m, and s5073, which are directed against the protein products of the genes hey2, stmn1, cyp4z1, and cdh1, had poorer prognosis than did those that were negative for these antibodies. although the study did not deal with hypoechoic lesions on trus, the authors speculated that such molecular markers may be detected in prostate cancer with hypoechoic lesions. in addition, the absolute volume of the tumor can influence the detection rate of hypoechoic lesions, and the volume itself may be a prognostic factor on trus. also, because it has already been shown that digital rectal examination (dre) palpation is a prognostic factor, we think it will be relevant to study its relationship with hypoechoic lesions on trus. regrettably, this study did not examine the tumor volume or dre palpation findings. in the current study, univariate analysis and kaplan - meier curves showed that hypoechoic lesions were of prognostic significance for prostate cancer. nevertheless, the statistical significance observed in the univariate analysis and kaplan - meier curves suggest that the presence of hypoechoic lesions on trus images may hold at least some importance as a prognostic factor for prostate cancer. second, we did not review the dna findings through dna analysis and molecular marker analysis to support our hypothesis on the biochemical significance of hypoechoic lesions. further studies involving larger subject populations appear to be necessary to fully evaluate the significance of the presence of hypoechoic lesions as a prognostic factor. localized prostate cancers that present preoperatively with hypoechoic lesions on trus were associated with worse prognostic characteristics than were prostate cancers with no hypoechoic lesions. however, such sonographic findings were shown to have no value as a prognostic factor. to further certify the results of this study and to investigate the associated underlying biological mechanisms, a larger - scale study on this subject is needed. | purposethe purpose of this study was to investigate the value of hypoechoic lesions on transrectal ultrasound (trus) as a prognostic factor for patients with localized prostate cancer.materials and methodsthe patients consisted of 71 patients with pt2n0m0 disease following radical prostatectomy between 2002 and 2008. the group with hypoechoic lesions was labeled group 1, whereas the group without hypoechoic lesions was labeled group 2. the presence of hypoechoic lesions on preoperative trus was analyzed as a prognostic factor along with several parameters, including preoperative factors and pathologic factors. the biochemical progression - free survival (bpfs) rate was compared between the two groups according to the presence of hypoechoic lesions on trus.resultsa total of 35 patients had hypoechoic lesions on trus, whereas 36 had no hypoechoic lesions. preoperative baseline characteristics were not significantly different between the two groups. in the univariate analysis, bpfs showed significant differences according to the presence of hypoechoic lesions on trus and the preoperative prostate - specific antigen level. the bpfs rates over the first 24 months were 97.0% in group 1 and 97.1% in group 2 ; however, the difference in the bpfs rate over 48 months significantly widened to 75.3% compared with 91.7%, respectively. despite this finding, no significant independent prognostic factor for bpfs was found on multivariate analysis in this patient cohort.conclusionsthe presence of hypoechoic lesions on trus may suggest worse prognostic characteristics in pt2 prostate cancer. further studies involving larger subject populations are needed to corroborate the significance of the presence of hypoechoic lesions as a prognostic factor. |
nearly, 200,000 malaria cases are reported each year in bangladesh for population of 140 millions. malaria transmission in bangladesh is mostly seasonal and limited to the border regions with myanmar in the east and india in the north (figure 1). out of country 's 6 administrative divisions (containing 64 districts), dhaka, sylhet, and chittagong (12 districts) these 3 divisions contribute nearly 98% of the total bangladesh malaria morbidity and mortality statistics reported each year [7, 8 ]. around 27 million people (20% of the total bangladesh population) live in malaria endemic area [9, 10 ]. three principal environmental factors for mosquito activity and malaria transmission are important : temperature, humidity, and rainfall [11, 12 ]. temperatures within the range of 20c30c affect malaria transmissions in several ways : (a) development of anopheles is shortened (b) biting capacity of mosquitoes is increased, and (c) mosquitoes survive long enough to acquire and transmit the parasite. temperatures lower than 16c or higher than 30c have a negative impact on the growth of the mosquitoes. mosquitoes breed in water habitats, thus requiring just the right amount of precipitation in order for mosquito breeding to occur. the effect of rainfall on the transmission of malaria is very complicated varying with the circumstances of particular geographic regions and depending on the local habits of mosquitoes. anopheles dirus (ad) females stay active during the period when precipitation exceeds 50 mm per month. however, a combination of large rainfall and hot weather during june august might reduce mosquito activity. rainfall also affects malaria transmission because it increases relative humidity and modifies temperature, and it also affects where and how much mosquito breeding can take place. plasmodium parasites are not affected by relative humidity, but the activity and survival of anopheline mosquitoes are. high relative humidity allows the parasite to complete the necessary life cycle, so that it can transmit the infection to several persons. if the average monthly relative humidity is below 60%, it is believed that the life of the mosquito is so shortened that there is no malaria transmission. monthly temperature and humidity are stable from year to year (variations are 1c and 1%, resp.), but precipitation has substantial interannual variability. human malaria is caused by four different species of the protozoan parasite plasmodium : plasmodium falciparum, p. vivax, p. ovale, and p. malariae. bangladesh has only plasmodium falciparum (70%) and plasmodium vivax (30%) [1, 17, 18 ]. in this study, we consider both types of malaria, plasmodium falciparum and vivax. three data types were used in this study : malaria epidemiological statistics, satellite data, and meteorological data from ground stations. malaria statistics were collected from the directorate general of health, bangladesh 's ministry of health from 1992 to 2001. malaria data were represented by annual number of people with fever tested in local hospital. standard blood slide examination was done by a medical officer trained in malaria microscopy, according to the who guidelines, and slide readers were blinded to the clinical diagnoses. ten percent each of the positive and negative slides were reexamined blindly by the national malaria reference laboratory to evaluate the accuracy of our study 's slide examination results. the diagnostic criteria were fever or history of fever within the last 48 hours ; an absence of signs of other disease ; inadequate antimalarials (or none) during the 4 weeks prior to present illness. the hospital data were aggregated by local administrative unit health centers and further by administrative districts [16, 19 ]. available malaria statistics are the number of patients (patient 's total pt) whose blood sample was tested for malaria and the number of positive malaria cases (pmcs). finally, the number of malaria cases was expressed in percent as (pmc / pt)100. the dynamics of annual pt and pmc for bangladesh during the investigated period are shown in figure 2. the gvi is produced by sampling and mapping the 4-km daily radiance in the visible (ch1, 0.580.68 m), near infrared (ch2, 0.72l.1 m), and thermal band (ch4, 10.311.3 m and ch5, 11.312.3 m) measured on board noaa polar - orbiting satellites, to a 16-km map. these maps, including the normalized difference vegetation index, ndvi = (ch2 ch1)/(ch2 + ch1), solar zenith angle, and satellite scan angle, are composited over a 7-day period. the vegetation health (vh) indices were developed from normalized difference vegetation index (ndvi) and brightness temperature (bt). the data processing included removal of high - frequency noise from the annual time series of ndvi and bt, approximation of annual cycle, calculation of multiyear climatology, and derivation of vh. high - frequency temporal noise in ndvi and bt related to fluctuating transmission of the atmosphere, sun / sensor geometry, bidirectional reflectance, random noise, and others was removed by statistical smoothing of ndvi and bt annual time series for each pixel during the entire period using a combination of median filter and least square technique. climatology of nvdi and bt seasonal cycle was approximated by multiyear maximum (max) and minimum (min) weekly values taken from the smoothed data. the max and min for each pixel and week were calculated from twenty years of historical gvi data. the (max min) criterion was used to describe and classify weather - related ecosystem 's carrying capacity, and therefore, it represented the climatology of those extreme weather - related fluctuations in ndvi and bt. the ndvi- and bt - derived weather component was expressed as the vegetation and temperature condition indices (vci / tci). equations (1) and (2) show numerical approximation of vci and tci (1)vci=100ndvindviminndvimaxndvimin,(2)tci=100btmaxbtbtmaxbtmin, where ndvi, ndvimax, and ndvimin (bt, btmax, and btmin) are smoothed weekly ndvi (bt) and their multiyear absolute maximum and minimum, respectively ; the vci and tci change from 0 to 100, reflecting changes in moisture and thermal conditions from extremely unfavorable (vegetation stress) to optimal (favorable) ; the vci and tci values around 50 estimates near normal conditions and values 50 or larger vegetation greenness, (1)). this confirms that in average wet climate excessive rainfall during monsoon season negatively affects mosquito activity and their ability to transmit malaria. regarding thermal conditions, larger number of malaria cases (dy is above the trend) is associated with tci greater than 50, which indicates cooler weather (see (2)). smaller number of malaria cases (dy below trend) is associated with lower tci (below 50, hotter weather, (3)). therefore, the investigation of vci and tci as predictors was performed for all three malaria divisions. correlations between dy (percent of malaria data) and deviation from mean temperature dt, deviation from average rainfall dr, and deviation from relatively mean humidity dh are shown in figure 5. figure 5 shows that all the selected parameters : temperature, rainfall, and relative humidity obtained from the network of ground - based meteorological stations are poorly correlated with the trend of actual malaria cases, and none of these parameters can be a proxy for the malaria trend for the period of 19911999. majority of annual malaria cases occur in summer. therefore, correlating annual malaria cases with vh and meteorological data pursued two goals : (1) if timing (summer) of the highest correlation is right, (2) if the correlation for this period is strong, (3) if before summer and after summer the correlation is not strong, and (4) if transition from spring to summer and from summer to fall is gradual. following figure 4, (correlation with vh) these four goals were met because vh indices are assessing cumulative conditions (have some memory). following figure 5 (correlation with decadal meteorological indices), all four goals were not met because p, t, and rh are not showing cumulative conditions (do not have memory). the result of correlation analysis in the figure 4 was used to develop regression equations. several options were investigated using either tci (thermal condition) or vci (moisture condition) only or both indices for the weeks of the highest correlation [10, 19 ]. general form of regression equation when both indices were used is written bellow (5)dp = a0+a1tcii+a2vcii, where a0, a1, and a2 are coefficients, i is the week number, and dp is predicted number of malaria cases (%) deviation from trend. the tested variables are presented in table 1 with the corresponding multiple correlation coefficients (mccs), root mean square error (rmse), and f criteria. analysis indicates that for the two minor divisions (dhaka, sylhet), the mcc is not much different than for individual weeks, but rmses are quite large (30%35%). such high errors could be expected since the area of minor divisions is very remote ; population is not large and spread much over diversified ecosystems and environmental conditions. in spite of large rmse, several models were selected for further analysis. for dhaka division, models 2 and 3 showed slightly higher mcc and lower rmse than others. model 3 has some advantages in terms of early indication (week 28) of possible malaria epidemic. for the sylhet division, model 3 for chittagong division, the best models based on the mcc, rmse, and f parameters were numbers three and four. model four (tci26 and tci30 predictors) provides slightly larger mcc and smaller rmse. final equations of the best accepted models for the three malaria prone divisions are shown in table 2. in addition to analysis of mcc, rmse, and f, we also used t - test for regression coefficients with a significance of 5% and 10%. following table 1, for chittagong division, model four was selected as the best since t - test value 1.58 for predictor tci26 was higher than critical value (1.38) with 10% significance. it is interesting to note that when tci and vci for the same week 26 were selected as predictors in model 3, the performance of statistically significant predictor tci26 deteriorated compared to model 4. regarding dhaka and sylhet models, second, predictor (tci41 and tci39 correspondingly) showed statistical significance at 5% critical value. since the training data is short, the jackknife technique was used as validation tools. for each model, one year of malaria and satellite data were excluded from the 19922001 dataset. a model (q = f(vci, tci)) was developed with one year out and this model was applied to the removed year to predict the number of malaria cases deviating from trend (q) based on satellite data of the eliminated year. then, the eliminated year was returned to the data set and the next year was removed for model development and testing. each year data were removed one at a time and the candidate model was fit nine times to the eliminated year. as the result of this procedure, nine independent predictions were obtained, where f is an arbitrary function. finally, in each of the predictions, the number of malaria cases (p) for the eliminated year (i) was estimated from equation (5). in addition, the coefficient of determination (r) for the numbers of independently predicted and observed malaria cases, the bias (b), percentage of relative bias (rb percent), and root mean square error (rmse) for this year was estimated using (6), (7), and (9) (6)pi = ytrend(qi100),(7)bi = piyi,(8)rbi=(bib)100yi,(9)rmse=i=110(bi)210, where p is predicted malaria cases (%) ; b is average bias for all years ; rmse is a measure of the precision of the predicted value and should be as small as possible for unbiased precise prediction. models were independently tested, 3 and 4 for chittagong and 3 for dhaka and sylhet divisions (table 3). in the estimation of models performance estimation we followed such rules : (1) for the entire model r greater than 70 and rmse less than 15% ; (2) for individual years bias (b) less than 2% and relative bias (rb) less than 10%. the independently validated results presented in table 3 and figure 6 show that for the entire models r and rmse criteria have been met for chittagong (model 3) and dhaka. however, the analysis of annual model 's performance showed that only chittagong models perform reliably. in 8 years for chittagong division, regarding models for minor malaria regions, the annual results of testing are negative, since as seen in table 3, rb indicates strong deterioration of model 's performance after 1996 (sylhet rb was 8%16% and dhaka rb was 19%33%), while prior to 1996 a rb was 50% less. such explanation can be because bangladesh government developed very comprehensive measures to combat malaria in sylhet and dhaka. during 19962001, this resulted in a considerable reduction of malaria cases (as shown in figure 3), so the data must be interpreted with caution because of the decline in surveillance activities in the country over the past few years (who 1999). bangladesh government has also undertaken malaria - fight measures in 13 districts from chittagong, sylhet, and dhaka divisions. however, the effectiveness was not as good as in the minor malaria region because a large number of people were exposed to malaria, especially among poor in chittagong division (93% of the entire bangladesh people were affected). smaller effectiveness of malaria combat measures is also indicated by an increase in the number of malaria cases during 19922001 (as shown in figure 3). it would be important to emphasize that although chittagong models met both performance criteria (for the entire model and individual years) in some years b, and rb exceed the threshold 's level. in 1997 (rb = 11%), models for chittagong overestimated the number of malaria - affected people. first, we should emphasize that 1997 was a strong el nio year (positive sea surface temperature anomaly in the tropical pacific) [24, 25 ]. as a result, the southeastern monsoon in bangladesh was delayed by one month resulted in a long period of extremely hot and dry weather. figure 7 shows tci and vci dynamics in chittagong. during the investigated years, severe drought (tci = 1530) developed from june through october. such conditions produced much stronger impact on mosquito development, disrupted reproductive mosquito cycle, and intensified malaria transmission, which resulted in smaller number of malaria cases compared to the prediction. to characterize such extreme conditions, model 's predictors should characterize longer period (several weeks and even months), which is not possible now due to a limited statistical sample. it is shown in the presented study that such parameters as the amount of rainfall relative humidity and temperature obtained from the network of ground meteorological stations can not be used as proxies for malaria trend in the three divisions of bangladesh. it is also shown here that the satellite data and in particular avhrr - based vh indices (vci and tci) are highly applicable as proxies for the malaria trend assessment and also for the estimation of the total number of malaria cases in divisions of bangladesh for the period from 1991 to 2001. | relationships between yearly malaria incidence and (1) climate data from weather station and (2) satellite - based vegetation health (vh) indices were investigated for prediction of malaria vector activities in bangladesh. correlation analysis of percent of malaria cases with advanced very high resolution radiometer- (avhrr-) based vh indices represented by the vegetation condition index (vci moisture condition) and the temperature condition index (tci estimates thermal condition) and with rainfall, relative humidity, and temperature from ground - based meteorological stations. results show that climate data from weather stations are poorly correlated and are not applicable to estimate prevalence in bangladesh. the study also has shown that avhrr - based vegetation health (vh) indices are highly applicable for malaria trend assessment and also for the estimation of the total number of malaria cases in bangladesh for the period of 19922001. |
exposure to environmental tobacco smoke (ets), which is largely composed of the sidestream cigarette smoke, has been implicated in increased incidence of cancer among nonsmokers. the present study was conducted to compare the potential of mainstream and sidestream cigarette smoke to induce dna adducts in mice. groups of female c57bl and dba mice were exposed twice daily for 65 - 70 weeks to mainstream or sidestream smoke from the university of kentucky reference cigarettes (2r1) in a nose - only exposure system. animals received a total particulate matter dose of about 16 and 6 mg / kg body weight / exposure and exhibited blood carboxyhemoglobin levels of about 16 and 34%, for mainstream and sidestream smoke - exposed groups, respectively. pulmonary aryl hydrocarbon hydroxylase (ahh) activity was induced by about 2- to 3-fold in both mainstream and sidestream groups of c57bl and in mainstream smoke - exposed group of dba mice, but not in sidestream smoke - exposed dba mice. an analysis of total dna adduct levels by the 32p - postlabeling assay showed a significant (12- to 25-fold) increase in the magnitude of preexisting lung dna adducts in both mainstream and sidestream smoke - exposed c57bl and dba mice. smoke exposures did not affect the total preexisting dna adducts in liver of either strain. it is concluded that both mainstream and sidestream smoke are capable of enhancing preexisting dna adducts in the lungs of chronically smoke - exposed mice.imagesfigure 3. |
|
in the past few decades, optical biosensors have been developed for applications in food industry, biomedical assay, and monitoring of environmental elements and changes.13 a great deal of effort has been made on developing various techniques for biomedical assays that use detection labels such as fluorophores to attach target molecules for specific4 and quantitative detection.5,6 however, it was known that a label - assisted assay revealed several drawbacks, such as an operation time that did not permit real - time assay, relatively high costs, and lack of reproducibility due to an inevitable assay dependence on operators.7,8 alternatively, a label - free assay, which could replace a need of using such labels by utilizing the conversion of interaction of the target molecules with their sensor surface into a transducer signal, has been highlighted, and a variety of its detection platforms have been reported for the clinical diagnosis.912 label - free biosensors that may support real - time assay could secure the specific detection of target molecules usually by resorting to their bio - affinity reactions or immunoreactions.2,13,14 one of the most widely used label - free bio - assays was optical biosensing with surface plasmon resonance1517 (spr), due to sufficiently high sensitivity and signal - to - noise ratio, and immunity to external electromagnetic disturbance. spr is a resonant optical phenomenon occurring at an interface between a metal and a dielectric (eg, an aqueous medium), as a result of optical phase matching between evanescent waves of high propagation constant provided by attenuated total reflection (atr), and nonradiative surface plasmon surface waves at the interface. this phase - matching condition, which governed the resonant coupling between those waves, can be altered sensitively with the refractive index of a dielectric in creating spr occurrences at the interface with a metal. this resonant coupling condition could be served as a sensing principle for highly sensitive detection of concentration of target molecules in a quantitative and real - time manner. recently, fiber optical spr sensors have been demonstrated and brought considerable interest, owing to their miniaturized and simple structures, and their potential usability, as remote sensors with high sensitivity and wide dynamic range.1822 however, a place where such remote sensors can be installed may not permit frequent replacement of sensor heads due to the limited accessibility, such as cosmic space, underground, and deserted lands with required sensor reusability. recently, histidine - tagged peptide (hp) on transition metals, such as cu and ni, was used to demonstrate the immobilization of peptides or proteins without a covalent cross - linker, and hp could be dissociated from the metal by imidazole23 (i m). this property led us to attempt to regenerate an spr sensor surface, consisting of multilayers of a peptide, an antibody, and target proteins. extensive researches have shown that human plasma fibrinogen (fbg) could be considered one of the possible biomarkers for estimating risks of atherosclerosis,24,25 car diovascular diseases,26,27 and alzheimer s disease.28 it was also known that the elevated levels of plasma fbg enabled the prediction of myocardial infarction and strokes.29,30 there were several methods to measure fbg concentration, such as clauss method, which relied on measuring thrombin clotting time for fbg concentration.31 however, it was known that this method did not allow the quantification of fbg concentrations in a real - time manner. in this paper, we demonstrate a regenerative fiber optical spr biosensor for immunoassay with its metal composite (ag al ni) sensor surface for the quantitative real - time detection of fbg concentrations. the heterogeneous metal layers were coated for high sensitivity, wide dynamic range of detection, and regeneration of the sensor surface. we immobilized a hp layer on the ni surface for subsequent adsorption of fbg antibody (immunoglobulin g [igg ]), which could capture fbg molecules specifically. we monitored the successive adsorption of each layer of a hp, an igg, and a human plasma - extracted fbg in a real - time and quantitative manner. we also demonstrated that the sensor surface could eventually be regenerated (> 95%) by removing the immobilized hp layer with i m and additional acetic acid (act). the regeneration of ni surface demonstrated the enhanced capability of multiple measurements of target molecules on the same sensor head. this removes the need for replacement of a sensor head for another assay of different targets, and thus eliminates possibility of substantial change in light - coupling efficiency into the sensor head. the current regenerative spr biosensor could find potential applications for use in places with limited accessibility for replacing sensor head. (kwangju, south korea), while an igg was purchased from emd millipore (billerica, ma, usa). purified human fbg was purchased from sigma - aldrich co. (st louis, mo, usa). blocking buffer solution (b) was prepared for minimizing the nonspecific binding of injected fbg to the hp layer, according to the block ace (abdserptec) instruction. all agents used were diluted with phosphate - buffered saline with tween 20 (pbst ; ph 7.4) obtained from sigma - aldrich co. a multimode optical fiber (jtflh - polymicro technologies) with core diameter of ~200 m was used to fabricate an spr sensor head. a soldering machine was used to remove the polymer cladding of 5 cm length, and the subsequently exposed core surface was cleaned with solutions of ethanol and acetone for assuring the removal of remaining cladding substance. using a thermal evaporator, the metal layers of ~36 nm thickness with ag and ~4 nm thickness with al were sequentially coated on the exposed fiber core for spr excitation.22 then, the radio - frequency magnetron sputter was used to deposit an ni layer of 1 nm thickness, which should not significantly affect the spr condition, determined by the coated ag and al. a flow cell was made of polydimethylsiloxane in a circular shape with two ports for the inlet and outlet of flowing solutions. figure 1a shows the schematic of the experimental setup for label - free optical biosensing, based on output power measurement. he ne laser was used as light source at a wavelength of 632.8 nm. laser light was coupled into the multimode optical fiber by an aspheric lens of a numerical aperture of 0.47 with its focus length of 4 mm. the acceptance angle of the fiber was ~21.72. light propagation through the clad - free fiber core of 5 cm length interfaced with coated layers of metals and supported multiple atrs, and the injected solutions that flowed from an inlet to an outlet were expected to cause changes in output optical power, due to the spr condition change. the fiber output light was collimated by an aspheric lens of a numerical aperture of 0.53. use of a power meter connected to a computer enabled us to measure fiber output power and recorded corresponding power meter signals at a sampling rate of 20 hz for a real - time monitoring. figure 1b and figure 1c show that the metal coating was made in an asymmetrical manner by evaporating the metals on two opposite sides of an exposed fiber core.22 thus, at least half the light that coupled into the fiber could be used for spr excitation by using a circular polarization of input light theoretically, which could be prepared by placing a quarter - wave plate (/4) before the fiber. decreased output power was observed as solution was injected into the flowing channel, due to enhanced atr, which was governed by an spr phase - matching condition, given by : ncoresinin = re[msm+s](1)where ncore was the fiber core refractive index, and in was the incidence angle of light at a boundary between fiber core and coated metal. m and s were relative permittivities of the metal composite and a dielectric (an aqueous medium to be sensed) on the outermost metal (ni), respectively. the range of incidence angle at the core / cladding interface for total internal reflection was approximately 7690. the immobilization of injected substance caused increases in s of the dielectric, leading to increased attenuation of reflected light off the fiber core. it was known that the surface wave amplitude from the metal / dielectric interface decreased exponentially normal to the interface with a characteristic decay length z, as given by the following equation.32 z=2(m+ss2)1/2(2)where was the wavelength of light in vacuum, and m was the real part of m. for a dielectric value of a refractive index ranging from 1.33 (water) to 1.38 (bovine serum albumin),33 z could be estimated as ~215.8233.3 nm, indicating the capability of detecting multilayers of bio / chemical molecules, including peptides and proteins on the metal. (kwangju, south korea), while an igg was purchased from emd millipore (billerica, ma, usa). purified human fbg was purchased from sigma - aldrich co. (st louis, mo, usa). blocking buffer solution (b) was prepared for minimizing the nonspecific binding of injected fbg to the hp layer, according to the block ace (abdserptec) instruction. all agents used were diluted with phosphate - buffered saline with tween 20 (pbst ; ph 7.4) obtained from sigma - aldrich co. a multimode optical fiber (jtflh - polymicro technologies) with core diameter of ~200 m was used to fabricate an spr sensor head. a soldering machine was used to remove the polymer cladding of 5 cm length, and the subsequently exposed core surface was cleaned with solutions of ethanol and acetone for assuring the removal of remaining cladding substance. using a thermal evaporator, the metal layers of ~36 nm thickness with ag and ~4 nm thickness with al were sequentially coated on the exposed fiber core for spr excitation.22 then, the radio - frequency magnetron sputter was used to deposit an ni layer of 1 nm thickness, which should not significantly affect the spr condition, determined by the coated ag and al. a flow cell was made of polydimethylsiloxane in a circular shape with two ports for the inlet and outlet of flowing solutions. figure 1a shows the schematic of the experimental setup for label - free optical biosensing, based on output power measurement. he ne laser was used as light source at a wavelength of 632.8 nm. laser light was coupled into the multimode optical fiber by an aspheric lens of a numerical aperture of 0.47 with its focus length of 4 mm. the acceptance angle of the fiber was ~21.72. light propagation through the clad - free fiber core of 5 cm length interfaced with coated layers of metals and supported multiple atrs, and the injected solutions that flowed from an inlet to an outlet were expected to cause changes in output optical power, due to the spr condition change. the fiber output light was collimated by an aspheric lens of a numerical aperture of 0.53. use of a power meter connected to a computer enabled us to measure fiber output power and recorded corresponding power meter signals at a sampling rate of 20 hz for a real - time monitoring. figure 1b and figure 1c show that the metal coating was made in an asymmetrical manner by evaporating the metals on two opposite sides of an exposed fiber core.22 thus, at least half the light that coupled into the fiber could be used for spr excitation by using a circular polarization of input light theoretically, which could be prepared by placing a quarter - wave plate (/4) before the fiber. decreased output power was observed as solution was injected into the flowing channel, due to enhanced atr, which was governed by an spr phase - matching condition, given by : ncoresinin = re[msm+s](1)where ncore was the fiber core refractive index, and in was the incidence angle of light at a boundary between fiber core and coated metal. m and s were relative permittivities of the metal composite and a dielectric (an aqueous medium to be sensed) on the outermost metal (ni), respectively. the range of incidence angle at the core / cladding interface for total internal reflection was approximately 7690. the immobilization of injected substance caused increases in s of the dielectric, leading to increased attenuation of reflected light off the fiber core. it was known that the surface wave amplitude from the metal / dielectric interface decreased exponentially normal to the interface with a characteristic decay length z, as given by the following equation.32 z=2(m+ss2)1/2(2)where was the wavelength of light in vacuum, and m was the real part of m. for a dielectric value of a refractive index ranging from 1.33 (water) to 1.38 (bovine serum albumin),33 z could be estimated as ~215.8233.3 nm, indicating the capability of detecting multilayers of bio / chemical molecules, including peptides and proteins on the metal. figure 2 schematically illustrates the procedures for fbg sensing, which cover from the sensor surface treatment to the surface regeneration. then, hp (1 g / ml) was injected for immobilization on the ni surface (1). the coordinate metal bonding of i m with ni through nitrogen electrons enabled hp to be immobilized. we used fbg antibody for stable bonding of fbg with the surface, even in the presence of surface washout using pbst buffer. this igg can also be used for selective bonding with fbg in cases where various other kinds of proteins are present together, which was not our case. we injected fbg antibody, igg (0.375 g / ml concentration, enzyme - linked immunosorbent assay dilution procedure 4,000 times) into the flow cell for igg immobilization on hps through peptide peptide interaction (2). to prevent the nonspecific binding of fbg molecules to sites other than igg, the sensor surface was passivated by b (0.4%, volume - to - volume ratio) (3) before immobilization of fbg on the igg (4). note that injection of each layer of hp, igg, b, and fbg was followed by respective incubation of ~30-minute duration. again, a pbst solution was injected to wash away weakly bound molecules after each incubation. for the regeneration of the ni surface, i m (20 mm) was injected to eliminate hp (5), and the final regeneration of the ni surface (7) was performed with 1 m act and pbst (6). the ni surface regeneration could be checked by comparing the output power level of the fiber sensor between before (1) and after (6). in addition, the whole procedures (1)(6) were repeated using the so - called regenerated ni surface, to confirm the same (or similar) pattern of the sensor output signal in the repeats of identical procedures. figure 3a shows the measured fiber output power in a real time, as a series of liquids of pbst, hp, igg, b, four different concentrations of fbg, i m, act, and pbst were injected successively. injection of the series of liquids was followed by another set of injections of the same series of liquids as mentioned earlier. in both series of injected liquids, four different fbg concentrations, that is, 10 ng / ml, 100 ng / ml, 500 ng / ml, and 1,000 ng / ml, were used. each circular point in figure 3a represents the averaged value of sensor output power over 1 minute. note that fbg of lower concentration was injected before injection of higher concentration, to clarify the signal change due to the lower concentration. this led us to estimate that, for example, the total signal change induced by injection of 500 ng / ml fbg should be the sum of those induced by 10 ng / ml, 100 ng / ml, and 500 ng / ml owing to the series of injection. it was visible that injection of each liquid tended to cause rapid decreases in the sensor output, and the following incubation saturated the output to the stabilized one. the insets of figure 3a display the stabilized sensor output (over ~15 minutes) for each fbg concentration. the incubation time for a certain liquid immobilization could be defined as the time interval between the liquid injection and the start of the stabilized signal. the incubation time for hp, igg, and fbg from the measurement was estimated, as shown in table 1. as expected, larger changes in the sensor output power were observed from higher fbg concentrations. note that successive injections of i m, act, and pbst recovered the sensor output level nearly to that of the sensor output at initial state. thus, the successive second regeneration of the sensor metal surface of the same fiber was demonstrated. this indicated that the layers of hp, igg, and fbg were physically removed successfully, since the fiber sensor was sensitive only to refractive indices of media on the sensor metal surface. figure 3b shows atomic force microscopy images displaying physical regeneration of the ni surface on the fiber sensor head, using i m, act, and pbst. it was also worth noting that the similar behavior of the observed sensor responses in the second series of liquid injection in comparison to the first series implied that the regenerated metal surface of the fiber sensor could support for a chemically reusable sensing platform, as well as physically reusable one. the standard deviation of the sensor output power was measured (over 10 minutes time span) at the time just before the first fbg was injected for each series of liquid injection. this meant that the standard deviation was obtained when pbst, hp, igg, and b were present on the sensor metal surface. this standard deviation represented the sensor noise level (), which was used to estimate its detection limit34 (slim). slim=(3)(c/p)(3)where c was the concentration of fbg, and p was the sensor output power level. the slim for the first - series injection was estimated to be approximately 3.40 ng / ml, corresponding to fbg concentration of ~10 pm. slim for the second - series injection was 11.21 ng / ml (32.97 pm). this difference was associated with the incomplete regeneration of the sensor metal surface as shown in table 2. we believe that the imperfection of regeneration resulted from incomplete removal of hp and remaining plasma proteins adsorbed nonspecifically on it. in addition, there is a possibility that the used acid may change the metal surface state. the sensor platform presented allowed the detection limits which were comparable to a conventional enzyme - linked immunosorbent assay method35 or a typical spr sensor system based on the prism - coupled kretschman raether configuration. the estimated detection limits were believed to be lower than that required for diagnosis of the aforementioned diseases. moreover, these detection limits for specific detection of fbg were lower than that using raman spectroscopy36 or comparable to those reported using local spr excited by nanoparticles.37,38 figure 4 shows the differential changes in the sensor output power as a function of fbg concentration by averaging measured data obtained with all fbg concentrations of both series of liquid injections. note that nonzero four concentrations of 10 ng / ml, 100 ng / ml, 500 ng / ml, and 1,000 ng / ml were used in a row. this means that the ultimate concentrations that caused signal to change from that immediately before the first concentration injection must be reestimated as accumulated ones, that is, 10 ng / ml, 110 ng / ml, 610 ng / ml, and 1,610 ng / ml. in this regard, note that the concentration range of fbg relied not only on detection device characteristics but also on the concentration of fbg antibody (igg) immobilized on the sensing surface. it is generally seen that the more the concentration of igg immobilized is, the wider the concentration range of fbg detected is. higher concentrations produced larger changes in the output power in an approximately linear fashion. however, the plot showed nonlinear behavior at around the lowest concentration (10 ng / ml), accounting for the steeper slope of the sensor signal change with respect to the fbg concentration change. this is due to the fact that higher intensity of spr wave was present at region closer to the metal surface. the use of hp for antibody immobilization onto ni surface could offer several benefits to the sensing surface treatment for a label - free optical immunoassay, as described in the following. first, the use of hp could allow simultaneous removal of a pair of a target protein and its antibody, leading to the regeneration of the sensor metal surface. as described earlier, i m with act and buffer solution (pbst in this work) could efficiently eliminate hp, the antibody igg, and fbg (target protein) in recovering ni surface for sensor reusability. as shown in figure 5, nitrogen (n), the electron donor of the i m ring of histidine molecules, formed the coordinate metal bonds with ni. a carboxyl acid group of the peptide side of hp was responsible for its bonding with an antibody igg. for the regeneration of ni surface, we injected i m (20 mm with 10-minute incubation) to break hp bonds with ni. this enabled subsequent elimination of i m molecules away from the ni surface, and therefore, a pair of igg and fbg would be washed away from the sensor surface by flowing act and pbst. secondly, hp could be used to immobilize different kinds of antibodies through engineering of its constituent peptides, thus supporting its applicability to various proteins sensing in a label - free biosensor. lastly, the use of hp could enable one to avoid denaturalization of a sensor metal surface, which may be encountered when whole metal surface was treated with toxic chemical cross - linker.39,40 table 2 illustrates the degrees of regeneration of the metal surface, which represents how close was the signal (sensor output power) recovered from binding of the last fbg concentrations toward the original (start) signal (before hp injection), as a result of injection of i m, act, and pbst. in the first series of liquid injection, ~77% signal recovery was achieved by i m injection, and eventually ~98% recovery by additional washing with act and pbst. similarly, in the second series of liquid injection, i m injection produced 73% signal recovery with subsequent signal recovery of 97% by additional act and pbst. this meant that the regeneration of ni surface could be fulfilled multiple times for the sensor reusability. the procedures required for the metal surface regeneration turned out to be relatively simple compared to those using toxic chemical treatment which could damage and denature the sensor metal surface, such as piranha solution41 and sodium hypochlorite solution methods.42 a label - free regenerative immuno - biosensor was demonstrated with a sensor key head, which comprised a multimode optical fiber with spr coating for detecting fbg of various concentrations quantitatively in a real - time manner. the key ingredient for regeneration procedure of immuno - assay was the immobilized hp layer on the sensor metal surface. this hp layer for binding igg was able to be eliminated from the metal surface by using i m, act, and pbst for such regeneration. the regeneration was demonstrated twice (using two identical series of liquid injection), to check its chemical validity, as well as the physical one. the regeneration of the sensor metal surface could open potential applications for biosensors in needs for limited human access, such as cosmic space, underground, and deserted lands. the detection limit of the sensor was estimated to be ~3.40 ng / ml (10 pm) and 11.21 ng / ml (32.97 pm) in the first and second series of liquid injection, respectively. the label - free detection platform presented may find potential applications for fbg - based diagnosis of cardiovascular disease, strokes, heart disease, and alzheimer s disease. actual application of this sensor device in the practical use would require calibration of the sensor signal in diagnosing different concentrations of injected fbg. however, one must note that this calibration would depend on igg concentrations and metal coating thickness, which would determine the spr wave decaying depth normal to the metal surface. the presented sensing scheme in using a multimode optical fiber used neither any spectroscopic technique nor measurement of incident angle of an optical beam, unlike conventional spr biosensor, but the present sensor would be miniaturized easily and integrated into a lab - on - chip platform. | purposewe present the regenerative label - free fiber optical biosensor that exploits surface plasmon resonance for quantitative detection of fibrinogen (fbg) extracted from human blood plasma.materials and methodsthe sensor head was made up of a multimode optical fiber with its polymer cladding replaced by metal composite of nanometer thickness made of silver, aluminum, and nickel. the ni layer coated allowed a direct immobilization of histidine - tagged peptide (hp) on its metal surface without an additional cross - linker in between. on the coated hp layer, immunoglobulin g was then immobilized for specific capturing of fbg.resultswe demonstrated a real - time quantitative detection of fbg concentrations with limit of detection of ~10 ng / ml. the fact that the hp layer could be removed by imidazole with acid also permitted us to demonstrate the regeneration of the outermost metal surface of the sensor head for the sensor reusability.conclusionthe sensor detection limit was estimated to be ~10 pm, which was believed to be sensitive enough for detecting fbg during the clinical diagnosis of cardiovascular diseases, myocardial infarction, strokes, and alzheimer s diseases. |
the precise mechanism of the action of the corticosteroids within the inner ear is scarcely known. corticosteroids bind to glucocorticoid receptors on the cell membrane surface, then are transferred into the cell nucleus where transcription is initiated or modulated, influencing cell signalling pathways. fluid and ionic transfer within the inner ear is influenced by modulation of na / k- atpase activity. hidro - ionic homeostasis of the inner ear is influenced by means of mineralocorticoid receptor regulated genes induction and control of aquaporin channels. dexamethasone has been proved to modulate ionic homeostasis by means of enac epithelial channels in a semicircular membranous channel in primary cultures. this results in the cationic transport in the vestibular labyrinth and osmotic coupled aquous flow. a decrease of free radical species production within the inner ear has been shown alongside with the protective effect against proinflamatory cytokines such as the tumor necrosis factor, after glucocorticoids administration. inner ear disease glucocorticoid therapy is based most frequently on the supposed immunosupressive and antiinflamatory effects within the cochlea. thus, a nuclear transcription factor regulates the synthesis of several proinflammatory cytokines involved in the glucocorticoids inhibited general immune response. systemic innoculation of lipopolisacharides in mice induces the expression of transcription factor mrna in the mouse cochlea. the process has been suggested to be inhibited by glucocorticoids leading to a reduction of the nuclear factor in different compartments of the inner ear and recovery of hearing loss. topical administration of corticoids improves the cochlear blood flow. among multiple factors influencing corticoids access to the inner ear structures, the administration modality (systemic or intratympanic) seems to be the most important. an animal study has compared the concentrations of hidrocortisone, metilprednisolone and dexamethasone in the perilymph, blood and cs fluid after oral, intravenous and intratympanic administration in mice. plasma concentrations of metilprednisolone and dexamethasone exceeded those in perilymph after oral and intravenous administration. they include : hidro - ionic disturbances, hydrosaline retention, heart failure in susceptible patients, hypopotassemia, hypertension, muscular atrophy, osteoporosis, vertebral fractures, aseptic necrosis of humeral or femural heads. gastrointestinal side effects include : peptic ulcer, bowel perforations, pancreatitis and reflux esophagitis. dermatologic side effects include alteration of the healing processes, thin and brittle skin, bruises and hyperhydrosis. endocrine problems associated with corticosteroids are menstrual irregularities ; development of cushingoid state ; suppression of growth in children ; secondary adrenocortical and pituitary unresponsiveness, particularly in times of stress ; decreased carbohydrate tolerance ; latent diabetes mellitus ; increased requirements for insulin or oral hypoglycemic agents in patients with diabetes ; and hirsutism. possible opthalmic complications are posterior cataracts, increased intraocular pressure, glaucoma, and exophtalmos. other adverse effects include thrombo - embolism, weight gain, increased appetite, nausea, and malaise. the wide range of adverse effects favors the intratympanic corticosteroids administration as a direct pathway to obtain high therapeutic intracochlear concentrations, devoid of systemic side effects. the indications for intratympanic corticosteroid therapy include sudden sensorineural hearing loss, meniere disease resistant to salt restriction and medical treatment with diuretics and vasodilators, tinnitus and autoimune inner ear disease., there is a strong recommendation for treatment only for salvage therapy in the case of sudden neurosensorial hearing loss after systemic corticosteroid failure. the treatment strategies, doses and the volume of drug injected intratympanically have been empirically devised. intratympanic injections are recomended some - times dailly for five days or weekly for up to four consecutive weeks. the drug solutions are variable, providing a minimal and short - lived exposure of inner ear to corticosteroids. modern polymer compounds, like dexamethasone based poloxamer oto-104, seem to have several advantages such as : prolonged exposure of inner ear after single injection, low injection volume, avoidance of a second miringostomy for aeration, few postinjections sequelae due to filling of the middle ear with solution, lack of restriction of the orthostatism, speech and deglutition after injection. although considered an adverse effect of antiinfectious therapy, ototoxicity has been proved to be useful for the therapy of vertigo related to meniere disease. surgery (endolymphatic sac decompression, vestibular neurectomy, labirinthectomy) and intratympanic therapy are therapeutic alternatives when salt restriction, diuretics and vasodilators fail to decrease the number of vertigo attacks in meniere disease. intratympanic therapy includes costicosteroids, when the auditive function is preserved, and pharmacologic destruction of the labyrinth with amynoglicoside antibiotics when there is no residual serviceable hearing. chemical labyrinthectomy with intramuscular streptomicine injections was achieved for the first time in 1948, by fowler. in 1956, schuknecht delivered streptomicine injections into the middle ear achieving vertigo control in 63% of the treated patients, with subsequent profound neurosensorial hearing loss in all cases. in 1977, lange delivered gentamicine intratympanically with hearing preservation in 76% of treated patients. gentamicine becomes the preferred therapeutic compound due to its higher vestibulotoxicity as compared to its cochleotoxicity. from the middle ear, gentamicine enters the perilymph of scala tympani by uptake through the round window membrane rather than by diffusion. thus, the outer layer of this trilaminate membrane comprises cubic cells tightly connected by means of tight junctions, with numerous mithocondria, endoplasmic reticulum and golgi apparatus which suggest intense endocitosis. the molecular weight and the positive electrical charge of the gentamicine molecule favors its entry into the scala tympani perilymph from where it reaches the perilymph in the vestibular scala by means of interscalar carrier systems. the positive electrical charge prevents gentamicine from entering passively into the scala media due to scala media s positive endocochlear potential. the amynoglicoside antibiotic seems to reach the cells in the organ of corti through the cochlear blood flow. aminoglycosides inflict degenerative injuries in the hair cells of the inner ear. in the organ of corti hair cells are more vulnerable than type 2 hair cells and, from an anatomical perspective, hair cells of the ampular crest are affected in the first place, followed by cells of the utricule and sacule. the mechanisms of action by which amynoglicosides inflict cell injuries include thermic shock protein 27 expression, increase of production of reactive oxygen species and nitric oxide. nowadays, titration protocols of administration are recommended by most of the clinical studies whenever there is indication for supression of the vestibular function by intratympanic gentamicine administration for control of vertigo in meniere disease. intratympanic gentamicine is administered once a week until either the first symptoms of vestibular hypofunction appear and control of vertigo is achieved or the audition deteriorates. among these protocols, long term control of vertigo is similar to that achieved by treatment with daily doses or multiple daily doses. titration gentamicine therapy controls vertigo in 87% (between 75 and 100% among different studies) of patients with unilateral meniere disease, the risk of secondary hearing loss being around 21% (between 0 and 37% among different studies). yet, in one third of the patients, the vertigo can recur. recurrences can also benefit from intratympanic gentamicine with the same risk of secondary hearing loss. the main effect of intratympanic gentamicine would be a reduction of vestibular function due to hair cells injury. optimisation of strategies for therapeutic inner ear perfusion by intratympanic drug delivery for the therapy of cochleo - vestibular symptoms requires a thorough understanding of the intratympanic administration protocols, knowledge of physico - chemical characteristics of intratympanic administered solutions and of round window normal and pathological anatomy, as well as labyrinthine pharmacokinetics advanced studies. intratympanic corticosteroid therapy is strongly recommended only as salvage therapy in the case of sudden neurosensorial hearing loss after systemic corticosteroid failure. less frequent dosing regimen of intratympanic gentamicine therapy for control of vertigo in meniere disease results in better hearing preservation. | intratympanic drug delivery refers to drug administration in the middle ear, the main advantage being direct diffusion of substances in the inner ear through the round window membrane with subsequent high intralabiryntine drug concentration and very low systemic side effects. the article is a review of literature concerning the inner ear barrier systems, the physiology of inner ear fluids, intralabirinthine pharmacokinetics and the commonest drugs applied in the middle ear for the treatment of cochleo - vestibular syndromes. |
tobacco use is the leading cause of preventable morbidity and mortality in the united states [1, 2 ]. according to the national youth tobacco survey, 5% of middle school students (grades 68) currently smoke cigarettes and 20% of nonsmokers report willingness to experiment with cigarettes. a growing body of research indicates that trait impulsivity, or a predisposition toward rapid, unplanned action with diminished regard to negative consequences high levels of intent to smoke among young adolescents may be driven in part by intrapersonal factors like impulsivity and contribute to sharp increases in smoking uptake among high school students. unfortunately, early initiation of smoking predicts future regular smoking and increases the likelihood of developing lifetime respiratory conditions, cardiovascular disease, and cancers. unfortunately, few well - designed prevention or intervention trials have shown promise in middle schools ; successful programs include the prevention - focused project towards no tobacco use and the cessation - focused not on tobacco, and project ex. improving program effectiveness depends on our ability to employ innovative methods to increase participation and retention. incentive - based programs, which provide rewards (e.g., money / prizes) in exchange for confirmed tobacco abstinence, have promise for application in middle schools. prior research indicates that community - based quit and win programs, which enroll smokers into contests wherein they may win prizes for being tobacco - free, are most appealing to younger smokers. behavioral reinforcement effectively prompts smoking cessation in treatment - seeking adults [15, 16 ], high school students [17, 18 ], and at the community level. recent research also indicates that incentive - based programs may be particularly effective for impulsive adolescent smokers who struggle disproportionately to quit smoking. with respect to impulsivity, children and adolescents demonstrate normative deficits in planning for the future and exhibit high discount rates relative to older adolescents and adults. research suggests that cigarette smoking (and even experimentation) may exacerbate these deficits ; adolescent smokers / experimenters have more difficulty planning for the future, exhibit higher discount rates, and self - report higher levels of impulsivity relative to adolescent nonsmokers. as mentioned previously, impulsive adolescent smokers also are less likely to successfully quit smoking after participating in a cessation program than their less impulsive counterparts. when considering the prior research findings in concert, an incentive - based approach may be ideal to encourage smoking cessation (and perhaps prevent smoking uptake) among a wide range of adolescents, especially those with higher impulsivity. although self - determination theory [24, 25 ] argues that financial incentives may undermie intrinsic motivation to sustain behavior change, a recent review of the psychology and economics literature concluded that the evidence is not sufficient to conclude that motivation for health - related behaviros would be adversely affected by incentives. rather, incentives may enhance self - control or ability to refuse tempting behaviors (such as smoking), therefore enhancing perceived competence while preserving (if not boosting) intrinsic motivation. with regard to evaluating the effectiveness of classroom - based, behavioral incentive programs, a recent meta - analysis of the smoke - free class competition, a program implemented in over 20 european countries that rewards classes for being smoke - free at 6-month intervals, found that contest participation decreased the likelihood of smoking initiation. however, selection bias may have inflated program efficacy ; not all classes enrolled in the program. to maximize the effectiveness of future incentive - based programs, it is essential that we understand the factors that increase or decrease program enrollment. to our knowledge, no incentive - based smoking prevention / cessation programs have been developed for use with middle schools in the united states. to inform the development of such a program, the current study evaluated the extent to which intrapersonal factors (i.e., demographics, tobacco use status, and trait impulsivity) and program - design features (i.e., prize type, value, and frequency of reward) influence students ' interest in participating. given the low participation rates of smokers in existing tobacco programs, we hypothesized that smokers and individuals deemed susceptible to smoking would be less interested than nonsusceptible nonsmokers. although there are clear links between impulsivity and smoking, it is unclear whether impulsive adolescents would be more or less interested in participating in an incentive - based prevention / intervention program. impulsive adolescents may be less interested if they perceive the rewards to be neither immediate nor guaranteed and lack the foresight to appreciate the long - term health benefits of living smoke - free. however, impulsive adolescents may be more interested in participating if the prospect of receiving a reward is reinforcing in itself and is perceived to be proximal relative to the distal experience of future health benefits. therefore, we did not outline a specific hypothesis regarding the relationship between impulsivity and program interest. lastly, we hypothesized that offering inexpensive rewards valued at $ 25 would motivate student interest based on the age range of our sample (1114 years). to contextualize this monetary value, adolescents ages 1618 spend an average of only $ 18 per week. we believe that the current study findings can inform the development of future, successful incentive - based programs designed to encourage tobacco - free living in middle school students. we obtained approval from the yale institutional review board and school officials at three connecticut middle schools prior to administering a brief, anonymous, cross - sectional, self - report survey of students ' tobacco use. two - weeks before the survey, we also mailed information sheets to all students ' parents / guardians. parents were told to call the research staff or school officials if they did not want their child to participate (no parent explicitly refused permission). otherwise, passive parental permission was assumed. these methods have been used successfully in similar school - based work. prior to survey completion, students were informed of the limits to confidentiality and the voluntary nature of the study and, subsequently, provided assent. surveys were administered in a general assembly and comprised 25 questions assessing demographic characteristics, tobacco use, and students ' views on the incentive - based program. nine hundred eighty - eight adolescents completed the survey (50.1% female, mean age 12.41 [sd = 1.02 ] years, 69.8% caucasian, 5.0% lifetime smokers, 10.0% susceptible to smoking). the following description of an incentive - based program was provided within the survey : we are interested in developing a program that would encourage middle school students to stop using tobacco products and to prevent students who do not use from ever starting. this program would be open to all students, whether or not they currently use tobacco. it involves a chance to enter a contest and make a pledge to not use any tobacco products. anyone who is tobacco free at the end of the contest period would have a chance to win a prize. we assessed students ' interest in participating using the following question : how interested would you be in participating in the contest ? response options included not at all, probably not, might or might not be interested, probably interested, and definitely interested. in total, 61.8% of students reported that they would probably or definitely be interested in participating in the contest. smoking status was assessed with the following item from the monitoring the future survey and national survey on drug use and health : do you currently use, or have you ever used, any of the following tobacco products ? (cigarettes, cigars, smokeless tobacco, bidis, cloves, or i never tried any tobacco products). students who reported ever using cigarettes were classified as lifetime smokers (n = 43). nonsmokers were classified using the fishbein / ajzen - hanson questionnaire as either susceptible to initiating smoking (n = 86) or not susceptible (n = 681) based on self - reported intention to smoke (i.e., i intend to smoke a month from now was assessed three separate times with the following 7-point anchors : (1) extremely likely to extremely unlikely, (2) extremely probably to extremely not probably, and (3) extremely true to extremely untrue). students were classified as low - risk nonsmokers only if they selected all three indicators that they had no intent to smoke (i.e., extremely unlikely, extremely not probably, and extremely untrue). all other nonsmokers were considered susceptible to smoking. given the low prevalence of smoking in the current sample, lifetime smokers and students considered to be at risk for initiating cigarette smoking students completed the 30-item barratt impulsiveness scale, version 11, which assesses a range of impulsive and nonimpulsive (reverse scored) behaviors using a 4-point scale (response options include rarely / never, occasionally, often, and almost always / always). a large body of research suggests that the 3 originally proposed bis-11 subscales (i.e., motor, attention, and nonplanning impulsiveness) lack psychometric stability and have not undergone sufficient psychometric evaluation for use with young adolescents [32, 33 ]. thus, we evaluated the latent structure of the bis-11 in our data prior to conducting statistical analyses (see appendix for a description of these analyses). consistent with a large, recent factor analytic study of the bis-11 in a sample of adults, two subscales emerged (i.e., the brief bis) which reflected impulsive behaviors (e.g., i say things without thinking) and impaired self - regulation / planning (e.g., these subscales evidenced adequate reliability and the distribution of scores for each subscale, which ranged from 4 to 16, approximated a normal distribution (impulsive behaviors : cronbach 's =.74, mean = 7.91 [sd = 2.37 ] ; impaired self - regulation : cronbach 's =.71, mean = 7.89 [sd = 2.52 ]). the two subscales were correlated moderately (r =.48), indicating that behavioral impulsivity and deficits in self - regulation are related domains of impulsivity. however, further examination of the data based on median split demonstrated that there was considerable individual variability in scores on these related, yet distinct, subscales (median for each subscale = 8.00 ; see table 1), with 30.8% of participants evidencing high scores on one subscale and low scores on the other. type of prizes. students reported on what types of prizes would make them interested in participating. response options included cash, giftcards, mp3 players, cell phones, and other. students selecting other were asked to describe the alternative prize. after reviewing all responses (including write - ins), two primary prize types emerged : cash and electronics (e.g., ipods, video games). monetary value of prizes. to determine the minimum monetary value of the prize needed to motivate program interest, students were asked the following question : what is the smallest prize that would make you interested in participating and staying tobacco - free for the rest of the school year ? answer choices were $ 25, $ 2550, $ 50$75, $ 75$100, and $ 100 +., students were asked the following question, how often should the contest be run ? response options included monthly, every two months, every grading period, every semester, and once a year. we employed multiple regression to evaluate the extent to which students ' interest in program participation was influenced by intrapersonal factors (i.e., gender, age, race / ethnicity, smoking risk status, and impulsivity) and aspects of the incentive - based program design (i.e., prize type, prize value, and reward frequency). we treated the following as categorical predictor variables : gender, race / ethnicity, smoking risk status, and prize type. we included age, impulsivity, prize value, and frequency of reward as continuous predictors. 18.0% of students were missing data on one or more central study variables (at random), so missing data were handled using full information maximum likelihood (fiml). the regression model including all variables accounted for 11.2% of the variance in program interest (see table 2). younger students, students of non - caucasian descent, those who self - reported higher levels of engagement in impulsive behavior, and those who reported higher levels of self - regulation were more interested in participating in the program than their respective counterparts. specifically, higher levels of interest were associated with offering inexpensive rewards more frequently and with offering electronics like video games as rewards. program interest was not influenced significantly by gender, smoking status, or offering cash incentives. our results suggest that the majority of middle school students (61.8%) reported interest in participating in an incentive - based program designed to encourage a smoke - free lifestyle. furthermore, the program appealed to students irrespective of smoking status, suggesting that it has the potential to target both smoking prevention and cessation among middle school students. although most students expressed program interest, several variables significantly influenced students ' interest level. as such, the proposed incentive - based program may be most impactful among younger students, which is encouraging given that the peak ages of cigarette experimentation are 11 to 13 years. the program also was of greater interest to students who were not of caucasian descent. with regard to impulsivity, students who reported higher levels of engagement in impulsive behavior were more likely to express interest in the program, consistent with prior research indicating that impulsive adolescents may be especially sensitive to reward in the context of smoking cessation programs. students reporting higher levels of impaired self - regulation / planning were less interested in participating relative to students with higher levels of self - regulation / planning. students with deficits in planning and concentration may have difficulty appreciating the full range of benefits of participating in an incentive - based program, including the possibility of winning a prize and the inherent health benefits associated with not smoking. however, these students also may optimally benefit from incentive - based programs, as incentives are thought to enhance one 's sense of self - control. these students may also perceive participation as requiring an inordinate amount of effort and, therefore, report being uninterested. to maximize participation, setting the optimal default to automatic participation (with the option to opt out) may be superior to providing standard, voluntary enrollment with the option to opt in (i.e., default nonparticipation). regarding program design, less expensive prizes offered monthly sufficiently motivated student interest, suggesting that implementing an incentive - based program needs not be costly. consistent with their tech - savvy moniker the igeneration, students ' interest was enhanced by offering rewards like video games. while the current study provides novel information about middle school students ' interest in participating in an incentive - based tobacco prevention / intervention program, several limitations merit note. program interest was assessed using a single question and all data were self - reported. it is worth noting, however, that while reliance on self - reported smoking history introduced the potential for misreporting, our smoking estimates were consistent with national estimates. our data are also limited in generalizability because they were collected from a small sample of schools in connecticut. students from different school environments may have different perspectives on school - based smoking prevention and cessation programs. further, the small number of lifetime smokers (n = 43) limited our statistical power to detect effects specifically within this group. as such, we relied on a broader conceptualization of smoking risk in the current study. finally, the intrapersonal and program design variables included in the current analyses accounted for only 11.2% of the variance in program interest. an important goal of future work will be to identify a range of other variables (i.e., family, parental, and peer influences) that account for additional variance in program interest and/or help to explain the relationships observed in the current study. for example, socioeconomic status, which was not assessed in the current study, may help to account for the fact that offering electronics as rewards predicted program interest while offering cash rewards did not ; it is possible, for instance, that adolescents of lower socioeconomic status may need to put cash rewards toward paying for necessities in the home. the current study provides formative data that can inform the development of maximally effective smoking cessation / prevention programs for middle schools that complement existing tobacco education by behaviorally reinforcing a tobacco - free lifestyle. importantly, students reported strong interest in a cost - effective program irrespective of smoking status. our data suggest that targeting younger middle school students and offering monthly rewards may maximize program impact. to help boost participation, especially among students with deficits in self - control / planning, automatic enrollment of all students in the program (with the option to opt out) may prove to be a superior voluntary approach to automatic nonenrollment. adjusting the optimal default to participation may seem unconventional, but drastic measures are warranted given the exorbitant social, economic, and health costs associated with cigarette smoking. | behavioral incentives have been used to encourage smoking cessation in older adolescents, but the acceptability of incentives to promote a smoke - free lifestyle in younger adolescents is unknown. to inform the development of novel, effective, school - based interventions for youth, we assessed middle school students ' interest in participating in an incentive - based tobacco abstinence program. we surveyed 988 students (grades 68) attending three connecticut middle schools to determine whether interest in program participation varied as a function of (1) intrapersonal factors (i.e., demographic characteristics (sex, age, race), smoking history, and trait impulsivity) and/or (2) aspects of program design (i.e., prize type, value, and reward frequency). primary analyses were conducted using multiple regression. a majority of students (61.8%) reported interest in program participation. interest did not vary by gender, smoking risk status, or offering cash prizes. however, younger students, non - caucasian students, behaviorally impulsive students, and students with higher levels of self - regulation were more likely to report interest. inexpensive awards (e.g., video games) offered monthly motivated program interest. in sum, middle school students reported high levels of interest in an incentive - based program to encourage a tobacco - free lifestyle. these formative data can inform the design of effective, incentive - based smoking cessation and prevention programs in middle schools. |
diabetes mellitus (dm) is a common disease in iran and around the world. it is a chronic, progressive and costly disease, and results in a number of complications. for individuals with dm, it is difficult to accept that they must change their lifestyle. since these patients are unaware of short - term and long - term complications of the disease, it is not unusual for them to experience mood disorders such as depression, anxiety caused by negative thoughts about the illness and low self - efficacy in dealing with their disease (1). depression and anxiety disorders are characterized by symptoms of low mood, reduction of energy and interest, feelings of guilt, difficulty in concentrating, loss of appetite, thoughts of death and suicide, chronic daily stress, lower levels of psychological well - being and consequent low quality of life, insomnia or hypersomnia, significant loss of weight, and dysfunction (2). children with dm, because of the need for self - care, and in most cases, care by family members, may see themselves as a burden on their families, compared to healthy children of the same age. the way these thoughts are interpreted is an important factor in determining the severity of the consequential discomfort, anxiety, and perceived negative stress ; such as believing themselves to be a financial burden on their family, and ascribing the difficulties of their family to themselves. evidently, it should be noted that being seen as a burden by parents and friends is also influential in creating stress and decreasing self - efficacy in children. therefore, misinterpretation of these negative thoughts leads to a set of symptoms such as negative perceived stress and low self - efficacy (4). perceived stress is derived from lazarus and folkman s concept of stress as an individual s cognitive appraisal of negative life events. diabetic individuals may forget to care for themselves, in terms of using certain foods and consumption of medications, due to stress, and this in turn affects their blood sugar levels (5). due to frustration and perceived stress, diabetic children have a particular mental condition which causes feelings of helplessness, powerlessness, lack of self - efficacy, and apathy toward life (6). self - efficacy is an important and effective concept in bandura s social cognitive theory and is explained as confidence and belief in one s ability to control thoughts, feelings, activities, and function effectively in stressful situations. therefore, efficacy is an individual s actual performance, emotions, and choices, as well as inhibition of negative influences, organization and execution of courses of action required to achieve goals and advancement, and ultimately the amount of effort spent on an activity (7). the aims of dm treatment are the prevention of its complications and maintaining optimal psychological well - being in patients. in the past, it was thought that the doctor was able to provide favorable conditions for an individual through effective treatments and control of disease symptoms. nevertheless, evidence suggests that psychological well - being, and in a wider context quality of life, in treating a chronic disease such as dm does not only influence the control of symptoms, but also the improvement of psychological well - being and quality of life (8). diabetic children do not show appropriate emotional responses and experience lower psychological well - being due to difficulties such as dietary and activity limitation, invasive monitoring of blood glucose, daily insulin injections, chronic physical complications, hospitalizations and shortened life expectancy (9). the treatment of chronic diseases such as dm, on the one hand, disrupts the psychological well - being and social function of the individual, and on the other hand, has a negative impact on family function. the prevalence of negative psychological outcomes among people with dm, especially children and adolescents, and their frustration from the medical treatment process demonstrates the necessity of developing psychological interventions in the fields of clinical psychology, health psychology and pediatric psychology. most studies performed on people with dm have often been based on self - care training, which has been performed publicly. acceptance and commitment therapy (act) differs from traditional cognitive behavioral therapy (cbt). this form of therapy has two major goals : a) fostering acceptance of problematic unhelpful thoughts and feelings that can not and perhaps need not be controlled, and b) commitment and action toward living a life according to one s chosen values (10). this treatment method endeavors to increase individual psychological acceptance in the case of subjective experiences (thoughts and emotions), reduces ineffective control measures, and increases psychological awareness (11). there are numerous psychological therapeutic interventions for stress, and depression and psychological consequences associated with it, such as inability and infirmity, for diabetic patients. some researchers believe that act has high efficacy, due to its underlying mechanisms such as increasing acceptance and awareness, desensitization, living in the present moment, observing without judgment, confrontation and release (12). results of previous studies showed that the use of the mindfulness method will cause a decrease in depressive and anxiety attacks (13, 14). the study by boey showed that acceptance of dm and its related cognitions is significantly associated with lower hba1c values and decreased stress in patients, simultaneously (15). the results of a research indicated that stress can lead to mental and physical diseases, impairment of function and adaptation, and ultimately lower self - efficacy in coping with the disease (7). another study revealed that stress can result in the patient not following the required diet, and therefore, indirectly affect blood sugar (16). there is a wide range of research on psychosocial and behavioral interventions for adolescents with dm, and current psychosocial interventions have demonstrated modest effects on glycemic control. it may prove useful to identify underlying psychological processes that contribute to poor disease management. however, very little research has been done on the mentioned psychological complications of dm (perceived stress and special health self - efficacy) with this treatment method. moreover, a few studies have been conducted on children and adolescents. this paper aimed to illustrate how the psychological processes of cognitive fusion and experiential avoidance may contribute to dm management difficulties. therapeutic strategies outlined in act might be a way to intervene in dm care and simultaneously target issues relating to regimen adherence, dm - related acceptance, and family management issues. according to the above discussion, this study aimed to answer the question of whether act is effective in reducing perceived stress and increasing special health self - efficacy in seven to fifteen - year - old children with dm. the present study was a clinical trial with a pretest - posttest control group design, and random assignment. the study population included all seven to fifteen - year - old individuals who had referred to the dm association of tabriz, iran, of whom 40 participants were selected using convenient sampling. the experimental group participated in therapy sessions and the control group did not receive any interventions. inclusion criteria for this study included age of < 15 years, having dm (type 1 and 2) for at least one year, and lack of any major psychiatric disorder. exclusion criteria, determined by the diagnosis of a physician in most cases, included needing significant change in the dose of insulin administered during the research, suffering from an acute or chronic medical illness that causes problems in venesection or intolerance of long sessions, having severe medical complications of dm, receiving psychiatric treatments or using psychotropic drugs, and drug abuse during the study period. in order to obey research ethics, in addition to obtaining written consent from the children and their parents to participate in the research, pretests were also conducted. evidently, two members of the experimental group and two patients of the control group were excluded for various reasons, including absenteeism from more than three sessions, lack of participation in pretest, disease, and relocation to another city. finally, 18 patients in the experimental group and 18 patients in the control group remained in the study. for data collection, the special health self - efficacy scale was used. this questionnaire included 14 items and three subscales of nutrition self - efficacy scale, physical exercise self - efficacy scale, and resist alcohol self - efficacy scale. it was a likert - type scale with items answered on a four - point scale from one for very uncertain to four for very certain. cronbach s alpha internal reliability was 0.87 for nutrition self - efficacy, 0.88 for physical exercise self - efficacy, and 0.79 for resist alcohol self - efficacy (17). validity evidence for this scale has been reported by narimani and ahadi (17). the reliability of this test was calculated at 0.76 using cronbach s alpha in this research. furthermore, the perceived stress scale (pss) was also used for data collections. the pss is a 14-item likert - type scale that offers a nonspecific measure of appraised stress. the internal consistency reliabilities of the pss ranged from 0.84 to 0.86 across two groups of university students and one group of participants in a community smoking - cessation program. the alpha coefficient for the mexican sample was 0.835 while for the individuals residing in the usa this was 0.885 (18). this instrument has been found to be significantly correlated with life events, depressive and physical symptoms, utilization of health services, social anxiety, maintenance of smoking reduction and lower life satisfaction (18). it is said to be an appropriate measure of global stress for all age groups (19). in a study performed by ghorbani. (20), cronbach s alpha was calculated as 0.86 for america and 0.81 for iran. in the present study, the topics for each session included : 1- building a therapeutic contract and functional analysis ; 2- creative hopelessness : the man in the cave and the farmer and the donkey metaphors ; 3- value clarification and building a commitment, the funeral exercise metaphor : eat the whole apple ; 4- control as a problem : the rule of 95 - 5% and control as a problem : pink elephants and what s the name of your mother ? exercises ; 5- the alternative to control, be willing as a possibility, and acceptance exercises : eyes on exercise ; 6- cognitive diffusion : the ride with posters, milk, milk, milk exercises and establishing language conventions : i m having the thought that i m a failure instead of saying i m a failure ; 7- self as context : metaphor : chessboard, and screening for barriers and strengthening values : metaphors : the journey and welcome to all and the rude ; 8- acceptance and commitment, and fear of commitment : metaphor : now you know how to drive ; 9- remember session, internal dialogue : this is not working, it is always the same, and i thought it was ok, but it is not... metaphor : the rider ; 10- remember session and relapse prevention (21). after ten sessions of intervention for the experimental group, the posttest was performed on both groups. we performed a descriptive study of the dependent variables of interest (means and standard deviations). data analysis was performed with the spss statistical package (version 19.0 ; spss inc., the participants in this research were in the age range of seven to fifteen years, and 69.44% were boys and 30.56% girls. the mean (sd) age of the experimental group was 11.44 (2.59) and the control group was 9.72 (2.37) (p < 0.05). in addition, twelve boys and four girls participated in the experimental group, and nine boys and seven girls participated in the control group. table 1 shows mean and standard deviation of perceived stress and special health self - efficacy variables in the experimental and control groups. to measure the equality of variances, the results showed that variances of the experimental and control groups for total perceived stress (f = 1.03, p = 0.317), negative perceived stress (f = 1.50, p = 0.22), positive perceived stress (f = 0.46, p = 0.50), and special health self - efficacy (f = 1.45, p = 0.23) were equal. the results showed significant homogeneity using mancova tests including pillai s trace, wilks lambda, lawley - hotelling trace, and roy s largest root. experimental and control groups differed from each other, in at least two dependent variables ; therefore, these variables could be used to analyze the data. the mancova results on the variables of perceived stress and special health self - efficacy in both control and experimental groups after controlling the pretest are shown in table 2. this analysis showed that the two groups were different in three investigated variables according to the means presented in table 1. furthermore, an increase in positive perceived stress and special health self - efficacy variables and a decrease in total perceived stress and negative perceived stress scores were observed in the experimental group as compared with the control group. the results showed that act is effective on reducing perceived stress and increasing special health self - efficacy of children with dm. they believed that the application can increases effectiveness of this method in addition to reducing the disease symptoms, due to its underlying mechanisms such as increasing acceptance and awareness, desensitization, living in the present moment, observing without judgment, confrontation, and release (24). it should be noted that this treatment modality is a short - term and structured intervention. in addition, and like traditional cognitive therapy, the purpose of mental care education is not to change the content of thoughts, but rather to create a different attitude toward or relationship with thoughts, feelings, and emotions, which includes maintaining full and constant attention with an attitude of acceptance and without judgment (25). conceptually, children and adolescents with dm, who drown in their private issues and subsequently engage in experiential avoidance, may attempt to control their private affairs via behavioral strategies that may not be useful in the long - term. for example, an adolescent with dm may have thoughts such as people think i m different when they see me check my blood sugar, my insulin makes me fat and unpopular i ca nt do normal things like go out for ice - cream, or they may then engage in unhealthy eating (e.g. unplanned snacking), or avoid insulin injections or blood - glucose checks, as an attempt to alleviate these painful thoughts. these experiential avoidance behaviors may lead to greater long - term emotional distress and health problems. by not engaging in dm management behaviors, the focus of this act process is to develop and enhance clients willingness to accept their private experiences. treatment involves exploring the futility of emotional control and avoidance, which can often paradoxically increase individuals levels of distress and deter them from engaging in purposeful and vital value - driven behavior. instead, individuals are encouraged to accept their private experiences ; doing so will help them engage in valued behavior (3). based on act, the concept of emotional interlinking or diffusion is defined as the rate of the impact of a thought on behavior ; such as the effects of subjective interpretation on children s perceived stress and special health self - efficacy (21). context - dependent behavior and thought - dependent behaviors are placed on the continuum between emotional interlinking and diffusion. when an individual merges and becomes one with his thoughts, he does not distinguish subjective judgment from reality (23, 26). thus, increasing psychological flexibility of pediatric patients in act and creating a thinking strategy based on mindfulness can increase the patient s ability to cope with symptoms of disease and family adversity, and follow the prescribed diet. naturally, reduction of negative perception caused by stress and individual commitment caused by some behaviors will increase self - efficacy of the child in dealing with the illness in the long - term. these findings indicate that increased cognitive fusion and experiential avoidance are related to decreased adherence and dm - related quality of life, and increased social anxiety and dm - related worry. in conclusion, these findings provide preliminary support for the adverse impact of cognitive fusion and experiential avoidance for children and adolescents with dm. limitations of this study were the small study population, inability to generalize the results and limited number of similar studies in iran and the world. moreover, some of the obtained differences are related to possible differences in confounding variables due to lack of matching confounding variables (such as age and gender). | background : diabetes mellitus (dm) imposes restrictions on physical, emotional and social functioning of children and adolescents.objectives:the aim of this study was to determine the impact of acceptance and commitment therapy (act) on perceived stress and special health self - efficacy in seven to fifteen - year - old children with dm.patients and methods : the present study was a clinical trial with a pretest - posttest control group design. the study population included all seven to fifteen - year - old patients who had referred to the diabetes mellitus association of tabriz, iran, of whom 40 participants were selected using convenient sampling. they were randomly allocated to two matched groups (experimental and control). the experimental group participated in therapy sessions, while the control group did not receive any interventions. the research instruments were perceived stress and special health self - efficacy scales.results:the multiple analysis of covariance (mancova) results showed that the treatment was effective on variables of perceived stress and special health self - efficacy (p < 0.001).conclusions : the act is effective for reducing perceived stress and increasing special health self - efficacy in children with dm. |
the institute of medicine report in 1995 stressed the need for change in dental education with better application of basic science to clinical problems and experimentation with different models of education, practice and performance assessment. rajiv gandhi university of health sciences curriculum in the state of karnataka, india for undergraduate dental students, advocates the use of learner - oriented methods such as problem - solving abilities and self - directed learning. the didactic lecture format is the predominant mode of teaching method, which is more teacher than student - centered. passive nature of didactic lectures leads to low receptivity from the audience and can be ineffective in retaining what is learnt and in problem - solving. with students having no clinical exposure in their initial year of dental training and the prescribed textbooks of dental materials focusing solely on material aspect, interpreting dental materials (that requires analytical skill) becomes difficult. it is left to the ability of the student to mentally visualize the clinical situation, which makes the subject rather unappealing. informal feedback from senior students and exam result analysis of the previous classes showed more disinterest and failures in dental materials. cuseo listed out few deleterious outcomes of large size lecture such as faculty overdependence on lecture, reduced student interaction ; less achievement of blooms taxonomy level of learning objectives and lower depth of student thinking especially on 1 year students. the promising trend globally is to have a problem - based integrated student centered learning with active participation and self - directed learning that can facilitate analytical, problem - solving skills and team work with group discussions. dental curricula have to shift their focus on core competencies with patient - centered education. case - based learning (cbl) is based on the principle of using a case or a problem or an inquiry to stimulate, support knowledge, skills and attitude that requires a degree of prior knowledge from students to help in clinical case solving. cases place situations in a realistic setting and can aid the students in applying the basic information. cbl also promotes team based approach, motivation, scientific inquiry and integration of knowledge and practice. du. concluded that -cbl was found to be more effective than lecture based education for 4 year dental students in oral leukoplakia in the school of stomatology at wuhan university and suggested that cbl be added in future oral medicine curriculum for dental students. tao. in the department of dentistry, shangai jiao tong university applied cbl with randomization in two groups in the clinical practice and found the favorable response of students towards cbl than traditional methods. ghosh had implemented case - oriented problem - solving tutorials with didactic lectures in physiology to improve understanding and motivation among students. a survey among dental graduates by keeve clinical application of dental materials contributes majorly to a student 's or a dentist 's clinical competence. case - oriented small group discussions (cosgds) may provide an excellent platform for student - centered learning with the integration of basic science and clinical application. the department of prosthodontics at m s ramaiah dental college introduced some basic topics in dental materials to 1 year dental students using didactic lectures complemented with clinical case problems. we hypothesized that that cosgd with the didactic lecture was better than lecture alone on the understanding of dental materials with the null hypothesis that there would be no difference between them. the aims and objectives of the study were to evaluate : effectiveness of cosgd with didactic lecture over didactic lecture alone on understanding of some topics of dental materialsstudents perception toward cosgd over traditional lecturefeasibility of introducing student - centered learning in the institution. effectiveness of cosgd with didactic lecture over didactic lecture alone on understanding of some topics of dental materials students perception toward cosgd over traditional lecture feasibility of introducing student - centered learning in the institution. a total of 170 students between the age range of 1822 years in the first semester of dental undergraduate course in the consecutive class of 2010, 2011 and 2012 were taught five topics in dental materials in the department of prosthodontics. each class was divided into two batches, a and b with equal aptitude and assimilation, based on their test scores after a didactic lecture on an introductory topic. a stratified random sampling was done to ensure that each of the batches a and b had equal representation based on the scores of the test with the mean scores of both batches being the same. the interventions of didactic lecture and cosgd were done to assess their effect on the study subjects. all three classes of 2010, 2011 and 2012 were taught the same five topics. the lesson plan for the lectures remained the same for both batches a and b. since the topics were new to all students, a 40 min didactic lecture was conducted for both the batches separately. flowchart shows the scheme of crossover study design for lecture with group discussion (l+cosgd) & lecture (l) for the batches a & b the methodology used in this study is a slight modification of the cbl process. here, a clinical problem is formulated by the facilitator with specific learning outcomes which is given to the students to later solve with group discussions and brainstorming with prior knowledge and present the solutions to the rest of the groups as shown in annexure 1. integration into practice can be assessed once the students enter the clinical years in future. after the lecture was taken, the cosgd batch of 2530 students, were divided into five groups, each of 56 students. all the students in the cosgd group were given worksheets with five clinical case problems. the students of each group were instructed to discuss the respective problem assigned to them as well as briefly discuss the rest of the clinical problems, come out with solutions and present them within the group. the students were encouraged to discuss the problems and clarified any differing views with their peers. the teacher was only a facilitator to assist the group in structuring their thoughts, apply their reasoning ability and identify solutions. the cross over after each topic allowed each of the batches to be part of the lecture and cosgd format to rule out any bias. separate teachers were assigned for each topic to rule out bias in teaching styles and were trained to conduct small group discussions. informed consent was obtained from the students to take part in the study prior to the commencement of the study. students were evaluated 23 days after the lecture or lecture + cosgd through an objective assessment in the form of single best answer multiple - choice questions (mcqs) (type a of hubbard and clemans). the mcq was designed with greater emphasis on clinical application (70%) and less on recall (30%). the second objective of this study was to evaluate the student 's perception of the new teaching methodology. it is important to get prompt feedback from the students before attempting to change the t - l method. the students were given a 10 statement 5 point likert scale questionnaire to evaluate their perception on the two teaching methodologies. the first five of the statements were worded favorably towards cosgd and the last five were favorable towards didactic lecture format. this was to make the students respond to the statements after some thought rather than agree or disagree automatically. the validity of the questionnaire was tested through a pilot study and discussion with subject experts. the number and percentage were presented for categorical data, mean and standard deviation for continuous data in tables. frequency distribution of the students was used to assess the student perception. to test for the difference in mean score between lecture and group discussion considering years two - way anova was performed for comparing class wise (2010, 2011 and 2012) mean scores by levels of teaching methods (two groups) simultaneously. two - way anova was performed for comparing class wise (2010, 2011 and 2012) mean scores by levels of teaching methods (two groups) simultaneously. a total of 170 students between the age range of 1822 years in the first semester of dental undergraduate course in the consecutive class of 2010, 2011 and 2012 were taught five topics in dental materials in the department of prosthodontics. each class was divided into two batches, a and b with equal aptitude and assimilation, based on their test scores after a didactic lecture on an introductory topic. a stratified random sampling was done to ensure that each of the batches a and b had equal representation based on the scores of the test with the mean scores of both batches being the same. the interventions of didactic lecture and cosgd were done to assess their effect on the study subjects. all three classes of 2010, 2011 and 2012 were taught the same five topics. the lesson plan for the lectures remained the same for both batches a and b. since the topics were new to all students, a 40 min didactic lecture was conducted for both the batches separately. flowchart shows the scheme of crossover study design for lecture with group discussion (l+cosgd) & lecture (l) for the batches a & b the methodology used in this study is a slight modification of the cbl process. here, a clinical problem is formulated by the facilitator with specific learning outcomes which is given to the students to later solve with group discussions and brainstorming with prior knowledge and present the solutions to the rest of the groups as shown in annexure 1. areas for improvement are identified with the help of the facilitator. integration into practice can be assessed once the students enter the clinical years in future. after the lecture was taken, the cosgd batch of 2530 students, were divided into five groups, each of 56 students. all the students in the cosgd group were given worksheets with five clinical case problems. the students of each group were instructed to discuss the respective problem assigned to them as well as briefly discuss the rest of the clinical problems, come out with solutions and present them within the group. the students were encouraged to discuss the problems and clarified any differing views with their peers. the teacher was only a facilitator to assist the group in structuring their thoughts, apply their reasoning ability and identify solutions. the cross over after each topic allowed each of the batches to be part of the lecture and cosgd format to rule out any bias. separate teachers were assigned for each topic to rule out bias in teaching styles and were trained to conduct small group discussions. informed consent was obtained from the students to take part in the study prior to the commencement of the study. students were evaluated 23 days after the lecture or lecture + cosgd through an objective assessment in the form of single best answer multiple - choice questions (mcqs) (type a of hubbard and clemans). the mcq was designed with greater emphasis on clinical application (70%) and less on recall (30%). the second objective of this study was to evaluate the student 's perception of the new teaching methodology. it is important to get prompt feedback from the students before attempting to change the t - l method. the students were given a 10 statement 5 point likert scale questionnaire to evaluate their perception on the two teaching methodologies. the first five of the statements were worded favorably towards cosgd and the last five were favorable towards didactic lecture format. this was to make the students respond to the statements after some thought rather than agree or disagree automatically. the validity of the questionnaire was tested through a pilot study and discussion with subject experts. the number and percentage were presented for categorical data, mean and standard deviation for continuous data in tables. frequency distribution of the students was used to assess the student perception. to test for the difference in mean score between lecture and group discussion considering years two - way anova was performed for comparing class wise (2010, 2011 and 2012) mean scores by levels of teaching methods (two groups) simultaneously. two - way anova was performed for comparing class wise (2010, 2011 and 2012) mean scores by levels of teaching methods (two groups) simultaneously. table 1 shows mean scores (with standard deviations) of the students in each of the topics in the corresponding class of 2010, 2011 and 2012. a significant difference was found among the classes (2010, 2011 and 2012) for all the topics except for the topic four. there was a significant difference between two methods of teaching on topic two (p = 0.03) and on topic three (p = 0.044). mean scores of students with case oriented small group discussion and lecture in the class of 2010, 2011 and 2012 table 2 shows most students in classes 2010, 2011 and 2012 strongly felt group discussions help them understand the subject better than lecture class [table 2, q1 and q6 ]. they are more comfortable in asking questions in a small group discussion set up than in a traditional lecture class [table 2, q2 and q7 ]. students also strongly felt that they are able to relate the theory into clinical application better with a small group discussion [table 2, q3 and q8 ]. group discussions also motivated them to learn [table 2 q4 and q9 ] and made the subject more interesting [table 2 q5 and q10 ]. class 2010 felt more comfortable in asking questions, discussions made the subject interesting and helped in clinical correlation than the class of 2011 and 2012. percentages of student response for posgd with lecture in the class of 2009, 2010 and 2011 table 1 shows mean scores (with standard deviations) of the students in each of the topics in the corresponding class of 2010, 2011 and 2012. a significant difference was found among the classes (2010, 2011 and 2012) for all the topics except for the topic four. there was a significant difference between two methods of teaching on topic two (p = 0.03) and on topic three (p = 0.044). mean scores of students with case oriented small group discussion and lecture in the class of 2010, 2011 and 2012 table 2 shows most students in classes 2010, 2011 and 2012 strongly felt group discussions help them understand the subject better than lecture class [table 2, q1 and q6 ]. they are more comfortable in asking questions in a small group discussion set up than in a traditional lecture class [table 2, q2 and q7 ]. students also strongly felt that they are able to relate the theory into clinical application better with a small group discussion [table 2, q3 and q8 ]. group discussions also motivated them to learn [table 2 q4 and q9 ] and made the subject more interesting [table 2 q5 and q10 ]. class 2010 felt more comfortable in asking questions, discussions made the subject interesting and helped in clinical correlation than the class of 2011 and 2012. percentages of student response for posgd with lecture in the class of 2009, 2010 and 2011 the evaluation of cosgd scores with didactic lectures scores showed significant difference only in two topics of the 15 topics covered for the classes 2010, 2011 and 2012. the reason could be that these two topics were taught hands on in the practical curriculum. manipulating gypsum products and heat cure resin are practical exercises followed in the curriculum that students have to perform and could be the reason that the students scored better in the above respective topics. this provides a cue that the practical application of theory in curriculum complemented with case - based problem - solving group discussions may help in better understanding of the subject. a significant difference in scores between all the classes for all topics [table 1 ] cbl with student centered education in oral medicine curriculum complemented in better understanding of the subject. differences were also noted with respect to perception towards cosgd amongst the classes 2010, 2011 and 2012. class 2010 felt more favorable toward cbl than class 2011 and 2012. this may indicate that student perception toward teaching methodology may be directly related to scoring in formative assessments, which could be explored in future. effect of gender on performance was not evaluated as the majority of the students were females in all classes. in contrast to the performance on mcq, majority of students perceived cosgd better for learning than didactic lecture. group discussion creates an active learning environment which can allow greater understanding of the problem from a conceptual point. the dynamics of discussion itself may encourage learning through peers and the discussions create an environment in which students may not dread asking a foolish question. zhang. at used cbl in selected stomatological courses and found a good student response and high acceptance at the shangai jiao tong university. online case based discussions in periodontology for clinical undergraduate students received appreciation from students in the faculty of medicine at ghent university though no significant differences were found in the test scores. mckenzie found cbl positively affected students knowledge, attitude and skills at the university of alabama. kumar and gadbury - amyot continue to implement case - based and team - based learning in oral medicine and radiology at the department of oral pathology at the university of missouri based on positive student feedback. over 76% of students feel more comfortable asking questions in a group discussion than in a didactic lecture because group discussion can act as a nonthreatening platform to clarify their doubts. jones. assessed small team active learning in an integrated pharmacokinetics course series and found the course had a positive impact on student 's ability to apply concepts to case - based scenarios, but little ability to critically evaluate new material. katsuragi added problem learning tutorials to a traditional lecture - based curriculum in a dental school and found students were comfortable in the discussions. over 79% of the students feel group discussions help them co - relate the topic better clinically for a patient than a lecture class, supporting the encoding specificity of the learning theory. knowledge being a combination of information and application requires encoding of the said information with the applied activity at the time of learning for successful retrieval. small group discussions allow integration of information from different sources, fusing broader concepts to specific cases. one of the principles of learning includes meaning orientation in which knowledge and skills are learned with understanding, as compared to a large majority of the students feel group discussions motivate them to learn more, vindicating student - centered learning over tutor centered learning. intrinsic motivation arises from the expectation of the long term utility of a learning task. as dentistry is an applied science, the learning experience with learning objectives must have a direct relevance to the care of humans in health and disease. steinert assessed student perception through focus group discussions on small group teaching in a medical school and found that students emphasized more group atmosphere, facilitation skills and on clinical relevance of problem cases, critical thinking skills and integration of basic and clinical sciences. cbl was an effective tool that led to significant improvement of self - reported student satisfaction, motivation and engagement in traditional pharmacology course. active participation, meaningful learning and problem - based group discussions are itself the highest level of learning. information is better understood, processed and retrieved if learners have the opportunity to elaborate on that information. botelho and odonnell found problem orientated small group discussion in fixed prosthodontic simulation laboratory course provides beneficial peer to peer interaction which is known to facilitate learning. small group discussion with problem orientation can stimulate deep learning, thereby enhancing the learning experience and help the student correlate prior knowledge acquired through the didactic lecture into actual application. small group discussions with the active problem - solving abilities have been experimented with the problem - based learning (pbl) around the world. rich. found a significant difference in performance of students on mock patients in -pbl than traditional educational methodology in preclinical and clinical periodontics and the students rated the pbl model favorably. ghosh concluded that it was possible to have a pbl module in the form of case - oriented problem - solving tutorials coexistent with the traditional didactic lecture module in the 1 year of medical education under a conventional curriculum. the feedback gains insight into the student learning preferences with respect to cosgd. the limitation of the study was that more number of topics could have been covered using the cosgd method. formative assessments after a gap of 46 months could have assessed the long - term retention of information. comparing summative assessments with traditional methods can also provide substantiate evidence for recommending cosgds in the curriculum. we also recommend inclusion of clinical postings for 1 year dental curriculum for clinical exposure. feasibility of introducing cosgd in institutions provides a great advantage for both the teachers and the students in integrating knowledge and practice. the positive student response could influence the inclusion of cosgd in the rajiv gandhi university curriculum in all the disciplines of dentistry. the evaluation of cosgd scores with didactic lectures scores showed significant difference only in two topics of the 15 topics covered for the classes 2010, 2011 and 2012. the reason could be that these two topics were taught hands on in the practical curriculum. manipulating gypsum products and heat cure resin are practical exercises followed in the curriculum that students have to perform and could be the reason that the students scored better in the above respective topics. this provides a cue that the practical application of theory in curriculum complemented with case - based problem - solving group discussions may help in better understanding of the subject. a significant difference in scores between all the classes for all topics [table 1 ] cbl with student centered education in oral medicine curriculum complemented in better understanding of the subject. differences were also noted with respect to perception towards cosgd amongst the classes 2010, 2011 and 2012. this may indicate that student perception toward teaching methodology may be directly related to scoring in formative assessments, which could be explored in future. effect of gender on performance was not evaluated as the majority of the students were females in all classes. in contrast to the performance on mcq, majority of students perceived cosgd better for learning than didactic lecture. group discussion creates an active learning environment which can allow greater understanding of the problem from a conceptual point. the dynamics of discussion itself may encourage learning through peers and the discussions create an environment in which students may not dread asking a foolish question. zhang. at used cbl in selected stomatological courses and found a good student response and high acceptance at the shangai jiao tong university. online case based discussions in periodontology for clinical undergraduate students received appreciation from students in the faculty of medicine at ghent university though no significant differences were found in the test scores. mckenzie found cbl positively affected students knowledge, attitude and skills at the university of alabama. kumar and gadbury - amyot continue to implement case - based and team - based learning in oral medicine and radiology at the department of oral pathology at the university of missouri based on positive student feedback. over 76% of students feel more comfortable asking questions in a group discussion than in a didactic lecture because group discussion can act as a nonthreatening platform to clarify their doubts. jones. assessed small team active learning in an integrated pharmacokinetics course series and found the course had a positive impact on student 's ability to apply concepts to case - based scenarios, but little ability to critically evaluate new material. katsuragi added problem learning tutorials to a traditional lecture - based curriculum in a dental school and found students were comfortable in the discussions. over 79% of the students feel group discussions help them co - relate the topic better clinically for a patient than a lecture class, supporting the encoding specificity of the learning theory. knowledge being a combination of information and application requires encoding of the said information with the applied activity at the time of learning for successful retrieval. small group discussions allow integration of information from different sources, fusing broader concepts to specific cases. one of the principles of learning includes meaning orientation in which knowledge and skills are learned with understanding, as compared to a large majority of the students feel group discussions motivate them to learn more, vindicating student - centered learning over tutor centered learning. intrinsic motivation arises from the expectation of the long term utility of a learning task. as dentistry is an applied science, the learning experience with learning objectives must have a direct relevance to the care of humans in health and disease. steinert assessed student perception through focus group discussions on small group teaching in a medical school and found that students emphasized more group atmosphere, facilitation skills and on clinical relevance of problem cases, critical thinking skills and integration of basic and clinical sciences. cbl was an effective tool that led to significant improvement of self - reported student satisfaction, motivation and engagement in traditional pharmacology course. active participation, meaningful learning and problem - based group discussions are itself the highest level of learning. information is better understood, processed and retrieved if learners have the opportunity to elaborate on that information. botelho and odonnell found problem orientated small group discussion in fixed prosthodontic simulation laboratory course provides beneficial peer to peer interaction which is known to facilitate learning. small group discussion with problem orientation can stimulate deep learning, thereby enhancing the learning experience and help the student correlate prior knowledge acquired through the didactic lecture into actual application. this methodology may help students who have a poor factual recollection. small group discussions with the active problem - solving abilities have been experimented with the problem - based learning (pbl) around the world. rich. found a significant difference in performance of students on mock patients in -pbl than traditional educational methodology in preclinical and clinical periodontics and the students rated the pbl model favorably. ghosh concluded that it was possible to have a pbl module in the form of case - oriented problem - solving tutorials coexistent with the traditional didactic lecture module in the 1 year of medical education under a conventional curriculum. the limitation of the study was that more number of topics could have been covered using the cosgd method. formative assessments after a gap of 46 months could have assessed the long - term retention of information. comparing summative assessments with traditional methods can also provide substantiate evidence for recommending cosgds in the curriculum. we also recommend inclusion of clinical postings for 1 year dental curriculum for clinical exposure. feasibility of introducing cosgd in institutions provides a great advantage for both the teachers and the students in integrating knowledge and practice. the positive student response could influence the inclusion of cosgd in the rajiv gandhi university curriculum in all the disciplines of dentistry. case - oriented small group discussions with lectures are comparable to traditional lectures in terms of student scoring in formative assessments. however, the students showed a positive response toward cosgds. as a teaching methodology in dental materials, case - oriented discussions can add to the effectiveness of a lecture. students feel more comfortable in clarifying doubts and raising questions thereby motivating the student for effective learning experience. | background : case - oriented small group discussions (cosgds) can help students to correlate and integrate the basic science of dental materials into clinical application. we used cosgds along with didactic lectures in dental material curriculum and hypothesized that case - oriented group discussions would be more effective than traditional lecture alone in terms of performance of students, student perception on the above two teaching methodologies and the feasibility in classes of 2010, 2011 and 2012.methods:a total of 170 students were taught using both cosgd and didactic lecture in a randomized controlled crossover trial design. their performance was assessed through multiple - choice questions (mcqs) as part of the formative assessment, and their perception was assessed through likert scale questionnaire.results:the mean difference in the scores between case - oriented group discussions with lecture and didactic lecture showed significant difference only in few topics. around 9496% of students perceived cosgd with didactic lecture help them understand theory better ; 7692% of students feel more comfortable asking questions in a group discussion ; 8998% of students feel such discussions motivate them and 91100% of students agree that discussions make the subject interesting in the respective years of 2010, 2011 and 2012.conclusion:effectiveness of cosgd in terms of scores through mcqs is comparable to traditional lecture. however, most of the students perceive cosgd help them understand the theory better ; co - relate clinically ; more motivating and interesting than a traditional lecture. feasibility in institution needs more time and resources to conduct cosgd within the dental material curriculum. |
a 60-year - old man presented to the emergency room with a sudden onset of intractable pain in the left leg. the patient had a history of intermittent abdominal pain and hypertension without other risk factors for atherosclerosis. a computed tomographic angiogram (cta) revealed chronic total occlusion of the abdominal aorta from the inferior mesenteric artery level to the level of both common iliac arteries (fig. the cta also showed chronic total occlusion of the left external iliac artery and acute total occlusion of the left popliteal artery (fig., the popliteal artery occlusion was removed, and angiography confirmed good distal run - off through the anterior and posterior tibial arteries (fig. however, 3 days after the procedure, the patient suffered from the same intractable pain in the left leg. repeated femoral angiography showed a recurrence of the acute total occlusion of the left popliteal artery. after repeated endovascular treatment, urgent surgery was performed to prevent the reoccurrence of thromboembolism. exploration of the abdominal aorta found fresh white clots that were adherent to the aortic wall (fig. resection of the abdominal aorta below the inferior mesenteric artery was followed by aortic replacement with a 201010-mm dacron y graft (meadox medicals, oakland, nj, usa). distal anastomosis of the right and left arteries was performed on the common iliac artery and common femoral artery levels, respectively (fig. however, due to the abnormal ranges of the platelet count since the first day of admission (ranging from 53310/l to 1,14910/l), a bone marrow biopsy was performed postoperatively. the exam showed markedly increased numbers of megakaryocytes, which were clustered with mature cytoplasm and hyper - lobulated nuclei. therefore, the final diagnosis of the patient was essential thrombocytosis (et), according to the 2008 world health organization (who) diagnostic criteria. medical therapy was started immediately with hydroxyurea and aspirin once daily at doses of 1,000 mg and 100 mg, respectively. the platelet count decreased gradually and the patient was discharged on postoperative day 17 without any complications. the therapeutic target for the platelet count (< 40010/l) was achieved 2 months after surgery. on the last follow - up, more than 2 years after the operation, the patient was in good condition with a patent graft (fig. et is an uncommon myeloproliferative disorder in which a proliferation of megakaryocytes in the bone marrow leads to an elevated platelet count. et is defined by the following 4 major criteria : (1) platelet count 45010/l ; (2) megakaryocyte proliferation with large and mature morphology, and little to no granulocyte or erythroid proliferation ; (3) not meeting the 2008 who criteria for chronic myelogenous leukemia, polycythemia vera, primary myelofibrosis, myelodysplastic syndromes, or any other myeloid neoplasm ; and (4) demonstration of jak2 or other clonal markers, or no evidence of reactive thrombosis. in general, common causes of aortic thrombosis include cardiac sources of embolism, hypercoagulable states, and other complications from atherosclerotic disease. although et remains an uncommon cause of aortic pathology, some reports have discussed cases of et - associated aortic mural thrombus. to the best of our knowledge, et caused a chronic obstruction of the abdominal aorta and acute obstruction of the arteries. we encountered a fast recurrence of artery occlusion (3 days after thrombus removal). we would have been able to prevent the recurrence of popliteal artery occlusion if we had immediately controlled the platelet count. many options exist for managing et, such as medical therapy with heparin anticoagulation, aspirin, and cytoreductive chemotherapy, and surgical treatment with aortic thrombectomy and/or endovascular surgery. in order to ensure the optimal treatment of et, the location of the thrombus, potential for embolism, individual risk of the patient, and the pathology of the thrombus we decided to perform surgical treatment due to the rapid formation of the thrombus, the location of the original chronic thrombus, and the insufficiency of endovascular treatment. according to harrison., hydroxyurea and low - dose aspirin are superior to other combinations of drugs for patients with et at high risk for vascular events, especially arterial thrombosis. in our case, once the diagnosis of et was made, the patient was treated with hydroxyurea and low - dose aspirin for a goal platelet count of < 40010/l. the patient s platelet count was normalized and maintained within a range of 21910/l to 25210/l. in conclusion, although et rarely presents in large vessels, early diagnosis and immediate management are essential. | essential thrombocytosis (et) is a myeloproliferative disorder characterized by an anomalous increase in platelet production. many patients with et are asymptomatic. few studies have reported et - associated thromboembolism in large vessels such as the aorta. we report a patient with et who presented with peripheral embolism from an abdominal aortic thrombus and developed acute limb ischemia. the patient underwent aortic replacement successfully. the patient s platelet count was controlled with hydroxyurea, and no recurrence was noted over 2 years of follow - up. |
glaucoma is the second leading cause of blindness after cataract, with approximately 60 million cases reported worldwide in 2010. if undiagnosed, glaucoma causes irreversible damage to the optic nerve leading to blindness. therefore diagnosing glaucoma at early stages is extremely important for an appropriate management of the first - line medical treatment of the disease [24 ]. accurate diagnosis of glaucoma requires three different sets of examinations : (1) evaluation of the intraocular pressure (iop) using contact or noncontact tonometry also known as air puff test or goldman tonometry, (2) evaluation of the visual field, and (3) evaluation of the optic nerve head damage. accurate diagnosis of glaucoma requires more control parameters, that is, gonioscopy and assessment of retinal nerve fibre layer (rnf). since both elevated - tension glaucoma and normal - tension glaucoma may or may not increase the iop, the iop by itself is not a sufficient screening or diagnosis method. on the other hand, visual field examination requires special equipment which is usually available only in tertiary hospitals, if they have a fundus camera and oct. in routine practice, patients with poag can be manifested with inconsistent reports between sd - oct and sap. in elderly, higher c / d ratio, larger cup volume, and lower rim area on sd - oct appear to be associated with detectable vf damage. moreover, additional worsening in rnfl parameters might reinforce diagnostic consistency between sd - oct and sap. therefore, the optic nerve head examination (cup - to - disc ratio) is the most valuable method for diagnosis glaucoma structurally. the visual field test, on the other hand, diagnoses glaucoma functionally through detecting the damages done to the visual field. determining the cup - to - disc ratio is a very expensive and time consuming task currently performed only by professionals. the first approach is based on the very challenging process of image feature extraction for binary classification of normal and abnormal conditions. the second and more common approach however is based on clinical indicators such as cup - to - disc ratio as well as inferior, superior, nasal, and temporal (is nt) zones rule in the optic disc area. the optic disc is made of 1.2 million ganglion cell axons passing across the retina and exiting the eye through the scleral canal in order to transit the visual information to brain. examining the optic disc helps clarify the relationship between the optic nerve cupping and loss of visual field in glaucoma. the optic disc is divided into three different areas : neuroretinal rim, the cup (central area), and sometimes parapapillary atrophy. the cup - to - disc ratio (cdr) is the ratio of the vertical diameter of the cup to the vertical diameter of the disc. different techniques have been used for optic disc (od), optic cup (oc), or optic disc with optic cup segmentation. in this paper, we critically review the od and oc segmentation methodologies that automatically detect od and oc boundaries. these techniques help professionals with diagnosing and monitoring glaucoma by providing them with clear and accurate information regarding the onh structure. the uniqueness of this paper is in demonstrating the segmentation methodology by creating a flowchart for each technique. we introduce the algorithms applied to od and oc segmentation, discuss the pros and cons of each method, and provide suggestions for future research. we describe the materials used for analysis of metrics performance of od and oc segmentation. in section 3, the techniques for od and oc segmentation separately and together are introduced and described. fundus camera is equipped with a low power microscope and is designed to capture the image of the posterior pole of the eye as well as the whole retina. fundus photography allows three types of examination : (1) color, in which white light is illuminated on the retina to examine it in full color ; (2) red - free in which the contrast among vessels and other structures is improved by removing the red color through filtering the imaging light ; and (3) angiography in which the contrast of vessels is improved by intravenous injection of a fluorescent dye. oct is an optical signal acquisition method for capturing 3d images with micrometer resolution from within optical scattering media. oct is usually used for imaging the retina due to its ability to provide high resolution cross - sectional images. it is also a useful imaging technique in other areas such as dermatology and cardiology. optic disc is one of the most important parts of a retinal fundus image (figure 1). od detection is considered a preprocessing component in many methods of automatic image segmentation of retinal structures, a common step in most retinopathy screening procedures. the od has a vertical oval (elliptical) shape and is divided into two separate zones : the central zone or the cup and the peripheral zone or neuroretinal rim. changes in the color, shape, or depth of od are indications of ophthalmic pathologies such as glaucoma ; therefore, od measurements have important diagnostic values [19, 20 ]. furthermore, correct segmentation of od requires accurate detection of the boundary between the retina and the rim. pathological cases occurring on the od boundaries, such as papillary atrophy, influence the segmentation accuracy. oc segmentation is further challenged by the density of blood vessels covering parts of the cup and the gradual change in color intensity between the rim and cup. the kinks in the blood vessels sometimes help detecting the cup boundaries and sometimes make it more challenging. accurate disc and cup segmentation is very important in all pathological cases since errors in disc and cup segmentation may mislead the professionals and hence affect their diagnosis. most of the retinal optic disc and cup segmentation methodologies presented in this survey are tested on various publicly available datasets, for example, riga, drive, stare, messidor, and origa. in this section the digital retinal images for vessel extraction (drive) dataset consists of 40 color fundus images. figure 2 shows an example of a normal (figure 2(a)) and a pathological (figure 2(b)) image. a canon cr5 nonmydriatic 3ccd camera with a 45 field of view was used to obtain the images. the images were divided into two groups, a training set and a test set, with 20 images in each group. three experts manually segmented the images in order to have reference images for evaluating the techniques by comparing the manually segmented images with those segmented automatically. the structured analysis of retina (stare) dataset is funded by the us national institutes of health. a topcon trv-50 fundus camera with 35 field of view was used to capture the images. messidor contains 1200 images in two sets ; the images were captured in three ophthalmological departments by a research program sponsored by the french ministries of research and defense. two diagnoses are provided by the medical experts for each image, retinopathy grade, and risk of macular edema. a color video 3ccd camera on a topcon trc nw6 nonmydriatic retinography with a 45 field of view was used to capture the images. the online retinal fundus image dataset for glaucoma analysis and research (origa) consists of 650 images acquired through singapore malay eye study (simes). the images were marked by experts based on an algorithm proposed in and are stored in a centralized server. the dataset includes 168 glaucomatous and 482 nonglaucoma images. the standard diabetic retinopathy database calibration level 0 diaretdb0 consists of 130 color fundus images, 20 normal and 110 with signs of diabetic retinopathy, acquired from the kuopio university hospital in finland. the images were captured by a digital fundus camera with 50 field of view. the diabetic retinopathy database and evaluation protocol diaretdb1 consists of 89 color fundus images acquired from the kuopio university hospital in finland. figure 3 shows the three distinctive areas : (1) the true positive area representing the overlapping area between the manually marked (ground truth) and automatically marked (segmented image) areas, (2) the false negative area where a pixel is classified only in the manually marked area, and (3) the false positive area where the pixel is classified only in the automatically segmented area. on the other hand, there are different measurements used in image classification of the optic disc and optic cup segmentation to determine whether an image is normal or glaucomatous. cup - to - disc ratio is defined as the ratio of vertical distances between pixels at the highest and lowest vertical position inside the cup and disc region (figure 4). various methods are used for image classification which is a clinical assessment of the is nt rule for the optic nerve. the is nt rule was considered to be an observer to the gradual decrease or no change in rim width at the following position order : inferior (i) superior (s) nasal (n) temporal (t) (figure 5). the true negative represents the number of normal images identified as normal ; false negative represents the number of glaucoma images identified as normal ; true positive represents the number of glaucoma images identified as glaucoma ; and false positive represents the number of normal images identified as glaucoma images. in this section technical information will be provided, where there are three main techniques for segmentation, namely, thresholding, edge - based methods, and region - based methods. these techniques have also been applied in the image processing methodologies of the optic disc and optic cup segmentation in this paper. here, we consider three segmentation methodologies : (1) optic disc segmentation approaches, (2) optic cup segmentation approaches, and (3) optic disc and optic cup segmentation together. where most of the papers are concerned with just the optic disc approaches, few are concerned with the optic cup approaches and some are concerned with optic disc and optic cup segmentation together. optic disc extraction or segmentation is performed using segmented reference images called ground truth on which the optic disc is accurately marked by ophthalmologists. the od processing includes two main steps : localization (detecting the center point of od) and segmentation (detecting the disc boundary). different od detection and segmentation algorithms have already been introduced ; however, many of them have a number of limitations such as using images with a clear color variation across od boundary. preprocessing methods are important steps for analyzing an image by enhancing the images and finding the region of interest (roi). the od segmentation approaches are summarized in table 2 and their results are shown in table 3. presented a methodology for the od segmentation containing different stages (figure 6). in order to decrease the contrast variability and increase the process reliability, the retinal image was normalized by means of the retinex algorithm. two different techniques were used to localize the optic disc : (1) analyzing the convergence of the vessels to detect the circular bright shapes and (2) detecting the brightest circular area based on a fuzzy hough transform. after detecting the od, the segmentation techniques were conducted using the region of interest specified by a difference of gaussian filter. the method achieved 100% of od localization for both fuzzy convergence and hough transform. using brute force search, the segmentation success rates were 92.23% and 93.36% for the fuzzy convergence and hough transform, respectively. this is a limitation which should be addressed in the future work in order to develop a robust methodology. present a new adaptive method based on a model of the vascular structure using mathematical morphology for the od automatic segmentation (figure 7). this methodology has two main stages : (1) detecting the od location from the information of the main vessels arcade, where the vessels were detected to determine the foreground and background of the green channel image ; in this stage, the rmin operator (which detects the regional minima pixels) was used to identify the background region ; (2) detecting the optic disc boundary. in order to detect the od boundary using the watershed transform, based on the previously detected vascular tree an internal point to the optic disc and other points in vicinity of the internal point were identified using the following three steps : (1) using a specific algorithm to find the od position and to determine whether it is on the right or left side of the image (morphological skeleton and pruning cycle are used in this step), (2) locating the optic disc by removing the less important vessels from the pruned image, (3) describing the shape of the optic disc. the methods were tested on 40 images obtained from drive dataset and 89 images from diaretdb1 dataset. the success rate in optic disc localization was 100% and 97.75% for the drive and diaretdb1 datasets, respectively. future works should consider detecting other important retina structures, such as fovea, based on the proposed method. proposed a new algorithm for od segmentation (figure 8), where the localization methodology obtains a pixel from the od called optic disc pixel. each method has its own od candidate pixel, and the final pixel is chosen by a voting procedure. two of the three detection methods are called maximum difference method and maximum variance method. in general the maximum variation occurs between the bright region (od) and the dark region (blood vessels in the disc). therefore, the maximum variation was used to select the od pixel of those two methods. in addition, statistical variance for every pixel was calculated in the maximum variance method and the bright pixels were obtained by blue channel thresholding via otsu method. the last method was low pass filter method, where the od pixel was the maximum gray level pixel in the filtered image. finally, the maximum variance method has been chosen as the final od pixel according to the voting procedure. on the other hand, the od segmentation methodology was applied on two components red and green and the better segmentation was selected (figure 10). the procedure was based on removing the blood vessels by employing a special morphological processing and then applying edge detection and morphological techniques to obtain a binary mask of the od boundary candidates. finally, the circular approximation of the od was computed using a circular hough transform. the current research is concentrated on improving the algorithm for executing a controlled elliptical deformation of the obtained circumference. tjandrasa and colleagues applied the hough transform as an initial level set for the active contours for optic disc segmentation. the od segmentation steps start by converting the image to a grayscale image and then implementing the image preprocessing (image enhancement). homomorphic filtering has two stages : (1) applying a gaussian low pass filter, (2) obtaining the filtered edge by performing dilation. the threshold is applied to detect the low pixel values in the image and followed by applying the median filter to blur the blood vessels. the next step in od segmentation is detecting a circle which matched the location of od by performing a hough transform. subsequent to this, an active contour model is used to obtain the od boundaries that are as close to the original od boundaries as possible. the active contour model is applied with a special processing termed selective binary and gaussian filtering regularized level set (sbgfrls). the algorithm achieved 75.56% of accuracy using 30 images from drive dataset. further work can be done to segment the cup disc in order to classify the images into normal and glaucomatous. lupacu and colleagues presented an alternative technique (figure 12) to detect the best circle that matches the od boundary. the technique uses a regression based method and texture descriptors to identify the circle which fits the od boundary. the variation in the intensity of pixels describes the appearance of the od, and therefore it was used in this algorithm for detecting od. since the color fundus images have a dark background the background pixels were not considered. a mask image is computed with zero values for background pixels and one for the foreground pixels. the maximum intensity pixels within the green component provide the highest contrast and therefore were selected. the initial point was established based on the center of the mass of the region, where eight directions, 45 apart from each other, were considered. the directions were obtained by moving counter clockwise in steps of 45. each direction was based on the rapid variation of intensity. three points were considered for each direction ; thus in total there were 24 points. the euclidean distances (the distances between the initial point and each of the 24 points of interest) were computed and their mean value was calculated. hundreds of circles were obtained ; however, based on their specific properties, less than twenty circles were selected as the better ones and the rest were removed. using bilinear filtering the selected circles were mapped into polar coordinate space. the next step was to find the maximum derivatives in y direction by applying the linear least squares fitting technique. the circle with the maximum correlation coefficient was chosen as the best circle matching the od. an ophthalmologist manually marked the ground truth of od boundary using standard software to select some pixels on the od boundary. the success rate was 95% for od localization and 70% for od contour (circle) identification. this method causes false detection of od in low quality images ; therefore, further study is needed to improve the algorithm by refining the selection of the initial points. have recently proposed a novel technique that consists of edge detection, circular hough transform, and a statistical deformable model to determine od (figure 13). the point distribution model was utilized to model the shape of the disc using a series of landmarks. a preprocessing step was performed to analyze the image and reduce the effect of blood vessels. subsequently the od was approximated by a circle using circular hough transform to determine the optic disc center and diameter. ultimately, the statistical deformable model was applied to fine tune the disc boundary according to the image texture. the direct least squared ellipse fitting method was executed to smooth the od boundary (figure 14). the average error in the overlapping area was 11.3% and the average absolute area error was 10.8%. the algorithm included three parts : edge filtering, constraint elliptical hough transform, and -ppa detection (figure 15). extracting the region of interest and detecting the edges of od were the initial steps in this algorithm. in the aforementioned steps a low pass filter was applied to remove the noise, and then the first derivative from each row of the region of interest (roi) was computed. there are two types of ppa : and. -ppa is pigmentary and includes a structural irregularity of retinal pigment epithelial cells (darker than od), while -ppa is a complete loss of the retinal pigment epithelial cells (similar color to od). the -ppa was simply detected by comparing the roi with the threshold, that is, the mean intensity in the roi, followed by a morphological closing processing. due to the elliptical shape of ppa together with od, a second elimination of ppa was conducted by a constrained elliptical hough transform. -ppa is much more difficult than -ppa due to the similarity of its color with that of od. to avoid false segmentation between the ppa and the od, a ring area inspired by the texture within -ppa compared with od, the local maximums and minimums were extracted within the ring and were named as feature points. -ppa was considered present in a quadrant when the number of feature points in a quadrant exceeded the threshold. then the edge points along the detected disc boundary were removed from the quadrant. finally, the constrained elliptical hough transform was reapplied to obtain the new disc boundary (figure 16). results showed an average overlapping error of 10%, an average absolute area error of 7.4%, and an average accuracy vertical disc diameter error of 4.9%. in the future studies, zhu and rangayyan proposed an automated segmentation method based on hough transform to detect the center as well as the radius of a circle that approximates the boundary of od (figure 17). gonzalez and woods in and canny in also used this method to detect the edge of od. to calculate reference intensity for circle selection, a preprocessing step was conducted by normalizing the color image components and converting them to luminance components and then thresholding the effective region of the image. finally, morphological erosion was used to remove the artifacts from the drive dataset which was used to test this algorithm. the components of horizontal and vertical gradient of the sobel operator were obtained by convolving the preprocessed image with specified operators. the binary edge map was obtained by a threshold applied to the gradient magnitude image. on the other hand, canny operator was applied to detect the edges based on three criteria : multidirectional derivatives, multiscale analysis, and optimization procedures. after edge detection, hough transform was applied to detect the center and radius of the circle. the algorithm achieved 92.5% (drive) and 40.24% (stare) success rates for sobel method, and 80% (drive) and 21.95% (stare) success rates for canny method. dehghani and colleagues proposed a novel technique that uses histogram matching for localizing the od and its center in the presence of pathological regions. the methodology is summarized in figure 18. four retinal images from drive dataset were used to create three histograms from the color image components (red, blue, and green) as a template. the next step included extracting the od for each retinal image using a window with a typical size of the od. then a template was created by obtaining a histogram for each color component for each od and calculating the mean of the aforementioned histograms. to reduce the effect of pathological regions with high intensity, the histograms with intensity of lower than 200 were used. the correlation between the histograms of each channel was calculated in order to gain the similarity of two histograms. finally, thresholding was applied on the correlation function to localize the center of the od. the methodology was applied on three datasets : 40 images from drive, 273 images from a local dataset, and 81 images from stare. the success rates were 100%, 98.9%, and 91.36% for the datasets, respectively. in the future work, the od center will be used as the first step for localizing the boundary as well as for human recognition based on the retinal image. zhang. proposed a novel od localization technique based on 1d projection (figure 19). a preprocessing step was necessary in which a binary mask obtained by morphological erosion operation was used to identify the region of interest of the retinal image. blood vessels extraction was then conducted using nonvessel boundary suppression based on gabor filtering and multithresholding process. the structure of the main vessels is more critical in measurement of vascular scatter degree ; therefore, vessels smaller than 30 pixels were neglected. after preprocessing, a vertical window was defined and was slid over the vessels map to calculate the vascular scatter degree in order to obtain 1d horizontal projection signal and locate the horizontal location of the od at the minimum position of horizontal projection curve. then a rectangular window was defined, centered at horizontal location of od, and slid over gabor filter map and gray intensity image to obtain the 1d vertical projection signal, where the location of the maximum peak of vertical projection curve was the vertical location of the od. the algorithm was evaluated on four publicly available and one self - marked dataset : (1) 40 images from drive (achieved 100% success rate) ; (2) 81 images from stare (achieved 91.4% success rate) ; (3) 130 images from diaretdb0 (achieved 95.5% success rate) ; (4) 89 images from diaretdb1 (achieved 92.1% success rate) ; and (5) 40 images from self - selection (achieved 97.5% success rate). lu proposed an alternative technique for automatic segmentation of od (figure 20). the circular transformation was conducted to detect the circular boundary and color variation across the od boundary simultaneously. the intensity image was first derived from the given retinal image by combining the red and green components since these components contain most of the structural information about od. several operations were performed to speed up the process and to improve the accuracy. to decrease the computation cost, image size then the image was filtered by a median filter to repress speckle noise as well as variation across the retinal vessels. the od search space was minimized using the od probability map based on mahfouz 's method. designing the circular transformation was based on observing the variation of the distance from the point within a circular area to the boundary area which reaches the minimum when the point lies exactly at the centroid region. in particular, each pixel detects maximum variation pixels (pms) along several evenly oriented radial line segments of specific length. in the next step the pms were filtered and finally the od map was obtained by converting the image. in this map, the maximum value represents the od center and the pms detected for the pixels at the identified od center lie on the od boundary. the algorithm was evaluated on three public datasets : messidor containing 1200 image, aria containing 59 images from individuals with diabetes and 61 normal images, and stare containing 31 normal and 50 pathological images. the od segmentation technique was applied only on stare and aria datasets, and the accuracies were 93.4% and 91.7%, respectively. another od detection algorithm based on matched filter inspired by the means of vessel direction was introduced by youssif. and is summarized in figure 21. in the preprocessing step a binary mask was generated by thresholding the red component image, and then a morphological operator was applied to label the pixels on the roi. the aforementioned was followed by equalizing the illumination using the hoover and goldbaum equation to avoid the negative effects of an uneven illumination on od localization process. the adaptive histogram equalization was applied to improve and normalize the contrast and in turn assist in detecting the small blood vessels with low contrast levels. the blood vessels were segmented based on an algorithm proposed by chaudhuri., where the similarity between the predefined 2d gaussian template and the fundus image was maximized. to model the retinal vascular in all different orientations, twelve filters were generated to obtain the maximum response for each pixel. to detect the od, direction match filter was used to match the direction of the vessels at the od. the algorithm was tested on 40 images from drive dataset and 81 images from stare dataset, and the success rates were 100% and 98.77%, respectively. the future work should aim to improve blood vessel segmentation by applying other pre- and postprocessing techniques, using other od parameters or vascular - related od (e.g., vessel density and diameter), as well as using a larger dataset for testing the algorithm and employing other vessel segmentation algorithms where the vessels direction map can be obtained. a different methodology introduced by sinha and babu and kumar and sinha is summarized in figure 22. the first part was od localization using l1 minimization in which a scale embedded dictionary was created based on manually marked fixed - size subimages with od at the center. two sets of sparse coefficients, one for the gray intensity image and the other for the red channel image, were obtained. the information from sparse coefficient of each subimage was converted to a single value termed confidence measure. the dot products were rearranged over the 2d image grid to form the probability map representing the possibility of finding the od. a convolution operation was conducted with laplacian of gaussian (log) blob detector on the map and the location with the most response was declared as the od. the method considered the differences between the intensity of od region and the surrounding area. to simplify the process, a bezier curve was defined by a set of control points to obtain the best closed curve. the curve was then smoothened to obtain the final od boundary (figure 23). the localization algorithm was evaluated on multiple datasets diaretdb0, diaretdb1, and drive and proved to be successful in 253 out of the total of 259 images from the three dataset (97.68% success rate). the segmentation algorithm was evaluated on 152 images based on two dataset : diaretdb1 and messidor. the average overlapping obtained was 89.5%. due to the high density of blood vessels in the optic cup, segmentation in this region furthermore, the gradual intensity change between the cup and neuroretinal rim causes extra complications for cup segmentation. the od and oc segmentation techniques, in addition to the techniques used only for oc segmentation, are illustrated in table 4 and the performance results shown in table 5. ingle and mishra discuss the cup segmentation based on gradient method (figure 24). two methods were used to find the gradient : (1) linear gradient, (2) radial gradient. the contrast was improved for all image components (red, blue, and green) by contrast limited adaptive histogram equalization. the initial threshold was set for red (r), blue (b), and g (green) components after much iteration to detect the region where r channel pixel value is less than 60 and b and g pixel values are greater than 100. the intensities were computed and linearly transformed to the range of (0 - 1). the circular structural elements were used to fill the blood vessels region in order to obtain a continuous region. the algorithm was evaluated based on the accuracy of the cup and disc area in all directions as well as cdr, instead of relying on the accuracy only in one direction. another system for automatic detection of the optic cup proposed by damon. is based on vessel kinking (figure 20). to detect the kinks, therefore, a segmentation technique for small vessel detection was introduced by fusing pixel features and a support vector based classification. then features for detecting small vessels were generated, where the green channel was chosen for the feature generation due to its better visibility for the vessels. a wavelet transform was generated for each poi using gabor filter to detect the overall architecture of vessels. the feature in the vessels segment based approach was fused instead of pixel classification for the vessels and nonvessels. kinking was localized by analyzing the identified vessels segments and locating points of maximum curvature on the vessels (i.e., to fit the segment to a curve). to avoid over or under fitting, a rigorous the pallor - based cup detection was conducted to detect the cup from the superior to nasal and inferior zones. therefore, changes in the cup size and cdr are considered important indications of glaucoma [6, 68 ]. the neuroretinal rim is an effective factor in glaucoma evaluation according to the is nt rule, when the optic disc and cup are precisely detected [45, 69 ]. wong. described a novel technique for detecting blood vessel kinks for optic cup segmentation (figure 26). a preprocessing step was conducted using a level set method to obtain the optic disc and to estimate the initial optic cup boundary. therefore, a region of interest was extracted and the disc center was identified by thresholding of the red component. next, variational level set method and direct ellipse fitting approach were applied to obtain and smoothen the optic disc. the results were then ellipse - fitted in order to provide an approximation of the cup boundary based on pallor. square pixel size patches were used as guide based on the pallor cup boundary to locate the kinks within the optic disc. canny edge detection and wavelet transform were applied separately in the green channel to detect the kinks on the intradisc vessel edges. to avoid the effects of protrusion along some of the detected edges, a polynomial application was used to smooth each edge, followed by vectorizing the vessel edges and dividing them into 15 segments. the kinks were identified by calculating the change in the angle between each of the two edges. finally, the kinks and the additional points with the direct ellipse fitting method were used to determine the oc boundary. the cdr calculated by the kink and pallor methods were compared with the ground truth cdr and the average errors of each method was calculated. the average errors were 0.139 and 0.093 for pallor method and kink method, respectively. introduced a statistical model based method that combines circular hough transform and a novel optimal channel selection for od and oc segmentation. the active shape model using 24 landmark points around the od was used as the first step. a preprocessing was conducted to decrease the effect of blood vessels, and the best image was determined based on the image contrast ratio. identifying the od center and approximating the od size therefore, canny edge detector and circular hough transform were applied to obtain the edge map and approximate the od, respectively. then the statistical deformable model was initialized to adjust the od boundary. to update the od segmentation, the landmark position by minimizing the mahalanobis distance was conducted, followed by the direct least squared ellipse fitting method to smooth the boundary of the contour (figure 28). on the other hand, the oc boundary was extracted by applying the active shape model in the green channel of the image without blood vessel. the optic cup center is close to the od center ; therefore, the model was initialized by translating the mean cup model to the od center (figure 29). the average dice coefficient for the od and oc segmentation was 0.92 and 0.81, respectively. superpixel classification based optic disc and optic cup segmentation for glaucoma screening system was introduced by cheng. and is illustrated in figure 30. classifying each superpixel as disc or nondisc in the od segmentation was done based on histograms and center surround statistics. on the other hand, in the oc segmentation a simple linear iterative clustering algorithm was used to gather nearby pixels into superpixels. extracting od features was achieved by enhancing the contrast using the histogram equalization for the three image components (r, b, and g) and computing the center surround statistics to avoid color similarity in the group of pixels forming the superpixel. a library for support vector machine (libsvm) was used as classifier to extract the od boundary (figure 31). detecting the oc boundary finally, libsvm was used as classifier to extract the oc boundary (figure 32). knowing the od and oc, the cdr could be computed. the algorithm was evaluated based on 2326 images from two resources : simes and scen. results showed an average overlapping error of 9.5% in optic disc segmentation and 24.1% in optic cup segmentation using only the simes dataset. mishra. proposed an active contour method to find the cdr in order to determine glaucoma (figure 33). the green channel image was used in the segmentation process similar to the previous algorithms. illumination was corrected using a mathematical morphology in which the background of the image was estimated by morphological opening process. the blood vessels were removed by applying a morphology based vessel segmentation proposed by fraz and colleagues. subsequently, image inpainting was used to replace the blood vessel region with plausible background. the method was tested on 25 images obtained from an optic disc organization in uk. wong. proposed an automatic cdr detection algorithm based on a variational level set approach (figure 34). therefore, an image histogram was obtained in which pixels with the highest intensity were selected to be the disc region. also, the image was divided into 64 regions, and the disc center was the region with greatest number of high intensity pixels. the roi was identified by a circle with a radius twice as long as the typical normal od radius. the variational level was applied to detect the od boundary using red channel. next, ellipse fitting was applied to smooth the boundary. due to the high density of the blood vessels in the oc region, the methodology was evaluated using 104 images from simes and the results produced up to 0.2 cdr units from manually graded samples. to calculate cdr, k - mean pixel clustering technique and gabor wavelet transform were used to segment the od and oc separately (figure 35). the k - mean clustering classifies the data into a number of clusters. for each cluster k centroids were defined and each point in the data was associated to the nearest centroid to create groups. the first step is completed when no point is pending and an early group is created. then k was recalculated to new centroids as barycenters of the clusters of the previous step. as the result, a new binding had to be made between the same data and the nearest new centroid. a loop was created to track the location of the centroids until centroids did not move any more in order to reduce the objective function (squared error function). finally, oc and od were segmented using green plane to choose mean value for background blood vessel. then the disc and cup were replaced, where the image was mapped in 4 iterations to calculate the mean value of the matrix distance. gabor wavelet transform was also executed to avoid problems due to the presence of blood vessels. since the vessels have directional pattern, the gabor wavelet transform was tuned for specific frequencies and orientations to filter out the background noise. ho. developed a novel technique for automatic fundus image analysis for glaucoma screening (figure 36). was the initial step and was conducted using two structural characteristics : shape and continuity feature. a canny edge detector was applied to detect general edges containing the boundaries of blood vessels, where the green channel was used in the analysis. bayesian rules were used to generate an accurate confidence map by combining the horizontal and vertical confidence maps from the shape and continuity feature. fast marching method was employed to fill the vessels free spaces and then the peak thresholding from inpainted image histogram was executed for segmentation, where the image was segmented into three regions. firstly, in order to estimate the disc boundary, the three regions were fitted with two circles and the active contour model was applied to extract the boundaries of the inner cup and surrounding disc. a dynamic histogram equalization technique may be applied to enhance the image contrast and to avoid wrong identification of the cdr and is nt due to nonclear oc on vessels free images. narasimhan and vijayarekha introduced a new system for glaucoma detection based on k - mean clustering technique to extract od and oc and also an elliptical fitting technique to calculate the cdr. in addition, a local entropy thresholding approach was applied to detect the blood vessels and compute is nt. roi covered the od, oc, and small part of the region near to the od in the retinal image ; thus, the k value was chosen as 3. the clusters not belonging to the od and oc were removed. as the result, two clusters from the od region remained, since the operation was conducted to fill the holes and spaces inside od and oc clusters. subsequently connected component technique was applied to form rectangles that represented the entire od and oc. to calculate cdr, elliptical fitting technique was executed on od and oc and the areas of the ellipse, oc, and oc were computed using a specific formula. the is nt was computed by measuring the area of the blood vessels in the four quadrants. therefore, a local entropy thresholding was used to segment the blood vessels and then a mask was applied to measure the four areas. three classifiers, that is, knn, bayes, and svm, were used to test 15 normal and 21 glaucomatous images. knn achieved 93.3% and 80.9% success rates ; bayes achieved 86.6% and 95.23% success rates ; and svm achieved 100% 95.23% success rates for normal and abnormal images, respectively. annu and justin proposed another method for automated classification of glaucoma by wavelet energy feature. the technique uses texture features within the image by applying energy distribution over wavelet subbands and efficient glaucoma classification based on probabilistic neural network. the wavelet features were gained from the daubechies (db3), symlets, and biorthogonal wavelet filters. z - score normalization was applied to the images to equalize the irregular illumination associated with the image. the feature of the retinal image was extracted to simplify the classification process since it provides characteristics of input pixel to the classifier. various textures have different energy in the space frequency domain ; hence, the energy obtained from the coefficient was used to distinguish between the normal and glaucomatous images. finally, a probabilistic neural network was used as classifier to analyze image properties and classify the dataset. this involved two phases : a training phase and a testing phase. in the training phase the known data was given and in the testing phase the unknown data was used. the algorithm was applied on 10 normal and 10 glaucomatous images, and 15 images were used for training. the results showed sensitivity, specificity, positive predictive accuracy, and accuracy of 100%, 90%, 90%, and 95%, respectively. the od and oc segmentation technique proposed by narasimhan and colleagues implements the opencv library functions based on k - mean clustering and elliptic fitting (figure 39) to calculate cdr. the cvminarearect2 () was used to draw the ellipse and the blood vessels were extracted using matched filter in which cv2drotationmatrix and cvwarpaffine were used to rotate the kernel. we provided a comprehensive review of the algorithms used for od and oc detection and segmentation that help with diagnosis of glaucoma by detecting the main structures of the onh. many algorithms were limited due to the complexities of onh structure which is very variable among people and among different pathologies. papillary atrophy causes some difficulties for disc segmentation due to its similarity in intensity to disc boundaries. however, there are some algorithms that can segment the disc with ppa perfectly. on the other hand, disc drusen causes greater difficulty for segmenting the disc since the changes that appear on the disc boundaries make the discs completely covered, especially in advanced cases. no current segmentation technique considers disc drusen based on retinal fundus images due to the rarity of the case and its complexity in terms of image processing. this is a challenge facing many researchers and there are limited segmentation techniques that address this challenge. some approaches used a small dataset, while some used large datasets to train and test the algorithm. many methods were tested only on normal retinal images, and those that were evaluated on pathological images used different number of glaucomatous images. also, the severity of the disease was different among the datasets used in different techniques ; therefore, the corresponding algorithms can not be compared with each other. most of the od segmentation was based on the circular hough transform along with other detection techniques. obtained excellent results based on a large dataset (messidor) for both localization and segmentation of od ; however, errors occurred due to ellipse eccentricity that was not suitable for circular approach. yin. introduced an edge detection, circular hough transform to estimate the od center and diameter, and a statistical deformable model to adjust the disc boundary according to the image texture. utilizing a large dataset, also achieved good results by eliminating the peripapillary atrophy based on edge filtering, constraint elliptical hough transform, and peripapillary atrophy detection. due to the low contrast of the disc boundary, od boundary was not detected in some images. therefore, a preprocessing stage to select the best image component is necessary to improve the results. lu gained excellent results based on three datasets : stare, aria, and messidor. a circular transform was designed to determine the circular shape of od and also the image variation across the od boundary with a very short computation time of only 5s. three sources of error contributed to segmentation failure for a few images ; these were as follows : (1) the large color variation across the oc boundary might have caused the pms to fall on the cup boundary instead of disc boundary, (2) due to ultralow image variation across the od boundary, much of the od boundary had no pm detected and therefore the od boundary remained undetected, and (3) the error introduced by the pms was created based on symmetry. on the other hand, cheng. obtained perfect results using an od and oc segmentation algorithm based on superpixel classification utilizing histograms and center surround statistics. however, a preprocessing step was essential to improve the image. also, to create a robust algorithm multiple kernel learning was required for enhancement and extraction of blood vessels to fine - tune the cup boundary. sinha and babu proposed an algorithm to localize the od based on l1 minimization. the algorithm achieved a high success rate in localizing the od ; the algorithm failed in only 6 out of 259 images. the fails were due to the scaling factor which needs to be fixed at the start of a trial for the dataset to downsample the image to suitable size in tune with those in the dictionary. this approach sometimes results in false segmentation due to the blood vessels and nerves crossing the od that appear darker than od and therefore restrict the search space in the retinal image. in general, in addition to blood vessel extraction, a preprocessing step including image channel selection, illumination normalization, and contrast improvement is necessary for a robust approach in od and oc segmentation. retinal pathological images that have captured the effect of the disease on the optic nerve head must be considered in order to obtain correct computations of the cdr and is nt for the glaucoma screening. segmentation of the optic disc and optic cup has captured the interest of many researchers. although there are many promising approaches, there is still room for improvement in segmentation techniques. only few of the existing methodologies, whether for optic disc or for optic cup segmentation, can be applied for glaucomatous retinal images. also, most of the current methods have been tested on a limited number of datasets such as drive and stare. furthermore, the generally low resolution of the images (ranging from 0.4 to 0.3 megapixels) has made the segmentation process even more challenging. an advanced camera capable of taking high volumes of high resolution retinal images will facilitate glaucoma screening. in order to achieve good outcomes for the images captured by different systems, most of the retinal images used to evaluate segmentation methods have been taken from adults. the retinas of infants, babies, and children have different morphological characteristics than that of adults, and this difference must be considered in segmentation methodologies. the glaucoma screening system complements but does not replace the work of ophthalmologists and optometrists in diagnosis ; routine examinations have to be conducted in addition to the fundus image analysis. however, the system facilitates diagnosis by calculating the disc and cup structural parameters and showing greater details of onh, such as the disc and cup areas, the vertical and horizontal cup - to - disc ratios, and cup to disc area ratio, and also checking the is nt arrangement. this is a shareable opinion that could associate the worlds of consultant ophthalmologists, optometrists, orthoptists, and engineers. the main contribution of this paper is in introducing a survey of current optic disc and optic cup segmentation methods for calculating the cdr and is nt. the optic disc segmentation methods were covered first, followed by two optic cup segmentation methods. the main objective was to present some of the current detection and segmentation methodologies and to give the reader an overview of the existing research. the current trends and challenges and the future directions in optic disc and optic cup segmentation were also discussed. | glaucoma is the second leading cause of loss of vision in the world. examining the head of optic nerve (cup - to - disc ratio) is very important for diagnosing glaucoma and for patient monitoring after diagnosis. images of optic disc and optic cup are acquired by fundus camera as well as optical coherence tomography. the optic disc and optic cup segmentation techniques are used to isolate the relevant parts of the retinal image and to calculate the cup - to - disc ratio. the main objective of this paper is to review segmentation methodologies and techniques for the disc and cup boundaries which are utilized to calculate the disc and cup geometrical parameters automatically and accurately to help the professionals in the glaucoma to have a wide view and more details about the optic nerve head structure using retinal fundus images. we provide a brief description of each technique, highlighting its classification and performance metrics. the current and future research directions are summarized and discussed. |
ionizing radiation has been increasingly used during the past decades for diagnosing and treating different medical conditions (1). however, besides its diagnostic and therapeutic effects, ionizing radiation is also associated with different side effects. severity of side effects varies with the dose, for which there is threshold value. beyond certain thresholds, radiation can impair the functioning of tissues and/or organs and can produce acute effects such as skin redness, hair loss, radiation burns or acute radiation syndrome. for instance, the dose threshold for acute radiation syndrome is about 1000 millisievert per year (msv / yr) (2). if the dose is low or delivered over a long period of time (low dose rate), there is greater likelihood for damaged cells to successfully repair themselves (3). however, long - term effects may still occur if cell damage is repaired but incorporates errors, transforming an irradiated cell that still retains its capacity for cell division. effects of this type will not always occur, but their likelihood is proportional to the radiation dose. this risk is higher for children and adolescents, as they are significantly more sensitive to radiation exposure than adults (3). epidemiological studies on populations exposed to radiation showed a significant increase of cancer risk at doses above 100 msv / yr (4). accordingly, healthcare professionals particularly nurses are at a great risk for being exposed to harmful effects of ionizing radiation (5). one of the most common indications of radiological examinations is for patients who are hospitalized at intensive care units (icu). the patients in these units are usually connected to different medical devices and have many catheters and tubes in place and hence, they can not be transferred to the radiology unit for undergoing radiological examinations (6). being aware of the risks of ionizing radiation as well as the probability of radiation exposure and effective strategies for radiation protection is of paramount importance for all healthcare providers particularly those who work in icus. without having such awareness, healthcare professionals may either have unnecessary fear and anxiety over radiation exposure or they may fail to adopt measures to protect themselves from the adverse effects of ionizing radiation (8). the highest permitted level of occupational radiation exposure is 0.25 micro sievert per hour (sv / h) or 20 milisievert per year (msv / y) (9). however, most hospital staff wrongly believe that all doses of ionizing radiation are harmful to humans and hence they have fear over portable radiological examinations (7). the consequent overprotection or under protection may cause considerable damage to patients and healthcare providers health. studies have shown that nurses have limited knowledge of radiation safety, exposure and protection (8). evaluated radiation knowledge and attitude of 68 physicians and 76 nurses who were working in high - exposure clinical settings. they found that more than 70% of physicians and nurses had limited knowledge regarding hazards of radiation, amount of environmental radiation of each radiological examination, and radiation protection strategies (10). they found that 94.7% of the technicians adopted self - protection strategies while only 26.3% of them employed strategies for protecting patients and other healthcare professionals (11), however, in our literature review no study describing iranian nursesknowledge was found. reliable sources indicated that there is a knowledge gap in the area of icu nurses ' knowledge and behavior concerning protection against portable radiation. moreover, there are major conflicts between iranian nurses and hospital administrators regarding the safest place during portable radiological examinations. accordingly, this study was conducted to fill this knowledge gap and to provide further evidence regarding nurses radiation protection knowledge and behavior. the aim of the present study was to investigate icu nurses knowledge of radiation safety and their behaviors towards portable radiological examinations. the study setting was the medical, surgical, and the trauma icus of shahid beheshti hospital, kashan, iran. in total, there were 22 beds in these three icus at the time of the study. all 45 icu nurses who were working in the study setting were recruited in the study using the census method. we used a demographic questionnaire, a radiation protection knowledge questionnaire (rpkq), and a checklist, all of which were researcher - made. the demographic questionnaire consisted of five questions related to nurses age, gender, marital status, education level, and icu work experience the rpkq contained eleven multiple - choice questions on nurses knowledge of x - ray radiation safety. the five items of the checklist were : going out of the unit, going to the break room, staying at the nursing station, standing behind a lead apron, and using protective equipment. additionally, we used a geiger - mller counter (summertown co., usa) for measuring real - time ionizing radiation. this device detects and measures ionizing radiation and shows the dose of radiation on a built - in display. furthermore, mobile imaging machines were similar in all three sectors and quality control was performed by each department of the hospital at the start of each year. an expert panel consisting of ten nursing and radiology faculty members was invited to assess the content validity of the rpkq and the checklist. the means of total relevance, simplicity, and clarity scores were 0.99, 0.98, and 0.97, respectively. moreover, the face validity of the instrument was assessed by asking ten practicing nurses to judge the readability, clarity, and comprehensibility of the items. accordingly, ten practicing nurses were asked to complete the rpkq twice with a two - week interval in between. the test - retest correlation coefficient was equal to 0.85. in case of any portable radiological examinations during the present study, the second author (a trained nurse) referred to the study setting and used a geiger - mller counter to measure ionizing radiation at predetermined locations within the icu. this device is annually calibrating at the secondary standard dosimetry lab (ssdl) located in karaj city of iran. the measurement locations were nurses break room, nursing station, and behind a lead apron. the mean of the three measurements was calculated and used for final data analysis. moreover, the same researcher observed and documented nurses radiation protection behavior during the concurrent measurement of radiation. at the end of the study, we invited the study participants to respond to the rpkq. nurses responded to the items at the end of their shift in the presence of the second author. the university review board and research ethics committee of kashan university of medical sciences approved this study (approval letter no. the objectives of the study and existence of an observer were explained to all participants. they were all assured of the privacy of their personal information and signed a written informed consent form before participating in this study. the mean, standard deviation, and percentage of nurses radiation protection knowledge, the frequency of their radiation protection behaviors, and the mean of radiation dose were calculated for the final analysis. one - sample t test was used for comparing the mean radiation dose with the highest permitted level of occupational radiation exposure. the university review board and research ethics committee of kashan university of medical sciences approved this study (approval letter no. the objectives of the study and existence of an observer were explained to all participants. they were all assured of the privacy of their personal information and signed a written informed consent form before participating in this study. the mean, standard deviation, and percentage of nurses radiation protection knowledge, the frequency of their radiation protection behaviors, and the mean of radiation dose were calculated for the final analysis. one - sample t test was used for comparing the mean radiation dose with the highest permitted level of occupational radiation exposure. in total, 45 nurses were recruited in the study, yet, 44 nurses replied to the study questionnaire completely. the age of study participants ranged between 25 and 45 years with a mean of 32 5.81 years. the range and the mean of participants work experience were 7.39 3.89 and 1 - 15 years, respectively. the mean of participants radiation protection knowledge was 4.77 1.38. the highest and the lowest scores were 2 and 8, respectively. the highest and the lowest scored questions of the rpkq were question numbers 4 and 8, respectively (table 1). we found that 37 nurses (84%) left the icu and missed to monitor their patients during portable radiological examinations. table 3 shows the findings of the radiation dosimetry at different locations within the three icus. the highest dose of radiation was related to the nursing station of the surgical icu. the results of the one - sample t test revealed that the mean dose of radiation was significantly lower than the highest permitted level of occupational radiation exposure (p value < 0.001 ; table 4). also reported that while more than 70% of physicians and nurses personally believed that they had great radiation protection knowledge, their knowledge was poor to moderate (10). the nurses limited radiation protection knowledge can be attributed to limited college - based and in - service educations about radiation safety and protection. aps (12), salti and whaites (13) and ilguy. (14) also conducted three studies in different countries and found that dental practitioners had limited radiation safety and protection knowledge. however, slechta, reagan and shah found that radiology technicians knowledge of x - ray radiation protection was 75 - 82% (13 - 16). the discrepancies among the findings of different studies can be attributed to differences in the settings, samples, and data collection instruments of the studies. we also found that most of the participating nurses left the icu during portable radiological examinations. in this study leaving the icu was the most common radiation protection strategy. this finding can be related to their limited knowledge of safe distance from the source of radiation during portable radiological examinations. however, flor and gelbcke found that nurses who worked in catheterization laboratories did not even use the basic safety equipment because they considered such equipment as heavy and uncomfortable (17). the conflict between our findings and the findings of flor and gelbcke can be attributed to the fact that catheterization nurses are constantly exposed to radiation and hence, they underestimate the risks of ionizing radiation and ignore the importance of using safety equipment. the study findings also revealed that only three nurses out of the 44 participating nurses stayed at the nursing station and continued monitoring patients during radiological examinations. nurses who leave the icu during portable radiological examinations may fail to diagnose patients accidental disconnection from mechanical ventilation devices. such accidental disconnection can cause potential complications such as hypoxia, increased length of hospital stay, and increased mortality rate (18). we also found that the dose of radiation in the study setting was significantly lower than the highest permitted level of radiation exposure. similar findings of different studies in this area demonstrate that the dose of radiation during portable radiological examinations in different locations of clinical settings is probably lower than the highest permitted level. the findings of this study may guide nurses about the correct behaviors during portable radiological examinations. this study was performed only in one medical center and the study sample size was small. furthermore we used an analog dosimeter, which may not be as accurate as the digital version. future studies with larger sample sizes and use of digital dosimeters may overcome these limitations. the study findings indicate that portable radiological examinations do not expose healthcare providers to high doses of ionizing radiation. accordingly, clinical settings, which have been designed and organized according to proper safety standards, can be considered safe and free from ionizing radiation during portable radiological examinations. | background : radiological examinations for patients who are hospitalized at intensive care units are usually performed using portable radiography devices. however they may require knowledge and safety precautions of nurses.objectives:the aim of the study was to investigate icu nurses knowledge of radiation safety and their behaviors towards portable radiological examinations.materials and methods : in total, 44 intensive care nurses were recruited for this cross - sectional descriptive study using census sampling during april and may 2014. the study setting was at intensive care units of shahid beheshti hospital of kashan, iran. an eleven - item questionnaire and a five - item checklist were used for evaluating nurses radiation protection knowledge and behaviors, respectively. an expert panel consisting of ten nursing and radiology faculty members confirmed the content validity of the questionnaire and the checklist. moreover, a geiger - mller counter was used for measuring ionizing radiation during portable radiological examinations. study data were analyzed using the spss software version 13.0. mean, standard deviation, frequency and one - sample t test were used for description of the data. the level of significance was set at below 0.05.results:the mean of participants radiation protection knowledge was 4.77 1.38. the most prevalent radiation protection behavior of nurses was leaving the intensive care unit during portable radiological examinations. only 6.8% of nurses stayed at the nursing station during radiological examinations. the highest dose of radiation was 0.11 micro sievert per hour (sv / h), which was much lower than the highest permitted level of radiation exposure i.e. 0.25 sv / h.conclusions : portable radiological examinations did not expose healthcare providers to high doses of ionizing radiation. nurses radiation protection knowledge was limited and hence, they require in - service education programs. |
a problem that has frequently emerged as a critical issue in patients with venoarterial (va) extracorporeal membranous oxygenation (ecmo) is a dilatation of the left heart due to volume overload of the left ventricle. conventionally, a venting cannula is placed in the left atrium via the right upper pulmonary vein or the la auricle with a sternotomy or a lateral thoracotomy. however, these approaches are risky because of significant complications such as bleeding and scarring. the procedure chosen for percutaneous left heart decompression varies from insertion of the la venting cannula to placement of an atrial septal stent. recent reports showed that there was no significant difference between these procedures. here, we describe a successful percutaneous balloon atrial septostomy and an la venting cannula insertion during va ecmo in a patient with severe acute myocarditis. a 38-month - old, 11.7 kg boy he had suffered from intraventricular hemorrhage and intracranial hemorrhage caused by neonatal asphyxia, and he had been kept on antiepileptic medication due to infantile spasm. the patient was transferred to the intensive care unit with very poor hemodynamics and subsequent supraventricular tachycardia (heart rate > 200/min), which did not respond to intravenous amiodarone or adenosine. despite conventional therapy including inotropes, his condition continued to deteriorate with tachycardia. echocardiography revealed a marked decrease of 20% in the ejection fraction, and we therefore decided to support him with va ecmo. arterial cannulation was performed via the right carotid artery with an 8 fr percutaneous arterial cannula (rmi ; edwards lifesciences, irvine, ca, usa), and a 14 fr percutaneous venous cannula (rmi, edwards lifesciences) was placed in the right internal jugular vein. ecmo flow was initially 1,300 ml / min and was maintained between 700 to 800 ml / min. after ecmo insertion, the patient s vital signs stabilized and his chest x - ray improved (fig. however, he began to produce a large amount of frothy, bloody endotracheal secretions and his pulse pressure disappeared twelve hours later. follow - up echocardiography revealed marked left heart distention and a left ventricular ejection fraction lower than 10%. therefore, fourteen hours after ecmo insertion, the patient was taken to the cardiac catheter laboratory for an atrial balloon septostomy and la venting cannula insertion. the procedure was accomplished with a percutaneous approach through the right femoral vein without complications and an 8.5 fr la venting cannula (mullins sheath ; cook inc. 2). after placement of the la venting cannula, the pulse pressure appeared again, with a 15 mmhg gap between the systolic and diastolic pressure. his follow - up chest x - ray improved (fig. four days later, we observed recovery of left ventricular function and improvement of the chest x - ray (fig. follow - up echocardiography showed improved lv systolic function and an ejection fraction of 65%. since its introduction as a major support for severe respiratory distress, ecmo has become a well - established therapy in pediatric patients, particularly those with severe but reversible neonatal respiratory failure, cardiac failure, or cardiorespiratory failure. in particular, va ecmo has been used in pediatric patients with cardiac dysfunction, such as myocarditis, cardiac arrest, and cardiomyopathy. left heart distension during va ecmo may develop, leading to progressive left heart deterioration, pulmonary edema, and impairment of myocardial oxygenation. despite its clinical importance, the management of left heart decompression in a patient with ecmo is rarely discussed. only sporadic case reports and a few articles have shown the efficacy of la decompression on functional recovery of the left heart [57 ]. conventionally, la decompression is achieved by insertion of an la venting cannula via sternotomy or thoracotomy. however, sternotomy or thoracotomy themselves are risky and have several complications, such as bleeding and significant scarring. la decompression with a percutaneous cardiac catheterization - based technique including septostomy using a blade or radiofrequency ablation, balloon dilatation, and la venting cannula insertion has been effective [2,46,8 ]. several institutions with la vents have identified technical issues related to management of the indwelling catheters, such as kinking, poor flow, movement of the catheter with required patient care, and ongoing concern for thrombosis. therefore, a recent study showed a shift in preference from la vent insertion to balloon dilation alone. however, balloon atrial septostomy alone is not always successful because of varying degrees of atrial septal thickness. we believe that using an la venting cannula after balloon dilation offers several advantages over balloon dilatation alone. first, the placement of an la venting cannula potentially allows for controlled decompression of the left heart by adjusting flow rates on the ecmo circuit or clamping the cannula. third, the size of the cannula can be tailored to each patient, so this procedure can be adjusted for use in smaller patients. for patients with left heart dysfunction causing pulmonary edema during va ecmo, percutaneous balloon atrial septostomy with la venting cannula insertion is a treatment option that carries a low risk of other complications such as bleeding. | patients with venoarterial extracorporeal membrane oxygenation (ecmo) frequently suffer from pulmonary edema due to left ventricular dysfunction that accompanies left heart dilatation, which is caused by left atrial hypertension. the problem can be resolved by left atrium (la) decompression. we performed a successful percutaneous la decompression with an atrial septostomy and placement of an la venting cannula in a 38-month - old child treated with venoarterial ecmo for acute myocarditis. |
a key idea that has emerged over the past two decades is that neurons in the mpfc, especially the anterior cingulate cortex, encode the recent history of successes and failures in performing a given task (shima and tanji, 1998 ; shidara and richmond, 2002 ; ito., 2003 ; mpfc neurons are thought to process these signals in parallel with network - level rhythmic activity that is associated with adaptive control, especially in the theta range (cavanagh., 2012). reversible inactivation of the mpfc impairs the expression of performance adjustments, such as changing plans of action (shima and tanji, 1998), switching between exploration and exploitation (amiez., 2006), and a crucial issue is to link neuronal spike activity to macro - level events that have been reported in many human studies and showing that these macro - level events are comparable across species (narayanan., 2013). a number of human studies have established that the mpfc is involved in the adaptive control of behavior (see ridderinkhof., 2004 for review and shackman., 2011 for an alternative perspective). a core initial finding was the discovery of error - related evoked potentials in eeg recordings from humans performing choice rt tasks (falkenstein., 1991 ; gehring., 1993). these signals were interpreted as markers of performance monitoring and adjustment (gehring., 1993), were localized to the anterior cingulate cortex using eeg (dehaene., 1994) and fmri (carter., 1998) based methods, and were associated with underlying theta band (48 hz) oscillations (luu., 2004). an early alternative interpretation emerged that proposed that the signals reflect the difficulty, or conflict, associated with the choice made by the participant (carter., 1998). that is, trials with difficult discriminations tend to have higher error rates and these conditions selectively activate the anterior cingulate cortex. however, single - unit recordings in the monkey mpfc, specifically the dorsal acc, did not support this view and found that, instead, neurons in this part of the brain encode information about behavioral outcomes (ito., 2003). more recent studies have emphasized the role of these signals in processing feedback about the success of action (e.g. sallet., 2013), and feedback - related potentials have recently been found in the rat mpfc (warren., 2014). single - unit recordings in humans have supported the view that the mpfc rapidly evaluates actions as successful or erroneous (sheth., 2012 ; bonini., 2014). studies of human eeg from this group have indicated that these regions in humans are central to action monitoring (burle., 2008). in addition, quantitative analyses of action and feedback related erps support the idea that mid - frontal signals encode variations in performance and monitor ongoing actions (meckler., 2010, 2011, 2013). this interpretation has been supported by single unit and field potential recordings in the monkey anterior cingulate cortex (ito., 2003 ; emeric., 2008) a recent combined recording and inactivation study suggests that these signals are necessary for the expression of adaptive control (kuwabara. studies in rodent models are needed to investigate the neural circuits that underlie adaptive control. our laboratory has studied this issue using a rat model (narayanan., 2006) and found that similar neural correlates of outcome monitoring exist across species (narayanan., 2013). our studies have focused on a rostral cingulate region, specifically the prelimbic area (aka area 32 ; (vogt and paxinos, 2014)). this cingulate region is found in all mammals (see laubach, 2012 for review) and has clear anatomical homologies across species (vogt., 2013 ; vogt and paxinos, 2014). furthermore, by using reversible inactivation methods (narayanan., 2006 ; allen., 2008), we found that this cortical region is necessary for the encoding of past and current behavioral outcomes by the firing rates of neurons in the primary motor cortex and for the ability to adjust behavior after errors, i.e. to exhibit post - error slowing in a simple rt task (narayanan and laubach, 2008). similar signals were later found in an mpfc - dependent delayed alternation task (horst and laubach, 2009, 2012). one influential idea was proposed in a recent modeling study by alexander and brown (2011). the model was able to integrate past outcomes in order to predict future outcomes and reproduced established markers for adaptive control, such as the error - related negativity (ern) and firing rate correlates from monkey physiology. while this connectionist model has done a lot to inspire theory and experiments on the mpfc, the neurons in it were modeled only in terms of firing rate, and not precise temporal patterns, and so it is unclear how the model can account for macro - level network signals such as the ern (falkenstein., 1991 ; gehring., 1993) or post - error theta (luu., 2004) that are based on precise synchronizations of firing rates over large pools of neurons as a first step towards addressing this issue, a spiking network model of the mpfc was developed through collaboration between one of us (ml) and the eliasmith group (bekolay., 2014). the model was based on analysis of the population statistics of spike activity in the rat mpfc during the simple rt task (narayanan and laubach, 2008, 2009). a key finding was that neuronal population activity in the mpfc integrates information about actions and the passage of time (narayanan and laubach, 2009) and accounts for successes and failures in obtaining desired outcomes by exhibiting persistent spiking activity (narayanan and laubach, 2008). we were able to reproduce such population spike activity by chaining together two pools of recurrently connected neurons (i.e. integrator networks). the first integrator network tracked the fact that the trial had begun and the second integrator network tracked the time that had elapsed since the start of the trial (fig 4 in bekolay., 2014). (2014) is similar in many ways to an emerging view in the interval timing literature : timing depends on an encoding of state transitions in the behavioral procedure. although somewhat similar accounts to explain temporal performance have been proposed by behavioral models of timing (e.g., killeen and fetterman, 1988 ; machado, 1997), the transitions proposed by such models were suggested to occur at a broader and ill - defined behavioral level. evidence of such encoding by the brain at either a behavioral or cognitive level is still lacking. transitions between states in the procedure are denoted by salient behavioral events, such as stimuli, the animal 's actions, and the delivery (or absence) of the reward. these events are usually referred to as time markers if they can serve as clues to the passage of time (caetano and church, 2009). the rt and time production tasks that we have used are comprised of several states : disengagement from the task (pre - trial), waiting for the stimulus or the temporal deadline, acting after the stimulus or deadline, and receiving the reward or experiencing a time - out. each of these states is bracketed by salient behavioral events : pressing the lever, receiving the stimulus, responding to the stimulus or at the end of the temporal deadline, and receiving the reward. event - related potentials were found after each of these events (see figures 26 below), and were accompanied by major changes in neuronal spike activity, as quantified using multivariate methods such as pca (see figures 7, 8 and 10 below). the successful model was based on an earlier model from singh and eliasmith (2006), called a double integrator network. the crucial aspect of the bekolay model was that reward feedback terminated activity in the second integrator network. without such feedback, the second integrator remained in an elevated state and denoted the failure to perform the task correctly on the previous trial. a phase analysis of this network showed that correct and incorrect performance resulted in the model entering into a different part of the state space (fig 9 in bekolay., 2014). neurons would thus experience different synaptic states following correct and incorrect performance, and this process could enable learning from errors. new modeling efforts are needed to address this issue using dynamic synapses with plasticity capable of implementing reinforcement learning algorithms. an additional extension of spiking network models to incorporate field potentials is needed for studying adaptive control. post - error theta rhythms are commonly observed in humans performing similar speeded response tasks (cavanagh., 2012). these signals might serve as a mechanism for adaptive control (cavanagh and frank, 2014). a recent collaborative study between our laboratory and a human research group found common markers for adaptive control in rats and humans (narayanan., 2013). developing computational models of these signals will require spiking network implementations of physiologically defined neurons and field simulations, e.g. (lempka., 2011). computational models of adaptive control must move beyond the slow time scales that are captured by firing rate models. these models may reproduce erp level findings but can not account for fast rhythmic activity, such as theta, or precisely coherent spike activity associated with these rhythms (narayanan., 2013). several tasks are classically associated with studies of mpfc / acc function in humans, including the stroop task (pardo., animal studies have used a much wider range of behavioral designs, and these are often determined by species - specific issues (e.g. maze tasks in rodents, eye movement tasks in primates). findings from many animal studies are difficult to relate to studies on the human mpfc, in part due to differences in behavioral design. our approach has been to use a simple type of behavioral task that can be performed in a highly similar way across species. deficits in simple reaction time performance (with simple meaning no choice about the response) are apparent in stroke patients (stuss., 2005) and are apparent immediately after cingulotomies are made (srinivasan., 2013). importantly, animals such as rats and monkeys can readily learn to perform these tasks (laubach., 2000), and this allows for studying neural correlates of rt variability and adaptive control without resorting to months of behavioral training. behavioral methods for studying the neural basis of rt performance in experimental animals were developed starting in the 1960s (e.g. stebbins, 1962 ; stebbins and lanson, 1962 ; stebbins and miller, 1964)). these studies led to some of the first single - unit recordings made in the motor (evarts, 1966) and medial prefrontal (niki and watanabe, 1979) cortices. using similar methods in rodents, a number of groups found that lesions and reversible inactivations of the mpfc (specifically, the prelimbic area) impaired the ability of animals to sustain actions over delay periods (broersen and uylings, 1999 ; risterucci., 2003 ; narayanan., 2006). a related study (brown., 1991) found that a more dorsal mpfc region, the medial agranular cortex (also known as the secondary motor cortex), controls bias over lateralized responses to visual stimuli and is necessary for speeded performance. this cortical area is not part of the anatomically defined anterior cingulate cortex. a more recent study by our group (smith., 2010) used the simple rt task and found similar slowing of rts occurred when this cortical region was inactivated. together, these studies establish that there is regional specialization within the rodent mpfc for the control of action initiation, with the ventral (anterior cingulate) regions having a selective role in limiting inappropriate actions and the dorsal (medial agranular) regions having a selective role in the initiation of action. the validity of these findings for the human brain has been established by a clinical study that used a modified simple rt task to study the immediate effects of damage near the cingulate bundle on action initiation (srinivasan., 2013). they found the same behavioral deficit found in the rat studies cited above : patients were unable to sustain an action over an extended delay and made excessive premature responses. the functional significance of this deficit was recently characterized in a comprehensive review (bari and robbins, 2013) as an impairment in the ability to postpone action, a core deficit of inhibitory control. in other words, the mpfc is necessary for the ability to wait (narayanan., 2006). but waiting alone can not explain the effects of damage in the mpfc. in a clever study, risterucci and colleagues (2003) used a standard simple rt design, in which rats had to release a lever in response to a visual stimulus that was presented after one of four potential delays. lesions led to increased premature responding and eliminated the delay - dependent speeding of the rt (i.e. shorter rt after longer delay). eventually, the rats were able to perform the task at pre - surgical levels. however, by slightly changing the timing of the delay periods, the premature response deficit was re - expressed. these findings suggest that in the absence of mpfc control, rats are able to learn to withhold responding but are not able to adapt to dynamic changes in a given behavioral procedure. inspired by this study, we tested rats with several variants on the simple rt design (narayanan., 2006), i.e. rats were tested in sessions with fixed or variable delay periods and with fixed or variable intensity stimuli. evidence for an inhibitory role of the mpfc was found in sessions with variable delays : rats were actually quicker to respond after short delays with mpfc inactivated. these results suggested that a form of response inhibition was generated by the mpfc early in the delay period. this interpretation was later confirmed by recording single - unit activity in the mpfc and by inactivating the mpfc while recording in the primary motor cortex (narayanan and laubach, 2006). taken together, our findings suggested that the mpfc generates a control signal that is used to control the timing of action and acts on the primary motor cortex to influence behavior. whereas many studies implicate mpfc in inhibitory control in tasks that require specific actions to be sustained over extended periods of time (chudasama., 2003, 2012 ;, 2003 ; narayanan and laubach, 2006 ; narayanan., 2006 ; 2013), this region does not appear to be involved in delayed discounting (cardinal., 2001). delay discounting (or delayed gratification) tasks involve presenting a highly valued outcome after an extended delay and a lower value outcome after a minimal delay. in contrast to the mpfc, lesions and manipulations of monoamines (serotonin and norepinephrine) in the orbital frontal cortex have clear effects on delayed discounting (winstanley., 2004, 2006 ; the neuronal basis of these effects has not been examined using paired recordings in the medial and orbital frontal cortex, and this should be a topic of future research. anatomical studies have reported minimal direct anatomical connections between the mpfc and primary motor cortex (donoghue and wise, 1982 ; vertes, 2004 ; hoover and vertes, 2007). therefore, a temporal control signal generated in the mpfc would likely need to use other circuits to influence the motor cortex, perhaps by way of a reciprocally connected cortical area or by more complex circuits through the basal ganglia and/or thalamus (narayanan and laubach, 2006). to investigate the direct cortical pathway hypothesis, a study from our group compared findings from mpfc inactivations with results from reversibly inactivating the secondary motor cortex (the rostral forelimb area located within the medial agranular cortex) (smith., 2010). inactivating instead, the rats tended to respond more slowly, similar to brown. these studies suggest that the secondary motor cortex (medial agranuarl cortex) is a direct cortical pathway between the mpfc and primary motor cortex in rodents. in addition to studies of mpfc using rt and time production tasks (reviewed above), we also used reversible inactivation methods to examine the role of the mpfc in a classic test of spatial working memory, the delayed alternation task (horst and laubach, 2009). we found that mpfc inactivation alters measures of temporal processing in that task and, more recently, found cells that fired as a function of the animal 's pace in performing the task (horst and laubach, 2012). related studies found that mpfc neurons fire to action - imperative stimuli in the delayed alternation task (caetano., 2012) and during the initiation of consummatory behavior (licking) when correct responses are reinforced (horst and laubach, 2013). our neural circuit model (bekolay., 2014) incorporated these response properties (stimulus, action and outcome driven cells with recurrent connectivity) and was able to reproduce the common modes of firing by populations of mpfc neurons in the simple rt task (narayanan and laubach, 2009) and the effects of previous outcomes on rt performance, specifically post - error slowing (narayanan and laubach, 2008). finally, we have described how individual neurons in the aged mpfc, as well as population activity in this area, fail to respond to imperative stimuli in a delayed alternation task, which leads to an inability of older rats to time their actions properly in the task when compared to younger rats (caetano., 2012). these studies establish that our findings in the rt and time production tasks generalize to other mpfc - dependent tasks, and support the view that the mpfc is crucial for the temporal control of action. in the previous section, we presented data describing how mpfc controls actions that must maintained over extended periods of time. single unit recording from our group has shown that medial prefrontal neurons consistently encode errors or movements that occur too early in time and do not lead to reward. neural ensemble activity was recorded in the primary motor and medial frontal cortices during the initial acquisition of the simple rt task. an encoding of the accuracy of the delayed response developed in the primary motor cortex over the period of training. most interestingly, the cells fired differently before the initiation of correct and incorrect responses (prospective error encoding). simultaneous recordings of sensors on the manipulandum (tilt - sensor on the lever) and electromyographical (emg) activity from muscles involved in lever pressing found no evidence for these signals being driven by differences in movement (laubach., 2000). based on the study by risterucci. (2003) and our own reversible inactivation study (narayanan., 2006), we decided to follow on laubach. (2000) by recording in the primary motor cortex and mpfc using variations on the standard simple rt task. these studies consistently revealed evidence for prospective error encoding by neurons in both cortical areas and further revealed the mpfc also participates in retrospective error encoding in the rt task (narayanan and laubach, 2008). that is, some mpfc neurons fired persistently after mistakes were made in the task and maintained their post - error firing rates throughout the inter - trial interval and subsequent trial until the next reward was earned. these neural signals were accompanied by the expression of post - error slowing by the rats, in which the rats took significantly more time to initiate actions when a mistake (premature or too late) was made on the previous trial. crucially, inactivation of the mpfc eliminated this post - error slowing (narayanan and laubach, 2008). similar encoding of prospective and retrospective outcome - related information was later found in delayed alternation tasks (horst and laubach, 2012, 2013 ; hyman., 2013). using population analysis methods similar to those used by our group (narayanan and laubach, 2009 ; caetano., 2012) 2013) found a pattern of firing across neurons that was related to the previous behavioral outcome. a similar population activity pattern in the simple rt task was recently reported from simulated neuronal ensembles in the spiking network model reported in bekolay. these population level signals suggest that outcomes may be encoded by network - level activity within the mpfc. to examine this issue, we initiated a collaborative study with a human eeg group, james cavanagh and michael frank. (2009, 2012), which reported that errors led to selective increases in theta oscillations when humans performed a set of common tasks used to study adaptive control. our collaborative study involved us applying data analysis methods from the cavanagh studies to our recordings of field potentials from the rat mpfc and primary motor cortex and making new recordings of human eeg as participants performed the simple rt task used in the rodent studies described above (based on kornblum, 1973 and used by srinivasan., two results from this project were that (1) rats and humans show the same neural markers of adaptive control, with increases in theta oscillations on post - error trials that were correlated with rt adjustments, and (2) mpfc inactivation eliminates correlates of adaptive control in the primary motor cortex. a theoretical perspective on how the mpfc might control the motor system to achieve control over rt performance was proposed by summerfield and yeung (2013). a standard assumption in rt studies is that actions are initiated when firing rates in the motor cortex pass a threshold. based on this idea and one of their own studies (wyart., 2012), summerfield and yeung proposed that post - error adjustments might arise by oscillatory processing in the mpfc resulting in an increase in the threshold required for triggering action in the motor cortex. they proposed that a mechanism based on a global regulation of cortical excitability underlies this process. if the mpfc entrains the phase of cortical oscillations, then changes in mpfc activity could alter the ability of the motor circuit to become activated following presentation of an action - imperative stimulus. support for this idea was found in the rodent portion of our study (narayanan., 2013) as (1) there was increased spike - field coherence in the theta (48 hz) range in the mpfc on post - error trials and (2) inactivation of mpfc eliminated theta - range oscillations and spike - field coherence on post - error trials in the motor cortex. the underlying idea is that these oscillations could represent long - range communication between areas (fries, 2005 ; womelsdorf and fries, 2007). investigation of this idea would require recording from several brain areas at once to study the propagation of oscillation across functionally connected neuronal networks (paz. how does the mpfc become aware of the need to implement adaptive control in the first place ? a special feature of the mpfc region that we have studied, the prelimbic cortex, is that it is extensively interconnected with the agranular insular cortex (gabbott., 2003). this cortical area encodes visceral and gustatory sensory information in rats and humans (cechetto and saper, 1987 ; allen. the prelimbic area also densely projects to a number of subcortical reward - related centers, such as the dorsal and ventral striatum, the dopaminergic midbrain and the lateral hypothalamus (sesack. a potential mechanism for linking reward - feedback (possibly encoded in the insula) with adaptive control (encoded in the mpfc) might therefore arise by interconnections between the two cortical areas (as first proposed in laubach, 2011) as well as the convergence of the agranular insular and prelimbic cortices onto the same groups of cells in parts of the basal ganglia, such as the striatum and subthalamic nucleus. the subthalamic nucleus, in particular, receives input from dorsal medial frontal regions, and has been shown to regulate premature responding during rt tasks (baunez and robbins, 1999). in the section above, we have described how medial prefrontal cortex participates in adaptive control and is able to adjust performance following mistakes in task performance. to understand the precise nature of performance adjustments in speeded response tasks, including simple rt tasks, it is necessary to review the behavioral processes that are thought to underlie rt variability. classic studies led to the idea that rt performance depends on a competition between stimulus detection and time estimation (ollman and billington, 1972 ; kornblum, 1973). these studies required participants to make a response (lever or button press) until a stimulus was presented after a fixed time interval, aka foreperiod (figure 1a). the stimulus occurred on half of the trials, and the participants had to estimate the time interval between the response and the moment the stimulus would appear to initiate action in the trials with no stimulus presentation. in the deadline model of ollman and billington (1972), participants employ a temporal criterion to respond (after some amount of time has elapsed) and break from waiting if the trigger stimulus is detected. an alternative model is the race model of kornblum (1973) in which there is a competition between an internal clock (that triggers action after the end of the interval) and a signal detector (that triggers action when the stimulus is detected) (figure 1b). these models are similar in many respects to later models of choice rt performance that assume that stimulus detection is gated by temporal processing and is adjusted after mistakes are made (laming, 1979a, 1979b). a key finding for the validity of these models in human studies (such as kornblum, 1973) was that participants showed reduced rt variability on the trials with the stimulus, resulting in a peak in the rt distribution that is not found on the stimulus - free trials. inactivation of medial prefrontal cortex impairs the performance of time estimation tasks (kim., 2009 ; narayanan., 2012). moreover, single neurons and neuronal population activity (analyzed using principal component analysis) exhibit ramping components as rats time discrete temporal intervals (kim., 2013 ; xu., 2014), similar to the ramp and hold components described in the simple rt task by narayanan and laubach (2009). another key player seems to be the dopamine system, which has been shown to participate in temporal processing (meck, 1996 ; buhusi and meck, 2005). systemic injections in rats (maricq and church, 1983 ; meck, 1983) or oral administration in humans (lake and meck, 2013) of dopamine agonists and antagonists seem to speed up and slow down the subjective passage of time, respectively. in particular, these temporal processes appear to be powerfully influenced by d1 dopamine receptors. depleting vta dopamine or focally blocking prefrontal d1 receptors impairs temporal control of action (narayanan., 2012). furthermore, optogenetically inhibiting prefrontal neurons expressing d1 receptors in mice impairs temporal control, while stimulating these neurons slightly improved temporal control (narayanan., 2012). another recent rodent study found evidence for dopaminergic circuits being specifically involved in temporal processing during rt performance. (2013) found that depleting the source of prefrontal dopamine in the ventral tegmental area did not impact overall rt performance, but eliminated delay - dependent speeding. furthermore, focally blocking d1, but not d2, dopamine receptors within the medial prefrontal cortex flattened the rt distribution, such that rts were shorter at short, but not long, delays. these studies provide insight into how rodents guide their behavior in time, a fundamental and highly conserved behavior (buhusi and meck 2005). future studies should examine how neuromodulatory molecules such as dopamine, acetylcholine, and norepinephrine influence rt performance. this effort is essential to developing new therapeutic strategies for parkinson s disease, schizophrenia, alzheimer s disease, adhd, and other neuropsychiatric diseases (parker., 2013). the behavioral studies reviewed above suggest shared bases for temporal processing in rt tasks in rodents and humans. recent work from our group discovered strikingly similar extracellular potentials in both rodents and humans during rt performance (narayanan., 2013). indeed, rodent field potentials and human eeg shared several major features : (1) prominent stimulus - related transients, (2) transients associated with the start of the trial, and (3) alterations in these signals on error trials (figure 2a). these extracellular potentials provide a unique window into information processing by cortical networks, as rhythms and frequencies may entrain large populations of neurons with cognitive signals (buzski, 2006). prefrontal theta oscillations can be linked with other regions, such as the ventral tegmental area and the hippocampus (hyman., 2005 ; jones and wilson, 2005 ; siapas., 2005 ; benchenane., 2011 ; fujisawa and buzski, 2011). combined with our own data suggesting theta coherence between medial prefrontal cortex and motor cortex, these findings suggest that low - frequency oscillations integrate task - relevant information across brain regions. our studies suggest that low - frequency oscillations (below 12 hz) encode critical aspects of rt performance. for instance, using kornblum 's (1973) task, we compared field potentials on trials when rats responded to a stimulus at the end of the delay period (tone trials) and trials when the rats initiated responding based on timing alone (time trials). an evoked potential was apparent just after the stimulus, which did not occur on the time trials (figure 2a), was accompanied by phase locking in the delta range (< 4 hz) (left plot in figure 2c). these responses were accompanied by persistently elevated theta activity (48 hz) (figure 2b) and delta - range phase locking occurred at the start of both types of trials (left and center plots in figure 2c). these neural markers of stimulus detection and action timing were notably lacking on trials when the rat responded prematurely (right plots in figure 2), which suggests that those signals could serve as reference points to properly time the moment at which the action needs to be performed. to study how action was distinct on stimulus - triggered and timed actions, we examined event - related field potentials (figure 3). on the latter trial type, the animals initiated responses that were guided by a temporal rule, based on an internal response ' deadline '. as expected, responses after the stimulus had a clear evoked potential and those guided by deadlines did not (figure 3b). our finding of delta phase entrainment being associated with the initiation of action timing is reminiscent of a study by stefanics. indeed, these low - frequency events are associated with variations in rt performance. using bandpass filtering and the hilbert transform (figure 4a), we measured the amplitude and phase of delta rhythms (or delta - band activity as suggested by a reviewer of this paper) on a trial by trial basis (figure 4b) and then plotted stacked images of the signals, using false color image plots, that were sorted by the animals ' rt. a consistent finding was that the amplitude of the delta rhythm started earlier before trials with the shortest rts (top plot in figure 4c) and was accompanied by a phase reset (bottom plot in figure 4c). these events are coterminous with the press - related erps in figure 2 (time 0) and major changes in spike activity (narayanan and laubach, 2009), as reviewed below. it is important to point out that the signals were not simply the product of bandpass filtering and fourier - based analysis. similar events could be detected using a non - fourier method, empirical mode decomposition (huang., 1998) we evaluated if the delta range activity was sensitive to changes in the behavioral procedure by recording over a series of behavioral test sessions with changes in the expected timing of the imperative stimulus (figure 6a). that is, rats were trained with a single, fixed delay period (1 sec) and then experienced sessions with two equally likely delays (0.4 or 1 sec) and sessions with one delay more likely (2/3 of trials) than the other (1/3 of trials). comparisons of the event - related potentials (erps) synchronized to the initiation of action timing (lever press) showed clear changes in the size of the erp over the period of testing (figure 6b). the erp was largest when there was a single delay period and was reduced in magnitude as the animals experienced the two potential delays and in sessions with short delay bias. however, the erp re - emerged in sessions with long delay bias. these changes were apparent in the first testing session with long delay bias (figure 6c). plots of amplitude (top row) and phase (bottom row) from those sessions revealed a gradual development of increased amplitude and phase consistency when the rats pressed the lever and learned that the stimulus was more likely to occur at the long delay. of note, because we do not have a monotonically varying foreperiod, we could not assess continuously varying temporal expectancies in this study future studies should address this issue. in summary, our studies revealed that rhythmic activity in the mpfc underlies the execution of timed actions. erps are coterminous with the initiation and termination of timed behaviors (figures 2 and 3), these events are accompanied by delta - band activity that is phase locked to the initiation of timing behavior (figure 4). the delta - band activity can be captured by non - fourier methods such as empirical mode decomposition that are designed to detect wave - like events (figure 5). the erps and delta - band activity are sensitive to changes in the expected timing of action in the behavioral task (figure 6). to our knowledge, these findings are the first reports of rhythmic network activity in the mpfc having a role in the control of precisely timed actions. in the previous section we have described macro - level phenomena underlyign the control of timed action. here, we show how neuronal population activity varies with regard to the erps and delta - band activity shown in figures 26. quantitative analysis of population spiking activity (narayanan and laubach, 2009) suggests that two distinct signals are emitted by the mpfc at the start of the trial (figure 7). one signal is a slow modulation of firing rate, starting just before the initiation of the timed action. that is, plots of the cumulative sums of the first two population functions, but not the higher order functions, closely resemble each other (figure 7c). these signals are not specific to maintaining a lever press during the simple rt and time production tasks. similar population functions were found in the mpfc as rats waited for the end of the delay period in a delayed alternation task (caetano., 2012) and engaged in extended bouts of reward consumption in a delayed alternation task and variable interval procedure (horst and laubach, 2013). one potential pitfall for the analysis of population activity that we have reported is that the results are based on firing estimates that are averaged over trials and from multiple animals. it is possible that the same population functions would not be found if single - animal or single - trial data were used. to examine this issue, we analyzed data from single animals using the same pca methods and found that the same two leading modes of population activity could be be detected (figure 8a, b). to address the issue of using trial - averaged data, we used an alternative pca method (chapin and nicolelis, 1999 ; laubach., 1999) that was based on the full time series for each neuron in a given ensemble (figure 8c). we found that the same two leading modes of population activity could be detected using this alternative approach. finally, it was possible to reproduce the firing patterns using simulated spike trains from the double - integration computational model developed in bekolay. our pca analysis revealed that major changes in spiking activity in the mpfc were coterminous with the macro - level events described in the previous section. these findings suggests that the expression of erps and delta - band phase locking to the initiation of behavioral timing is linked to changes in populations activity. to our knowledge, this is a novel result for the mpfc. we are not aware of any published study that reports changes in spiking activity accompany changes in established markers of network synchronization such as erps and delta - band synchronization. two previous studies, one experimental (narayanan and laubach, 2009) and the other based on a spiking network model (bekolay., 2013), suggest that the neuronal activity patterns are generated by an integrator network that can track the passage of time since the animal has entered into the delay period. as such, our results provide a novel mechanism for denoting behavioral time markers in terms of neuronal activity that could be used to control action timing, as proposed by caetano and church (2009). the studies described above establish that neuronal spike activity in mpfc has a role in stimulus and temporal processing and in encoding previous and forthcoming behavioral outcomes during the performance of simple rt tasks. we propose a conceptual model (figure 9a) in which errors can lead to two types of changes in processing, which could occur together, and that would lead to post - error slowing. first, errors could lead to increased control over action, for example by increasing the threshold needed to trigger action on post - error trials (summerfield and young, 2013). second, errors could increase reliance on the stimulus, leading subjects to pay more attention to the stimulus (or increase resources for stimulus detection and integration). both of these processes imply that post - error slowing reflects a change in the performance strategy. to determine if there was support for these two types of changes in processing following an error, we compared spectral amplitude and power on post - correct and post - error trials using the same data sets and analysis methods as in narayanan. we found evidence both for pre - stimulus increases in the amplitude of low - frequency theta fluctuations and for increased phase locking to the action - imperative stimulus on post - error trials. similar results were also found for theta - range field potential fluctuations in the motor cortex (not shown). these field potential signals were generally coherent with spiking by mpfc neurons and depended on the integrity of the mpfc network, i.e. reversible inactivation of mpfc disrupts the expression theta locking in the motor cortex and leads to the loss of adaptive control over action (narayanan., 2013). these processes could serve as a mechanism for adaptive control (cavanagh and frank, 2014). the increased low - frequency rhythm before the stimulus could reflect changes in spiking during the initiation of the trial, as revealed in our pca - based population analysis (figures 78), and lead to increased phase locking to the stimulus. such changes in spike activity would then reflect a change in the behavioral strategy in the task, and might result from altered dynamics and learning among the neuronal ensemble. there was a major difference in spiking before trials were initiated (figure 10a, b). the firing rates of many neurons were modulated around the lever press on post - correct trials (left plot in figure 10a). by contrast, neurons fired persistently before the start of the post - error trials (right plot in figure 10b). these differences in neural activity resulted in the leading components of variance being highly distinct as a function of the previous trial outcome. on post - correct trials, the population functions were the same as in narayanan and laubach (2009), which reported data from sessions with a single (fixed) delay and with two equally likely delays, post - correct trials. on post - error trials, these differences in population activity resulted in distinct dynamics associated with the post - correct and post - error trials. phase plots of these functions revealed distinct neural dynamics associated with the outcome of the previous trial (figure 10c). interactions between the two leading components on post - correct trials resulted in a closed triangular trajectory through phase space, with the neural population starting from and returning to the same region of phase space before and after the trial. hop across phase space, starting and ending in distinct locations within the space defined by the neural activity. (2014). as the complete set of synaptic weights could be gleaned from the model, it was possible to demonstrate that errors resulted in the network experiencing activity states that are not experienced after correct responses. these activity patterns engaged sets of distinct synapses with activity levels that were not found on post - correct trials. as a result, it is possible to learn from errors given that the network dynamics associated with correct and incorrect responding were different. the observed in vivo dynamics of the mpfc and the neural circuit model, together, provide a novel account for how the mpfc may learn from mistakes while enabling adaptive control over action. the mpfc is crucial for the control of action initiation and the ability to adjust performance after mistakes are made. two recent studies (narayanan., 2013 ; srinivasan., 2013) used a classic simple rt task (kornblum, 1973) and established that these functions are evolutionarily conserved. a key neural marker for adaptive control is low - frequency rhythmic activity, in the delta (< 4 hz) and theta (412 hz) range that can be measured in eeg recordings in humans and field potential recordings in experimental animals. changes in these brain rhythms are associated with changes in neuronal spike activity that encodes previous and forthcoming behavioral outcomes. based on the studies discussed in this review, it seems that significant progress can now be made on understanding the neural mechanisms for the adaptive control of action and determining if changes in these processes underlie prominent diseases such as parkinson 's and alzheimer 's diseases and a variety of psychiatric illnesses associated with mpfc dysfunction. | studies in rats, monkeys and humans have established that the medial prefrontal cortex is crucial for the ability to exert adaptive control over behavior. here, we review studies on the role of the rat medial prefrontal cortex in adaptive control, with a focus on simple reaction time tasks that can be easily used across species and have clinical relevance. the performance of these tasks is associated with neural activity in the medial prefrontal cortex that reflects stimulus detection, action timing, and outcome monitoring. we describe rhythmic neural activity that occurs when animals initiate a temporally extended action. such rhythmic activity is coterminous with major changes in population spike activity. testing animals over a series of sessions with varying pre - stimulus intervals showed that the signals adapt to the current temporal demands of the task. disruptions of rhythmic neural activity occur on error trials (premature responding) and lead to a persistent encoding of the error and a subsequent change in behavioral performance (i.e. post - error slowing). analysis of simultaneously recorded spike activity suggests that the presence of strong theta rhythms is coterminous with altered network dynamics, and might serve as a mechanism for adaptive control. computational modeling suggests that these signals may enable learning from errors. together, our findings contribute to an emerging literature and provide a new perspective on the neuronal mechanisms for the adaptive control of action. |
although individuals younger than 40 years of age account for only 3% of all patients with coronary heart disease (chd)1 and also myocardial infarction (mi) mainly occurs in individuals older than 45 years old, the young are not completely immune from these cardiac diseases.2 the causes of mi among patients aged less than 45 years can be divided into four groups : 1) atheromatous coronary artery disease (cad) ; 2) non - atheromatous coronary artery abnormalities ; 3) hypercoagulable states ; and 4) mi secondary to substance misuse.2 cigarette smoking appears to be the most common risk factor for heart disease,35 and a positive family history of cad (defined as the occurrence of premature cad in a first - degree relative) is a major risk factor for mi in young individulas.6 the prevalence of a positive family history among these patients ranges from 14% to 69%.1 siblings of a young patient with mi have up to a tenfold increased risk of developing cad,7 and approximately half of young patients with mi have single - vessel coronary disease.4 we herein introduce a very young patient with extensive premature cad without congenital heart abnormality, hypercoagulable state, substance misuse, and traditional risk factors (except for a positive family history of premature cad) who underwent coronary artery bypass grafting (cabg) at tehran heart center. the patient illness had started one month before admission with an onset of acute mi. he was 71 kg in weight and 180 cm in height, which meant that his body mass index (bmi) was in safe limits (21.91 kg / m). risk factors such as diabetes, smoking, obesity, and dyslipidemia were not seen in his history, but his family history for chd was positive. his father had died at 38 years of age because of sudden cardiac death and his mother was a known case of ischemic heart disease. the patient had no history of the use of legal or recreational drugs, and his family history was negative for any hereditary or metabolic disorders. the results of laboratory tests conducted on admission were as follows : normal complete blood count (white blood cell [wbc ] = 6600 / mm, red blood cell [rbc ] = 5.39 10 / mm, hemoglobin [hgb ] = 16.1 mgr / dl, and hematocrit [hct ] = 45.7%) ; normal hepatic transaminases (alanine aminotransferase [alt ] = 29 iu / l and aspartate aminotransferase [ast ] = 20 iu / l) ; normal - range blood serum electrolytes ; total cholesterol of 126 mg / dl ; triglyceride of 92 mg / dl ; high - density lipoprotein (hdl) of 26 mg / dl ; low - density lipoprotein (ldl) of 84 mg / dl ; very low - density lipoprotein (vldl) of 18.4 mg / dl ; ldl / hdl ratio of 3.2 ; and cholesterol / hdl ratio of 4.8. additionally, creatine kinase mb (ckmb) and troponin on the day before surgery were 5.41 ng / ml and less than 3 the patient s blood group and rh was o positive. on physical examination, the patient s blood pressure was 105/80 mmhg with a heart rate of 100 beats per minute. in heart auscultation, echocardiography demonstrated a left ventricular end diastolic volume (ldedv) of 96 cc, left ventricular end systolic volume (lvesv) of 48 cc, and ejection fraction (ef) of 42%. furthermore, there was an abnormal septal motion, hypokinesia, in the septal wall and the mid - portion of the anteroseptal wall. three other coronary arteries, i.e. the left anterior descending artery, diagonal 1 artery, and right coronary artery, had severe stenosis (figures 1 & 2). the left circumflex coronary artery was patent, and the ef based on angiography was 45%. two days after surgery, laboratory tests revealed ckmb of 4.74 ng / ml and troponin of 437.7 mcg / l. on postoperative electrocardiography, the st segment was slightly elevated in leads ii, iii, avf, v5, and v6. the patient was discharged from the hospital in good healthy condition five days after surgery. postoperative follow - up of the patient, conducted one year later, showed that he was still symptom free and that he had no traditional risk factors other than a positive family history of premature cad. fortunately, its incidence is not common in individuals younger than 45 years of age. however, the disease carries significant morbidity, psychological effects, and financial constraints for the person and the family when it occurs at a young age. the protection offered by young age has been gradually eroded by the increased prevalence of risk factors for chd in adolescents such as smoking, obesity, and lack of physical activity.2 the risk factors of cad are no different between individuals younger or older than 40 years old, but the increased incidence of a positive family history of cad and lipid abnormalities in younger individuals with early onset coronary atherosclerosis renders them unique.8 about 40% of young cad patients have a first - degree relative with premature atherosclerosis.9 although for a long time a family history of ischemic heart disease has been deemed a main risk factor a risk factor for developing cad in patients,10, 11 there are two different viewpoints about this concept : some researchers strongly believe that dominancy of a family history of cad in a family is accompanied by other risk factors like hypertension and hyperlipidemia12, 13 whereas others maintain that a family history is an independent risk factor and its presence is not necessarily related to the other factors.14 in our patient, the only detectable traditional risk factor was a positive family history of premature cad. he was a normotensive, non - diabetic, non - smoking, and non - hyperlipidemic patient. also, he had no congenital heart disease and hypercoagulable state, and nor was he a drug abuser. emotional stress and aggressive nature in the young age group are thought to be related to the prevalence of cad.15 the cardia study offered an explanation for the association between aggression and chd mortality.16 acute physical or emotional stress increases shear forces and thus causes a previously non - significant plaque to rupture, triggering acute mi.17 the classic presentation of worsening angina culminating in mi is rare in younger patients. the first onset of angina that rapidly progresses to fully evolved mi is often the case in patients less than 45 years of age.2 in our patient, mi was the first presentation of his coronary problems too. as secondary prevention, antiplatelet agents such as aspirin and clopidogrel should be used as per the guidelines for adults. statins should invariably be prescribed in all patients with mi insofar as their clinical effects extend beyond lipid lowering. statins are believed to stabilize plaques in patients with atheromatous chd, thereby improving their outcome and reducing recurrent events.2 in patients with established mi, exercise stress testing could well be a useful tool for risk stratification. echocardiographic assessment of the lv function should be done in all patients. however, angiographic assessment has a defining and leading role for deciding about the next step in a patient management program.2 it is advisable that cabg be offered to patients with triple - vessel disease, complex coronary artery abnormalities, and impaired lv function. cabg is believed to confer better results in young patients : survival rates of 92% at five years and 86% at ten years, which are significantly better than 75% and 58% for patients over a positive family history of cad can be deemed a very important risk factor for developing premature cad and patients with this predisposing risk factor should be treated more conservatively and diagnostic measures must be considered more frequently when there is a possibility of premature cad. | although coronary artery disease (cad) is not common among individuals younger than 4045 years of age, a small percentage of this age group needs to undergo surgical revascularization because of cad. why some people are at higher risk of developing premature cad is not clearly known. increased number of traditional risk factors or genetic predisposition may play significant roles in this regard.a 22-year - old man with a negative history for all traditional risk factors except for a family history of premature cad referred to our center due to an episode of myocardial infarction of one month s duration. he had no congenital heart disease and no hypercoagulable state, and there was a negative history of drug abuse.his coronary angiography showed extensive cad. he underwent coronary artery bypass grafting and he left the hospital in good healthy condition. one year after surgery, his follow - up showed that he was symptom free and he still had no new traditional risk factor. it seems that a positive family history of premature cad is an important and independent risk factor for developing premature cad and individuals with this type of history should be treated more cautiously. |
a monteggia fracture is a rare injury consisting of a proximal ulnar fracture with associated radial head dislocation. notable differences exist in the treatment and outcomes of monteggia fractures in pediatric and adult populations, with children often having a better prognosis. surgical fixation of these fractures through percutaneous techniques is typically reserved for skeletally immature pediatric patients. this case report depicts a skeletally mature patient with a left monteggia equivalent fracture who underwent percutaneous reduction and flexible intramedullary nailing of a displaced radial head fracture, and open reduction and internal fixation (orif) of a proximal olecranon fracture. her unique case demonstrates that percutaneous techniques can be utilized in fracture reduction and fixation in skeletally mature patients. a skeletally mature 14-year - old right - hand - dominant female with no significant past medical history presented with left elbow pain. three days prior to presentation, she fell from a height of 3.7 meters, landing onto her left arm. she was taken to an outside hospital where left elbow radiographs and a ct scan were performed. these revealed a comminuted, displaced left radial head fracture and a non - displaced proximal olecranon fracture, consistent with a monteggia equivalent fracture. the patient was subsequently placed into a posterior long arm splint and was instructed to follow - up with an orthopaedist as an outpatient. upon presentation to the clinic, the patient noted improving, but persistent, pain about the lateral aspect of her left elbow, for which she was medicating with acetaminophen with codeine. of note, the patient was the eldest of three children, born via normal spontaneous vaginal delivery with normal developmental milestones, and was two years post - menarchal. the posterior splint was removed, and the skin was intact with a significant amount of swelling around the left elbow. there was tenderness to palpation at this site, but no tenderness or swelling proximally or distally. she had intact extensor pollicis longus, flexor pollicis longus, and interosseous function, and no pain or difficulty with active metacarpal - phalangeal joint extension. four days after presenting to the clinic (seven days post - injury), the patient was taken to the operating room where a 1.57 mm k - wire was inserted into the fracture site and levered up to perform a percutaneous reduction (fig. 3a). a nearly anatomic reduction was achieved, and great care was taken to not penetrate the anterior tissues near the posterior interosseous nerve. since the fracture was still impacted and slightly rotated, the decision was made to insert a flexible intramedullary nail for internal fixation (metaizeau technique). to accomplish this, a previously bent 2.5 this was rotated around, an excellent reduction was obtained, and the pin was then cut short at the skin level. the olecranon was then observed to be unstable under fluoroscopy. a rush rod was initially attempted for fixation, but as this did not produce a stable reduction, an olecranon plate was placed which obtained excellent fixation both proximally and distally. the plate was secured with both locking and non - locking screws, as well as a diaphyseal shaft screw (fig. the patient progressed well post - operatively. at her first post - operative visit ten days after surgery, her pain was controlled without medications and she remained neurologically intact. the k - wire was then removed one week later, and the patient was started on gentle left elbow range of motion exercises in a sling. her range of motion five weeks after surgery was from 35 to 100 degrees of flexion - extension, 10 degrees of pronation and 50 degrees of supination. she was started on more aggressive range of motion therapy, resulting in an improvement to 25125 degrees of flexion - extension by post - operative week 13. at five months post - operatively, after noting mild prominence of the olecranon plate and a residual left elbow flexion contracture of 25 degrees, the patient underwent arthroscopic release of the anterior capsule as well as excision of scar tissue which had formed in the anterior compartment. the patient attained full left elbow extension, flexion to 130 degrees, and supination - pronation to 85 degrees post - operatively. a monteggia fracture refers to a fracture of the proximal ulna with associated dislocation of the radial head. type 1 fractures are an anterior radial head dislocation and proximal third ulna fracture, type 2 fractures are a posterior radial head dislocation and proximal ulna fracture, type 3 fractures are a lateral radial head fracture and proximal ulna fracture, and type 4 injuries refer to a dislocation of the radial head in any direction with fractures of both the proximal radius and ulna. a relatively uncommon injury, monteggia and equivalent fractures account for approximately 12% of all forearm fractures. the management of monteggia fractures in pediatric patients is typically dictated by the characteristics of the ulna fracture. in children, plastic deformation or incomplete fractures are initially treated with closed reduction followed by immobilization in full supination and 110 degrees of elbow flexion for six weeks. this technique is used almost exclusively in the pediatric population as it often does not achieve a precise reduction ; children, however, can tolerate this due to their remodeling capacity. in the case of long oblique or comminuted fracture patterns in children, treatment should consist of internal fixation with a plate (often one - third tubular or semitubular) and screw construct rather than intramedullary nail fixation. in regards to the radial head, dislocation is typically evidenced radiographically when a line drawn through the center of the proximal radial shaft and head does not intersect the capitellum. for incomplete fractures, closed reduction is often attempted by flexion, supination, and direct pressure on the radial head. alternatively, closed reduction of the radial head can be achieved through traction and counter - traction applied to the forearm, followed by rotation of the forearm until the maximum prominence of the radial head is palpated. a varus force is subsequently applied to the elbow and the radial head is reduced by direct digital pressure. furthermore, leonidou. reported success with closed reduction and conservative management in their series of 40 pediatric monteggia fracture cases. the degree of radial head displacement can be assessed by drawing a line down the center of the radial shaft and comparing it to a line perpendicular to the radial head articular surface. operative reduction of a displaced radial head / neck fracture is indicated when there is over 30 degrees of residual angulation after attempted closed reduction. percutaneous approaches include the use of a steinmann pin, k - wires or intramedullary nails. reduction is initially attempted by applying pressure on the lateral aspect of the elbow while performing repetitive supination - pronation maneuvers. after, an incision is made just proximal to the distal radial physis and a flexible k - wire or intramedullary nail is introduced into the shaft. the nail is then advanced proximally in a retrograde fashion until reaching the distal aspect of the displaced radial epiphysis. rotation of the intramedullary nail allows for manipulation, and ultimate reduction, of the radial head / neck fracture fragment. if reduction is not possible with the nail, a k - wire can be inserted percutaneously through the lateral aspect of the radial head and used as a lever to assist reduction. several studies have reported good radiographic and functional outcomes in children treated with the metaizeau technique. our patient is a skeletally mature individual who sustained a monteggia equivalent fracture with a displaced radial head fracture treated with the metaizeau technique. near anatomic reduction, full supination and pronation, and, ultimately, full extension, was achieved. consequently, we demonstrate that percutaneous reduction with intramedullary nailing through the metaizeau technique, traditionally described for skeletally immature pediatric patients, can be performed successfully in skeletally mature patients. given their less invasive nature, percutaneous interventions may be an option in some skeletally mature individuals for radial head / neck fracture reduction and fixation prior to open or more invasive procedures. the authors declare that there is no conflict of interest regarding the publication of this paper. written informed consent was obtained from the patient for publication of this case report and case series and accompanying images. a copy of the written consent is available for review by the editor - in - chief of this journal on request. bryan g. beutel : data collection, data analysis, writing major portion of the manuscript, final approval of the version submitted. christopher s. klifto : data analysis, writing major portion of the manuscript, final approval of the version submitted. alice chu : data analysis, critical revision.key learning pointsmetaizeau technique traditionally described for skeletally immature patients.percutaneous reduction with intramedullary nailing through the metaizeau technique can be performed successfully in skeletally mature patients.percutaneous interventions may be option for treating radial head / neck fracture in skeletally mature individuals prior to more invasive procedures metaizeau technique traditionally described for skeletally immature patients.percutaneous reduction with intramedullary nailing through the metaizeau technique can be performed successfully in skeletally mature patients.percutaneous interventions may be option for treating radial head / neck fracture in skeletally mature individuals prior to more invasive procedures metaizeau technique traditionally described for skeletally immature patients. percutaneous reduction with intramedullary nailing through the metaizeau technique can be performed successfully in skeletally mature patients. percutaneous interventions may be option for treating radial head / neck fracture in skeletally mature individuals prior to more invasive procedures | introductionmonteggia lesions are defined as a fracture of the proximal ulna with an associated radial head dislocation. management of these injuries varies depending upon the patient population, ranging from non - operative treatment with closed reduction and immobilization to surgical fixation. percutaneous techniques of radial head reduction are often reserved for skeletally immature patients.presentation of casein this case report, a 14-year - old female presented with left elbow pain three days after a fall. radiographs and ct images from an outside hospital revealed a displaced left radial head fracture and a non - displaced proximal olecranon fracture, consistent with a monteggia equivalent fracture. the patient underwent percutaneous reduction and internal fixation of the radial head with a flexible intramedullary nail (metaizeau technique), and open reduction and internal fixation of the olecranon. she developed a 25 degree left elbow flexion contracture and, five months after her index procedure, underwent arthroscopic release and removal of hardware. the radial head reduction was near anatomic and she regained full extension.discussionthis report demonstrates that percutaneous reduction with intramedullary nailing and fixation techniques can be performed successfully in skeletally mature patients.conclusiongiven their less invasive nature, we recommend attempting percutaneous interventions in some skeletally mature individuals for fracture reduction and fixation. |
the rapid development of new digital display devices over the past decade has changed the performance requirements of modern contact lenses. where previously the lens - wearing population interfaced with primarily large, analog crt screens and low - definition television monitors, current lens wearers increasingly use digital devices having smaller screen sizes in addition to high - definition digital computer monitors and televisions. in 2014, 55% of american adults owned a smartphone, 42% a tablet computer, and 32% an e - reader.1 our modern population spends over 10 hours daily using technology or electronic devices.2 as smaller devices are used for viewing and reading at close range, the eyes must constantly refocus and reposition to process content. decreased blink frequency, increased rate of tear evaporation, and decreased tear stability during video display terminal (vdt) use were first reported over 2 decades ago3,4 after personal computers became commonplace, and other aspects such as reduced blink amplitude and tear - film disruption were reported over intervening years.5,6 the blink rates of contact lens wearers during digital display use decrease on average from 15 to 5 blinks per minute, while the number of incomplete blinks increases.511 this can be problematic for two reasons. first, tear - film disruption during longer interblink intervals leads to visual aberration due to changes in light refraction through the altered tear film. second, lens dehydration per se perturbs lens geometry, which leads to further changes in light refraction and additional aberration. contact lens wear during vdt use can be a contributor to computer vision syndrome, a combination of eye and vision problems associated with the use of computers.1113 new contact lens models should address the increased demands of wear while using digital display devices.14 contact lens water characteristics play a key role in lens performance, vision, and comfort. numerous in vitro and in vivo studies over several decades under a variety of conditions suggest that lens dehydration increases with lens water content.1521 as silicone hydrogels are inherently of low water content, they typically dehydrate less than traditional hydrogels do,15,19,22 but not all lenses follow this trend. while most lenses of similar water content show only subtle differences in dehydration behavior,18 omafilcon a lenses are reported to dehydrate on - eye less than do other high water lenses of similar water content.23 this suggests that some hydrophilic wetting agents (such as phosphorylcholine in omafilcon a lenses) might attenuate lens dehydration. two novel daily disposable contact lenses with uncommon water characteristics were recently introduced to the contact lens market during the period of personal digital device use growth. bausch & lomb incorporated (rochester, ny, usa) launched biotrue oneday (nesofilcon a, 78% water content), a us food and drug administration (fda) group ii (high water, nonionic) lens in 2012.24 ciba vision (now alcon, fort worth, tx, usa) launched dailies total1 (delefilcon a, 80% surface water content ; 33% bulk water content), an fda group v (silicone hydrogel) lens in 2013.25 nesofilcon a is unique among commercial lenses as it has a water content the same as that of the human cornea (78%),26 while delefilcon a is also unique in its water gradient structure. although lens surface hydration would seem desirable, lenses of higher water content are reported to dehydrate at a higher rate and to a greater extent than those of lower water content15 and to be more susceptible to post - lens - tear - film depletion under dehydrating conditions.22 tear - film stability is a function of both rate and amount of water loss across the anterior surface of the lens;27 thus, lenses that minimize water loss promote tear - film stability, a smooth and consistent optical surface, and greater visual stability. further, lenses are exposed to air and tear components during wear that may change the surface properties of the polymers,28,29 and lipid and protein deposition may reduce lens wettability, increase dehydration, and destabilize the pre - lens - tear film.22 because contact lens materials differ in their ability to resist dehydration, it is of interest to know if the unique engineering of nesofilcon a and delefilcon a lenses maintains lens surface water to promote a stable tear film. maintaining a consistent optical surface is important in reducing light scatter and preventing optical aberrations.30 while all soft lenses change dimensions to some extent on - eye, those that best maintain their physical properties provide the least change in visual acuity during wear. hydrogel lenses dehydrate during interblink intervals, resulting in an irregular surface that scatters incoming light, thus reducing low - contrast retinal acuity and negatively affecting the vision of the wearer.31 suppression of blinking during high water content lens wear is reported to effect a major reduction in visual acuity first referred to as dehydration blur.32 additionally, decreased blink rates and incomplete blinks during digital display use lead to a disrupted tear film and additional visual aberration.5,10 changes in lens water content manifest as corresponding changes in refractive index (ri). thus, dehydration that leads to changing ri can lead to suboptimal lens performance and vision, as well as increased discomfort.33,34 because ri and water content are related, measurement of ri has been established as a means to assess lens water content.35,36 while early attempts to develop a predictive model of dehydration based upon water content were unsuccessful,37 later advances in interferometry measurement led to linear models for hydrogels, with good reliability within and between operators.38 a similar linear model was also developed for silicone hydrogels.39 lenses with higher surface water content have a surface ri closer to that of water (1.33), while lenses with lower surface water content have a higher surface ri.40 thus, many researchers measured ri to follow changes in lens water content during wear or exposure to various environmental conditions. the ris of many commercial lenses have been published.16,38 the objective of this study was to compare surface water characteristics of recently introduced nesofilcon a and delefilcon a high surface water lenses with those of 1-day acuvue moist (etafilcon a ; vistakon, jacksonville, fl, usa ; 58% water content) lenses before and after the initial 15 minutes of wear (table 1). to determine water behavior when lenses were first placed on - eye, 20 healthy subjects wore each of the three lens types studied in a randomly determined order for 15 minutes. each subject wore a lens of his or her prescribed power (ranging from 1.00 to 5.00 d). after each wearing, lenses were removed and the surface ri of each lens was immediately measured with the metricon m-2010 prism coupler (pennington, nj, usa) by a masked operator using sodium light (=589.3 nm). lenses were not dabbed with a lint - free wipe to remove residual tear fluid so as not to artificially remove liquid from the lens surface, or not to deposit residue from the wipe to the lens that would interfere with the ri measurement. in contrast to the gravimetric method, ri is sensitive to changes in surface water that may not manifest as corresponding changes in weight depending upon the accuracy of the scale used and the systematic errors introduced by lens handling. for reference, ten unworn lenses of each type removed from their respective original packaging and shaken five times to remove excess fluid and surface ris were then measured. published values of ris of various materials ranging from pure water (ri = 1.33) to hydroxyethyl methacrylate (hema, ri = 1.43) (table 2) were compared with measured values to estimate water lost during early lens wear. the differences in ri between lenses before and after 15 minutes of wear were tested for significance using student s t - test. lenses with high surface water content have a surface ri close to that of water (1.33), while lenses with low surface water content have a higher surface ri. the ri is typically 1.461.48 for a 20% water lens and 1.371.38 for a 75% water lens.40 differences between ri before and after wear were significant (p 6%), the nesofilcon a lens water loss was consistently below 2% over the course of the day (figure 1). morgan and efron19 similarly reported that etafilcon a lenses lost 6.0% of their water after 2 weeks of wear. dailies total1 (delefilcon a) is a low water, silicone - hydrogel lens with a surface treatment that results in extremely high surface water content for a silicone - hydrogel lens. the designers of this lens sought to maintain the high amount of oxygen permeability and lens - handling properties of silicone - hydrogel material while imparting the wettability, lubricity, and resistance to lipid fouling properties of high water, traditional hydrogel lenses.45 this is accomplished by packaging molded lenses in a solution that includes copolymers of polyamidoamine and poly(acrylamide - acrylic acid) wetting agents and then initiating the surface modification reaction by bringing the packaged lenses to autoclave sterilization temperature.25,46 this results in what the manufacturer describes as a water gradient across the lens, with a manufacturer - reported 90 m hydrophobic core of 33% water content and 6 m thick hydrophilic surface of 78.4%5% water content on each side.47 while the manufacturer did not measure the water content of the surface of the delefilcon a lens, the water content was estimated from a film of copolymer applied to a silicon wafer using neutron reflectometry.48 although the ris of other commercial silicone - hydrogel lenses are reported in excess of 1.40,16 the average surface ri of the delefilcon a lens before insertion was 1.34, which is closer to that of pure water (1.33) than those of other silicone - hydrogel materials (> 1.40), the nesofilcon a lens (1.37), or the etafilcon a lens (1.40). however, the delefilcon a lens did not maintain its high surface water content over the first 15 minutes of wear as reflected by a large change in surface ri (1.3370.0005 before vs 1.4300.0031 after). while the delefilcon a lens quickly loses its surface water to exhibit water behavior similar to that of other silicone hydrogels, the nesofilcon a lens maintains its water over the first 15 minutes of wear and dehydrates less than 2% over 16 hours of wear;44 although the etafilcon a lens did not lose substantial surface water over the first 15 minutes of wear in this study, it loses in excess of 6% of its water content over an extended period of wear.19,43 dehydration of the delefilcon a lens surface previously reported suggests that the mechanism may be collapse of the hydrophilic surface moieties that attract water once in contact with the eye and the associated tear fluid under the shear of normal blinking.49 the effect of dehydration upon lens shape and image stability of nesofilcon a versus etafilcon a lenses was recently studied. using an in vitro method that quantitates a predicted logmar score based upon optical image quality as lenses dehydrate, researchers demonstrated a consistent and slower reduction in predicted retinal image quality over time of nesofilcon a compared to etafilcon a lenses.50 although the loss of water with the delefilcon a lens was not evaluated in this study, dehydration may manifest as decreased lens performance, including visual aberration and decreased acuity,31 and increased deposition of tear - film components.21 additional research regarding the changes in surface water and the relationship to symptoms among contact lens wearers that use digital devices will be valuable. two recently introduced daily disposable lenses with unique water characteristics behave differently on - eye. the surface of delefilcon a, a novel silicone - hydrogel lens with 80% or greater initial (prewear) surface water content and 33% bulk water content, behaves like a high water hydrogel upon insertion but quickly dehydrates to behave like its low - water silicone - hydrogel bulk material with respect to water content during wear, while both nesofilcon a and etafilcon a lenses maintain their water content during initial wear. in contrast, both nesofilcon a, a novel hydrogel lens with 78% water content, and etafilcon a, a traditional hydrogel lens developed some 4 decades ago, maintain their water content during initial wear. the nesofilcon a lens appears unique among high water lenses in maintaining high surface and bulk water content during wear. because surface dehydration is reported to lead to visual aberration due to tear - film disruption and changes in lens geometry, additional studies of the effects of surface water loss from delefilcon a and nesofilcon a on visual performance are warranted. | purposecontact lens wearers today spend much time using digital display devices. contact lens manufacturers are challenged to develop products that account for longer periods of time where blink rate is reduced and tear - film evaporation rate is increased, affecting both visual acuity and comfort. two manufacturers recently introduced novel daily disposable contact lenses with high surface water content. the objective of the present study was to compare surface water characteristics before and after initial wear of recently introduced nesofilcon a and delefilcon a high surface water lenses with those of etafilcon a lenses.patients and methodstwenty healthy subjects wore each of the three lens types studied in a randomly determined order for 15 minutes. after each wearing, lenses were removed and the surface refractive index (ri) of each lens was immediately measured.resultsthe mean ri of the unworn delefilcon a lens was 1.34, consistent with water content in excess of 80%. after 15 minutes of wear, the surface ri shifted to 1.43, consistent with its reported 33% bulk water content. in contrast, the mean surface ri of the nesofilcon a lens was 1.38, both initially and after 15 minutes of wear, and that of the etafilcon a lens was 1.41 initially and 1.42 after 15 minutes of wear.conclusionthe surface of the delefilcon a lens behaves like a high water hydrogel upon insertion but quickly dehydrates to behave like its low - water silicone - hydrogel bulk material with respect to surface water content during wear, while both nesofilcon a and etafilcon a lenses maintain their water content during initial wear. the nesofilcon a lens appears unique among high water lenses in maintaining high surface and bulk water content during wear. this is important because changes in surface ri due to dehydration are reported to lead to visual aberration affecting user experience. |
the development of advanced imaging methods has revealed that living cells exhibit highly dynamic structural remodeling [1, 2 ]. the rate and structural details of cellular motility can change over development or in response to the environment in ways that reveal important details about cellular signaling mechanisms [35 ]. useful commercial and public domain programs are available to identify and measure the movements of relatively large cell structures like amoeboid pseudopodia [68 ] as well as fine features like growth cone filopodia, astrocytic protrusions, and dendritic spines [11, 12 ]. analysis of these kinds of sparsely distributed cellular protrusions may be amenable to the use of image skeletonization or active contour tracing to select the features of interest and to track end - tips for motility analysis. an alternative approach is to measure perimeter shape changes of an entire cell by analyzing the difference between an original image and an eroded image from which all fine processes have been filtered away. however, if the features of interest are very dense and spindly, overlapping and oriented in many directions as in the case of astrocytes and radial glia [13, 14 ], quantitative measurements of motility become particularly challenging for any of the above methods. we have previously introduced a method for quantifying motility in cells with densely packed, fine processes as part of a study analyzing dynamic remodeling of midbrain radial glia. after collecting a time series of 2-photon z - stacks, maximum intensity projections (i.e., maximum intensity value at each x - y position through the z - stack is used to generate a 2d projection) are aligned to correct for drift and then images are preprocessed by binarization using sobel edge detection, followed by pixel dilation to remove gaps generated by the edge detection procedure. the algorithm then calculates a motility index, defined as the mean number of redistributed (added or lost) pixels between processed images at sequential time points. to deal with the wide range of different cell sizes, indices are normalized for size by dividing by cell area (in pixels). one potential limitation of this approach is that normalizing pixel counts to the 2d projection area of each cell can distort the results due to variations in cell shapes and sizes. for example, z - projections of very long, narrow cells like radial glia will give dramatically different measurements of 2d projected area depending on whether a cell is viewed parallel or perpendicular to its radial axis. although this index is still highly sensitive for measuring relative changes in motility of individual cells imaged from the same angle over time in response to different treatment conditions, the area normalization used to calculate the motility index introduces a source of artifact that limits its usefulness for comparing multiple cells that might be imaged at a range of different orientations. in this paper, we introduce several significant improvements to our original method that make important advances toward correcting these limitations. the new approach offers greater sensitivity for cell motility analysis while decreasing the impact of total cell area on measurements by using an algorithm based on spatial boxcar averaging of redistributed pixels. this new motility index provides a value that better correlates with the mean elongation and retraction speeds of moving filopodial processes, eliminating the need to normalize by total cell area. boxcar averaging measures motility preferentially in the dynamic parts of the image by giving more weight to pixel redistributions that occur in close proximity to other redistributions and are thus more likely to be part of real restructuring events. in addition, for high - temporal - resolution imaging, we have added a noise filter based on the temporal frequency power spectra of the pixels, optimized to preserve biological activity while removing imaging artifacts. we present these new tools as part of an open - source program for the popular matlab platform with a customizable user interface that can easily be applied to measure motility of a wide variety of cell types and structures. the cells examined for this study are radial glia in the optic tectum of albino xenopus laevis tadpoles at developmental stage 47. radial glia have many fine filopodial processes that undergo continuous structural remodeling over the timescale of minutes (figure 1). the optic tectum in stage 45 tadpoles was bulk electroporated with a dna plasmid encoding membrane - targeting farnesylated egfp (egfp - f). tectal radial glia cells were imaged two days later using a custom - built two - photon laser - scanning microscope with a 60 1.1 na water - immersion objective (olympus). a maitai - bb femtosecond pulsed ti : sapphire laser (newport / spectra physics) was used to generate excitation light at 910 nm. in preparation for imaging, tadpoles were paralyzed by immersion in 0.2 mm pancuronium bromide (sigma) solution in 0.1x modified barth 's solution with hepes (vwr). images of individual egfp - f - expressing cells in live albino tadpoles were collected as z - series stacks of 50150 optical sections sized 512 pixels 512 pixels (79.5 m 79.5 m) m at 1 m step size. in a typical experiment, subsequently, mk-801 maleate (100 m, tocris) was injected intraventricularly into the tadpoles at the level of the optic tectum. after a 20 min incubation, another 3 images were captured at 5 min intervals to assess the effects of the treatment on motility. in another set of experiments to estimate the contribution of sample drift and noise artifact, animals were euthanized in 0.2% ms222 (sigma) and fixed by immersion in 4% paraformaldehyde (pfa, vwr) for 2 hours prior to imaging. two - photon z - series stacks were processed by blind deconvolution using autoquant software. as all images of cells were captured in vivo, surrounding neurons and skin cells expressing egfp as well as autofluorescent melanophores were sometimes present in a subset of z - series images, above or below the cell of interest where they could interfere with the automatic motility assessment. these non - glia objects were removed manually using imagej from the z - series stacks. the careful removal of extraneous objects from the stacks is critical for obtaining accurate measurements and typically takes about 30 minutes per 100 optical sections. the inherent voxel anisotropy in 2-photon microscopy axial resolution is always poorer than resolution within the focal plane makes perfect 3d registration of image stacks impractical. we therefore designed our motility analysis for 2d time series and took precautions to minimize rotation during image acquisition. tadpoles were mounted in form - fitting polydimethylsiloxane (pdms) imaging chambers sealed with a coverslip to minimize rotation of the samples over time. z - series stacks were converted to 2d maximum intensity projections and realigned to correct for slight lateral drift over time using the rigid body setting of the epfl stackreg plugin for imagej (http://bigwww.epfl.ch/thevenaz/stackreg/). all subsequent processing and analysis steps in this paper were performed using custom - made scripts that can be run under the matlab (mathworks) platform. these routines have been made available under a modified version of the gnu general public license v3 (see details in program files) as part of a set package controlled with a user - friendly graphical user interface available at http://ruthazerlab.mcgill.ca/downloads/motility_guiv2.zip. after optimizing the alignment of the maximum intensity projections for each time point as described above, images were subjected to preprocessing by binarization using sobel edge detection to identify edges, followed by pixel dilation (figure 2). pixel dilation expands the edges of the binarized images, largely eliminating discontinuity artifacts that sometimes occur in the edge detection step due to variations in the pixel intensities at fine processes in the raw images (e.g., arrowhead in figure 2). a dilation radius of 6 pixels was used, as this was determined empirically to remove this artifact efficiently while still maintaining adequate resolution to detect small movements of the cell surface. to assess the motility of the cell we subtracted the processed images of consecutive time points (figure 3(a)) from one another. we define the binary intensity value of an image with dimensions x and y as ixy(t) where t is the time index of the image ranging from 1 to t in integral steps, with t being the number of time points captured. the redistribution of pixels between two time points, for each pixel defined by (x, y), is calculated as (1)xy(t)=ixy(t+1)ixy(t). the absolute value of this subtraction result generates an image highlighting pixels where a change has taken place from one time point to another, showing pixel redistribution (figure 3(b)). in the original dynamics assessment approach of tremblay. (2009), which we here term method 1, the average total area of the images is taken into consideration. the area of an image with time index t is defined by (2)a(t)=x, yixy(t). sum of the redistributed pixels between time points is calculated : (3)r(t)=xyxy(t). motility index m1 between two time points using method 1 is defined as (4)m1(t)=r(t)a, where a is the average total area of the cell over all time points. in the new, improved algorithm, here referred to as method 2, the difference images calculated by formula (1) are subjected to boxcar averaging, often referred to as taking a moving average, (figure 3(c)) as defined by (5)^xy(t)=1w2m = xh x+hn = yhy+hmn(t), where w denotes the boxcar window width and h = (w 1)/2. the choice of the boxcar window size for averaging should be determined empirically depending on the dimensions of the structures imaged, taking into consideration that important details may be lost as the boxcar size is expanded. we set the boxcar size to w = 9 (9 9 pixel square) for our analysis. next, the boxcar - averaged image (figure 3(c)) is multiplied with the image showing redistribution of pixels between time points (figure 3(b)) to obtain a final boxcar - weighted image xy(t) (figure 3(d)) : (6)xy(t)=^xy(t)xy(t). this last step has the useful effect of blunting the contributions of the large number of sparse individual pixels found along the edges of the boxcar - averaged images, thus weighting the analysis in favor of dynamic hot spots where large groups of pixels change over time. these highly dynamic zones are expected to reflect biologically relevant pixel redistributions whereas the sparse intermittent changes along the periphery are more likely to arise from nonbiological artifact such as specimen drift, photobleaching, and detector noise. finally, the mean pixel value m2 of the filtered boxcar averaged pixel redistribution image xy(t) is calculated by (7)m2(t)=1nx, yx, y(t), where n is the count of nonzero pixels. we thus define m1 and m2, respectively, as the original and improved motility indices measured between two time points. for the overall motility value of a cell under a certain condition, the mean motility index m1 or m2 over all time points was used. the size of the boxcar window used for analysis is a customizable parameter in our software. the optimal setting depends in large part on the dimensions of the most motile processes extending out from the cell and the density with which they occur at the cell surface. we recommend using an independent dataset to empirically determine the parameters that give the greatest sensitivity for the cell type being studied. for example, in figure 3(e), we systematically varied the boxcar window size and found that although the absolute motility index values decrease with larger boxcar sizes, the greatest difference between experimental groups is obtained with an intermediate boxcar size, in this case 9 pixels. in another experiment, images of an active cell were taken at the higher rate of once every 20 seconds over the 15 to 18 minutes normally used for dynamics analysis (figure 4(a)). this sampling rate (0.05 hz) constitutes temporal oversampling for the cellular motility behavior in which we are interested. for technical reasons only a subsection of the cell was measured in order to achieve the necessary temporal resolution. images were preprocessed as described above, resulting in dilated binary images as in figure 2(c). three characteristic examples of the time - dependent behavior at single pixels are shown in figure 4(b). pixels located at the center of the cell main process typically will have an unvarying intensity function as shown in figure 4(b)(i). similarly, pixels that lie within the trajectory of an elongating or withdrawing filopodium will be continuously on or off until the filopodium either moves into or out of the pixel position, after which the pixel value will flip (figure 4(b)(ii)). pixels that are near the edge of the cell tend to alternate between a value of 1 and 0 irregularly, due to imaging artifact and alignment - drift error (figure 4(b)(iii)). the time - domain pixel intensity functions shown were transformed into the frequency domain by means of the discrete fast fourier transform (dft) algorithm of matlab. a large proportion of the spurious motility can be filtered based on the dft results, as image noise is expected to have a higher frequency dft peak than biologically relevant slower fluctuations. we therefore implemented a dft - based image filter with a user - selectable frequency threshold as part of our analysis package. setting the filter to separate fluctuations at a threshold of 0.0026 hz (< 6.4 min periods) appeared to effectively distinguish between image noise at high frequency (figure 4(c)) and biologically relevant motility fluctuating at lower frequencies (figure 4(d)). to assess our improved method for cell morphological dynamics measurement, we electroporated albino xenopus laevis tadpoles with plasmid driving the expression of membrane - targeting farnesylated egfp (egfp - f). two days after electroporation, we collected images of individual egfp - expressing radial glia cells in the optic tectum in live tadpoles by two - photon microscopy. we tested the sensitivity of our improved motility index (method 2) compared to the original algorithm (method 1) from tremblay. (2009), using an established pharmacological manipulation known to reduce radial glial motility. we have previously shown that radial glia decrease their filopodial process motility in vivo in response to intraventricular application of the n - methyl - d - aspartate receptor (nmdar) blocker mk-801. here we used this glial response to mk-801 to compare the relative sensitivity of methods 1 and 2. in the study by tremblay., time - lapse images had been collected at 15 minute intervals. in order to push the limits of our detection capability, we shortened the imaging interval to 5 minutes (figures 5(a) and 5(b)). the cumulative restructuring of the cells is considerably less during this shorter interval and we sought to determine whether either analysis method could still detect a difference between control and mk-801-treated conditions. tectal radial glia are highly dynamic on a timescale of minutes, continually adding and retracting many filopodial processes. however, although they remodel extensively, they do not exhibit cumulative growth over these periods. we found no significant difference between the area profiles of radial glia cells before compared to after mk-801 treatment (area mean sd before mk-801 : 1465.25 140.56 m, after mk-801 : 1411.36 150.6 m, n = 10, p = 0.45, two - tailed student 's t - test). we were unable to demonstrate a significant decrease in the motility index values of cells in response to mk-801 application when imaged at 5 min intervals and analyzed using method 1 (n = 10, p = 0.11, paired t - test) (figure 5(c)). in contrast, applying method 2 to the same dataset revealed a significant decrease in the rates of dynamics of these cells after mk-801 treatment (n = 10, p < 0.02, paired t - test) (figure 5(d)). the greater sensitivity of method 2 was likely due to smaller variance in the motility index values resulting from the reduced contribution of artifact from nondynamic parts of the cell. to assess the relative contributions of spurious motility caused by imaging artifact, we compared motility index values of control egfp - f - expressing radial glial cells in living tadpoles (n = 4) with cells from the animals that had been euthanized and fixed with 4% pfa (n = 5) (figures 6(a) and 6(b)). fixation abolishes all cellular dynamics, leaving only imaging artifact, photobleaching, and brownian motion of the fluorophore molecules. not surprisingly, a large difference in cell motility scores between the control and fixed groups was obtained using both the old and new analysis methods. somewhat unexpectedly, motility index scores obtained using method 1 (figure 6(c)) were on average lower, after normalization to the matched control group, than those produced by method 2 (figure 6(d)), probably reflecting a greater sensitivity of the new method to systematic artifact due to photobleaching or specimen drift. however, method 1 exhibited larger variance in the motility indices obtained and thus gave a wider 95% confidence interval for the difference between means (ci = [0.3589, 0.7854 ]). analysis by method 2 resulted in a smaller two - sided 95% confidence interval for the difference between means (ci = [0.2607, 0.5342 ]) and consequently a lower p value by the two - tailed student 's t - test (method 1, p = 0.00039 ; method 2, p = 0.00024). we also applied the dft - based temporal frequency filter to a different set of control and pfa - fixed cell image sequences collected at higher temporal resolution to further distinguish actual biological motility from artifact. filtering cells with a 0.0026 hz temporal frequency (period < 6.4 min) threshold decreased the already low motility index values of pfa - fixed cells (as measured using method 2) by 66% on average (figure 6(e)), confirming the value of the temporal frequency filter for reducing spurious motility from measurements. in contrast, the motility index value of the control live cells was only reduced by an average of 23%, consistent with most of the signal being biological in origin. thus, the temporal frequency filter in conjunction with our improved motility index provides a set of useful and sensitive tools for the detection and quantification of biologically relevant morphological remodeling of cells from 2-photon time - series images. we present a novel method for motility analysis of a wide variety of morphologically complex cells. this versatile approach offers increased sensitivity compared to the earlier version due to its superior discrimination of real movement from noise. this is achieved by boxcar averaging of pixel redistribution images, which results in the relatively greater weighting of areas in the images where large groups of adjacent pixels exhibit coordinated changes from one time point to another, while reducing the contribution of spurious pixel fluctuations. when the size of the boxcar window is set to roughly match that of the most relevant motile structure for the phenomenon under study (e.g., dendritic spines, axonal growth cones, and glial filopodia), our algorithm returns a single motility index value that effectively reflects the degree of motility of the specific individual structures of interest without requiring painstaking and time - consuming reconstruction of each of these cellular protuberances. in addition, we demonstrate that further improvement can be obtained by temporal frequency filtering of the time series. real biologically relevant movements like filopodial extension typically involve changes of larger groups of neighboring pixels. changes entailing the redistribution of a smaller number of adjacent pixels from one time point to another often arise from artifacts including photobleaching, detector noise, and imperfect alignment of time series images. this is most evident in the faint outlining of the whole perimeter of the cell in pixel redistribution images (figure 3(b)). this perimeter outlining is unlikely to be related to cellular metabolism or function, as it is also present in the pfa - fixed cells. the use of boxcar averaging dramatically reduces the contribution of this artifactual component to our motility measurements by weakening the influence of isolated pixel values while enhancing the weighting of clusters of pixels that change together. the new method 2 consistently yields lower coefficients of variance than the original method 1. the principal reason is the above - mentioned reduction of noise at the cell perimeter. in addition, eliminating the need for normalization by cell area removes another source of variability that is not relevant to actual motility. radial glia cells appear to come in an endless variety of shapes and sizes, and the number of processes does not necessarily linearly scale with the area. because method 1 relies on counting the total number of redistributed pixels between time points, it is necessary to normalize these values in order to correct for different cell sizes to prevent larger, less motile cells from being scored higher than highly motile cells that are just very small. however, normalizing to total cell area can result in two cells with identical motility of their processes but different 2d areas being reported as having different motility rates. the use of boxcar averaging in method 2, in contrast, gives a value that reflects process movement within local domains that is independent of the total size of the cell. to further eliminate spurious pixels some of the most rapid and stochastic changes in pixel values occur along the perimeter of imaged cells where out - of - focus light, photon scattering, as well as fine image drift enhance the inherent fluctuations in signal detection at photomultiplier tubes or other detectors. by thresholding out the highest temporal frequency pixels, mainly biologically relevant pixels remain. a surprisingly large proportion (23%) of the prefiltered motility measures of this also helps explain why the motility index scores of pfa - fixed glial cells were not simply zero, as a considerable fraction of the motility index appears to be derived from nonbiological artifact. thus, the application of temporal frequency domain filtering has tremendous potential for improving the dynamic range and sensitivity of the motility index. however, temporal frequency filtering can be properly applied only when numerous rapid interval images have been collected. the optimal acquisition rate will depend upon the velocity of the remodeling processes of the cell and on the pixel size of the imaging system. the question of what constitutes the remaining motility in fixed cells, after the spurious edge pixels have been removed, is intriguing. the images may gradually change due to photobleaching, photochemistry releasing reactive species, and perhaps even thermal effects from the imaging laser. the finding that fixed material exhibits considerable spurious motility raises potential questions about the correct interpretation of the numerous studies reporting continuous subtle movements of processes like dendritic spines or astrocytic filopodia under the microscope. this argues that appropriate fixative - treated controls should be tested as a first step whenever measuring cellular dynamics in order to define the noise floor of the imaging system used. in certain cases it would be useful to measure motility of only selected parts of a cell. we tested choosing user - defined smaller parts of the images for motility analysis during the course of our algorithm development. however, we ultimately settled on the automatic boxcar - filtered approach for the majority of our analyses because it allows for truly objective quantification of motility without introducing investigator bias, for example, due to selecting specific regions of interest. one interesting future possibility for comparing defined subregions of cells without bias might be to have the software create an internal standard coordinate system for all cells, as was done in a study analyzing bacterial division. another important future direction would be to implement a similar unbiased motility analysis for the full original three - dimensional data sets, rather than maximum intensity projections. in light of the large amount of noise introduced by image drift and registration over time, this problem will be compounded greatly by adding a three - dimensional registration step, especially complicated given the anisotropy of axial resolution compared with lateral image resolution on most optical microscopes. new high - resolution light - sheet microscopy techniques such as selective plane illumination microscopy (spim) and bessel beam microscopy should facilitate extending these analyses into 3d [21, 22 ]. we have created a robust and sensitive method to measure structural motility of any cell type and generate a quantitative motility index. this method is especially useful for cells with complex morphologies that are complicated to analyze by other means. the programs implementing this method with a user - friendly interface are freely available for download at http://ruthazerlab.mcgill.ca/downloads/motility_guiv2.zip. | cells such as astrocytes and radial glia with many densely ramified, fine processes pose particular challenges for the quantification of structural motility. here we report the development of a method to calculate a motility index for individual cells with complex, dynamic morphologies. this motility index relies on boxcar averaging of the difference images generated by subtraction of images collected at consecutive time points. an image preprocessing step involving 2d projection, edge detection, and dilation of the raw images is first applied in order to binarize the images. the boxcar averaging of difference images diminishes the impact of artifactual pixel fluctuations while accentuating the group - wise changes in pixel values which are more likely to represent real biological movement. importantly, this provides a value that correlates with mean process elongation and retraction rates without requiring detailed reconstructions of very complex cells. we also demonstrate that additional increases in the sensitivity of the method can be obtained by denoising images using the temporal frequency power spectra, based on the fact that rapid intensity fluctuations over time are mainly due to imaging artifact. the matlab programs implementing these motility analysis methods, complete with user - friendly graphical interfaces, have been made publicly available for download. |
we obtained cdcl3, sq, tetramethylsilane (tms), and reagents from sigma - aldrich corp. meibomian glands were expressed by compressing the eyelid between cotton - tipped applicators with strict attention to avoid touching the eyelid margin during expression. all four eyelids were expressed, and approximately 0.5 mg meibum (ml) was collected per individual for direct spectroscopic study. the ml was collected with a platinum spatula and dissolved in a vial of chloroform. the subjects for nmr spectroscopic analysis were recruited from the kentucky lion 's eye center (louisville, ky, usa). normal status was assigned when the subject 's meibomian gland orifices showed no evidence of keratinization or plugging with turbid or thickened secretions, and no dilated blood vessels were observed on the eyelid margin. lipid absorbent tape (sebutape ; cuderm corp., dallas, tx, usa ; fig. 2a) is a microporous film that was designed to collect sebum from the skin. the tape (cuderm corp.) was pressed for 45 seconds onto the nose to collect sebum. as the sq content in the nose and eyelid skin sebum is presumably identical, sebum from the skin of the nose was used because it is easier to collect higher sample amounts suitable for repetitive measurements. sebum was collected from a 59-year - old caucasian donor once in the morning and once at night for a period of a week. a total of 56 tape (cuderm corp.) samples were removed from the cardboard backing and placed directly into a 15-ml glass scintillation vial containing 5 ml chloroform. the samples were sonicated under an atmosphere of argon gas in an ultrasonic bath (branson 1510 ; branson ultrasonics, danbury, ct, usa) for 10 minutes. the tape (cuderm corp.) was removed from the vial and placed into another vial containing 5 ml chloroform. the tape (cuderm corp.) was removed and the chloroform from the two extractions was mixed and the chloroform was evaporated under a stream of nitrogen gas. the sample was sonicated under an atmosphere of argon gas in an ultrasonic bath (branson ultrasonics) for 10 minutes and placed into an nmr tube for spectral measurement. (a) sebutape (cuderm corp.) is a thin lipid absorbent surface that covers the gray box shown in the figure on a cardboard backing. sebum lipid absorbed into the tape after pressing the tape onto the forehead is visible as dark dots on the gray surface. the length of the cardboard backing is 4.5 cm. the tape (cuderm corp.) can be removed from the cardboard backing and the amount and composition of lipid can be measured directly using infrared spectroscopy, or extracted and quantified by nmr spectroscopy as in this study or quantified chemically. (b) sebum was also collected using a stainless steel blackhead remover (revlon, inc.) by rubbing the nose and forehead with the remover., new york, ny, usa) by rubbing the nose and forehead with the blackhead remover (revlon, inc. ; fig. sebum was collected from the same 59-year - old caucasian donor from which sebum was collected with tape (cuderm corp.). the sebum that accumulated in the small holes of the device was dislodged from the remover by placing it into a weighed 15-ml glass scintillation vial containing 2 ml chloroform and sonicated under an atmosphere of argon gas in an ultrasonic bath (branson ultrasonics) for 10 minutes. we added cdcl3 (500 l) to the 11.9 mg of collected sebum lipid. the sample was sonicated under an atmosphere of argon gas in an ultrasonic bath (branson ultrasonics) for 10 minutes and placed into an nmr tube for spectral measurement. spectral data were acquired using a spectrometer (varian vnmr 700 mhz nmr ; varian, lexington, ma, usa) equipped with a 5 mm h{c / n } c enhanced cold probe (varian, palo alto, ca, usa). spectra were acquired with a minimum of 250 scans, 45 pulse width, and a relaxation delay of 1.000 seconds. we performed hsqc using 512 increments with 16 scans per increment, 45 pulse width, and a relaxation delay of 1.000 seconds, mixing time of 0.080 seconds, and a one - bond coupling constant threshold of 140 hz. spectra were analyzed using chemistry software (mestrenova, version 7.1.2 - 10008 ; mestrelab research s.l., salem, nh, usa) was used for spectral deconvolution and curve fitting. the cell was jacketed by an insulated water coil connected to a circulating water bath (model r-134a ; neslab instruments, newton nh, usa). the sample temperature was measured and controlled by a thermistor touching the sample cell window. the water bath unit was programmed to measure the temperature at the thermistor and to adjust the bath temperature so that the sample temperature could be set to the desired value. the rate of heating or cooling (1c/15 minutes) at the sample was also adjusted by the water bath unit. infrared spectra were measured using a fourier transform infrared spectrometer (nicolet 5000 magna series ; thermo fisher scientific, inc. phase transitions were run four times with care taken to obtain data points in the sharp phase - transition temperature region. the frequency of the ch2 symmetric ch2 stretching band near (2850 cm) was used to estimate the content of trans and gauche rotamers in the hydrocarbon chains. although the 2954 cm asymmetric ch2 stretching band is useful for measuring phase - transition parameters, we chose to use the 2850 cm band rather than the band near 2954 cm, because measurement of the asymmetric band frequency is complicated by the adjacent ch3 symmetric stretching band near 2955 cm and the ch2 symmetric stretching band near 2852 cm. the symmetric stretch was calculated by first baseline leveling the oh - ch stretching region between 3500 and 2700 cm. the center of mass of the ch2 symmetric stretching band, sym, the baseline for integrating the top 10% of the intensity of the band was parallel to the oh - ch region baseline. lipid ch2 groups in the hydrocarbon chains are present as gauche rotamers, prevalent in disordered hydrocarbon chains, or trans rotamers, more abundant in ordered hydrocarbon chains. thus, lipid hydrocarbon chain order may be evaluated in terms of the relative amount of ch2 trans rotamers. the frequency of the ch2 symmetric stretch is dependent on the amount of trans or gauche rotamers and has been used to characterize lipid phase transitions and to measure the trans rotamer content of lipid hydrocarbon chains with changes in temperature. since rotamers are either in trans or gauche conformations, phase transitions can be described by a two - state sigmoidal equation, as described by borchman. lipid order at 33.4c was calculated by extrapolating the sym at 33.4c from the fit of the phase transition and then converting sym to the percentage of trans rotamers, a measure of lipid conformational order. the data for percentage of trans rotamers were used to calculate the phase - transition enthalpy and entropy from the slopes of arrhenius plots, as described in borchman. surface pressure - area profiles of human meibum and human sebum were recorded using a computer - controlled single barrier langmuir teflon trough (nima 102 m ; nima technology ltd., the surface pressure was measured by a pressure sensor with a wilhelmy plate (whatman, chr 1 filter paper). the trough was enclosed in a transparent pmma (perspex ; lucite international, lancashire, uk) cabinet to avoid air currents and dust particles. the trough was filled with an artificial tear (at) solution that emulated the salt composition of human tears (nacl 6.6 g / l ; cacl2.2h2o 0.15 g / l ; nah2po4.h2o 0.1g / l ; mops 4.18 purified water (milli - q, resistance > 18.2 m ; millipore corp., billerica, ma, usa) was used for preparing the at solution. the at solution surface was cleaned with a vacuum aspirator until a clean surface was achieved (pressure change 18.2 m ; millipore corp., billerica, ma, usa) was used for preparing the at solution. the at solution surface was cleaned with a vacuum aspirator until a clean surface was achieved (pressure change < 0.02 mn / m when the surface area was compressed and expanded completely). the lipid sample in chloroform was spread dropwise on the surface of the at solution using a microsyringe (hamilton co., bonaduz, switzerland) and chloroform was allowed to evaporate for 10 minutes. the lipid film was compressed and expanded with a barrier speed of 15 cm / minute and changes in pressure () with area (a) were recorded as -a profiles. the sebum -a profiles (23.8 mg / ml) and meibum (1 mg / ml) alone was recorded. sebum was mixed with meibum (s : m) at mole fraction ratios : 0.25:0.75, 0.70:0.30, and 0.97:0.03 (based on estimated molecular weights 490 and 720 g / mole, respectively) and -a profiles of mixtures were recorded. the excess area of mixing (aex) of sebum and meibum in the mixed films was determined by the following equation : where a1,2, a1, and a2 are the molecular areas of the mixture and the pure components, and x1 and x2 are the mole fractions of the two components in the mixture. a negative value means molecules in the mixture occupy less surface area than expected (condensation effect), while a positive value indicates the opposite, that is, an expansion effect. for the infrared spectroscopy meibum / sebum phase transition study, meibum was pooled from three donors : mc4, mc4, fc6. meibum from children was used as a first test rather than meibum from adults since the difference between the phase transition temperature of meibum from children and sebum was greater than the difference between the phase transition temperature of meibum from adults and sebum. if we were to see a change with sebum, our best chance would be to first use meibum from children. for the infrared spectroscopy meibum / sq phase transition study, meibum was pooled from seven donors : ma21, fc 21, fb21, mc59, mc22, fa 42, and fa19, where m is male, f is female, a is asian, c is caucasian, b is black, and the number is the age of the donor in years. this age range reflects the majority of adults without major age- or dry eye related changes in their infrared phase transition parameters. for langmuir trough studies, meibum was pooled from four donors : mc37, fc56, mc59, and mc67. the phospholipid composition of this sample was typical of sebum collected from a wide range of donors (table 1). the composition of sebum was identical within 1% for samples collected with tape (cuderm corp.) or mole fractions of components of human sebum from a 59-year - old caucasian male and literature lipid phase transition parameters sebum (20 l) spread on an at solution at the maximum area had a very high baseline spreading pressure (26 mn / m ; fig. with further compression, there was a steep increase in pressure that continued until approximately 70 mn / m, after which the film collapsed. since the baseline and surface pressures for sebum were quite high, lower volumes were also tested. the baseline pressure for 10 l was also very high (13 mn / m) and a very low volume (2 l) showed a baseline pressure near zero, but the increase in pressure was seen immediately on starting the compression (fig. films prepared with lower amounts of sebum showed a continuous increase in pressure upon compression and were highly compressible. the pressure - area profile of 20 l meibum was typical with a slow and continuous increase in pressure upon compression (fig. pressure - area profiles of various volumes of sebum on the artificial tear solution at 35c. data show compression parts of the profiles for 2, 10, and 20 l sebum. pressure - area profiles of the mixtures of sebum with meibum on the artificial tear solution at 35c. data show compression parts of the profiles of sebum : meibum mixtures (s : m in mole fraction ratios 0.25:0.75, 0.70:0.30, and 0.97:0.03) and meibum (m). sebum increased the average molecular area in the 0.25:0.75 mixture, did not affect it much in the 0.70:0.30 mixture, and decreased it in the 0.97:0.03 mixture, in comparison with the molecular area of meibum alone. sebum was mixed with meibum to observe how it influenced the biophysical properties of meibum at the air - liquid interface. the pressure - area profile of 0.25:0.75 mixture showed first pressure rise upon compression nearly 30 cm earlier than that for meibum alone which shows that sebum caused meibum to expand by around 30 cm (fig. sebum also increased the surface pressure of the mixture at the maximum compression by around 10 mn / m. increasing amounts of sebum caused an increase in the baseline pressures of mixtures 0.70:0.30 and 0.97:0.03 (fig. the surface pressure at the maximum compression also increased by 17 mn / m and 38 mn / m, respectively. the shape of the pressure - area curves for all mixtures showed a continuous increase in pressure with high compressibility, typical of liquid films. although pressure - area profiles of meibum / sebum mixtures indicated an increase in surface area with increasing amount of sebum, plots of surface pressure versus molecular area show that sebum caused an increase in average molecular area for only 0.25:0.75 mixture with respect to that of meibum (fig. 4b). the average molecular area of 0.70:0.30 mixture did not change much and that of 0.97:0.03 mixture was reduced substantially in comparison with meibum (fig. 4b). the excess area of mixing calculated for mixed films of sebum and meibum at different surface pressures (fig. 5) showed that in 0.25:0.75 mole fraction mixture sebum caused an expansion effect (as indicated by the positive values of aex). the 0.70:0.30 mole fraction mixture also showed slight expansion but the highest mole fraction of sebum (0.97:0.03) caused a condensation effect on the lipid mixture at the pressure of 15mn / m (as indicated by the negative values of aex). the baseline pressure for 0.97:0.03 mixture was 15 mn / m, so aex values below this pressure could not be calculated for this mixture. similarly, the maximum surface pressure for meibum was 15 mn / m, so aex values above this pressure could not be calculated for mixtures. in spite of these technical difficulties, the data indicated that sebum can cause expansion or condensation of meibum depending on its concentration in the mixture. excess area of mixing of the mixed films of sebum and meibum at different surface pressures. the data indicate that sebum exhibits an expansion effect on meibum in 0.25:0.75 mole fraction ratio, a slight expansion effect in 0.70:0.30 mole fraction ratio, but a condensation effect in 0.97:0.03 mole fraction ratio. ftir was used to measure the biophysical properties of meibum, sebum, sq and meibum mixtures. the changes in hydrocarbon chain conformation with temperature (phase transition) of sebum or sq have never been measured. 6a) centered at 27c (table 2). as expected from the melting temperature of sq (75c), sq was 87% disordered and did not undergo a phase transition between 20 and 80c (fig. 6b). the slight increase (0.4 cm) in the ch2 symmetric stretching frequency of sq between 20 and 80c may be due to increased bond rotational motion upon heating. the infrared ch2 symmetric stretching band center of mass (frequency) was measured to calculate trans / gauche rotamer ratios as a lipid order parameter. (a) () lipid phase transition of sebum from a 61-year - old caucasian male. () lipid phase transition of meibum from children mixed with sebum (20% by weight). (b) no order - disorder transition was detected for squalene through the temperature range measured. (d) phase transitions for a pool of human meibum pooled from adults and squalene (3:1, weight : weight). lipid phase transition parameters the lipid phase transition parameters of meibum from children (table 2) were characteristic of those measured previously for children. meibum from children was much more ordered than meibum from adults (table 3) in agreement with a previous study. at physiological temperature, 33.4c, sebum was less ordered than meibum from children (table 2) and more ordered than meibum from adults (table 3). meibum from children was mixed with sebum to test if sebum had an effect on the phase transition parameters of meibum. when meibum from children was mixed with sebum (20% sebum by weight), the mixture became much less ordered compared with meibum alone and all of the phase transition parameters were significantly different (fig. sebum lowered the enthalpy of the phase transition and lowered the phase transition temperature of meibum (fig. confirmation of h and c nmr resonance assignments for squalene and human sebum sebum contains 28% sq (table 4) so we tested if sq could contribute to the disordering of meibum by sebum. squalene has a much lower melting point (75c) than the transition temperature of both sebum (table 2) and meibum (2835c). a ratio of sq well above expected physiological levels was used to clearly delineate an effect should one occur. squalene caused significant (p < 0.05) changes in the phase transition parameters for a pool of human meibum (figs. although sq caused a small 5c change in the phase transition temperature of meibum, because the phase transition temperature of adult meibum is close to physiological temperature, sq caused a large (21%) decrease in meibum lipid order from 30% to 23.8%. the phase transition temperature, enthalpy, entropy and order at 34c all decreased with sq (table 3). the = ch resonance region (figs. 7a, 7ab, 7ba, 7bb), and ch2 and ch3 regions (figs. 7ac, 7ad, 7bc, 7bd) of the nmr spectra of human sebum extracted from tape (cuderm corp. ; figs. 7aa, 7ac) were almost identical to those observed in the spectrum of human sebum collected directly using an extractor tool (fig. however, there were slight differences in the resonances at 2.38 and 0.847 ppm that were more intense in the nmr spectrum of human sebum extracted from sebutape compared to sebum extracted directly. (a) h nmr spectra of sebum from a 59-year - old caucasian donor. the = ch resonance regions of (a) sebum extracted from tape (cuderm corp.) ; (b) sebum collected directly. the ch2 and ch3 resonance regions of (c) sebum extracted from tape (cuderm corp.) ; (d) sebum collected directly. (b) h nmr spectra of : (a, c) sebum collected directly from a 59-year - old caucasian donor ; (b, d) squalene. the = ch resonance region accounts for 6 of the 50 protons of sq (fig. the close correspondence between the nmr resonance intensities (table 2) and chemical shifts (table 3) of human sebum (figs. 7bb, 7bd) strongly suggests that the resonances in this region for human sebum are due to terpenoids such as sq. vicinal coupling constants (jhh), the frequency difference between the split peaks, are larger for anticlinal than for synclinal isomers. the vicinal coupling constants for the peaks near 5.15 are 7.6 0.7 hz, thus confirming the proposed anticlinal isomer assignment. the largest resonance in this region was observed at 5.32 ppm with a shoulder at 5.35 ppm (figs. these partially overlapped resonances are assigned to protons of the = ch moieties from hydrocarbon chains and to the proton attached to carbon # 6 of cholesterol esters, respectively. the spectra hsqc confirm the resonance assignments for this region of the h and c spectra of human sebum (fig. h nmr spectra of human sebum collected directly from a 59-year - old caucasian donor atop the hsqc spectra. 7bc) and hsqc spectra confirm the resonance assignments for the h and c spectra of human sebum (fig. 9b ; table 3) for this region. from the intensities of the nmr ester resonances in figure 7ab, we calculated the mole fractions of sq, cholesteryl, and wax esters and triglycerides in a sample of human sebum (table 4). for the infrared spectroscopy meibum / sebum phase transition study, meibum was pooled from three donors : mc4, mc4, fc6. meibum from children was used as a first test rather than meibum from adults since the difference between the phase transition temperature of meibum from children and sebum was greater than the difference between the phase transition temperature of meibum from adults and sebum. if we were to see a change with sebum, our best chance would be to first use meibum from children. for the infrared spectroscopy meibum / sq phase transition study, meibum was pooled from seven donors : ma21, fc 21, fb21, mc59, mc22, fa 42, and fa19, where m is male, f is female, a is asian, c is caucasian, b is black, and the number is the age of the donor in years. this age range reflects the majority of adults without major age- or dry eye related changes in their infrared phase transition parameters. for langmuir trough studies, meibum was pooled from four donors : mc37, fc56, mc59, and mc67. the phospholipid composition of this sample was typical of sebum collected from a wide range of donors (table 1). the composition of sebum was identical within 1% for samples collected with tape (cuderm corp.) or mole fractions of components of human sebum from a 59-year - old caucasian male and literature lipid phase transition parameters sebum (20 l) spread on an at solution at the maximum area had a very high baseline spreading pressure (26 mn / m ; fig., there was a continuous increase in pressure until approximately 50 mn / m. with further compression, there was a steep increase in pressure that continued until approximately 70 mn / m, after which the film collapsed. since the baseline and surface pressures for sebum were quite high, lower volumes were also tested. the baseline pressure for 10 l was also very high (13 mn / m) and a very low volume (2 l) showed a baseline pressure near zero, but the increase in pressure was seen immediately on starting the compression (fig. films prepared with lower amounts of sebum showed a continuous increase in pressure upon compression and were highly compressible. the pressure - area profile of 20 l meibum was typical with a slow and continuous increase in pressure upon compression (fig. pressure - area profiles of various volumes of sebum on the artificial tear solution at 35c. data show compression parts of the profiles for 2, 10, and 20 l sebum. pressure - area profiles of the mixtures of sebum with meibum on the artificial tear solution at 35c. data show compression parts of the profiles of sebum : meibum mixtures (s : m in mole fraction ratios 0.25:0.75, 0.70:0.30, and 0.97:0.03) and meibum (m). sebum increased the average molecular area in the 0.25:0.75 mixture, did not affect it much in the 0.70:0.30 mixture, and decreased it in the 0.97:0.03 mixture, in comparison with the molecular area of meibum alone. sebum was mixed with meibum to observe how it influenced the biophysical properties of meibum at the air - liquid interface. the pressure - area profile of 0.25:0.75 mixture showed first pressure rise upon compression nearly 30 cm earlier than that for meibum alone which shows that sebum caused meibum to expand by around 30 cm (fig. sebum also increased the surface pressure of the mixture at the maximum compression by around 10 mn / m. increasing amounts of sebum caused an increase in the baseline pressures of mixtures 0.70:0.30 and 0.97:0.03 (fig. the surface pressure at the maximum compression also increased by 17 mn / m and 38 mn / m, respectively. the shape of the pressure - area curves for all mixtures showed a continuous increase in pressure with high compressibility, typical of liquid films. although pressure - area profiles of meibum / sebum mixtures indicated an increase in surface area with increasing amount of sebum, plots of surface pressure versus molecular area show that sebum caused an increase in average molecular area for only 0.25:0.75 mixture with respect to that of meibum (fig. 4b). the average molecular area of 0.70:0.30 mixture did not change much and that of 0.97:0.03 mixture was reduced substantially in comparison with meibum (fig. the excess area of mixing calculated for mixed films of sebum and meibum at different surface pressures (fig. 5) showed that in 0.25:0.75 mole fraction mixture sebum caused an expansion effect (as indicated by the positive values of aex). the 0.70:0.30 mole fraction mixture also showed slight expansion but the highest mole fraction of sebum (0.97:0.03) caused a condensation effect on the lipid mixture at the pressure of 15mn / m (as indicated by the negative values of aex). the baseline pressure for 0.97:0.03 mixture was 15 mn / m, so aex values below this pressure could not be calculated for this mixture. similarly, the maximum surface pressure for meibum was 15 mn / m, so aex values above this pressure could not be calculated for mixtures. in spite of these technical difficulties, the data indicated that sebum can cause expansion or condensation of meibum depending on its concentration in the mixture. excess area of mixing of the mixed films of sebum and meibum at different surface pressures. the data indicate that sebum exhibits an expansion effect on meibum in 0.25:0.75 mole fraction ratio, a slight expansion effect in 0.70:0.30 mole fraction ratio, but a condensation effect in 0.97:0.03 mole fraction ratio. ftir was used to measure the biophysical properties of meibum, sebum, sq and meibum mixtures. the changes in hydrocarbon chain conformation with temperature (phase transition) of sebum or sq have never been measured. 6a) centered at 27c (table 2). as expected from the melting temperature of sq (75c), sq was 87% disordered and did not undergo a phase transition between 20 and 80c (fig. the slight increase (0.4 cm) in the ch2 symmetric stretching frequency of sq between 20 and 80c may be due to increased bond rotational motion upon heating. the infrared ch2 symmetric stretching band center of mass (frequency) was measured to calculate trans / gauche rotamer ratios as a lipid order parameter. (a) () lipid phase transition of sebum from a 61-year - old caucasian male. () lipid phase transition of meibum from children mixed with sebum (20% by weight). (b) no order - disorder transition was detected for squalene through the temperature range measured. (d) phase transitions for a pool of human meibum pooled from adults and squalene (3:1, weight : weight). () curve fit of data from figure 3c for comparison. lipid phase transition parameters the lipid phase transition parameters of meibum from children (table 2) were characteristic of those measured previously for children. meibum from children was much more ordered than meibum from adults (table 3) in agreement with a previous study. at physiological temperature, 33.4c, sebum was less ordered than meibum from children (table 2) and more ordered than meibum from adults (table 3). meibum from children was mixed with sebum to test if sebum had an effect on the phase transition parameters of meibum. when meibum from children was mixed with sebum (20% sebum by weight), the mixture became much less ordered compared with meibum alone and all of the phase transition parameters were significantly different (fig. sebum lowered the enthalpy of the phase transition and lowered the phase transition temperature of meibum (fig. confirmation of h and c nmr resonance assignments for squalene and human sebum sebum contains 28% sq (table 4) so we tested if sq could contribute to the disordering of meibum by sebum. squalene has a much lower melting point (75c) than the transition temperature of both sebum (table 2) and meibum (2835c). a ratio of sq well above expected physiological levels was used to clearly delineate an effect should one occur. squalene caused significant (p < 0.05) changes in the phase transition parameters for a pool of human meibum (figs. although sq caused a small 5c change in the phase transition temperature of meibum, because the phase transition temperature of adult meibum is close to physiological temperature, sq caused a large (21%) decrease in meibum lipid order from 30% to 23.8%. the phase transition temperature, enthalpy, entropy and order at 34c all decreased with sq (table 3). the = ch resonance region (figs. 7a, 7ab, 7ba, 7bb), and ch2 and ch3 regions (figs. 7ac, 7ad, 7bc, 7bd) of the nmr spectra of human sebum extracted from tape (cuderm corp. ; figs. 7aa, 7ac) were almost identical to those observed in the spectrum of human sebum collected directly using an extractor tool (fig. however, there were slight differences in the resonances at 2.38 and 0.847 ppm that were more intense in the nmr spectrum of human sebum extracted from sebutape compared to sebum extracted directly. (a) h nmr spectra of sebum from a 59-year - old caucasian donor. the = ch resonance regions of (a) sebum extracted from tape (cuderm corp.) ; (b) sebum collected directly. the ch2 and ch3 resonance regions of (c) sebum extracted from tape (cuderm corp.) ; (d) sebum collected directly. (b) h nmr spectra of : (a, c) sebum collected directly from a 59-year - old caucasian donor ; (b, d) squalene. the = ch resonance region accounts for 6 of the 50 protons of sq (fig. 7bb) that are characteristic of terpenoids (fig. 8). the close correspondence between the nmr resonance intensities (table 2) and chemical shifts (table 3) of human sebum (figs. 7bb, 7bd) strongly suggests that the resonances in this region for human sebum are due to terpenoids such as sq. vicinal coupling constants (jhh), the frequency difference between the split peaks, are larger for anticlinal than for synclinal isomers. the vicinal coupling constants for the peaks near 5.15 are 7.6 0.7 hz, thus confirming the proposed anticlinal isomer assignment. the largest resonance in this region was observed at 5.32 ppm with a shoulder at 5.35 ppm (figs. these partially overlapped resonances are assigned to protons of the = ch moieties from hydrocarbon chains and to the proton attached to carbon # 6 of cholesterol esters, respectively. the spectra hsqc confirm the resonance assignments for this region of the h and c spectra of human sebum (fig. h nmr spectra of human sebum collected directly from a 59-year - old caucasian donor atop the hsqc spectra. 7bc) and hsqc spectra confirm the resonance assignments for the h and c spectra of human sebum (fig. 9b ; table 3) for this region. from the intensities of the nmr ester resonances in figure 7ab, we calculated the mole fractions of sq, cholesteryl, and wax esters and triglycerides in a sample of human sebum (table 4). as stated previously, sebum could mix with meibum on the eyelid margin (fig. the major aim of our study was to determine if sebum affected the surface properties of meibum. using langmuir trough technology, we found that the surfactant properties of a mixture of meibum and sebum were enhanced compared with meibum alone. meibum itself forms a highly compressible liquid film that is suitable for repeated compression and expansion during blinking. the baseline pressure and surface activity of sebum films were much higher than that of meibum films. the estimated molecular weight of sebum is 490 g / mole and it is rich in triglycerides, which contribute to the high spreading pressure of its film, while the estimated molecular weight of meibum is 720 g / mole with a relatively lower level of triglycerides. so the presence of triglycerides in sebum might explain the high baseline spreading pressure observed in our sebum - meibum mixtures. the molecular areas of mixtures at highest compression, calculated by estimated molecular weights of two components and assuming all molecules were on the surface, were too small for a lipid molecule. these unusually small molecular areas were indicative of multilayer formation in which molecules continued to stack vertically under increasing compression but did not collapse even at high pressures. this would explain high compressibility and high surface pressures in the sebum - meibum mixtures. our infrared spectroscopic study showed that at physiological temperature, sebum was 30% less ordered (more fluid) than meibum with weaker lipid lipid interactions. lipid interactions would be expected to aggregate into islands and not to exhibit strong spreading pressures. conversely, sebum that is less ordered would be expected to exhibit a high spreading pressure. this hypothesis was confirmed in our langmuir trough study. in another langmuir trough / infrared spectroscopy study we showed that the major factor affecting the conformation (fluidity) of many lipid systems including meibum was hydrocarbon chain saturation. as confirmed in this study, meibum from adults were less ordered than meibum from children largely due to hydrocarbon chain saturation. although hydrocarbon chain saturation is likely to contribute to the difference in lipid order between sebum and meibum from children, it has yet to be determined. sebum decreased the phase transition temperature and hydrocarbon chain order when mixed with meibum resulting in a more fluid film. this is in agreement with the langmuir trough study which showed that sebum expanded meibum films at lower concentrations, fluidizing the meibum. furthermore, sebum caused meibum to be more compressible and more surface active at higher pressures. a variety of techniques have been used to confirm squalene is present in sebum. in this study, using hsqc nmr spectroscopy, we confirmed that the resonances near 5.2 ppm tentatively assigned to sq in human sebum are correct. heteronuclear single quantum correlation, an inverse heteronuclear two - dimensional technique, constitutes one the most powerful methods available for tracing out the carbon skeleton of organic compounds. in our sebum sample, the molar percentage of sq was 28% identical with the average values reported (table 1). based on the observed nmr resonance intensities and shifts observed, we can confidently confirm that squalene is present on the eyelid and in this study, sebum. however, it is possible that other terpenoids and derivatives of squalene such as epoxides and mono to tetramethylsqualene could be present as wide variety of terpenoids exist in nature. as our nmr spectra are complicated by a wide variety of lipids, nmr alone can not be used to confidently identify the many types of terpenoids that exist, especially if they are not abundant. we propose to determine if other terpenoids are present in sebum, tears, and meibum using gas chromatography / mass spectrometry along with nmr analysis as was done for other systems. using infrared spectroscopy, we found that 20 weight percent sq had a disordering effect on meibum. this is opposite the effect of sq in other phospholipid systems where sq may have a condensation or area - expansion effect in a lipid mixture depending on its content and film pressure. it exerts area condensing effects on polar lipids above 10 mole percent and in dense liquid - expanded or liquid - condensed phase. although sq causes the hydrocarbon chains of meibum lipid to be more fluid, sq in sebum is unlikely to influence the rheology of meibum ; in another study, sq alone did not possess surfactant properties and when mixed with human meibum, it was shown that at a higher degree of film area compression sq did not affect the surface pressure of the films. at low surface pressures, sq localized over thinner regions of meibum films. we found that sebum expanded meibum films at lower concentrations and condensed meibum films at higher concentrations. it is likely that only a small quantity of sebum, less than 28%, is expected to mix with the tear film, so physiological levels of sebum would be expected to expand or fluidize meibum, making it spread better and be more surface active, the qualities beneficial for the tear film lipid layer. sebum caused meibum to be more stable at higher pressures (greater maximum surface pressure). so sebum could stabilize meibum, allowing it to withstand the high shear pressure of a blink. from this study, we see sebum - meibum interaction appear to be relevant. in future studies, we hope to measure meibum - sebum interactions related to age, sex, race, and disease. | purposesebum may contribute to the composition of the tear film lipid layer naturally or as a contaminant artifact from collection. the aims of this study were to determine : if sebum changes the rheology of meibum surface films ; if the resonance near 5.2 ppm in the 1h - nmr spectra of sebum is due to squalene (sq) ; and if sebum or sq, a major component of sebum, interacts with human meibum.methodshuman meibum was collected from the lid margin with a platinum spatula. human sebum was collected using lipid absorbent tape. langmuir trough technology was used to measure the rheology of surface films. infrared spectroscopy was used to measure lipid conformation and phase transitions. we used 1h - nmr to measure composition and confirm the primary structure of sq.resultsthe nmr resonance near 5.2 ppm in the spectra of human sebum was from sq which composed 28 mole percent of sebum. both sebum and sq lowered the lipid order of meibum. sebum expanded meibum films at lower concentrations and condensed meibum films at higher concentrations. sebum caused meibum to be more stable at higher pressures (greater maximum surface pressure).conclusionsphysiological levels of sebum would be expected to expand or fluidize meibum making it spread better and be more surface active (qualities beneficial for tear film stability). sebum would also be expected to stabilize the tear film lipid layer, which may allow it to withstand the high shear pressure of a blink. |
blood - slide microscopy using thick and thin smears stained with giemsa has remained the gold standard in the diagnosis of malaria for many years.12 however, microscopy has its draw backs and limitations ; it has high - fixed cost, and demands well - trained and experienced laboratory technician and microscopist.34 these limitations have undoubtedly hindered the accurate diagnosis and reporting of malaria infection with all its attendant consequences.56 recently, malaria rapid diagnostic tests (mrdts) have been developed and are in operation in various settings that lack reliable microscopy.78 because of low - fixed cost and less demand for skilled training, mrdts have prospect for wider distribution and use in comparison to microscopy.9 these tests are being put forward as a potential solution for targeting valuable antimalarial drugs to those who need them. several studies have shown high performance of mrdts in the diagnosis of malaria.101112131415161718 there are fewer data on test performance in children, with varying reports on the effect of age on mrdts performance.101314151920 nigeria has adopted mrdts as a diagnostic tool, where microscopic diagnosis is not feasible.21 however, only very few studies have been done to assess the performance of these devices in the under - five age group in the country1011 and none to the best of my knowledge has been reported from northeastern nigeria. this may be particularly necessary due to variation in histidine - rich protein-2 produced by plasmodium falciparum from different regions and countries.2223 in addition, the hot climatic condition of maiduguri, with ambient temperature reaching 45c at the peak of the hot dry season in march and april,24 which is well above the recommended storage temperature of 2c to 30c by manufacturers25, could adversely affect the performance of these kits if there is disruption in the cold - chain. this study is thus aimed at determining the performance of mrdts in the diagnosis of malaria among under - five aged children in an out - patient clinic in semi - arid maiduguri. this was a hospital based cross - sectional observational study carried out at the paediatric general out - patient (pgop) unit of university of maiduguri teaching hospital (umth), maiduguri, borno state of nigeria. university of maiduguri teaching hospital is a centre of excellence for infectious diseases and immunology. it serves as a referral centre for the six states in the region as well as the neighbouring countries of cameroun, chad, and niger. consecutive children aged below five years presenting to the pgop unit of the umth with presumptive malaria defined as fever (axillary temperature > 37.5c), and/or history of fever in the 72 hours prior to presentation,27 who met the inclusion criteria were studied after an informed consent and approval by the research and ethical committee of the hospital were studied using malaria rapid diagnostic kit, acon[] malaria p. f. (mrdt). p-value was taken from a study in jos nigeria.29 patients were excluded from the study if they were human immune - deficiency virus (hiv) positive, or had rheumatologic disease, or had a history of antimalarial treatment within 4 weeks prior to presentation or malaria prophylaxis, or had treatment with cotrimoxazole, tetracycline and clindamycin. on the day of inclusion, demographic and clinical information were recorded using a questionnaire. thick and thin blood smears were prepared, and the mrdt was performed from the same finger or heal prick blood sample. number was allotted to every participant at the point of entry and was used for identification of mrdt kit, slides and questionnaire from the same patient. results of the tests were disclosed to the guardians and those with positive malaria parasitaemia, and or positive mrdt were given antimalarial drugs free of charge that were sponsored by the researchers. all mrdt tests were performed by a trained laboratory scientist and the results were read and interpreted within 15 minutes according to the manufacturer 's instructions. for each mrdt four slides were prepared for each patient ; two thin and two thick smears and were air - dried. the thin blood smears were fixed with methanol and the thick smears were left unfixed. each slide the thick smears were used for diagnosis of plasmodium species and for parasite - density counting. smears were considered negative if no parasites were seen in 100 oil - immersion fields. for positive smears, parasite density was calculated assuming 8,000 wbc per microlitre using the formula:30 the thin smears were examined to confirm the parasite species for positive samples. presence or absence of gametocyte in all negative slides was also recorded, and gametocyte - density counts (number of gametocytes/1,000 wbc) performed. all slides were double - read, blinded, by the first author and the laboratory scientist from the department of microbiology umth. there was an agreement of > 95% between the first author and the laboratory scientist in slide reading. analysis was done using statistical package for the social sciences (spss version 16.0, chicago, il, usa). baseline characteristics (demographical, clinical, and parasitological) were analysed using descriptive statistics ; mean, mode, medians, standard deviation, as appropriate. frequencies and proportions were compared using chi - square (2) and strength of association was tested using contingency coefficient. sensitivity (true positive / true positive + false negative 100), specificity (true negative / true negative + false positive 100), ppv (true positive / true positive + false positive 100) and npv (true negative / true negative + false negative 100) were calculated using the method of galen and gambino31. further stratification by category of parasitaemia ; 37.5c at presentation. it is not clear why there is inconsistency in the effect of temperature at presentation on the sensitivity of mrdt, however, history of fever as an inclusion criteria is subjective compared with objective measurement of temperature at presentation. the high specificity of 100% obtained in this study is similar to findings in other studies.1011131518 this current finding provides confidence that there is no risk of wrongly treating any patient without malaria if diagnosis is done by mrdt. nonetheless, other workers have reported lower specificities.1214151617 the disparity in specificities between different studies could be due to differences in inclusion criteria. for instance, kaushik.16 from india found 25% of children who were positive for hrp-2 test had history suggestive of use of antimalaria drugs along with other treatments for fever, probably affecting parasitaemia but not the antigenaemia and thus high false positive results. in addition, malaria endemicity seems to inversely affect the specificity of mrdt ; this is evident in the study by abeku.15 from kenya and uganda where specificity of 99.9% was recorded from hypoendemic site and 65.0% from mesoendemic site in the same study. the specificities in this study remained unchanged irrespective of category of parasite density, temperature at presentation, age and sex. however, some previous studies have found parasite density, age and temperature at presentation to significantly affect the specificity of rapid diagnostic test (rdt).111538 this disparity in the effect of age may be due to the differences in age of the studied population. while this study was limited to children under five years of age, abeku.15 and bisoffi.38 studied both children and adults. although this study did not find parasite density and temperature at presentation to significantly affect the specificity of mrdt, other workers have reported a significant association between parasite density1115 and temperature at presentation.15 this difference may be attributable to the generally low parasite densities observed in the present study. the predictive value of a positive test of 100% implies that all positive mrdt truly have parasitaemia and thus treatment decision could reliably be based on it. this finding is comparable to the reported ppv in earlier studies,101518 but higher than that reported by others.111214 the variation in ppv among studies using hrp-2 kit may be due to failure to exclude patients who have had antimalarial drug prior to presentation thereby leading to high rate of false positivity. in addition, differences in malaria endemicity could also account for the observed differences.15 the ppv in this study was not affected by age, sex, temperature at presentation and parasite density. this is similar to the finding of abeku.15 with regard to effect of temperature at presentation. laurent.14 showed ppv to decrease with increasing age, and this statistics could not be demonstrated in this study probably due to differences in the ages of the study population in the two studies. the negative predictive values of 74% on the other hand, infers that the probability of a negative result excluding malaria is 0.74 and hence the need to exclude malaria by other means. this is lower than reported npv in other studies.101112141518 this differences could be explained by the high rate of false negativity in this study, which resulted from the inability of the kit to detect malaria antigen at low parasite density in the face of overall low parasite densities recorded. in addition, temperature at presentation had no effect on npv in this study, which is in agreement with a previous report.15 malaria rapid diagnostic test is a poor screening tool for malaria infection in the under - five aged children. while a positive rapid diagnostic test result in this age group is diagnostic of malaria ; a negative result, on the other hand, is not a sufficient evidence to withhold antimalarial treatment. hence, routine use of mrdt for the diagnosis of malaria among the under - five children should be done with caution. | background : malaria has remained a major cause of morbidity and mortality among the under - five children in nigeria. prompt and accurate diagnosis of malaria is necessary in controlling this high burden and preventing unnecessary use of anti - malarial drugs. malaria rapid diagnostic test (mrdt) offers the hope of achieving this goal. however, the performance of these kits among the most vulnerable age group to malaria is inadequate.materials and methods : in this cross - sectional study, 433 out - patients, aged < 5 years with fever or history of fever were enrolled. each candidate was tested for malaria parasitaemia using acon malaria pf. thick and thin films were also prepared from the same finger prick blood for each candidate.result:malaria rapid diagnostic test had sensitivity of 8.3%, specificity of 100%, positive predictive value (ppv) of 100% and negative predictive value (npv) of 74%. the sensitivity of mrdt increased with increasing age. this effect of age on sensitivity was statistically significant (p = 0.007). similarly parasite density had significant effect on the sensitivity of mrdt (p = < 0.001).conclusion : histidine - rich protein-2 based mrdt is not a reliable mean of diagnosing malaria in the under - five age children with acute uncomplicated malaria. |
agranulocytosis is defined as an absolute neutrophil count (anc) less than 100/mm in association with infectious disease. the risk of agranulocytosis is 0.38% of all clozapine treated cases and there is a relatively lesser incidence in indian population. the risk of clozapine - induced agranulocytosis and neutropenia is highest in the first 6 months and higher in the initial 18 months after the onset of treatment. the reports of clozapine induced agranulocytosis in co - morbid multiple sclerosis and delayed onset neutropenia and 2 reports of early treatment phase clozapine induced agranulocytosis have been reported from india, so far no reports of late onset clozapine induced agranulocytosis has been reported from india. a 44-year - old female patient with a diagnosis of paranoid schizophrenia, on clozapine treatment and regular follow - up presented in psychiatry outpatient department with fever, rigor, swelling of the right hand and sore throat. she has a 22 year history of fear suspicion and hearing voices with history of treatment with typical and atypical antipsychotics and poor treatment response. she was started on clozapine around 5 years back and subsequently given risperidone and trihexyphenidyl. at the time of presentation, she was on 150 mg of clozapine, 6 mg of risperidone and 4 mg of trihexyphenidyl. a total count done 1 week back showed 6,700/mm with 70% neutrophils, 26% lymphocytes and 4% eosinophils. she was on examination, conscious, oriented, febrile, had a pulse rate of 96/min, her blood pressure was 110/60 mm of hg, diffuse swelling of right upper limb, her systemic examination was normal and had on mental status examination persecutory delusions and third person auditory hallucinations. she was admitted under the department of internal medicine and worked up. on admission, her hemoglobin level was 8.1 g / dl, total count was 700, her differential count was n4p95e1, packed cell volume (pcv) was 25.3%, erythrocyte sedimentation rate - 140 mm/1 h, platelet count was 6.8 lakhs / dl, random blood sugar was 100 mg / dl, urea - 14 mg / dl, creatinine - 1.1 mg / dl, total bilirubin - 0.8 mg / dl, serum glutamic oxaloacetic transaminase - 103 iu / l, serum glutamic - pyruvic transaminase - 102 iu / l, serum alkaline phosphatase (sap) - 125iu / l, total protein - 8 g / dl, a : g ratio was 1:2, human immunodeficiency virus and hepatitis b surface antigens were negative, chest x - ray was normal, electrocardiogram was normal, computed tomography head was normal, ultrasonography abdomen was normal, but doppler of right upper limb showed dilatation of cephalic vein (4.2 mm) with echogenic content and thrombus extending up to axillary vein with non - compressibility and no internal flow. she was diagnosed as having - drug induced agranulocytosis and deep vein thrombosis of right upper limb. she was started on antibiotics (cefoperazone + sulbactum), warfarin, analgesics, proton pump inhibitors, supportive measures, barrier nursing and was given granulocyte - colony stimulating factor 300 g for 7 days. the bone marrow examination and biopsy carried out post - treatment showed lymphocytosis with 6% blasts. she however was at request referred to a specialized hematology unit and was treated there with antibiotics (amoxicillin + clavulanic acid) warfarin, analgesics, proton pump inhibitors, supportive measures and barrier nursing. improvement of blood picture patient in the meantime had an exacerbation of psychotic symptoms and was given risperidone, chlorpromazine and trihexiphenidyl. the patient on improvement of blood picture was discharged on oral antibiotics, warfarin, mupirocin ointment, glycerine mag sulfate thrombocytophobe dressing, risperidone 3 mg, chlorpromazine 150 mg and trihexyphenidyl 2 mg. the patient had an asymptomatic course and was reviewed by both medicine and psychiatry. at 6 months post event follow - up she is currently on 8 mg of risperidone, 50 mg of chlorpromazine and 4 mg of trihexiphenidyl and is in partial symptom remission and not on any other medication. the mechanism of clozapine - induced of agranulocytosis is unclear especially as neither clozapine nor its major stable metabolites, n - desmethylclozapine at therapeutic drug concentrations (1 - 3 m), have been found to be directly cytotoxic to neutrophils or interfere with the turnover of bone marrow precursor cells. a strong possibility is for an immune - mediated mechanism or at least an immunological background for clozapine - induced agranulocytosis, as on re - exposure to the drug, the course is more severe and the time interval to recurrence of toxicity is shorter. of the known risk factors of agranulocytosis such as female sex and increased age or age less than 21 of which this case had one risk factor. there is also an association between eosinophilia and neutropenia, which was not seen in this case. the report of delayed onset agranulocytosis is very rare and this is the first reported from india on a patient without co - morbidity. it is hypothesized modest growth - inhibiting effects of clozapine on bone marrow may be amplified in patients undergoing long - term therapy with clozapine. dose and serum levels of clozapine may not be directly associated with clozapine - induced agranulocytosis, although some reports suggest a dose - related aspect of this phenomenon. the phenomenon of late onset agranulocytosis should therefore be considered with care and all clinicians should insist to regular guideline based monitoring of white cell count, even in patients who have been on clozapine for years. | agranulocytosis is defined as an absolute neutrophil count less than 100/mm3 in association with infectious disease. the risk of agranulocytosis is 0.38% of all clozapine treated cases and there is a relatively lesser incidence in indian population. the risk of clozapine - induced agranulocytosis and neutropenia is highest in the first 6 months and higher in the initial 18 months after the onset of treatment. there have been very few reports of neutropenia and agranulocytosis after this period. there have so far been no reports of late onset clozapine induced agranulocytosis has been reported from india. a case of late onset clozapine induced agranulocytosis with possible mechanism of the same is reported. |
cervical cancer is mainly treated by radiotherapy which consists of external beam radiation therapy (ebrt) and intracavitary radiation therapy (icrt). due to technological advances intensity modulated radiation therapy (imrt), a form of conformal radiation therapy, is increasingly being used nowadays in cervical cancer since several studies have reported dosimetric and clinical benefit over conventional whole pelvis ebrt [17 ]. though icrt is an integral part of treatment, imrt is posing a challenge to it. interstitial brachytherapy (ibt) is used as an alternative to icrt in patients with extensive disease in the cervix, obliteration of the cervical os, narrow vagina, extension of disease into the lower vagina and parametrical disease beyond the high dose range of the intracavitary applicators. even though ibt is a better option in such patients, the associated morbidity due to physical injury and radiation dose to organs at risk (oar) still remains a concern [8, 9 ]. imrt, which has been suggested to replace icrt, can potentially further reduce the oar doses. concomitant use of ibt and imrt will synergize the potential benefits, physical and biological, of both. for this, we have devised a new technique called interstitial brachytherapy guided intensity modulated radiotherapy (ibgimrt) which can be highly conformal. this technique utilizes the imrt planning on the tumor volume defined by implantation of ibt needles. before its clinical application, we conducted a dosimetric study for comparing the treatment plans of ibt and ibgimrt. ct scan images of 18 patients with primary cervical carcinoma stage iiib, who have been already treated by high dose rate (hdr) ibt following whole pelvis ebrt, were used for this study. the ebrt dose schedule consisted of 40 gy in 22 fractions over 5.5 weeks to whole pelvis with four field box technique followed by 10 gy in 5 fractions over 5 days with midline shield (split field). following ebrt, they were assessed for standard icrt application (hdr 7 gy 3, weekly) and were found unsuitable due to various geometrical and dosimetric reasons. we decided to treat them by ibt (2 sessions of hdr 10 gy each, one week apart) instead of standard icrt. the implant was performed under spinal / epidural anesthesia using martinez universal perineal interstitial template (mupit) with the assistance of trans - rectal ultrasonography (trus). foley s tri - lumen urinary catheter was inserted and the bulb was inflated with 7 cm of contrast material (2 cm hypaque and 5 cm of normal saline). thorough clinical examination and trus imaging of the pelvis was done before inserting the stainless steel needles with blind ends. number of needles to be inserted was determined by the target volume decided by pretreatment clinical and radiological (ct / mri) findings as well as operative clinical & trus findings. needle injury to various pelvic organs like urinary bladder, rectum and small bowel was avoided as they were well visualized on trus. thus the target area was adequately covered by the needles, maintaining adequate distance from the normal structures. after the completion of the needle implantation, template was fixed to the perineal skin with the help of stitches. a dose of 10 gy was delivered and the template was removed immediately after completing the treatment. after a gap of 1 week another implant was repeated for delivering 10 gy. a planning ct scan of the whole pelvis was done with slice thickness of 2.5 mm. brachytherapy planning was performed in plato planning system, version 14.1 (nucletron, netherlands) where target and oar were delineated. the contour drawn by the line joining the outermost needles on the each ct slice constituted the boundary of the target (fig. the cranio - caudal extent of the target was decided by selecting the length of needles keeping in mind the clinical findings. due to overlapping of the target and oar volumes, once the target volume and oar volumes were finalized, the same were transferred to external beam imrt eclipse planning system (version 7.35, varian medical system, usa) through dicom - rt. for ibt planning, implant needles were also marked on each slice in order to reconstruct the needle length. simultaneously two comparative plans were generated, one each on plato (ibt) and eclipse (ibgimrt) for a prescription dose 10 gy to the target. for ibt plan, step size of 2.5 mm was selected. only dwell positions within the target volume were activated. if needed, optimization was done to achieve the best plan. for imrt plan, 7 - 9 co - planar 6 mv photon beams (mlc width 10 mm, dynamic imrt) were chosen. dose constraints were set to minimize the volume of normal tissue receiving the prescription dose without compromising target coverage. ct scan image showing the interstitial brachytherapy needles, contouring of target volume, bladder and rectum dose conformality and normal tissue avoidance were used to compare the two rival plans. following dosimetric indices were used for comparison : volume receiving 95% of prescription dose (v95), conformal index (coin) and external volume index (ei) for target. coin is a unique index that accounts for the entire dose inside the treated volume, not just inside the target volume, but also outside of any contoured structures. we calculated the coin by using the following formula : tvref was defined as the volume within target volume (tv) that was also within the referenced isodose, and vref was defined as the volume (inside and outside of tv) within the reference isodose. ei was defined as the ratio of the volume of normal tissue that received a dose equal to or greater than the reference dose to the target volume. for oar, dose received by volume of 1 cm (d1cc), 2 cm (d2cc), 5 cm (d5cc) and also volume received by 50% (v50) and 75% (v75) of prescription dose were evaluated for both bladder and rectum. the statistical analysis was done using paired t - test and a p - value of 0.05). similar observations for rectum with ibt vs. ibgimrt were 11.2 gy vs. 7 gy, 10.5 gy vs. 6.4 gy and 9.1 gy vs. 4.8 gy respectively and the difference was statistically significant for all the values (p < 0.01). the v50 and v75 values for bladder were slightly better with ibgimrt as compared to ibt but statistically no significant. there is an emerging feeling among the radiation oncologists worldwide that imrt has a potential of replacing the most brachytherapy (bt) treatments whether it is icrt for cervix or ibt for prostate cancer. though studies relating cervical cancer have already shown the benefit of imrt over conventional ebrt in terms of dosimetry and toxicity, there are very few studies comparing icrt and imrt [1315 ], and none comparing the ibt and imrt. a study by roeske. evaluated the use of imrt as a replacement for bt in cervical cancer by generating boost plans in 10 patients. though the study did not compare directly the icrt and imrt dosimetry, authors found that a total dose of 79 gy was possible (45 gy pelvic rt plus a 34 gy imrt boost). subsequently, a study by low. compared the dosimetry of icrt with imrt. they observed that imrt dose distributions covered point a isodose surfaces while reducing the dose to the bladder and rectum. in a patient with unfavorable anatomy, significantly better dose coverage of the target tissues kavanagh. used imrt instead of icrt, adopting simultaneous integrated boost imrt (sibimrt) technique and reported that bladder and rectum doses were significantly better with the use of imrt. based on these 3 reports, the issue of imrt replacing bt in cervical cancer is being debated with arguments in favor and against [16, 17 ]. so far, there is no study in the literature comparing ibt and imrt in cervix. it delivers a concentrated dose of radiation to the target area ; and minimal dose to oar as compared to icrt. though, in use for last 30 years or so, it had not gained wide popularity neither among patients or radiation oncologists due to various reasons : invasive & cumbersome procedure, lack of expertise, associated morbidity and lack of convincing data. various series [8, 9 ] on ibt in gynecological malignancies, primary as well as recurrent, have reported 4 - 18% risk of severe late toxicity like recto - vaginal fistulas. on the contrary considering the increasing popularity of imrt and emerging data on bt - imrt comparison in various sites like breast [18, 19 ] and prostate, ibt in cervix is likely to face, sooner or later, a stiff challenge. both techniques have good potentials and we believe in their complementary use rather than substitute of each other. with this aim, we have conducted the present study for testing its dosimetric superiority by comparing with ibt. ours is a unique study since no study in the literature, so far, has compared, directly or indirectly, ibt with imrt (ibgimrt) in cervical cancer. for a strict and head to head comparison, we have kept the target volume same for both plans even though, a certain margin outside the ctv, for creating ptv, is mandatory in imrt planning for countering the day to day setup errors. in brachytherapy planning, we have chosen 10 gy as the prescription dose since our treatment protocol uses ibt of hdr 10 gy each in 2 sessions, one week apart. the results of our dosimetric study in 18 patients have shown that ibgimrt in comparison to ibt provided significantly better overall conformality and reduced doses to oar, proving its dosimetric superiority. since rectum is more susceptible to radiation injury, this dose reduction can be of good help in clinical practice. some of the indices are better with ibt (v95) and hence our hypothesis of combining the two techniques seems justifiable. the visualization of the tumor, especially the parametrial disease, on the ct / mri scan is not very good. with our technique, while the ibt needles are being inserted under anesthesia, there is a better clinical appreciation of the pelvic disease. simultaneously the real time use of trus provides additional information of the tumor and pelvic structures. correlation of this clinical disease assessment during anesthesia with imaging findings helps in better definition of the target volume. secondly, the ibt treatment is usually fractionated spread over 2 - 3 days. during the course of ibt the 50% of the treatment is carried out with ibt and rest with ibgimrt with similar dose per fraction and number of fractions. for example in a given patient, if ibt dosimetry is equally good or better, then higher dose may be given by ibt and rest by imrt. thus, various biological and physical advantages of both are exploited in order to improve the clinical outcome. thirdly, various pelvic structures especially uterus, cervix and hence the tumor are mobile structures since they are suspended by the ligaments. the ibt needles in situ fix the target region and hence minimize the risk of target movement which is key to any radiation treatment especially ebrt and more so, treatment like imrt. for the same reason, we have kept the target volume same for both ibt and ibgimrt planning in this present study. as it happens with every new technique, we expect readers to question some of the points in our new technique, ibgimrt. for example, all forms of conformal ebrt treatments (like imrt) ; require application of strict immobilization devices which might be problematic in a patient having implant needles in situ. during the imrt treatment, but these shortcomings can be slowly overcome in the subsequent study involving its clinical use. to conclude, the novel technique ibgimrt devised by us has shown it s dosimetric superiority over ibt in cervical cancer. | purposeinterstitial brachytherapy (ibt) is used as an alternative to intracavitary radiotherapy in the management of cervical carcinoma. we have devised a new technique called interstitial brachytherapy guided intensity modulated radiotherapy (ibgimrt) which can potentially reduce doses to organs at risk (oars). it utilizes imrt planning on the target volume (tv) defined by implantation of ibt needles. this study compares the dosimetry of ibt and ibgimrt.material and methodsct scan images of 18 patients with cervical cancer, who have been already treated by hdr - bt, were used to generate two rival plans, ibt and ibgimrt, for a prescription dose of 10 gy. following dosimetric factors were used for comparison : volume receiving 95% of prescription dose (v95), conformity index (coin) and external volume index (ei) for target and for oar, dose received by volume of 1 cm3 (d1cc), 2 cm3 (d2cc), 5 cm3 (d5cc) and also volume receiving 50% and 75% of prescription dose (v50 and v75).resultsthe two plans resulted in coin difference of 49.8% (p 0.05). similar figures for rectum with ibt vs. ibgimrt were 11.2 gy vs. 7.02 gy, 10.5 gy vs. 6.4 gy and 9.1 gy vs. 4.8 gy respectively (p < 0.01).conclusionsour novel technique, ibgimrt, has shown its dosimetric superiority and therefore needs to be studied in clinical set up. |
lymphoma of the bone is a rare malignancy, first suggested by oberling in 1928 and further described by parker and jackson in a series on reticulum cell sarcoma of bone. primary bone lymphoma, as originally defined by ostrowski, is a lymphoma of bone without disease present elsewhere for at least 6 months after initial diagnosis, account for less than 1% of all malignant lymphomas and occur at a median age of 46 years. the characteristics of bone lymphoma have been further defined by a number of case series : the most common locations of bone lymphoma are variously reported as the spine, the ischium, and long bones, particularly the femur ; the most common presenting symptom is pain associated with swelling ; the most common histology is diffuse large b - cell lymphoma, and the phenotype may be germinal center- or activated b cell - like. the current treatment of primary bone lymphoma appears to typically be a combination of chemotherapy and radiotherapy. we encountered two male patients, both age 19, whose chief complaint was knee pain and each had a biopsy of the proximal tibia that was diagnostic of a b - cell lymphoma. in both cases, one patient had bilateral proximal tibia involvement by diffuse large b cell lymphoma, not otherwise specified. the other had unilateral tibia involvement by a low grade b cell lymphoma (not further classifiable) that was treated with local radiation and recurred 17 months later in the contralateral tibia. both patients bone x - rays showed a sclerotic pattern. these cases prompted us to review all lymphomas with an initial diagnosis of lymphoma in bone at one institution, to identify all patients with tibial lymphoma at two additional institutions, and to examine the association of age and relative incidence of lower limb bone lymphoma within a national cancer database. correlation of the clinical and pathology records of the university of rochester medical center from 2003 - 2011 identified all lymphomas in patient s whose initial diagnosis was based on a bone biopsy (excluding iliac crest) directed at a radiographic lesion. the demographics, symptoms at presentation, radiologic findings, clinical stage, treatment, and follow - up were identified for the subset of bone lymphoma specimens for which the site was tibia in the pathology report (table1). the demographics and clinical stage were also obtained for the subset of bone lymphoma specimens for which the site was femur. reproducibility of findings was assessed by searching the pathology records of two other institutions for lymphomas diagnosed in the tibia ; the latter searches were preformed without age restriction and without the stipulation that the specimen represent the patient s initial diagnosis. the surveillance, epidemiology, and end results (seer) program of the national cancer institute is a population - based national cancer database comprised of data on incident cancer cases contributed from registries across the united states. seer began collecting data from 9 registries in 1973 ; currently seer includes data captured on incident cases from 17 participating registries, a catchment area representing approximately 28% of the us population. in order to limit the influence of variability in referral and diagnosis patterns, data from the 2000 - 2009 seer dataset was used for this analysis ; this dataset was comprised of incident cancer cases captured in 17 seer site registries. inclusion in the analysis dataset was limited to patients with a lymphoma diagnosis (icdo3 codes 9590, 9591, 9650, 9663, 9670, 9671, 9673, 9675, 9680, 9684, 9687, 9690, 9691, 9695, 9698, 9699, 9702, 9714, 9727, 9728, 9729, 9920, and 9930 ; n=129,097), and bone as their primary site of disease (only included if site was c40.0, c40.1,c40.2, c40.3, c40.8, c40.9, c41.0, c41.1, c41.2, c41.3, c41.4, c41.8, c41.9;n=1,315). patients diagnosed with plasma cell tumors (icdo3 9730 - 9739) were excluded from this analysis (n=923). our final analysis dataset included 808 lymphomas with bone involvement diagnosed from 2000 - 2009. histology was grouped by icdo3 codes into malignant lymphomas not otherwise specified or diffuse, hodgkin lymphomas, non - hodgkin lymphoma - mature t- and nk - cell lymphomas, non - hodgkin lymphoma -precursor cell lymphoblastic lymphoma, myeloid leukemias, and non - hodgkin lymphoma -mature b - cell lymphomas, which was further categorized into diffuse large b cell lymphoma, not otherwise specified and other. involvement of the tibia, specifically, is not captured with the icdo3 site codes ; therefore, patients with primary involvement of the long bones of the lower limb and associated joints (c40.2) were designated as the lower extremity cases and were compared to other bone lymphoma patients with involvement of all other sites. from this point forward, patients with lymphoma involvement of any long bones of the lower limb and associated joints will be referred to as lower extremity cases. descriptive analyses included presentation of case characteristics by frequency and percents, stratified by age, site of bone involvement (lower extremity versus other bone sites) and gender. differences in age and stage of lymphoma at diagnosis by site of bone involvement were analyzed using chi - squared tests. overall survival was defined as time from diagnosis to date of death from any cause ; patients who were still alive at the end of follow - up were censored as of december 31, 2009. we compared overall survival between cases with lower extremity involvement and cases with lymphoma involvement of other bone sites using the log - rank test. analyses were implemented using sas software system (sas institute, cary, nc ; version 9.3). 49 cases of non - hodgkin lymphoma with biopsy - proven initial presentation in bone were identified at the index institution ; these had a median age at presentation of 42 years (data not shown). these patients were significantly younger (median age of 21.5 years ; p 40 years, p 40 (figure 3b), two - year overall survival among those with lower extremity involvement was 73% versus 68% in non - lower extremity bone involvement and five - year overall survival was 68% versus 57%, (log - rank p=0.15). because the curves repeatedly cross and do not separate until 12 months, site may have no real effect on survival in those > 40. our data reveal a syndromic pattern of presentation of lymphoma that occurs specifically in the proximal tibia of young people (40 years old) presenting with knee pain and/or swelling, is frequently bilateral, and shows sclerotic changes on imaging. epidemiologic data indicate that lymphoma of lower extremity bones has excellent prognosis compared to bone non - hodgkin lymphoma presenting in young patients at other sites. furthermore, in our patients the lymphoma was often highly restricted to the proximal tibia and showed a profound tropism for this site : of 10 patients at the index institution, 6 patients had lymphoma solely in the proximal tibia as the only bone site and 4 patients demonstrated bilateral proximal tibial involvement with relative sparing of other bone sites. our institutional data show a striking bias toward tibial rather than femoral presentation in young patients (25 versus 74 years median age of presentation). strikingly, the youngest patient (18 years old) with femoral presentation of lymphoma at this institution had disease characterized by the surgeon as knee and distal femur, suggesting a similarity to the presentations seen in the proximal tibia. although the seer database does not include localization specifically to the proximal tibia, the data on the lower extremity corroborates and extend our institutional findings. most importantly, cases of lower extremity lymphoma in young patients had significantly better overall survival in comparison to lymphomas of non - lower extremity bone sites in young patients. although lower extremity presentation tended to be associated with a lower stage, low stage did not fully account for the improved overall survival ; site of bone involvement remained statistically significant after adjustment for stage in the multivariate cox proportional hazards model. a sclerotic radiographic pattern was identified in all 7 cases at the index institution in patients 40 for whom imaging was available. overall, 9/11 patients with available radiologic information had either purely sclerotic or mixed sclerotic lesion, and only 2 had a purely lytic lesion. this finding is in contrast with the typical lytic appearance of non - hodgkin lymphomas of the bone which is either permeative or moth - eaten, with bone destruction as a significant feature. a predominately sclerotic image, while more often seen in classical hodgkin lymphoma of the bone, is described in just 2% of bone non - hodgkin lymphoma. therefore, radiographic sclerosis may be a diagnostic clue for non - hodgkin lymphoma presenting in the proximal tibia. while a range of common studies was attempted (e.g. immunohistochemical studies for cd10, mum1, bcl-2, bcl-6, ebv - lmp, and ki-67, as well as in - situ hybridization for eber), no shared histologic, immunophenotypic, or genetic features that further characterized these b cell tumors were identified. the specimens were in general small and crushed, and the decalcification performed on most hindered any pcr - based analyses. bone lymphomas are often difficult to diagnose and classify and the osteoblastic / sclerotic nature of these tumors makes them particularly prone to crush artifact and limited sample size. in fact, several of the patients required repeat procedures to obtain sufficient material for the final diagnosis. this syndromic pattern of presentation of lymphoma may have escaped notice in prior studies of primary bone lymphoma because many of our patients (for example patients 2 - 5) would have been excluded from those series since there was lymph node involvement at the time of presentation. furthermore, the patient ages straddled the cut - off between adult and pediatric series ; our two index cases were both seen in adult clinics and were not enrolled on pediatric trials. still, the seer data show that the highest incidence of lower extremity bone lymphomas for males is in the second decade (see figure 2). our review of the literature identified 9 publications describing 7 case series of pediatric bone lymphomas (the two largest series are each reported in two parts, with a publication describing a follow - up time point or the clinical and histologic data described separately). these series document that pediatric primary bone lymphoma commonly presents in the lower limb. while the femur may be a more common site of lymphoma than the tibia, it is unclear if the femoral presentation is associated with the same syndromic pattern of presentation involving a complaint of knee pain with sclerosis on bone x - ray. regardless, one of these series of pediatric primary bone lymphomas showed a striking similarity to the series we describe here ; zhao describe a series of 10 pediatric patients with, all male, four with tibial presentation, one of which was bilateral. the bilateral presentation in the proximal tibias with sparing of other sites has also been described by others. for example, two recent case reports both show striking images of bilateral proximal tibial lymphoma, although both in older males. several non - hodgkin lymphoma subtypes with site - specific biology, prognostic and treatment characteristics, and even distinctive molecular features have been described and incorporated into the world health organization s classification of lymphoid tumors. the site - specific pathogenesis of a subset of these is thought to be dependent on chronic, local inflammation, the most common of which are the various forms of mucosal associated lymphoid tissue (malt) lymphoma., the prototypical form of which occurs in males in the seventh decade and specifically in the pleural cavity ; it has also been described associated with inflammation around metal implants in the femur. a small case series of bone lymphomas putatively associated with trauma has been reported. our reviews of the patients medical records did not suggest any obvious etiologies for the cases of proximal tibial non - hodgkin lymphoma, but one possible explanation relates to the increased athletic activities of this age group that might result in repetitive, microtrauma and subsequent inflammation of the proximal tibia. while evidence of ebv infection is typically found in cases of diffuse large b cell lymphoma associated with chronic inflammation, we were unable to detect ebv in any of the tumors from patients < 40 years old in this series. in sum, we describe a strong association between proximal tibial lymphoma (often bilateral), young age, sclerotic lesions on x - ray and excellent prognosis, associations that are reinforced by analyses of the seer database. due to the uncommon nature of these tumors, an increased awareness of the possibility of this unusual lymphoma in young patients is essential, since ample diagnostic material is required for diagnostic studies, including immunohistochemical and molecular studies, and prognosis may vary significantly by site of involvement. in addition, this syndromic pattern of presentation suggests intriguing hypotheses regarding the relationship between microtrauma and the development of lymphoma. | the presentation of two 19 year old males with stage i non - hodgkin lymphoma in the proximal tibia prompted an extensive review of institutional and national databases to assess if there is any statistical evidence that these reflected a previously overlooked syndromic pattern of presentation. the institutional records of a single institution were reviewed for presentation of non - hodgkin lymphoma in bone. the records of two additional institutions were reviewed for all reports of non - hodgkin lymphoma in the tibia. analysis was performed on data from seer (surveillance, epidemiology, and end results) dichotomized to bone presentation in the lower extremity versus other bones. institutional databases included 20 patients with tibial presentation of lymphoma with a median age of 22.5 years (versus 42 for all bone lymphomas ; p 40. these data show a previously undescribed syndromic pattern of disease presentation : bone lymphoma in young patients is likely to present in the lower extremity, specifically the proximal tibia, has atypical sclerotic features on x - ray, is often bilateral, and has an excellent prognosis compared to bone lymphomas at other sites matched for stage and age. |
hepatitis c virus (hcv) is noncytopathic virus that causes chronic hepatitis and hepatocellular carcinoma (hcc). around 30% of chc patients exhibit pnalt and show milder disease activity and slower progression to hepatic cirrhosis [26 ]. however, it is reported that about 40% of these progress to the active stage of inflammation, but the incidence of hcc in the pnalt was lower than that in those with elevated alt levels. cellular and humoral immune responses to hcv play an important role in the pathogenesis of active and nonactive chronic hepatitis. numerous studies have indicated that failure of the cellular immune response, including type 1 helper t cells (th1) hypo - responsiveness, cytotoxic t lymphocyte (ctl) exhaustion, excessive function of cd4 + cd25 + foxp3 + regulatory t cells, and failure of lymphoid cells via direct binding and/or infection in b cells, t cells, nk cells, and dcs occurs in chc patients [921 ]. since the liver damage in chc is mainly induced by th1 and/or ctl related responses [2224 ], these responses might be strongly suppressed in pnalt. given the involvement of immune responses, genetic factors including polymorphism of hla and cyotokine - related genes could also contribute to the activity of inflammation in chc patients [2537 ]. many groups, including us, have reported on the relationship between certain hla and alt levels in chc patients [25, 2729 ]. moreover, some groups indicated the polymorphism of certain cytokines - related genes contributed to the level of inflammation [3037 ]. in a genomewide association study (gwas), il28b polymorphism was shown to influence the outcome of peg - ifn and rbv therapy. however, although the relationship between il28b polymorphism and pnalt is still unclear, a possible relationship between il28b polymorphism and the activity of inflammation has been reported [39, 40 ]. in this review, we focused on the possible immunopathological aspects of pnalt and summarize various studies about the mechanism and genetic host factors involved in the immune suppression in chc patients. innate immune systems are important for the initial step of viral infection [41, 42 ] (figure 1). toll - like receptors (tlrs) are a family of innate immune - recognition receptors that recognize molecular patterns associated with microbial pathogens including single and double - strand rna. hcv interferes with the innate immune response and the induction of ifn - beta via the hcv ns3/4a protease activity, which inhibits the phosphorylation of irf-3, a key transcriptional regulator of the ifn response [43, 44 ]. hcv ns3 protein interacts directly with tbk1, and this binding results in the inhibition of the association between tbk1 and irf-3, which leads to the inhibition of irf-3 activation. however, since little is known about the direct relationship between the suppression of tlr signaling and pnalt, the level of tlr signaling suppression might contribute to the immunopathogenesis of pnalt. in addition to the intracellular immune reaction of hepatocytes, monocytes, nk, and nk - t cells are responsible for the rapid reaction in hcv infection (figure 1). many groups have described that nk and nk - t cells were suppressed in chc patients [4653 ]. however, whether nk and nk - t cells would be suppressed in chc patients is still controversial. the function of nk cells is regulated by a balance of inhibitory and activating signals, which are mediated by the differential expression of receptors. takehara and hayashi recently reported that the expression of the inhibitory receptor cd94/nkg2a is upregulated on nk cells in chc patients. another group reported that exposure to hcvcc modulates the pattern of cytokines produced by nk cells, leading to reduced antiviral activity. previously, it was reported that hcv - core and ns3 protein triggered the inflammatory pathway via tlr2, which might affect viral recognition and activation of the immune system. it was also reported that peripheral blood monocyte expression of tlr2 but not of tlr4 correlated significantly with the serum alt levels. concerning the mechanisms of monocyte - suppression, it was clearly demonstrated that macrophage cell lines expressing ns3, ns3/4a, ns4b, or ns5a inhibited the activation of the tlr2, tlr4, tlr7, and tlr9 signaling pathways. among the hcv individual proteins, ns5a bound to myd88, a major adaptor molecule in tlr, inhibited the recruitment of interleukin-1 receptor - associated kinase 1 to myd88 and impaired the cytokine production in response to tlr ligands. these results indicated that the activation of monocytes was probably suppressed in low alt and pnalt chc patients. after the innate immune period, the adaptive immune system including cd4 + t cells, cd8 + cyototoxic t cells, b cells, and dendritic cells should be involved in a more effective immune response to hcv. the hcv antigen - driven proliferation of cd4 + t cells is weak in patients who develop persistent hcv infection [57, 58 ]. it has been demonstrated that depletion of cd4 + t cells results in a weak cd8 + t cell response, which partly controls viremia, followed by viral persistence in chimpanzee infection studies. in addition, an appropriate th1 response is essential to eradicate hcv. it has been reported that an increased th2 cytokine response may reduce the inflammatory and biochemical activity. moreover, various studies have indicated that failure of the adaptive immune response, including th1 hypo - responsiveness, cd8 + ctl exhaustion, excessive function of cd4 + cd25 + foxp3 + regulatory t cells, and failure of lymphoid cell via direct binding and/or infection in b cells, t cells, and dcs occurs in chc patients [921 ]. previously, we reported the direct suppressive effect of hcv on t cell- and b cell - immunity in chc by using a lymphotropic hcv strain [1417 ]. however, since the contribution of lymphotropic hcv to the pathogenesis of pnalt is still not clear, the biological significance of lymphotropic hcv needs to be analyzed in future studies. studies about the relationship between the infectivity of lymphotropic hcv and pnalt are ongoing in our laboratory. tregs constitutively express cd25 (the il2 receptor alpha - chain) in the physiological state. in human, this tregs population, defined as cd4 + cd25 + foxp3 + cells, constitutes 5% to 10% of peripheral cd4 + t cells and has a broad repertoire that recognizes various types of self and nonself antigen. antigens induced by hcv might induce tregs to escape from immunological pressure as reported in persistent infection of eb virus, hepatitis b virus, and hiv [6367 ] (figure 2). more recently, itose. reported that the frequencies of naturally occurring - treg in chc patients were significantly higher than those in healthy individuals. another group also described that their suppressor ability is stronger in patients with pnalt than that in those with active chc hepatitis. these two studies could be direct evidence about the relationship between pnalt and the function of tregs. moreover, a unique subset of lymphocytes might contribute to the immune suppression in pnalt (figure 2). cd8 + ctls are able to recognize viral antigens synthesized within infected cells in the form of short peptides associated with hla class i molecules. on the other hand, cd4 + th cells are able to recognize antigens associated with hla class ii molecules [70, 71 ]. individuals that are heterozygous at hla class i loci are able to present a greater variety of antigenic peptides to ctl resulting in a broader immune response. hla class i heterozygosity was found at a higher rate in patients with slow progression to aids in hiv-1 infection. however, hla class i heterozygosity did not affect the inflammatory levels of chc patients in our previous study. the frequency of hla - a2 tended to be higher in patients with pnalt than in those with elevated alt level. a specific hla class ii allele has been reported to influence the disease severity or viral clearance in chronic hepatitis c. yoshizawa. reported that the frequencies of drb1 12 (1201 and 1202), dqb1 0301, and drb3 03 alleles were higher in patients with asymptomatic hcv carriers than those in liver cirrhosis patients. large - scale studies might be able to verify the ethnic, gender, age, and other genetic factors and determine the influence of the hla allele on pnalt. numerous studies indicated that various kinds of cytokine - related gene polymorphism were involved in the immunopathogenesis of chc. il10 is a suppressive cytokine that could contribute to the persistence of hcv infection and low inflammation level in chc. mangia. reported that the il-10 ata haplotype was more frequent in patients with spontaneous hcv rna clearance (36.0%) than that in patients with persistent infection (23%). on the other hand, another group reported that no effect of il-1beta and il-10 gene polymorphism on the degree of hepatocellular injury was apparent based on the alt levels. however, a gender effect is clearly observed in women carrying the gg high il-10 producer genotype. the higher levels of il-10 present in such individuals are associated with a higher risk of inefficient clearance of the hcv and the development of a chronic hcv infection together with a lower risk of progression to cirrhosis in female patients. these reports indicated that il-10-related gene polymorphism might affect the level of inflammation in certain conditions. ccr5delta32, a 32-base pair deletion of the cc chemokine receptor (ccr) 5 gene, is associated with slower human immunodeficiency virus disease progression in heterozygotes and protection against infection in homozygotes. reported that heterozygosity for ccr5delta32 was significantly associated with spontaneous hepatitis c viral clearance and with significantly lower hepatic inflammatory scores. in addition to these gene polymorphisms, polymorphism of tgf - beta, tnf - alfa, il2, ifn - g, and oas-1 genes might contribute to the level of inflammation [3032, 35, 74 ]. a genomewide association of il28b with the response to pegylated interferon and ribavirin was reported. then, another group reported that different cytokine profiles induced by the il28 polymorphism resulted in different interferon stimulated genes and il28 expression during chronic hcv infection. they reported that the expression of il28, mxa, pkr, oas1, and isg15 in hepatic cells was significantly lower in patients with the response - favorable (rs8099917) t / t genotype compared to those with t / g or g / g genotypes. a future study might be able to determine the relationship between il28 polymorphism and pnalt. in chc patients, there are many kinds of immune - suppressive mechanisms. however, although the immunopathogenesis of pnalt has not been clarified yet, the complexities of immune reactions likely contribute to the difficulties of determining the detailed mechanisms of pnalt. recently, the technologies of gwas, immunoassay with increased numbers of multicolor flow cytometry analysis, and chimera mice with human hepatocytes and lymphocytes have been developed. these technologies, together with previous data, might be able to clarify the immunopathogenesis of pnalt in chc. | patients with chronic hepatitis c (chc) virus infection who have persistently normal alanine aminotransferase levels (pnalt) have mild inflammation and fibrosis in comparison to those with elevated alt levels. the cellular immune responses to hcv are mainly responsible for viral clearance and the disease pathogenesis during infection. however, since the innate and adaptive immune systems are suppressed by various kinds of mechanisms in chc patients, the immunopathogenesis of chc patients with pnalt is still unclear. in this review, we summarize the representative reports about the immune suppression in chc to better understand the immunopathogenesis of pnalt. then, we summarize and speculate on the immunological aspects of pnalt including innate and adaptive immune systems and genetic polymorphisms of hla and cytokines. |
paraneoplastic pemphigus, which was initially described by anhalt (1), is characterized by non - specific pemphigus accompanying mucosal skin lesions showing erosion and blisters, which occur as a result of the production of autoantibodies against internal tumors. skin lesions associated with autoantibodies may not only be pemphigus lesions, but also erythema multiforme - like lesions, graft - versus - host disease - like lesions and lichen planus lesions (1,2). these diseases may also cause mortality due to the infiltration of autoantibodies into other organs, thus leading to the term paraneoplastic autoimmune multiorgan syndrome (pams) (2). lymphoid hyperplasia is the rapid growth and proliferation of normal cells that resemble lymph tissue, and the majority of lymphoid hyperplasia cells are t lymphocytes (2,3). neoplasms associated with lymphoid hyperplasia include castleman 's disease, non - hodgkin 's lymphoma and thymoma, and these tumors have been frequently associated with pams (2). conversely, sarcoma and malignant melanoma have rarely been associated with pams (3). the most common symptoms of pams are persistent oral lesions that are typically resistant to pharmacological treatment (47). brachytherapy can be attempted when considering the accessibility of the disease lesion, to minimize the side effects to the adjacent organ and to increase the therapeutic radiation dose (8). the present study is, to the best of our knowledge, the first to report the results of intraluminal brachytherapy application for the treatment of a persistent and pharmacological - resistant oral erosive ulcer in a 42-year - old female patient with giant lymph node hyperplasia (castleman 's disease) and erosive skin lesions in the vaginal mucosa and trunk region. a 42-year - old female patient visited chonbuk national university hospital (jeonju, republic of korea) with an 8-month history of erosive skin lesions occurring in the trunk region, oral mucosa and vaginal mucosa. an abdominal computed tomography (ct) scan (date, 18/6/2008) was performed following the detection of elevated ca125 (86.4 u / ml ; normal, 037 u / ml) and ca19 - 9 (185.46 u / ml ; normal, < 37 u / ml) levels in a blood examination. a retroperitoneal mass identified in the abdominal ct scan was removed (date, 25/6/2008) and the patient was diagnosed with castleman 's disease according to this biopsy (date, 30/6/2008) (fig. 1). the biopsy was a large (126.56.8 cm) mass with multicentric, hyaline vasular lymph node hyperplasia. the study was approved by the institutional review board of chonbuk national university hospital and was conducted according to the declaration of helsinki regarding biomedical research involving human subjects. a detailed explanation of the study was provided to the patient, and written informed consent was obtained from the patient. biopsies of the skin lesions were performed, and hematoxylin and eosin - stained pathology sections were classified according to their histological features, analyzed under a microscope (bx50 ; olympus corporation, tokyo, japan). the trunk lesions showed non - caseating granulomous features and positive lichen planus under low magnification, and chronic inflammatory cell infiltration, numerous blood vessels, lymphohistiocytic granuloma infiltrate and multicentric giant cells under high magnification (fig. 2a). in the skin lesions from the vaginal mucosa, epidermal labia majora - acanthosis, separation of the dermoepidermal junction, destruction of the basal layer and deposition of lymphoid cells and neutrophils in the dermis were observed under low magnification, and dyskeratosis, exocytosis, acantholysis and squamous metaplasia of the epidermis and keratinocytes were observed under high magnification (fig. the tongue was ulcerated and lacked the epithelium, and dense lymphoid cell infiltration into the tongue was observed under low magnification. immunofluorescence (date, 7/8/2008) revealed fibrinogen deposition along the basement membrane (fig. 2c). for the immunofluorescence assay, the tissue specimen was incubated for 1 h at room temperature using a human igg fluorescence - labeled antibody (cat., waltham, ma, usa ; dilution, 1:200). the patient was diagnosed with pams (7/8/2008) following analyses of the tissue obtained from the retroperitoneal mass and skin lesions. following the diagnosis, retroperitoneal mass resection was performed to alleviate pain caused by the mass and pharmacological treatment was performed for skin and mucosal lesions. pharmacological treatment consisted of a 4-month treatment regime of twice daily methotrexate (50 mg ; jw pharmaceutical, seoul, republic of korea) and thalidomide (200 mg ; taytech biogen, seoul, republic of korea) administration, followed by a one - time administration of azaprine (100 mg ; korean united pharmaceutical, inc., seoul, republic of korea), an immunosuppressive drug, and 10 mg / day prednisolone (korea pharma, seoul, republic of korea) for 1 year. the majority of the skin lesions in the trunk and vaginal mucosa were successfully treated, albeit the erosive lesion in the tongue was non - responsive to systemic pharmacological treatment and caused persistent pain., ulsan, republic of korea) treatment and local injection of tamceton (40 mg ; hanall biopharma co., ltd., seoul, republic of korea) were administered 20 and 15 times, respectively. however, the tongue lesion was non - responsive to these treatments, and the patient underwent intraluminal brachytherapy. oral lesions were limited to the anterior half of the tongue, and no ulcerous lesions were observed in the buccal mucosa or gingiva (fig. intraluminal brachytherapy was performed (date, 7/1/2010) to treat locally - located lesions, prevent damage to the gingiva and enhance the radiation dose effect. the device for oral brachytherapy was designed using acrylic resin and consisted of separate molds for the upper and lower jaws. the mold for the lower jaw consisted of three 6f catheter holes with 1-cm intervals to insert the catheter for brachytherapy (fig. the mold for the lower jaw constituted 2-mm lead plates to minimize the radiation exposure to the gingiva and teeth during the therapy, which were located adjacent to the tongue lesion. a 2-mm lead plate was also inserted into the mold for the upper jaw during each therapy to reduce the radiation exposure to the palate (fig. treatment was performed using a lumencath catheter (6f 150 cm ; elekta instrument ab stockholm, stockholm, sweden) for brachytherapy. radiation treatment consisted of 2 gy per session and two sessions per week, using an iridium-192 high - dose - rate brachytherapy system (microselectron hdr afterloader ; elekta instrument ab stockholm) (fig. the patient was exposed to a total of 40 gy radiation during 20 therapy sessions. grade 2 radiation - induced oral mucositis (9) was observed during the treatment. chronic side effects were not observed during the follow - up period and the majority of the tongue lesions were successfully treated following brachytherapy (fig. no disease progression was observed during the 4-year follow - up period ; the patient 's oral disease lesions completely healed. pemphigus vulgaris is characterized by acantholysis and intraepidermal blister formation, which are caused by the loss of normal interactions between cells due to the production of autoantibodies against the surface proteins of keratinocytes (10). however, anhalt (1) examined a case of pemphigus vulgaris showing non - specific clinical symptoms, including painful erosive mucosal lesions and various skin rashes, that were associated with the production of autoantibodies against a tumor, which they termed paraneoplastic pemphigus. subsequently, nguyen (11) suggested pams as an alternative and more appropriate name for paraneoplastic pemphigus for various reasons. first, the heterogeneity of clinical characteristics can be expressed as clear rash without blisters against the cross - section of the cells ; second, autoimmune multiorgan syndrome targeting epidermal cells and internal organs is commonly observed in patients with paraneoplastic pemphigus ; and third, respiratory failure as a result of changes in bronchial epithelial cells is observed, despite not typically being associated with pemphigus. anhalt (1) suggested that paraneoplastic pemphigus be diagnosed using the results of direct and indirect immunofluorescence analyses, immunoprecipitation assays, an analysis of clinical symptoms, including mucosal lesions with pain, various systemic skin lesions and internal organ tumors, and characteristic histological findings, including necrosis of keratinocytes, disjunction of intraepidermal pickle cells, vacuolization of the basal cell layer and dermatitis in the cell junction area. however, camisa and helm (6) reported that pams could not be diagnosed in some cases due to insufficient findings upon examination or a condition that prohibited such examinations. therefore, authors of that study proposed novel criteria for the diagnosis of pams based on distinguishing between major and minor findings (6). the major findings included various types of skin rashes, associated internal tumors and characteristic immunoprecipitation results, whereas the minor findings included the confirmed disjunction of pickle cells via histological analysis, precipitation of immunoreactants between the basal cell layer and cells upon direct immunofluorescence and positive findings in indirect immunofluorescence analyses using epithelial cells from rat urinary bladders (6). using this method, pams may be diagnosed if all the three major findings are identified or if any two of the major findings and any two of the minor findings are observed (6). in the present study, the patient was diagnosed with pams since she showed two of the major findings and two of the minor findings identified previously (1,4,10). this may be because many cases of pams are misdiagnosed as other diseases, including erythema multiforme, stevens - johnson syndrome, toxic epidermal necrolysis, lichen planus, pemphigus and graft - versus - host disease, due to its diversity of clinical manifestations and histopathological findings (11). at present, pams is considered an autoimmune disease and thus is treated with palliative treatments, including removal of the symptom - causing mass or administration of immunosuppressive drugs or adrenal cortical hormones (37). however, a clear method for its treatment has yet to be established (38). painful oral erosive ulcers and various forms of skin rashes are typical skin lesions associated with pams (2). in particular stomatitis is observed in the earliest stage of the disease and shows the strongest resistance to treatment, such that it is often the most persistent of the associated symptoms. it typically occurs on the lateral side of the tongue and extends towards the lip versmilion, thus causing pain. notably, pams has been shown to have more severe symptoms and a wider range of clinical manifestations, as compared with normal pemphigus (10,11). in the present case, the first symptom experienced by the patient was an erosive lesion in the oral mucosa and tongue, which was associated with severe pain. other symptoms experienced by the patient, including skin lesions of the trunk and vaginal mucosa, were improved following surgical resection of the mass from the retroperitoneum, which was associated with the patient 's castleman 's disease, as well as treatment with an adrenal cortical hormone, methotrexate, thalidomide and an immunosuppressive drug, azaprine. however, the oral lesion was unresponsive to the pharmacological treatment and surgical resection, and was the cause of persistent severe pain. previous studies have reported that autoimmune disorders may be sensitive to radiation (12,13). therefore, radiation therapy was considered for the present case. in the present study, the patient underwent brachytherapy to minimize radiation exposure to the surrounding organs. as a result of brachytherapy, the lesions in the tongue were controlled without causing serious acute or chronic side effects. in addition, neither worsening nor progression of the lesion was observed during the 4-year follow - up period. in conclusion, the present study has demonstrated that brachytherapy is a promising therapeutic strategy for the persistent and drug - resistant oral lesions that are often observed in patients with pams. however, regular observation of the patient may be required due to the slow response of pams to treatment and the high rate of relapse of this disease. | paraneoplastic autoimmune multiorgan syndrome (pams), also known as paraneoplasic pemphigus, involves the skin, internal organs and mucosa. pams - associated mortality may occur as a result of autoantibody formation against internal tumors and their infiltration into organs other than the skin lesions that characterize pams. the most common symptoms of pams include pain associated with continuous oral ulceration and resistance to pharmacological treatment. the present study reports the case of a 42-year - old female patient who was admitted with an 8-month history of erosive skin lesions within the trunk region, oral mucosa and vaginal mucosa. the patient was diagnosed with pams based on computed tomography scans and histological analyses of the lesions. the lymphoid hyperplasia in the retroperitoneum and lesions in the vaginal mucosa and trunk area were improved following pharmacological treatment and resection of the lymph node showing hyperplasia. however, the oral lesion was treated with intraluminal brachytherapy due to its resistance to long - term pharmacological treatment. the majority of the lesions were improved following treatment, in the absence of any severe side effects. in addition, neither worsening nor progression of the oral lesion was observed during the 4-year follow - up period. |
the impact of land use practices in esthetically - managed landscapes of the united states was summarized in a us environmental protection agency report, which noted : the widespread replacement of millions of acres of native vegetation with primarily non - native ornamental plants in managed landscapes is a growing problem for the organisms that depend on native plants for food, shelter, and places to rear their young;many studies have documented the negative effect that non - native plants can have on the abundance and diversity of insect herbivores;if ornamental plants can not serve as food for the same number and diversity of herbivores, the energy available for food webs decreases. the widespread replacement of millions of acres of native vegetation with primarily non - native ornamental plants in managed landscapes is a growing problem for the organisms that depend on native plants for food, shelter, and places to rear their young ; many studies have documented the negative effect that non - native plants can have on the abundance and diversity of insect herbivores ; if ornamental plants can not serve as food for the same number and diversity of herbivores, the energy available for food webs decreases. non - native or exotic plants can be defined as plant species that evolved someplace other than where they have been introduced. native plants, in contrast, share an evolutionary history with regional insects and other organisms. the observations of erlich and raven, with further modification, have led to an understanding of plant and insect co - evolution in which the adaptation of insects to plant defenses plays an important role. landscaping primarily with exotic plant species would be expected to be detrimental to insect herbivores that have adapted to native plant hosts and recent studies support this hypothesis. changes caused by exotic plants to the abundance and diversity of insects, and the birds that consume them, are discussed in the following section. the spread of invasive exotic plants, however, has been linked to a decline in the diversity of reptiles, spiders and mycorrhizal fungi. invasive exotic plants can affect native species through food - web dynamics or by less predictable mechanisms. to conserve biodiversity in urbanized areas, the increased use of native plant species in designed landscapes has been advocated by conservation groups and us federal and state agencies. this includes ngos such as the national wildlife federation, the audubon society and the native conservancy and government agencies such as the epa, the usda and the dot. there are over 32 million hectares of esthetically managed land in the united states, including urban and suburban landscapes and highway corridors. the developed area of the united states is projected to increase by nearly 80% in the first quarter of this century, adding millions more hectares of landscaping. the amount of land managed for esthetics is similar in scale to the land in corn cultivation (37 m ha in 2014) or in all us national and state parks (40 m ha). increasing native plant landscaping to 30%, for example, of the managed landscape would require a significant expansion of what is now a niche market. a major challenge to scaling up the use of native species in landscaping is in providing ornamental plants that are both ecologically functional and economically viable. similar to environmental restoration with native plants, attention should be paid to genetic diversity and local adaptability. unlike environmental restoration, though, native plants must be introduced into managed landscapes through a market system in which landscaping plants that meet consumer demand are delivered profitably by the horticulture industry. ecological function, cost - effective production and ornamental traits are qualities desired in native landscaping material that are potentially conflicting. the scale - up of landscaping plants that can support biodiversity would benefit from interdisciplinary research in genetics, ecology, and economics. the prevalence of exotic plants in a landscape may alter the number of ecologically important insects, as well as the composition of insect populations. in the northeastern united states, a comparison of suburban yards landscaped with native or exotic plants found that exotic plants reduced the abundance and diversity of lepidopteran insects. a study of urban vegetation in singapore determined that lepidopteran diversity correlated directly with the percentage of native plants. field trials confirmed the negative impact of exotic plants on specialist and generalist lepidopteran numbers and found a similar effect on insects of other taxa and feeding guilds. a study in which old - field plant communities were manipulated found that insect species richness was reduced on exotic plants, although insect abundance was similar on native and exotic plants. while the effects of exotic plants on insects may differ between studies, the geographic origin of introduced plants this is relevant to ornamental plants since many exotic species that have become invasive in the united states were introduced for landscaping purposes. field studies have found that invasive exotic plants can shift the insect population from large, specialist insects (e.g., lepidoptera) to small, generalist insects (e.g. dipteran midges), significantly reducing insect biomass. some invasive exotic plants, such as honeysuckle (lonicera maackii), may increase insect species richness and numbers by creating a more complex vegetative structure. separately, honeysuckle was found to cause a decrease in caterpillar abundance that was moderated when there was higher tree diversity and more intact forest cover. habitat fragmentation and homogeneity are common features of urban landscapes and they may mediate the effects of exotic plants on insect herbivores. studies have indicated that several life - history attributes of insects may be altered due to exotic plants. insect size, egg load and attraction to mates were reduced, and developmental period was longer on exotic species. native pollinators may visit abundant exotic plants more frequently, thus lowering pollination of native plants. lower feeding damage on exotic than on native plants has been reported, perhaps due to lower nutrient quality. an exotic plant with foliage that is toxic to caterpillars can be a dead - end host for a native butterfly species. this may allow exotic plant species to escape herbivory, and persist and spread on the landscape. overall, while exotic plants can provide certain ecological services, their ability to support native insects is limited in many ways. changes in insect quality and quantity can affect higher trophic levels through food web interactions. as argued by tallamy, nearly all terrestrial birds in north america rear their young on insects, with food being a major limitation to breeding success. two studies on the ecological impacts of plant origin, discussed previously with regard to insects, also examined effects on bird populations. in suburban pennsylvania yards landscaped with exotic plants, a reduction in bird abundance and diversity correlated with the decrease in lepidopteran populations. both avian and lepidopteran species richness varied directly with the percentage of native shrubs and trees in urban vegetation of singapore. the presence of native landscaping plants was found to have a positive effect on native bird abundance and diversity in urbanized areas across different environments. lepidoptera and birds have served as surrogate taxa in biodiversity studies because they are environmentally sensitive and relatively easy to measure. the corresponding changes in native lepidopteran and avian populations could be causative (fewer caterpillars make birds forage elsewhere) or correlative (exotic plants negatively affect butterflies and birds independently). a niche market has developed in the united states for native ornamental plants that provide wildlife support, as well as local adaptability. the single largest venture directed at this market is the american beauties program, a partnership between the national wildlife federation and two wholesale nurseries. the program distributes native landscaping plants to independent garden centers and landscapers in the northeastern united states. over 350 plant species are provided through this system, including native perennials, grasses, vines, trees and shrubs. in addition, armitage describes more than 400 native ornamental plants, primarily herbaceous species, that can be ordered directly from local nurseries in the united states. native plants for ornamental horticulture generally come from breeding, genotype selection or open - pollinated seed. within the american beauties inventory, approximately 35% of the plants are named cultivars and 65% are propagated genotypes of native species. north american plant species have been selected or bred for flowering, architecture, foliage and disease - resistance traits, although not to extent of exotic ornamentals. for example, native plant genotypes have been selected that exhibit early flowering (e.g., potentilla fruticosa flame). from an open - pollination breeding program, an oak leaf hydrangea genotype (hydrangea quercifolia snow queen) was identified that had low, compact form and abundant, showy blooms. sugar lace) with a modified branching pattern and powdery mildew resistance. through the interspecific hybridization of baptisia australis and b. bracteata, a false indigo genotype (baptisia bicolor most breeding and selection of north american plant species for ornamental traits has been conducted by private sector programs, including some in europe. native perennial plants for mid - western us landscapes have been bred at the chicago botanic garden using wild collected germplasm and cultivated plants from nursery sources. genera targeted in this program include asclepias (milkweed), baptisia (false indigo), echinacea (purple coneflower), liatris (blazing star) and penstemon (beardtongue). public breeding programs at us universities have developed horticultural traits in native plants of genera such as aronia (chokeberry), cercis (redbud), cornus (dogwood), penstemon and vaccinium (blueberry). many native landscaping plants available in the horticultural trade are vegetatively - propagated genotypes that have been selected or bred for ornamental characteristics. there is little information about whether native ornamental cultivars can provide the same ecological services as their parent species. one study compared two cultivars of ninebark (physocarpus opulifolius) and a local genotype (minnesota, usa) as hosts for the ninebark beetle (calligrapha spiraeae), a specialist herbivore. controlled - feeding experiments found significant differences in feeding preference between the local ninebark and the purple - leaved cultivar monlo, but not between the local ninebark and the yellow - leaved cultivar dart 's gold. leaves of dart 's gold and the local ninebark had at least fourfold less anthocyanins, a potential feeding deterrent, than the purple leaves of monlo. these results indicate that while native cultivars can support specialist insects, this may vary with the ornamental trait. field studies comparing the effect of native plant cultivars and ecotypes on insect populations are being conducted at two botanical gardens in the united states, the mt cuba center (delaware) and the state botanical garden of georgia (james affolter, pers. a field study is in progress that compares the impact of native and exotic ornamentals on predatory insects (e.g., parasitic hymenoptera). the range over which a native cultivar can provide an ecological service, such as food - web support, has not been investigated. scaling up the use of native plants the genetic diversity needed in native ornamentals to provide ecological services across a regional market needs to be examined. there are similar concerns regarding the diversity needed for native plant adaptability in ecological restoration projects. for ecological restoration, environmentally defined regions can be used to estimate where native plant material is suitable. epa ecoregions, for example, are geographic areas with similar geology, climate, vegetation, soils and hydrology. ecoregions i through iv are hierarchical classifications of land areas, with environmental similarity increasing at each level. level iii ecoregions have been used to estimate seed transfer zones, i.e., a region within which plant material can be distributed with little risk of maladaptation. figure 1 shows, for example, a level iii ecoregion that encompasses the appalachian piedmont of the united states. miller and colleagues found that a level iii ecoregion could serve as a seed transfer zone for four of the five native plant species that they examined. climatic data alone or in combination with ecological data have also been used to predict regions suitable for native plant material. for ornamentals, the regional limits of cultivar adaptability are already considered by many consumers and retailers through usda hardiness zone ratings. like native plant genotypes for restoration, native cultivars for landscaping could potentially be adaptable throughout a level iii ecoregion or other environmentally - defined region. research is needed on food - web support by native cultivars on a regional basis. level iii ecoregions may also be of sufficient size to be markets for native landscaping plants. the appalachian piedmont ecoregion, for example, contains several expanding metropolitan areas in the southeast united states, including atlanta, charlotte and raleigh - durham (figure 1). native plants make up approximately 13% of the total sales of the nursery industry in the united states. to understand the issues limiting the use of native plants in landscaping, surveys have been conducted of nursery retailers, landscape architects and master gardeners. three general factors that were consistently considered important in survey responses were (i) the availability of native plants ; (ii) consumer preferences ; and (iii) knowledge about native plants. with regard to native plant education, botanical gardens and citizen science can be effective vehicles for increasing public awareness of the cultivation and ecological value of native plants. increasing the availability of native ornamentals would be accomplished most efficiently through existing supply chains. the major routes to market for ornamental plants in the united states, based on sales from nurseries, were through landscape firms (31%), garden centers (22%), re - wholesalers (21%) and mass merchandisers (9%). scaling up native ornamentals through established distribution procedures would most likely require propagated selections of a limited number of genotypes. an economic assessment is needed of the number of different genotypes of native ornamental species that can be delivered profitably by the horticulture industry for a regional market. an alternative or complement to mainstream supply chains would be the distribution of local ecotypes by smaller nurseries specializing in native plants. it is likely that both specialty and mainstream outlets will be needed to scale up the availability of native ornamentals to consumers. native landscaping plants need to meet consumer preferences regarding ornamental qualities and compete with exotic alternatives in the marketplace. native plants can often be more expensive than exotic plants, perhaps as a result of their small scale of production. the cost of native ornamentals, however, was identified in surveys as one of the least important factors limiting their adoption. interestingly, consumers were found to be willing to pay more for well - designed yards that included native plants instead of lawns. this was determined by a contingent choice survey in which consumers in michigan were presented with hypothetical options that varied in purchase and maintenance costs. complementing this approach, non - hypothetical auctions were conducted in minnesota where consumers bid on native and exotic ornamental plants. in experimental auctions, consumers were willing to pay a $ 0.35 premium for plants labeled as non - invasive and native. environmental qualities of native ornamentals could therefore be considered value - added traits that may be signaled to consumers via information and labeling strategies. half of consumers in the same study purchased ornamentals based on plant traits, not plant origin or invasive potential. traits of ornamental plants that are popular with consumers include extended flowering, novel floral morphology (e.g., double flowers), compactness, and disease - resistance. endless summer hydrangeas are examples of top - selling exotic cultivars in the united states that have one or more of these characteristics. some of the native ornamental species that are currently available have been selected for traits such as double flowers, reduced stature and foliage color. further development of native ornamentals with flowering, architecture or drought - tolerance traits may be a strategy to increase native plant use among a large segment of the consumer market. molecular breeding could be used to accelerate the development of native plants species with ornamental traits. molecular markers have been used with ornamental plants primarily to identify cultivars, conduct pedigree analysis and study germplasm variability. markers have also been developed in a few cases for breeding traits such as disease resistance in roses and flowering time in chrysanthemum. for native ornamental plants, marker - assisted selection has the potential to accelerate cultivar development, particularly for woody species. woody plants are an important target because (i) they have the highest wholesale value in the us ornamental plant market ; and (ii) the hosts for the greatest diversity of lepidopteran species are native woody species. molecular markers have been generated for a limited number of ornamental species that are native to north america. this may be due in part to the current cost of marker development relative to the market size of a native species. amplified fragment length polymorphism (aflp) and simple sequence repeat (ssr) markers were developed to identify cultivars and lines of flowering dogwood (cornus florida). the genetic diversity and population structure of c. florida were assessed using ssr markers. a genetic linkage map of c. florida was constructed and potential quantitative trait loci for red foliage were identified. ssr markers were examined in redbud (cercis canadensis) in order to determine pedigree and the applicability of molecular markers to breeding. aflp analysis was used to determine the genetic diversity and degree of introgression among several deciduous azalea species (rhododendron sp.). in another woody ornamental, chokecherry (prunus virginiana), a major quantitative trait loci for disease resistance was identified using aflp and ssr markers. saturated linkage maps and a genome sequence database have been developed for other prunus species and other rosaceae members that could be used in ornamental trait development. among herbaceous north american species, genetic diversity has been examined in coreopsis leavenworthii with aflp markers and in helianthus annuus with both anonymous ssrs and gene - specific est - ssrs. to take advantage of the genetic variation present in native plant populations, reverse genetic approaches strategies such as ecotilling or brda (breeding with rare defective alleles) use genetic screening to identify defective alleles of genes known to play major roles in the control of qualitative traits. allelic variation has been detected in coding sequences by several screening methods, including dna nuclease assays, high - resolution melting analysis and next - generation sequencing. the genetic screening of 100800 accessions from germplasm collections has identified defective variants of genes leading to targeted traits. examples include improved lignin quality in black poplar (populus nigra), virus resistance in pepper (capsicum sp.) and improved oil quality in rapeseed (brassica napus). there are several ornamental traits controlled by recessive genes that could be targeted in native plants. many of the novel flowering and architecture phenotypes that have been obtained by traditional breeding are due to defective alleles of single genes. for example, floral timing has been modified in several plant species by selecting for natural terminal flower1 (tfl1) mutations. tfl1 represses the transition from vegetative to reproductive growth in the shoot meristem. in perennial plants such as rose (rosa hybrida) and woodland strawberry (fragaria vesca), tfl1 mutations cause continuous flowering. in annual crop plants, such as tomato and soybean, determinate varieties were developed through selection for defective alleles of tfl1 orthologs. floral structure has been modified by selecting for mutations of agamous (ag), a transcription factor that regulates floral organ identity. a consequence of the loss of ag function is the homeotic conversion of stamens to petals to produce double flowers. natural mutations of ag orthologs are responsible for double flowers in varieties of ornamental cherry, morning glory and anemone. novel architectural traits, such as reduced stature and increased branching, have been obtained from the loss of function of particular genes. plant stature has been altered by selection for mutations in genes for gibberellic acid biosynthesis or signaling. natural and induced mutations in gibberellin 20-oxidase (ga20ox) of rice led to semi - dwarf varieties that played a critical role in the green revolution. semi - dwarf phenotypes have been induced in crop species such as apple and tomato through the knockdown of ga20ox expression and in hybrid poplar through the overexpression of ga insensitive (gai). plant branching patterns can be altered by changes in the expression of branched1 (brc1) or teosinte branched1 (tb1), two closely related transcription factors that repress axillary bud growth. reduced branching due to tb1 overexpression was critical to maize domestication ; conversely, the knockout of brc1 expression in arabidopsis and tomato causes increased branching. similar to tfl1, ag and ga20ox mutations in different plant species, the loss of function of brc1 resulted in the same phenotype in diverse plants. the discovery of natural mutations in candidate genes like these could lead to ornamental traits in native plant species. research in model species may be useful for the identification of other genes that play major roles in ornamental traits. for example, peach (prunus persica) is a model rosaceae species that could be used to study flowering genes in woody plants. peach has complete, autogamous flowers that are produced after a relatively short juvenile period (23 years) and a small, sequenced, diploid genome (227 mb). although gene transfer in peach is not practical, flowers can be fertilized with mutagenized pollen to generate m1 mutants ; non - chimeric m1 populations would allow early screening for mutations in targeted genes by tilling or next - generation sequencing. in addition to the known flowering genes that have been characterized in peach, floral morphology traits have been identified. peach flowers can be large and showy or small with curved petals (non - showy), with the showy flower phenotype (sh / sh) segregating as a recessive, monogenic trait. knowledge of the peach sh sequence and function could potentially be applied through ecotilling to obtain novel floral morphology in native ornamental prunus species (e.g., p. virginiana, p. serotina, p. americana). other strategies that could be used to develop ornamental traits in native plants include interspecific hybridization and polyploidization. interspecific hybridization can occur naturally, an example being hybrid azaleas produced by the north american species rhododendron prunifolium and r. arborescens. spatial, temporal, or biological barriers, however, usually prevent interspecific hybridization. pre- and post - fertilization barriers can be overcome by a range of methods, including pollination techniques, ovule and embryo rescue, and polyploidization. controlled crosses with stored pollen were used to hybridize the north american natives franklinia alatamaha and gordonia lasianthus for woody ornamental development. polyploidization has been induced in order to restore fertility in interspecific crosses, e.g., native azalea hybrids. ornamental traits have also been developed directly through polyploidization, such as increased flower size in the north american species phlox subulata. genetic transformation or genome editing may be a more direct means to obtain certain traits, but such approaches are rarely economically viable for ornamental plants. during ornamental trait development in native plant species, the trait and the source material a purple foliage trait, for example, could reduce food - web support. for environmental restoration, local provenances are usually the best adapted material, although exceptions to the local is best guideline may increase with climate change. the success of molecular markers for detecting the adaptive potential of native plant species has been mixed. for example, aflp markers did not to reveal population differentiation related to local adaptation for three herbaceous perennial species native to minnesota, whereas aflp markers could delineate local seed collection zones for a native australian tree species. next - generation sequencing technology is being examined as a means to measure adaptive variation for restoration ecology, as well as the effect of outbreeding on local gene pools. whether there is sufficient regional genetic diversity in native species for breeding new traits needs to be determined. ideally, ecological services provided by new ornamental cultivars of native species (e.g., native herbivore support) would be examined at a regional level. the prevalence of exotic plants in a landscape may alter the number of ecologically important insects, as well as the composition of insect populations. in the northeastern united states, a comparison of suburban yards landscaped with native or exotic plants found that exotic plants reduced the abundance and diversity of lepidopteran insects. a study of urban vegetation in singapore determined that lepidopteran diversity correlated directly with the percentage of native plants. field trials confirmed the negative impact of exotic plants on specialist and generalist lepidopteran numbers and found a similar effect on insects of other taxa and feeding guilds. a study in which old - field plant communities were manipulated found that insect species richness was reduced on exotic plants, although insect abundance was similar on native and exotic plants. while the effects of exotic plants on insects may differ between studies, the geographic origin of introduced plants this is relevant to ornamental plants since many exotic species that have become invasive in the united states were introduced for landscaping purposes. field studies have found that invasive exotic plants can shift the insect population from large, specialist insects (e.g., lepidoptera) to small, generalist insects (e.g. dipteran midges), significantly reducing insect biomass. some invasive exotic plants, such as honeysuckle (lonicera maackii), may increase insect species richness and numbers by creating a more complex vegetative structure. separately, honeysuckle was found to cause a decrease in caterpillar abundance that was moderated when there was higher tree diversity and more intact forest cover. habitat fragmentation and homogeneity are common features of urban landscapes and they may mediate the effects of exotic plants on insect herbivores. studies have indicated that several life - history attributes of insects may be altered due to exotic plants. insect size, egg load and attraction to mates were reduced, and developmental period was longer on exotic species. native pollinators may visit abundant exotic plants more frequently, thus lowering pollination of native plants. lower feeding damage on exotic than on native plants has been reported, perhaps due to lower nutrient quality. an exotic plant with foliage that is toxic to caterpillars can be a dead - end host for a native butterfly species. this may allow exotic plant species to escape herbivory, and persist and spread on the landscape. overall, while exotic plants can provide certain ecological services, their ability to support native insects is limited in many ways. changes in insect quality and quantity can affect higher trophic levels through food web interactions. as argued by tallamy, nearly all terrestrial birds in north america rear their young on insects, with food being a major limitation to breeding success. two studies on the ecological impacts of plant origin, discussed previously with regard to insects, also examined effects on bird populations. in suburban pennsylvania yards landscaped with exotic plants, a reduction in bird abundance and diversity correlated with the decrease in lepidopteran populations. both avian and lepidopteran species richness varied directly with the percentage of native shrubs and trees in urban vegetation of singapore. the presence of native landscaping plants was found to have a positive effect on native bird abundance and diversity in urbanized areas across different environments. lepidoptera and birds have served as surrogate taxa in biodiversity studies because they are environmentally sensitive and relatively easy to measure. the corresponding changes in native lepidopteran and avian populations could be causative (fewer caterpillars make birds forage elsewhere) or correlative (exotic plants negatively affect butterflies and birds independently). a niche market has developed in the united states for native ornamental plants that provide wildlife support, as well as local adaptability. the single largest venture directed at this market is the american beauties program, a partnership between the national wildlife federation and two wholesale nurseries. the program distributes native landscaping plants to independent garden centers and landscapers in the northeastern united states. over 350 plant species are provided through this system, including native perennials, grasses, vines, trees and shrubs. in addition, armitage describes more than 400 native ornamental plants, primarily herbaceous species, that can be ordered directly from local nurseries in the united states. native plants for ornamental horticulture generally come from breeding, genotype selection or open - pollinated seed. within the american beauties inventory, approximately 35% of the plants are named cultivars and 65% are propagated genotypes of native species. north american plant species have been selected or bred for flowering, architecture, foliage and disease - resistance traits, although not to extent of exotic ornamentals. for example, native plant genotypes have been selected that exhibit early flowering (e.g., potentilla fruticosa km01) or double flowers (e.g., cercis canadensis flame). from an open - pollination breeding program, an oak leaf hydrangea genotype (hydrangea quercifolia snow queen) was identified that had low, compact form and abundant, showy blooms. sugar lace) with a modified branching pattern and powdery mildew resistance. through the interspecific hybridization of baptisia australis and b. bracteata, a false indigo genotype (baptisia bicolor most breeding and selection of north american plant species for ornamental traits has been conducted by private sector programs, including some in europe. native perennial plants for mid - western us landscapes have been bred at the chicago botanic garden using wild collected germplasm and cultivated plants from nursery sources. genera targeted in this program include asclepias (milkweed), baptisia (false indigo), echinacea (purple coneflower), liatris (blazing star) and penstemon (beardtongue). public breeding programs at us universities have developed horticultural traits in native plants of genera such as aronia (chokeberry), cercis (redbud), cornus (dogwood), penstemon and vaccinium (blueberry). many native landscaping plants available in the horticultural trade are vegetatively - propagated genotypes that have been selected or bred for ornamental characteristics. there is little information about whether native ornamental cultivars can provide the same ecological services as their parent species. one study compared two cultivars of ninebark (physocarpus opulifolius) and a local genotype (minnesota, usa) as hosts for the ninebark beetle (calligrapha spiraeae), a specialist herbivore. controlled - feeding experiments found significant differences in feeding preference between the local ninebark and the purple - leaved cultivar monlo, but not between the local ninebark and the yellow - leaved cultivar dart 's gold. leaves of dart 's gold and the local ninebark had at least fourfold less anthocyanins, a potential feeding deterrent, than the purple leaves of these results indicate that while native cultivars can support specialist insects, this may vary with the ornamental trait. field studies comparing the effect of native plant cultivars and ecotypes on insect populations are being conducted at two botanical gardens in the united states, the mt cuba center (delaware) and the state botanical garden of georgia (james affolter, pers. a field study is in progress that compares the impact of native and exotic ornamentals on predatory insects (e.g., parasitic hymenoptera). the range over which a native cultivar can provide an ecological service, such as food - web support, has not been investigated. scaling up the use of native plants the genetic diversity needed in native ornamentals to provide ecological services across a regional market needs to be examined. there are similar concerns regarding the diversity needed for native plant adaptability in ecological restoration projects. for ecological restoration, environmentally defined regions can be used to estimate where native plant material is suitable. epa ecoregions, for example, are geographic areas with similar geology, climate, vegetation, soils and hydrology. ecoregions i through iv are hierarchical classifications of land areas, with environmental similarity increasing at each level. level iii ecoregions have been used to estimate seed transfer zones, i.e., a region within which plant material can be distributed with little risk of maladaptation. figure 1 shows, for example, a level iii ecoregion that encompasses the appalachian piedmont of the united states. miller and colleagues found that a level iii ecoregion could serve as a seed transfer zone for four of the five native plant species that they examined. climatic data alone or in combination with ecological data have also been used to predict regions suitable for native plant material. for ornamentals, the regional limits of cultivar adaptability are already considered by many consumers and retailers through usda hardiness zone ratings. like native plant genotypes for restoration, native cultivars for landscaping could potentially be adaptable throughout a level iii ecoregion or other environmentally - defined region. research is needed on food - web support by native cultivars on a regional basis. level iii ecoregions may also be of sufficient size to be markets for native landscaping plants. the appalachian piedmont ecoregion, for example, contains several expanding metropolitan areas in the southeast united states, including atlanta, charlotte and raleigh - durham (figure 1). native plants make up approximately 13% of the total sales of the nursery industry in the united states. to understand the issues limiting the use of native plants in landscaping, surveys have been conducted of nursery retailers, landscape architects and master gardeners. three general factors that were consistently considered important in survey responses were (i) the availability of native plants ; (ii) consumer preferences ; and (iii) knowledge about native plants. with regard to native plant education, botanical gardens and citizen science can be effective vehicles for increasing public awareness of the cultivation and ecological value of native plants. increasing the availability of native ornamentals would be accomplished most efficiently through existing supply chains. the major routes to market for ornamental plants in the united states, based on sales from nurseries, were through landscape firms (31%), garden centers (22%), re - wholesalers (21%) and mass merchandisers (9%). the plants distributed through these channels are primarily cultivars of exotic species. scaling up native ornamentals through established distribution procedures an economic assessment is needed of the number of different genotypes of native ornamental species that can be delivered profitably by the horticulture industry for a regional market. an alternative or complement to mainstream supply chains would be the distribution of local ecotypes by smaller nurseries specializing in native plants. it is likely that both specialty and mainstream outlets will be needed to scale up the availability of native ornamentals to consumers. native landscaping plants need to meet consumer preferences regarding ornamental qualities and compete with exotic alternatives in the marketplace. native plants can often be more expensive than exotic plants, perhaps as a result of their small scale of production. the cost of native ornamentals, however, was identified in surveys as one of the least important factors limiting their adoption. interestingly, consumers were found to be willing to pay more for well - designed yards that included native plants instead of lawns. this was determined by a contingent choice survey in which consumers in michigan were presented with hypothetical options that varied in purchase and maintenance costs. complementing this approach, non - hypothetical auctions were conducted in minnesota where consumers bid on native and exotic ornamental plants. in experimental auctions, consumers were willing to pay a $ 0.35 premium for plants labeled as non - invasive and native. purchasing patterns indicated that approximately 50% of consumers considered that plants labeled as native or environmental qualities of native ornamentals could therefore be considered value - added traits that may be signaled to consumers via information and labeling strategies. half of consumers in the same study purchased ornamentals based on plant traits, not plant origin or invasive potential. traits of ornamental plants that are popular with consumers include extended flowering, novel floral morphology (e.g., double flowers), compactness, and disease - resistance. endless summer hydrangeas are examples of top - selling exotic cultivars in the united states that have one or more of these characteristics. some of the native ornamental species that are currently available have been selected for traits such as double flowers, reduced stature and foliage color. further development of native ornamentals with flowering, architecture or drought - tolerance traits may be a strategy to increase native plant use among a large segment of the consumer market. molecular breeding could be used to accelerate the development of native plants species with ornamental traits. molecular markers have been used with ornamental plants primarily to identify cultivars, conduct pedigree analysis and study germplasm variability. markers have also been developed in a few cases for breeding traits such as disease resistance in roses and flowering time in chrysanthemum. for native ornamental plants, marker - assisted selection has the potential to accelerate cultivar development, particularly for woody species. woody plants are an important target because (i) they have the highest wholesale value in the us ornamental plant market ; and (ii) the hosts for the greatest diversity of lepidopteran species are native woody species. molecular markers have been generated for a limited number of ornamental species that are native to north america. this may be due in part to the current cost of marker development relative to the market size of a native species. amplified fragment length polymorphism (aflp) and simple sequence repeat (ssr) markers were developed to identify cultivars and lines of flowering dogwood (cornus florida). the genetic diversity and population structure of c. florida were assessed using ssr markers. a genetic linkage map of c. florida was constructed and potential quantitative trait loci for red foliage were identified. ssr markers were examined in redbud (cercis canadensis) in order to determine pedigree and the applicability of molecular markers to breeding. aflp analysis was used to determine the genetic diversity and degree of introgression among several deciduous azalea species (rhododendron sp.). in another woody ornamental, chokecherry (prunus virginiana), a major quantitative trait loci for disease resistance was identified using aflp and ssr markers. saturated linkage maps and a genome sequence database have been developed for other prunus species and other rosaceae members that could be used in ornamental trait development. among herbaceous north american species, genetic diversity has been examined in coreopsis leavenworthii with aflp markers and in helianthus annuus with both anonymous ssrs and gene - specific est - ssrs. to take advantage of the genetic variation present in native plant populations, reverse genetic approaches strategies such as ecotilling or brda (breeding with rare defective alleles) use genetic screening to identify defective alleles of genes known to play major roles in the control of qualitative traits. allelic variation has been detected in coding sequences by several screening methods, including dna nuclease assays, high - resolution melting analysis and next - generation sequencing. the genetic screening of 100800 accessions from germplasm collections has identified defective variants of genes leading to targeted traits. examples include improved lignin quality in black poplar (populus nigra), virus resistance in pepper (capsicum sp.) and improved oil quality in rapeseed (brassica napus). there are several ornamental traits controlled by recessive genes that could be targeted in native plants. many of the novel flowering and architecture phenotypes that have been obtained by traditional breeding are due to defective alleles of single genes. for example, floral timing has been modified in several plant species by selecting for natural terminal flower1 (tfl1) mutations. tfl1 represses the transition from vegetative to reproductive growth in the shoot meristem. in perennial plants such as rose (rosa hybrida) and woodland strawberry (fragaria vesca), tfl1 mutations cause continuous flowering. in annual crop plants, such as tomato and soybean, determinate varieties were developed through selection for defective alleles of tfl1 orthologs. floral structure has been modified by selecting for mutations of agamous (ag), a transcription factor that regulates floral organ identity. a consequence of the loss of ag function is the homeotic conversion of stamens to petals to produce double flowers. natural mutations of ag orthologs are responsible for double flowers in varieties of ornamental cherry, morning glory and anemone. novel architectural traits, such as reduced stature and increased branching, have been obtained from the loss of function of particular genes. plant stature has been altered by selection for mutations in genes for gibberellic acid biosynthesis or signaling. natural and induced mutations in gibberellin 20-oxidase (ga20ox) of rice led to semi - dwarf varieties that played a critical role in the green revolution. semi - dwarf phenotypes have been induced in crop species such as apple and tomato through the knockdown of ga20ox expression and in hybrid poplar through the overexpression of ga insensitive (gai). plant branching patterns can be altered by changes in the expression of branched1 (brc1) or teosinte branched1 (tb1), two closely related transcription factors that repress axillary bud growth. reduced branching due to tb1 overexpression was critical to maize domestication ; conversely, the knockout of brc1 expression in arabidopsis and tomato causes increased branching. similar to tfl1, ag and ga20ox mutations in different plant species, the loss of function of brc1 resulted in the same phenotype in diverse plants. the discovery of natural mutations in candidate genes like these could lead to ornamental traits in native plant species. research in model species may be useful for the identification of other genes that play major roles in ornamental traits. for example, peach (prunus persica) is a model rosaceae species that could be used to study flowering genes in woody plants. peach has complete, autogamous flowers that are produced after a relatively short juvenile period (23 years) and a small, sequenced, diploid genome (227 mb). although gene transfer in peach is not practical, flowers can be fertilized with mutagenized pollen to generate m1 mutants ; non - chimeric m1 populations would allow early screening for mutations in targeted genes by tilling or next - generation sequencing. in addition to the known flowering genes that have been characterized in peach, floral morphology traits have been identified. peach flowers can be large and showy or small with curved petals (non - showy), with the showy flower phenotype (sh / sh) segregating as a recessive, monogenic trait. knowledge of the peach sh sequence and function could potentially be applied through ecotilling to obtain novel floral morphology in native ornamental prunus species (e.g., p. virginiana, p. serotina, p. americana). other strategies that could be used to develop ornamental traits in native plants include interspecific hybridization and polyploidization. interspecific hybridization can occur naturally, an example being hybrid azaleas produced by the north american species rhododendron prunifolium and r. arborescens.. pre- and post - fertilization barriers can be overcome by a range of methods, including pollination techniques, ovule and embryo rescue, and polyploidization. controlled crosses with stored pollen were used to hybridize the north american natives franklinia alatamaha and gordonia lasianthus for woody ornamental development. polyploidization has been induced in order to restore fertility in interspecific crosses, e.g., native azalea hybrids. ornamental traits have also been developed directly through polyploidization, such as increased flower size in the north american species phlox subulata. genetic transformation or genome editing may be a more direct means to obtain certain traits, but such approaches are rarely economically viable for ornamental plants. during ornamental trait development in native plant species, the trait and the source material should be chosen to maintain ecological and adaptive functions. a purple foliage trait, for example, could reduce food - web support. for environmental restoration, local provenances are usually the best adapted material, although exceptions to the local is best guideline may increase with climate change. the success of molecular markers for detecting the adaptive potential of native plant species has been mixed. for example, aflp markers did not to reveal population differentiation related to local adaptation for three herbaceous perennial species native to minnesota, whereas aflp markers could delineate local seed collection zones for a native australian tree species. next - generation sequencing technology is being examined as a means to measure adaptive variation for restoration ecology, as well as the effect of outbreeding on local gene pools. whether there is sufficient regional genetic diversity in native species for breeding new traits needs to be determined. ideally, ecological services provided by new ornamental cultivars of native species (e.g., native herbivore support) would be examined at a regional level. it has been argued that the origin of a plant species has no bearing on whether it poses an ecological risk, although this is not a conclusion shared by many conservation biologists. exotic plants have a complex effect on biodiversity in urban areas. because new species are introduced into urban landscapes more rapidly than native species disappear the reduction of native shrub and tree cover, however, can alter the composition of native populations ; ground - foraging bird species, for example, are favored over birds that are canopy foragers. consequently, while diversity may remain high within a locality (-diversity), the diversity between localities (-diversity) is reduced. the result of this trend is biotic homogenization. to maintain native biodiversity in urban landscapes, the cultivation of native plant species has been recommended. the extent to which native species need to be incorporated in esthetically managed landscapes to provide ecological services small - scale additions of native ornamental plants in new york city community gardens did not increase beneficial insect richness. in contrast, landscaping with native shrubs and ground cover was found to increase the abundance and diversity of butterflies and birds in residential yards in pennsylvania. suburbs of canberra had significantly higher bird species richness when native trees made up more than 30% of the streetscape vegetation. this was assumed to be due to the increased foraging resources provided by native trees. to manage biodiversity in urban environments, residential landscapes should be considered as patches of interconnected habitat that can link other green spaces (e.g., parks, remnant forests). a proposal has been made to replace half the landscaping devoted to grass lawn in the united states with native plants, which would be equivalent to about 25% of the esthetically managed landscape. to scale up native plants in landscaping to the 30% range will require that current constraints to their use be addressed. stakeholder surveys have found that the availability of native plants is a major limitation to increasing their use in landscaping. if native ornamentals were made more available through mainstream supply chains, it would likely be as a few selected genotypes of each species. this raises several interrelated questions, such as : what is the genetic diversity needed in a native plant species to provide ecological services regionally ? what is the number of genotypes that can be provided profitably for regional markets ? ecological objectives, including improved adaptation and sustainability, are receiving greater consideration in plant breeding. the development of native plants with ornamental traits could be accelerated using molecular breeding approaches, although the current market size of native landscaping plants may be insufficient to justify their cost. however, as ornamental shrubs and trees alone have an annual wholesale value of approximately $ 3 billion in the united states, molecular breeding would be feasible if native species made up a larger part of that market. tools from restoration ecology can be applied to address the genetic appropriateness of native plant material. environmentally defined regions such as ecoregions or seed transfer zones may be useful as a platform for integrating economic, ecological and genetic research on native ornamental plants (figure 1). an interdisciplinary approach could help resolve competing demands for ecological function, cost - effective production and consumer appeal in native landscaping plants. | exotic plants dominate esthetically - managed landscapes, which cover 3040 million hectares in the united states alone. recent ecological studies have found that landscaping with exotic plant species can reduce biodiversity on multiple trophic levels. to support biodiversity in urbanized areas, the increased use of native landscaping plants has been advocated by conservation groups and us federal and state agencies. a major challenge to scaling up the use of native species in landscaping is providing ornamental plants that are both ecologically functional and economically viable. depending on ecological and economic constraints, accelerated breeding approaches could be applied to ornamental trait development in native plants. this review examines the impact of landscaping choices on biodiversity, the current status of breeding and selection of native ornamental plants, and the interdisciplinary research needed to scale up landscaping plants that can support native biodiversity. |
lower urinary tract infections (utis) are among the most frequently seen bacterial infection and account for considerable morbidity among sexually active women.(1) escherichia coli remains the predominant uropathogen, causing 80 - 90% of acute community acquired uncomplicated uti.(2) more than half of all women experience at least one episode of uti during their lifetime and about 25% of them have a second infection within six months.(3) there is no definitive explanation for why only some women get utis, and why recurrences tend to occur only in some subjects.(4) the repeated infections generally occur in the absence of anatomic abnormalities in the urinary tract. host genetic, behavioral and bacterial virulence characteristics all have been suspected to play a role in causation.(5) host factors that might influence the risk of uti include : sexual history, use of barrier contraceptives with spermicides, delayed postcoital micturition, etc.(56) behavioral modification is shown to reduce the risk of uti.(7) women with recurrent uti were found to have stronger family history of uti.(8) most of these studies have been conducted in developed countries where the socioeconomic status is higher and a lot of behavioral practices among women differ from those in developing countries. many of the risk factors described for the western population differ from the population in this region ; for example, the use of spermicides, hot tubs and tampons. we have asked all the participants about cranberry juice, none of the women replied in affirmative. the given reference is of our previous study, where we reported similar result.(9) therefore, the aim of the present study was to examine various host factors and identify independent risk factors that may be associated with an increased risk of first or recurrent cystitis in women in a developing country. this was a case - control study conducted in the department of microbiology at a tertiary care hospital in india between june 2011 and february 2013. patients attending gynecology outpatients department (opd) who gave written informed consent for participation, were recruited for the study. the case population was sexually active premenopausal women of 18 years of age with symptoms suggestive of acute cystitis (i.e., two or more of the following symptoms : dysuria, urine frequency six times per day, urgency, suprapubic pain, fever, hematuria / smoky urine, burning micturition and acute onset incontinence), who gave urine sample for examination. non - pregnant women with bacteriologically documented e. coli as sole uropathogen in quantities of at least 10 cfu / ml,(1) with no underlying comorbidity, apparent urological abnormality, or a urethral catheter in place were included for final analysis. control subjects were asymptomatic healthy women attending family planning clinics of the same hospital at the same time interval as cases. they came for copper - t insertion, tubal ligation, etc. and did not have any symptoms suggestive of cystitis or a past history of uti. controls were subjected to urine culture and, if sterile, they were included in the study. self - report of prior uti ever in the past was considered sufficient to exclude a potential control. a midstream urine sample from each case and control was collected and processed as described previously.(9) if the woman presenting with acute cystitis did not report any history of uti in the past, she was considered as first cystitis case ; if the woman experienced either three or more symptomatic uti episodes in the past year, or two such episodes in the last six months (including index episode), she was included in recurrent cystitis group.(3) this was based on documented proof of uti including previous urine culture reports. in the absence of a culture report, the demonstration of pyuria on urinalysis and two or more urinary symptoms, as well as complete and rapid resolution of urinary symptoms in response to antibiotic therapy, were taken as evidence of past uti.(5) data were collected from each participant through a structured face - to - face interview during the visit to the clinic and noted on a predesigned questionnaire, which was formed after consultation with a concerned gynecologist and was pilot tested for relevance. a separate area was provided in the gynecology opd to conduct these interviews, and it was ensured that no males were present in that area to help ease the atmosphere. the questionnaire was divided into seven main parts : socioeconomic status (education, employment and household income) ; demographic characteristics (age, marital status and parity) ; medical history (past history of utis, investigations reports, medication during previous uti, age at first uti, history of uti among first - degree female relatives, interval from last episode of uti, recent antibiotic use, stress incontinence, abnormal vaginal discharge and constipation) ; sexual history (age at first intercourse, frequency of sexual intercourse, new sex partner, anal sex, contraceptive use in past 12 months including exposure to spermicides, time interval between last sexual intercourse and current episode of uti) ; voiding pattern (postcoital voiding, delayed / postponed voiding) ; personal hygiene (wiping back to front after bowel movement, use of hot tub once or more per month, douching, use of sanitary napkin / cloth during menstrual cycle and reuse of cloth after washing) ; fluid consumption (water, tea / coffee intake per day and cranberry juice consumption). stress incontinence was assessed as by asking the patient if she experiences any involuntary leakage of urine on coughing / straining. women were taken into confidence and made comfortable so that they could talk freely on these sensitive topics. statistical analysis was carried out using statistical package for the social sciences (spss) version 16.0, ibm corporation. univariate logistic regression analysis was employed to find the risk of first and recurrent cystitis in comparison to healthy controls. the risk of recurrence in comparison to first cystitis was also assessed using univariate logistic regression. the factors found significant in all the three models were entered in the multiple logistic regression models by the enter method to find significant factors affecting the outcomes. the results are presented in odds ratios (ors) with its 95% confidence interval (ci). a total of 710 symptomatic premenopausal women were interviewed during the study period and 635 consented to participate. 222 of these women satisfying the inclusion criteria were included in final analysis (145 women as first cystitis and 77 women as recurrent cases). 311 apparently healthy women were interviewed for control subjects and 257 fitting the inclusion criteria were included in final analysis. the mean age of control population, first and recurrent cystitis cases was 30.5 6.33 years (range, 18 - 48 years), 30.31 7.91 years (range 18 - 50 years) and 33.2 6.94 years (range 20 - 50 years), respectively. cases and controls were similar with regard to socioeconomic status, marital status, etc.. demographic characteristics of study subjects in univariate analysis, when compared with control subjects, a significantly higher number of women with first and recurrent cystitis reported anal sex and abnormal vaginal discharge along with less intake of water. a twofold increase in risk of first episode of cystitis was found in women who used cloth during menstruation and the risk become fourfold when they reused it after washing (n = 79). all variables related to sexual history were significantly associated with first episode of cystitis [table 2 ]. in our study, contraceptive methods practiced, age at first uti and age at first intercourse were not found to be associated with increased risk of cystitis. postcoital voiding was the only variable which had a negative association (protective) with first episode of cystitis [table 2 ]. history of uti in a first - degree female relative, stress incontinence, constipation and wiping back to front had stronger association with recurrence in comparison to both, women with first cystitis and control subjects. risk of first and recurrent cystitis : univariate logistic regression analysis in the multivariate model, consumption of more than 250 ml tea / coffee per day increased the risk of first episode of cystitis about five times (or = 4.73, 95% ci = 2.67 - 8.38). other independent risk factors for first episode of cystitis included anal sex (or = 3.68, 95% ci = 1.59 - 8.52), consumption of less than 2 l water per day (or = 3.69, 95% ci = 2.06 - 6.59), abnormal vaginal discharge (or = 3.23, 95% ci = 1.85 - 5.62) and use of cloth during menstrual cycle (or = 2.36, 95% ci = 1.31 - 4.26) [table 3 ]. when women with recurrent cystitis were compared with control subjects, family history of uti was the strongest independent risk factor (or = 10.88, 95% ci = 2.41 - 49.07). other independent risk factors included constipation (or = 4.85, 95% ci = 1.97 - 11.92), tea consumption > 250 ml / day (or = 4.14, 95% ci = 1.95 - 8.80), wiping back to front, less than 2 l water consumption per day, abnormal vaginal discharge and stress incontinence [table 3 ]. the strongest independent risk factor for getting recurrence after first uti was history of uti in a first - degree female relative (or = 4.13, 95% ci = 1.64 - 10.40), followed by constipation (or = 3.40, 95% ci = 1.58 - 7.32) and stress incontinence (or= 1.88, 95% ci=1.02 - 3.47) [table 3 ]. the study was conducted to address some of the gaps in our understanding of risk factors for first and recurrent cystitis amongst sexually active women in developing countries. in the present study, majority of women attending the hospital came from rural and semi - urban areas and belonged to lower socio - economic strata with poor literacy rates. increased consumption of tea / coffee was found to be associated with an increase in uti among women, as reported earlier.(610) there was a 3.5 times increased risk of first episode of cystitis among those who have anal sex. this is because the female urethra is short, located fairly close to the anus and small amounts of fecal flora could be transferred to the urethra;(11) significant association of anal sex with acute uti and pyelonephritis has been reported.(1112) low water intake was an independent risk factor for uti ; consistent with other studies.(713) water diuresis serves to flush the urinary tract of infecting organisms and frequent voiding reduces bacterial multiplication in the bladder.(13) the presence of abnormal vaginal discharge indicating vaginal infection was significantly high in cystitis cases when compared with control subjects. vaginitis has been reported as a risk factor for uti.(14) in our study, the percentage of vaginal infection amongst both cases and controls though was higher than reported in literature from developed countries.(5) this may be because of poor personal hygiene in low socioeconomic strata in our study population. wiping back to front was an important behavioral risk factor for uti and so was the recent sexual intercourse (250 ml of tea consumption per day, presence of vaginal infection and wiping back to front. along with the latter three, history of uti in a first degree female relative, constipation and stress incontinence were additional independent risk factors for recurrent cystitis in comparison to healthy controls. this study shows that major risk factors for lower uti differ from those identified in the western world. since most of the women in our study belonged to rural and semi - urban background with low socioeconomic status, these findings can be applied to a larger population of india as well as other developing countries with similar demographic characteristics. we also found that several risk factors for initial infection although potentially modifiable were sufficient to also pose risk of recurrence. more such studies from developing countries are required to validate these findings and the formulation of appropriate preventive strategies. | background : the risk factors for urinary tract infections (utis) from developed countries are not applicable to women from developing world.objective:to analyze the behavioral practices and psychosocial aspects pertinent to women in our region and assess their association with acute first time or recurrent uti.materials and methods : sexually active premenopausal women with their first (145) and recurrent (77) cystitis with escherichia coli as cases and women with no prior history of uti as healthy controls (257) were enrolled at a tertiary care hospital in india, between june 2011 and february 2013. questionnaire - based data was collected from each participant through a structured face - to - face interview.results:using univariate and multivariate regression models, independent risk factors for the first episode of cystitis when compared with healthy controls were (presented in odds ratios [ors ] with its 95% confidence interval [ci ]) : anal sex (or = 3.68, 95% ci = 1.59 - 8.52), time interval between last sexual intercourse and current episode of uti was 250 ml of tea consumption per day (or = 4.73, 95% ci = 2.67 - 8.38), presence of vaginal infection (or = 3.23, 95% ci = 1.85 - 5.62) and wiping back to front (or = 2.52, 95% ci = 1.45 - 4.38). along with the latter three, history of uti in a first - degree female relative (or = 10.88, 95% ci = 2.41 - 49.07), constipation (or = 4.85, 95% ci = 1.97 - 11.92) and stress incontinence (or = 2.45, 95% ci = 1.18 - 5.06) were additional independent risk factors for recurrent cystitis in comparison to healthy controls.conclusion:most of the risk factors for initial infection are potentially modifiable but sufficient to also pose risk for recurrence. many of the findings reflect the cultural and ethnic practices in our country. |
a twenty one year old primi gravida at six months gestation presented with a history of rapidly enlarging lump in the left breast associated with pain. on examination, a mass approximately measuring 20 x 14 cm was present in the upper and lower quadrants of the left breast. the specimen received by the pathology laboratory measured 16 x 10 x 5cms and weighed 750 gm (fig.1). the enucleated specimen : the external surface was lobulated and the cut surface was nodular with focal white areas. haematoxylin and eosin stained four - micron sections showed a well circumscribed tumor composed of hyperplastic acini retaining the configuration of normal breast lobules (fig.2). lactating adenomas present as small, well circumscribed, freely mobile masses during pregnancy or lactation. benign breast tumors associated with pregnancy can be of different types. in a study of 37 cases of benign breast tumors associated with pregnancy by o hara, only eight cases were lactating adenomas.(1) the others were fibroadenomas with lactational changes and tubular adenomas. lactating adenoma is a rare tumor and there are differing views on its histogenesis. james considered lacating adenoma to be a pure and readily recognisable morphological form clearly distinguishable from tubular adenoma and fibroadenoma that is always related to current or recent pregnancy.(2) according to them, most tumors diagnosed as lactating adenomas are diagnosed during pregnancy and do not have lactational secretion. the secretory changes seen are similar to the physiological changes of pregnancy in the adjacent breast tissue. this is also supported by slavin, who in a study of 30 cases of nodular breast lesions of pregnancy, described 12 lesions that fitted with the description of lactating adenoma. according to slavin, lactating adenomas are nodules of physiologic lobular proliferation which become more prominent than the adjacent breast tissue and appear clinically to be a distinct mass and histologically resemble focal exaggerated physiological hyperplasia.(3) hertel however proposed that lactating adenomas arise in preexisting adenomas.(4) in a study by hertel, five of the seven postpartum patients with tubular adenomas, first observed the lump during pregnancy, leading to the authors conclusion that tubular adenomas and lactating adenomas are two ends of a spectrum, the latter with secretory changes associated with physiological states of pregnancy. both the views are given in the latest who fascicle on breast tumors, that is to say that a lacating adenoma is considered as a tubular type adenoma that may show extensive secretory changes in the epithelial cells during pregnancy and lactation.(5) it has also been suggested that such lesions represent focal accumulation of hyperplastic lobules. usually, lactating adenomas are slow growing tumors which are smaller than 5 cm in size and are well demarcated from the surrounding breast tissue.(6) in a series of 14 lactating adenomas by james, most of the tumors were 2.5 3.5 cm in size. they reported a giant breast mass which grew to a maximum size of 25 x 18cms.(7) the present case measured 16cms in diameter and qualifies for the second largest reported case of lactating adenoma. sonologically, lactating adenomas are oval, sharply circumscribed, solid hypoechoic mass which can have a prominent central tubular structure presumed to be a dilated duct.(8) lactating adenomas are characterised by glands with a tubuloalveolar architecture and florid secretory features. the histologic changes relate to the stage of pregnancy and approximate the changes in the adjacent breast. if removed during pregnancy, the secretory changes are much less pronounced than in the tumor removed postpartum (6) as was observed in the present case. the characteristic microscopic features of the tumors that come in the differential diagnosis is discussed by ohara, james and slavin.(1,2,3) tubular adenomas are characterised by uniform closely approximated tubular structures lined by epithelial and myoepithelial cells with little or no cytoplasmic vacuolisation. fibroadenoma with secretory hyperplasia should be distinguished from lactating adenoma ; the latter lacks the characteristic stroma in a fibroadenoma. rapid increase in size in a lactating adenoma can be due to infarction.(9) reeves have also described rapid increase in size in their report of giant lactating adenoma. (7) even though there was a history of pain and rapid growth, there was no evidence of infarction in the present case. huge size and rapid increase in size can lead to a mistaken clinical diagnosis of malignancy. enucleation is the recommended treatment for lactating adenomas as there is a low risk of recurrence. (7) bromocriptine can suppress lactation, the benefits of tumor shrinkage must be weighed against the cessation of lactation in a mother who is breast feeding. in summary we report a case of a lactating adenoma presenting as a giant breast mass. in a case of rapidly enlarging breast mass in a pregnant lady | lactating adenoma is one of the breast tumours associated with pregnancy. a case of lactating adenoma, unusual on account of its huge size, is presented. large size and history of rapid growth can lead to a mistaken diagnosis of malignancy. a review of the literature of this particular tumour with the different views on its histogenesis and the differential diagnoses are also discussed. |
the classical renin - angiotensin - system (ras) is a proteolytic cascade which is constituted by multiple enzymes and effector peptides. the cascade starts when angiotensin i (ang 110) is released from the propeptide angiotensinogen by kidney - secreted renin. the peptide metabolites produced from ang 110 by a variety of proteases act as ligands for angiotensin receptors in different tissues leading to a diversified panel of physiological functions mediated by angiotensin peptides. angiotensin ii (ang 18) is one of the most extensively studied angiotensin peptides. it is mainly produced by the proteolytic action of angiotensin - converting enzyme (ace) by removal of the two c - terminal amino acids from ang 110. ang 18 is able to bind to several cellular receptors leading to a variety of physiologic effects among different tissues and cell types. importantly, increased levels of ang 18 are reported to be associated with life - threatening pathologic conditions including hypertension, congestive heart failure, chronic kidney disease, and also tumor progression. ang 18 was described to directly increase blood pressure and vessel permeability, to induce na reabsorption and ros production and excert proinflammatory and proliferative effects on various cell types [4, 5 ]. the disease - promoting functions of ang 18 convert it to a favorable therapeutic target in the treatment of many diseases mainly by preventing its formation by low - molecular - weight compounds inhibiting appropriate enzymes of the ras cascade. an alternative way of decreasing ang 18 levels became available over the recent years and uses recombinant angiotensin - converting enzyme 2 (ace2) to lower ang 18 levels. inactivates ang 18 by clipping off one c - terminal phenylalanine, while ang 17 is generated. ang 17 is known to take over ang 18 antagonistic functions by activating the mas receptor [79 ] and therefore is thought to be the key effector peptide of the so - called alternative ras. therefore, the monocarboxypeptidase ace2 is a key activator of the alternative ras and is critically involved in the regulation of the classical ras, which is known to be functionally important in the vascular system and in a variety of organs [6, 10, 11 ]. the biological function of the ras has been investigated in cardiovascular [12, 13 ], pulmonary, fibrotic, nephrologic, and artheriosclerotic models. throughout all these studies the loss of ace2 activity in knock - out variants induced pathologies which could be restored by systemic administration of the recombinant enzyme. ace2 therefore can be regarded as one of the key players of the renin - angiotensin - system (ras) being responsible for fluid homeostasis, blood pressure regulation, inflammatory processes, and cell proliferation. ace2 is a membrane anchored glycoprotein which is expressed in most organs and blood vessels and recognizes multiple peptide substrates within the ras and other peptide hormone systems. among its substrates beside ang 18, ang 110, and des - arg - bradykinin, apelins and dynorphins have been reported to be cleaved by ace2 in vitro with ang 18 being the preferred substrate regarding conversion rates. we recombinantly expressed both human ace2 (rhace2) and murine ace2 (rmace2) and compared their substrate conversion rates in vitro and in blood plasma which represents the natural compartment of enzyme action. in previously mentioned murine knock - out models, rhace2 was frequently used to restore ace2 activity. despite the fact that sequence coverage between murine and human ace2 is only 83%, it has been assumed that the enzyme has the same catalytic activity and function. in this work we will highlight species - specific differences between human and murine ace2 regarding their function of keeping the balance between the classical and the alternative ras. the extracellular domains of human or murine ace2 were recombinantly expressed in cho cells under serum - free conditions. the sequence identity between rhace2 and rmace2 accounts to 84% which leads to minor alterations in physicochemical properties and altered patterns in posttranslational modifications, especially n - glycosylation. both expression products were purified by sequentially performing a capture step on a deae - sepharose, ammonium sulfate precipitation, followed by a purification step on a hic - phenyl sepharose column and a final polishing step on a superdex 200 gel filtration column. the purity of rhace2 and rmace2 was determined by high - performance liquid chromatography (hplc) and was found to exceed 98%. the concentrations of final ace2 preparations were determined by size - exclusion chromatography (sec) and in line with photometric measurement at 280 nm and peak integration (od280 : rhace2 : = 1621 lmolcm, rmace2 : = 1750 lmolcm). 2 g of rmace2 and rhace2 were applied on a precast native 312% gradient gel (invitrogen). anode buffer (50 mm bis / tris, 50 mm tricine) and cathode buffer (invitrogen nativepage cathode buffer additive, 50 mm bis / tris, 50 mm tricine) were used to run the gel. 40% glycerol, 200 mm bis / tris, and 200 mm tricine were used as a loading buffer. nativemark unstained protein standard (thermo scientific) was used for estimation of molecular weights in coomassie blue - stained gels. proteins were stained in gel using novex colloidal blue staining kit according to manufacturers ' recommendations. samples were analyzed by sds - page using a 412% precast gradient gel (nupage) following reductive denaturation for 5 min at 95c. the gel was run in nupage mes sds running buffer (invitrogen) at 150 v for 80 min. in gel protein staining substrate specific turnover rates for rhace2 and rmace2 were determined by in vitro kinetic analysis of ang 18 and ang 110 cleavage followed by hplc - based quantification of substrate and product concentrations. enzyme reactions were started by adding a defined amount of enzyme to substrate dilutions in mes - buffer (50 mm mes, 300 mm nacl, 10 m zncl2, 0.01% brij-35, ph 6.5) which were previously equilibrated at 37c. aliquots of the reaction mixes were taken every 10 minutes and stopped by addition of 0.5 m edta to a final concentration of 100 mm before hplc - based quantification of peptides. the concentration of peptides in enzymatic reactions was quantified by detection of peaks eluted from the hplc column using an in - line diode array detector. chromatography was performed by running a gradient on a reversed - phase matrix (source 5rpc, 4.6150 mm, 5 m) with 0.08% h3po4 in water as mobile phase a and 40% acetonitrile in water and 0.08% h3po4 as mobile phase b. the optical density at 280 nm was recorded inline for all eluting peaks, and peptide concentrations were calculated via calibration curves for each individual peptide. anticoagulated blood was collected from healthy volunteers, and plasma was separated by 10 minutes centrifugation at 3000 rcf. following addition of 100 pg / ml recombinant human renin (sigma) to isolated blood plasma, rmace2 or rhace2 was added to the samples. after 10 minutes of incubation at 37c, in the presence or absence of lisinopril (sigma), samples were chilled on ice and immediately subjected to lc - ms / ms analysis. plasma samples were spiked with 100 pg / ml stable - isotope - labeled internal standards and subjected to solid - phase extraction using sep - pak cartridges (waters) according to manufacturers protocol. following elution and solvent evaporation, samples were reconstituted in 50 l 50% acetonitrile/0.1% formic acid and subjected to lc - ms / ms analysis using a reversed - phase analytical column (luna c18, phenomenex) using a gradient ranging from 10% acetonitrile/0.1% formic acid to 70% acetonitrile/0.1% formic acid in 9 minutes. the eluate was analyzed in line with a qtrap-4000 mass spectrometer (ab sciex) operated in the mrm mode using dwell times of 25 msec at a cone voltage of 4000 volts and a source temperature of 300c. angiotensin peptide concentrations were calculated by relating endogenous peptide signals to internal standard signals provided that integrated signals achieved a signal - to - noise ratio above 10. the quantification limits for individual peptides were found to range between 1 pg / ml and 5 pg / ml undiluted plasma. the quality of the frozen enzyme batches used for later functional analysis was analyzed regarding enzyme purity and characteristics. the investigation of rmace2 and rhace2 by size - exclusion chromatography revealed that no detectable contaminations were present in the enzyme preparations. the protein concentration in the enzyme batches was determined by measuring the peak absorbance inline at 280 nm, peak integration, and subsequent calculation based on the corresponding extinction coefficients. rhace2 and rmace2 were found to slightly differ in retention times, pointing to a difference in their hydrodynamic molecular diameter which was found to be lower for rmace2 (figure 1(a)). in order to further investigate this observation, we employed sds - page analysis, revealing a mass difference under denatured conditions (figure 1(b)), indicating the presence of additional covalent mass - increasing modifications in rhace2. the mass shift was found to be caused by two additional glycosylation sites in the human enzyme (data not shown). according to our results, both recombinant ace2 versions apparently occur as noncovalent homodimers in physiological solution. these findings and their possible implications the calculated molecular weights of monomeric rmace2 and rhace2 are 85.2 kda and 85.3 kda, respectively. rmace2 and rhace2 were both found to give a single band at approximately 170 kda in native page, giving evidence for a homodimer occurrence of both recombinant ace2 versions (figure 1(c)). these findings indicate that the recombinant enzymes, produced and purified according to our protocol, are free of contaminants and possess their natural folding and tertiary structure. based on the concentrations and purity of enzyme batches previously determined, we investigated the biological activity of rhace2 and rmace2 in an in vitro system. therefore, we coincubated defined amounts of purified enzymes with an excess of ang 18 and ang 110, respectively, which represent natural substrates for ace2. we found that rhace2 as well as rmace2 converted ang 18 to ang 17 at comparable rates (figure 2(a)). the calculation of kcat via the graphically determined product formation rate and substrate degradation rate revealed that the turnover number of rhace2 for ang 18 was 1.2-fold higher than that for rmace2 (table 1). as an alternative natural angiotensin substrate for ace2 surprisingly, rhace2 turned out to be much more effective in performing the cleavage of ang 110 to ang 19 compared to rmace2 (figure 2(b)). the calculation of ang 110 related turnover rates for rhace2, and rmace2 revealed that the ang 110 related kcat for rhace2 was 15-fold higher than that for rmace2 (1.8 10versus 1.2 10 s). furthermore, the comparison of turnover numbers for different substrates revealed that ang 18 is the preferred substrate for both enzymes in vitro with a 42-fold higher turnover number for rhace2 (0.77 s) and a 492-fold higher turnover number for rmace2 (0.62 s) compared to ang 110 (table 1). these results demonstrate that human and murine ace2 possess substantially different turnover numbers for ang 110, pointing to a species - specific functional diversity of the enzyme. in order to investigate the substrate specificity of rhace2 and rmace2 under physiologic conditions, we assessed the impact of the two enzymes on the human ras in blood plasma. therefore, we simulated a pathological hyperactivated ras by addition of recombinant human renin to anticoagulated human blood plasma. going in line with our previous in vitro findings, the addition of rhace2 or rmace2 to ex vivo incubated plasma samples revealed that both enzymes effectively degraded ang 18 to yield ang 17 and ang 15 when compared to the enzyme - free control sample (figure 3(a)). although the plasma concentration of ang 110 was only 161 pg / ml (124 pm), a concentration of 5 g / ml (58,8 nm) rhace2 was found to efficiently convert ang 110 to ang 19, as indicated by the peptide levels depicted in the ras - fingerprints (figure 3(a), right). in contrast to rhace2, rmace2 was unable to decrease ang 110 concentrations in plasma and failed to induce detectable ang 19 levels (figure 3(a), middle). of note, the increase of ang 17 and ang 15 in the presence of rhace2 was even more prominent, due to this second pathway of ang 17 production via ang 19, which was selectively supported only by rhace2. as in vitro experiments revealed that rmace2 was capable of converting ang 110 to ang 19, although to a much lower extent compared to rhace2, we further investigated the capability of rmace2 for ang 19 formation in human plasma at increased ang 110 concentrations. we added the ace - inhibitor lisinopril to our ex vivo setting, in order to prevent ace - mediated degradation of ace2-produced ang 19 and to increase ang 110 levels by preventing its degradation by endogenous ace. the presence of lisinopril led to significantly increased ang 110 peptide levels compared to untreated control samples (710 pg / ml versus 161 pg / ml) (figures 3(a) and 3(b) left). comparison of rhace2 and rmace2 activities in lisinopril - treated complete human plasma revealed that rhace2 effectively converts large amounts of ang 110 to ang 19 in the physiological matrix while rmace2 was found to be much less effective in catalysing this reaction (figure 3(b)). interestingly, lisinopril was not able to increase ang 17 concentrations in our experimental settings, which was in contrast to several published reports. no ang 17 was detectable in plasma samples incubated with lisinopril in the absence or presence of rhace2 or rmace2 (figure 3(b)) meaning that the concentration was below the quantification limit of 2 pg / ml plasma. for further investigation of these surprising results, whole blood incubations gave similar results as previously reported by other groups, showing an increase of ang 17 concentrations in control and rhace2 samples in response to lisinopril (see supplementary figure 1 available online at doi:10.1155/2012/428950). for further investigation of rmace2 and rhace2 substrate specificities, different states of ras activity were simulated by addition of lower amounts of recombinant human renin in the presence of lisinopril, confirming our findings about strongly diverging conversion rates for ang 110 between rhace2 and rmace2 in a substrate concentration - dependent manner (figure 3(c)). these results demonstrate that ang 110 serves as a natural substrate for rhace2 which is efficiently processed under physiological conditions. in contrast to that, rmace2 is much less effective regarding this catalytic conversion, strongly supporting a species - specific role of ace2 in the activation of the alternative ras pathway. we expressed and purified both rhace2 and rmace2 in cho cells under serum - free conditions. both cell lines were stably secreting high levels of recombinant proteins for at least two months of roller bottle cultivation. the quality of the expression products did not change from early to the latest passages. both rhace2 and rmace2 appeared as stable homo - dimers, while we did not identify monomeric or other multimeric forms. we evaluated the quality of the enzyme preparations by multiple methods including hplc, sec, sds - page, and native page which all confirmed the purity of the final products and their homo - dimeric tertiary structure (figure 1). despite the similarity of the calculated molecular weights for human and murine monomers, surprisingly high mass differences between rhace2 and rmace2 were observed in sec and could be finally identified to be caused by species - specific sequence variations which lead to a different number in n - glycosylation sites in human and murine ace2. ace2 is known to cleave a variety of peptide substrates in vitro, which are involved in a broad panel of physiological functions. based on our findings about the differences in tertiary structure between rhace2 and rmace2, we hypothesized that the well - known sequence diversity between the two species might have an impact on the functional characteristics of the enzymes. therefore, we assessed the turnover rates for rhace2 and rmace2 for two natural and physiologically important substrates (ang 110 and ang 18) in a well - defined in vitro model system (figure 2). we selected these substrates for ace2 characterization because of their functional importance in maintaining ras peptide levels. it has been described previously that the angiotensin peptides ang 18 and ang 110 are cleaved by ace2 in vitro. as the conversion rates of ace2 for ang 110 were reported to be substantially slower than those for ang 18, this enzyme reaction was supposed to take over a minor role in the formation of ang 17 than the direct production by ang 18 cleavage. we could confirm previous findings regarding substrate preferences and found a 42-fold higher turnover number for ang 18 compared to ang 110 when cleaved by rhace2 (table 1). interestingly, our values for kcat were lower compared to previous publications which might have been caused by differences in the employed experimental settings, in particular because of different buffer systems. while showing comparable turnover rates for ang 18, the ang 110-related turnover rate for rmace2 was found to be only 7% of the respective rate for rhace2. this fundamental difference in the substrate conversion rates of the two enzymes might also have substantial impact on the regulation of the ras under physiologic conditions in the two different species. unfortunately, only limited conclusions about physiological consequences can be drawn out of in vitro experiments. an important feature of the physiologic conditions in blood plasma is that all ras enzymes except renin are present in excess compared to their substrates, which is the exact opposite of the in vitro situation. although in vitro investigations are very useful for the comparison of enzyme characteristics in one and the same model system, they tell us very little about the in vivo situation. therefore, we developed an ex vivo experimental setup which allowed us to investigate the enzymatic function of the two recombinant enzymes in their physiological environment, with their natural substrates being present at picomolar concentrations. we would like to point out that these ex vivo conditions reflect the human in vivo plasma conditions regarding circulating enzyme concentrations after systemic administration of rhace2 (data not shown). although ex vivo incubations are very reproducible and reflect an integrated picture of soluble enzyme activities throughout the ras in undiluted plasma, the angiotensin peptide concentrations are clearly higher in ex vivo incubated plasma samples, which might be caused by a lack of the peptide flow towards organs or endothelial surfaces ex vivo. we investigated the ras in these samples by means of a newly developed lc - ms / ms method, which allows the quantification of multiple angiotensin metabolites simultaneously in one single sample of blood plasma. the obtained ras - fingerprints revealed that, in contrast to rmace2, rhace2 is capable to generate ang 19 from ang 110 at physiologic peptide concentrations (figure 3). this activity even more gains importance in the presence of the ace - inhibitor lisinopril, which blocks the formation of ang 18. under latter conditions, large amounts of ang 19 are generated in the plasma samples by rhace2, while rmace2 is much less effective in its formation of ang 19 from ang 110. although significant amounts of ang 110 and ang 19 were present in samples treated with lisinopril alone or in combination with rhace2, no ang 17 could be detected in these samples. these findings were in contrast to previously published reports on ang 17 accumulating effects of ace inhibitors in vivo [20, 21 ]. in our experimental setting, we employed heparinized blood plasma as a sample matrix for ace2 characterization which is reflecting in vivo conditions very well. however, plasma lacks all blood cells which might carry receptors and angiotensin peptide converting enzymes being able to affect angiotensin peptide concentrations in vivo. comparison of plasma and whole blood samples revealed that lisinopril - induced ang 17 accumulation is strictly dependent on blood cell - associated angiotensin peptide converting enzymes, as it was exclusively observed in whole blood ex vivo incubations (figure 3(b), supplementary figure 1). as neutral endopeptidase (nep, cd10) is known to be expressed on the cell surface of leukocytes [22, 23 ] and that it is able to convert ang 110 and ang 19 to ang 17 in vitro, nep is very likely to be responsible for ang 17 accumulation also in vivo, especially in the presence of ace inhibitors which block the formation of ang 18 which is an important precursor for ang 17. in human plasma, the ace2-mediated formation of ang 19 from ang 110 represents a significant route of establishment of the alternative ras. this may be, for example, of particular importance in vivo, when ace inhibitors are used for antihypertensive treatment. as ace2 is primarily expressed as a membrane - attached enzyme in several organs, the local production of ang 19 from ang 110 which is increased when ace inhibitors are present, might become an important mechanism of action for ace inhibitors action in vivo in humans. in addition to ang 17, also ang 19 has been reported to possess protective effects in cardiovascular disease models. these mechanistic considerations seem to be of particular importance in humans, while murine model systems for the investigation of ace inhibitor efficacy might be reconsidered in respect to the species - specific lack of ang 110 cleavage by murine ace2. altogether, our findings describe important species - specific differences in the fine specificity of ace2. thus, the murine ras is likely to function differently when compared to its human counterpart. furthermore, our data point to the importance of further investigations and improved understanding of the human ras, while data generated in murine model systems might be partially reconsidered in respect to different enzyme properties. deciphering the functional characteristics of the human ras using new analytical possibilities reveals previously invisible features of the system. the future generation of human - derived data describing ras function in health and disease will pave the way for new concepts of therapeutic manipulations of the system which are more specifically designed for application in humans. | angiotensin - converting enzyme 2 (ace2) is a monocarboxypeptidase of the renin - angiotensin - system (ras) which is known to cleave several substrates among vasoactive peptides. its preferred substrate is angiotensin ii, which is tightly involved in the regulation of important physiological functions including fluid homeostasis and blood pressure. ang 17, the main enzymatic product of ace2, became increasingly important in the literature in recent years, as it was reported to counteract hypertensive and fibrotic actions of angiotensin ii via the mas receptor. the functional connection of ace2, ang 17, and the mas receptor is also referred to as the alternative axis of the ras. in the present paper, we describe the recombinant expression and purification of human and murine ace2 (rhace2 and rmace2). furthermore, we determined the conversion rates of rhace2 and rmace2 for different natural peptide substrates in plasma samples and discovered species - specific differences in substrate specificities, probably leading to functional differences in the alternative axis of the ras. in particular, conversion rates of ang 110 to ang 19 were found to be substantially different when applying rhace2 or rmace2 in vitro. in contrast to rhace2, rm ace2 is substantially less potent in transformation of ang 110 to ang 19. |
sacral sitting is a poor seated posture with a posterior pelvic tilt and thoracic kyphosis1. it is typically observed in frail older adults using a wheelchair, and occurs when they lack the ability to retain a seated posture and/or their body size and function do not match the size and structure of the wheelchair2. in some cases, the size of the standard wheelchair used in hospitals and elderly care facilities is not suitable for individual wheelchair users3 ; however, there are also structural problems with wheelchair design that can make it difficult to maintain a seated posture, such as the hammocking effect of sling seats and poor back support2, both of which are likely to cause sacral sitting. patients in care facilities often sit in wheelchairs with poor seated posture, including sacral sitting, for long periods of the day4 and it has been reported that sacral sitting with a posterior pelvic tilt increases the risk of pressure ulcers on the buttocks in frail older adults5, 6. a pressure ulcer is a localized injury caused by contact pressure or pressure in combination with shear force on the skin and/or subcutaneous tissues over a bony prominence7. the vertical and horizontal forces that load the sacrococcygeal region during sitting increase with an increase in the posterior inclination angle of the pelvis8. however, the influence of sacral sitting on the contact pressure and shear force load on the buttocks while seated in a wheelchair has not been clarified. in this study, the pelvic inclination angle, contact pressures on the buttocks and back, and shear force of healthy subjects who adopted a sacral sitting posture in a wheelchair were quantitatively measured. the goal of this investigation was to determine the influence of sacral sitting on factors likely to predispose to the development of pressure ulcers. twenty - six healthy adults (5 males, 21 females ; mean age, 21.0 0.9 years) participated in this study. their body sizes were as follows : mean height : 159.3 7.4 cm ; mean thigh length (the distance from the sacrum to the popliteal fossa) : 44.4 2.7 cm ; mean axilla height (from the seat surface to the axilla while in a sitting position) : 42.8 3.1 cm ; mean lower leg length (from the popliteal fossa to the heel while in a sitting position) : 39.7 2.5 cm ; and mean elbow height (from the seat surface to the elbow while in a sitting position) : 21.2 2.7 cm. measurements were performed using a modular wheelchair (revo next ; etac co., ltd., stockholm, sweden), each part of which was adjustable to the body size of the user. after the initial measurements, a wheelchair cushion (type 5 tc-045 ; takano heartworks co., ltd., nagoya, japan) was placed on the seat and the wheelchair was adjusted to the body size of each subject as follows : seat depth was adjusted to thigh depth minus 5 cm ; back height was adjusted to axilla height minus 10 cm ; leg length was adjusted to the lower leg length ; and the height of the arm supports was adjusted to the elbow height of each subject. the subjects assumed two postures : a basic sitting posture with the buttocks placed far back on the wheelchair seat and sacral sitting with a posterior pelvic tilt and the ischium slid forward by 5 cm relative to its position in the basic sitting posture (figs. the subject sits up straight with the buttocks placed far back on the wheelchair seat. the subject sits with a posterior pelvic tilt and the ischium slid forward by 5 cm compared with the basic sitting posture). the subjects assumed the basic sitting posture first, and then transitioned from the basic to the sacral sitting posture. in each posture, the inclination angle of the sagittal pelvic line, contact pressure on the ischial region, and maximum contact pressures and contact areas on the buttocks and back were measured. in addition, the shear forces generated by sliding the ischial region forward during basic sitting and during the transition from basic to sacral sitting were measured. the subject sits up straight with the buttocks placed far back on the wheelchair seat. the subject sits with a posterior pelvic tilt and the ischium slid forward by 5 cm compared with the basic sitting posture the forward displacement of the ischium was measured by placing the end of a 30-cm steel carpenter s square ruler against the lower edge of the subject s patella while the ruler was held parallel to the thigh in a horizontal position. the distance from the patella to the point where the ruler and the front of the seat met was considered to be the forward displacement of the ischium9, 10. the inclination angle of the sagittal pelvic line was measured using an inclination angle - measuring device (horizon ; yuki trading co., ltd., tokyo, japan), which is a seated posture - measuring device, in accordance with the iso16840 - 1 standard. when the sagittal pelvic line tilted backwards from the vertical with a posterior pelvic tilt, the values measured with horizon became negative. in contrast, when the sagittal pelvic line tilted forward from the vertical with an anterior pelvic tilt, they became positive. the contact pressures and contact areas on the buttocks and back were measured using an sr soft vision sensor pad (fukoku busssan co., ltd., sr soft vision is a seat - type sensor pad with 256 pressure - sensing points indicating the pressure load on each point. the number of responding sensing points was considered to be the size of the contact area. the contact pressure on the ischial region and shear force generated by sliding the ischial region forward the paired t - test was used to analyze between - posture differences in the mean values of each measurement when the measured values were normally distributed, and the wilcoxon signed - rank test was used when the distribution was not normal. correlations between the inclination angle of the sagittal pelvic line and the contact pressure on the ischial region, maximum contact pressures and contact areas on the buttocks and back during basic and sacral sitting, and shear force during basic sitting and during the transition from basic to sacral sitting were investigated using spearman s correlation coefficient when the measured values were normally distributed, and pearson s rank correlation coefficient when their distribution was not normal. all analyses were performed using the japanese version of spss version 21 (ibm, armonk, ny, usa). the medical ethics committee of gunma university approved this study (26 - 43), and written informed consent was provided by subjects. the inclination angles of the sagittal pelvic line were 16.4 4.0 and 30.3 4.3 during basic and sacral sitting, respectively, which indicates that posterior pelvic tilt was significantly greater during sacral sitting than during basic sitting (p<0.001 ; table 1table 1.measurement values during basic and sacral sitting (n=26)basic sitting posturesacral sittingmean standard deviationmedian (minimum value to maximum value)mean standard deviationmedian (minimum value to maximum value)inclination angle of the sagittal pelvic line (degree) 16.4 4.0 16.5 (24.0 to 8.0)30.3 4.330.0 (41.0 to 20.0)contact pressure on the ischial region (mmhg) 72.5 14.4 69.8 (42.5 to 107.5)61.1 14.362.0 (27.5 to 88.0)buttocksmaximum contact pressure (mmhg) 92.1 18.3 87.5 (66.0 to 133.0)78.6 19.475.0 (56.0 to 130.0)size of contact area (point) 137.3 30.4 143.5 (86.0 to 187.0)150.1 28.1146.0 (102.0 to 210.0)backmaximum contact pressure (mmhg) 36.1 9.4 35.5 (21.0 to 57.0)50.9 13.550.5 (29.0 to 79.0)size of contact area (point) 17.2 10.0 15.0 (2.0 to 47.0)29.3 10.129.0 (14.0 to 55.0)shear force generated by sliding the ischial region forward (newton) 6.1 3.0 5.5 (1.6 to 12.6)7.1 3.66.9 (1.7 to 15.8)significance was tested using the paired t - test, significance was tested using the wilcoxon signed - rank test. p<0.01, p<0.001). maximum contact pressures on the buttocks (p<0.001) and ischial region (p<0.001) were significantly lower during sacral sitting than during basic sitting. in contrast, maximum contact pressure on the back (p<0.001), contact area on the buttocks (p<0.001), contact area on the back (p<0.001) were significantly greater during sacral sitting than during basic sitting (table 1). the shear force generated by sliding the ischial region forward to a sacral sitting position was significantly greater than the shear force during basic sitting (p=0.003). the inclination angle of the sagittal pelvic line was significantly correlated with the back contact area during the transition from a basic to a sacral sitting posture (|r|=0.451, p=0.021). significance was tested using the paired t - test, significance was tested using the wilcoxon signed - rank test. the major findings of this study were that, during sacral sitting, the pressures on the buttocks were lower while pressures on the back were higher than during basic sitting. in addition, significant shear forces were generated by sliding the ischium forward from a basic sitting posture into a sacral sitting position. these findings are consistent with those of previous studies that investigated the influence of sacral sitting on subjects without using wheelchairs. since the posterior tilt of the pelvis was greater during sacral sitting than in a basic sitting posture, the combined center of gravity of the head, arms, and trunk may have shifted back relative to its position during basic sitting ; this may have increased in the force pressing the back against the back support during sacral sitting and the maximum contact pressure on areas of the back. the results of this study are consistent with those of a previous report, which also found that the weight borne by a wheelchair seat supporting the buttocks decreased as the combined center of gravity shifted back during sacral sitting with a posterior pelvic tilt, while the load on the back support increased11. concomitantly, maximum contact pressure on the buttocks decreased and maximum contact pressure on the back increased. this is also likely due to the posterior tilt of the pelvis and backwards shift in the center of gravity during sacral sitting, as is shown by the positive correlation between the pelvic posterior tilt angle and back contact area. the act of pressing the trunk against the back support produces a counterforce that shifts the buttocks forward12. the back support converts backward angular momentum of the trunk produced by posterior pelvic tilt to shear force in the forward direction13, 14. in this study, posterior pelvic tilt markedly increased in sacral sitting compared with that in basic sitting, which may have increased the force pressing the trunk against the back support and shear force generated by sliding the ischial region forward, compared to basic sitting. in a previous study, the shear force in the sacrococcygeal and ischial regions, measured on the seat surface of a chair created specifically for the measurement, was shown to increase with an increase in the posterior pelvic tilt angle in a sitting position8. in the present study, shear force was measured on the seat surface of a wheelchair, and the forward force in the ischial region increased when adopting a sacral sitting posture with the pelvis tilted backwards, confirming the previously published finding. to reduce contact pressure and shear force and prevent pressure ulcers, it is recommended that wheelchair users maintain proper posture and postural control, and that they sit on a supportive surface appropriate for their individual needs7. the results of the current study indicate that the shear force load on the ischial region increases with the increase in posterior pelvic tilt during sacral sitting. the decreases in contact pressure on the ischial region and maximum contact pressure on the buttocks during sacral sitting may reduce the risk of pressure ulcers ; however, the increased shear force generated by sliding the ischial region forward remains a risk factor for ulcer development. the present study used healthy young participants ; however, similar measurements should be taken of frail older individuals who use a wheelchair daily, in order to verify that these results are applicable to more typical wheelchair users. furthermore, while a sacral sitting posture was defined as sitting with the ischium slid 5 cm forward relative to its position in the basic sitting posture, additional measurements should be performed at various posterior pelvic tilt angles in future studies, in order to clarify the influences of these angles on wheelchair users. in conclusion, sacral sitting in a wheelchair increases the maximum contact pressure on the back, contact areas of the buttocks and back, and the shear force generated by sliding the ischial region forward. these factors may contribute to the development of pressure ulcers, and improvements in wheelchair seating that reduce sacral sitting by frail older adults may reduce the risk of ulcer development. | [purpose ] the purpose of this study was to investigate the influence of sacral sitting in a wheelchair on contact pressure on the buttocks and back, and shear force on the ischial region. [subjects and methods ] twenty - six healthy adults assumed two postures while seated in a wheelchair : a basic sitting posture, and sacral sitting with the pelvis tilted posteriorly and the ischium slid forward by 5 cm relative to its position in the basic sitting posture. the inclination angle of the sagittal pelvic line, contact pressures and contact areas on the buttocks and back, and the shear force generated by sliding the ischial region forward were measured. [results ] posterior pelvic tilt was significantly greater during sacral sitting. maximum contact pressures on the buttocks and ischial region were significantly lower during sacral than during basic sitting. however, maximum contact pressure on the back, the contact areas of the buttocks and back, and the shear force generated by sliding the ischial region forward were significantly greater during sacral sitting. [conclusion ] sacral sitting in a wheelchair increases the maximum contact pressure on the back, contact areas of the buttocks and back, and the shear force generated by sliding the ischial region forward. |
in 2005, wood discs were cut from a discolored stump of pinus thunbergii (fig. 1) grown in a forest in taean, chungnam, korea. after washing with tap water the wood pieces were surface - sterilized with 0.5% chlorine lax solution for 2 min, washed twice with sterile water, and air dried. the dried wood pieces were placed on mea (2% malt extract agar, bd science, usa) supplemented with cycloheximide (200 g / ml) and incubated for 10 days at room temperature. fungal isolates were obtained by taking mycelial tips grown out from the incubated wood pieces. single spore isolates were prepared from the obtained isolates grown on 2% mea at 25 for seven days. all the isolated fungi were stored at -80 in 10% glycerol for long - term storage and in water at 4 for short - term storage. to identify optimal growth media, pre - cultured isolates were transferred to the center of each of pda, mea, oa (oatmeal agar, bd science, usa) and omea (2% oxoid malt extract agar, oxoid, uk) media, respectively, and grown for 9 days at 25. mycelial growth was recorded by measuring the diameters of the colonies. light microscopic images of the morphological features of the isolates were examined under a phase - contrast microscope (karl zeiss, axioskop 40) after growing the culture on 2% mea at 25 for 5~7 days. for scanning electron microscopy (sem), the fungal isolate was grown for 5~7 days at 25 on 2% mea plates overlaid with cellophane (bio - rad laboratories, canada). pieces of cellophane were fixed in 2% glutaraldehyde buffered in 0.1 m cacodylate buffer for 16 h and 1% osmium tetroxide in 0.1 m phosphate for 1 h. samples were subsequently washed in 0.05 m cacodylate buffer, dehydrated in a series of ethanol washes (50% for 20 min, 75% for 20 min, 90% for 20 min, 95% for 20 min and 100% for 20 min), passed through ethanol - isoamylacetate, dried with a hitachi critical point dryer and coated with platinum - palladium at 25 nm with an hitachi e-1030 ion sputter. the specimens were examined with a hitachi s-4300 scanning electron microscope operating at 15 kv. for fungal genomic dna, fungi were grown for 5~7 days on 2% mea plates overlaid with cellophane (bio - rad laboratories, usa). fungal genomic dna for pcr was obtained from the mycelium using the drilling method described by kim. the -tubulin gene was amplified using the primers t10 and bt12 (o'donnel and cigelnik, 1997 ; kim., 2003). sequences were manually edited using the chromas v2.31 program and aligned using the clustalw 2 program. the aligned sequences were analyzed with paup 4.0 beta 10 (swofford, 2003). in 2005, wood discs were cut from a discolored stump of pinus thunbergii (fig. 1) grown in a forest in taean, chungnam, korea. after washing with tap water the wood pieces were surface - sterilized with 0.5% chlorine lax solution for 2 min, washed twice with sterile water, and air dried. the dried wood pieces were placed on mea (2% malt extract agar, bd science, usa) supplemented with cycloheximide (200 g / ml) and incubated for 10 days at room temperature. fungal isolates were obtained by taking mycelial tips grown out from the incubated wood pieces. single spore isolates were prepared from the obtained isolates grown on 2% mea at 25 for seven days. all the isolated fungi were stored at -80 in 10% glycerol for long - term storage and in water at 4 for short - term storage. to identify optimal growth media, pre - cultured isolates were transferred to the center of each of pda, mea, oa (oatmeal agar, bd science, usa) and omea (2% oxoid malt extract agar, oxoid, uk) media, respectively, and grown for 9 days at 25. mycelial growth was recorded by measuring the diameters of the colonies. light microscopic images of the morphological features of the isolates were examined under a phase - contrast microscope (karl zeiss, axioskop 40) after growing the culture on 2% mea at 25 for 5~7 days. for scanning electron microscopy (sem), the fungal isolate was grown for 5~7 days at 25 on 2% mea plates overlaid with cellophane (bio - rad laboratories, canada). pieces of cellophane were fixed in 2% glutaraldehyde buffered in 0.1 m cacodylate buffer for 16 h and 1% osmium tetroxide in 0.1 m phosphate for 1 h. samples were subsequently washed in 0.05 m cacodylate buffer, dehydrated in a series of ethanol washes (50% for 20 min, 75% for 20 min, 90% for 20 min, 95% for 20 min and 100% for 20 min), passed through ethanol - isoamylacetate, dried with a hitachi critical point dryer and coated with platinum - palladium at 25 nm with an hitachi e-1030 ion sputter. the specimens were examined with a hitachi s-4300 scanning electron microscope operating at 15 kv. for fungal genomic dna, fungi were grown for 5~7 days on 2% mea plates overlaid with cellophane (bio - rad laboratories, usa). fungal genomic dna for pcr was obtained from the mycelium using the drilling method described by kim. the -tubulin gene was amplified using the primers t10 and bt12 (o'donnel and cigelnik, 1997 ; kim., 2003). sequences were manually edited using the chromas v2.31 program and aligned using the clustalw 2 program. the aligned sequences were analyzed with paup 4.0 beta 10 (swofford, 2003). initially. several fungal isolates were obtained from the sapwood pieces of a stained stump of japanease black pine. they all grew well in the cycloheximide - supplemented mea media, indicating that they are cycleheximide tolerant. they showed the same morphology and growth pattern, thus, one of the fungal isolates coded as dkm 0514 was used for identification in this work. the isolate formed pale or red synnemata and droplets of conidia at the apex the synnemata (fig. 2a~2f). the shape and size of conidia on synnema and mononema are given in table 1. these features of synnemata are similar to synnema - forming species of the ophiostoma piceae complex. (2006) compared morphological characters of seven species of the o. piceae complex, including o. breviusculum, o. canum, o. floccosum, o. piceae, o. quercus, o. setosum, and o. subalpinum. among these compared species reported from conifers, especially, the red - brown synnema and yellow color of the conidia mass found in dkm 0514 were considered to be distinct features of o. floccosum by harrington. o. floccosum (mathiesen) hunt (anamorph : pesotum aureum (hedgecock) mcnew et harrington), one of the common sapwood - staining species (hunt, 1956 ; harrington. a sporothrix synanamorph with denticles and secondary conidia was observed from dkm 0514 by scanning electron microscopy (fig. o. floccosum is a heterothallic species, as it can produce perithecia only through cross of two different mating type partners. in this study dkm 0514 itself did not form a perithecium, suggesting it is a heterothallic species. consequently, we could not observe a telemorph of dkm 0514 (table 1). the differentiation of the o. piceae complex is not easy based only on morphological characters. therefore, to confirm whether the isolate is the anamorph of o. floccosum, its -tubulin gene sequence was analyzed. when the determined -tubulin gene sequence was searched for homologous sequences in the genbank dna database, it matched well with the known -tubulin gene sequence of ophiostoma floccosum kuc 2412 (accession number dq868378) (100% similarity). the -tubulin gene sequence of the isolate dkm 0514 was deposited in the genbank under accession no. the phylogenetic analysis based on the -tubulin gene sequences also revealed that dkm 0514 was placed in a clade with o. floccosum (fig. the isolate dkm 0514 from this study showed better mycelial growth on mea than on pda and oa (fig. the colony color of o. floccosum dkm 0514 incubated at 25 was creamy on pda, creamy grayish on oa, and first white then gradually turning brownish on mea and omea (fig. it produced no culture aroma and no mycelium with concentric rings that were observed as distinguishing characteristics of o. floccosum by harrington. 3) of the - tublin gene, and physiological properties, the isolate dkm 0514 was identified as the anamorph of ophiostoma floccosum. this is the first report in korea on the detailed mycological properties of the anamorph of o. floccosum isolated from pinus thunbergii. | an ophiostoma fungus was isolated from a stump of pinus thunbergii in a forest on the west coast of korea. microscopic analysis using a light microscope, a stereo microscope, and a scanning electron microscope revealed that it had morphological features of pesotum and sporothix synanarmorphs. based on the -tubulin gene sequence analysis, the fungus was identified as the anamorph of ophiostoma floccosum. mycological properties of the species including its growth properties on different culture media were described. |
in total, 165 blood and 194 sputum samples were collected from 181 different hiv - positive patients with upper respiratory complaints, regardless of tb suspicions, who were attended at the correia picano hospital and oswaldo cruz university hospital, as shown in fig. the samples were forwarded to pernambuco central laboratory (lacen - pe), where three unprocessed 0.5 ml - aliquots of sputum were transferred into sterile microtubes, inside a biosafety cabinet located in the mycology laboratory to assure no cross - contamination with cultivated mycobacterium. unprocessed sputum - aliquots and corresponding - patient blood samples were then forwarded to the molecular biology laboratory at institute of integrative medicine prof. the remaining sputum samples underwent smear microscopy and culturing at the reference laboratory for tb diagnosis accredited by the brazilian ministry of health located in the lacen - pe. all samples were handled blindly by all technicians involved, from sample processing to results analysis. microbiological analysis - acid - fast bacilli were detected by means of ziehl - neelsen staining on sputa smears. sputa were decontaminated in accordance with the petroff method and aliquots of 0.1 ml were placed in lowenstein - jansen solid medium. genomic dna extraction - the patients blood samples underwent ficoll - paque plus (ge healthcare bio - sciences ab, sweden) fractioning for leucocyte isolation. an aliquot of 10 leucocytes and the first of the three sputum aliquots underwent genomic dna extraction using proteinase k protocol. briefly, the material was suspended in a 400 l lysozyme solution (1.25 mg / ml) and was incubated at 37c for 16 h. then, 75 l of proteinase k (20 mg / ml) and 10% sodium dodecyl sulfate solution were added and the mixture was incubated at 65c. next, 100 l of 5 m nacl and 100 l of ctab / nacl were added and the samples were incubated at 65c. after 10 min of incubation, the dna was extracted with phenol / chloroform solution and then concentrated by means of precipitation with isopropanol. the dna precipitate was obtained through centrifugation at 16,000 g in a microcentrifuge, washed with 70% ethanol and dissolved in 50 l of sterile water. conventional pcr - first, the genomic dna underwent pcr for amplification of a target sequence on human dna, acting as a positive control for the dna extraction, thereby ensuring the absence of pcr inhibitors in the reaction. next, pcr was performed with specific primers for amplification of the mycobacteria is6110 genetic element. the total reaction volume was 50 l and included 1.5 mm of mgcl2, 25 pmol of each primer (sense : 5cgagctgcgcgatggcgaac and antisense : 5taggtgctggtggtccgaag, synthesised by invitrogen, usa), 200 m of each dntp and 1.25 units of dna polymerase (invitrogen). the reaction conditions were one cycle of 96c for 3 min, 30 cycles of 96c for 30 s for denaturation, 65c for 30 s for annealing, 72c for 30 s for extension and, finally, a cycle of 7 min at 72c using a thermocycler (gradient eppendorf, germany). the reaction was considered positive when the ethidium bromide - stained band corresponded to 245 bp. r eal - time pcr - quantitative pcr (qpcr) was performed using the same set of primers for is6110 amplification as used in conventional pcr and an internal probe (applied biosystems, usa) in the presence of the taqman universal pcr master mix and the dna extracted from the patients sputum or blood. the conditions for amplification of the is6110 element were as follows : denaturation for 15 min at 95c followed by 45 cycles of 15 s at 94c and 60 s at 60c. in all pcr runs, standard curves were obtained using plasmid dna encompassing the mycobacteria is6110 sequence as the reaction positive control and all samples were tested in duplicate. reaction with no dna added was used as the negative control, also in duplicate. the reaction was run in an abi 7500 machine with setup for absolute quantification, using a standard curve prepared with serial 10x dilution from 10 ng [cycle threshold (ct) = 14 ] to 100 fg (ct = 37) of plasmid control dna in triplicate. the efficiency of the amplification reaction was 1.8, with a threshold set at 0.02 based on data from 26 different experiments. detect - tb - the second sputum aliquot was tested for the presence of mycobacteria genome using the detect - tb ampligenix biotech company kit (belo horizonte, brazil). briefly, the cells were lysed to release the genomic dna and to make it soluble. the extracted dna was purified by means of silica resin capture in the presence of chaotropic agents, followed by successive washings and elution in a low - ionic - strength solution. pcr product - bounded to the is6110 immobilised probe was detected using a streptavidin - peroxidase / tetramethylbenzidine colorimetric system. readings within the absorbance range from 0.225 - 0.275 were considered to be indeterminate. values below 0.225 were considered to be negative and above 0.275 as positive. gen - probe amplified mtd - the third frozen stored sputum aliquot underwent the gen - probe amplified mtd (san diego, usa) testing. firstly, the 500 l samples were defrosted at room temperature (rt) in a biological cabinet. then, the same volume of purifying solution of 2.9% sodium citrate and 4% naoh was added and incubated for 15 min at rt. the samples were neutralised by adding 500 l of phosphate buffer solution (ph 6.8). all reagents and equipment used in the gen - probe protocol were as recommended by the manufacturer. quality control - the flux and transport of the biological samples between the different institutions involved in this project was carefully planned. these hospitals had a transport flow from their labs to the lacen - pe, which is responsible for tb diagnosis in pe. the main problem was identifying the samples related to this research among the routine samples and therefore, we created small colourful forms to send with the research samples, working with the personnel of the lacen - pe to identify the samples related to this study, to avoid processing exams in duplicate and possible specimen loss and to shorten the time of sample retention at the laboratory reception. another potential problem was related to where and how to aliquot the samples for the different tests. from the outset, we had decided to use the same samples for all tests given the possibility of different samples having different bacterial loads even when they are collected on the same sample day and the high likelihood that patients would not return on the second day to bring the first - daily sputum. to avoid possible cross - contamination with cultivated bacteria in the mycobacterium facilities, the sputum samples were sent to the mycology lab because primarily manipulation was performed inside a biological cabinet in that laboratory after working hours. three 0.5 ml - aliquots were prepared from each sputum specimen, which were frozen and sent to the molecular biology laboratory at another institution under refrigeration ; the remaining sputa were sent to the mycobacteria facilities at lacen - pe for microbiological analysis. all dna extractions were performed at the molecular biology laboratory of imip, inside a biosafety cabinet located in a room with restricted use to clinic sample handling. the pcr reactions were prepared in another room specifically designed for this purpose, free of biological samples and also inside a biosafety cabinet. the hybridisation procedures and the analysis of pcr products in gel were performed in the main area of the molecular biology laboratory. for every conventional or real - time pcr run, two negative controls were run : one reaction was performed without the dna template and another included genomic dna of a healthy individual to identify possible non - specific dna amplification. to avoid interpretation bias, the research teams at the hospitals, lacen - pe and the molecular biology laboratory at imip, were different and the samples received a number at the hospital, a different number at lacen - pe and yet another at the molecular biology laboratory. all patient identification numbers were noted in the patient database at the molecular biology laboratory ; however, the codes were only broken for analysis at the end of the cohort study. statistical analysis - the sensitivity, specificity and the positive and negative predictive values (npv) for each of the molecular tests evaluated for the diagnosis of tb in hiv - infected patients were calculated considering sputum culture as the gold standard, using a 2 x 2 table. the concordance between tests was evaluated using the kappa (k) test (epi info v.6.04 software). the receiver operating characteristic (roc) curves were performed using medcalc software, ostend, belgium. ethics - the aggeu magalhes research centre institutional review board approved this study under the registration caae : 0007.0.095.000 - 07. the authors declare no conflict of interest and do not have a direct financial relation with the commercial identity mentioned in this manuscript. sputum samples - among 194 sputum samples from 181 different hiv - infected patients, 19 were culture - positive for m. tuberculosis, of which only eight were smear - positive. comparing the roc curves of the different tests with sputum culture as the reference, the best results were associated with qpcr methodology (fig. qpcr presented 100% sensitivity, 96.7% specificity, 78.6% positive predictive value (ppv), 100% npv and 97% accuracy (table i). qpcr results demonstrated excellent concordance with culture (k = 0.864) and moderate concordance with gen - probe results (k = 0.586) (table ii). the ct average of culture - positive, smear - positive sputa (32.5 ; range, 24.4 - 36.4) was similar to culture - positive, smear - negative sputa (33.4 ; range 30.3 - 35.4). three samples presented culture - negative and positive - qpcr results, with ct of 18, 19 and 21. fig. 2 : receiver operating characteristic curve accuracy for molecular assay in tuberculosis (tb). a : accuracy estimated for four different molecular assays for tb testing in sputa using culture as gold - standard ; b : accuracy of different cut - off set for tb testing in sputa using the detect - tb assay ; c : accuracy of conventional e quantitative polymerase chain reaction (qpcr) for tb diagnosis in blood. table ipositive (ppv) and negative (npv) predictive values, sensitivity and specificity in samples using different molecular methods for the diagnosis of tuberculosis (tb) and sputum culture as gold standardreference x tests (sample)nppv (%) npv (%) sensitivity (%) specificity (%) culture x pcr (sputum)19416.81 (9.4 - 29.5)100 (88.8 - 100)100 (67.9 - 100)46.3 (32.7 - 53.7)culture x qpcr (sputum)10278.60 (48.8 - 94.3)100 (94.8 - 100)100 (67.9 - 100)96.70 (90 - 99.1)culture x detect - tb (sputum)19424.36 (12.2 - 37)100 (91.6 - 100)100 (67.9 - 100)66.30 (47.4 - 68.3)culture x gen - probe (sputum)10264.30 (35.6 - 86)97.70 (91.3 - 99.6)81.80 (47.8 - 96.8)94.50 (87.1 - 98)culture x pcr (blood)16513.8 (8.3 - 21.7)95.9 (89.9 - 99.3)88.90 (63.9 - 98.3)32 (24.7 - 40.2)culture x qpcr (blood)10261.1 (36.1 - 81.7)100 (94.6 - 100)100 (67.9 - 100)92.30 (84.3 - 96.6)detect - tb is a test in developing and gen - probe a commercial molecular test for tb diagnosis. pcr : in house polymerase chain reaction ; qpcr : quantitative real - time pcr. detect - tb is a test in developing and gen - probe a commercial molecular test for tb diagnosis. pcr : in house polymerase chain reaction ; qpcr : quantitative real - time pcr. table iiconcordance between microbiological and molecular tests for diagnosis of tuberculosis (tb)tests (sample)nagreementkappazpculture x pcr (sputum)1940.4900.1392.760.0029culture x qpcr (sputum)1020.9710.8648.800.0000culture x detect - tb (sputum)1940.6280.2313.650.0002culture x gen - probe (sputum)1020.9310.6826.950.0000culture x pcr (blood)1650.3820.0621.830.0337culture x qpcr (blood)1020.9310.7547.590.0000pcr (sputum) x qpcr (sputum)1020.5200.1793.170.0007pcr (sputum) x detect - tb (sputum)1020.6470.3013.150.0008pcr (sputum) x gen - probe (sputum)1020.4800.1121.990.0236qpcr (sputum) x detect - tb (sputum)1020.6570.2944.190.0000qpcr (sputum) x gen - probe (sputum)1020.9020.5865.920.0000pcr (blood) x qpcr (blood)1020.4610.1572.950.0016qpcr (sputum) x qpcr (blood)1020.9020.6306.440.0000detect - tb is a test in developing and gen - probe a commercial molecular test for tb diagnosis. pcr : in house polymerase chain reaction ; qpcr : quantitative real - time pcr. detect - tb is a test in developing and gen - probe a commercial molecular test for tb diagnosis. pcr : in house polymerase chain reaction ; qpcr : quantitative real - time pcr. gen - probe presented the second - best results with 81.8% sensitivity, 94.5% specificity, 64.3% ppv, 97.7% npv and 93% accuracy. a substantial concordance between gen - probe and culture results was observed (k = 0.682) detect - tb demonstrated a sensitivity of 100%, but a specificity of 66.3%, corresponding to a ppv of 24.4%. roc curves constructed with different cut - off values for testing detect - tb showed that the best results for sensitivity and specificity occurred with a cut - off of 300 (100% sensitivity, 67.4% specificity) and 275 (100% sensitivity, 66.3% specificity). in this study, the cut - off used was 275, which was indicated by the manufacturer (fig. however, higher cut - off values might improve specificity with some compromised of sensitivity. the lowest specificity was associated with conventional pcr performed from sputum (46.3%) and blood (32%) samples (table i). blood samples - concerning the molecular tests performed on the patients blood samples, we only took into consideration samples from patients for whom sputum also had been collected for definition of the tb cases based on sputum culture. regarding blood samples, qpcr showed 100% sensitivity, 92.3% specificity, 61.1% ppv and 100% npv in comparison to the sputum culture, whereas the in - house pcr showed sensitivity and specificity values of 88.9% and 32%, respectively (fig. 2c). a substantial concordance was observed between qpcr results obtained from blood and positive culture on sputum (k = 0.754) and also between qpcr results from blood and sputa (k = 0.630) (table ii). many studies on the accuracy of molecular assays have been published on the diagnosis of pulmonary and non - pulmonary tb, both associated with smear - positive or smear - negative sputum samples and in hiv - infected or non - infected patients (peter. smear - based microscopy is the most commonly used approach for pulmonary tb detection, demonstrating 70% sensitivity compared with culture associated with a clinical definition of the disease as the gold standard ; however, in hiv - infected patients the smear - based sensitivity might be lower than 40% (boehme. this was mainly related to the low bacillary load in sputum from hiv - infected patients (ogrady. we observed a great variation in the accuracies of the four tests evaluated considering that all were pcr - based assays and all used samples obtained from the same sputum. qpcr demonstrated superior performance with 97% accuracy, followed by gen - probe (93%), detect - tb (70%) and conventional pcr (52%) for the detection of pulmonary tb infection from sputum. recent publications regarding the molecular detection of pulmonary tb in hiv - infected patients also have shown variations in assay sensitivity (53 - 100%) between different or even the same assay (table iii). table iiiperformance of different molecular tests for tuberculosis detection in hiv - infected patientsreferencehiv - infected populationbiological samplesampling (n)methodologysensitivity (%) specificity (%) ppv (%) npv (%) target suspected casesgold stantardthis paperrecife, brazilblood102qpcr10092.361.1100 in and outpatientsolid culturesputa102qpcr10096.778.6100102gene - probe81.894.564.397.7 detect - tb66.310024.4100albuquerque. (2013)malawi, africablood104xpert mtb / rif2110010064 in and outpatientsputum and solid cultureabed al - darraji. (2011)porto alegre, brazilsputa74pcr dot blot72858572 in and outpatientsolid culture combined with clinicspcr (agarose)42766853lawn. (2011)uganda, south africasputa and bronchoalveolar lavage170mtb / rif3995 - -inpatientsolid culturehiv : human immunodeficiency virus ; npv : negative predictive value ; pcr : in house polymerase chain reaction ; ppv : positive predictive value ; qpcr : quantitative real - time pcr. hiv : human immunodeficiency virus ; npv : negative predictive value ; pcr : in house polymerase chain reaction ; ppv : positive predictive value ; qpcr : quantitative real - time pcr. for tb detection in sputum, our qpcr assay presented 100% sensitivity and 96.7% specificity, comparable to the sensitivity of 80 - 95% and the specificity of 95 - 100% reported by others who also developed the taqman assay for detection of the is6110 element (gomez. qpcr was positive for 100% of the smear - negative, culture - positive patients, providing earlier tb diagnosis for more tb - suspected patients than smear - based microscopy (7% vs. 4%) in hiv - infected patients. improvement in pulmonary tb detection (25%) by means of molecular assay was reported in chile, a tb non - endemic area, confirming the power of molecular tools in tb diagnosis for tb - control programs (balcells. three patients with false - positive qpcr from sputum received empirical treatment for tb within six months of being tested and the clinical - symptom improvement confirmed their disease status. the withdrawal of a considerable (1.5 ml) amount of sputum for molecular analysis prior to sputum culturing might explained the absence of acid - fast bacillary growth on solid media, likely due to the loss of bacillary viability as a consequence of the sputum decontamination procedure (michelon. 2011). the sensitivity and specificity of the gen - probe assay as reported in the literature ranges from 92 - 100% and from 85 - 100%, respectively, but in hiv - positive patients the sensitivity might be lower than 42% (syre., the performance of gen - probe was similar to qpcr (93% vs. 97% accuracy), with 81.8% sensitivity and 94.5% specificity for tb detection in sputum. five false - positive cases were observed, two of whom received empirical tb treatment with improvement in clinical symptoms. in contrast to the qpcr assay, the gen - probe assay was associated with two false - negative cases, possibly due to the insufficient target dna in the 0.5 ml sputum aliquot used, considering that the gene - probe protocol recommends the collection of 10 ml of sputum for decontamination and concentration procedures prior to use. the presence of pcr inhibitors in the sample may also have induced false - negative reactions with the gen - probe assay, which were not observed in the qpcr assay because, in this latter case, dna was extracted using proteinase k digestion followed by a purification step performed with phenol - chloroform. cases identified as false - positives by the detect - tb assay were responsible for the low specificity (66.3%) and ppv (24.4%) observed in our study. the causes for this performance are not clear, because a sensitivity of 75% and a specificity of 100% were reported using the same assay for tb detection in spontaneous sputum samples obtained from patients suspected of having tb (michelon. difficulties in handling the kit, reagents stability and delays in reading the reaction were considered. the handling was performed exclusively by laboratory personnel that had received training in executing the detect - tb protocol. to read the samples, we placed the microplates on a cold surface to transport them to another laboratory in a connected building and thus some delay in reading might have contributed to these results, although we also should consider that some of these false - positive cases might indeed have been positive cases that had not been identified by culturing. a published meta - analysis demonstrated a sensitivity variation of 32 - 92% with a mean of 72% and a specificity variation of 93 - 100% with a mean of 96% for the pcr simplex methodology for tb detection, in comparison with sputum culture results and clinical criteria (sarmiento. 2003). in our study, we used only culture as the gold standard. nevertheless, the fact that qpcr and conventional pcr results were so divergent surprises us because both assays used the same primers and sample processing. the main differences were (i) qpcr used a fluorescent internal probe for accuracy improvement, which per se justifies this finding, while the conventional pcr did not have the probe hybridisation step, (ii) samples were run in duplicate or triplicate in qpcr, whereas a single sample normally was run for conventional pcr and (iii) qpcr data were measurable and positive cases were defined based on a standard curve, whereas in conventional pcr, the results were based on the identification of a band in agarose gel corresponding in size to the amplified pcr product. for all these reasons, the conventional pcr test may not be reliable (al zahrani. 2001, chakravorty. 2005). the difference in sample processing is a limitation for comparative analysis of the accuracy of different molecular assays for tb diagnosis. a study on the performance of the xpert mtb / rif test with an is6110-taqman qpcr assay for the detection of mycobacteria in respiratory specimens processed by the standard procedure of decontamination and centrifugation reported no differences in overall sensitivity (79% vs. 84%, respectively) of both tests, which presented 100% sensitivity for smear - positive sputum, with no differences observed in smear - negative sputum sensitivity (57% vs. 68%, respectively) (armand. (2013) compared the performance of the xpert mtb / rif test using 1 ml of non - processed respiratory specimens with the cobas taqman mtb assay using decontaminated - concentrated respiratory specimens obtained from ~5 ml sputum. the performance of both assays using culture results as the gold standard showed that the overall sensitivities of the xpert (67.9%) and cobas (71.4%) assays were similar. the xpert sensitivity did not significantly differ between smear - positive and smear - negative (67% vs. 69%) sputum ; however, the reduction from the 87% sensitivity in smear - positive sputum to 54% sensitivity in smear - negative sputum observed with the cobas assay suggested that the sputum - decontamination processing included in the cobas protocol contributed to reducing the bacillary viability in culture, even though the proportional sputum volume used was larger than that used in the xpert test (park. 2013). comparing the performance of qpcr from sputum and blood samples of corresponding patients, the qpcr test exhibited an accuracy of 93% for the detection of tb in blood, showing good concordance with culture results (75%) and the qpcr results from sputum (63%). one explanation for this higher concordance with sputum culture than with qpcr testing of sputum was the high sensitivity of the qpcr test in sputum in relation to culture. the three cases of negative - culture and positive - qpcr results obtained from sputum were also negative - qpcr for blood, suggesting that mycobacteraemia might be associated with advanced disease. in this context, published data on the xpert test for tb detection in blood revealed a 21% sensitivity and 100% specificity compared with sputum culture (56% concordance), but a positive association was reported between positive xpert assay from blood samples and the mortality rate in hiv - infected patients (feasey. the main difference between the xpert study and our protocol was in sample processing : we used leukocytes purified from 5 ml peripheral blood, whereas the xpert protocol requires the collection of 18 ml of peripheral blood for cellular lyses and concentration into a 1 ml sample for introduction into the xpert cartridge for diagnosis. in this context, it is noteworthy that blood components such as haem, lactoferrin and immunoglobulin g have been associated with reduced amplification yield (al - soud. 2000, al - soud & rdstrm 2001) and the efficient removal of pcr - inhibitors from blood - extracted dna contributes to improved sensitivity of the pcr - based diagnostic assay. in hiv - infected patients, confirmation of the diagnosis of pulmonary tb from sputum is more difficult due to the low bacillary load in sputum and this difficulty is also associated with external factors that influence the sample quality, such as inadequate sputum collection, sample transportation, time delays in sample processing and the methodology employed. we believe that qpcr is one of the molecular tests that should be considered as a tool for the detection of pulmonary tb in smear - negative patients. | the present study analysed the concordance among four different molecular diagnostic methods for tuberculosis (tb) in pulmonary and blood samples from immunocompromised patients. a total of 165 blood and 194 sputum samples were collected from 181 human immunodeficiency virus (hiv)-infected patients with upper respiratory complaints, regardless of suspicious for tb. the samples were submitted for smear microscopy, culture and molecular tests : a laboratory - developed conventional polymerase chain reaction (pcr) and real - time quantitative pcr (qpcr) and the gen - probe and detect - tb ampligenix kits. the samples were handled blindly by all the technicians involved, from sample processing to results analysis. for sputum, the sensitivity and specificity were 100% and 96.7% for qpcr, 81.8% and 94.5% for gen - probe and 100% and 66.3% for detect - tb, respectively. qpcr presented the best concordance with sputum culture [kappa (k) = 0.864) ], followed by gen - probe (k = 0.682). for blood samples, qpcr showed 100% sensitivity and 92.3% specificity, with a substantial correlation with sputum culture (k = 0.754) and with the qpcr results obtained from sputum of the corresponding patient (k = 0.630). conventional pcr demonstrated the worst results for sputa and blood, with a sensitivity of 100% vs. 88.9% and a specificity of 46.3% vs. 32%, respectively. commercial or laboratory - developed molecular assays can overcome the difficulties in the diagnosis of tb in paucibacillary patients using conventional methods available in most laboratories. |
mechanical rotational thrombectomy devices can be utilized as a safe and effective alternative in the treatment of acute or subacute infrainguinal occlusions and chronic occlusions of the iliac and femoropopliteal arteries. the limitation of rotational thrombectomy with rotarex catheter (rotarex, straub medical ag, wangs, switzerland) is that there is no treatment possible in the infrapopliteal artery.1,2 laser atherectomy,3 the silverhawk atherectomy catheter,4 and the pathway atherectomy system are other atherectomy devices with promising results in initial trials.4,5 the comparatively high restenosis rate is the main problem with treatment of arterial stenosis and occlusions. to raise the patency rate after arterial intervention, a lot of methods have been developed. in randomized trials, the stent implantation has demonstrated an advantage over percutaneous transluminal angioplasty (pta) alone. however, this benefit was not always significant.6 stents coated with different drugs to reduce the restenosis rate are interesting approaches.7 the objective of this study is to investigate the combination of mechanical rotational catheter system and paclitaxel - coated balloon angioplasty for femoropopliteal occlusion. in this single center, retrospective study, 29 patients with acute / subacute or chronic occlusions of the superficial femoral artery (sfa) or popliteal artery (pa) were included. this study was exempt from the requirement for ethics committee approval because patients received standard treatment and the study constituted a retrospective review of their records. in our institute, all patients were treated using the rotarex catheter and drug - eluting balloons (debs ; in.pact pacific or in.pact admiral medtronic, usa). the risk profile, clinical classification according to the rutherford classification,8 and the pattern of occlusions are demonstrated in table 1. before treatment, after procedure, and after six months, all patients data were recorded by clinical investigation and documented by rutherford stage, standard treadmill ergometer, and designation of the ankle - brachial index (abi). to exclude reocclusions, additional ultrasound examinations were carried out. to plan the treatment, either a color - coded duplex sonography (ccds) or a ct-/mr - angiography an ipsilateral access was used in 27 patients (93%), and in 2 patients (7%), the cross - over technique was used. in 90% (n = 26) of patients, technical success after atherothrombectomy and deb use was defined as complete recanalization of the occlusion with a residual stenosis 50%. the working principal is the archimedes screw with a rotating inner helix and even rotating head of the catheter (1, 2). the paclitaxel - eluting pta balloon catheters (in.pact pacific and in.pact admiral) are over the wire (otw) peripheral balloon catheters, specifically designed for pta in atherosclerotic vessels. the catheter has a dual lumen shaft, one central lumen for the guide wire and a second tube used to inflate and deflate the balloon. the length and size of each balloon is specified ; the maximum guide wire diameter for pacific is 0.018 inch (0.46 mm) and the maximum guide wire diameter for admiral is 0.035 inch (0.89 mm). in.pact pacific and in.pact admiral are deb coated with paclitaxel (3 g / mm balloon surface) and urea as hydrophilic natural spacer.9 first of all, 5,000 iu heparin (ufh) were given intra - arterial. the caliber of the rotarex catheter for the target lesion was selected after implementation of angiography using a standard technique. according to the instructions for use, a vessel diameter up to 5 mm has to be treated with the rotarex 6f catheter. for lesions with a vessel diameter of 58 mm first, the occlusion was probed with a hydrophilic - coated guide wire (terumo stiff, 0.035 inch). then a 0.018 inch hydrophilic and teflon - coated guide wire was placed via a straight 4f catheter. above the target lesion, the tip of the rotarex catheter was placed and the complete occlusion was passed with alternating forward and backward movements. after this procedure and complete passage of the target lesion, a control angiography was obtained. a maximum of three passages with the rotarex catheter were conducted (mean 2.0 0.6 ; range 13). the technical success after intervention was defined as treated target lesion with a residual stenosis < 50%. after the femoral artery angiographic procedures, the puncture site was closed with hemostasis devices. our patients received acetylsalicylic acid (asa) 100 mg / day before intervention. during the intervention, each patient after treatment, the asa therapy (100 mg / day) was continued as a permanent therapy. for six weeks, a dose of 75 mg of clopidogrel / day was also given. after intervention, a loading dose of 300 mg of clopidogrel was administered. for each patient, in this single center, retrospective study, 29 patients with acute / subacute or chronic occlusions of the superficial femoral artery (sfa) or popliteal artery (pa) were included. this study was exempt from the requirement for ethics committee approval because patients received standard treatment and the study constituted a retrospective review of their records. in our institute, all patients were treated using the rotarex catheter and drug - eluting balloons (debs ; in.pact pacific or in.pact admiral medtronic, usa). the risk profile, clinical classification according to the rutherford classification,8 and the pattern of occlusions are demonstrated in table 1. before treatment, after procedure, and after six months, all patients data were recorded by clinical investigation and documented by rutherford stage, standard treadmill ergometer, and designation of the ankle - brachial index (abi). to exclude reocclusions, additional ultrasound examinations were carried out. to plan the treatment, either a color - coded duplex sonography (ccds) or a ct-/mr - angiography an ipsilateral access was used in 27 patients (93%), and in 2 patients (7%), the cross - over technique was used. in 90% (n = 26) of patients, technical success after atherothrombectomy and deb use was defined as complete recanalization of the occlusion with a residual stenosis 50%. the working principal is the archimedes screw with a rotating inner helix and even rotating head of the catheter (1, 2). the paclitaxel - eluting pta balloon catheters (in.pact pacific and in.pact admiral) are over the wire (otw) peripheral balloon catheters, specifically designed for pta in atherosclerotic vessels. the catheter has a dual lumen shaft, one central lumen for the guide wire and a second tube used to inflate and deflate the balloon. the length and size of each balloon is specified ; the maximum guide wire diameter for pacific is 0.018 inch (0.46 mm) and the maximum guide wire diameter for admiral is 0.035 inch (0.89 mm). in.pact pacific and in.pact admiral are deb coated with paclitaxel (3 g / mm balloon surface) and urea as hydrophilic natural spacer.9 first of all, 5,000 iu heparin (ufh) were given intra - arterial. the caliber of the rotarex catheter for the target lesion was selected after implementation of angiography using a standard technique. according to the instructions for use, a vessel diameter up to 5 mm has to be treated with the rotarex 6f catheter. for lesions with a vessel diameter of 58 mm first, the occlusion was probed with a hydrophilic - coated guide wire (terumo stiff, 0.035 inch). then a 0.018 inch hydrophilic and teflon - coated guide wire was placed via a straight 4f catheter. above the target lesion, the tip of the rotarex catheter was placed and the complete occlusion was passed with alternating forward and backward movements. after this procedure and complete passage of the target lesion, a control angiography was obtained. a maximum of three passages with the rotarex catheter were conducted (mean 2.0 0.6 ; range 13). the technical success after intervention was defined as treated target lesion with a residual stenosis < 50%. after the femoral artery angiographic procedures, the puncture site was closed with hemostasis devices. our patients received acetylsalicylic acid (asa) 100 mg / day before intervention. during the intervention, each patient after treatment, the asa therapy (100 mg / day) was continued as a permanent therapy. for six weeks, a dose of 75 mg of clopidogrel / day was also given. after intervention, a loading dose of 300 mg of clopidogrel was administered. for each patient, 2). a significant increase in the abi from 0.52 0.17 prior to the treatment to 0.89 0.18 after intervention demonstrated a hemodynamic success. in the follow - up after six months the improvement of rutherford stage showed a raise in clinical conditions (table 2). the period of rotational atherothrombectomy was 5 2.3 (115) minutes. in the middle after rotarex atherothrombectomy and pta with in.pact pacific with different lengths and sizes (table 2), 26 patients (89.7%) showed a residual stenosis of 30%. in the middle, 1.8 deb / patient were used. these patients required no further therapy. in three patients (10.3%), a stent implantation was necessary because of a residual stenosis of 50% or dissection (table 2). in the follow - up, no in - stent restenosis was documented by ultrasound examination. in the follow - up examinations, two high - grade restenoses (6.9%) arteriovenous fistulas, distal embolisms, and pseudoaneurysms were not observed. in one case, a dissection occurred during the procedure. we investigated the clinical outcome of a mechanical rotational thrombectomy catheter in combination with paclitaxel - coated angioplasty for the therapy of acute / subacute or chronic vascular occlusions. in varying studies, the rotarex catheter system has proved its efficiency in the therapy of acute and subacute occlusions.1,10 important reasons for repeated pta are restenosis and reocclusions after balloon angioplasty or stent implantation. restenosis can occur in 4060% of patients.6,11 the most common cause for the formation of restenoses is intimal hyperproliferation. further elastic recoil and remodeling are reasons for restenosis.12,13 regardless of all the technological progresses in balloons, the high rate of restenosis is problematic.11,14 the thunder study concluded that the rate of restenosis in the six - month follow - up could be reduced if paclitaxel - coated balloon catheters are used.15 the pacifier trial implied similar results with significant reductions of restenosis in the follow - up after femoropopliteal pta.9 in our study, just two restenoses were discovered in the six - month follow - up. until expansion, the paclitaxel adheres to the balloon catheters. the drug released during the inflation of the balloon is taken up by the vessel wall.16 therefore, a deb can only be used once. another risk factor for percutaneous intervention, this trouble occurs if agents like paclitaxel are used for prevention of restenosis.15 according to present literature, we prescribe clopidogrel for all patients to prevent thrombosis. in our patients, restenosis rate after rotarex atherothrombectomy in acute and subacute occlusions of femoropopliteal arteries was specified between 18 and 54%.1,11,17,18 in this study, a significantly lower rate of restenosis was noted (6.9%) after six months. a porcine overstretch model showed a reduction of intimal hyperplasia after the intra - arterial exposure of paclitaxel.19 after treatment with paclitaxel - coated balloon catheters in in - stent restenosis of coronary arteries, a significant reduction in incidence of restenosis was noted.20 in a randomized trial between conventional angioplasty balloon and deb, fanelli described a benefit of deb pta. pta.21 similar results were described by scheinert in the levant i trial that postulated a prevention of femoropopliteal restenosis after pta with paclitaxel - coated balloon.22 another possibility of directional atherectomy is the silverhawk atherectomy catheter. a technical success rate of 96% was reported by zeller.4 the restenosis rate of silverhawk atherectomy after six months was 22%. they concluded that an additional balloon angioplasty might be necessary in selected cases.4 distal embolic protection is a very important tool for directional atherectomy. the definitive ca trial investigated the safety and effectiveness of directional atherectomy and distal embolic protection of treatment of calcified femoropopliteal disease.23 the results demonstrated that the atherectomy devices (silverhawk and turbohawk) are safe and effective in treatment of moderate to severely calcified lesions in femoropopliteal arteries. thereby, the thrombotic material can be aspirated into the cutting window of the catheter. there, the material is crushed and transported via a screw conveyor into a collection bag.1,2 there are no interruptions necessary for cleaning the protection device, and a continuous workflow of atherectomy is guaranteed. the complication rate in our patient collective (3.5%) is comparable with that of other atherectomy studies.3,18,23 the complication in our study group (n = 1) could be treated during the intervention. the benefits of other directional atherectomy devices in combination with paclitaxel - coated balloon catheters have to be investigated in other studies. also long - term results are necessary for a final evaluation of rotational atherothrombectomy in combination with paclitaxel - coated balloon catheters. the price of the rotarex system is comparable to that for silverhawk atherectomy or laser angioplasty. the costs of the rotarex system and the use of paclitaxel - coated balloon catheters can be covered within the german drg system, which is relevant for us.24 the use of atherectomy systems in combination with deb means initially higher costs than pta or stent - assisted pta. we think that by the use of both systems in combination, the rate of restenosis could be reduced. the use of the rotarex system for the atherectomy of acute / subacute and chronic occlusions of femoropopliteal arteries in combination with paclitaxel - coated balloon catheters is safe and effective. the deb seems to be a prevention of restenosis at the six - month follow - up. | objectivethe rotational atherothrombectomy with straub rotarex is a safe and efficient treatment of acute / subactute vascular occlusions. the purpose of this study was to evaluate the benefit of paclitaxel - coated angioplasty after rotational atherothrombectomy over an observation period of six months.materials and methodsoverall, 29 patients were treated with the rotarex catheter in combination with paclitaxel - coated angioplasty. all patients had acute / subacute and chronic occlusions of the superficial femoral artery (sfa) and/or popliteal arteries. the ankle - brachial index (abi) was detected before the intervention, after the procedure, and after six months. also clinical examination and ultrasound scans were done in the observation period.resultsthere were no technical failures. the abi shows a significant increase from 0.52 0.17 to 0.91 0.25 in the follow - up. by ultrasound examination, there were found two (6.9%) restenoses during the follow - up. there was one dissection during the intervention (3.5%).conclusionthe rotational atherothrombectomy in combination with paclitaxel - coated angioplasty might be an effective and safe method with a promising low rate of restenosis at six months. |
streptococcus agalactiae is the principal cause of bacterial sepsis, neonatal meningitis and endocarditis in parturient women. it is also a cause of pneumonia particularly in the immunocompromised elderly (1). s. agalactiae commonly colonizes the gastrointestinal and urogenital tracts of humans (2) and the proteins enabling the bacteria for colonization, invasion and evasion are poorly defined (3). the interaction between s. agalactiae and the epithelial cells the fibronectin functions as a binding site for s. agalactiae through an insoluble phase (4, 5). a sequence of arginine, glycine and aspartic acid (rgd) in fibronectin is also involved in binding to proteins (6). furthermore, c5a peptidase has a high affinity to the rgd sequence of the fibronectin and plays a significant role in adhesion and invasion (4). however, the fibrinogen in s. agalactiae performs key role in attachment (7) and fbsa and fbsb are recognized fibrinogen - binding proteins (2). the fbsa binds to cell wall covalently because of lpxtg motif while the fbsb seems to be secreted due to lack of such motif (8). both proteins promote the entry of the s. agalactiae into the epithelial cells (9). these enzymes play an important role in remodeling, turnover, division and separation of the cell wall (10). in critical situations, some of the peptidoglycan hydrolases(autolysin) facilitate self - disintegration(autolysis) of the peptidoglycan (11, 12). while there is no clear evidence about the details of autolysin in s. agalactiae, s. aureus (atl) contains two major domains of autolysin : amidase and glucosaminidase (11). another autolysin of s. aureus (aaa) is bifunctional, and it also mediates adherence to immobilized fibrinogen and fibronectin (14). similar roles were found in other streptococcus species such as streptococcus pneumoniae (15). the s. agalactiae contains proteins which are not fully understood of their roles, like gbs1805. in this study, afb, which is a novel protein encoded by gbs1805 gene in s. agalactiae was cloned, over expressed and purified. in silico analysis of afb this experimental study was performed on functional analysis of gbs1805 gene of s. agalactiae. the strains and plasmids used in this study the s. agalactiae isolate were grown on blood agar enrichedby 5% sheep blood. also, escherichia coli strains were cultured overnight on luria bertani (lb) (merck, germany) broth at 37 c. bacterial strains and plasmids chromosomal dna of s. agalactiae was extracted using dna extraction kit (promega, usa) based on the manufacturer s instructions. the upstream (gcgcgccatatgatacatataactatgcagtagatgta) and the downstream (gcgcgcctcgagattcggataaatgtagctaactac) primers (20pmol/l) with the underlined restriction sites were used to amplify the gbs1805 gene at : 95 c for 5 min, 95 c for 1 min, 59 c for 45 seconds (30 cycles), 72 c for 45 seconds and 72 c for 10 seconds. the amplified gene and pet21a were double digested by ndei and xhoi enzymes (takara, japan) and ligated using t4 ligase (takara, japan). then, the recombinant vector was transformed to escherichia coli dh5. then positive clones were chosen fromthe ampicillin - supplemented lb agar plates and were confirmed by colony pcr and sequencing of plasmid. the overexpression was optimized at 37 c, 1mm / ml iptg (fermentas, usa) for 4 hours oncethe culture has reached od600 of 0.6. the recombinant insoluble protein was purified by qiagen purification kit (qiagen, netherland) based on the manufacturer s instructions. the purification process included 4 steps : cell lysis, binding, washing and elution. 12.5% sds - page gel was applied to analyze the purified recombinant protein by coomassie brilliant blue staining. the membrane was blocked overnight (4 c) with 3% skimmed milk in pbs. subsequently, it was washed three times in a washing buffer (tween 20 and pbs) and incubated in his - tag antibody (sigma, usa) diluted in 1:1000 in pbs for 1h at room temperature. afterwards, the membrane was washed three times and dab substrate (3, 3-diaminobenzidine) (sigma, usa) was added to detect the recombinant protein. western blotting was used to assess binding to biotinylated plasma proteins (fibrinogen and fibronectin). the recombinant protein was electroblotted on nitrocellulose membrane as previously mentioned. after blocking and washing the membrane, it was incubated in plasma protein (fibrinogen and fibronectin) diluted in 1:1000 for 3h at room temperature. then the membrane was washed as before and incubated in streptavidin (roche, germany) diluted washing buffer in 1:30000 at room temperature for 3h. subsequently, the membrane was washed and incubated in alkaline phosphatase buffer for 5 min. then the membrane was immersedin nbt / bcip (roche, germany) solution and kept in dark condition until the protein band appears. the s. agalactiae isolate were grown on blood agar enrichedby 5% sheep blood. also, escherichia coli strains were cultured overnight on luria bertani (lb) (merck, germany) broth at 37 c. chromosomal dna of s. agalactiae was extracted using dna extraction kit (promega, usa) based on the manufacturer s instructions. the upstream (gcgcgccatatgatacatataactatgcagtagatgta) and the downstream (gcgcgcctcgagattcggataaatgtagctaactac) primers (20pmol/l) with the underlined restriction sites were used to amplify the gbs1805 gene at : 95 c for 5 min, 95 c for 1 min, 59 c for 45 seconds (30 cycles), 72 c for 45 seconds and 72 c for 10 seconds. the amplified gene and pet21a were double digested by ndei and xhoi enzymes (takara, japan) and ligated using t4 ligase (takara, japan). then, the recombinant vector was transformed to escherichia coli dh5. then positive clones were chosen fromthe ampicillin - supplemented lb agar plates and were confirmed by colony pcr and sequencing of plasmid. the overexpression was optimized at 37 c, 1mm / ml iptg (fermentas, usa) for 4 hours oncethe culture has reached od600 of 0.6. the recombinant insoluble protein was purified by qiagen purification kit (qiagen, netherland) based on the manufacturer s instructions. the purification process included 4 steps : cell lysis, binding, washing and elution. 12.5% sds - page gel was applied to analyze the purified recombinant protein by coomassie brilliant blue staining. the membrane was blocked overnight (4 c) with 3% skimmed milk in pbs. subsequently, it was washed three times in a washing buffer (tween 20 and pbs) and incubated in his - tag antibody (sigma, usa) diluted in 1:1000 in pbs for 1h at room temperature. afterwards, the membrane was washed three times and dab substrate (3, 3-diaminobenzidine) (sigma, usa) was added to detect the recombinant protein. western blotting was used to assess binding to biotinylated plasma proteins (fibrinogen and fibronectin). the recombinant protein was electroblotted on nitrocellulose membrane as previously mentioned. after blocking and washing the membrane, it was incubated in plasma protein (fibrinogen and fibronectin) diluted in 1:1000 for 3h at room temperature. then the membrane was washed as before and incubated in streptavidin (roche, germany) diluted washing buffer in 1:30000 at room temperature for 3h. subsequently, the membrane was washed and incubated in alkaline phosphatase buffer for 5 min. then the membrane was immersedin nbt / bcip (roche, germany) solution and kept in dark condition until the protein band appears. the gbs1805 gene was amplified by pcr (fig. 1) and cloned into pet21a in e. coli dh5 as cloning host. then, the constructed plasmid was transformed into bl21 and expressed as a hexahistidyl - tagged protein. the recombinant protein was successfully purified using ni - nta (qiagen, netherland), as predicted by bioinformatics analysis in jcvi. a full sized 18 kda mature protein was indicated by the sds- page (fig. 2). then, the purified his6-tagged recombinant protein was confirmed by anti his - tag western blot experiment (fig. (m) marker 100bp (geneon, usa), (1) positive control streptococcus agalactiae nem316, (24) clinical isolates (m) : unstained protein marker (fermentas, usa), lane1 : purified recombinant protein (18 kda). lane1 : prestained marker (sinaclon, iran), lane2 : recombinant protein (18 kda). lane 1 : prestained marker (sinaclon, iran), lane 2 : positive control (ant ii), lane 3 : recombinant protein (18 kda). lane 1 : prestained marker (sinaclon, iran), lane 2 : positive control (ant ii), lane 3 : recombinant protein (18 kda). attachment to specific receptors is the initial step in the pathogenesis of gram - positive bacteria (16). the most common receptors mediating adherence to epithelial cells including fibrinogen and fibronectin are parts of the extra cellular matrix (ecm) (2, 17) and fibrinogen and fibronectin are known to be the major components of the ecm in a number of gram - positive bacteria (18, 19). in this study, afb (autolysin, fibrinogen / fibronectin binding), is identified to be a novel protein of group b streptococcus capable of bindingto fibrinogen and fibronectin. s. agalactiae interacts with fibrinogen via a variety of proteins including fbsa, fbsb, fbsc, srr1 and srr2 (2, 8, 20, 21). fibrinogen is expressed on epithelial and endothelial cell surfaces and interferes complement activation (22), phagocytosis and polymorphonuclear activation (23). since fbsa protects s. agalactiae against opsonophagocytosis (9), deletion of fbsa leads to reduced proliferation of the bacterium in blood (7). the interaction of srr1 and fibrinogen contribute to pathogenesis and plays key role in attachment to brain microvascular endothelial cells (24). the binding ability to epithelial and endothelial cells, biofilm formation and invasion decreases significantly in fbsc - negative mutants (20). furthermore, fbsa and fbsb also participate in evasion of host defense (23). fibronectin, another component of ecm, produce - sa549 on cell surfaces in the respiratory tract and on vaginal and cervical cells (6, 25). the well - defined fibronectin binding protein of group b streptococcus encoded by scpb gene, known asc5a peptidase, adheres to epithelial cells and involved in evasion (4). however, the scpb defective mutant s. agalactiae s attachment to fibronectin significantly decreaseswhen compared to the wild strain (6). in addition to the binding activity of afb, it seems to be a peptidoglycan hydrolase. the possible role of the afb in the attachment process and its substantial pathogenicity is not well recognized due to the lack of afb - defective mutant s. agalactiae. commonly, peptidoglycan hydrolases deal with cell separation, turn over, remodeling, and degradation of cell wall. evidence shows that peptidoglycan hydrolases, autolysins, are involved in the pathogenesis and virulence of gram - positive bacteria by mediating bacterial adherence (26, 27). to date numerous autolysin / adhesion proteins including aaa, atl, aas, aae, lytm, amic, etc which confirmed binding to ecm are described undergram - positive bacteria (11, 1315, 28). in vivo studies demonstrated that autolysin - defective mutants to be less virulent than wild type strains of listeria monocytogenes, s. aureus, s. pneumonia, and s. epidermidis (2931). in silico studies of afb demonstrated high homology to amidase, and zymography confirmed the activity in vitro (fig 5). therefore, afb can be a bifunctional protein, based on its binding affinity to two plasma proteins and amidase like activity. the afb is a novel protein encoded by gbs1805 in s. agalactiae and is capable to bind with the plasma proteins - fibrinogen and fibronectin. the role of the protein in adhesion and colonization of the bacterium is unknown and needs further investigation. | background and objectives : streptococcus agalactiae is the leading cause of bacterial sepsis and meningitis in newborns and results in pneumonia and bacteremia in adults. a number of s. agalactiae components are involved in colonization of target cells. destruction of peptidoglycan and division of covalently linked daughter cells is mediated by autolysins. in this study, autolytic activity and plasma binding ability of afb novel recombinant protein of s. agalactiae was investigated.materials and methods : the gbs1805 gene was cloned and expressed. e. coli strains dh5 and bl21 were used as cloning and expression hosts, respectively. after purification, antigenicity and binding ability to plasma proteins of the recombinant protein was evaluated.results:afb, the 18kda protein was purified successfully. the insoluble mature protein revealed the ability to bind to fibrinogen and fibronectin. this insoluble mature protein revealed that it has the ability to bind to fibrinogen and fibronectin plasma proteins. furthermore, in silico analysis demonstrated the afb has an autolytic activity.conclusions:afb is a novel protein capable of binding to fibrinogen and fibronectin. this findings lay a ground work for further investigation of the role of the bacteria in adhesion and colonization to the host. |
pentacene was deposited on a muscovite mica surface by physical vapor deposition from a knudsen cell in an ultrahigh vacuum chamber. the cell temperature was about 500 k to realize a deposition rate of 1 monolayer / min. the mica samples (10 10 0.01 mm) were attached to a steel plate via tantalum wires. the steel plate was heated resistively, and its temperature was controlled by a ni, the temperature of the mica sample could be varied between 100 and 1000 k. for a quantitative determination of the deposited material, a quartz microbalance was used, which was located next to the mica substrate. the mica substrate was cleaved with adhesive tape prior to installation into the vacuum chamber and subsequently gently sputtered by argon ions. ten minutes of sputtering with 500 ev ar ions at an argon pressure of 5 10 mbar was sufficient to change the 5a film morphology from needle - like islands, composed of lying molecules, to compact islands composed of standing molecules. the surface chemical composition was analyzed by auger electron spectroscopy and x - ray photoelectron spectroscopy. thermal desorption spectroscopy was applied to determine the thermal stability of the pentacene film and the sticking coefficient. ex situ atomic force microscopy (nanosurf, easyscan2) was used to analyze the film morphology. | organic thin films have attracted considerable interest due to their applicability in organic electronics. the classical scenario for thin film nucleation is the diffusion - limited aggregation (dla). recently, it has been shown that organic thin film growth is better described by attachment - limited aggregation (ala). however, in both cases, an unusual relationship between the island density and the substrate temperature was observed. here, we present an aggregation model that goes beyond the classical dla or ala models to explain this behavior. we propose that the (hot) molecules impinging on the surface can not immediately equilibrate to the substrate temperature but remain in a hot precursor state. in this state, the molecules can migrate considerable distances before attaching to a stable or unstable island. this results in a significantly smaller island density than expected by assuming fast equilibration and random diffusion. we have applied our model to pentacene film growth on amorphous muscovite mica. |
ocular dominance is the preference of one eye over the other in terms of sighting, sensory, and oculomotor tasks [1, 2 ]. ocular dominance is clinically important in sports vision and vision therapy, but the most important application of the principles of ocular dominance is fitting of monovision contact lenses and applying monovision excimer laser refractive surgery for near vision [2, 3 ]. contrast sensitivity is defined as the ability to differentiate between light and dark in a series of bands with no clear boundary. it is revealed that impaired contrast sensitivity may be present in cases of normal visual acuity. visual acuity is a measure of the spatial - resolving ability of the visual system under conditions of very high contrast (at least 85%) ; all targets are presented at the same contrast, but their sizes vary during the test, whereas contrast sensitivity is a measurement of the threshold contrast for seeing a target ; but contrast is not kept constant during the test. ross. found that, in the age range 5087 years when compared to 2030 years, there was a linear decline in contrast sensitivity with age for medium and high spatial frequencies, but sensitivity for low spatial frequencies was independent of age. in the aspect of ocular dominance, suttle. monovision therapies like contact lens for near vision, corneal refractive surgery for near vision, and multifocal intraocular lens implantation in various cases generally come into consideration in middle - aged people. since nondominant eye is usually chosen for near vision applications, it is important to reveal whether ocular dominance affects contrast sensitivity, because monovision therapies might also have a negative influence on it. in this study, we aimed to evaluate the effects of sighting ocular dominance on contrast sensitivity in middle - aged healthy people. ninety eyes of 45 healthy middle - aged subjects (30 males and 15 females) were included in this retrospective comparative study. the study and data collection conformed to all local laws and were compliant with the principles of the declaration of helsinki. patients who were aged between 40 and 60 years and were having uncorrected visual acuity (ucva) of 20/25 or better (snellen chart), keratometry values between 41 and 47 diopters, and spherical or cylindrical refractive error values between + 0.50 and 0.50 diopters were eligible for inclusion in the study. those parameters were evaluated in order to eliminate other factors that might have an influence on contrast sensitivity other than ocular dominance. both ocular dominance and contrast sensitivity measurements were done with spectacle correction. in order to avoid observer bias, exclusion criteria were any ocular surgeries, ocular diseases, such as corneal opacities or irregularity, dry eye, amblyopia, anisometropia, glaucoma, retinal abnormalities, any neurological disorder, diabetes mellitus, taking medications that might affect contrast sensitivity, insufficient mental capacity to perform the tests, and any physical disability that might make it difficult to perform the test. the participant is given a card with a small hole in the middle, instructed to hold it with both hands, and then told to view a distant object through the hole with both eyes open. the observer then alternates closing the eyes or slowly draws the opening back to the head to determine which eye is viewing the object (this is the dominant eye). functional acuity contrast testing (f.a.c.t.) was measured using the optec 6500 vision testing system (stereo optical co. inc., chicago, il, usa) with natural pupil under both the photopic condition (target luminance value of 85 cd / m) and mesopic condition (target luminance value of 3 cd / m). sequence of testing was as follows : 1.5, 3, 6, 12, and 18 cpd (cycles per degree). examinations under photopic conditions were done at first, and, after 10 minutes of dark adaptation, examinations under mesopic condition were performed. contrast sensitivity values were converted to numerical values by using a conversion chart of f.a.c.t. contrast sensitivity values of dominant and nondominant eyes were compared at all five spatial frequencies (1.5, 3, 6, 12, and 18 cpd). since this test needs full concentration for appropriate results, all the measurements were repeated three times at all spatial frequencies. all the examinations were done by two researchers (gp and na). for statistical analysis, spss 17.0 software for windows (spss inc., chicago, il, usa) was used. paired samples t - test was used to compare contrast sensitivity values of the dominant and nondominant eyes. forty patients (91%) had their dominant eyes on the same side as the master hand. the mean central corneal thickness (cct) of the dominant eyes was 567.04 23.86 m and the mean cct of the nondominant eyes was 563.70 28.84 m (p = 0.21). the mean pupil diameter of the dominant eyes was 5.68 0.55 mm and the mean pupil diameter of the nondominant eyes was 5.69 0.54 mm (p = 0.75). at all spatial frequencies (1.5, 3, 6, 12, and 18 cpd), under mesopic conditions, the contrast sensitivity values of the dominant eyes were slightly greater than those of the nondominant eyes. however, among all of the differences between the values of the two groups, only mesopic 18 cpd spatial frequency measurements were statistically significant (p = 0.035). under photopic conditions, the contrast sensitivity values of the dominant eyes and nondominant eyes were similar at all spatial frequencies (p > 0.05). tables 1 and 2 show numerical contrast sensitivity values and p values under photopic and mesopic conditions. when the data were transformed into logarithmic units, the p value for the comparison of dominant and nondominant eyes became 0.08 at mesopic 18 cpd. for all the other comparisons at photopic and mesopic states, p value was > 0.05 similar to using cs scores. ocular dominance is usually defined as the superiority of one eye over the other in some sensory or motor tasks. ocular dominance is an important consideration in monovision therapies, because it helps us to decide which eye should be corrected for near or far. ocular dominance has a strong effect on the success of monovision techniques. when with both eyes open, people with normal binocular vision have no sense that one eye or the other contributes more strongly to the combined binocular vision ; it is only sensed when normal binocular vision is deteriorated. generally, blurring the dominant eye causes more discomfort when compared with blurring the nondominant eye at far, so it seems convenient to choose the nondominant eye for near correction. this is an easy, repeatable, and reliable test for sighting ocular dominance detection. the dominant eye is often, but not always, on the same side as the master hand ; this statement was also acceptable for our patients. in this study, functional acuity contrast testing (f.a.c.t.) was measured using the optec 6500 vision testing system. in this test, the test targets were vertically oriented sine - wave gratings, so - named because the luminance of the vertical bars varied sinusoidally over space. the bar gratings presented to the test subject covered spatial frequencies of 1.5, 3, 6, 12, and 18 cycles per degree (cpd) of visual angle. in general, contrast sensitivity function had its peak sensitivity at intermediate spatial frequencies (36 cpd) with a steep decrease at high spatial frequencies and a more gradual decrease at lower frequencies. suttle. found no significant interocular difference in contrast sensitivity or alignment sensitivity in their study. handa. investigated the effects of ocular dominance on binocular summation after monocular reading adds and found that, with strong ocular dominance, defocus results in a greater loss of contrast sensitivity than with weak ocular dominance. in this study, there was not statistically significant difference at all spatial frequencies in mean photopic contrast sensitivity values between dominant and nondominant eyes. but, in mesopic condition, at 18 cpd, there was statistically significant difference that dominant eye had greater contrast sensitivity function values. in the f.a.c.t. chart, mild refractive disorders and early cataracts generally cause contrast sensitivity losses at higher spatial frequencies, whereas severe refractive disorders and advanced cataracts cause contrast sensitivity losses at lower spatial frequencies [13, 14 ]. although it was not previously reported that interocular difference occurred on higher spatial frequencies like 18 cpd, we found that dominant eye had better contrast sensitivity function values at mesopic 18 cpd spatial frequency. this result might be interpreted as deterioration of stereopsis and decrease of reading capacity (if near monovision therapy was performed) at mesopic 18 cpd. the present study is one of the few conducted to describe contrast sensitivity function values in a middle - aged population. there are several reports in the literature about the effect of age on contrast sensitivity [15, 16 ]. found that age - related decrease in contrast sensitivity was confirmed at all frequencies in japanese population, even when adjusted for visual acuity, and added that contrast sensitivity tests, especially at high frequencies, assessed aspects of visual function that could not be determined in the elderly population from visual acuity tests alone. revealed that statistically significant age - related declines in contrast sensitivities occurred due to age - related changes in the magnocellular pathway. in this study, contrast sensitivity curves both under photopic and mesopic conditions did not show any pathological patterns in middle - aged population. found that senile miosis was not responsible for older adults ' loss in spatial vision ; rather, older adults ' miotic pupil tended to have a positive effect on their spatial vision in that it slightly improved their contrast sensitivity. in this study, in order to avoid pupil diameter influences, we tried to do measurements under similar pupil diameter values. since monovision therapies are usually applied in middle - aged people, it is important to make visual measurements of this age group. the presbyopic patients over the age of 40 years are the best candidates for monovision. beyond the past literature, this study investigated contrast sensitivity and other ocular parameters in people whose age ranged between 40 and 60 years. some of the factors contributing to better results in monovision therapies include good interocular blur suppression, posttreatment anisometropia of less than 2.50 diopters, successful distance correction of the dominant eye, good stereoacuity, and motivation to adapt to this visual system. although we did not measure the degree of ocular dominance in this study, the degree of ocular dominance plays a strong role in monovision success. handa. reported that patients with strong sighting preference tended to have reduced interocular blur suppression and decreased binocular depth of focus that makes monovision less tolerable. schor. have found that interocular blur suppression is more effective under photopic viewing conditions than high contrast mesopic and scotopic conditions. horn revealed that suppression of the out of focus image in the near eye is easier under lower contrast viewing situations. our contrast sensitivity scores provided were slightly low when compared to some other fact data in the literature. some concerns about statistical analysis might come to one 's mind that it would be better to use logarithmic units while interpreting the data ; but according to us there is no definitive superiority of using logarithmic units instead of cs scores. in conclusion, in the present study, at mesopic 18 cpd, contrast sensitivity of a nondominant eye was slightly lower than that of the dominant eye. although this parameter is not the best indicator of monovision treatment success, it is worth giving importance. | purpose. our aim was to compare contrast sensitivity values of the dominant and nondominant eyes of healthy middle - aged subjects. material and methods. ninety eyes of 45 healthy middle - aged subjects (30 males and 15 females) were included in this study. patients were aged between 40 and 60 years, having uncorrected visual acuity (ucva) of 20/25 or better (snellen chart). ocular dominance was determined by hole - in - the - card test. functional acuity contrast testing (f.a.c.t.) was measured using the optec 6500 vision testing system (stereo optical co. inc., chicago, il, usa) under both photopic and mesopic conditions. results. at all spatial frequencies (1.5, 3, 6, 12, and 18 cpd), under mesopic conditions, the contrast sensitivity values of the dominant eyes were slightly greater than those of the nondominant eyes ; but only 18 cpd spatial frequency measurements ' difference was statistically significant (p = 0.035). under photopic conditions, the contrast sensitivity values of the dominant eyes and non - dominant eyes were similar at all spatial frequencies (p > 0.05). conclusions. the photopic and mesopic contrast sensitivity values of dominant and nondominant eyes of healthy middle - aged people were similar at all spatial frequencies, except at mesopic 18 cpd spatial frequency. |
phechromocytomas are rare cathecholamine secreting tumors derived from the chromaffin cells of the embryonic neural crest. although these tumors are similar in origin, the clinical manifestations, prognosis and management differ and occurrence of pheochromocytoma in patients with hypertensive symptoms is less than 0.5%. while pheochromocytomas and abdominal paragangliomas are catecholamine - producing tumors of the sympathetic nervous system, head and neck paragangliomas are non - secreting tumors of parasympathetic origin. recent developments in clinical and molecular research on these tumor forms have significantly clarified their genetic backgrounds and challenged the view of pheochromocytoma as the 10% rule tumor. it has been known for some time that pheochromocytomas present as a component of the familial syndromes multiple endocrine neoplasia type 2, von hippel - lindau disease and, rarely, neurofibromatosis type 1. germline mutations have been identified in these diseases in, respectively, the proto - oncogene ret, and the tumor suppressor genes vhl and nf1. more recently, germline mutations in the genes encoding succinate dehydrogenase subunit d (sdhd) and subunit b (sdhb) have been described in patients with pheochromocytomas. the current definition of a malignant pheochromocytoma is the presence of metastases, although elegant attempts have been made to outline histopathological risk factors for the malignant course of these tumors. we report a case of adrenal phechromocytoma in a 25-year - old man who presented with hypertension, palpitations and excessive sweating that was managed by left adrenalectomy after medical control of symptoms, and who is free from recurrence one year after surgery. we also highlight the techniques adopted in pre- and peri - operative management of hypercathecolaminemia, the difficulty in predicting malignancy or otherwise, and strategies for improving patient compliance with follow up in a developing country. a 25-year - old man was referred by nephrologists with recurrent episodes of palpitation and headache of two years duration. he also complained of excessive sweating that meant he had to wash 67 times a day. he was started on amlodipine 10 mg die, -methyldopa 250 mg three times a day, and ranitidine 300 mg at night for two weeks, all in tablet form. the following tests were perfomed : serum electrolytes urea and creatinine (s / e / u / cr), chest x - ray, postero - anterior view (cxr, pa view), serum protein, lipid profile, urinalysis, full blood count (fbc), human immune deficiency virus screening (hiv screening), hepatitis b surface antigen screening (hbsag), hepatitis c virus screening (hcv), abdominal ultrasound scan and 24 h urine assay. the results are listed in table 1. table 1results of tests performed.resultsnormal ranges / e / u / crna136 mmol / l(135145 mmol / l)k4.6 mmol / l(3.55.0 mmol / l)hco328 mmol / l(2428 mmol / l)cl98 mmol / l(97108 mmol / l)urea3.1 mmol / l(2.58.5 mmol / l)cr2.6 mmol / l(44.2194.5 mmol / l)ca22.6 mmol / l(2.22.8 mmol / l)po40.8 mmol / l(11.018.0 mmol / l)serum proteintotal74 g / l(6285 g / l)albumin48 g / l(3550 g / l)globulin26 g / l(2335 g / l)lipid profilecholesterol3.7 mmol / l(1.5 mmol / l)ldl1.9 mmol / l(0.77 mmol / l)tg0.3 mmol / l(3/10hpf) (2)2atypical mitotic figures (2)2profound nuclear pleomorphism (1)1hyperchromasia (1)1total8 phechromocytomas are rare cathechola - mine secreting tumors derived from the chro - maffin cells of the embryonic neural crest. approximately 85% arise from chromaffin cells in the adrenal medulla, and 15% arise from chromaffin tissue in extra - adrenal sites extending from the neck to the pelvis, although most are found intra - abdominally. common presenting features are hypertension, palpitations and sweating, which our patient had for two years before a diagnosis was made. it has been shown that phechromocytoma is a rare tumor in black africans with similar symptomatology to other races. however, laboratory and radiological facilities for diagnosis are limited in sub - saharan africa. a high index of suspicion remains the most important factor in determining whether a correct early diagnosis can be made. the need for pre - operative control of blood can not be overemphasized, as cardiovascular complications such as congestive cardiac failure, hypertensive encephalopathy and pulmonary edema are well known, and it has been shown that pre - operative patient preparation has accounted for the most significant reduction in peri - operative mortality. the use of blockade using phenoxybenzamine or prazosin to reduce blood pressure and facilitate volume expansion is well established, but calcium channel blockers such as amlodipine can achieve a similar reduction without the risk of orthostatic hypotension. access to the gland was obtained using an abbreviated chevron incision, which has been judged to provide good superior and lateral access to the adrenal gland, and gave excellent exposure that allowed controlled dissection. it has been stated that, wherever possible, phechromocytoma should be removed using a laparoscopic approach, to achieve less postoperative pain, faster recovery and better cosmesis, unless the tumor is large as was the case in our patient. we did note that the open approach afforded the patient safe and complete tumor resection. there was no evidence of capsular or vascular invasion by the tumor, but considering the pass score of 8, we counseled the patient on the need for long - term follow up. this we have done by phone calls to remind the patient of clinic appointments and intermittent home visits to reaffirm earlier discussions regarding compliance with follow up. this was greatly facilitated by the widespread availability of cell phones in nigeria, with the availability of global system for mobile telephony (gsm) mobile telephones since 2001. at his last hospital visit, urine assay for metanephrine and normetanephrine were normal and repeat ultrasound showed no evidence of recurrence. we would like to perform a postoperative magnetic resonance imaging or computerized tomography, but this is not yet possible due to the cost ($ 450$1000). i - labeled meta - iodobenzylguanide scintigraphy and positron emission tomography using f fluorodopamine are not currently available in our setting. in conclusion, pheochromocytoma management is challenging and is made more so in countries with limited resources. it can, however, be diagnosed and treated effectively, with a high index of suspicion especially amongst primary care physicians. we recommend the following guidelines to aid diagnosis and treatment in developing countries. in settings with few resources, all newly diagnosed hypertensive patients under the age of 35 years be screened with the following simple easily available tests : i) urine metanephrine ; ii) urine normetanephrine ; iii) urine vma ; iv) abdominal ultrasonography to detect presence of adrenal and or other retroperitoneal swellings ; v) genetic testing (where available) for germline mutations in ret proto oncogene, vhl tumor suppressor gene, nf-1 tumor suppressor gene, and b and d subunits of mitochondrial succinate dehydrogenase sdhb and sdhd, under the following conditions : i) positive family history ; ii) clinical evidence of syndromic disorder e.g. vhl and men 2. treatment : i) determine total number of swellings and trigger factors ; ii) perform abdominal, mri scanning or ct scan if mri is not available to localize tumor properly ; iii) commence pre - treatment with calcium channel blockers ; iv) avoid blockers if possible ; v) commence volume replacement on admission 2448 h before surgery, and assess adequacy of same with urine output monitoring ; vi) establish contact and have a patient - centered discussion with an anesthetic team to anticipate problems and offer solutions to them proactively and prepare for same ; vii) anticipate possible intensive care unit admission pre - operatively and prepare for same. in conclusion, the role of adequate pre - operative preparation is vital to reduce perioperative morbidity and mortality, and is safely achieved with calcium channel blockers and volume expansion using normal saline. | pheochromocytomas are rare tumors that present a diagnostic challenge in developing countries. they occur in the adrenal gland and as paragangliomas along the sympathetic chain. clinical features are usually those of sustained or paroxysmal hypertension and complications thereof. surgical extirpation remains the mainstay of treatment and is greatly facilitated by accurate pre - operative tumor localization. pre - operative medical management with antihypertensive medication has led to significant reductions in peri - operative mortality. determination of malignancy is difficult in the absence of obvious metastases. we present a case of left adrenal phechromocytoma that was stabilized. adrenalectomy had a good outcome and the patient has so far been followed up for a year. |
management is the art of performing jobs by or with other people mary parker follet [figure 1 ]. this is one of the many definitions of management, but apart from these definitions, it is very important to mention one of the general management theory postulates that gave henry fayol and which proposed the five primary functions of management as : anticipate and plan, organize, command, coordinate and control. in the few last decades, papilloma and herpes viruses gets more importance in the development of epithelial dysplasia, neoplasia and cervix cancer. cervix cancer has the second place in mortality from gynecology diseases with the incidence of 350,000 new cases diagnosed each year. in countries where screening is well - developed, such as england, the number of women suffering and dying from cervix cancer has been reduced by 80%. breast cancer is the most common cancer among women (about 32% of all cancers) and the most common cause of death in the age of 45 - 55 years. in the world mortality was significantly reduced to about 25%, thanks to the early detection and modern therapy. the incidence of the polycystic ovary syndrome (pcos) is 15 - 25% in the population of women in the reproductive age according to the european criteria. luckily, after the age of 40 it is relieved by hyperandrogenemia spontaneously so that in this age the incidence is about 15% and in perimenopausal period the incidence is 10%. diagnosis is made by medical history (general, gynecologic, family), clinical examination (general condition of the patient - performance status and gynecological speculum examination, bimanual and rectal), by taking the smear by papanicolaou method and histological examination after biopsy. papanicolaou test is the standard test for cervix cancer detection and like some results of several studies shows this cytological test reduces the incidence of cervix cancer in many countries. numerous studies have shown that the rate of incidence and mortality are significantly reduced where there is organized screening. the general practitioners has an important role to make sure that most of the women are attending regular, systematic gynecological examinations according to recommendation that exist in the national guide for the prevention of malignant diseases. in terms of medical science and practice this imply : how to identify, lead and resolve, also treat the diseases according to certain guidelines and treatment algorithms. furthermore, disease management and compliance means algorithms and the adoption of certain postulates by family doctors in the health care centers as they represent the first line of meeting and solving certain diseases and conditions in patients. gynecological diseases are diseases of the female genital organs and within it we can talk about sexually transmitted diseases and obstetrics. their diagnosis and treatment is an important aspect of the quality - of - life of women and their reproductive health because these diseases are public health and social problem and is very important to deal with them at the level of primary health - care (phc), so in this context to promote both primary and secondary prevention. sometimes, this is more important than curative procedures. first of all, it is important to promote a healthy life - style and conscious entering the sexual activity by young girls. screening involves preventive examinations, which test apparently healthy population with a preventive goal in order to identify as early as possible those who show early signs of disease or are at risk for the development of a disease. in addition to primary prevention and screening it is important to emphasize education of patients about the importance of a healthy life - style and explaining hygienic and diet measures for certain diseases. thus, achieves the effect that patients understand the importance of the early of the prevention of gynecological diseases and the application of regular screening for their early detection in order to eradicate the disease. here, we will specify the definition and epidemiology of the most frequent gynecological diseases and their risk factors : cervical cancer, breast cancer, pcos, irregular bleedings from the uterus and vulvovaginitis. in recent decades, to papilloma and herpes viruses is attributed the growing importance in the emergence of epithelial dysplasia, neoplasia and cervical cancer. it is believed that the influence of these viruses that penetrate the epithelium around the outer cervix at the place of metaplasia of the layered stratified epithelium in the cylinder caused changes in epithelial cells that lead to dysplasia. cervical cancer primarily affects women from 45 to 50 years of age ; approximately 37% of patients are younger than 35 years. women over 65 make up 10% of patients and this age group usually dies from the disease, which is related to progression of the disease at the time of diagnosis. among gynecological malignancies cervical cancer ranks second both in incidence and mortality among women in almost all developed countries, diagnosed each year. although in recent years their incidence declined, there are still areas of high incidence of mortality among women of low socio - economic status, which is a consequence of the lack or absence of regular and irregular screening. in countries where screening is well - developed, such as england, the number of women suffering and dying from cervical cancer has been reduced by 80%. at 5-year survival for patients with early clinical stage varies from 50% to 90% according to various prognostic factors. scientific evidences support the link between human papilloma virus (hpv) infections which is present in 93% of cases of cervical neoplasia. the risk of malignant transformation in the cervix increases with the presence of high - risk genital hpv subtypes. among more than 70 so far detected hpv virus types, most probable role in oncogenesis the disease often affects persons from lower socio - economic class, with a lower possibility of regular health - care. early onset of sexual life and a greater number of sexual partners, also favors the development of the disease. specifically, the transformation zone in the younger age is more sensitive to oncogenic agents. opinions are divided, but higher incidence of abnormal histological types of cervical cancer is observed in women who have for a longer period of time used these contraceptives. breast cancer occurs and develops from the milk ducts (duct epithelium) and lobule, so the most common types are ductal (80%) and lobular (10%) breast cancer. it can be in invasive and non - invasive form (ductal carcinoma in situ) and (lobular carcinoma in situ). breast cancer is the most common cancer in women (about 32% of all malignancies) and the most common cause of death at the age of 45 - 55 years. in the world in developed countries, mortality was significantly reduced to about 25%, thanks to early detection and modern therapy. survival is slightly lower in women younger than 40 years (82%), 40 - 74 years of age (88%) and at age of 75 years and over (89%). screening is the examination of women who have no symptoms of the disease, with the purpose of early detection of cancer. at these examinations, it is not known exactly what causes the appearance of breast cancer, but it is known that there are several risk factors, some of which are already known from before ; others are yet to be explored. the frequency (incidence) of breast cancer increases with age, about 80% occurs after menopause. it is extremely rare before age of 20 years of age and is also unusual before age of 35 years. women who were previously treated for breast cancer have 2 times greater risk of developing cancer in the other breast. among hereditary factors few women in the course of their lives, especially in the age of sexual maturity, did not have an acute infection, subacute or chronic, at the level of the external genitalia. whether it comes to an acute infection, recurrent from inactive focal points or repeated infection (reinfection) is very often health, family and social problem, as they often have to be for long and persistently treated and that the conservative and surgical therapy eliminates its consequences or complications. the causes are infection (streptococcus, staphylococcus, escheria coli, neisseria gonorhea, chlamydia trachomatis, trichomas vaginalis, mycoplasma hominis, also hpv, cytomegalovirus, etc.). possible causes are also irritants in the form of substances or objects, tumors or other abnormal buildup of tissue, irradiation therapy, medications and hormonal changes. poor personal hygiene can contribute to the proliferation of bacteria and fungi and cause irritation. the feces can enter the vagina through the abnormal connection with the guts (fistula), which can lead to inflammation of the vagina. pcos is the most common reproductive and metabolic disorder in women of childbearing age, which is characterized by chronic anovulation / oligomenorrhea, hyperandrogenism and the appearance of polycystic ovaries. often is associated with obesity, hyperlipidemia, insulin resistance (ir) and type ii diabetes. the incidence of the syndrome is 15 - 25% of the female population childbearing age according to the european criteria for diagnosis. it is the lucky circumstance that after the age of 40 it is spontaneously relieved by hyperandrogenaemia and ovulation are more common, so in this age its incidence is around 15% and perimenopausal incidence is 10%. because of the many preceding pathophysiology changes of pcos it seems to affects very heterogeneous group of patients. despite the extensive literature data on the etiology of pcos, no uniform position on the nomenclature and criteria used in the definition of the syndrome exist. in 2003, it needed two of the three criteria for the diagnosis of pcos : oligo / anovulation, clinical or biochemical signs of elevated androgens and polycystic ovaries demonstrated by ultrasound (us). furthermore, for the diagnosis of pcos it is necessary to exclude a number of conditions and diseases related to similar changes in the appearance of ovarian us image. just the appearance as polycystic ovaries is not sufficient for the diagnosis of this syndrome. diseases and conditions that should be by differential diagnosis excluded are hyperprolactinemia, gonadotropin, congenital adrenal hyperplasia, cushing 's syndrome, virilizing tumors, hypothalamic amenorrhea, acromegaly, hipertecosis, glucocorticoid and ir and the effect of some medications. childhood obesity, especially in adolescence is the most important trigger for the development and worsening of pcos. it was found that adolescent obesity independently contributes to disorders at childbearing age, as well as premature menarche, later infertility, infertility, abnormal pregnancies and ir. any bleeding from the uterus that is not regular menstruation is considered as abnormal (metrorrhagia). menorrhagia may result from anatomical (visible pathological changes in some of the genital organs) and functional reasons. they may differ, not only in the time of occurrence, duration, amount of the lost blood, but also at intervals. however, it is significantly often seen at puberty and menopause, as well as juvenile and menopausal bleeding (explained by a disturbed balance in those ages between the ovaries and other endocrine glands). causes of primary dysmenorrhea and mechanism of pain occurrence in it are not known today. it is believed that a substantial influence have psychological factors, due to the threshold of sensitivity of different people. more frequent occurrence of dysmenorrhea is in underdeveloped and physically weak parsons, who are suffering from anemia, diabetes, tuberculosis and other exhaustive diseases. for them to achieve good therapeutic results it is necessary the healing and repair of the general health condition. among etiological factors great attention is paid to the factors that may lead to partial or complete temporary obstruction. the fact that dysmenorrhea does not occur during anovulatory cycle, when the endometrium is affected mainly by estrogen. the goals of this study were : to understand the role of the health system in early diagnosis of gynecological diseasesemphasize the importance of prevention through the management of gynecological diseaseshighlight the role of family doctors in educating women about the importance of regular gynecological examinations. to understand the role of the health system in early diagnosis of gynecological diseases emphasize the importance of prevention through the management of gynecological diseases highlight the role of family doctors in educating women about the importance of regular gynecological examinations. made is a descriptive analysis of experience of gynecological and obstetric diseases management described in the articles published in indexed journals retrieved from biomedical databases : pubmed central, scopemed, google scholar, etc. emphasis is placed on the guidelines for gynecological diseases because they are basic landmark that doctors should respect and use in the management of any disease and also gynecological. these are guides to whom physicians should adhere and stick to them and their algorithms in the course of their work. within this set are : basic symptoms, how to identify and diagnose and therapy protocols for the most common gynecological diseases, as parameters to procedures in managing gynecological and obstetric diseases. for cervical cancer there are no early symptoms, which will prompt the patients to contact a doctor for review. symptoms usually occur at a later stage when it came to the erosion that accompanies contact bleeding (bleeding is usually sparse and occurs after intercourse, irrigation or gynecological exam). they can be frequent and persistent, resistant to therapy with concomitant blood secretion and in advanced stage also with severe pain. diagnostic procedure includes : history (general, gynecological, family, targeted family), clinical examination (general patient state, physical examination and gynecological speculum examination, bimanual and rectal examination) and swab by papanicolaou method. the standard papanicolaou test for detection of cervical cancer as the results of several studies indicated is cytological test, which reduces the incidence of cervical cancer in many countries. the bethesda system classification : atypical squamous cell of undetermined sigificance (ascus), atypical glandular cell of undetermined significance (agus), low - grade squamous intraepithelial lesions (lsil) and high - grade squamous intraepithelial lesions (hgsil) and histopathological examination of the biopsies of the cervix and cervical canal abrasion. additional tests, which are needed to determine the stage of the disease, are : cystoscopy, rectoscopy, intravenous pyelography and chest x - ray. us, computed tomography, magnetic resonance imaging (mri) and abdominal lymphangiography and possible laparoscopy may not be used to determine the clinical stage of disease according to international federation of gynecology and obstetrics (figo), but are important in planning treatment. the clinical stage of the disease is determined by using the figo classification, which is also called morphological classification because it is based on tumor size and histological data for the early stages and the spreading of pelvic masses with disease progression [figure 2 ]. colposcopy finding of the cervix cancer stage 0 - changes within the epithelium, or preinvasive cancer (stroma intact). stage i - the cancer is affected only cervix without spreading to the body of the uterus. ia1 - stromal invasion between 1 and 3 mm with horizontal spread of up to 7 mmia2 - invasion into the stroma of 3 - 5 mm from the horizontal spread of up to 7 mmib1 - clinically evident cervical lesions up to 4 cm in sizeib2 - clinical cervical lesions greater than 4 cm. ia1 - stromal invasion between 1 and 3 mm with horizontal spread of up to 7 mm ia2 - invasion into the stroma of 3 - 5 mm from the horizontal spread of up to 7 mm ib1 - clinically evident cervical lesions up to 4 cm in size ib2 - clinical cervical lesions greater than 4 cm. stage ii - expansion at the upper and middle third of the vagina or parametrium (does not reach the bone). iia1 - initial expansion into fornixiia2 - spreading into the upper and middle third of the vaginaiib1 - initial infiltration of parametriumiib2 - parametrium infiltration, but not reaching the bone. iia1 - initial expansion into fornix iia2 - spreading into the upper and middle third of the vagina iib1 - initial infiltration of parametrium iib2 - parametrium infiltration, but not reaching the bone. stage iii - spread to the pelvic wall or lower third of the vagina and/or hydronephrosis and/or kidney dysfunction. iiia - infiltration into lower third of the vaginaiiib - tumor spread to the pelvic wall and/or kidney hydronephrosis and/or kidney dysfunction. iiia - infiltration into lower third of the vagina iiib - tumor spread to the pelvic wall and/or kidney hydronephrosis and/or kidney dysfunction. stage iv - spreading outside of pelvis iva - spread into surrounding organs (bladder or colon)ivb - distant metastases. iva - spread into surrounding organs (bladder or colon) ivb - distant metastases. after classification, according to the figo classification and staging of disease, the decision and the sequence of therapeutic procedures for each patient individually, is made by a multidisciplinary team of radiologists, pathologists, gynecologists, radiation oncologists and medical oncologists. only a multidisciplinary approach to treatment may result in properly and successfully treatment and result in an overall improvement of survival. surgical therapy should be carried out in institutions that have requirements for specified diagnostic and multidisciplinary treatment planning. it should aim to total removal of a diseased organ and lymphadenectomy (minimum of 10 lymph nodes from the chain of iliac blood vessels, both sides). adjuvant therapy should begin within a period of 3 - 6 weeks after surgery or with advanced disease immediately after the diagnosis and staging of the disease. concomitant chemo and radiotherapy should be conducted in an institution that has the technology for high voltage radiotherapy and intra - cavitary radiotherapy. self - examination includes periodic examination that the woman herself done by watching and feeling the texture of the breast and axillary lodge. for this review previously advised monthly self - examination is abandoned in many developed countries and is left to women to choose whether to use it and in what interval and then follows clinical examination. doctor carefully observe the breast, their environment and with palpation explores possible changes in the breast and adjacent lymph nodes. clinical examination should be conducted at least once every three years for all women who do not belong to a risk group, aged 20 - 40 years. from the age of 40 a woman should once a year have clinical examination and then to perform the initial (basic) mammographs. it is best that clinical examination precedes mammography. if there is a screening program, it in some countries starting with the age of 40, in some at age of 45 or 50 years, to age of 65 or 70 years, depending upon the incidence of cancer, the available resources and the level of population health culture. mammography is the gold standard of breast cancer diagnosis and the most important screening method. mammography is a radiological imaging method for breast that uses minimal radiation dose and allows you to see the internal structure of the breast. it is very important that the doctor discussed with the woman and advise her about the best time for her regular mammogram control in accordance with the existing guide for screening, so it does not happened that in the meantime the tumor that was not visible progresses. mammography as a diagnostic tool has a much lower value (reliability) in younger (premenopausal) women due to developed glandular breast tissue that makes it radiologically dens or poorly visible for interpretation. in these cases, us is an additional (complementary) method for diagnosis using us waves, without ionizing radiation, it is completely harmless and can be used indefinitely even in pregnant women. it is used in finding tumors in the dens breasts, for example in young premenopausal women. not a method for mass screening, but in recent years can be used for the diagnosis of tumors in genetically predisposed women, where the screening normally begins in early premenopausal period, then in case of more dense breast tissue. when the radiologist in the mammography images finds a change that raises doubts on cancer, or is not able to declare it a benign, it is necessary to take a small sample of cells from the area for cytological examination and setting cytological diagnosis. before treatment the set diagnosis of cancer, allows the duly treatment plan, selection of the best method for treatment (for example, type of surgery) in consultation between the patient and team of specialists who will treat. although breast cancer is a very serious disease, it can be successfully treated if detected at an early stage, when it is not invasive and when tumor cells do not have the ability for displacement - metastasizing. this treatment can be successful if it is carried out by an expert team of specialists comprising of : a surgeon, radiation oncologist, internist - medical oncologist, radiologist, pathologist, oncology nurse, social worker and others as needed. this expert team examines the patient at one place, within joint review and makes decisions on any additional diagnostic tests, treatment method and sequence of methods. in this way if the cancer has not metastasized and if not locally advanced, treatment usually begins with the surgical procedure. if the tumor is small, only the tumor can be removed and part of the surrounding healthy breast tissue (sparing surgery) so that the breast is not removed. at the same time after radical surgery plastic reconstructive surgery may follow to make a new breast, immediately during breast removal, or when all other therapies are completed. irradiation therapy last for about 6 weeks and usually does not cause special problems. with the presence of a vulvitis of any etiology, the patient complains of itching and burning sensation and burning of the skin around the vulva and vaginal introitus. on examination the vulvar skin first signs of infection are redness and smaller island of the affected areas of skin. condyloma are warty growths that occur as a consequence of infection by papova virus (from a group of hpv type 6 and type 11), first individually around vaginal introitus, usually at first in the area of the perineum and later spread to most of the vulvar skin, mucous membrane of the vagina and cervix. usually transmitted by sexual intercourse and formed over a period of few days to months after infection. later, they can multiply to form a broad plate of compressed and joined individual warts. diagnosis is made based on history (general, gynecological, family, targeted family), clinical examination (general condition of the patient, physical examination and gynecological speculum examination, bimanual and rectal examination) as well as histological examination of taken biopsy material. if the cause is the infection, the treatment consists of antibiotic, anti - fungal or antiviral medications, depending on the agent. if the infection is cured, to maintain the improved condition can be used for a short time rinsing of the vagina by exact ratio of vinegar and water. frequent washing and use of medical type detergents is not advisable because it increases the risk of developing pelvic inflammatory disease. with antibiotics, treatment of bacterial infections may include propionic acid gel that makes more acidic vaginal mucus, which hinders the growth of bacteria. in case of stds both partners must be treated simultaneously to prevent re - infection. estrogen can be administered orally or by skin patch, or it can be applied directly to the vulva and vagina. additional procedures include wearing comfortable and absorbent lingerie that allows air to circulate, such as cotton or cotton padded panties and maintaining the hygiene of the vulva. sometimes, putting ice on the vagina, sitting in cold baths or cold compresses can ease sensitivity and itching. itching that is not caused by infection can be mitigated by corticosteroid creams and ointments, such as those that contain hydrocortisone, as well as antihistamines taken orally. if chronic vulvitis is caused by poor personal hygiene, the first to be given is instructions on proper hygiene. following are some guidelines for the treatment of vulvovaginitis caused by different agents [table 1 ]. the usual treatment of infection of the vagina and vulva the diagnosis of pcos is based on the case history and physical examination, biochemical tests and us examination of the ovaries. there are a number of data from medical history and physical findings that help in the diagnosis of pcos. in the family history in personal history is important birth weight, rapid weight gain in infancy, rapid growth and early adrenarhe, obesity in childhood and adolescence, menarche, menstrual cycle characteristics, weight changes, symptoms of hyperandrogenism, infertility and miscarriages. physical examination includes determination of body mass index, the ratio of waist and hip circumferences, blood pressure measurement and evaluation of hyperandrogenism. signs of hyperandrogenaemia and hyperandrogenism, which involves increased activity of androgens, are seborrhea, oily skin and hair, acne, hirsutism, alopecia and virilization. hirsutism should be distinguished from hypertrichosis in which there is no male - type hair distribution and is not dependent on androgens. however, the most common disorder in pcos is anovulation in more than 90% of women, which is primarily linked with oligomenorrhea and rarely amenorrhea. us examination of the ovaries is unavoidable and simplest method in the diagnosis of pcos. criteria for declaring polycystic ovary according to the latest classification are 12 or more follicles with a diameter of 2 - 9 mm and ovarian volume greater than 10 ml and it is enough that only one ovary have these characteristics. it is important to emphasize that in puberty and adolescence us pcos is not specific. biochemical analysis includes determining hormonal status : follicle - stimulating hormone, luteinizing hormone, e2, total testosterone, shbg, free testosterone, dehydroepiandrostendion sulfate, 17-hydroxyprogesterone androstenedione, the determination of ir (glucose tolerance test), fasting glucose, ir and some dynamic tests are performed exceptionally for the differential diagnosis of pcos with other endocrine disorders. however, biochemical tests are necessary for girls who are overweight, with pronounced hirsutism or acne resistant to treatment. furthermore, to adolescents that in the first two years after menarche have amenorrhea / oligomenorrhea or repeated dysfunctional uterine bleeding is necessary to determine the biochemical status. regardless of that, women with pcos should be treated and monitored continuously. treatment of pcos depends on the patient 's age, symptoms and signs of this syndrome and reproductive desires. for this purpose, the hormonal preparations, insulin - sensitizing medicines and surgical treatments are performed. in adolescents with pcos treatment is aimed at controlling irregular bleeding, reduce acne and hirsutism and reduction of obesity and ir (risk of endometrial cancer in these women is three times increased). the strongest effect of anti - androgens has oral hormonal contraceptives. from other hormone therapy for pcos should be noted neandrogene progestogens that are given because of their opposed action to estrogens primarily to protect the endometrium. surgical treatment of pcos is laparoscopic ovarian electrocoagulation (drilling), which destroys fat ovarian stroma. diagnosis is based on the history of irregular bleeding and more abundant bleeding, the existence of secondary anemia that accompanies it and normal palpation findings of patient 's genital organs, but if this is the result of anatomical changes, then we can not talk about these types of bleeding. therefore, it is essential that before diagnosis are excluded other possible causes of irregular bleeding, which is usually done by combined rectal - vaginal examination. also, examination of peripheral blood and bone marrow needle aspiration is needed to exclude blood diseases. diagnostic curettage is performed in the extreme conditions and can be therapeutic and most often the material is sent for histological evaluation. treatment of juvenile bleeding should first stop the bleeding, compensate for lost blood and fluid and improve the general condition. among drugs are given uterotonic agents and preparations of the anterior pituitary lobe or synthetic preparations with identical actions, together with calcium, vitamin k and nicotinic acid amide. treatment of metrorrhagia in the generative period is implemented by giving progesterone at a dose of 25 mg and in the second half of treatment, during the 3 months. if the therapy begins at the stage of irregular bleeding, then progesterone provides 2 or 3 days to regulate the bleeding. patients with atrophic endometrium and demonstrated lack of estrogen are treated by alternately application of estrogen and progesterone in 3 - 4 cycles. quality and successful management of gynecological diseases can not be ensured without following certain guidelines recommended by experts in this field. good clinical practice concept that is applied in the world puts in front : (a) patient education, (b) counseling patients about healthy life - style, (c) conducting screening. necessary and advisable is to follow proper quality parameters of provided gynecological care at certain levels of its organization in the health system given in the documents of the world health organization and the comparable results (incidence, morbidity, mortality) in the countries that did so in relation to the countries that were not able to implement it. reasons for the latter may be low socioeconomic status, lack of education of patients by their physicians about the importance of regular gynecological examinations, etc. although in recent years, the incidence of cervical cancer has decreased there is still a high incidence and high mortality among women with low socio - economic status, which is the result of a lack of screening or irregular screening. numerous studies have shown that the rate of morbidity and mortality are significantly reduced where there is organized screening. selected family doctor plays an important role in regular referring of woman to systematic gynecological examinations according to the recommendations that are in the national guide for the prevention of malignant diseases. furthermore, he / she has a duty to educate women about the risk factors for malignant diseases, as well as preventive measures to prevent their occurrence. in developed countries where screening is regularly conducted the number of women suffering and dying from cervical cancer has been reduced by 80%. the disease often affects women from lower socio - economic class, with a lower possibility of regular health care. in developed countries, mortality was significantly reduced to about 25%, thanks to early detection and modern therapy. hence, it is very important to perform comparisons on the basis of the results obtained from the rich countries to the results from poor countries because the incidence of diseases and mortality rates are significantly higher in poor countries than in rich ones. poorer countries due to lack of funds do not have good technological methods for screening that will allow the disease detection at an early stage and thus prevent complications, which does not even have close phc centers and specialist consultation services in their place of residence. not only the financial aspect is cited as an important factor in health for an increase of morbidity and mortality in a group of gynecological diseases, but there are also important other factors, such as : (un) healthy environment, lack of clean drinking water, inhumane living conditions, which may lead to the occurrence of a number of infections than in rich countries with higher gross national income of the population in which they can provide a means for personal hygiene. richer countries have the resources to invest in a variety of methods of prevention, such as the development of educational advertisements, posters and brochures for health promotion and education of the population at all levels : local communities, schools, companies, medical facilities, etc. it is also very important to stress the importance of sexual education, especially in schools, which can contribute to reduced incidence of sexually transmitted diseases, especially human immunodeficiency virus (hiv) and the hpv which is considered as important in the development of dysplasia with consequential occurrence of cervical cancer. because of the high incidence of cervical cancer it is necessary to organize a screening examination of women. numerous studies have shown that the rate of morbidity and mortality significantly reduced where there is organized screening. selected family doctor has a very important role in referring to regular systematic gynecological examinations according to the recommendations that are in the national guide for the prevention of malignant diseases. furthermore, the physician has a duty to educate women about the risk factors for malignant diseases, as well as preventive measures. cervical cancer is an ideal disease for screening because it typically has a long preclinical phase, which allows early detection. taking a cervical smear and staining by method of papanikolaou is the best method available to reduce the morbidity and mortality of invasive cancer of the uterus cervix. according to the recommendations the screening should begin as early as at the age of 18 years (or from the moment of sexual relations start) because the age of this disease occurrence moves toward the younger generations. control papa test should be done once a year and if two consecutive findings are negative then is recommended control every 2 years. any patient with persistent or progressive cervical intraepithelial neoplasia regardless of age, according to new studies and each patient aged over 30 years should do hpv deoxyribonucleic acid screening test. regular and proper implementation of the screening program is also the best way to prevent the appearance of clinical symptoms. outside the organized screening program, women should be advised on the following : it is necessary to improve information and increase awareness about the importance of women about the possibilities and the importance of preventive measures and examinationsmammography is recommended to start at age of 40 year and continue each year until a woman is in good healthclinical breast examination as part of a periodic health examination every 3 years for women aged 20 - 40 years, then every yearwomen should know how their breasts look normal and that any changes immediately and without delay leads them to the doctor. self - examination is an option (according to the will of women) and it should begin at the age of 20 yearswomen at increased risk (family history, genetic predisposition, previous cancer in the other breast) should talk with their doctor about the possible consequences of the irregular examinations. it is necessary to improve information and increase awareness about the importance of women about the possibilities and the importance of preventive measures and examinations mammography is recommended to start at age of 40 year and continue each year until a woman is in good health clinical breast examination as part of a periodic health examination every 3 years for women aged 20 - 40 years, then every year women should know how their breasts look normal and that any changes immediately and without delay leads them to the doctor. self - examination is an option (according to the will of women) and it should begin at the age of 20 years women at increased risk (family history, genetic predisposition, previous cancer in the other breast) should talk with their doctor about the possible consequences of the irregular examinations. screening as an organized program of secondary prevention for breast cancer usually starts at the age of 45 in women who do not belong to the risk group of the first category and in high - risk even earlier, i.e. 40 years. it is needed to raise self - awareness of women by education from physicians and polyvalent nurses. it is needed to raise self - awareness of women by education from physicians and polyvalent nurses. it is necessary to create awareness among medical staff in phc, particularly family doctor about the possibilities, needs and the importance of early detection of breast cancer. it is necessary to provide human and material resources to carry out the screening, especially mammography machines, radiology technicians and radiologists trained to perform quality interpretation of the findings. it is necessary to provide human and material resources to carry out the screening, especially mammography machines, radiology technicians and radiologists trained to perform quality interpretation of the findings. establish centers at the secondary or tertiary health - care level for the setting of explicit diagnosis and treatment of breast cancer. create conditions for exact and timely histopathological examination of biopsy material at the secondary or tertiary health - care level. create conditions for exact and timely histopathological examination of biopsy material at the secondary or tertiary health - care level. a particular problem is the issue of taboo in our society about sexuality, which is of a systemic character and it should be a deal with by the multi - disciplinary teams in health care and education (educators at all levels of education, teachers, psychologists, sociologists, family doctors, gynecologists, sexologists etc.). the system should ensure the introduction of the health education in primary and secondary schools in the framework of which the students, as age - appropriate, are informed about sexually transmitted diseases, their prevention, diagnosis, treatment. the particular attention should be paid to the prevention of teenage pregnancies and abortions, which is increasingly prevalent among younger people with a tendency to move toward even younger ages. of course, the parents had to be maximally involved in the work of these teams. a particular problem is the social network that indiscriminately provides information to young people about sexuality, very often wrong and non - selective, even to say in an inappropriate way that should be banned by the relevant institutions. unwanted pregnancy, hiv infection, genital organs, especially sexually transmitted disease are difficult to manage, especially their early discovering and then treatment, which has resulted in increasing incidence of unwanted pregnancies, abortions and infertility in women, or in women of childbearing age. family doctors and gynecologists here can play a key role, especially in the field of health promotion. prevention of diseases in gynecology can be improved by better understanding of health promotion and management of diseases. the importance of family medicine physicians and their team is remarkable in the prevention of gynecological diseases. girls and women in their office should find advice and a create way to educate them about the importance of personal hygiene, life - style, diet and of course, sexual behavior and the use of antibiotics that lead to the disruption of normal vaginal flora and fungal infections. they need to provide sufficient information, either orally or by educational brochures about the origin, prevention and the ultimate treatment of these infections. to girls and women essential is also the education of those people who do not have permanent sexual partner in the proper use of condoms and before this would be better the importance of highlighting the hazards of promiscuity. in the existing clinical guidelines for pcos all school children are available for preventive activities and medical examinations, which provide great opportunities for early detection and improving the health of children and young people and in the long - term of the whole population. very often from the school, doctor and nurse while working on counseling the students and their parents seeking clarification on the recommended procedures and treatment. however, the first measure is a healthy life - style and weight reduction of obese patients. thus, the weight loss in combination with other therapeutic procedures achieves optimal therapeutic effects, prevents long - term adverse and harmful effects and provides high - quality life. early detection and timely treatment can, not only reduce and eliminate these symptoms and clinical manifestations, but also prevent the development of diabetes and cardiovascular diseases and some form of cancers later in life. family doctor in the health - care system should be oriented to a number of measures and activities in order to adequately and well manage gynecological disease in practice as follows : know that the regular and proper implementation of screening programs at the same time is the best prevention of the occurrence of clinical forms of the diseaseemphasize that the increase in the number of patients in the early stages of the disease (based on records and hospital records) is very importantencourage the improvement of treatment (based on hospital records and records of mortality)highlight the importance of self - examination, to the extent that the woman be aware of her breasts and to think of them, to be properly informedinsist on teaching women, as well as the professional staff in primary and family health - care, that breast cancer is very serious disease, that early detection is important for successful treatment and that the methods by which breast cancer is detected is simple and painlesscounseling, education and guidance to women through a phc about the importance of keeping proper daily personal hygiene should be the primary task of the family medicine teamscounseling and education of women, especially young women of the dangers from frequent change of sexual partners and condom use should be encouraged by doctorsinfection control, because they are a serious social and public health problem, especially in women who plan their families and pregnant women, should also be stimulatededucation of women about healthy life - style and proper nutrition, with weight reduction in obese patients is one of the main tasks of the family medicine teamsemphasize the need for all school children to undergo preventive activities and medical examinations, which provides great opportunities for early detection and improving the health of children and young people and in the long - term of the whole populationemphasize the need for the development of guidelines with instructions and procedures for the management of gynecological diseases. know that the regular and proper implementation of screening programs at the same time is the best prevention of the occurrence of clinical forms of the disease emphasize that the increase in the number of patients in the early stages of the disease (based on records and hospital records) is very important encourage the improvement of treatment (based on hospital records and records of mortality) highlight the importance of self - examination, to the extent that the woman be aware of her breasts and to think of them, to be properly informed insist on teaching women, as well as the professional staff in primary and family health - care, that breast cancer is very serious disease, that early detection is important for successful treatment and that the methods by which breast cancer is detected is simple and painless counseling, education and guidance to women through a phc about the importance of keeping proper daily personal hygiene should be the primary task of the family medicine teams counseling and education of women, especially young women of the dangers from frequent change of sexual partners and condom use should be encouraged by doctors infection control, because they are a serious social and public health problem, especially in women who plan their families and pregnant women, should also be stimulated education of women about healthy life - style and proper nutrition, with weight reduction in obese patients is one of the main tasks of the family medicine teams emphasize the need for all school children to undergo preventive activities and medical examinations, which provides great opportunities for early detection and improving the health of children and young people and in the long - term of the whole population emphasize the need for the development of guidelines with instructions and procedures for the management of gynecological diseases. | background : prevention of diseases in gynecology can be improved by better understanding of health promotion and management of diseases. management is the art of performing jobs by or with other people mary parker follet.methods:a descriptive analysis was performed on scientific studies in several published articles in medical journals and books.results:there are five primary functions of management as : anticipate and plan, organize, command, coordinate and control. if we introduce the following definition in the sense of medical science and apply it to the medical practice that would mean way of recognizing, managing and resolving issues of diagnosis and therapy of diseases (in this case gynecology diseases) according to certain guidelines and treatment algorithms. treatment of family doctors is an important aspect in the quality - of - life of women and their reproductive health as well as a significant issue in public, environmental and social problems.conclusions:it is very important to deal with it on the primary care level and in addition to promote the primary and secondary prevention of diseases, which is sometimes more important than the curative procedures. the primary prevention involves regular gynecological examinations and screening. the doctors have also a duty to educate women about the risk factors for malignant diseases, as well as proposing some of the qualitative preventive measures. |
at hcb, as part of the routine workup for febrile patients, serum samples were collected, stored at 20c, and transported in liquid nitrogen to quito for pcr. hospital personnel also tested these samples by using a dengue igm / igg - capture elisa with high specificity and sensitivity (panbio, waltham, ma, usa). at the snem laboratory, 24 drops of whole blood were collected on filter paper (whatman 903, kent, uk) from persons spontaneously seeking or referred for malaria diagnosis. filter papers were left to dry overnight, stored at 0c in a zipper bag, and transported to quito for analysis. denv was amplified from total rna from blood spots and serum as described (12,13). pcr products were sized in 1.5% agarose gel electrophoresis and sybr safe dna gel stain (invitrogen, carlsbad, ca, usa) (1:10,000) under uv light. pcr product was sent to functional biosciences (madison, wi, usa) for sequencing. the study was approved by institutional review board committees at the universidad san francisco de quito (quito, ecuador) and the university of michigan (ann arbor, mi, usa). from july 2010 through february 2011, a total of 77 samples (36 serum, 41 blood spot) were collected from febrile patients. of these 36 hospital patients, 10 were from borbn and 26 were from the surrounding communities ; patients were 274 years of age (median 19 years), and fever duration was 320 days (median 6 days). six (17%) of the 36 serum samples and 7 (17%) of the 41 blood spots were positive for dengue by pcr ; whereas 10 (29%) of the 34 serum samples tested by elisa were positive for dengue igm (table). the ages of the 10 patients with positive results by elisa were 363 years (median 38 years), and fever duration was 413 days (median 6.5 days). although positive pcrs are sufficient indicators of acute infection, the positive igm reflects a cumulative incidence over 6090 days. therefore, the 17% pcr - positive estimate is a lower bound, and the 42% estimate by pcr or elisa is an upper bound. the denvs in the 13 samples that were positive by pcr were either serotype 2 or 3 ; samples from 1 patient contained both serotypes, probably resulting from a co - infection. each institution (hcb and snem) submitted samples from the same 2 patients, but only 1 was positive for dengue by pcr. during this same period, denv-1, -2, and -4 were detected in coastal cities in other regions of ecuador (denv-3 has not been reported in ecuador since 2009). colombia is a likely source, given the proximity of the study region to colombia and the fact that denv-3 was circulating in colombia ; but without sequence data, the geographic location of the source can not be confirmed. only 34 serum samples were tested by elisa ; only 1 of the 10 positive samples was also positive by pcr. this study provides evidence of a transition of febrile disease etiology from plasmodium spp., other possible fever - causing agents for which we did not test include leptospira spp. given that malaria has historically been the predominant cause of fever in the developing world, febrile patients are often triaged toward malaria treatment, especially in resource - poor areas. moreover, the awareness of malaria is embedded culturally and behaviorally in these communities : having a fever is equated with having malaria. of the 40 febrile patients who sought treatment for malaria, none had malaria but 17% had dengue (positive for denv by pcr). further research is needed to refine this estimate and explore how the ministry of health and the general population should be directed to manage cases of fever during this etiologic transition. the need to bring attention to this transition is exemplified by our finding of denv-3 in our study site ; this serotype has not been isolated in other parts of ecuador since 2009. esmeraldas, therefore, may be a major source of newly introduced dengue serotypes into ecuador. | in tropical areas, the predominant cause of fever has historically been malaria. however by 2011, among febrile patients in northwestern ecuador, dengue was identified in 42% and malaria in none. this finding suggests a transition in the cause of fever from malaria to other illnesses, such as dengue. |
stroke, caused by ischemia or hemorrhage, results from the interruption of blood supply to the brain that induces constant deficiency of oxygen and causes brain damage1. though fatality after stroke has been greatly reduced by the development of medical technology, stroke presents physical and mental obstacles that impair quality of life1, 2. once a stroke has occurred, various motor skills deteriorate, and therefore stroke rehabilitation focuses greatly on exercises designed to recover motor skills2. balance is the ability to sustain the center of gravity, and it is a complex process of controlling posture when conducting a voluntary movement and responding to external perturbations3. stroke patients often experience hemiplegia, weakness of one side of the body that induces unbalanced posture, loss of proprioception, and abnormal muscle tone, thereby reducing balance ability4, 5. due to balance instability, stroke patients develop an abnormal gait with a short weight support duration on the affected side, and differences between the strides of the normal side and affected side cause the gait speed to decrease, affecting physical ability and impairing independent daily activities5, 6. in order to solve problems concerning balance, walking, and daily activities related to stroke, various treatment methods such as neurological development treatment (ndt), proprioceptive neuromuscular facilitation (pnf), the brunnstrm approach, and motor relearning programs have been developed7. ideal treatment programs are yet to be discovered, and various approaches are being developed for more effective treatment7, 8. many approaches to physical therapy are being developed, and horse - riding exercise is one method being tested for rehabilitation. horse - riding exercise is a complex and scientific therapeutic method resembling movements from riding a horse9. horse riding strongly stimulates proprioceptive sensation by providing the rhythmical and repetitive movements of a horse. these movements stimulate the upper motor neuron system and input information similar to movement patterns of the pelvis when walking10, 11. such movements control abnormal muscle tone and movement patterns while enhancing balance and walking11. positive effects that can be induced from horse - riding exercise include recovery of disability in patients with cerebral palsy, multiple sclerosis, and spinal cord damage10, 12, 13. recently, research related to horse - riding exercise is being conducted, but studies investigating the effect of horse - riding exercise on balance, gait, and activities of daily living (adls) in stroke patients are still lacking. therefore, the purpose of this study was to investigate the effect of simulated horse - riding exercise on balance, gait, and adls in stroke patients. this study included 20 patients diagnosed with stroke on mri at least 6 months prior to the study. participants were randomly assigned to a control group (5 males, 5 females) and an experimental group (5 males, 5 females), who participated in a horse - riding exercise program. the inclusion criteria were a mini - mental state examination (mmse) score greater than 24 points, ability to walk more than 10 meters independently, and brunnstrm approach stage of four or greater. participants were excluded if they suffered from a visual disability or orthopedic disease of the lower extremities. before the experiment, all participants were notified of the purpose and method of this study and provided written consent in advance. this protocol was approved by the institutional review board of nambu university and was conducted in accordance with the ethical standards of the declaration of helsinki. the general characteristics of the participants are listed in table 1table 1.general characteristics of the participantsexperimental group (n=10)control group (n=10)gender (male / female)5/55/5age (years)71.1 3.069.2 3.4height (cm)170.5 7.3167.9 6.5weight (kg)71.2 7.467.0 6.5paretic side (right / left)5/55/5onset (months)10.6 1.110.8 1.1meansd. the mean age of the experimental group was 71.1 3.0 years, mean height was 170.5 7.3 cm, mean weight was 71.2 7.4 kg, and mean time from stroke onset was 10.6 1.1 months. the mean age of the control group was 69.2 3.4 years, mean height was 167.9 6.5 cm, mean weight was 67.0 6.5 kg, and mean time from stroke onset was 10.8 1.1 months. both groups were treated using an ndt approach for 30 minutes per day, 5 days a week for 6 weeks. horse - riding exercise utilized mechanical equipment that effectively resembles the movement of an actual horse (joba eu7800, panasonic corporation, osaka, japan). the equipment generates three - dimensional movements including twisting, up - down slide, back - forth slide, up - down roll, and back - forth roll. in this study, a whole body course and partial body course were alternately conducted, and the difficulty was increased from level 1 to 4, according to the adaptability of the participants. participants were allowed to freely control their posture and were instructed to grab the handle to ensure correct posture while riding. the bbs is composed of a total 14 items and covers sitting, standing, and posture changes. the total score is 56 points, and a higher score corresponds to better balancing skill. the 10mwt measures time spent while walking a total of 14 meters, excluding the first and last 2 meters. the mbi has a total score of 100 points and contains a total of 10 items including personal sanitation, independent bathing, eating, using the bathroom, dressing, controlling bowel movements, controlling urination, walking or using a wheel chair, and moving towards a bed or chair. scores of 0 to 24 indicate total dependency, scores of 25 to 49 indicate mostly dependent, 50 to 74 indicate moderate dependency, score of 75 to 90 indicate minor dependency, and score of 91 to 99 indicate minimal dependency. data were analyzed using spss 12.0 (spss, chicago, il, usa). general features of the participants were detailed as means and standard deviations using descriptive statistics. differences before and after the experiment within the two groups were compared using paired t - test analysis. to compare between - group differences before and after the horse - exercise therapy experiment, independent t - tests were used. the changes in the scores of the in bbs, 10mwt, and mbi are listed in table 2table 2.comparison of bbs, 10mwt, and mbi measures between the experimental and control groupsgroupprepostbbs (bug balance scale)experimental group42.4 1.344.1 1.2control group41.6 1.342.2 1.610mwt (10-meter walk test)experimental group19.9 0.818.5 1.0control group20.0 0.919.7 0.6mbi (modified barthel index)experimental group88.0 1.491.5 2.1control group87.3 2.088.2 1.8meansd. the experimental group exhibited significant differences for all pre- and post - experiment variables (p 0.05). in the between - group comparison, the outcomes of the experimental group were significantly difference from those of the control group (p < 0.05). meansd. the purpose of this study was to investigate the effects of horse - riding exercise on balance, gait, and adls in stroke patients. significant improvements in balance were as observed in the experimental group (p < 0.05) but not in the control group. balance, gait, and adls were significantly different between the two groups (p < 0.05). research by han.14 and lee.15 found the bbs to be more significantly improved among those participating in horse - riding therapy than in control subjects. horse - riding exercise simulates the natural walking rhythm of a horse, which is similar to that of the human trunk during motion. while a constant movement pattern is being applied, the trunk muscles act to counteract gravity14,15,16. reduction of the instability of trunk muscles and enhancement of proprioception and vestibular function are considered to improve balance ability16, 17. such results mean that the horse - riding exercise used in this study has positive effects on balance in stroke patients. patients with hemiplegia from stroke exert a great deal of energy and have difficulty walking independently18. changes in gait were observed to be significant in the experimental group but not in the control group (p < 0.05). in the between - group comparison, the outcomes of the experimental group were significantly different from those of the control group (p < 0.05). mcgibbon.19 used horse - riding exercise in children with cerebral palsy for 12 weeks, and it enhanced gait skill by activating adductor muscles. rhythmical and repetitive movements of the mechanical horse simulate movements during gait and provide a positive effect on gait skill20. constant pelvis movement and enhancement of trunks stroke patients need to set goals to improve balance and gait skills that can enable independent daily activities21. significant changes in adls were observed in the experimental group (p < 0.05) but not in the control group. in the between - group comparison, the outcomes of the experimental group were significantly different from those of the control group (p < 0.05). jung.22 showed improvement in movements related to daily activities in children with cerebral palsy following a horse - riding exercise program. kim23 used horse - riding exercises in autistic children, and their movements of daily activities significantly improved, coinciding with this study s results. horse - riding exercise uses various movements in a horse that can naturally provide physical effects to stimulate and activate shortened muscles in order to improve movements in daily activities. one limitation of this study is the small number of participants, which precludes generalization. follow - up studies will need to confirm the durability of these effects, and further research should verify the benefits of horse - riding exercise. | [purpose ] this study aimed to investigate the effects of horse - riding exercise on balance, gait, and activities of daily living (adls) in stroke patients. [subjects ] among 20 participants with stroke, 10 were randomly assigned to the experimental group, and 10 were randomly assigned to the control group. the experimental group participated in horse - riding exercise for 30 minutes per day, 5 days a week for 6 weeks. balance was tested with the berg balance scale (bbs). gait was measured using the 10-meter walk test (10mwt). adls were tested with the modified barthel index (mbi). differences between pre- and post - experiment values within the two groups were compared using paired t - tests. between - group differences were compared using independent t - tests. [results ] the experimental group showed significant improvements in balance, gait, and adls following horse - riding exercise. additionally, the experimental group showed significant differences in balance, gait, and adls compared with in the control group. [conclusion ] these results support that horse - riding exercise enhances balance, gait, and adls in stroke patients. this study supports the need for further research on horse - riding exercise programs. |
stereoscopic experiments on natural flocks of european starlings were performed in the field in rome using three high speed machine vision cameras shooting at 170 fps. the stereoscopic video acquisitions were then processed using a novel purpose - built three - dimensional tracking algorithm based on a recursive global optimization method. this algorithm is extremely powerful, allowing for the reconstruction of full 3d trajectories of all individuals in groups of several hundreds individuals. we collected 3d data from 12 flocking events with sizes ranging from 50 to 600 individuals, and lasting from 2s to 6s (for details on the experiments and the dataset see table s1 and [10, 29 ]). to avoid interference from birds flapping, which occurs at frequency 10 hz, we subsampled all the 3d sequences so that two snapshots are separated by dt = 0.1 s. the instantaneous flight orientations were estimated by si(t)=[ri(t+dt)ri(t)]/ri(t+dt)ri(t). to avoid overlap between two subsequent evaluations of si(t), we used dt = 2dt = 0.2 s. the lower sampling rates of fig. 1c, were obtained by taking dt = 0.2, 0.3, and 0.4 s. data were simulated in three dimensions with the continuous vicsek model of eq. the positions ri of individuals are updated according to dri / dt=0si, with 0 = 1. the simulations were set in a 8 8 8 box with periodic boundary conditions, and n = 512 birds, so that density is exactly 1. we set 2t=0.15 to obtain a polarization p 0.99 similar to natural flocks. 1 was integrated using euler s method with a simulation step dtsim = 0.01 that is much smaller than any other time scale in the system. the interaction range nc varied from 7 to 25, and the interaction strength was picked so that jnc = 1.5, hence relax = (jnc) ~ 0.7. the flocks were first brought to a steady state before taking snapshots for analysis. the polarization p quantifies the level of order in the system. when p 1, we can expand each si around the common direction of flight n(1/np)isi. this expansion gives si=i+1i2ni+(1i2/2)n, with ni=0. at leading order in i1, eq. similarly, the equilibrium distribution (eq. 8) can be expanded into (10)p()=1ze(j / t)ijijij. since this distribution is gaussian, z can be calculated analytically and reads : z=(2t / j)(n1)k>0k1, where k are the eigenvalues of the matrix ij. the equilibrium inference is performed by maximising the likelihood of the data given by eq. 10 over the parameters nc and (j / t) (see si for detailed formulas). the dynamical inference based on euler s rule is implemented by maximising the likelihood p({i(t+dt)}|{i(t) }) calculated from euler s formula (eq. 5, rewritten as (t+dt)=ejdt(t)+, where is a zero - mean gaussian vector of covariance =4t0dtdu ejueju = x1. the conditional likelihood p({i(t+dt)}|{i(t) }) now reads (12)det(x)(2)ne12[(t+dt)ejdt(t)]x[(t+dt)ejdt(t) ]. depending on whether one uses euler s or exact integration rules, eq. 11 or 12 is maximised over j, t and nc (see si for detailed formulas). in all three inference procedures, the parameters are learned for each time t. then the median and the associated standard error are calculated for each flocking event. the data that support the plots within this paper and other findings of this study are available from the corresponding author upon request. stereoscopic experiments on natural flocks of european starlings were performed in the field in rome using three high speed machine vision cameras shooting at 170 fps. the stereoscopic video acquisitions were then processed using a novel purpose - built three - dimensional tracking algorithm based on a recursive global optimization method. this algorithm is extremely powerful, allowing for the reconstruction of full 3d trajectories of all individuals in groups of several hundreds individuals. we collected 3d data from 12 flocking events with sizes ranging from 50 to 600 individuals, and lasting from 2s to 6s (for details on the experiments and the dataset see table s1 and [10, 29 ]). to avoid interference from birds flapping, which occurs at frequency 10 hz, we subsampled all the 3d sequences so that two snapshots are separated by dt = 0.1 s. the instantaneous flight orientations were estimated by si(t)=[ri(t+dt)ri(t)]/ri(t+dt)ri(t). to avoid overlap between two subsequent evaluations of si(t), we used dt = 2dt = 0.2 s. the lower sampling rates of fig. 1c, were obtained by taking dt = 0.2, 0.3, and 0.4 s. the positions ri of individuals are updated according to dri / dt=0si, with 0 = 1. the simulations were set in a 8 8 8 box with periodic boundary conditions, and n = 512 birds, so that density is exactly 1. we set 2t=0.15 to obtain a polarization p 0.99 similar to natural flocks. 1 was integrated using euler s method with a simulation step dtsim = 0.01 that is much smaller than any other time scale in the system. the interaction range nc varied from 7 to 25, and the interaction strength was picked so that jnc = 1.5, hence relax = (jnc) ~ 0.7. the flocks were first brought to a steady state before taking snapshots for analysis. the polarization p quantifies the level of order in the system. when p 1, we can expand each si around the common direction of flight n(1/np)isi. this expansion gives si=i+1i2ni+(1i2/2)n, with ni=0. at leading order in i1, eq. similarly, the equilibrium distribution (eq. 8) can be expanded into (10)p()=1ze(j / t)ijijij. since this distribution is gaussian, z can be calculated analytically and reads : z=(2t / j)(n1)k>0k1, where k are the eigenvalues of the matrix ij. the equilibrium inference is performed by maximising the likelihood of the data given by eq. 10 over the parameters nc and (j / t) (see si for detailed formulas). the dynamical inference based on euler s rule is implemented by maximising the likelihood p({i(t+dt)}|{i(t) }) calculated from euler s formula (eq. 5, rewritten as (t+dt)=ejdt(t)+, where is a zero - mean gaussian vector of covariance =4t0dtdu ejueju = x1. the conditional likelihood p({i(t+dt)}|{i(t) }) now reads (12)det(x)(2)ne12[(t+dt)ejdt(t)]x[(t+dt)ejdt(t) ]. depending on whether one uses euler s or exact integration rules, eq. 11 or 12 is maximised over j, t and nc (see si for detailed formulas). in all three inference procedures, the parameters are learned for each time t. then the median and the associated standard error are calculated for each flocking event. the data that support the plots within this paper and other findings of this study are available from the corresponding author upon request. | the correlated motion of flocks is an instance of global order emerging from local interactions. an essential difference with analogous ferromagnetic systems is that flocks are active : animals move relative to each other, dynamically rearranging their interaction network. the effect of this off - equilibrium element is well studied theoretically, but its impact on actual biological groups deserves more experimental attention. here, we introduce a novel dynamical inference technique, based on the principle of maximum entropy, which accodomates network rearrangements and overcomes the problem of slow experimental sampling rates. we use this method to infer the strength and range of alignment forces from data of starling flocks. we find that local bird alignment happens on a much faster timescale than neighbour rearrangement. accordingly, equilibrium inference, which assumes a fixed interaction network, gives results consistent with dynamical inference. we conclude that bird orientations are in a state of local quasi - equilibrium over the interaction length scale, providing firm ground for the applicability of statistical physics in certain active systems. |
international guidelines recommend that for patients who present with symptoms suggestive of an acute coronary syndrome (acs), attending emergency medical service (ems) personnel record a 12-lead ecg before transit to hospital.14 this prehospital ecg (phecg) may allow targeted treatments to be given outside of a hospital, determine which type of hospital receives the patient, and facilitate activation of the cardiac catheter laboratory. failure to perform a phecg is associated with delayed and denied reperfusion treatment in patients with st - elevation myocardial infarction (stemi).59 although some reports suggest that women are less likely than men to have a phecg recorded,10 there is incomplete understanding of the factors associated with the use of phecg and its impact on processes of care and mortality. furthermore, despite calls for widespread implementation, there is little empirical evidence that phecg is associated with lower mortality.3 4 that is, much of the previous literature focuses on processes of care such as the time to reperfusion with fibrinolytic drugs, or primary percutaneous coronary intervention (ppci).59 in england and wales, ems involvement in the care of patients with stemi is the highest in europe,11 and ecgs have been available through the national health service (nhs) ems since 2001. this, along with the availability of national data from the myocardial ischaemia national audit project (minap) concerning patients hospitalised with acs, provides a unique opportunity to study the use of phecg in patients with stemi and non - stemi and its association with processes of care and mortality.12 the a priori hypotheses for this study were that stemi and non - stemi patients who did not receive phecg differed in baseline clinical characteristics from those who did, and that the use of phecg by ems systems was associated with better processes of care and lower mortality rates. this study was based on national acs data from minap, participation in which is mandated for all hospitals in england and wales.12 data were collected prospectively at each hospital by a secure electronic system, developed by the central cardiac audit database (ccad), electronically encrypted and transferred online to a central database. minap is overseen by a multiprofessional steering group representing the stakeholders within the national institute for cardiovascular outcomes research (nicor).13 as such, this study includes data collected on behalf of the british cardiovascular society under the auspices of nicor in which patient identity was protected. the study population was drawn from 424 866 consecutive patients admitted to hospital with acs from 228 hospitals. patients were eligible for study if they were hospitalised between 1 january 2005 and 31 december 2009, and aged at least 18 years. for patients with multiple admissions we studied patients by initial diagnosis of stemi and non - stemi, determined by ems personnel or the hospital clinician responsible for providing definitive treatment. eligibility for emergency reperfusion therapy was based upon standard practice with a recommendation that patients should have a symptom duration of 12 h or less and st segment elevation of 0.1 mv or greater in at least two contiguous leads, or 0.2 mv or greater in in v1-v3, or presumed new onset left bundle branch block. the date and time of call for help was registered by the ems and the data transferred into the minap database by hospital staff. the date and time of reperfusion (defined as the time of first balloon inflation for ppci and time of injection for fibrinolytics) were recorded in minap by hospital staff. each minap entry provides details of the patient 's management across 122 fields,14 and date of all - cause mortality from linkage to the medical research information system, part of the nhs information centre using a unique nhs number. we used the procedure means of sas (statistical analysis system ; sas, cary, north carolina, usa) to obtain percentages, medians and interquartile ranges. ors, with 95% cis are presented, being more informative than p values, because the p values resulting from logistic regression with such a large dataset were, without exception, highly significant. sas (sas institute) proc logistic was used to obtain the estimates, with the dichotomous dependent variable, for example, phecg - recorded versus phecg - unrecorded regressed on the explanatory variables together with standardisation for case - mix using variables including those compatible with the mini - grace (global registry of acute coronary events) risk score.15 the covariates chosen are listed under the relevant tables. we used multiple imputation to mitigate bias due to missing data (details in online supplement). to investigate the extent to which the provision (or not) of reperfusion in stemi could be predicted by phecg use the dependent variable was reperfusion therapy, the independent variables being phecg, congestive heart failure (chf), whether or not older than 75 years, previous mi, previous coronary artery bypass grafting (cabg), sex, diabetes mellitus, patient delay in hours, and calendar year of stemi.16 missing values were accommodated as outlined above. mortality within 30 days (yes / no) was the dependent variable in a logistic regression (using sas proc logistic) with independent variables : whether or not on aspirin, age in years at admission, body mass index, whether elevated marker set (yes / no), whether chronic renal failure (crf) (yes / no), whether diabetic (yes / no), whether prior stroke (yes / no), and whether prior chf (yes / no). an output of this logistic regression exercise, based on the model parameter estimates and the values for each patient of the independent variables for that patient, was a predicted probability of 30-day mortality for that patient. patients were sorted in descending order by these predicted probabilities, and the resultant dataset divided into terciles (3 equinumerous, non - overlapping, exhaustive subsets). the intermediate versus lowest 30-day mortality risk was the ratio for each subclassification (eg, phecg, no phecg), of the corresponding numbers of patients in the middle tercile and in the lowest tercile. for the highest versus lowest 30-day mortality risk, we used the procedure means of sas (statistical analysis system ; sas, cary, north carolina, usa) to obtain percentages, medians and interquartile ranges. ors, with 95% cis are presented, being more informative than p values, because the p values resulting from logistic regression with such a large dataset were, without exception, highly significant. sas (sas institute) proc logistic was used to obtain the estimates, with the dichotomous dependent variable, for example, phecg - recorded versus phecg - unrecorded regressed on the explanatory variables together with standardisation for case - mix using variables including those compatible with the mini - grace (global registry of acute coronary events) risk score.15 the covariates chosen are listed under the relevant tables. we used multiple imputation to mitigate bias due to missing data (details in online supplement). to investigate the extent to which the provision (or not) of reperfusion in stemi could be predicted by phecg use the dependent variable was reperfusion therapy, the independent variables being phecg, congestive heart failure (chf), whether or not older than 75 years, previous mi, previous coronary artery bypass grafting (cabg), sex, diabetes mellitus, patient delay in hours, and calendar year of stemi.16 missing values were accommodated as outlined above. mortality within 30 days (yes / no) was the dependent variable in a logistic regression (using sas proc logistic) with independent variables : whether or not on aspirin, age in years at admission, body mass index, whether elevated marker set (yes / no), whether chronic renal failure (crf) (yes / no), whether diabetic (yes / no), whether prior stroke (yes / no), and whether prior chf (yes / no). an output of this logistic regression exercise, based on the model parameter estimates and the values for each patient of the independent variables for that patient, was a predicted probability of 30-day mortality for that patient. patients were sorted in descending order by these predicted probabilities, and the resultant dataset divided into terciles (3 equinumerous, non - overlapping, exhaustive subsets). the intermediate versus lowest 30-day mortality risk was the ratio for each subclassification (eg, phecg, no phecg), of the corresponding numbers of patients in the middle tercile and in the lowest tercile. for the highest versus lowest 30-day mortality risk, the corresponding terciles were the highest and the lowest. among 424 866 patients in the minap registry for the years of the study, 288 990(68%) were recorded as using ems, 22 965(5.4%) were documented as not using ems, and the method of hospital arrival was unknown for 112 911 (26.6%) (figure 1). table 1 compares baseline characteristics of patients by ems use. after adjustment, patients who used ems were older, more likely to be female, caucasian, and to have had prior mi, angina, chf, or chronic pulmonary disease (copd) than those who did not use ems. baseline characteristics : ems versus no ems transportation to hospital data expressed as percentages unless indicated. cabg, coronary artery bypass graft ; chf, chronic heart failure ; copd, chronic obstructive pulmonary disease ; crf, chronic renal failure ; ems, emergency medical services ; mi, myocardial infarction ; pad, peripheral arterial disease ; pci, percutaneous coronary intervention. study flow chart based on initial diagnosis. of those known to have used ems, 145 247 (50.3%) received phecg. between 2005 and 2009, phecg use increased overall (51% vs 64%, adjusted or (aor) 2.17, 95% ci 2.12 to 2.22) and in stemi (64% vs 79%, aor 2.34, 95% ci 2.25 to 2.44). compared with patients who did not receive a phecg, those who did were younger (71 years vs 74 years, p<0.0001), less frequently female (33.1% vs 40.3%, or 0.87, 95% ci 0.86 to 0.89) and had fewer comorbidities. patients who did not receive phecg were more frequently hypertensive, had a history of stroke, chf, crf, angina, diabetes or (copd) (table 2). use of phecg increased (including among women, older people, patients with chf and those with comorbidities) over the study period (table 4). patients who received phecg had a lower baseline mortality risk measured by mini - grace than those who did not.15 baseline characteristics by phecg use in patients who came via ems age in median (iqr) years. cabg, coronary artery bypass graft ; chf, chronic heart failure ; crf, chronic renal failure ; grace, global registry of acute coronary events ; pad, peripheral arterial disease ; pci, percutaneous coronary intervention ; phecg, prehospital ecg ; sbp, systolic blood pressure. the recording of phecg was associated with longer prehospital ems time intervals. considering all acs, the median time from ems call to arrival at hospital was 6 min longer in patients who had phecg (52 min (iqr 40.0, 66.0) versus 46 min (iqr 35.0, 62.0). similarly, time from ems arrival at scene to hospital arrival was 5 min longer (40 (iqr 31.0, 53.0) vs 35 (26.0, 46.0) min). the same pattern was seen for stemi (ems call to hospital arrival 52 (40.0, 666.0) vs 45 (33.0, 62.0) min ; time in ems care 41 (iqr 31.0, 54.0) vs 34 (25.0, 46.0) min). the use of any reperfusion strategy (pci or fibrinolytic) in stemi patients was more frequent in those who had phecg (85.3% vs 74.4%, p<0.001), after adjustment for confounding factors. performance of phecg was predictive of reperfusion therapy in stemi compared with other patient characteristics (aor 1.70, 95% ci 1.63 to 1.78) (figure 2). characteristics associated with use of reperfusion therapy in patients with acute st - elevation myocardial infarction (stemi) : influence of prehospital 12-lead ecg. door - to - balloon time for patients who received ppci for stemi was not influenced by phecg use (median (iqr) : 46.0 (30.0, 71.0) vs 45.0 (28.0, 75.0) min, respectively). however, a significant increase in the proportion of patients who received ppci within 90 min of calling the ems was observed when a phecg was recorded (27.9% vs 21.4%, aor 1.38, 95% ci 1.24 to 1.54). for stemi patients receiving fibrinolytics in hospital, phecg use was associated with a higher proportion of patients who received treatment within 30 min of arrival (90.6% vs 83.7% ; aor 2.13, 95% ci 1.91 to 2.38). the median door - to - needle interval was 3 min shorter (17 (iqr 12.0, 23.0) versus 20 (14.0, 27.0) min). however, the overall call - to - needle interval was similar between the two groups (59 (iqr 49.0, 72.0) versus 58 (47.0, 73.0 min). of 11 172 stemi patients who received prehospital fibrinolytic therapy, phecg was recorded by ems personnel in 10 816, (96.8%). in the remainder, phecg was performed by non - ems personnel (eg, primary care physicians) prior to ems arrival. as phecg was associated with an increased likelihood of a stemi patient receiving any reperfusion therapy (figure 2), we sought to determine whether patients who did not have phecg shared similar characteristics to those who subsequently failed to receive reperfusion treatment for stemi. the separate baseline characteristics for these two categories were summarised and were clearly different (data on file). on account of the large numbers of patients in each category, and the overlap of patients in the two categories, any statistical judgement on the significances of these differences would be uninformative : the only meaningful comparisons would be ones based on clinical judgement. patients who received a phecg exhibited significantly lower hospital and 30-day mortality rates than those who did not (30-day mortality 7.4% vs 8.2%, aor 0.94, 95% ci 0.91 to 0.96). most of the differences were attributable to significantly lower rates of mortality in stemi patients who received a phecg (8.6% vs 11.4%, aor 0.94, ci 0.90 to 0.98). there was no difference in mortality by phecg in stemi patients who did not undergo any reperfusion strategy (18.6% vs 18.8%, aor 0.96 95% ci 0.90 to 1.03). patients with non - stemi who received a phecg had lower mortality than those who did not (5.9% vs 6.5%, aor 0.84, 95% ci 0.81 to 0.88). (table 3). hospital and 30-day mortality by phecg use ems, emergency medical services ; phecg, prehospital ecg ; ppci, primary percutaneous coronary intervention ; stemi, st - elevation myocardial infarction. this study demonstrates that, in patients presenting with symptoms of acs, phecg use is significantly associated with a reduction in mortality during the 30 days following hospitalisation. this mortality benefit was seen in stemi (where there was an association between phecg and an increased likelihood of, and reduced delay to, reperfusion) and in non - stemi. phecg use increased over the study period (including among women, older people, chf patients and those with comorbidities), but was still suboptimal at approximately two - thirds of eligible patients with acs (almost 80% in stemi). patients with higher mortality risk at baseline, as assessed using the mini - grace score, were less likely to receive phecg. although prehospital time was increased for those who had received phecg, in - hospital processes of care were improved, particularly for stemi. moreover, the risk of death was lower in stemi and non - stemi even after adjustment for confounding effects. in - hospital and 30-day mortality rates in those receiving phecg and ppci for stemi were 11% and 4% lower, respectively suggesting a similar beneficial effect as in most other groups of patients, but in this case failing to reach statistical significance at the 95% level. first, our patients were older ; 72 (60, 81) years compared with 61 years in the nrmi-4 registry,5 and 62 (52,75) years in the ncd - action registry,8 and 62 years in the series reported by patel.17 the proportion of ems patients who were female was similar to ncd - action8 (36.1% vs 34.1%) but lower than the 47% reported by patel.17 previous reports suggest sex differences in prehospital management of acs. rothcock reported that phecg use was significantly lower in women than men (32.9% vs 39.3%, p<0.001).18 our study suggests that patients who did not have phecg were more frequently older, female and comorbid. it is possible that, in a predominantly male ems workforce, staff were reluctant to undertake phecg in female patients because of the need for intimate exposure. this phenomenon has been reported elsewhere.18 19 meisel found that including ems provider sex in their logistic regression model did not change differences observed between patient sex and rates of prehospital use of acs protocol interventions (although phecg was not included in the ems protocols). we did not collect data on patient preferences, and it is possible that women were less likely than men to consent to having a phecg recorded. we have shown that, in contrast to other patient variables, having a phecg recorded is associated with the provision of reperfusion therapy for stemi. in an analysis of the grace,16 phecg was not included in the model to assess characteristics associated with failure to use reperfusion therapy. the role of the phecg in patients with non - stemi acs has received little attention in previous studies. cudnick reported that of 21 151 patients with non - stemi in the ncdr - action - get with the guidelines (gwtg) registry, a phecg was documented in only 1609 (7.6%), and the primary outcomes of interest were process measures including use of aspirin, -blocker and heparin and length of stay in the emergency department (ed). since minap does not collect these data, we were unable to compare our findings. cudnick did not find an association between phecg and lower mortality for non - stemi. the precise mechanism whereby the recording of a phecg was associated with lower mortality in our series remains unexplained and requires further evaluation. our study should be interpreted in the context of the following limitations. given the observational nature of our research, we are not able to establish causality.21 our analysis was dependent upon the extent and validity of data in the minap database. we used multiple imputation to mitigate bias due to missing data.22 it is possible, however, that those with missing data were the most seriously ill, and it was more difficult to obtain and record accurate data for the minap database (eg, those who died prior to hospital arrival or in the ed), and we can not exclude this potential source of bias. minap does not collect data on presenting symptoms, and we were therefore unable to ascertain clinical indications for recording a phecg. nor were we able to distinguish between cases where the phecg was transmitted electronically for expert review (eg, by a cardiologist23 or cardiac care unit (ccu) nurse24) or interpreted by ems staff. ducas report that non - physician ems interpretation of phecg is safe and reliable. we were also unable to ascertain the skill level of ems staff : in england and wales, ambulances are staffed by a combination of paramedics (trained in advanced life support and ecg interpretation) and emergency medical technicians trained in basic life support and use of an automated external defibrillator, but not in ecg interpretation. it is possible that paramedics underwent a different process of clinical assessment and decision making, and this may have implications for appropriateness of cardiac catheter laboratory activation.26 it is possible that increased availability of ppci following publication of national guidance in 2008 could result in an increase in phecg use, but we did not identify an increase in phecg use from 2008 to 2009 (table 4).27 changes in use of phecg in patients who used ems, by year chf, chronic heart failure ; ems, emergency medical services ; phecg, prehospital ecg. findings from this national mi registry demonstrate for the first time a survival advantage in stemi and non - stemi patients when phecg was used. this study strengthens the evidence base for guidelines which recommend phecg. however, use was variable, indicating the need for quality improvement interventions. such interventions need to be evaluated through randomised trials in order to provide rigorous evidence of their clinical and cost effectiveness. key messageswhat is already known on this subject?use of the phecg has been recommended in international guidelines for st - elevation myocardial infarction (stemi), but while several reports of the impact of processes, such as reperfusion times have been published, there have been no data exploring the association of phecg with patient outcome, and little is known about the impact of phecg on patients with non - stemi acs.what this study addsfindings from this national mi registry demonstrate for the first time a survival advantage associated with phecg use, in patients with stemi and non - stemi. it also identifies categories of patients in whom phecg is underutilised.how might this impact on clinical practice?this study strengthens the evidence base for existing guidelines, and identifies the need for interventions to increase phecg use in categories of patients in which it is currently underutilised. use of the phecg has been recommended in international guidelines for st - elevation myocardial infarction (stemi), but while several reports of the impact of processes, such as reperfusion times have been published, there have been no data exploring the association of phecg with patient outcome, and little is known about the impact of phecg on patients with non - stemi acs. findings from this national mi registry demonstrate for the first time a survival advantage associated with phecg use, in patients with stemi and non - stemi. this study strengthens the evidence base for existing guidelines, and identifies the need for interventions to increase phecg use in categories of patients in which it is currently underutilised. | objectiveto describe patterns of prehospital ecg (phecg) use and determine its association with processes and outcomes of care in patients with st - elevation myocardial infarction (stemi) and non-stemi.methodspopulation-based linked cohort study of a national myocardial infarction registry.results288 990 patients were admitted to hospitals via emergency medical services (ems) between 1 january 2005 and 31 december 2009. phecg use increased overall (51% vs 64%, adjusted or (aor) 2.17, 95% ci 2.12 to 2.22), and in stemi (64% vs 79%, aor 2.34, 95% ci 2.25 to 2.44). patients who received phecg were younger (71 years vs 74 years, p<0.0001) ; and less likely to be female (33.1% vs 40.3%, or 0.87, 95% ci 0.86 to 0.89), or to have comorbidities than those who did not. for stemi, reperfusion was more frequent in those having phecg (83.5% vs 74.4%, p<0.0001). phecg was associated with more primary percutaneous coronary intervention patients achieving call - to - balloon time < 90 min (27.9% vs 21.4%, aor 1.38, 95% ci 1.24 to 1.54) and more patients who received fibrinolytic therapy achieving door - to - needle time < 30 min (90.6% vs 83.7%, aor 2.13, 95% ci 1.91 to 2.38). patients with phecg exhibited significantly lower 30-day mortality rates than those who did not (7.4% vs 8.2%, aor 0.94, 95% ci 0.91 to 0.96).conclusionsfindings from this national mi registry demonstrate a survival advantage in stemi and non - stemi patients when phecg was used. |
high oxygen \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ ({ \rm o}_{2})$\end{document } therapy (hyperoxia) is a necessary treatment of low blood \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ { \rm o}_{2}$\end{document } in adult and pediatric patients with acute lung injury (ali). this treatment is effective in restoring blood \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ { \rm po}_{2}$\end{document } to a level which sustains vital organ metabolic requirements. however, prolonged exposure to high \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ { \rm o}_{2}$\end{document } concentrations \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ ({ > } { 50\%})$\end{document } causes lung injury. further complicating this situation is the fact that the time frame over which hyperoxic lung injury develops is difficult to predict due to the wide variation between patient tolerance / susceptibility. thus, a minimally invasive method to detect pulmonary injury in an individual patient exposed to high fractions of \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ { \rm o}_{2}$\end{document } in real time is highly desirable. rat exposure to \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ { > } { 95\%}~{\rm o}_{2}$\end{document } is a well - documented model of hyperoxic lung injury and human ali,. previous studies have suggested that mitochondrial dysfunction is a cardinal feature of hyperoxic lung injury. although much work has been done in cell cultures and tissue homogenates, studies probing key tissue mitochondrial functions and the effect of oxidant injury in intact lungs in real - time are limited,,. because indices of mitochondrial function of in situ tissue are often different than those of tissue homogenates, measurements of indices of oxidative phosphorylation in intact tissue for comparison to those of isolated mitochondria are important. recently, we demonstrated the utility of optical fluorometry (fig. 1) to detect a change in the redox status of lung mitochondrial autofluorescent coenzymes nadh (nicotinamide adenine dinucleotide) and fad (oxidized form of flavin adenine dinucleotide \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ ({ \rm fadh}_{2})$\end{document }), in isolated perfused rat lungs. nadh and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ { \rm fadh}_{2}$\end{document } (flavin adenine dinucleotide) are mitochondrial metabolic coenzymes, and are the primary electron carriers in oxidative phosphorylation. the oxidation of these two via the mitochondrial electron transport chain involves the transport of protons from mitochondrial complexes i, iii, and iv into the mitochondrial intermembrane space (fig. 2). this creates a proton gradient, which, along with the presence of adenosine diphosphate (adp), yields the production of the cell 's basic unit of energy, adenosine triphosphate (atp). therefore, a change in the redox state of the electron transport chain, and thus nadh and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ { \rm fadh}_{2}$\end{document }, is a quantitative marker of lung tissue mitochondrial bioenergetics, and hence mitochondrial function,. hydrogen ions are transported from the mitochondrial matrix across the inner mitochondrial membrane into the intermembrane space by complexes i, iii, and iv. the movement of hydrogen ions down the electrochemical gradient is coupled to the phosphorylation of adenosine diphosphate (adp) to form adenosine triphosphate (atp) by complex v. electrons from the autofluorescent reducing agent, nicotine adenine dinucleotide (nadh), move from complex i through ubiquinone to complex iii and then complex iv via cytochrome c (cyt c). electrons from succinate, another reducing agent, enter the respiratory chain through flavin adenine dinucleotide (fad), which is covalently linked to complex ii of the respiratory chain. rotenone (rot) and potassium cyanide (kcn) inhibit complex i and iv, respectively. pentachlorophenol (pcp) is a protonophore which increases membrane proton conductivity, disrupts the proton gradient across the membrane, and as a result uncouples mitochondrial electron transport chain from phosphorylation. hydrogen ions are transported from the mitochondrial matrix across the inner mitochondrial membrane into the intermembrane space by complexes i, iii, and iv. the movement of hydrogen ions down the electrochemical gradient is coupled to the phosphorylation of adenosine diphosphate (adp) to form adenosine triphosphate (atp) by complex v. electrons from the autofluorescent reducing agent, nicotine adenine dinucleotide (nadh), move from complex i through ubiquinone to complex iii and then complex iv via cytochrome c (cyt c). electrons from succinate, another reducing agent, enter the respiratory chain through flavin adenine dinucleotide (fad), which is covalently linked to complex ii of the respiratory chain. rotenone (rot) and potassium cyanide (kcn) inhibit complex i and iv, respectively. pentachlorophenol (pcp) is a protonophore which increases membrane proton conductivity, disrupts the proton gradient across the membrane, and as a result uncouples mitochondrial electron transport chain from phosphorylation. the objective of this paper was to utilize optical fluorometry to evaluate the effect of rat exposure to hyperoxia (\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ { > } { 95\%}~{\rm o}_{2}$\end{document } for 48 hours) on lung tissue mitochondrial redox status in a nondestructive manner in intact lungs, with a long term goal of understanding the role of mitochondrial dysfunction in the pathogenesis of lung \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ { \rm o}_{2}$\end{document } toxicity as well as developing a diagnostic modality of oxygen toxicity. fatty - acid free bovine serum albumin (standard powder, bsa) was purchased from serologicals corp. (gaithersburg, md). all other reagent grade chemicals were purchased from sigma chemical company. a schematic for the fluorometer device used in these studies briefly, excitation light is generated from a mercury arc lamp and delivered through a liquid light guide to a filter wheel, where the appropriate excitation wavelength can be selected. on the other side of this filter wheel is one leg of a bifurcated fiber bundle with a distal end of 3.2 mm inner diameter consisting of 158 (79 for excitation and 79 for emission) randomly distributed fibers, each 200 \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \mu{\rm m}$\end{document } in diameter, which is brought into contact with the tissue with minimal pressure on the lung. the power of the light emitted from the head of the probe is 1 \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ { \rm mw}/{\rm cm}^{2}$\end{document } for nadh and 4 \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ { \rm mw}/{\rm cm}^{2}$\end{document } for fad. the other leg of the bifurcated fiber bundle delivers light to the detection optics where it is collimated and split using a beam splitter. half of the light is then incident on an avalanche photodiode for detection of reflected light. the other half of the light then passes through a dichroic mirror to separate the nadh and fad channels. in either of the channels, the light is then filtered to select the emitted fluorescence and is finally incident on a photomultiplier tube. to optimally excite the fluorophores of interest, nadh and fad, using the mercury arc lamp, the excitation filters used were centered at 370 nm and 452 nm, with bandwidths of 40 nm and 50 nm, respectively. finally, the filters used to detect the emitted fluorescence are centered at 460 and 520 nm, respectively, each with a bandwidth of 40 nm. for normoxic (control) lung studies, adult male sprague - dawley rats (charles river ; 300350 g) for the hyperoxic lung studies, age matched rats were housed in a plexiglass chamber maintained at \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ { > } { 95\%}~{\rm o}_{2}$\end{document } for 48 hours (hyperoxic). the total gas flow was 3.5 liters / min and the chamber \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ { \rm co}_{2}$\end{document } was maintained at \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ { } { 95\%}~{\rm o}_{2}$\end{document}. over the course of this exposure period, the rats experienced a small \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ ({ \sim}{3\%})$\end{document }, but significant loss in body weight (pre- and post - body weights of \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ 337\pm 14~({\rm se},~{\rm n}={16})~{\rm g}$\end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ 327\pm 13~{\rm g}$\end{document }, respectively). 3.histology : images of h&e section of normoxic (a) vs. hyperoxic (b) lungs. after 48 hours of exposure, lungs show no evidence of neutrophilic infiltrates, pulmonary edema, or vascular smooth muscle thickening, which are characteristic of hyperoxic injury sustained after rat exposure for 60 hours or longer. histology : images of h&e section of normoxic (a) vs. hyperoxic (b) lungs. after 48 hours of exposure, lungs show no evidence of neutrophilic infiltrates, pulmonary edema, or vascular smooth muscle thickening, which are characteristic of hyperoxic injury sustained after rat exposure for 60 hours or longer. for both normoxic and hyperoxic lungs, the response of both nadh and fad lung surface signals to lung perfusion with rotenone, kcn, or pcp appeared within a minute of adding the chemical to the perfusate reservoir (figs. 4 and 5). an increase (from baseline) in nadh fluorescence signal indicates reduction of the mitochondrial matrix (fig. 2), whereas an increase in the fad fluorescence signal indicates oxidation of the electron transport chain. in this paper, the change in nadh signal in the presence of rotenone or kcn is considered a measure of mitochondrial complex i activity, and the change in the fad signal in the presence of kcn is considered a measure of mitochondrial complex ii activity. fig. 4.representative fluorometer response to perfusion with chemical inhibitors and uncouplers in a normoxic lung. representative fluorometer response to perfusion with chemical inhibitors and uncouplers in a hyperoxic lung. for normoxic lungs (fig. 4 and table i), lung perfusion with rotenone(complex i inhibitor) reduced the mitochondrial matrix (etc) upstream from complex i resulting in an increase in nadh signal by \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ 20.2\pm 2.3$\end{document } (se) %, with no effect on fad signal. lung perfusion with kcn (complex iv inhibitor) reduced the etc resulting in a \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ 21.7\pm 2.5\%$\end{document } increase in nadh and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ 6.8\pm 1.6\%$\end{document } decrease in fad. lung perfusion with pcp, which uncoupled etc from phosphorylation, decreased nadh signal by \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ 19.7\pm 2.1\%$\end{document } with no effect on fad signal. the addition of kcn to pcp - treated lungs reversed the effect of pcp on the redox status of the etc, increasing nadh signal by \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ 25.7\pm 2.6\%$\end{document } and decreasing fad signal by \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ { -}9.3\pm 1.0\%$\end{document}. in the presence of rotenone, kcn resulted in a small but significant decrease \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ ({ -}3.3\pm 0.8\%)$\end{document } in lung surface fad signal and increase \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ (4.6\pm 1.0\%)$\end{document } on nadh signal as compared to values in the presence of rotenone only. table ithe effects of metabolic inhibitors and uncoupler on the lung tissue surface fad and nadh fluorescence signals of normoxic and hyperoxic ratsinhibitor/ uncouplerfad % nadh % normoxichyperoxicnormoxichyperoxicrotenone0.2 0.20.3 0.320.2 2.37.5 1.0kcn6.8 1.65.2 0.521.7 2.59.2 1.2pcp1.7 0.82.3 1.419.7 2.120.8 1.2pcp + kcn9.3 1.04.2 0.7 25.7 2.69.0 1.0rotenone + kcn0.83.3 3.8 0.64.6 1.02.8 for the (pcp + kcn) and (rotenone + kcn) treatments, the percentage change due to additional treatment with kcn is calculated relative to the new baseline in the presence of pcp or rotenone, respectively. for normoxic lungs, \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ { \rm n}=5,7,6,6,$\end{document } and 5 for rotenone, potassium cyanide (kcn), pentachlorophenol (pcp), pcp + kcn, and rotenone + kcn, respectively. for hyperoxic lungs \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ { \rm n}=4,5,6,5$\end{document }, and 4 for rotenone, kcn, pcp, pcp + kcn, and rotenone + kcn, respectively. indicates value significantly different from the corresponding normoxic value (t - test \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ { \rm p} } { 95\%}~{\rm o}_{2}$\end{document } for 48 hours decreased the change in nadh signal in the presence of kcn or rotenone by 58% and 63%, respectively, as compared to those of normoxic lungs. a similar decrease (65%) in nadh signal was also measured following the addition of kcn to pcp - treated hyperoxic lungs as compared to normoxic lungs. rotenone- or kcn - induced change in nadh signal is a measure of complex i activity. thus these result suggest that the etc upstream from complex i is more reduced in intact hyperoxic lungs than in normoxic lungs, and that complex i activity is lower in hyperoxic lungs. this is consistent with the 77% decrease in mitochondrial complex i activity per mg protein which we measured in p2 fractions derived from hyperoxic lungs as compared to normoxic lung. the measured hyperoxia - induced change in complex i redox state (table ii) could be due to a change in complex i protein and/or change in rate of nadh production. the latter could result from impairment to the krebs cycle and/or change in cytoslic \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ { \rm nadh}/{\rm nad}^{+}$\end{document } which could affect mitochondrial nadh level via the malate - aspartate shuttle. however, the hyperoxia - induced change in complex i redox state is most likely due to a change in complex i protein since for the complex i assay (p2 fraction), the nadh concentration used was the same for both normoxic and hyperoxic lung mitochondrial preparations (p2 fractions). the results of this assay (table ii) show that the measured hyperoxia - induced change in complex i activity is qualitatively and quantitatively consistent with the hyperoxia - induced change in complex i redox state measured on the surface of the lung (table i). the sulfhydryl - containing krebs cycle enzymes pyruvate and alpha - ketoglutarate dehydrogenase and their coenzymes coa and lipoic acid are sensitive to oxidative stress. previous studies evaluated the effect of rat exposure to 100% \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ { \rm o}_{2}$\end{document } for 24 hrs on these and other krebs cycle enzymes,,. gardner. reported a 73% decrease in lung aconitase activity after 24 hrs of rate exposure to 100% \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ { \rm o}_{2}$\end{document}. this decrease is consistent with the increase in citrate level (aconitase substrate) in lung tissue under the same exposure conditions as reported by bassett.. this impairment to the krebs cycle could affect nadh supplied to the electron transport chain and in turn complex i redox state. however it is not known whether this impairment to aconitase activity persists after 48 hrs of exposure to 100% \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ { \rm o}_{2}$\end{document } or whether it is sufficient to account for the measured hyperoxia - induced change in complex i redox state. in another study, bassett. reported that rat exposure to 100% \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ { \rm o}_{2}$\end{document } for 24 hrs had no effect on the activities of the krebs cycle enzymes succinate dehydrogenase, isocitrate dehydrogenase or \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \alpha$\end{document}-glycerophosphate dehydrogenase. in the present study we report a 64% decrease in succinate dehydrogenase (complex ii) activity after 48 hrs of exposure to 100% \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ { \rm o}_{2}$\end{document}. additional studies would be needed to evaluate the effect of rat exposure to 100% \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ { \rm o}_{2}$\end{document } for 48 hrs on the activities of krebs cycle enzymes isocitrate dehydrogenase, \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \alpha$\end{document}-glycerophosphate dehydrogenase, and aconitase to determine the potential contribution of impaired production of nadh by the krebs cycle to the measured change in complex i redox state. fisher ab reported that rat exposure to 100% \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ { \rm o}_{2}$\end{document } for 48 hrs increased lung lactate production rate (78%) and lactate to pyruvate ratio (108%). since lactate to pyruvate ratio is proportional to cytosolic \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ { \rm nadh}/{\rm nad}^{+}$\end{document }, the increase in lactate to pyruvate ratio suggests an increase in cytosolic nadh transported to the mitochondria matrix via the malate - aspartate shuttle. this shuttle provide more cytosolic nadh to mitochondria when the cytosolic \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ { \rm nadh}/{\rm nad}^{+}$\end{document } is higher than in the mitochondrial matrix. thus the hyperoxia - induced increase in cytosolic \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ { \rm nadh}/{\rm nad}^{+}$\end{document } could contribute to the measured change in complex i redox state in hyperoxic lungs. rat exposure to hyperoxia had no effect on the change in nadh signal in the presence of pcp as compared to that in normoxic lungs as a measure of the coupling between etc and phosphorylation. this observation implies that rat treatment with hyperoxia (\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ { > } { 95\%}~{\rm o}_{2}$\end{document } for 48 hours) did not alter the coupling between respiration and phosphorylation in lung tissue despite the apparent decrease in complex i activity. however, since the etc upstream from complex i is more reduced in hyperoxic lungs than in normoxic lungs, one would expect a larger pcp - induced decrease in nadh signal in hyperoxic lung. demonstrated that rat exposure to 100% \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ { \rm o}_{2}$\end{document } for 48 hours decreased adp - stimulated \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ { \rm o}_{2}$\end{document } consumption (state 3) by \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ { \sim}{50\%}$\end{document } with a - ketoglutarate as an nad - linked substrate. together these results support a decreased tightness of coupling between respiration and phosphorylation in hyperoxic lungs as compared to normoxic lungs. there is ample evidence that increased production of reactive oxygen species (ros) is a major pathophysiological factor in the genesis of hyperoxic lung injury,. thus, one strategy that cells may have evolved to protect against hyperoxic lung injury is to mitigate the activities of ros sources,. mitochondrial electron transport complex i is a major source of ros,,. moreover, studies have shown that the rate of ros formation at complex i in endothelial cells increased with an increase in \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ { \rm o}_{2}$\end{document } tension, and that complex i inactivation using rotenone decreased ros generation in sheep pulmonary microvascular endothelial cells exposed to hyperoxia (100% \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ { \rm o}_{2}$\end{document } for 30 min),,. thus the measured decrease in complex i could be an adaptive mechanism by the cells to decrease the rate of ros formation at complex i under hyperoxic conditions. on the other hand, the measured decrease in complex i activity could represent hyperoxia - induced injury leading to increases in the rate of ros formation. hyperoxia - induced increase in the rate of ros formation could damage mdna and as a result compromise complex i activity since 7 out of 45 subunits of complex i are encoded by mdna,. hyperoxia - induced increase in ros formation could also cause direct damage to complex i activity by oxidizing cardiolipin, which is sensitive to ros,. in addition, oxidation of this lipid could lead to increase in the loss of electrons at complex i and in the rate of mitochondrial superoxide formation at complex i,. ratner. demonstrated that exposure of neonatal mice to hyperoxia (75% \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ { \rm o}_{2}$\end{document } for 72 hours) decreases complex i activity in lung homogenates by \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ { \sim } 70\%$\end{document }, and that this decrease compromises mitochondrial oxidative phosphorylation and contributes to alveolar development arrest. fisher ab showed that rat exposure to 100% \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ { \rm o}_{2}$\end{document } for 48 hours had no effect on lung tissue atp content as compared to normoxic lungs, although there was an increase (105%) in lactate / pyruvate ratio indicating an increase in atp production via glycolysis. he suggested that the increased lactate / pyruvate ratio could be due to demand for glycolytic atp and/or decrease in atp production via oxidative phosphorylation which is compensated for by an increase in atp production via glycolysis. compared to nadh, the measured change in the fad signal in response to lung treatment with the metabolic inhibitors was relatively small for normoxic and hyperoxic lungs one reason for this observation could be lower lung tissue concentration of fad as compared to nadh. in fact, the fad baseline signal is small relative to the nadh signal as evidenced by the difference in signal amplification for the nadh and fad channels (\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ 10^{3}$\end{document } for nadh compared to \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ { \sim}6\times 10^{5}$\end{document } for fad). lung treatment with kcn, which reduces the etc upstream from complex iv, should reduce complex ii and as a result decrease fad signal. just as a change in nadh tracks complex i activity, a change in fad signal reflect complex ii activity. rat exposure to hyperoxia had no significant effect on the change in fad signal in the presence of kcn as compared to that in lungs from normoxic rats. however, the change in fad signal following the addition of kcn to pcp - treated lungs was 56% lower in hyperoxic lungs than normoxic lungs. it could be that lung treatment with pcp, which simulates the flow of reducing equivalents through the chain, fully oxidized the chain and as a result exposed the difference in the capacities of complex ii between normoxic and hyperoxic lungs. regardless, this apparent decrease in complex ii activity is consistent with the 63% decrease in mitochondrial complex ii activity per mg protein in p2 fractions derived from hyperoxic lungs as compared to normoxic lung (table ii). the measured hyperoxia - induced change in fad signal in the presence of \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ ({ \rm pcp}+{\rm kcn})$\end{document } could be due to a direct oxidant - induced inhibition of complex ii or indirect inhibition of complex ii by impairment of krebs cycle enzymes / coenzymes that result in a decrease in succinate concentration or increase in the concentration of oxaloacetate (oaa). complex ii activity is inhibited by a high level of oaa. however the results of the mitochondrial isolates (p2 fractions) suggest that the hyperoxia - induced change in complex ii redox state is most likely due to impairment of complex ii itself since for this assay the concentrations of succinate and the electron acceptor (dcpip) used were the same for the mitochondrial isolates from both normoxic and hyperoxic lungs and should be in excess of what is required for maximal function of complex ii. the measured decrease in complex ii activity using this assay (table ii) is qualitatively and quantitatively consistent with the measured hyperoxia - induced decrease in fad signal in the presence of \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ { \rm pcp}+{\rm kcn}$\end{document } as a measure of complex ii activity (table i). hence, damage to mdna due to hyperoxia - induced increase in the rate of ros formation should have no effect on complex ii. since electrons channeled through complex ii produce 4-fold more mitochondrial superoxide than electrons channeled through complex i, the apparent decrease in complex ii activity could be a means by the cells to reduce ros formation under hyperoxic conditions. additional studies are needed to evaluate the effect of the depression in complex i and complex ii activities observed in hyperoxic lungs on ros production at complex i and iii and mitochondrial bioenergetics, and to determine whether this depression is an injury or an adaptive response to the hyperoxic environment. our assumption in this paper is that changes in the mitochondrial pool of nadh is a key contributor to the measured changes in the nadh fluorescence signal since the metabolic inhibitors we used target the mitochondrial electron transport chain. fisher. demonstrated that rat lung treatment with kcn increased lung lactate / pyruvate by 4-fold. in this paper, lung perfusion with kcn increased lung surface nadh signal by 22% in normoxic lungs. since lactate / pyruvate ratio reflects cytosolic \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ { \rm nadh}/{\rm nad}^{+}$\end{document },, this suggests that cytosolic nadh did not contribute significantly to the measured lung surface nadh signal. unlike the nadh signal which has cytosolic and mitochondrial components sources of redox - sensitive flavoprotein (fad) include succinate dehydrogenase (complex ii), lipoamide dehydrogenase (lipdh), and electron transfer flavoprotein (etf),,. however, as previously discussed, most of the measured lung surface fad signal is from complex ii flavin. fisher ab demonstrated that rat exposure to 100% \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ { \rm o}_{2}$\end{document } for 48 hours stimulated glycolysis as measured by \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ { \sim}{105\%}$\end{document } increase in the lung lactate / pyruvate ratio. since this ratio is a measure of cytosolic \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ { \rm nadh}/{\rm nad}^{+}$\end{document }, this suggest that lung tissue cytoplasm is more reduced in hyperoxic lungs than normoxic lungs. thus, coupled with the results of the present study, the data document that both tissue cytosolic and mitochondrial compartments are more reduced in hyperoxic lungs than normoxic lungs. the hyperoxia - induced decrease in complex i and ii activities in the present study represents a relatively early in situ metabolic consequence of hyperoxia in that it precedes effects on lung histology, hemodynamic and functional endpoints observed with rat exposure to \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ { > } { 95\%}~{\rm o}_{2}$\end{document } for \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ { > } { \rm 48}~{\rm hours}$\end{document },. of the few studies evaluating the metabolic consequences of hyperoxia in the 1848 hr period, a decrease in serotonin clearance and an increase in lactate production have been observed in lungs from rats exposed to 100% \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ { \rm o}_{2}$\end{document } for 18 and 36 hrs, respectively,. audi. reported that rat exposure to hyperoxia (85% \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ { \rm o}_{2}$\end{document } for 48 hours) results in 47% decrease in the capacity of complex i mediated coenzyme \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ { \rm q}_{1}$\end{document } (amphipathic homolog of ubiquinone) reduction on passages through the pulmonary circulation as compared to that in lungs of normoxic rats. additionally, klein. demonstrated a decrease in the metabolism of prostaglandin \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ { \rm e}_{2}$\end{document } metabolism in intact lungs of rats exposed to \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ { > } { 97\%}~{\rm o}_{2}$\end{document } for 36 hrs. in the present study and previous studies by us and others,, the relative change in the nadh and fad signals are reported instead of the actual signals which are sensitive to various factors including probe distance from the organ surface, day - to - day variations in light intensity, and pmt gain settings. one approach to overcoming this limitation would be by imaging a phantom of known nadh and fad concentrations at the end of a given experiment (lung), and then using this information to scale the measured nadh and fad signals. the lung surface optical imaging data do not provide information about the specific types of lung cells contributing to the measured nadh and fad signals, although endothelial cells would be expected to contribute significantly because of their relatively large surface area and fraction of total lung cells. though determining the contributions of specific lung cell types to the measured signal is potentially important, the global oxidoreductive state of the lung tissue is a highly valuable piece of information irrespective of the individual cell types contributing to the redox ratio. another limitation of lung surface optical imaging is that it may not detect deeper than 500 \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \mu{\rm m}$\end{document }, with a diameter of 3.2 mm, for a volume of \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ { \sim}{\rm 4}~{\rm mm}^{3}$\end{document}. however, this resolution is more than sufficient for determining the rr of parenchymal tissue which has a thickness (air to plasma) of 1.6 \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ \mu{\rm m}$\end{document }. that said, central lung lesions without pleural extension would not be expected to be detected by surface fluorescence measurements such as those used in the present study. over 900,000 adults receive invasive mechanical ventilation (mv) in the united states each year,. many either have acute lung injury (ali) or have conditions such as shock and severe sepsis that place them at particular risk of ali. treatment with high fractions of oxygen to maintain adequate tissue oxygenation may further exacerbate lung injury. however susceptibilities to lung injury (from hyperoxia or shock) are widely variable from person to person, and there are only crude means of screening for or following these injuries clinically. the results of this paper suggest that hyperoxia - induced mitochondrial dysfunction occurs prior to the inflammatory phase of lung \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ { \rm o}_{2}$\end{document } toxicity. if so, a change in lung surface mitochondrial redox state measured using optical fluorescence techniques could be used as an index of lung \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ { \rm o}_{2}$\end{document } toxicity in patients with ali requiring high oxygen therapy or to monitor the progression of ali and its most severe form acute respiratory distress syndrome (ards), one of the most frequent causes of admission to the intensive care unit. the fiber optic probe could be placed on the lung pleural surface through a small thoracotomy incision or a thoracostomy tube in patients with these devices in place. alternatively, the probe might be introduced through an endotracheal tube, and positioned against airway epithelium. the same probe could be used to evaluate the efficacy of novel or existing interventions on lung tissue mitochondrial redox state and energy homeostasis in real time. an individual with enhanced susceptibility to ards would be a strong candidate for strategies such as scrupulous attention to ventilation with low tidal volumes, deliberate tolerance of lower arterial oxygen or higher carbon dioxide tensions to limit oxygen toxicity or barotrauma, avoidance of transfusions, etc. these interventions decrease injury but incur additional risks (increased sedation, impairment of vital organ function) that limit their universal and strict application in ali patients. the diagnostic and therapeutic monitoring applications of this tool are important not only for ali / ards, but also for other lung conditions including lung cancer which is characterized by mitochondrial impairment (so called warburg effect), lung transplant related ischemia - reperfusion injury, or other animal models of human ali. additional applications include diagnostic and therapeutic monitoring of conditions in other organs with high energy flux such as heart ischemia - reperfusion injury and heart failure management, or intraoperative identification of ischemic intestine and others. | recently, we demonstrated the utility of optical fluorometry to detect a change in the redox status of mitochondrial autofluorescent coenzymes nicotinamide adenine dinucleotide (nadh) and oxidized form of flavin adenine dinucleotide \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ ({ \rm fadh}_{2})$\end{document } (fad), as a measure of mitochondrial function in isolated perfused rat lungs (ipl). the objective of this paper was to utilize optical fluorometry to evaluate the effect of rat exposure to hyperoxia (\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } $ { > } { 95\%}~{\rm o}_{2}$\end{document } for 48 h) on lung tissue mitochondrial redox status of nadh and fad in a nondestructive manner in ipl. surface nadh and fad signals were measured before and after lung perfusion with perfusate containing rotenone (rot, complex i inhibitor), potassium cyanide (kcn, complex iv inhibitor), and/or pentachlorophenol (pcp, uncoupler). rot- or kcn - induced increase in nadh signal is considered a measure of complex i activity, and kcn - induced decrease in fad signal is considered a measure of complex ii activity. the results show that hyperoxia decreased complex i and ii activities by 63% and 55%, respectively, when compared to lungs of rats exposed to room air (normoxic rats). mitochondrial complex i and ii activities in lung homogenates were also lower (77% and 63%, respectively) for hyperoxic than for normoxic lungs. these results suggest that the mitochondrial matrix is more reduced in hyperoxic lungs than in normoxic lungs, and demonstrate the ability of optical fluorometry to detect a change in mitochondrial redox state of hyperoxic lungs prior to histological changes characteristic of hyperoxia. |
prostate cancer (pca) is the most commonly diagnosed malignancy and the second leading cause of cancer - related deaths amongst men. just as digital rectal examination, prostate - specific antigen (psa) testing and transrectal biopsy have been stalwarts in the diagnosis of pca, staging has relied on computed tomography (ct), magnetic resonance imaging (mri) and technetium-99 m (99mtc)-methylene diphosphonate bone scans (bs). however, significant recent technological advancements have seen the staging landscape being transformed by positron - emission tomography (pet) based imaging. the principle of pet imaging is to visualise biochemical or physiological phenomena by utilising radiolabelled biomolecules that can be detected by the scanner as the tracer undergoes radioactive delay. f-18 fluoro - deoxyglucose (fdg) is the most common tracer used in clinical practice but has been relatively disappointing when evaluating pca because prostate cancers generally exhibit a low level of glucose metabolism. as a result, a range of biomolecules and tracers were developed to improve pca imaging of which a radiolabeled ligand targeted to prostate - specific membrane antigen (psma) has shown the greatest promise. psma is a 750 amino acid type ii transmembrane glycoprotein that is characterised by the monoclonal antibody 7e11.c5. it is highly prostate specific and is only expressed in limited healthy tissue in other parts of the body, primarily the salivary glands and proximal renal tubules. importantly, its uptake in noncancerous tissue, including benign prostatic tissue, is limited by a variety of physiological barriers, which makes it an ideal marker of pca. while psma is expressed within the apical epithelium of the secretory ducts in benign prostatic tissue, studies have demonstrated that it up - regulates and migrates to the plasma membrane in malignant cells especially during the transition to hormone refractory disease. increased psma expression has been associated with higher tumour grade and increased risk of tumour progression. nonetheless, psma is expressed in neoplastic prostate tissue regardless of androgen status. identification of systemic disease at primary staging has the single greatest impact on prognosis and is of considerable importance in treatment planning. while there has been substantial enthusiasm surrounding the use of psma - pet in evaluating patient with recurrence following primary treatment, recent studies have suggested that this new technology may also have a role in primary staging. the current standard of care involves imaging lymphatic and visceral spread with either ct or mri and bone metastases with nuclear bs. the utility of these conventional techniques are limited as reported in a large meta - analysis which found a pooled sensitivity and specificity of 42% and 82% respectively for ct in detecting nodal metastases. mri performed even more poorly with identical specificity as ct but was only 39% sensitive. furthermore, the assessment of nodal involvement on conventional imaging is primarily based on size of lymph nodes rather than any functional or physiological information. thus, enter pet - based imaging, which has been shown to enhance detection of both nodal and osseous metastases in comparison to the aforementioned technologies. in terms of nodal detection, van leeuwen. compared primary staging psma - pet results to histopathology of thirty men with predominantly high - risk disease and reported a sensitivity and specificity of 64% and 95% respectively for psma - pet in the detection of lymph node metastases. these figures were further supported by a german study utilising psma - pet in the same setting. the positive and negative predictive value of psma pet / ct was 88% and 82% respectively. these rates are superior to those reported for imaging using 11c - choline or f - choline. in addition, the average size of lymph nodes that were missed on psma pet were 2.7 mm which is considerably smaller than the lower limit of the size of pathological nodes that are able to be detected on ct or mri. this further compares favorably to 11c - choline pet / ct in which the mean size of false - negative lymph nodes was 4.2 mm. although the superiority over conventional imaging is evident, studies have suggested caution with the interpretation of psma - pet in this setting due to its limited sensitivity which has been variable between cohorts and thus reiterates the need for further research. perera. reviewed the literature on psma in primary staging and identified seven studies (totaling 210 men) assessing use of psma in this setting, three of which reported lymph node detection rates with subsequent radical prostatectomy. presented the largest set of men (n=130) with psma detected lymph nodes who subsequently underwent pelvic lymphadenectomy. they reported a sensitivity of 65.9% and specificity of 98.9% for lymph nodes detected by psma - pet which is far superior to conventional imaging approaches. the specificity is particularly impressive and also reflects the quality of lymph node dissection in this unit : nodes identified by avidity on psma were almost always harvested by lymph node dissection. with osseous metastases, similar to the advancements seen in the detection of nodal disease, functional pet scanning has had a comparable impact on staging. technetium bone scanning has long been unchallenged in this landscape with reported sensitivities ranging from 62%89%. however, uptake of technetium occurs in a number of nonmalignant bone processes including inflammation, degenerative joint disease and benign fractures leading to a low specificity. by contrast, ga - psma pet scanning has shown promising sensitivity and specificity in detection of small volume skeletal disease in primary staging. compared the diagnostic performance of bone scintigraphy and ga - psma pet ct for skeletal staging in 126 men with pca and reported that for those undergoing primary staging the sensitivity and specificity were 98.7% and 88.2% for psma - pet compared to 86.7% and 60.8% for bone scanning. they also noted that bone scanning rarely offers additional information to psma - pet, which can be used for detection of all metastatic sites as opposed to bone scanning alone. studies have also assessed the role of psma - pet in detection of visceral metastatic deposits, for example pulmonary or cerebral, but the evidence is still weak in this area mainly because of the lack of a histopathological correlation. currently, the primary application of psma - pet imaging appears to be in the biochemical recurrence (bcr) setting, that is, patients who have failed local therapy and are experiencing rise in their serum psa levels but do not have metastatic disease on conventional imaging. the ability to accurately characterise the disease in the bcr setting as either local recurrence or metastatic spread is vital to choosing the optimal salvage therapy. in addition, having the capacity to make the aforementioned differentiation as early as possible is important in improving outcomes. this is exemplified in the case of salvage radiotherapy (srt), which is optimally given at psa levels 2.00 ng / ml. while eiber. did not find psadt to be a predictor of disease detection, they rather suggested that psa velocity was a significant factor for psma positivity with rates of 81.8%, 82.4%, 92.1%, and 100% in 2 ng / ml higher than the psa nadir value, regardless of the serum concentration of the nadir and the short - term hormonal manipulation. currently, little or no evidence exists regarding the role of ga - psma pet / ct in patients with bcr after having received radiotherapy (external beam or brachytherapy) as a primary treatment with curative intent. however, it is clear that ga - psma pet / ct facilitates early detection and localisation of pca recurrence either local or distant and that it has displayed superior sensitivity when compared to other staging modalities such as choline pet / ct. in a german retrospective analysis in which 292 of the 319 included patients underwent a ga - psma pet / ct post primary treatment, a prostatic lesion was seen in 22.5% of the cohort. however, this subset of patients included those undergoing primary staging as well as patients who had received primary radiation therapy or androgen deprivation therapy (adt). histological testing with biopsy or surgery was only available in 42 of these patients and although lesion - based analysis allowed the authors to define ga - psma pet / ct sensitivity (76%), specificity (100%), negative predictive value (91%), and positive predictive value (100%), they could not draw any separate conclusions for the group of patients that had previously received radiation therapy. similarly, bluemel. reported on 142 patients who had undergone primary treatment for pca, of which 28 patients were treated initially with radiation therapy, and 56 with prostatectomy followed by srt. although the authors found that the highest rate of ga - psma positivity was seen when psa was > 2 ng / ml, the heterogeneous cohort and small sample size did not allow any conclusions to be drawn regarding the primary radiotherapy group. this was also the case in small sample studies by verburg. and morigi. where only a small proportion of included patients had been primarily treated with radiotherapy furthermore, histopathological diagnosis was only available in a very limited amount of patients in these studies, if it was indeed available at all. in the german study, ga - psma pet / ct was more often positive in patients who were being treated with adt, regardless of radiotherapy. firstly, they argued patients undergoing ga - psma pet / ct were more often patients with more advanced disease, and thus were more likely to be treated with adt. secondly, they stated it is probable that ga - psma expression in tumours is differentially regulated by androgens. conversely, eiber. reported no significant difference in detection efficacy with ga - psma pet / ct, with regard to adt. it is not clear if the tumours visualised on ga - psma pet / ct after radiotherapy, such as that seen in fig. 1, are true relapses or if they reflect residual vitality in tumours after the patients have undergone radiation. analysis of standardised uptake values has shown that ga - psma uptake is high in primary tumours as well as in relapses or distant metastases. higher contrast is however usually seen in lymph node metastases, followed by bone metastases, whereas local relapses and soft tissue metastases seem to present with lower ga - psma uptake. in summary, larger correlation studies with histological diagnosis will be necessary in order to clearly define the role of ga - psma pet / ct in the subgroup of patients with primary radiation therapy failure. it should be noted that the current literature is limited by the significant heterogeneity of patients between studies, a small sample size, and often lack a histological confirmation of diagnosis. the presence of psma expression in over 95% of all metastatic pca cells allows for novel targeted radio - ligand theranostics. currently, this uses the binding property of psma to lutetium-177 (lu) as a radio - ligand therapy in metastatic castrate resistant prostate cancer (mcrpc). there are four key papers, which analyze the safety and efficacy of lu - psma radio - ligand therapeutics. these studies utilize psma-617 or lu - dotaga (1,4,7,10-tetraaz acyclododececane, 1-(glutaric acid)-4,7,10-triacetic acid) as the principle - binding molecule. these ligands are selected for their lipophilicity, binding specificity, metabolic stability, as well as bio - distribution, and are superior to the psma antibody, which has cross selectivity for salivary gland and renal tissue potentially exposing these organs to unnecessary radiation effect. kratochwil. from the university of heidelberg reported on 30 patients with mcrpc treated with lu - psma for one to three cycles. he noted 21 patients (70%) demonstrated a psa response, of which this response was greater than 50% in 13 patients (40%). in addition, 73% of patients who completed three cycles of therapy sustained a psa response of greater than 50% for over 24 months with measurable radiological decrease in metastasis size and volume. 45 patients (80%) demonstrated a decrease in psa levels and critically, follow - up was with ga - psma pet which revealed partial remission in 5 patients, stable disease in 2 and progressive disease in 7 patients. the median progression free survival was 13.7 months and severity of pain reduced in 2 of 6 patients (33%).. reported on 2 studies, both conducted at the university hospital munster, germany. the first reported on outcomes of 74 patients treated with a single dose of lu - psma-617. psa response was observed in 47 patients (64%) in whom a psa decrease over 50% was seen in 23 patients (31%). of note, with only one cycle of treatment, psa remained stable in 35 patients (47%) and rose (greater than 25%) in 17 patients (23%). in a second study, rahbar. compared outcomes in those who received one cycle of treatment versus two in 28 patients. he noted that median survival was 29 weeks compared to 20 weeks based on historical published data. the clinical effectiveness of two treatments outweighed one, with psa response demonstrated in 59% of patients after one treatment versus 75% after two treatments. these studies report lu - psma radioligand therapy as safe and effective in end stage progressive mcrpc in appropriately selected patients. side effects including haematotoxicity, xerostomia, nausea, and fatigue were transient, short lived and uncommon. whilst promising, these studies are small and have limited follow - up, all use psa decline as their primary endpoint and only one utilized radiological criteria to define response. further work is required to determine the optimal ligand, dose, timing and number of treatments. the role of lu - psma radioligand therapy beyond the mcrpc remains to be evaluated. as discussed above, accuracy in prediction of positive and negative results is important for a clinically useful staging tool. systematically reviewed studies providing data correlating ga - psma findings with histopathological - proven disease on a per - patient and perlesion basis. they identified five studies with a summary sensitivity of 80% and specificity of 97% for perlesion analysis and 86% for both sensitivity and specificity for per - patient analysis of 220 patients. they commented that the numbers were low and the confidence intervals wide but that the pooled data appeared to be promising compared to alternative imaging modalities for recurrent and metastatic pca. in general, despite the heterogeneity between groups of studies assessing the accuracy of psma scanning in detection of pca, on meta - analysis of studies divided into broad subtypes, 40% of scans were positive for patients undergoing primary staging for high risk disease and 76% were positive for those undergoing secondary staging for recurrent disease. the authors tested for predictors of positivity and found that psa of around 0.2 to 0.3 ng / ml and psadt of < 6 months were helpful thresholds for predicting a positive scan. overall, the initial published literature on ga - psma pet / ct suggests that it represents a substantial improvement over conventional imaging for the staging of pca. despite this early promise, further research is required to validate its utility especially in the primary staging setting, whereas its role in the recurrent disease is becoming established. the ability to more accurately stage patients and detect recurrent disease at an earlier clinical time point has been shown to have a considerable impact on the optimal management of patients. | the ability to accurately stage prostate cancer in both the primary and secondary staging setting can have a major impact on management. until recently radiological staging has relied on computer tomography, magnetic resonance imaging, and nuclear bone scans to evaluate the extent of disease. however, the utility of these imaging technologies has been limited by their sensitivity and specificity especially in detecting early recurrence. functional imaging using positron - emission tomography with a radiolabeled ligand targeted to prostate - specific membrane antigen has transformed the prostate cancer imaging landscape. initial results suggest that it is a substantial improvement over conventional imaging in the setting of recurrence following primary therapy by having a superior ability to detect disease and to do so at an earlier stage. additionally, it appears that the benefits seen in the secondary staging setting may also exist in the primary staging setting. |
the earliest host - cell response to viral infection is activation of the type - i interferon (ifn/) system (see fig. 1), which ultimately leads to the establishment of antiviral responses in infected / neighboring cells and contributes to the shaping of an effective adaptive response [55, 70 ]. initiation of the ifn response follows recognition of pathogen associated molecular patterns (pamps) by germline - encoded pattern - recognition proteins (prps) (e.g. toll - like receptors [tlrs ] and retinoic acid - inducible gene i [rigi]-like receptors [rlrs ]) [55, 70 ]. rna virus pamps include double stranded rna (dsrna) and uncapped rna with a 5 triphosphate, which are presented by genomic rna or products of transcription / replication ; these variously stimulate the cytoplasmic rlrs rig - i and melanoma differentiation - associated protein 5 (mda5) (which principally recognize pamps generated within infected cells) and certain of the transmembrane tlrs (which detect extracellularly - derived pamps) [6, 22, 55, 70 ]. rlr signaling proceeds through the adapter protein mitochondrial antiviral - signaling protein (mavs), ultimately activating the kinases, tank - binding kinase 1 (tbk1) and i - kappa b kinase (ikk) (fig. 1) ; an initially distinct signaling pathway from the double stranded rna receptor tlr3 also converges at tbk1/ikk. subsequent phosphorylation / dimerisation of ifn regulatory factor 3 (irf3) in most cell types (and irf7 in certain immune cells or ifn - primed cells) precedes nuclear localization leading to ifn/ expression. nuclear factor - kappa b (nfkb) is also activated to form part of the ifn enhanceosome (transcription factor complex), as well as activating the expression of other pro - inflamatory cytokines. secreted ifn/ subsequently binds to the type - i ifn receptor (ifnar) to activate the transcription factors signal transducers and activators of transcription 1 and 2 (stat1 and 2) (fig. stat1/2 heterodimerization via reciprocal phosphotyrosine - sh2 interactions precedes nuclear translocation and formation with irf9 of the ifn - stimulated gene factor 3 (isgf3), which upregulates several hundred ifn - stimulated gene (isg) products, including antiviral (e.g. protein kinase r [pkr ], tetherin, myxoma virus resistance [mx ], promyelocytic leukemia [pml ]) and immunostimulatory (e.g. major histocompatibility complex [mhc ]) proteins, to coordinate a potent antiviral response [55, 63 ]. experiments using genetically modified virus and/or infection of dendritic cells to minimize viral mechanisms that inhibit immune signaling (see below and fig. 1), have indicated that rabv can induce ifn through pathways dependent on rig - i, mda5 and mavs, but independent of tlr signaling, consistent with increased pathogenicity in mavs - deficient mice [16, 22 ]. since pathogenicity is also enhanced in ifnar mice, this indicates that rabv can induce type i - ifns which are at least partially effective in slowing the onset and/or reducing the severity of symptoms in vivo. nevertheless, rabv remains a potent killer, indicative of efficient mechanisms to counteract the ifn response. in common with many other viruses, rabv expresses proteins that can directly inhibit ifn signaling pathways. collectively termed viral ifn antagonists, which encompass a remarkable array of proteins (with hundreds of examples in the literature), variously reported to stages of the ifn response through diverse mechanisms [44, 55, 70 ]. these mechanisms can be broadly categorized as : (i) general inhibition of host gene expression, (ii) sequestration / masking of pamps and (iii) sequestration / modification of ifn signaling components or isg products. more generally, mechanisms may be considered as virus - targeted (where antagonists affect other viral components to minimize pamp production or exposure to prps) or host - targeted (where antagonists, often autonomously, form inhibitory interactions with cellular factors). many ifn antagonists are multifunctional with roles in the basic viral life cycle as well as accessory roles in ifn antagonism, which often encompass multiple mechanisms targeting different stages of the response [55, 70 ]. this is particularly important to rna viruses where limited genome size excludes the expression of dedicated antagonists, resulting in the evolution of accessory ifn - antagonist functions within conserved structural proteins and/or alternative products encoded by conserved genes (e.g. [1, 11, 55, 66, 70, 72 ]). this has made analysis of the significance of ifn antagonism in infection / pathogenicity challenging due to potential off - target effects in mutagenic studies ; however, several recent studies of rabv and other viruses indicate critical roles in disease (see below). rabv p, m and n proteins have ifn antagonist functions that encompass many archetypal features of this class of protein. p protein is the best defined, with in vitro infection and protein expression studies, indicative of several mechanisms, mediated through a large interactome incorporating host innate immune factors, nuclear trafficking receptors and elements of the cytoskeleton (reviewed in [11, 31, 49, 60 ] ;, summarized below and in figs. 1 and 2). notably, p protein forms many other interactions with host proteins not obviously associated with immunity, indicative of roles for p as a major hub at the virus - host interface (e.g. [17, 32, 51, 56 ]). this is perhaps consistent with a high degree of evolutionary flexibility in this non - enzymatic component of the replication machinery, which is encoded by a p gene in all mononegaviruses and is essential to replication, but shows little to no sequence conservation across the mnv order or even between genera of the same family. the first indications of a role for p protein in immune evasion came from the conzelmann laboratory, through analysis of rabv in which p protein expression was downregulated by translocation of the p gene within the genome. although the precise molecular interactions involved in tbk1 inhibition remain unresolved [8, 58 ], it was recently shown that, p proteins of certain wild - type street strains, but not those of representative fixed laboratory strains, have an additional function to inhibit ikk, involving physical interaction with this adapter molecule. subsequently, the conzelmann and blondel groups identified an interaction of p protein with stat1 and stat2 that inhibits their nuclear translocation and transactivation in response to type - i and type - ii ifns ([9, 71 ], fig. this interaction is conserved among lyssaviruses and notably is strongly dependent on ifn - activation (phospholylation of stats), possibly reflecting a mechanism to ensure that p protein is diverted from replication / transcription function only when required [9, 75 ]. recently, p protein was also shown to target stat3, enabling inhibition of il6-dependent signaling, indicative of immune antagonistic roles beyond ifns. other than the full length p protein (p or p1), which interacts with l protein in the rdrp complex, rabv p gene expresses four n - terminal truncated isoforms (p2-p5) from four extra in - frame start codons via a ribosomal leaky scanning mechanism. p2-p5 lack the n - terminal l - binding region, suggestive of alternative functions (reviewed in), including specialized roles in ifn antagonism. indeed, analysis of rabv in which isoform expression is modulated using an internal ribosomal entry site (ires) has suggested that, while p1 is required for efficient replication, p2 has more important roles in suppressing ifn signaling. protein expression studies have also identified a number of apparently isoform - specific mechanisms of ifn antagonism, suggestive of a multifaceted strategy (fig. the mechanisms involved in inhibition of ifn signaling by rabv p proteins are shown. all of the mechanisms require a physical interaction of p proteins (p1, p2 and p3) with stats. mechanisms directly implicated in pathogenicity are indicated by an asterisk.) ; this might be required to effect an efficient generalized shutdown of the potent antiviral ifn system or to enable targeting of specific elements / pathways of the ifn response that may be more important during different stages of infection and/or in different cell types. p1/p2 exploit the cellular trafficking machinery to undergo active nuclear export via an n - terminal nuclear export sequence (nes), thereby effecting strong nuclear exclusion of p1/p2-associated stats ([9, 23, 33, 52, 71, 75, 76 ], fig. n - terminal truncation inactivates the nes, activates a nuclear localization sequence (nls) and induces association with microtubules [7, 47, 50 ] ; together with several additional trafficking sequences [45, 46, 49,50,51,52 ], this results in p3 distribution to the cytoskeleton and nucleus, enabling cytoskeletal arrest of p3-associated stat1 and a potential intra - nuclear blockade of stat1-dna interaction ([47, 72 ], fig. 2). p protein may also target functions of isg products, since p1 and p3 interact with the pml protein. although the significance of this interaction is unclear, expression of certain pml isoforms can inhibit infection, suggestive of antiviral functions toward rabv [4, 5 ]. specific mechanisms of antagonism of ifn signaling by rabv p proteins. the mechanisms involved in inhibition of ifn signaling by rabv p proteins are shown. all of the mechanisms require a physical interaction of p proteins (p1, p2 and p3) with stats. m protein immune antagonistic activity involves interaction with a novel isoform of nfkb rela protein, relap43, which was initially identified in a screen for m protein interactors and shown to be a positive regulator of nfkb signaling (, fig. m protein interaction inhibited expression of type i ifn, proinflammatory cytokines and antiviral genes irf1 and hiap, consistent with important roles for m - relap43 in immune evasion. recent data indicate that rabv n protein acts as an ifn antagonist by suppressing ifn induction, although this uses a mechanism distinct from that of p protein, acting upstream of tbk1/irf3 at the level of rig - i (, fig. 1). notably, this effect was only observed in the context of rabv infection, where the pathogenic rabv strain nishigahara induced lower irf3 activation and expression of type - i ifn / chemokines than the attenuated nishigahara - derivative strain ni - ce. mutagenic analysis demonstrated that this is due to substitutions in the ni - ce n gene affecting two n protein residues. since single expression of n protein from a plasmid did not inhibit responses to the dsrna analogue polyi : c or infection by a heterologous virus, this appears to involve a virus - targeted mechanism, potentially due to n protein function in encapsidating the rabv genome / replication products and/or forming cage - like structures around cytoplasmic virus factories (negri bodies) [30, 42 ], thereby inhibiting pamp - prp recognition. comparative analyses of wild - type street strains and fixed laboratory / attenuated vaccine strains have included the demonstration that the cvs - b2c laboratory strain induces greater inflammatory responses in mice (including elevated type - i ifn - related gene and pro - inflamatory cytokine expression) than the street strain of bat origin (shbrv), indicative of greater immuno - evasive function in the latter. similarly, relap3 targeting has been reported to be observed for m protein from wild - type lyssaviruses but not from laboratory / vaccine strains, with analogous results reported for ikk targeting by p protein. while these data indicate a correlation between ifn antagonist function and pathogenesis, some other findings argue against such a simple relationship, including the report that the cvs - b2c laboratory strain harbors greater capacity to antagonize ifn signaling than a wild - type dog rabv strain drv, which reverse genetic analysis indicated to be due to differences in the ifn - antagonist - encoding p gene of the respective strains. this is perhaps to be expected, since the attenuated phenotypes of different strains, particularly fixed strains adapted to laboratory animal models and/or cell culture, are likely to have multigenic origin (e.g.) ; indeed, previous data suggested that g protein is responsible for the attenuated phenotype of cvs - b2c strain via a mechanism distinct from p protein - mediated immune evasion. similarly, the behavior of street strains derived from host species, such as bats and dogs, may differ significantly when transferred to laboratory animal models. in this respect, it is possible that the p protein - dependent difference observed between drv and cvs - b2c in murine neuronal cells relates to some extent to the adaptation of the latter to rodents since the parental cvs strain was serially passaged in mouse brains. thus, more direct evidence for key roles of ifn - antagonism in disease has come from reverse genetics studies, which have enabled direct comparison of the pathogenicity of viruses that are homogeneous except for altered expression of, or sequences within, specific ifn - antagonists. suppression of p protein expression in the sad rabv strain using transcription and translation - based approaches has been shown to cause attenuation in vivo, correlating with reduced capacity to inhibit ifn induction and ifn signaling ([8, 9, 36, 58 ] and see above). the fact that the p - deficient viruses showed more virulent phenotype in ifnar - deficient mice is consistent with an important role of ifn antagonism in the viral pathogenesis ; however, approaches using altered expression of the entire p protein are complicated by potential off - target effects due to p protein s function in genome transcription / replication. furthermore, such approaches can not assess the contribution of particular mechanisms of ifn antagonism. directed mutagenesis of rabv has enabled such analyses, where deletions within a 10-residue central region of p protein and substitutions in the hydrophobic w - hole of the p protein c - terminal domain have been shown to specifically impair antagonism of ifn induction and stat1/2 signaling, respectively [58, 76 ]. importantly, defects in replication / transcription function or growth in ifn - incompetent cells were not apparent for viruses carrying either the deletions or the substitutions, but neurovirulence in mice was reduced in both cases, indicating significant roles for antagonism of both ifn induction and signaling in disease. reverse genetics studies using the nishigahara / ni - ce viruses (see above) have also revealed roles in virulence for p protein nuclear trafficking and consequent inhibition of stat1 trafficking / signaling [23, 37,38,39 ]. nishigahara is lethal in mice following intracerebral (ic) or intramuscular (i m) inoculation, indicative of neurovirulence and neuroinvasiveness, respectively, while the derivative ni - ce strain is non - lethal by either route [67, 78 ]. although attenuation of ni - ce is multigenic, a significant restoration of pathogenicity in the recombinant ce(nip) strain, in which the nishigahara p gene is expressed in the ni - ce genetic background, identified p protein as a pathogenic determinant by both inoculation routes [23, 67, 78 ]. this correlated with altered viral sensitivity to ifn in neuronal and muscle cell lines, suggesting that circumvention of ifn responses by p protein is important not only to propagation in neurons, but also in muscle cells en route to peripheral nerves [23, 78 ]. analysis of p protein function in neuronal cells indicated that ni - ce p protein is not defective for suppression of ifn induction or binding to stat1, but can not prevent stat1 nuclear accumulation / signaling due to mutations in the p protein nes that impair nuclear export of p - stat1 complexes. notably, in muscle cells, ni - ce p protein displayed an additional defect in antagonizing ifn induction, suggestive of differences in ifn responses of these cell types. this is consistent with the idea that the diverse ifn - antagonistic mechanisms identified for p protein might have developed to enable immune evasion in different cell - types. the reverse genetics approach using nishigahara / ni - ce chimeric viruses has also highlighted the importance of n protein - dependent inhibition of rig - i signaling in the pathogenicity : the expression of the nishigahara n gene in the ni - ce background [generating the ce(nin) strain ] resulted in increased suppression of viral ifn induction and pathogenicity in mice, with decreased ifn responses and increased viral spread observed in the brain [38, 39 ]. rabv not only impacts on innate immune signaling within infected cells, but also has developed mechanisms to suppress broader adaptive inflammatory responses. in the cns, despite high levels of viral replication in naturally infected humans and animals, a lack of significant infiltration by inflammatory immune cells is a hallmark of pathogenic infection. several lines of evidence indicate key roles in pathogenesis [2, 74 ].. demonstrated that infection of mouse brain with the pathogenic rabv strain shbrv, only modestly induces expression of chemokines, such as mcp-1 (ccl2), ip-10 (cxcl10) and rantes (ccl5), that are critical for leukocyte recruitment to sites of inflammation, while the less pathogenic laboratory strain cvs - b2c induced expression more strongly. cytokines including proinflammatory il-6, and cytokine receptors, were also up - regulated in cvs - b2c - infected brain. these data indicated a correlation between the ability of rabv to suppress inflammatory responses in the cns and pathogenicity, suggesting that rabv s mechanisms to maintain low levels of chemokines and cytokines and/or their cognate receptors in the infected cns (including the mechanisms described above), suppress inflammation and virus clearance, resulting in a lethal outcome. similar approaches have provided insights into the mechanisms by which rabv regulates inflammatory cell infiltration of the cns, highlighting a role for the blood - brain barrier (bbb). in particular, infection with the attenuated cvs - f3 strain increased bbb permeability, which was accompanied by high - levels of expression of several chemokines including ccl2, ccl5 and cxcl10 in the cerebellum as well as infiltration of cd4 t cells and cd19 b cells into this region. in contrast, infection with pathogenic shbrv maintained bbb integrity and prevented infiltration of immune effectors. these data strongly indicated that enhancement of bbb permeability is important for recruitment of immune effectors into the cns and subsequent clearance of attenuated rabv, while pathogenic strains harbor mechanisms to maintain the bbb. the key role of bbb integrity in the outcome of viral infection was also supported by the finding that in plsjl mice, which show moderate resistance to shbrv infection, reduction of bbb permeability through treatment with a steroid hormone increased the mortality rate of infected mice, while enhancement of bbb permeability by immunization with myelin basic protein resulted in decreased mortality. it was also reported that, in mouse brain infected with cvs - f3 strain, virus - specific antibody produced in situ after recruitment of b cells into the brain plays a critical role in virus clearance, highlighting the role of the humoral response in the cns. several studies have begun to delineate the mechanisms by which attenuated rabv infection results in loss of bbb integrity. phares. reported that in cvs - f3-infected mouse, cd4 t cells, but not cd8 t cells or b cells, play an important role in enhancement of bbb permeability. the study suggested that ifn- released by cd4 t cells that accumulate in the neurovasculature stimulates neurovascular endothelial cells to produce peroxynitrite (onoo), which directly triggers enhancement of bbb permeability. a recent study demonstrated that in mouse brain infected with attenuated cvs - b2c strain, cxcl10 produced by infected neurons promotes infiltration of cxcr3 cd4 t cells, which can differentiate into ifn--producing th1 cells as well as th17 cells expressing il-17, an important contributor to disruption of the bbb. the identification of mechanisms by which attenuated rabv infection results in recruitment of immune effectors via enhanced bbb permeability has provided insights into the strategies used by pathogenic rabv to inhibit inflammatory responses in the cns. specifically, it is thought that pathogenic rabv minimizes expression of cxcl10 in neurons, thereby preventing infiltration of cxcr3 cd4 t cells (fig. 3afig. (a) infection of neurons by pathogenic but not attenuated rabv suppresses induction of cxcl10 expression, reducing cxcl10-dependent infiltration of cxcr3 cd4 + t cells, thereby preventing transition to il17-producing th17 cells that promote bbb permeability and immune cell infiltration. (b) rabv infection induces expression of b7-h1 and other immunosuppressive molecules on infected neurons (and potentially non - infected glia), which induce the apoptosis of infiltrating t cells.) ; this hypothesis is based on the observations that infection of mice by pathogenic shbrv only modestly induces expression of cxcl10 in the mouse brains and that infection of cultured neuroblastoma with nishigahara induces significantly lower levels of cxcl10 than infection with the attenuated ni - ce. thus, reduction of cxcl10 expression in infected neurons may be a general strategy used by pathogenic rabv strains to suppress inflammatory responses in the cns. (a) infection of neurons by pathogenic but not attenuated rabv suppresses induction of cxcl10 expression, reducing cxcl10-dependent infiltration of cxcr3 cd4 + t cells, thereby preventing transition to il17-producing th17 cells that promote bbb permeability and immune cell infiltration. (b) rabv infection induces expression of b7-h1 and other immunosuppressive molecules on infected neurons (and potentially non - infected glia), which induce the apoptosis of infiltrating t cells. interestingly, studies by other groups have suggested that rabv may have evolved additional, distinct strategies to suppress inflammatory t - cell responses in the cns. in contrast to the model above, it was reported that infection both by pathogenic cvs strain and by attenuated pv strain led to infiltration of cd3 t cells into the cns of infected mice after i m inoculation. however, by seven days post - inocultion, apoptosis of infiltrating t cells and the resultant disappearance of t cells from the cns were observed in mice infected with cvs, but not with pv. these findings are particularly intriguing as rabv generally does not infect lymphocytes, raising the question of how pathogenic rabv induces t - cell apoptosis. the most likely scenario appears to relate to the finding that pathogenic rabv infection induces the expression of immunosuppressive molecules, such as b7-h1, hla - g and fasl, on neurons, which can trigger apoptosis of activated t cells, both in mouse cns and in cultured neurons [3, 27, 28, 41 ]. this indicates that pathogenic rabv can hijack host immunosuppressive mechanisms to destroy infiltrating t cells (fig. this hypothesis is directly supported by the finding that a pathogenic cvs strain caused significantly milder symptoms in b7-h1 knockout mice than in wild - type mice. notably, it was also found that the percentages of cd3 t cells and cd8 t cells in the total t cell infiltrate in the cns of b7-h1 knockout mice were higher than those in the cns of the wild - type mice and that the proportion of apoptotic cd8 t cells was reduced in the cns of the b7-h1 knockout mice. these findings indicate that the b7-h1-mediated apoptosis of t cells infiltrating the cns fulfills a key role not only in suppression of the inflammatory response, but also in the pathogenesis of rabv. while the findings above are suggestive of a sophisticated strategy for immune evasion by rabv, there is a discrepancy that needs to be resolved : expression of the immunosuppressive b7-h1 and hla - g, both known isg products, is induced by ifn [14, 27, 28 ], but ifn production and signaling is suppressed in neurons infected by pathogenic rabv via the function of n, m and p proteins (see above). however, even pathogenic rabv infection induces modest but detectable level of ifn in the brain and in cultured neurons [37, 74 ]. ifn might be sufficient to induce b7-h1 and hla - g expression and to cause destruction of infiltrating t cells. although it has been speculated that non - infected glia cells play a role in the destruction of t cells in the cns, this remains to be proven experimentally. current knowledge indicates that rabv effects a potent and multipronged strategy to disable host immunity at many levels, with a growing body of evidence from experiments using genetically modified viruses / hosts indicating critical roles in disease. in ifn - mediated innate immunity, the capacity of p protein to interact with and effect mislocalization of stats, and that of p and n proteins to inhibit rlr - driven ifn induction, have been demonstrated to impact on pathogenicity in animals. in adaptive immunity / inflammation of the cns, rabv has a clear capacity to suppress host responses, with two mechanisms suggested in in vivo models, specifically blockage of immune effector infiltration via maintenance of bbb integrity, and induction of t - cell apoptosis (fig. firstly, the roles in pathogenicity of a number of ifn - antagonist mechanisms of p protein identified in vitro, such as targeting of pml, stat3, and microtubules remain unresolved and await research using reverse genetics approaches / animal infection models similar to those that indicated roles in disease for nes - driven p protein nuclear export. secondly, there are apparently conflicting reports with respect to the roles of ifn signaling / isg expression in infection (where antiviral and proviral roles have been identified), as well as the contribution of altered bbb permeability and t - cell apoptosis in the cns to rabv suppression of t - cell immunity [28, 62 ]. although such observations may relate in part to differences in experimental design / models used, it seems likely that lyssaviruses have evolved diverse mechanisms to effect immune subversion, as indicated by in vitro studies of ifn - antagonism, and that certain mechanisms may predominate in different settings due to factors, such as the viral strains / species examined, cell type infected, stage of infection, infectious dose, etc. for example, a pathogenic strain that only moderately suppresses the expression of ifn and/or cxcl10 in neurons might have evolved mechanisms to induce apoptosis of t cells. thirdly, in spite of clear evidence that suppression of inflammation in the cns is important to disease, the molecular mechanisms by which the virus achieves this remain undefined, although involvement of p, m or n protein in suppressing signaling during cytokine / chemokine production seems likely. future research using genetically modified viruses / hosts should help to delineate these issues, but what is clear at present is that mutations impacting viral evasion of immunity can potently impact disease, indicating that such mutants are potentially useful for the generation of attenuated vaccine strains. in particular, novel mutations affecting immune evasion may be combined with mutations affecting other genes / mechanisms [15, 24, 38, 67,68,69 ] to achieve high levels of safety while retaining largely native structure and replication to generate self - adjuventing vaccines ; such advances should greatly enhance deliverability, including providing the potential means to achieve single - dose oral vaccination, thereby overcoming current limitations of multiple - dose / needle injection regimes, as well as providing potent protection in diverse host species. importantly, such vaccines should not simply be weakened, but should have the potential to induce stronger immune responses that could generate protection more efficiently. this promise is yet to be realized, however, as a recent study using a p protein - mutated rabv strain unable to prevent ifn induction could induce protection in orally - vaccinated foxes, but gave no apparent improvement in protection compared with the wild - type strain. the effectiveness of such mutations in attenuating strains optimized for immunogenicity, or of alternative strategies targeting stat antagonism by p protein, or rig - i - antagonism by n protein, awaits further research. finally, another clear corollary of the above considerations is that the mechanisms underlying immune evasion may provide targets for therapeutics for rabies. several molecular interfaces have been shown to be critical to viral inhibition of immune signaling and virulence (e.g. p protein - stat1, p - protein - exportin interactions). others have been defined as important in vitro but not confirmed in vivo (see above), and some involve interactions as yet undefined at the molecular level (e.g. n protein - mediated inhibition of rig - i). in most cases, however, progress has been made toward elucidating the sites involved by mapping important domains / sequences [5, 38, 76 ]. the ultimate outcome of such research would be molecular and structural definition of the interfaces, providing knowledge that might guide the development of inhibitors capable of preventing viral evasion of innate immunity. until the mechanisms underlying viral modulation of bbb permeability and t - cell apoptosis are resolved, potential pathways to therapeutic targeting of these processes are less clear. however, since viral targeting of innate signaling is probably linked to effects on adaptive immunity, the above mentioned therapeutics may have a dual effect on both arms of the response. it is also possible that targeting the host to enhance adaptive responses, rather than targeting viral counter - measures might be useful ; indeed, mouse studies indicated that strategies to directly alter bbb permeability can improve outcomes of infection, providing proof - of - principal to assess such possibilities towards antiviral therapies. | rabies is a zoonotic disease caused by the lyssavirus rabies virus (rabv) that can infect most mammals, including humans, where it has a case - fatality rate of almost 100%. although preventable by vaccination, rabies causes c. 59,000 human fatalities every year worldwide. thus, there exists an urgent need to establish an effective therapy and/or improve dissemination of vaccines for humans and animals. these outcomes require greater understanding of the mechanisms of rabv pathogenesis to identify new molecular targets for the development of therapeutics and/or live vaccines with high levels of safety. importantly, a number of studies in recent years have indicated that rabv specifically suppresses host immunity through diverse mechanisms and that this is a key process in pathogenicity. here, we review current understanding of immune modulation by rabv, with an emphasis on its significance to pathogenicity and the potential exploitation of this knowledge to develop new vaccines and antivirals. |
rheumatoid arthritis (ra) is the most frequent chronic autoimmune inflammatory rheumatism, with a worldwide prevalence around 1%. ra severity is related to joint destruction characterised by erosion and space narrowing that is responsible for joint functional disability [24 ]. early diagnosis and treatment are crucial in order to prevent joint destruction and preserve joint function defining the window of opportunity concept [5, 6 ]. since few years, the concept outside - inside suggested a beginning of ra disease also in the subchondral bone marrow. in fact, a subchondral bone loss at the metacarpal phalangeal head starts since the early phase of ra disease. furthermore, joint inflammation due to synovitis is one of the most powerful predictors of new bone erosion. so, the synovial membrane was the first actor mainly described by production of some mediators induced by inflammatory cytokines such as tnf or others. these mediators induced cartilage matrix degradation and subchondral bone loss [10, 11 ]. these data support a strong interaction between synovial membrane, cartilage, and subchondral bone. inflammatory joint induced the release of specific protein fragments from its various compartments into the serum and the urine, which may be used as tissue specific biomarkers. by this way, biomarkers of each component of the joint could be useful to manage ra patients. tnf inhibitors and other biologics reduce synovitis, biomarkers of inflammation, and bone destruction. these tnf inhibitors are able to block joint destruction, even if ra disease is still active [1315 ]. in 2014, in front of early ra patient, the goal of early ra therapy is to obtain remission according to the new criteria for remission acr / eular. however, though clinical remission was obtained, in some patients a structural progression can occur probably due to persistence of joint inflammation [18, 19 ]. exploration with specific biomarkers of each component of the joint could be helpful to investigate this paradigm. in daily practice in 2014, only das28 combining clinical parameters with erythrocyte sedimentation rate (esr) or c - reactive protein (crp) is used. so, they are not strongly correlated with joint involvement. despite its large usefulness in daily practice, das28 fails to strongly predict the joint progression or a real remission. at the time of personalized medicine, which aims to individually improve treatment management, biomarkers of the joint will be useful in ra especially at the early stage. the aim of this paper is to review some biomarkers of synovial, cartilage, and bone turnover in ra, clarify their utility in ra management, and analyze data in remission. matrix metalloproteinase-3 (mmp-3 or stromelysin 1) is a proteinase secreted by synovial fibroblasts and chondrocytes. its activity results in degradation of aggrecan core protein, cartilage link protein, fibronectin, and collagen types iv, vii, ix, and xi. mmp-3 is present in ra synovial fluid and overexpressed in rheumatoid synovium [23, 24 ]. one mmp-3 polymorphism was described to be associated with higher joint damage in ra [25, 26 ]. otherwise, serum mmp-3 level was suggested as a predictor for joint destruction in early ra [27, 28 ] or established ra [29, 30 ]. correlation between serum mmp-3 level and joint damage progression appeared to be independent of rheumatoid factor (rf) or acpa status. the next step was to assess mmp-3 variation induced by ra therapy and particularly during biological therapies. anti - tnf therapy decreased mmp-3 expression in ra patients [32, 33 ]. similar results were observed with tocilizumab (il-6 blocker) or abatacept (inhibitor of costimulation). its level was similar in ra patients in remission or not induced by anti - tnf therapy. however, normal mmp-3 level in ra patients treated with tocilizumab was predictive to absence of relapse after tocilizumab cessation. to summarize, high mmp-3 level was associated with disease activity and joint progression in ra patients and should be used in association with usual inflammatory markers to follow therapy efficiency. however, this biomarker was never tested in patients in clinical remission to predict structural remission. another synovial biomarker considered in ra is the glycosylated form of pyridinoline (pyd). pyd is mainly a bone resorption biomarker but is also related to remodeling of cartilage and synovium. the glycosylated analogue of pyd, glucosyl - galactosyl - pyd (glc - gal - pyd), can be assessed in urine and appeared to be specific to synovial tissue. urinary glc - gal - pyd level was higher in patients with early ra than controls and its high level is associated with higher risk for the progression of joint damage. in established ra, urinary glc - gal - pyd was associated with changes of the erosion, joint space narrowing (jsn), and the total sharp score. after one year of anti - tnf therapy, the levels of urinary glc - gal - pyd was similar in ra patients with or without progressive joint damage over one year of anti - tnf therapy, but its reduction over one year was higher in patients with progressive joint damage. these results suggested that, in some patients, other mechanisms were possibly involved than tnf related inflammation. the last synovium biomarker recently developed is the nitrated type iii collagen (iiinys), which was explored in both osteoarthritis (oa) and ra patients. in patients with joint disorder, its level was the highest in ra patients which suggests that it is related to synovial tissue inflammation. we attempted to describe synovial biomarkers and put out their interest in ra management. despite many studies reviewed, no data are currently available to predict relapse in ra patients in remission then, we focused on three main cartilage biomarkers with a summary of their characteristics in table 2. two are biomarkers of cartilage breakdown, whereas the third one is a biomarker of cartilage formation. cartilage is mainly composed of collagen type ii (70%) and proteoglycans including aggrecan which is the most abundant one. mmps and aggrecanases are mediators of cartilage degradation. collagen type ii c - telopeptide (ctx - ii) is a neoepitope generated from mmps, derived from the carboxy - terminal part of type ii collagen. in early ra, urinary ctx - ii level was higher than in controls, and patients with high ctx - ii level have a higher risk for the progression of joint damage over 1 year, independent of the extent of joint destruction at baseline and of clinical indices of disease activity. in established ra, urinary ctx - ii level was associated with rapid radiologic progression or changes of the jsn sharp score over one year. then, ctx - ii was assessed during anti - tnf therapy in ra patients. after one year of anti - tnf therapy, the levels of urinary ctx - ii were similar in ra patients with or without progressive joint damage over one year of anti - tnf therapy. in patients with progressive joint damage, reduction of urinary ctx - ii was higher than in others. cartilage oligomeric matrix protein (comp) is a noncollagenous extracellular matrix protein mainly found in cartilage maintaining the integrity of the collagen network. serum comp was reduced in ra patients in remission induced by anti - tnf therapy compared to other patients. in early ra, early changes in serum comp levels were related to radiological outcome over the first 5 years. serum propeptide of type iia procollagen (piianp) arises from the maturation of type iia procollagen. its level was decreased in patients with oa or ra. in ra patients treated with low - dose corticosteroids, no data are at this time available to describe their interest to predict relapse in ra patient in remission. bone homeostasis is highly regulated by balance between new bone formation and removing old bone. bone formation markers included the serum bone formation markers total osteocalcin (oc), the alkaline phosphatase bone isoenzyme (balp), and the c- and n - propeptide of type i collagen (picp and pinp). bone degradation is driven by osteoclasts and results in stimulation by rankl induced by il-1, il-6, or tnf. osteoclasts secrete cathepsin k, which degrades the collagen type i and releases c - terminal crosslinked telopeptide of type i collagen (ctx - i), or n - terminal crosslinked telopeptide of type i collagen (ntx) neoepitope. the crosslinked carboxyterminal telopeptide of type i collagen (ictp) is another fragment of c - telopeptide end, which is not released with cathepsin k action but probably mmps [52, 53 ]. other type i collagen crosslinks are pyridinoline (pyd) and deoxypyridinoline (dpd). in established ra, uncoupling with low level of bone formation markers and high bone resorption markers was described in 1999. oc, a bone formation marker, was reduced in ra without destruction compared to controls. on the contrary, ctx - i, a catabolic bone marker, is higher in ra patients with destruction compared to other ra patients. this uncoupling was recently confirmed by using an innovative way to assess bone damage in ra by high - resolution peripheral quantitative computed tomography (hr - pqct). trap 5b level, a catabolic bone marker, was associated with bone erosions, whereas bone alkaline phosphatase (bap) was associated with osteophytes. furthermore, in longitudinal studies, catabolic bone markers (ctx - i or pyd) are also good predictors for radiologic progression in ra [47, 58, 59 ]. like cartilage and synovium turnover markers, ratio between bone formation markers and bone resorption markers increased during one year of treatment, suggesting improvement of the bone remodeling balance, mainly due to a decrease in bone resorption. a differential effect was observed at one year of anti - tnf therapy between ictp and ctx - i. ictp, which is related to mmps activity, remained decreased at one year, whereas ctx - i level, which is related to cathepsin k, returned to its baseline level at one year. this suggests a strong effect of anti - tnf on local subchondral bone related to joint inflammation. since tnf blockers already showed a reduction of the bone biomarker unbalance, tnf blockers also demonstrated a positive effect on bone mineral density in ra patients with or without a clinical response as observed at the joint level. all these data support that anti - tnf therapy is not only able to prevent joint destruction, but it is also able to prevent bone loss in ra patients. similarly, with tocilizumab, bone formation biomarker pinp increased whereas bone resorption markers, ictp and ctx - i, decreased. this suggests a nonspecific effect of a pathway but an effect on suppression of joint inflammation. denosumab reduced both serum pinp and ctx - i levels over one year, whereas urinary ctx - ii decreased only at 3 months. since denosumab targets rankl, but not a proinflammatory cytokine, ra disease was not improved, but it reduced erosion progression. so according to the target, drugs have different effects. blocking inflammation reduces bone loss, but blocking pathway induced in bone loss reduced it without effect on ra activity. among all these biomarkers, only ctx - i has demonstrated its ability to be associated with joint destruction, sensitivity to treatment, and prediction of joint progression we showed that synovium, cartilage, and bone turnover biomarkers are correlated with ra activity. to summarize furthermore, these biomarkers could be useful to identify ra patients with high risk of rapid disease progression. since these biomarkers reflected different compartments involved in ra, they will be useful to define structural remission in ra. some of these reviewed biomarkers compose the multibiomarker disease activity (mbda) test developed to quantify ra disease activity. recent data suggested that low mbda was associated with clinical remission criteria [67, 68 ]. treat - to - target strategy emerged since few years to manage early ra patients. only one study combining clinical and biomarkers demonstrated its utility in the treat - to- target strategy. however, we need more studies to generate more data to define the place of these biomarkers in ra remission. at this time | objective. the aim of this review is to clarify the usefulness of bone, cartilage, and synovial biomarker in the management of rheumatoid arthritis (ra) therapy in remission. synovial biomarkers. high mmp-3 levels are associated with joint progression in ra patients, but there is no data about their utility in clinical remission. iiinys and glc - gal - pyd seem to be more specific to synovium, but more studies are required. cartilage biomarkers. unbalance between cartilage break - down biomarkers (urinary ctx ii and comp) and cartilage formation biomarker (piianp) was described. this unbalance is also associated with joint destruction and prognosis of destruction. no data are available on patients in remission. bone biomarkers. ra activity is correlated with an increase of bone resorption markers such as ctx i, pyd, and tracp 5b and a decrease of bone formation markers such as oc and balp. ra therapies seem to improve bone turnover in limiting bone resorption. there is no study about bone marker utility in remission. conclusion. biomarkers seem to correlate with ra activity and progression. they also could be used to manage ra therapies, but we need more data on ra remission to predict relapse. |
for all the painstaking attention granted to tracheal intubation, especially with regard to the management of the difficult airway, precious little heed has thus far been paid to tracheal extubation.1 compared to 4.6% respiratory complications in the intubation of elective cases, extubation - related complications arise in 12% in the same group.2 in some studies, researchers have tried to, along with other extubation criteria, indicate the application of oxy - hemoglobin as a guide to extubation decision.3, 4 during the extubation process, vital signs and oxy - hemoglobin saturation percentage should be monitored.2,5 given that the period immediately after extubationis the most critical and vulnerable time for the patient, it is necessary for the medical staff to be alert and look for any sign or symptom of respiratory disturbance and hypoxia.5 the pulmonary effects of systemic inflammatory reaction after cardiac surgery are often modest and include decreased lung compliance, pulmonary edema, increased intrapulmonary shunt fraction, and decreased functional residual capacity and their resultant hypoxemia. few patients (2%) undergoing cardiac surgery develop full - blown acute respiratory distress syndrome.6 however, it is reported that up to 40% of cardiac surgery patients are readmitted to the intensive care unit (icu) because of respiratory failure.7,8 during the last decade, many researchers have tried to address different strategies like the open lung concept (olc),9,10 recruitment maneuver,11 and positive end expiratory pressure (peep)12,13 as well as some other measures14,15 in order to attenuate hypoxemia after cardiac surgery. considering that there are no practical standards for extubation techniques and an increasing number of patients experience extubation - related complications,16 we devised a novel extubation method and compared its results with those of the conventional method. the principal goals were:(1) to augment oxygenation by reducing the aspiration of the respiratory secretion and (2) to decrease intra - pulmonary shunting and its effects on the icu stay. a pilot study was initially devised so as to determine the sample size, there being no similar study available in the existing literature. the results of the pilot study determined the number at 90 per study group with a confidence coefficient of 90%. data were gathered by trained staff, matching was performed both for the patients and the methods, anesthesia techniques and drugs were coordinated and equalized by three experienced anesthesiologists, and randomization was done on a time basis : the new method was utilized in the first three months, followed by the conventional method in the ensuing three months. the inclusion criterion was elective on - pump coronary artery bypass grafting surgery (cabg), and the exclusion criteria were comprised of severe lung disease, intubation before surgery, severe hemodynamic disturbance requiring balloon pumps, and need for operation before extubation. these data were comprised of the mean of partial pressure of oxygen in arterial blood(pao2) = 87.7 mmhg with a standard deviation of 16.6 for the new method group and 95.31 mmhg with a standard deviation of 14.56 for the conventional method group. arterial blood gas (abg) parameters constituted the main variables, particularly pao2 and pao2 / fio2 (fraction of inspired oxygen), at one and four hours after extubation. the time periods considered for the purposes of the present study were : 1) one hour after icu admission ; 2) just before extubation ; 3) one hour after extubation ; 4) four hours after extubation ; 5) twelve hours after extubation ; and 6) forty - eight hours after extubation. the study population comprised post on - pump cabg patients who were under care in the icu during a six - month period in 2008. confounding factors were cardiopulmonary bypass (cpb) time, aortic cross - clamp time, body mass index (bmi), and underlying diseases such as chronic obstructive pulmonary disease, diabetes mellitus, smoking, reoperation, and dialysis. the inclusion criteria were composed of cabg without any co - surgery, intubation in the operating room, and consent for participation in the study. the exclusion criteria were comprised of valvular disease requiring surgery, pneumonia, hemodynamic disturbance, intra - aortic balloon pump (because it induces inflammation), respiratory distress, urgent or elective intubation, carbon dioxide pressure (pco2) > 45mmhg, oxygen pressure(po2) 40. immediately after icu admission, the cuff pressure was controlled and was thereafter monitored every eight hours. next, the ventilator machine was set on simv - psv (simv : synchronized intermittent mechanical ventilation, psv : pressure support ventilation) : vt (tidal volume) = 8 cc / kg of ideal body weight, frequency of intermittent mandatory ventilation (f) (imv) = 10/min ; f (imv + psv) = 15/min, i / e (inspiratory - expiratory time ratio) = 1/2, peep = 5 cmh2o, psv = 5 cmh2o above total inspiratory pressure support, (peep) = 10 cmh2o), pressure support = 10 cmh2o, oxygen flow = 60 lit / min, and fio2 105, the patient was regarded as not being able to stand extubation (crawford j, otero r, donnino m, garcia j, khazal r, lenoir t. rapid shallow breathing index a key predictor for noninvasive ventilation. critical care 2007;11:169).before extubation, the recruitment maneuver was done for all the patients. in the conventional extubation method, the patient s mouth was washed and suctioned using normal saline (10 cc). next, separation from the machine was done. in aseptic condition, the patient s tracheal tube was thereafter suctioned using a suction tube with a caliber 1/3 the caliber of the patient s tracheal tube. then, the tracheal tube cuff was evacuated and patient was asked to take a deep breath. in the climax of the inspiration, the patient s mouth was suctioned dry (without liquid).then, only if it was necessary, intra - tracheal suction was done. afterward and before evacuating the tracheal tube cuff, the system s peep was set to 15 cmh2o and psv to 20 cmh2o. next, immediately after evacuating the cuff with a syringe, the patient s mouth and pharynx were suctioned cautiously. and finally, the tracheal tube was removed along its curve. if there was secretion in the pharynx, it was suctioned again and the patient was encouraged to cough or swallow the secretion and to breathe deeply. the patient was set in a semi - sitting posture (3045 degrees) and oxygenation was done with nasal oxygen, and if necessary, by using a face mask with an oxygen reservoir bag. based on ethical rules, in the fifth and sixth time periods, abg analysis (as an invasive procedure) was conducted in accordance with the rules of our icu or the clinical judgment of the anesthesiologist. the results are reported as mean standard deviation (sd) for the quantitative variables and are summarized by absolute frequencies and percentages for the categorical variables. differences in the distribution of the characteristics in the patients were examined using the chi - square test for the discrete variables, while the t - test was employed to examine differences between the two groups for the continuous variables. logistic regression analysis was utilized to eliminate the effect of the confounders. for the statistical analyses, the statistical software spss version 16.0 for windows (spss inc., chicago, il) and the statistical package sas version 9.1 for windows (sas institute inc. this study initially recruited 257 patients, and after 5 patients were eliminated because their intubation time exceeded 36 hours as a result of decreased consciousness level, hemodynamic instability, or the other underlying diseases, the study population was divided into the conventional group (n = 154) and the new method group (n = 98).totally, 74.2% of the cases were male and 25.8% female:73.4% male and 26.6% female in the control group and 75.5% male and 24.5% female in the case group (p value=0.7). according to the chi - square statistical method the distribution of the independent quantitative variables, in all the patients in the study and differentially in the two groups is shown in table 1. as regards the underlying diseases and risk factors, cigarette smoking was seen in 37.8% of all the patients, followed by diabetes mellitus (31.9%). there was no significant difference between the two groups in the percentage of the diabetic patients (p value=0.98), chronic obstructive pulmonary disease (copd) patients (p value = 0.08), cigarette smoking (p value = 0.84), and opium consumption (p value = 0.23). in terms of admission in the icu (p value = 0.95), inotrope requirement (p value = 0.71) and balloon pump before extubation (p value = 0.71) and balloon pump two hours after icu admission (p value = 1), there was no significant difference between the two groups. there was, however, a significant difference in the percentage of inotrope usage two hours after icu admission : the control group 26% and the case group 12% (p value = 0.01). there was a significant difference between the two groups in the age average : 61.848.86 years in the control group and 59.0710.05 years in case group (p value = 0.02), but the difference was not significant, clinically. there was no significant difference in the other variables like bmi (p value = 0.2), graft number (p value = 0.77), cardiopulmonary bypass (cpb) time (p value = 0.16), cross - clamp time (p value = 0.15), ejection fraction (ef) % (p value = 0.44), and fev1/fvc (p value = 0.28) between the new method and control groups. based on our findings, recorded in table 2, some of the abg parameters such as pao2, ph, and oxygen saturation (spo2) showed significant differences between the two groups, before extubation. after extubation, all the patients were oxygenated by nasal cannulae unless there was 1) respiratory distress, 2) tachypnea > 35/min, or 3) po2 decrease < 60 mm hg, in which case, nasal cannulae were replaced with reservoir masks. the patients were, accordingly, assigned into two groups according to the usage of the nasal cannulae or reservoir mask : 9 (5.9%) patients in the control group and none of the patients in the case group required reservoir masks. (the assumption was that the reservoir mask provides 80% oxygenation and the nasal cannula 40 %.) one hour after extubation, the difference was significant (p value = 0.02). four hours after extubation, 8 patients in the control group and none in the case group needed the reservoir mask and breathing via the nasal cannula was adequate to prepare desired oxygenation ; nevertheless, the difference was not significant (p value = 0.08). with respect to inotrope or balloon pump requirement at one, four, and twelve hours after extubation, there were no significant differences between the patients of the conventional and new method groups. in the hours mentioned, p values were 0.8, 0.66, and 0.29, respectively, for inotrope demand and 0.59, 0.54, and 0.08 for balloon pump requirement. a comparison of the dependent variables between the two groups revealed no significant difference in the icu length of stay (los) between the two groups (table 3). as it has been mentioned above, after weaning the patient from the respiratory machine, fio2 was estimated based on the patient s oxygenation way : 0.4 (40%) for the nasal cannula and 0.8 (80%) for the reservoir mask. among the independent variables, significant differences were seen in the variables of age (p value=0.02), inotrope (p value=0.01), and abg factors (table 2) like pao2 (p value=0.02), ph (p value=0.01), and spo2 (p value=0.001) when using the t - test. nonetheless, pao2/fio2 was not different between the two groups statistically. ultimately, the regression statistical method was utilized to consider the confounding effect(s) of these factors. among the abg factors, one hour after extubation, partial pressure of carbon dioxide in arterial blood (paco2) in the control group was lower than that in the case group, significantly (table 3). a comparison of paco2, four hours after extubation, between the two groups demonstrated recovery in paco2 reduction, with the difference not constituting a significant difference anymore. four hours after extubation, spo2 exhibited improvement in the case group by comparison with that in the control group ; their difference was statistically significant (p value=0.03) (table 3). finally, pao2 / fio2=225 (approximately the average level), at which the new extubation method had the most efficiency, was considered as the cut point. a comparison of this proportion between the two groups showed that pao2 / fio2 < 225 (pao2 / fio2 less than 225) was about 51.3% and 37.3% in the conventional and new method groups, respectively, at one hour after extubation, and also, 54.2% and 32.7% in the control and case groups, respectively, at four hours after extubation ; their differences were statistically significant. the other abg variables such as ph, be (base excess), and pao2 did not show significant statistical differences between the two study groups, although almost all of them exhibited improvement in the new method group. furthermore, twelve hours after extubation, most of the patients who required abg, and all of them, forty - eight hours after that, were in the control group. there was a higher rate of requirement to the reservoir mask than the nasal cannula in the control group than that in the case group at one hour after extubation, with the difference being significant. also, at four hours after extubation, there was no requirement to the reservoir mask in the case group but 8 patients in the control group required the usage of the reservoir mask ; as a result, breathing via the nasal cannula seemed appropriate for providing proper oxygenation in the case group. the percentages of the patients with po2 / fio2 < 200 (pao2 / fio2 less than 200) at one and four hours after extubation were smaller in the case group than in the control group, but their differences were not significant (table 4). at one hour after extubation, 7 (4.6%) patients in the control group showed po2 / fio2 < 150, whereas none of the patients in the case group developed this complication ; their difference was significant. also, in the control group, at four and twelve hours after extubation, 9 and 10 patients showed po2 / fio2 < 150 (pao2 / fio2 less than 150), respectively, while no patient experienced a similar situation in the new method group. at forty - eight hours after extubation, in the open method group, 8 patients (of 20), who required abg, had respiratory parameters within the range of po2/fio2 < 150. in contrast, no patient required abg forty - eight hours after extubation in the other group (table 5). as is mentioned in the results, variables that might affect the findings considering the variables of age, gender, bmi, ef, intubation time, fev1/fvc, and pao2 / fio2 in the logistic regression test demonstrated that the new method decreased the extubation complications in pao2 / fio2<225 at one and four hours after extubation, and po2/fio2<200 at one, four, and twelve hours after extubation. however, only the difference in pao2 / fio2<225 at four hours after extubation was statistically significant between the two groups (table 6). additionally, the multivariable linear regression test, spss 16, showed a higher range of pao2 / fio2 at one hour after extubation and pao2 / fio2 at four hours after extubation in the patients with the new extubation method than that in those with the conventional extubation method (8.888 mmhg and 8.248 mmhg, respectively) ; there were, however, no significant differences. tracheal extubation has captured precious little attention compared with intubation.1 we sought to present the details of a new extubation method to prevent atelectasis and hypoxia and to augment pao2 / fio2 in the icu for first time. although we found no comprehensive report of a similar method to compare our results with, our new method and its goals, mechanically, bears considerable similarities with the open lung concept (olc) recruitment maneuver and use of peep and continuous positive airway pressure (cpap) during and after surgery. the application of the olc results in fewer episodes of hypoxemia,9,10 and the use of peep as well as that of cpap prevents the formation of atelectasis.12, 13,17 in all the above - mentioned methods, preventing atelectasis and its unavoidable profound and catastrophic consequences in highly inflame lung parenchyma after on - pump cabg are the main target. our study would be deemed a new aspect of the olc, which has been previously ignored. in comparison with the existing literature on the olc, we placed greater emphasis on a very significant, albeit temporary, intervention which can significantly improve the patient s condition and could be considered a routine in other populations of icu patients. based on our results, even a short period of atelectasia plays an important role in the production of hypoxemia in latter phases ; consequently, considering the olc strategy, even at definite special times, can have a significant preventive effect for hypoxemia. among the abg factors, one hour after extubation, paco2 in the control group was significantly lower than that in the case group (table 3). it is noteworthy that agitation, pain, and hypoxia can cause paco2 reduction after extubation. four hours after extubation, spo2 was better in the case group than in the control group, with the difference constituting statistical significance (p value=0.03) (table 3). based on these differences and given the importance of oxygen saturation, the new extubation method seems more appropriate than the old one. finally, considering the cut point of 225 for pao2 / fio2, we found pao2 / fio2<225 in about 51.3% and 37.3% in the conventional and new method groups, respectively, atone hour after extubation and also 54.2% and 32.7% in the control and case groups, respectively, at four hours after extubation ; the differences were statistically significant. therefore, the efficiency of the new method for enhancing pao2 / fio2 and oxygenation rate was apparent in the level < 225. regarding the other abg variables such as ph, be (base excess), and pao2, their differences were not significant statistically ; be that as it may, almost all of them enjoyed improvement in the new method group. furthermore, with respect to rough parameters, clinical need to perform abg analysis, and use of reservoir masks or nasal cannulae, there were fewer patients with po2/fio2<200 and po2/fio2<300 at one and four hours after extubation in the case group. although these differences are not statistically significant, they seem to further underscore the efficiency of the new method. at forty - eight hours after extubation, in the conventional method group, 8 patients (of 20), who required abg, had respiratory parameters within the range of po2/fio2<150, while none of the new method group patients needed abg forty - eight hours after extubation. given the high rate of mortality and morbidity in such patients, these percentages should be regarded as a very important clinical parameter to compare the two groups and to introduce the new method as an effective and safe extubation method. considering confounding variables in the logistic regression test using sas 9.1 software, we found that in almost all the time periods, pao2 / fio2 was higher in the new extubation method group ; however, only pao2 / fio2 four hours after extubation<225 between the two groups was statistically significant (table 6). these findings suggest that our new method of extubation enjoys an acceptable oxygenation profile after cabg by comparison with the conventional method. one of the most important restrictions in this study was ethical limitations in redundant blood sampling for abg. when the patients were discharged from the icu, their catheters were off, usually. therefore, afterward, blood sampling for abg was limited for the patients who required it based on medical indications. in addition, after extubating and weaning the patients from the respiratory machine, fio2 was estimated based on the nasal mask or the reservoir mask, 40% or 80%, respectively. we believe that accurate monitoring of all patients with po2 / fio2<200 and po2 / fio2<300, at least for forty - eight hours after extubation (when atelectasia, pneumonia, or the other extubation complications may have appeared), could indicate the differences between the two methods. considering all of the findings in the present study, we believe that our new extubation method could improve some respiratory parameters and thus lessen the complications and augment oxygenation after extubation. however, future studies are required to further confirm our results and improve our new extubation method. | background : extubation is associated with the risk of complications such as accumulated secretion above the endotracheal tube cuff, eventual atelectasia following a reduction in pulmonary volumes because of a lack of physiological positive end expiratory pressure, and intra - tracheal suction. in order to reduce these complications, and, based on basic physiological principles, a new practical extubation method is presented in this article.methods:the study was designed as a six - month prospective cross - sectional clinical trial. two hundred fifty - seven patients undergoing coronary artery bypass grafting (cabg) were divided into two groups based on their scheduled surgery time. the first group underwent the conventional extubation method, while the other group was extubated according to a new described method. arterial blood gas (abg) analysis results before and after extubation were compared between the two groups to find the effect of the extubation method on the abg parameters and the oxygenation profile.results:in all time intervals, the partial pressure of oxygen in arterial blood / fraction of inspired oxygen (pao2/fio2) ratio in the new method group patients was improved compared to that in the conventional method ; some differences, like pao2/fio2 four hours after extubation, were statistically significant, however (p value=0.0063).conclusion : the new extubation method improved some respiratory parameters and thus attenuated oxygenation complications and amplified oxygenation after extubation. |
salmonellosis is a well - known cause of morbidity and mortality in patients, particularly in endemic areas. it is also a well - known cause of pyogenic liver abscess [1, 2 ]. it is frequently encountered in patients with pre - existing liver pathology such as amoebic abscess or echinococcus cyst. we present a case of salmonellosis complicated by pyogenic liver abscess in a previously known simple liver cyst. this signifies the importance of the fact that simple cysts can become a focus of abscess formation. a 74-year - old gentleman presented to the accident and emergency department following a 3-month stay in india. four weeks into his return, he started developing daily episodes of fever and night sweats. whilst in india, he was asymptomatic although he did not take any malaria prophylaxis or salmonella vaccine during his travel. he was also known to have a simple cyst measuring 5 cm in diameter in the right lobe of the liver, incidentally found on routine abdominal ultrasonography (usg). he did not take any regular medication, and was otherwise in good health. on examination, he had a temperature of 38.2c, pulse 90 beats per minute regular, and blood pressure of 116/60 mmhg. his initial blood biochemical examination showed normal liver and kidney functions but a raised c - reactive protein (crp) of 129 mg / dl. his haematological parameters showed a raised white cell count of 12 000/cumm with predominant neutrophilia. repeated blood and urine cultures were obtained and abdominal usg requested to find any abdominal collection as a source of sepsis. the delayed start of his symptoms vis a vis his travel history made viral aetiology, namely, dengue fever unlikely. his blood culture grew salmonella paratyphi a. serologies for amoeba and hydatid disease were negative. abdominal usg showed a collection in the right liver lobe, the same site as the simple cyst noted on the previous scans. the liver abscess was drained under ultrasound guidance using a pigtail catheter and the aspirate cultures also grew salmonella paratyphi a. the patient received systemic antibiotic, ceftriaxone 2 gm intravenously once daily for 10 days based on the sensitivity report and made an uneventful recovery. on followup, he remains asymptomatic. we present a case of liver abscess caused by salmonella paratyphi a, in a previously known simple cyst of the liver. the disease severity varies from mild self - limited gastroenteritis to septicaemia and abscess formation, the later being a major cause of morbidity and mortality. salmonella infection can involve any part of the abdomen, but most commonly involves the hepatobiliary system and spleen. certain conditions such as malignancies, sickle cell disease, liver cirrhosis, and gastric achlorhydria predispose to intra - abdominal salmonella sepsis [79 ]. salmonellosis is often diagnosed on blood cultures and stool cultures. pyogenic liver abscess (pla) is a rare presentation and most frequently caused by bacteroides, enterococcus, e. coli, klebsiella, streptococcus, staphylococcus, and salmonella spp. it is diagnosed by ultrasound guided sampling of collection followed by culture and repeated blood cultures. it is occasionally difficult to diagnose pyogenic liver disease as in up to 50% of the pla, blood cultures are negative. it is important to consider an alternative diagnosis of amoebic liver disease in a traveller returning from tropics as was our patient. absence of antibodies after one week of symptoms is almost exclusive of amoebic liver disease and stool examination for detection of cysts is recommended in case patient is a carrier for the infection. tumours of the hepatobiliary region can occasionally mimic liver abscess whilst an underlying malignancy on liver abscess is associated with poor prognosis [1214 ]. there has also been a case report of salmonella in polycystic liver disease. in one case report of polycystic liver disease, one of the cysts became infected with salmonella javiana that was successfully treated with percutaneous drainage and systemic antibiotic followed by installation of intracystic tetracycline as a sclerosant thus preventing a laparotomy. similarly pla caused by salmonella enteritidis has been reported in a returned traveller with hiv infection. many strategies have been proposed for treatment of pyogenic liver abscesses depending on their initial size on ct or ultrasound abdomen. some studies suggest that small abscesses (less than 3 cm) should be treated with intravenous antibiotics alone. large uniloculated (more than 3 cm) abscesses should be treated with intravenous antibiotics and percutaneous drainage in the form of ultrasound guided needle aspiration or percutaneous catheter drainage. surgical or laparoscopic drainage has been recommended for large (more than 3 cm) multiloculated collections. other studies suggest treatment with antibiotics alone on abscesses less than 5 cm, and percutaneous drainage or surgery for sizes more than or equal to 5 cm. our case illustrates the value of percutaneous ultrasound guided drainage either by needle aspiration or by catheter drainage to reduce the time for resolution of sepsis and prevention of mortality. it also illustrates the fact that simple liver cysts can be a focus of pyogenic liver abscess and can be treated effectively with percutaneous catheter insertion and intravenous antibiotic therapy directed by microbiological sensitivities. | salmonellosis, endemic in various part of the world, is considered a differential diagnosis in a tropical traveller. although it usually presents as gastroenteritis, its various clinical syndromes may vary from mild gastroenteritis to severe septicaemia including abscess formation, the later two being the most common cause of morbidity and mortality. here we present a patient who returned to the uk after an overseas trip and was diagnosed with a pyogenic liver abscess with salmonella paratyphi at a site of a pre - existing simple liver cyst. |
generally, there are associations between the concept of social capital and social and civic participation as well as networks of cooperation and solidarity (1). the existing literature is rife with different definitions, conceptualizations and perspectives in social capital area. for example, bourdieu s distinct perspective on social theory of forms of capital (2) in contrast to putnam s perspective on communication line of political thinking (3) and coleman s exposition of family social capital (4) are three distinct schools of thought which currently well known in the published literature. despite these different definitions and perspectives, there is a slowly growing general agreement on social capital definition in the health field (5), which referred to as social networks and their associated norms of reciprocity (6). social capital is composed of the features of social organization and integration that makes co - operation easier for reciprocal advantage (5). this comprises the social relations which allow individuals and/or communities to obtain preferred goals (4) as well as the features of social life like networks, norms and trust in others which allow participants to act together in a more effective manner to follow jointly held objectives (3). membership density-the number of organizations to which people belong - and social trust-whether or not someone can trust most people- as social capital indicators consisting with structural / cognitive framework, have been associated with better health status (7), decreased mortality (8 - 9), and decreased violence (10). additionally, the numbers of literatures linking health behaviors in the developing countries to social capital are few. for example, a study conducted in kermanshah (a western city close to the place the current study conducted) found that there are associations between social capital and mental health of the immigrants living in their new society (11). moreover, a study in india showed that performing a community- empowerment program could lead to higher participation in childhood immunizations (12). searching literature in the area of instrumentation of social capital with theoretically based instruments shows that the focus of these studies are on creating new instruments instead of trying to replicate or modify an existing one (13). as psychometric testing or standardization of these new instruments has not been subjected, their interpretation and generalization have become difficult (14). therefore, conducting such studies which test psychometric properties of an instrument in different languages may be useful in interpreting and generalizing results found in different studies. the social capital questionnaire (scq) is the outcome of a work conducted by onyx and bullen (15 - 17) from the center for australian community organizations and management (cacom) in order to measure the concept of social capital. in order to define a conceptual framework for social capital and develop the questions for the survey instrument, onyx and bullen applied a comprehensive literature reviews and discussions through expert panels including academician and practitioners. these dimensions included trust /perceived safety, values of self, personal empowerment, diversity / openness, participation in the local community, reciprocity, relations within the workplace, and attitudes toward government. the original scq comprised 68 items, along with 17 additional demographic items. after administrating the scq to 1211 adults in rural and urban areas of new south wales, australia, factor analysis of the instrument showed a factor structure very similar to the initial theoretical conceptualization. these eight factors included proactivity in a social context, feelings of trust and safety, tolerance of diversity, value of life, family and friends connections, neighborhood connections, formal participation in local community, and work connections. based on factor loadings and item total correlations, 36 best items, were retained from the original 68 social capital items. the internal consistency, using cronbach s coefficient alpha estimated to be 0.84 for the 36 items with item total correlations in the range of 0.250.45 which indicated a significant but not redundant contribution from each item. the results of their study approved the psychometric strength of their newly developed scq. after a few years, obrien., (13) in the united states administered a revised version of the instrument as part of a larger study designed to measure individual perceptions of social capital, sense of community, and fear of crime in an effort to tease apart the interaction of these constructs and their relationship with the fear of crime. they reported the psychometric properties of the scq in a separated article (13). for example, the original self - administered and pencil instrument was altered for telephone administration. after collecting data applying this instrument, exploratory factor analysis (efa) was conducted to evaluate the factor structure of the revised scq. at the end of the study, obrien., (13) discovered a similar factor structure to that found in the initial study and concluded that the onyx and bullen scq were worthy of more consideration as a practical instrument for health researchers and community agencies interested in social capital. to the best of our knowledge, the number of studies investigated the psychometric properties of a social capital scale in persian is few. therefore, the aim of present study was to investigate the psychometric properties of onyx and bullen s instrument among a sample of medical science students in tehran university of medical sciences, iran and to compare the factor analysis with findings from two previous studies in australia (15) and the united states (13). multistage cluster sampling was employed to recruit 360 medical students (male : 95/female : 198) from 7 depatrments in tehran university of medical sciences, in 2011. the ratio of at least 10 subjects for each item (18) considered to estimate the sample size. since the scq constituted 36 items, the sample size was considered to be 360 students. among 10 departments existed in the university, seven were randomly selected. students were recruited proportionally base on the department capacity (i.e., the higher capacity of the department, the higher recruitment). students who attended regular academic senior courses were included in the study. at the first days of autumn semester, prior to the beginning of formal classes, the questionnaires were administered to the respondents and after considering the ethical issues they were guided for completing the questionnaires and then asked to complete them. the refusal rate among the students was low and 317 questionnaires completed by the students, with, the response rate of about 88%. due to partial completion, 24 questionnaires excluded from the original data. factor 1= feelings of trust and safety in the local community ; factor 2 = feeling of trust for formal participation in the community ; factor 3= feeling of safety at night in the community ; factor 4= tolerance of diversity and social participation ; factor 5 = neighborhood connections ; factor 6 = value of life ; factor 7 = family and friends connections ; factor 8 = pro - activity in social context the original survey protocol was reviewed and approved by the human subjects committee at school of health and health research institute, tehran university of medical sciences. ethical approval for the study was also given by the medical research council 's ethics committee in tehran university of medical sciences. the social capital questionnaire (scq) is one of the most significant instruments in the social capital literature (15). the scq was composed of 36 items which developed and piloted across 5 communities in australia. it classified into eight dimensions, encompassing value of life (3 items), tolerance of diversity (3 items), neighborhood connections (5 items), family and friends connections (3 items), work connections (4 items), community participation (7 items), feelings of trust and safety (5 items) and proactivity (6 items). all 36 scq items were provided with a 4-point likert - type scale ranging from 1 (no, not much or no, not at all) to 4 (yes, definitely or yes, frequently) (15). demographic data form included 8 questions and was developed by researchers to obtain data that are related to the participants and their the socio- demographic characteristics of them, such as age, gender, residency place, field of study, degree, economic and marital status and the number of family members. for the present study, an original persian translation of the scq was used as part of a larger study designed to investigate the relationship between social capital and mental health among a sample of medical sciences students in tehran, iran. the focus of current study was only on investigating the psychometric properties of the persian version of the 36 items scq. in order to achieve the persian translation of scq, two persian native translators (one specialist in the area of health education and behavior with experience in health sociology and one professional translator) translated the scq into persian, independently. the formated translation was discussed in a first consensus panel (a specialist in the area of health education and behavior with experience in health sociology, a sociologist and two experts in health education) to achieve the first preliminary version. this consensus version was translated back to english by another translator (one english native professional translator) who had not seen the original english versions of the scale. in order to achieve a second preliminary version, these consensus versions completed by 20 students to confirm if all items of the questionnaire were understandable and included all the expected concepts and items without any redundancy. it found that the questionnaire was clear and well understood and therefore no cross - cultural modification made for them. finally, a third consensus panel was formed to achieve the final version of the persian scq (p - scq). statistical analysis was performed using spss version 16.0 for windows. a p - value 0.11 are significant at the 0.01 level. factor 1= feelings of trust and safety in the local community ; factor 2 = feeling of trust for formal participation in the community ; factor 3= feeling of safety at night in the community ; factor 4= tolerance of diversity and social participation ; factor 5 = neighborhood connections ; factor 6 = value of life ; factor 7 = family and friends connections ; factor 8 = pro - activity in social context the present study investigated the psychometric properties of onyx and bullen s instrument among a sample of medical science students in tehran university of medical sciences, iran and compared the factor analysis with findings from two previous studies in australia (15) and the united states (13). the scq has been validated in several countries, including australia (15), the u.s (13) and northern ireland (23). however, not only any persian version of this index in iran was not available nor validated social capital scale does exist in persian. therefore, we had to translate the scq into persian language and tested its psychometric properties and validity. as a whole, the results found in the present study support, moderately, the applicability and construct validity of the p - scq in an iranian sample. in the present study all of the items loaded on, at least, one factor and, were similar to the findings of the previous studies (13, 15), an eight factor analysis was derived from the iranian sample. moreover, 19 out of 36 items did not load on the expected factors, whereas in the study conducted in the u.s. a possible reason for the differences found between item loadings in these studies might be due to variation in selected methodologies. in the study conducted in australia the selected respondents were from rural, suburban and inner - city community completed a self - administered questionnaire and in the us study, the data collected from a sample of adults living in a community in the midwestern united states through telephone survey whereas in the present study, the respondents were medical sciences students. another possible reason was due to the fewer relevancy of some items to the homogen sample of our study. most of the students were single and living in dormitories apart from their family, and therefore, less likely to have relationship with neighbors, workmates and local community members. the p - scq factor correlations were somewhat similar to those found by previous studies (13, 15) and some notable differences were found. for instance, neighborhood connections and tolerance of diversity had a fair relationship (r=0.450) in the present study. but, in the previous studies this relation was moderate (r=0.21) (13) and weak (r=0.03) (15), respectively. in the current study, the correlation between formal participation and work connections was moderate (r = 0.220) which is similar to those found by obrien. (r= 0.29), but is in contrast to those found by bullen and onyx (r<0.01). in the studies conducted in australia and the u.s., the correlations between family and friends connections and pro - activity in social context were moderate (r=0.37 and r=0.35), but high (r=0.61) in the present study. in order to compare, more precisely, the discrepancies and similarities of the findings of the present study with those conducted in australia and the us and, also, and also to make the psychometric properties of scq more obvious, the relationships between the factor scores and the student characteristics were investigated. like findings in study conducted in australia, were found little associations between the dimensions of social capital and demographic variables, except for some limited factors. for example, significant differences were found in feelings of trust and safety and tolerance of diversity by gender and field of study. but, there was no significant difference in total social capital by the students characteristics. these findings support the idea concluded by bullen and onyx (15) that social capital is evidenced equally by rich and poor, men and women, all ages, and all educational levels. in contrast, the findings of this study did not support those of obrien. (13) who found that increased salary and higher education were significantly associated with greater scores on the most of social capital factors. moreover, the results of our study showed that there is no association between social capital factors and the student s age, financial status and race. the lack of association between social capital dimensions and demographic characteristics may result from homogeneity of respondents. since all respondents were university students, they had somewhat close demographic characteristics and therefore low variations in population. for study which investigated the applicability of an international scale in a new community, considering the community s individuals as a primary research in society may obtain better understandings of differences between various studies. moreover, since the similarity in labeling factors was somewhat moderate in the present study and because of variations in scale composition between different studies, it was difficult to compare these results to those with dimensions of social capital applying different social capital scales in different communities. the results of current study showed that 19 out of 36 items did not load on the expected factors. there are several possibilities for these differences such as ; the homogeneity of the sample, as noted before, as well as the irrelevancy of the items to the sample, and variation in research or statistical methodologies (13). as a more significant possibility, the medical students in iran (mean age ~21) may well have a different definition of social capital to those with english - speaking, home - owning, middle - aged residents of australia / usa. therefore, the differences found in the factor analysis between the studies may ascribed different types of populations studied. the authors believe that this reason along with the homogeneity of the sample, are the most probabilities for the differences found. moreover, in agreement with obrien. (13) the term social capital was too broad and questionable to ever completely capture the mutual action between society and individuals with health and happiness. also, due to its skeptical and wide dimensions especially in different communities with different cultures, collecting all its aspects together in a scale may be difficult and could cause variations in results of different studies. although, the ratio of at least 10 subjects for each item (18) considered to estimate the sample size (360 students), the analysis performed on the data was from, only, 293 respondents. considering the importance of sample size in comparing subgroups, the reader is cautioned that the sample size was somewhat low and the inferences drown from results may be interpreted with caution. the students of a medical sciences university are not representative of the whole society and so, complementary studies are recommended. nonetheless, iranian medical sciences students have different characteristics from those australian and the us populations ; therefore, the results were limited in terms of comparison between communities. finally, as noted, the homogeneity of the sample may be another limitation of the present study. despite the limitations noted, the results of the present study are useful in helping researchers to obtain more evidence for constructing a valid and reliable social capital instrument. according to the results of the present study, the persian version of scq demonstrated a moderate replicability, validity, and reliability. further studies are required to help researchers in comparing various dimensions in multiple communities and also, in comparing the dimensions with other indicators of social capital and/or public health, like civic engagement, organizational membership records (13), mental health and participation in health promotion programs. finally, as bullen and onyx (15) noted, this instrument is a practical and useful theory - based tool for researchers, health sociologists and community agencies, and is now available in persian. | background : the aim of this study was to investigate the psychometric properties of social capital questionnaire (scq) developed by onyx and bullen (2000) among a sample of medical science students in tehran university of medical sciences, iran and to compare the factor analysis with findings from two previous studies in australia and the united states. methods : multistage cluster sampling was employed to recruit 293 medical science students (male : 95/female : 198) from 7 faculties in tehran university of medical sciences. after translating scq into persian applying back - translation technique and three - stage consensus panel, the questionnaires administered to the respondents and they were asked to complete them. statistical analysis was performed using spss version 16.0 for windows. results : exploratory factor analysis (efa) was conducted to evaluate factor structure of the persian scq (pscq),which showed a moderate replicability, validity, and reliability (cronbach alpha=.79) to those found in previous studies. twelve factors extracted with eight values greater than 1 which altogether accounted for 76.23% of the total variance. applying cattell 's scree test, it was indicated that between seven and eight factor sextracted. the correlations between factors were detected in the low (at the lowest 0.002) to modest (at the highest 0.614) range. conclusion : the differences found in the factor analysis between the studies may be ascribed to the various types of populations studied. despite the difference in populations studied, our findings support the meaningful nessof p - scq as an instrument that is worthy of further attention for use in social health researches, although more studies are recommended to help researchers in comparing its variety in dimensions of different communities. |
in 2005, heimburg and jackson showed that biomembranes may carry solitonic sound waves whose maximum amplitude and minimum velocity are close to the propagation velocity in myelinated nerves.(1) their paper concluded : it would be surprising if nature did not exploit these features. subsequent works by the same authors argue directly that nerve signals are not primarily electrical but solitonic sound waves carried by the nerve cell membrane. the conventional wisdom is that nerve signals propagate via electrical current as formulated in the hodgkinhuxley theory.(4) the heimburgjackson theory explains anesthesia as a straightforward effect of melting - point depression of the orderdisorder transition. this can in turn explain why biomembranes have transition temperatures close to physiological temperatures.(5) the heimburgjackson nerve - signal theory motivated this study. one element of the theory is the assumption that volume and enthalpy correlate strongly in their thermal equilibrium fluctuations, at least as it regards the slow parts of these fluctuations. this assumption was justified by experimental observations that membranes specific heat and compressibility are proportional in their temperature dependence across the phase transition. also, a correlation between lipid area and enthalpy has been proposed(6) on the basis of experimental observations.(8) if so, both volume, membrane area, and enthalpy are controlled by a single parameter. below, we present first results from extensive computer simulations of different phospholipid membranes performed in order to investigate whether strong volumeenergy and/or areaenergy correlations are observed and, if so, what causes them. recently, we studied equilibrium thermodynamic fluctuations of much simpler systems, namely, various model liquids like the standard lennard - jones (lj) liquid and similar systems. in many such simple liquids, one finds a strong correlation between the equilibrium fluctuations of virial w and potential energy u, when fluctuations are studied at constant particle number n, constant volume v, and constant temperature t (the so - called nvt ensemble(14)). recall(15) that the virial w = w(t) gives the nonideal contribution to the instantaneous pressure p = p(t) via the defining equation p(t)v = nkbt(t) + w(t), where t(t) is the instantaneous temperature defined via the instantaneous kinetic energy. the virial is a function of the particle positions.(15) for the lj liquid, as well as for a united - atom toluene model, a dumbbell model, the kobandersen binary lj liquid,(16) and other van der waals liquids, w and u correlate better than 90% in their equilibrium fluctuations.(9) this reflects an effective inverse power - law potential dominating fluctuations, as discussed in detail in refs (11 and 12). the correlations are ruined by the hydrogen bonds, which are conventionally modeled via coulomb forces ; the existence of competing interactions prevents strong wu correlation in hydrogen - bonded liquids. for liquids with time - scale separation, like highly viscous liquids, strong wu correlations are particularly significant : viscous liquids with strong wu correlations are close to being single - order parameter liquids in the classical prigoginedefay sense. this implies that complex frequency - dependent thermoviscoelastic response functions like the isobaric / isochoric dynamic specific heat, the dynamic thermal expansion coefficient, the dynamic compressibility, etc., are all given by a single function.(19) in particular, these can not decouple(20) from one another ; they must all exhibit relaxations in the same frequency range. it has also been shown that strongly correlating viscous liquids obey density scaling, i.e., that if the relaxation time is measured at different temperatures and density, is a unique function(21) of /t, where the exponent may be determined from studies of wu correlations at a single state point.(22) finally, it was recently found that strongly correlating viscous liquids have much simpler aging properties than viscous liquids in general.(23) fluctuations are ensemble dependent, of course, and one may ask what happens if fluctuations are studied instead in the ensemble of constant temperature and pressure (npt ensemble). in this ensemble, virial fluctuations are not interesting, but there are strong correlations for simple liquids between the fluctuations of volume and potential energy.(10) this is the ensemble used below for studying biomembrane thermodynamic fluctuations. motivated by the findings for simple model liquids and the heimburgjackson theory, we decided to focus on phospholipid membranes in order to investigate whether the heimburgjackson assumption of strong volumeenthalpy correlations is confirmed. a phospholipid has van der waals interactions between its acyl chains and hydrogen bonds in the head region. similarities to simple van der waals liquids are not at all obvious, and the microscopic origin of the volumeenthalpy correlation tentatively derived from experiments is not trivial. thermodynamic fluctuations of membranes have been studied in the past, however, not with a focus on volumeenergy correlations. because of the large amount of water in the system and the hydrophilic head groups, one does not expect strong instantaneous correlations of phospholipid membrane thermodynamic fluctuations. the heimburgjackson theory, however, relates to strong correlations of slow degrees of freedom of the biomembrane (on millisecond time scales), and so do the experiments they quote. this is analogous to the situation for highly viscous liquids where time - scale separation between the fast, vibrational degrees of freedom and the much slower configurational ones is also, e.g., essential for viscous flow or visco - elastic responses. phospholipids are the major constituent of biological membranes.(28) close to physiological temperature, these membranes undergo a transition from an ordered phase (l) to a disordered phase (l). below, we evaluate the strength of vu correlations for both the disordered and ordered phases with a main focus on the disordered phase. we show that vu fluctuations correlate strongly but only on long time scales.(32) we also investigate how well membrane area as well as chain order parameter fluctuations correlate with v and u fluctuations ; such correlations are generally weak. finally, the cause of the correlations is identified by splitting volume and energy into contributions from the tail, head, and water regions : the origin of the slow, strongly correlating vu fluctuations are located in the tail region which are dominated by van der waals interactions. thus, establishing a conceptual link to strongly correlating fluctuations of simple van der waals liquids.(9) dmpc - f and dmpc - g : fully hydrated dimyristoyl - phosphatidyl - choline membrane in the fluid and ordered phases, respectively.(33) figure 1 shows configurations of these membranes. dppc - f and dppc - g : fully hydrated dipalmitoyl - phosphatidyl - choline membrane in the fluid and ordered phases, respectively.(34) dppg : a fully hydrated dipalmitoyl - phosphatidyl - glycerol membrane in the fluid phase with calcium counterions.(35) dpps : a fully hydrated dimyristoyl - phosphatidyl - serine membrane in the fluid phase with calcium counterions.(35) dmpsh : a fully hydrated and protonated dimyristoyl - phosphatidyl - serine membrane in the fluid phase.(35) phospholipids (and counterions) were modeled using the all - atom charmm27 force field(36) with modified charges of the headgroup as described in detail elsewhere.(33) membranes were hydrated using explicit water represented by the tip3 model.(37) tsim, total simulation time in nanoseconds ; tprod, length of production run in nanoseconds (only membranes in quasi - equilibrium, i.e., with no detectable drift in the area per molecule, were included in the data analysis) ; nlipid, number of lipid molecules ; t, thermostat temperature in kelvin ; tactual, average temperature and standard deviation of fluctuations ; nwater / nlipid, number of water molecules per lipid molecule. the uncertainty is estimated from the dmpc - f and dppc - f trajectories as described in the text (67% confidence interval) ;, energyvolume scaling factor in units of 10 ml / j (see eq 11) ; ruut, energyenergy of tail region correlation coefficient ; rua, energyarea correlation coefficient ; rva, volumearea correlation coefficient ; rascd, areachain order parameter correlation coefficient ; ruscd, energychain order parameter correlation coefficient ; rvscd, volumechain order parameter correlation coefficient. snapshots of dmpc membranes in the fluid phase (dmpc - f ; panel a) and in the ordered phase (dmpc - g ; panel b). the red atoms are the oxygen atoms of water molecules ; hydrogen atoms were removed for visual clarity (but included in the simulations). simulations were carried out using the namd software package.(38) in all simulations, a time step of 1.0 fs was used. temperature and pressure were controlled by a langevin thermostat (damping coefficient : 5 ps) and a noshoover langevin barostat (anisotropic regulation ; piston oscillation time of 100 fs ; damping time of 50 fs).(14) electrostatic interactions were evaluated using the particle - mesh - ewald method with a grid spacing of about 1 and updated every 4 fs. lennard - jones potentials were brought smoothly to zero by multiplying a switching function s(rij) ; s(rij) = 1 for rij roff with ron = 10 and roff = 12. initial configurations of dmpc - f, dppc - f, dppg, dpps, dmps, and dmpsh are taken from refs (3335). initial configurations of the ordered membranes, dmpc - g and dppc - g, were built from a membrane studied by venable and co - workers.(41) throughout the simulation, the acyl chains remain in an ordered structure, as shown in figure 1b.(31) thermal equilibrium was ensured by monitoring the membrane area ; only trajectories with no drift (compared to the thermal fluctuations) were used in the data analysis. lengths of equilibrium trajectories are listed in the top section of table 1 in the column under tprod. the importance of firmly establishing that the system is in equilibrium should be emphasized, since an apparent strong correlation would appear if volume and energy relax from some (arbitrary) out - of - equilibrium state. the following collective quantities were evaluated every 0.5 ps : potential energy u, volume of simulations box v = xyz (where x, y, and z are the box dimensions), projected membrane area a = xy, box thickness z, and average chain order parameter scdch. the latter quantity characterizes the overall order of acyl chains(43) and is defined by scdch = |(/2) cos(cd) (/2)ch|, where cd is the angle between the membrane normal (z) and the ch bond of a given methylene group.... first, we consider the fluid dmpc - f membrane shown in figure 1a. instantaneous fluctuations of volume and energy do not show any significant correlation (data not shown). this is not surprising, since a significant part of the simulation box is water, and water is known not to show strong correlation.(9) however, if fluctuations are averaged over time windows of 0.5 ns, volume and energy correlate strongly, as shown in the top panel of figure 2. this is quantified by the correlation coefficient where the bar here and henceforth indicates a 0.5 ns average. r = 0 corresponds to no correlation, whereas |r| = 1 corresponds to perfect correlation. we will refer to r 0.75 as strong correlation. for comparison, correlations in the slow thermal equilibrium fluctuations of volume and energy (top) and correlation matrix for the dmpc - f membrane (bottom). the normalized fluctuations of volume and potential energy shown are averaged over time intervals of 0.5 ns. data are shifted and scaled such that the average value is zero and the standard deviation is unity. a significant correlation is observed and quantified by the correlation coefficient, ruv = 0.77. this strong correlation can be associated with the tail region, as seen by the similarities with figure 5. the bottom panel represents the absolute values of the elements of the correlation matrix of energy, volume, membrane area, thickness, and the average chain order parameter, where dark red illustrates strong correlation. membrane area, thickness, and average chain order parameter are strongly correlated, but these quantities only correlate weakly with energy and volume. similar results are found for the other fluid membranes (except for dmpc - g and dmps where the energyvolume correlation is only 0.47 and 0.59, respectively) ; see table 1. it is an appealing idea to establish a direct connection between thermodynamic properties and microscopic structures, and several studies have focused on the ordering of the acyl chains as the important microscopic structure. following this philosophy, one possible explanation for the observed strong correlation is that the order of the acyl chains is the single parameter controlling the fluctuations : if chains, as a result of a thermal fluctuation, become more ordered, one expects a decrease of energy u, volume v, and area a, but an increase of thickness z, and chain order parameter scdch. thus, the correlation has the expected sign, but it is significantly weaker than ruv. the same is the case for z and scdch. the bottom panel of figure 2 shows the full correlation matrix. clearly, a single parameter description is not sufficient. we need two parameters to describe the fluctuations : one parameter controlling v and u and one geometrical parameter controlling a, z, and scdch. the bottom section of table 1 shows that dmpc - f, dppc - g, dppc - g, dmpg, dmps, and dmpsh all have strong volumeenergy correlation (ruv 0.75). volume fluctuations of the dmpc - g and dmps membranes, however, are only weakly correlated with energy fluctuations. to show that this finding is not due to uncertainty from random noise, we estimated the error bar as follows : two of the simulations, dmpc - f and dppc - f, are about 3 times longer than the remaining five simulations. we used these two long simulations to estimate the error bar of the calculated correlation coefficients by dividing them into three blocks of 40 ns (regarded as uncorrelated blocks).(44) the standard deviation of the correlation coefficient is 0.03 and 0.10 for dmpc - f and dppc - f, respectively, or about 0.07 on average. each of the five short runs corresponds to a single block, and thus, we estimate the error bar of these to be about 0.07 (within a 67% confidence interval). for the two longer runs, we use the n rule and estimate an error bar of 0.07/3 = 0.04. thus, the uncertainty is smaller than the spread among ruv s, and the weak vu correlation of the dmpc - g and dmps membranes is genuine, a point returned to later. the term slow fluctuations has so far been defined via the 0.5 ns averaging time window (indicated with a bar). a more general approach is to investigate the following time - dependent correlation coefficient similarly, one defines the time - dependent energyarea correlation coefficient ua(t). in contrast to ua(t), we observe strong correlation on long time scales for uv(t) (uv(t) 0.75) for the five membranes where slow fluctuations of v and u correlate strongly consistent with ruv 0.75 (table 1, bottom section). in the following section, the slow parts of the volume and energy fluctuations are investigated via the auto - correlation functions v(0)v(t) and u(0)u(t). time - dependent correlation coefficient of volumeenergy uv(t) (left) and areaenergy ua(t) (right). < 10 ns, only correlate weakly, whereas the slow fluctuations, t 1 ns, correlate strongly. a membrane is a highly heterogeneous system,(28) and it is reasonable to divide it into regions.(27) let the three regions t, h, and w be defined as follows : t (tail) refers to the hydrophobic acyl - chain atoms (i.e., atoms of methylene and methyl groups in the acyl chains), h (head) refers to the hydrophilic lipid atoms (the remaining lipid atoms), and w refers to the water atoms (and counterions). to identify the origin of the slow volume fluctuations, we construct voronoi polyhedra(45) of heavy atoms (i.e., ignoring hydrogen) and sum the voronoi volumes for the regions t, h, and w. in this way, the total volume of the simulation box is divided into three terms : the auto - correlation function of the volume in eq 2 can now be split into a sum of three auto- and three cross - correlation functions : figure 4a shows these six functions for the dmpc - f membrane. the only nonvanishing function at long times (responsible for the slow fluctuations) is the auto - correlation function of the hydrophobic (tail) part of the membrane, vt(0)vt(t). this is verified by rvvt = 0.94 being close to unity. time - dependent auto- and cross - correlation function of volume and energy terms of the dmpc - f membrane. panel a : volume correlation functions of the tail, head, and water regions (eq 4). the shot - time tailwater anticorrelation is probably an artifact of the way the voronoi polyhedron is constructed (related to the tailwater interface, see text for details). panel c : energy correlations split into intramolecular, lennard - jones (lj), and coulombic energies (eq 7 with x = tail). the short time cross - correlation between water and the tail region is significant and negative. this is, however, probably a spurious consequence of the voronoi construction between neighboring groups of different size : when a water molecule approaches the boundary of the tail region, it gains an (unfair) increase of the voronoi volume, due to methylene groups being larger than water molecules. this shows up as a negative correlation, since the water molecule steals volume from the methyl groups, however, only at short times (t < 0.1 ns). in the simulation, the potential energy of the system consists of a sum of lennard - jones terms, coulomb pair energy terms, and intramolecular energies : where uijlj = 4ij((ij / rij) (ij / rij)) are lennard - jones terms (van der waals interactions), uijcoul = qiqj/(40rij) are columbic terms, and u is a sum of the reminder terms (which are intramolecular ; harmonic bonds, angles, dihedrals, and improper dihedrals). again, we split the total potential energy into contributions from regions of tails, heads, and water : where where x represents either tails, heads, or water. as for the volume, the auto - correlation function of the energy fluctuations in eq 2 is also split into a sum of three auto- and three cross - correlation functions : figure 4b shows the six auto- and cross - correlation functions of ut, uh, and uw. again, the slow fluctuations are dominated by the tail region. it should be noted, though, that the slow tailtail correlation is not quite as dominating, as for the volume fluctuations. this is quantified by ruut = 0.82 (table 1, bottom section) not being as close to unity as rvvt = 0.94 ; thus, slow energy fluctuations of the head uh and water region uw are significant (in contrast to slow volume fluctuations of the head and water region). figure 4c shows the auto- and cross - correlation functions corresponding to an additional splitting of the tail energy into intramolecular interactions, coulombic interactions, and in the previous section, it was demonstrated that slow energyvolume correlation (of some membranes) originates from van der waals interactions in the tail region ; thus, where this is consistent with our findings for simple strongly correlating liquids. it should be remembered, however, that eq 9 neglects the energy terms uh and uw with some significance. if we correlate the slow fluctuations (defined as a 0.5 ns average) of the voronoi volume of the tail region and the van der waals energy of the tail region, we find a correlation coefficient of rvtutlj = 0.87, as shown in figure 5. the same number for the fluctuations for the whole simulation box was rvu = 0.77. consistent with this, the bottom section of table 1 shows a general correlation between rvu and ruut ; e.g., for the weakly correlated membranes, dmps and dmpc - g, both rvu and ruut have low values. a better understanding of how this loss of correlation is related to various lipid head groups deserves future study. normalized fluctuations of voronoi volume and van der waals energy of the tail region of the dmpc - f membrane, vt(t) and utlj(t). vt(t) and utlj(t) are shifted and scaled so the average value is zero and the standard deviation is unity. the correlation is strong with a correlation coefficient of 0.87 (justifying eq 9). note the similarity with figure 2a ; thus, slow vu fluctuations are dominated by the tail region. it is convenient to define a volumeenergy scaling factor via so that if ruv = 1 then v = u. for the seven membranes, given in table 1, we find that ranges from 6.1 10 ml / j (dmpc - g) to 13.2 10 ml / j (dmpsh). this scaling factor is indirectly accessible though experiments : close to the phase transition temperature, curves of excess enthalpy h(t) and volume v(t) can be superimposed.(7) heimburg showed that such a relation is trivial if excess volume and enthalpy of relevant microstates are proportional:(6) v = vhh. the inverse vh scaling factor can be written as (vh) = h/v = u/v + p. since p = 1 atm = 10 j / ml is much smaller than u/v 10 j / ml (a typical value as seen in table 1), then h/v u/v and the pv contribution to enthalpy is negligible. moreover, the excess volume and enthalpy of the phase transition is expected to be related to the slow equilibrium fluctuations close to the transition. thus, the scaling factor calculated from equilibrium simulations (eq 11) is closely related to the (experimental) phase transition scaling factor vh, and we expect them to have the same value. in agreement with this, ebel, grabitz, and heimburg(7) report a scaling factor of (9.01 0.71) 10 and (8.14 0.67) 10 ml / j for large unilamellar vesicles of dmpc and dppc, respectively, only slightly smaller than our findings of 9.6 10 and 10.2 10 ml / j, respectively (table 1, bottom section). this supports that we have identified the microscopic origin of the scaling of the phase transition. the proportionality constant, however, is not the same in both phases (table 1, bottom section) but is about /3 of the fluid value in the ordered phase. ebel, grabitz, and heimburg(7) reported a similar decrease (65% ; multilamellar vesicles of dmpc or dppc) when comparing scaling factors of the pretransition with the main transition. this suggests that the configuration of the ordered membranes (dmpc - g and dppc - g) is related to the pretransition, and that the nature of the correlations changes when passing the phase transition. interestingly, this is in contrast to our earlier findings for crystallization of the standard lennard - jones liquid. more work is needed to clarify the cause of this difference between biomembranes and simple liquids. biologically relevant membranes are mixtures of many sorts of amphiphilic molecules and are far more complex than the membranes studied here. the origin of the strong correlations is, however, not specific, but reflects the van der waals bonded nature of the core of the membranes. how solutes in membranes affect the volumeenergy correlation is an interesting subject for a future study. another concern could be the finite size of the simulated membranes, since fluctuations on length scales larger than the length of the simulation box can not be represented.(26) again, since the origin of strong vu correlations is intrinsic to van der waals interactions, the correlations are not expected to be affected by the size. one caveat is that, although we do observe some correlation between lipid area and energy fluctuations, the correlation is weaker than the volumeenergy correlation. their conjecture depends on the membrane being close to the phase transition, and it is possible that such strong au correlation appears only when approaching the phase transition. this can be investigated by evaluating the slow au correlation coefficient as a function of temperature. also, it is possible that such a correlation only appears on even slower time scales (e.g., s). this paper reports a study of thermodynamic equilibrium fluctuations of phospholipid membranes. on long (nanosecond) time scales, we identify strong volumeenergy correlations of a kind that were previously only observed for simple model liquids. these correlations are mainly documented for the fluid phase, but we also show that they exist in the ordered phase. it may seem surprising that a complex system like a biomembrane exhibits such strong thermodynamic correlations. the identification of the origin of the correlations as deriving from the van der waals interactions of the hydrophobic part of the membrane, however, points to a common origin of strong thermodynamic correlations in simple van der waals liquids and biomembranes. this is consistent with the finding that there are strong energyvolume correlations in both fluid and ordered phases : the correlations do not depend on the degree of chain order, just as for simple liquids where the strong correlations survive crystallization. we find weaker correlation between energy / volume and geometrical order parameters such as membrane area, thickness, and scd (characterizing ordering of acyl chains). thus, one parameter is not sufficient to describe thermodynamic fluctuations. regarding the heimburgjackson nerve signal theory, our findings largely confirm one crucial assumption of this theory, namely, that volume and energy (enthalpy) correlate strongly for microstates. we find strong correlations only on the nanosecond and longer time scales, which are, however, precisely the relevant times for nerve signals. | this paper reports all - atom computer simulations of five phospholipid membranes (dmpc, dppc, dmpg, dmps, and dmpsh) with focus on the thermal equilibrium fluctuations of volume, energy, area, thickness, and chain order. at constant temperature and pressure, volume and energy exhibit strong correlations of their slow fluctuations (defined by averaging over 0.5 ns). these quantities, on the other hand, do not correlate significantly with area, thickness, or chain order. the correlations are mainly reported for the fluid phase, but we also give some results for the ordered (gel) phase of two membranes, showing a similar picture. the cause of the observed strong correlations is identified by splitting volume and energy into contributions from tails, heads, and water, and showing that the slow volumeenergy fluctuations derive from van der waals interactions of the tail region ; they are thus analogous to the similar strong correlations recently observed in computer simulations of the lennard - jones and other simple van der waals type liquids (u. r. pedersen., phys. rev. lett.2008, 100, 015701). the strong correlations reported here confirm one crucial assumption of a recent theory for nerve signal propagation proposed by heimburg and jackson (t. heimburg and a. d. jackson, proc. natl. acad. sci.2005, 102, 97909795). |
this paper describes a novel assessment and care planning system for improving quality of life (qol) in nursing homes. the quality of life structured resident interview and care plan (qol.sri/cp) builds on a decade of research on measuring qol and is designed to be easily implemented in any us nursing facility. the materials are compatible with the nursing home minimum data set (mds) 3.0. qol for people living in nursing facilities can be understood as a subjective assessment of the outcome of the clinical care, housing, and other services provided by the facility. this concept of qol is broader than that of health related quality of life (hrqol), used in a lot of health care research [2, 3 ]. from the perspective of the individual resident, the concept of qol refers to their perceptions of their own lives, as a function of their own personal preferences, personality, and life history as experienced in the daily environment of a nursing facility. since nursing facilities structure not only the medical care but also the housing and social context, the definition of qol for this population therefore incorporates the myriad ways that everyday life is facilitated and constrained by policies, procedures, and interactions with staff. the qol of the approximately 1.5 million nursing facility (nf) residents in the us is undoubtedly lower than desired by residents, families, providers, and policy makers. although the landmark institute of medicine report on nursing facility quality and the subsequent 1987 legislative reforms placed high priority on qol, much of the regulatory focus over the subsequent two decades was geared toward measuring and ensuring quality of care. one major outcome of those reforms was the development of the resident assessment instrument (also referred to as the mds) which all nfs that accept medicaid payment must use to collect data at regular intervals on all residents. the rai was designed primarily as a tool for clinical care planning and thus covers physical function, cognitive function, and other health care needs in detail. the data derived from the rai, known as the minimum data set (mds), are submitted to state licensure and certification agencies and subsequently to the centers for medicare and medicaid services (cms) and serve as the main source of information for nursing home staff, policy makers, and researchers about the condition of nursing home residents. the data from the mds have been used to develop indicators of quality of care for benchmarking and internal quality improvement and public reporting [8, 9 ]. the development of consumer friendly report cards is intended to use market forces to increase visibility and accountability for quality and further spur quality improvement efforts [1012 ]. the recent revision of the mds to version 3.0 has made major strides towards increasing attention paid to resident qol. first, the designers have placed priority on resident self - report relative to observation and proxy report by incorporating the general principle is that, for sections related to mood, pain, and preferences, the default expectation is to ask residents directly. staff or family members can serve as a proxy only if the resident is unable to communicate or if an interpreter is not available [14, appendix d ]. the second is the inclusion of two sets of questions about daily preferences (f0400) and activity preferences (f0500). the inclusion of these items is designed to produce information about residents ' preferences that can be used as a guide to create individualized care plans. all nursing homes are required to have multidisciplinary care plans for each resident which serves as the primary documentation of all daily care and services. under the regulations, care plans are developed based on information collected with the rai and are reviewed and updated on regular basis (typically 90 days unless there is a change in status). the critical role of the assessment process as part of individualized care planning can not be understated. the cms state operations manual provides interpretive guidance for the survey and certification process and specifically highlights residents ' right to choose activities and schedules consistent with their interests and make choices about their lives. the guidance also identifies the expectation that facilities identify each resident 's interests and needs and involve the resident in activities that appeal to his or her interests. to be in compliance, staff needs to recognize and assess preferences and define and implement activities (including but not limited to formal and scheduled group activities) in accordance with resident needs and goals. it is therefore imperative that nfs have the technology to determine resident preferences and incorporate those preferences into the resident 's care plan. the wording of the items in mds 3.0 section f is intended to identify issues that residents find important for their daily lives. the mds 3.0 manual notes that these items are not meant to be all - inclusive. in addition to breadth, what is missing from the mds 3.0 items is an approach to eliciting two important factors crucial to care planning. first, there needs to be a way to elicit whether residents ' appraisal of their daily experience meets their expectations, given that they find a particular issue important. second, in order to develop a truly individualized plan of care, staff needs to have a way to learn the content of resident 's preferences. in order to meet the regulatory and ethical expectations of respecting residents ' rights of self - determination, staff need to consistently learn what, when, how, and with whom individual residents want to live their daily lives. the mds 3.0 does not provide the detailed prompts or questions to address this expectation. we developed a structured resident interview and care planning system for nursing home residents and tested it in a longitudinal randomized, controlled trial at three nursing homes. the following sections describe the quality of life assessment, care plan, and all evaluation procedures. every aspect of the assessment and care planning materials was extensively and iteratively pilot tested. the procedure was to develop a draft assessment and have two interviewers (a former director of social service and a recent social work graduate) conduct a series of interviews with a small sample of nursing residents from one facility. after each sample, the study team reviewed the results and made revisions to the approach. in this way, we were able to streamline the assessment process and simplify the scoring. the study was conducted at three not - for - profit nursing homes in the pittsburgh area. two were owned by a not - for - profit medical system : one in an urban setting and one on a suburban campus that also included personal care homes and independent living apartments. all three facilities had skilled units dedicated to postacute care ; however residents living on those units were excluded from the study. the qol.sri consists of two main components : the domain questionnaire (dq) and the in - depth follow - up. the dq contains 69 closed - ended items drawn from previous research to define and measure quality of life among nursing home residents. the items are organized into 12 domains : comfort, security, food enjoyment, privacy, meaningful activities, religious practices, relationships, functional competence, dignity, individuality, autonomy, and spiritual well - being. based on extensive pilot testing, items related to religious practices were separated from meaningful activities to create a new domain area that can be easily skipped for residents who report that they do not practice a religion. residents were first asked a yes or no question, followed by a frequency question : yes was followed up with always or often and no was followed up with rarely or never. this approach reduces the cognitive burden of using the full four - point scale and improves participation rates. residents who provide a response that indicates poor quality of life (e.g., indicating they never find it easy to make friends) are asked to rate the importance of that issue. the importance rating follows the response categories used in the mds 3.0 (very important, somewhat important, not very important, not important at all, and important but can not do or no choice). this approach minimizes respondent burden by focusing on the information needed to make decisions about care planning around issues where there is a need for improvement. a simple algorithm was developed to calculate a priority score by multiplying the qol rating for each item by the importance rating for that item. the numbers were arranged so that lower qol received a lower score and higher importance received a lower score. wherein priority is given to items in declining order (i.e., 1st, 2nd, 3rd, etc.). each item on the dq has a corresponding set of in - depth (i d) follow - up questions (see table 2 for a sample item). these are open - ended probes designed to elicit the what, where, when, and with whom for each topic. to reduce respondent burden, the assessor selected only the top 5 ranking items for in - depth follow - up. based on our pilot testing, we observed that occasionally residents might mention issues that are not covered in the dq items or make other comments that indicate that an issue is very important to them. in these cases, the assessor was allowed to select one wild - card item to follow - up on an issue that might not have scored in the top 5 but nonetheless seemed especially important to the resident. all residents received a standardized assessment ; however the actual questions and the intervention they received were tailored to their own individual preferences based on their responses to the assessment questions. the assessor used the residents ' responses to the open ended component of the qol.sri to develop a draft qol care plan task. these tasks were written on a simple form that identified the issue of concern, the goal in terms of resident qol, the staff involved, and the frequency with which the task should be accomplished. the assessor used the responses to the i d questions to select one specific issue to address. care was taken to develop tasks that were practical and feasible for staff to execute without requiring substantial amounts of additional time or resources. impossible requests (e.g., visit with a deceased relative) were not addressed ; however, roommate changes were considered. the draft care plan task was brought to the unit manager and the appropriate department head (i.e., if a task involved activities or dietary staff, the corresponding person was involved) for their review and approval. all three facilities used electronic point - of - care systems for nurse aides. in two of the facilities, a reminder was placed into a voice - activated system that informed the aide to check a project - specific order book placed at the nurses ' station. in the third facility a detailed description of the task was placed onto the touch screen kiosk. thus, in all three facilities, the qol care plan task was placed at the same level of accountability as other orders. we obtained a census of all residents living in each of the three participating facilities in order to screen for study eligibility. we excluded residents who were receiving hospice services and rehabilitation, were not elderly, did not speak english, were under infection quarantine, or lived in a dementia special care unit. letters were sent by the facilities to all residents and, if available, community residing spouses or people with power of attorney informing them of the study and providing instructions on how to opt out. research staff approached residents using a verbal informed consent script that included multiple check points for understanding. residents were asked to repeat back key elements of the informed consent disclosure, and if their responses were not correct then the assessor terminated the interview. we anticipated heterogeneity in the types of care plans that residents in the treatment condition would receive ; therefore residents were randomized to treatment and control conditions using a 60/40 allocation. residents who were randomized to the treatment group had a qol care plan task provided to nursing home staff for implementation after the baseline interview. after the 180-day follow - up interview, qol care plan tasks were written for all residents (treatment and control) and provided to staff. to assess the comparability of the treatment and control groups, we constructed physical function and cognitive function scores based on data drawn from the nursing home minimum data set. physical function was computed as the sum of level of difficulty with 10 activities of daily living (moving from lying position, transfer, walking in room, walking in corridor, moving between room and corridor, moving on and off the unit, dressing, eating, using the toilet, and grooming) (ranged from 0 to 40). cognitive function was computed as the sum of items measuring short - term and long - term memory and ability to make daily decisions (ranged from 0 to 5). we calculated qol scores for each of the 12 qol domains measured in the assessment. the change from baseline to 90 days was calculated and averaged across treatment and control groups. to display the 180-day findings, we calculated the average difference in difference between treatment and control groups. this yields a positive value if the qol in the treatment group is higher than the qol in the control group. a total of 164 residents were approached (86 additional residents were eligible but were not approached because we had reached our recruitment goal). a total of 64 residents were randomized using a 60/40 quota, yielding 39 in the treatment group and 25 in the control group. at the 90-day point, 12 residents from the treatment group were unavailable (3 were discharged, 4 had died, 2 were cognitively unable, 1 refused, 1 was quarantined, and 1 was physically unable to participate) and 6 from the control group were unavailable (2 were discharged, 2 had died, and 2 were cognitively unable). at the 180-day point, 5 residents from the treatment group were unavailable (1 was discharged, 3 were cognitively unable, and 1 was quarantined) and 4 from the control group were unavailable (1 had died, 1 was cognitively unable, and 2 refused). our analysis is focused on those residents who were assessed at baseline and the 90-day assessment (a subset of whom were also assessed at 180 days). at baseline, treatment and control groups were similar in terms of age (82.6 versus 82.4 ; p =.923), gender (n = 6 ; 15% male versus n = 5 ; 22% female ; p =.363), and race (n = 7 ; 18% african american ; n = 3 ; 13% african american ; p =.466). physical function scores were 22 and 24.0 in treatment and control (p =.266). cognitive function scores were 1.5 and 1.6 in treatment and control (p =.843). care plans were categorized based on the domain area of the issue that was being addressed. table 1 lists the types of care plans and provides examples. the most common care plans addressed functional competence, followed by meaningful activities and comfort. although none of the care plans were based on a topic elicited during the autonomy section of the assessment, all are written with an autonomy focus. all of the care plans direct staff to ask residents if, how, or when they would like things done. for example, the qol care plan related to religious practices has an element of functional competence. the qol care plan related to security focuses on relationships with staff because the resident indicated that staff is not responsive to her requests related to personal care that is physically painful. the decision was made to focus on improving her relationship with staff in order to reduce the tension and distrust. we calculated the change in qol domain score for each resident and grouped qol care plan target area. for example, the 5 residents whose care plans were focused on a comfort issue are grouped together. for comparison, we calculated the change in each of the 8 targeted qol domains in the control group. thus, in the comparison group, only those residents whose qol care plan targeted a particular domain are included in the change score, whereas all of the control group members are used for all of the comparison domain scores. the average change in qol across all domains in the treatment group was.25 (sd.40), compared to a slight decline of.02 (sd.39) in the control group. this comparison was statistically significant using a one - sided t - test (p =.014). to examine the 180-day outcomes, we compared the change in the treatment group to the change in the control group on each domain score. this was calculated as the difference in difference ; the resultant score is positive if the treatment group outperforms the control group and negative if the opposite is true. the average of the differences in difference scores at 180 days was.20 (sd =.41). this is statistically significantly different compared to zero using a one - sided t - test (p =.0346). this study demonstrated that an individualized assessment and care planning system, the qol.sri, can produce meaningful and lasting improvements in resident qol. the system was developed to be straightforward to implement and provide a high level of accountability within a traditional nursing home management structure. the intervention group experienced improvements in all qol domains at 90 days with the exception of functional competence. this area is closely linked with physical function and can be expected to decline over time in this population. we note that the decrease in qol scores in this domain was lower in the treatment group than in the control group (the small sample size precludes statistical significance testing of this comparison). at 180 days, the overall difference was slightly smaller and in two domains (individuality and food enjoyment) was actually negative. this is particularly important considering that the qol care plan tasks were not updated or changed between 90 and 180 days. thus, residents in the treatment group were still receiving the benefit of personalized attention to an issue raised approximately six months earlier. previous individual - level intervention research in the nursing home setting has focused on modifying specific factors related to the broad concept of qol, such as autonomy [18, 19 ], psychological well - being, pain, physical function, or physical comfort (positioning). certainly, reducing the use of physical restraints is clearly in service of improving qol and has been shown to reduce injuries [23, 24 ]. other studies have found that personal relationships and quality of communication between residents and staff can be enhanced and that simple interventions can improve the mealtime experience. life reminiscence and programs, such as timeslips which use creative storytelling with demented residents, have been shown to improve general qol and reduce depressive symptoms [31, 32 ]. there have been several noteworthy facility - wide interventions that place priority on resident - centered care and have the potential to improve qol. anecdotal evidence suggests that residents in wellspring facilities experienced improved qol ; however the evaluation did not include a quantitative measure of qol. likewise, the green house model is a comprehensive alternative to the traditional nursing home, involving completely different architecture, staffing, and operations. results of the evaluation show that residents in the green house experience better quality of life than those in traditional nursing homes (an average of.39 points on a 4-point scale). this study builds on previous research on measuring qol that found that 91% of the variation in resident self - reported qol scores can be attributed to differences among individual residents rather than between facilities. even though it is possible to rank order nursing homes based on resident qol scores, the variation in ranks can not be fully explained by organizational factors. taken together, these findings suggest that effective interventions need to be tailored to the individual resident. facility - wide improvements are important, however, and should not be forgone. however, the best improvements are ones that enable staff to identify and act on individual residents ' preferences. this is not a trivial commitment for most facilities, given the constant challenges of staffing and competing demands for limited resources. an important benefit of the system, in addition to improving individual resident qol, is that it generates data about resident qol that can be aggregated to the unit or facility level in order to track performance and support quality improvement efforts. these data can be compared to the experience of other facilities in order to benchmark improvement over time. in this study, we repeated the assessment at 90 and 180 days in order to determine whether qol improvements would persist. we had found that qol changes reverted ; we would be in a position to argue that these issues should be discussed more frequently with residents. however, the results were somewhat mixed on this point. although residents continued to experience better qol on average, anecdotally, several of the more cognitively intact residents indicated at the 180-day interview that they were expecting their care plans to be refreshed and asked why further improvements had not been made. however, staff would be able to return to the answers to the i d component throughout the year and raise new issues at the quarterly care conference. this would likely provide a richer and more systematic source of information about resident preferences than is currently available and, as residents experience decline in their cognitive function, can serve as a historical record of their likes and dislikes. resident qol has been found to be associated with physical function, cognitive function, and various facility factors. longitudinal research found that decline in resident health is associated with decline in qol ; however, the amount of variation explained by these factors is relatively small. the potential exists that residents in the treatment group experienced greater declines in such factors than the control group. although the sample sizes were small, there is no evidence of differential decline over time. the relatively small sample size limits our ability to conduct extensive multivariate or subgroup analyses. the study was constrained by the time required to recruit, randomize, and follow up on residents. the decision to exclude short - stay residents was based on the expectation that many would not be available for the 90-day follow - up. however, that decision eliminated a large number of potential residents from participation and limits the generalizability to the long - stay population. a larger study with more facilities would be able to identify organizational factors associated with fidelity of implementation and outcomes. the assessments were conducted and care plans were written by a member of the study team (nb). this individual had a similar profile to a nursing home social worker in terms of training and experience. after a short period, facility staff accepted her presence and treated her as a colleague. by the same token, residents came to identify her as the qol person. since her role and function were independent from the facility, it is possible that residents felt more comfortable discussing problems with care staff than they might have been with a nursing home employee. the qol.sri provides a system for nursing homes to conduct a tailored and individualized assessment of resident qol that can be used to inform care planning. | the quality of life (qol) of the approximately 1.5 million nursing facility (nf) residents in the us is undoubtedly lower than desired by residents, families, providers, and policy makers. although there have been important advances in defining and measuring qol for this population, there is a need for interventions that are tied to standardized measurement and quality improvement programs. this paper describes the development and testing of a structured, tailored assessment and care planning process for improving the qol of nursing home residents. the quality of life structured resident interview and care plan (qol.sri/cp) builds on a decade of research on measuring qol and is designed to be easily implemented in any us nursing home. the approach was developed through extensive and iterative pilot testing and then tested in a randomized controlled trial in three nursing homes. residents were randomly assigned to receive the assessment alone or both the assessment and an individualized qol care plan task. the results show that residents assigned to the intervention group experienced improved qol at 90- and 180-day follow - up, while qol of residents in the control group was unchanged. |
dialkyl phthalates, such as di-(2-ethylhexyl) phthalate (dehp), diisononyl phthalate (dinp), diisodecyl phthalate (didp) and dibutyl phthalate (dbp), are petrochemicals used as plasticizers or solvents in a variety of industrial products. these chemicals have been thought to be environmental pollutants and detected in soils, sediments, terrestrial and marine waters, and also living organisms. dehp has been isolated from terrestrial and marine organisms including plants, marine algae [25 ], and fungal and bacterial culture broths. however, it is difficult to determine whether dehp was produced by these organisms, the sample was contaminated during the separation process, or dehp accumulated in the organisms, because dehp has been used abundantly in petrochemical phthalate esters. more than 65% of all the phthalate esters used in japan in 2003 were dehps followed by dinps (> 26%), didps (about 3%), and dbps (about 1%), and this relative ratio has changed little in recent years. interestingly, there has been no report of the isolation of dinp and didp from organisms, whereas dbp has been isolated from plants, marine algae, bacteria, and fungi [2, 811 ]. diethyl phthalate (dep), a less common petrochemical product, was obtained as a chemotactic factor from the culture medium of helicobacter pylori and also detected in the broth of streptomyces sp. moreover, di-(2-methylheptyl) phthalate, which is not a petrochemical used in the chemical industry, was isolated from a plant hypericum hyssopifolium (guttiferae). chen reported the incorporation of c into dbp and dehp by culturing the filamentous phase of a red alga, bangia atropurpurea, with c - enriched nahco3. dbp was enriched by about 171 times the background level and dehp, by 5.7 times. recently, teuten. demonstrated that polybrominated diphenyl esters isolated from a true s beaked whale (mesoplodon mirus) were naturally produced compounds and not derived from artificial products by analyzing the natural abundance c content of the isolated compounds and industrial products. therefore, we intended to investigate if dbp and dehp obtained from marine algae are natural products or contaminants of petrochemical products using a similar method. in this report, we suggest that dbp isolated from the ch2cl2-methanol extracts of undaria pinnatifida (harvey) suringar (alariaceae, phaeophyceae), laminaria japonica areschoug (laminariaceae, phaeophyceae) and ulva sp. (ulvaceae, chlorophyceae) was a natural product based on an analysis of the natural abundance c content of the isolates. industrial products of dbp and dehp contain very small amounts of c which can not be detected even by the most sensitive method, accelerator mass spectrometry (ams), because these compounds are made from fossil oils. if these phthalate esters are produced by living organisms, natural abundance c will be detected in the same amounts as modern carbon. the isolation of dbp and dehp was first examined using ulva sp. collected in may 2005 to determine solvents suitable for the extraction process and procedures for concentrating lipophilic compounds. the conditions for hplc and gc were established using authentic samples of dbp and dehp. the extraction and separation of u. pinnatifida were performed according to the procedures used for small amounts of ulva sp. the aqueous residue obtained after the evaporation of organic solvents from the ch2cl2-meoh extract of the alga, was dissolved in meoh and adsorbed on hyflo supercell. the adsorbent was placed in a glass column and lipophilic compounds were eluted with ch2cl2. the lipophilic fraction was adsorbed on hyflo super - cell and applied to a silica gel column with hexane. the silica gel column was eluted successively with hexane and hexane - etoac (gradient). the eluate was monitored by tlc (hexane - etoac = 4:1) and three fractions containing dbp and/or dehp were obtained. the first fraction (fr. dbp (1.24 mg) was separated by hplc (ods) with 80% meoh - h2o from frs. 2 and 3, and dehp since the particles of hyflo super - cell were too small, dispersion and formation of masses occurred during the evaporation of solvents when large amounts of extract or lipophilic fraction were adsorbed. therefore, silica gel was used in lieu of hyflo super - cell for the separation from l. japonica and ulva sp. the other separation procedures for these algae were the same as those for u. pinnatifida. dbp and dehp obtained from three algae were identified and analyzed the purity by h nmr and gc - mass spectra. the h nmr spectra of dbp and dehp from u. pinnatifida were clean and only a very few faint signals due to contaminants were detected. on the other hand, pigments and lipophilic compounds disturbed the separation of dbp and especially dehp from l. japonica and ulva sp. dehp fractions obtained by the first hplc separation from l. japonica and ulva sp. contained a large quantity of contaminants, which were most probably unsaturated fatty acids. the h nmr spectra of the final fraction of dbp and dehp from these two algae still showed the signals due to the contaminants. it is unclear if the difference in the amounts / species of contaminants between u. pinnatifida and the other two algae is due to the nature of these algae or the season when they were collected. l. japonica and ulva sp. were harvested in the winter (cold water), when they usually contain more unsaturated fatty acids. the concentration (w / w%) of dbp and dehp in the final samples, analyzed by gc - ms utilizing the selected ion monitoring (sim) method, was 60% (dbp) and 70% (dehp) from l. japonica and 75% (dbp) and 60% (dehp) from ulva sp. it was not feasible to conduct further purification since the separation of contaminant(s) is difficult and would significantly reduce the amounts of dehp. we thought that the measurement of c with these samples would give decipherable results because petrochemical compounds contain no measurable c and biogenetic products contain modern levels of c. therefore, we submitted dbp and dehp samples obtained from l. japonica and ulva sp. without further separation, together with dbp and dehp from u. pinnatifida. natural abundance c content was analyzed at the tandetron ams c dating laboratory, center for chronological research at nagoya university by the ams method. this unit represents a percentage value of the ratio of sample c concentration to the absolute c concentration, which is defined as corresponding to ad1950. the industrial samples of dbp and dehp did not give measurable c concentration as they are petrochemical products. the dbp samples from three algae contained modern c, which indicated that dbp was synthesized naturally and not of industrial origin. the higher c content in dbp can be ascribed to the enrichment of the c level caused by the testing of nuclear bombs during the 1950s and 1960s. significant amounts of c were detected in the dehp samples from three algae. in the most reliable (highly purified) sample obtained from u. pinnatifida, the contaminant(s) (unsaturated fatty acid(s)) in the former two samples would raise the c concentration. it may be that remarkable amounts of industrial dehp were incorporated into the algae and/or contaminated the sample during the isolation procedures and that some amount of dehp was biosynthesized to give the significant c content. this study revealed that dbp obtained from two edible brown algae, u. pinnatifida and l. japonica, and a green alga, ulva sp., was a natural product since modern c was detected in the isolated dbp samples. dehp may also be produced naturally, but the results of this study were not conclusive. therefore, further studies will be required to confirm whether this compound is biosynthesized by these algae. di-(2-methylheptyl) phthalate isolated from h. hyssopifolium must be a biogenetic product of this plant, because it has not been synthesized. dbp and dep detected in the culture media of microorganisms would also be produced by microorganisms [813 ]. it may be true that they are stored in the cell membrane and affect the flexibility of the cell. h nmr (400 mhz) and c nmr (100 mhz) spectra were measured on a jeol al-400 spectrometer in cdcl3. gc - ms data were obtained with a shimadzu gcms - qp5050a spectrometer using class-5000 software and a tc-70 column (0.25 m x 30 m) : carrier gas, he (0.4 ml / min) ; interface and ion source temperatures, 300 c. for a typical elution, the column temperature was first set at 100 c for 5 min, raised to 300 c at 2 c / min, and kept at 300 c for 20 min. hplc was carried out with a hitachi l-2130 pump and l-2400 uv detector (280 nm) equipped with a d-2500 data processor using a senshu pack pegasil - ods column (10 mm x 250 mm) at a flow rate of 3 ml / min. standard samples (petrochemical products) of dbp and dehp were provided by showa ether co., ltd. and cg ester corporation, respectively. all other solvents and reagents were of the highest grade commercially available and used without further purification. the alga (about 13.5 kg) was cut into pieces and extracted four times with ch2cl2-meoh (2:1, each 10.5 l). the alga (about 9.3 kg) was cut into pieces and extracted four times with ch2cl2-meoh (2:1, each 12 l). was collected at yokohama marine park, yokohama, japan in may and december 2005. the alga collected in december (about 13.5 kg) was cut into pieces and extracted four times with ch2cl2-meoh (2:1, each 12 l). the aqueous residue obtained from the organic extract of u. pinnatifida was dissolved in meoh and the solution was mixed with hyflo super - cell (1 kg). meoh and water were evaporated and the dried adsorbent was placed in a glass column (diameter, 70 mm ; length, 600 mm). the column was eluted with ch2cl2 (4 l) to give a lipophilic fraction (32.5 g). the lipophilic fraction was dissolved in ch2cl2, and the solution was mixed with 100 g of hyflo super - cell. after evaporation of the organic solvent, the dried adsorbent was mixed with hexane and poured on to a silica gel column (700 g) made up with hexane. the column was eluted with 2 l of hexane followed by hexane - etoac = 9:1 (2 l) and 4:1 (2 the eluates were monitored by tlc (hexane - etoac = 4:1) and divided into three fractions (frs. dbp and dehp were detected in two fractions (frs. 2 and 3). fr. 2 (120.2 mg) was separated by hplc (ods) with 80% meoh - h2o to obtain a dbp fraction and then a dehp fraction was recovered with 100% meoh. fr. 3 (12.1 mg) was subjected to a similar hplc separation to give dbp and dehp fractions. two dbp fractions were combined and separated by hplc (80% meoh - h2o) to afford 1.24 mg of dbp. 1, and dehp (2.14 mg) was isolated by hplc separation (100% meoh). the aqueous residue from ulva sp. was dissolved in meoh and the solution was mixed with silica gel (1.22 kg). meoh and water were evaporated and the dried silica gel was placed in a glass column (diameter, 70 mm ; length, 600 mm). the column was eluted with ch2cl2 (3 l) to give a lipophilic fraction (216.8 g). the ch2cl2 solution of the lipophilic fraction was mixed with 250 g of silica gel, and, after evaporation of the organic solvent, the adsorbed silica gel was applied to a silica gel column (800 g) with hexane. the column was eluted successively with 1 l each of hexane and hexane - ch2cl2 = 9:1, 7:3, 1:1, 3:7, and 1:4. the eluates were monitored by tlc (hexane - etoac = 4:1) and divided into five fractions. dbp and dehp were contained into two fractions (frs. 3 and 4). fr. 3 (127.1 mg) was separated by hplc (ods) with 80% meoh - h2o to obtain a dbp fraction and then a dehp fraction was recovered with 100% meoh. fr. 4 (240.7 mg) was subjected to a similar hplc separation to give dbp and dehp fractions. the combined dbp fraction (12.8 mg) was further separated by repeated hplc (80% meoh - h2o) to afford 1.78 mg of dbp. dehp (3.87 mg) was isolated from the dehp fraction (135.7 mg) by repeated hplc separation (100% meoh). dbp (1.93 mg) and dehp (2.47 mg) were isolated from the aqueous residue obtained from the organic extract of l. japonica by similar procedures. dbp and dehp isolated from these algae were identified based on the h nmr and gc - mass spectra with the standard samples of dbp and dehp. were analyzed by gc - ms using the selected ion monitor (sim) method. a calibration table was created by injecting standard solutions containing 10, 5, 2, 1, 0.5, and 0.1 g of the authentic dbp or dehp. the samples in the same solvent were injected and the chromatogram was integrated in terms of concentration. the gc column temperature used for the analysis of dbp was first set at 100 c for 6 min, raised to 300 c at 2 c / min, and held at 300 c for 20 min. the amounts of dbp isolated from l. japonica and ulva sp. were about 60 and 75 (w / w)%, respectively. the column temperature for dehp was set at 100 c for 6 min and raised to 300 c at 4 c / min, and dehp was eluted at around 38 min. natural abundance c content was measured by the following three steps at the tandetron ams c dating laboratory, center for chronological research, nagoya university utilizing a model 4130- ams system : (1) each organic compound was first burned into co2, (2) the co2 was reduced to graphite, and (3) the graphite was analyzed by accelerator mass spectrometry (ams) (kitagawa, 1993 ; nakamura., 2004). the results (table 1) were expressed as percent modern carbon (pmc), a percentage value of the ratio of sample c concentrations to the absolute c concentration defined as corresponding to ad 1950. h nmr (400 mhz) and c nmr (100 mhz) spectra were measured on a jeol al-400 spectrometer in cdcl3. gc - ms data were obtained with a shimadzu gcms - qp5050a spectrometer using class-5000 software and a tc-70 column (0.25 m x 30 m) : carrier gas, he (0.4 ml / min) ; interface and ion source temperatures, 300 c. for a typical elution, the column temperature was first set at 100 c for 5 min, raised to 300 c at 2 c / min, and kept at 300 c for 20 min. hplc was carried out with a hitachi l-2130 pump and l-2400 uv detector (280 nm) equipped with a d-2500 data processor using a senshu pack pegasil - ods column (10 mm x 250 mm) at a flow rate of 3 ml / min. standard samples (petrochemical products) of dbp and dehp were provided by showa ether co., ltd. and cg ester corporation, respectively. all other solvents and reagents were of the highest grade commercially available and used without further purification. the alga (about 13.5 kg) was cut into pieces and extracted four times with ch2cl2-meoh (2:1, each 10.5 l). the alga (about 9.3 kg) was cut into pieces and extracted four times with ch2cl2-meoh (2:1, each 12 l). was collected at yokohama marine park, yokohama, japan in may and december 2005. the alga collected in december (about 13.5 kg) was cut into pieces and extracted four times with ch2cl2-meoh (2:1, each 12 l). the aqueous residue obtained from the organic extract of u. pinnatifida was dissolved in meoh and the solution was mixed with hyflo super - cell (1 kg). meoh and water were evaporated and the dried adsorbent was placed in a glass column (diameter, 70 mm ; length, 600 mm). the column was eluted with ch2cl2 (4 l) to give a lipophilic fraction (32.5 g). the lipophilic fraction was dissolved in ch2cl2, and the solution was mixed with 100 g of hyflo super - cell. after evaporation of the organic solvent, the dried adsorbent was mixed with hexane and poured on to a silica gel column (700 g) made up with hexane. the column was eluted with 2 l of hexane followed by hexane - etoac = 9:1 (2 l) and 4:1 (2 the eluates were monitored by tlc (hexane - etoac = 4:1) and divided into three fractions (frs. dbp and dehp were detected in two fractions (frs. 2 and 3). fr. 2 (120.2 mg) was separated by hplc (ods) with 80% meoh - h2o to obtain a dbp fraction and then a dehp fraction was recovered with 100% meoh. fr. 3 (12.1 mg) was subjected to a similar hplc separation to give dbp and dehp fractions. two dbp fractions were combined and separated by hplc (80% meoh - h2o) to afford 1.24 mg of dbp. 1, and dehp (2.14 mg) was isolated by hplc separation (100% meoh). the aqueous residue from ulva sp. was dissolved in meoh and the solution was mixed with silica gel (1.22 kg). meoh and water were evaporated and the dried silica gel was placed in a glass column (diameter, 70 mm ; length, 600 mm). the column was eluted with ch2cl2 (3 l) to give a lipophilic fraction (216.8 g). the ch2cl2 solution of the lipophilic fraction was mixed with 250 g of silica gel, and, after evaporation of the organic solvent, the adsorbed silica gel was applied to a silica gel column (800 g) with hexane. the column was eluted successively with 1 l each of hexane and hexane - ch2cl2 = 9:1, 7:3, 1:1, 3:7, and 1:4. the eluates were monitored by tlc (hexane - etoac = 4:1) and divided into five fractions. dbp and dehp were contained into two fractions (frs. 3 and 4). fr. 3 (127.1 mg) was separated by hplc (ods) with 80% meoh - h2o to obtain a dbp fraction and then a dehp fraction was recovered with 100% meoh. fr. 4 (240.7 mg) was subjected to a similar hplc separation to give dbp and dehp fractions. the combined dbp fraction (12.8 mg) was further separated by repeated hplc (80% meoh - h2o) to afford 1.78 mg of dbp. dehp (3.87 mg) was isolated from the dehp fraction (135.7 mg) by repeated hplc separation (100% meoh). dbp (1.93 mg) and dehp (2.47 mg) were isolated from the aqueous residue obtained from the organic extract of l. japonica by similar procedures. dbp and dehp isolated from these algae were identified based on the h nmr and gc - mass spectra with the standard samples of dbp and dehp. dbp and dehp isolated from l. japonica and ulva sp. were analyzed by gc - ms using the selected ion monitor (sim) method. a calibration table was created by injecting standard solutions containing 10, 5, 2, 1, 0.5, and 0.1 g of the authentic dbp or dehp. the samples in the same solvent were injected and the chromatogram was integrated in terms of concentration. the gc column temperature used for the analysis of dbp was first set at 100 c for 6 min, raised to 300 c at 2 c / min, and held at 300 c for 20 min. the amounts of dbp isolated from l. japonica and ulva sp. were about 60 and 75 (w / w)%, respectively. the column temperature for dehp was set at 100 c for 6 min and raised to 300 c at 4 c / min, and dehp was eluted at around 38 min. the amounts of dehp isolated from l. japonica and ulva sp. were about 70 and 60 (w / w)%, respectively. natural abundance c content was measured by the following three steps at the tandetron ams c dating laboratory, center for chronological research, nagoya university utilizing a model 4130- ams system : (1) each organic compound was first burned into co2, (2) the co2 was reduced to graphite, and (3) the graphite was analyzed by accelerator mass spectrometry (ams) (kitagawa, 1993 ; nakamura., 2004). the results (table 1) were expressed as percent modern carbon (pmc), a percentage value of the ratio of sample c concentrations to the absolute c concentration defined as corresponding to ad 1950. | analysis of the natural abundance 14c content of dibutyl phthalate (dbp) from two edible brown algae, undaria pinnatifida and laminaria japonica, and a green alga, ulva sp., revealed that the dbp was naturally produced. the natural abundance 14c content of di-(2-ethylhexyl) phthalate (dehp) obtained from the same algae was about 5080% of the standard sample and the 14c content of the petrochemical (industrial) products of dbp and dehp were below the detection limit. |
palmar hyperhidrosis is a somatic disorder characterized by excessive sudoresis that is limited to the hands. it is caused by hyperfunctioning of the sympathetic nervous system and is frequently related to a triggering emotional situation.1,2 this hyperfunction goes beyond what is needed for thermoregulation.3,4 it may cause serious problems of psychosocial nature2,3 and also professional difficulties, as these individuals may develop conditions of social phobia.5 the only effective and definitive treatment for essential hyperhidrosis is sympathectomy. the excellent functional results with this treatment mean that it is currently considered the best therapeutic approach.1,2,3,4,6 as the operation has become technically simpler, the number of patients undergoing sympathectomy has been increasing. consequently, compensatory hyperhidrosis is seen more frequently.7,8 of all the complications associated with sympathectomy, this compensatory hyperhidrosis is the most common and, when severe, may cause dissatisfaction regarding the operation. the relationship between the severity of compensatory hyperhidrosis and the denervation level is still unclear and has not been investigated by prospective randomized studies.9,10,11 the aim of the present prospective randomized study was to compare the results from sympathectomy performed at the t2 and t3 denervation levels with 20 months of follow - up, by analyzing the resolution of palmar hyperhidrosis, incidence and severity of compensatory hyperhidrosis and its evolution over time, and patients quality of life. this prospective, randomized and controlled study was conducted in accordance with the norms of the ethics committee for analysis of research projects involving human experimentation, and all subjects gave their informed consent. from may 2003 to june 2006, patients with prior thoracic surgery, cardiac diseases, pulmonary infections, neoplasia or pleural or lung diseases that could increase surgical risk, or with a body mass index (bmi) greater than 25 were not included in this study. most of these (18 cases) had used local dermatological therapies (creams and lotions). half of the 60 patients were randomly assigned to undergo thoracic sympathectomy by means of videothoracoscopy at the denervation level of the t2 ganglion and the other half at the t3 level. there was no statistically significant difference in relation to the variables of sex and age. the patients underwent the operations under general anesthesia in a semi - seated position (45). two mini - incisions of approximately 5.5 mm each were made : the first into the fourth or fifth intercostal space on the anterior axillary line (in the submammary sulcus for the women), through which a video camera was introduced, and the second into the second intercostal space on the mid - axillary line, through which an electric or harmonic bistoury was introduced. the level of ganglion resection was randomly assigned ; half of the patients were resected at the t2 level and the other half at the t3 level. after identification of the sympathetic chain in the patients drawn for the t2 group, it was sectioned (sympathicotomy) on the body of the second and third ribs, followed by thermoablation of the segment isolated between the ribs. the patients drawn for the t3 group underwent sectioning of the sympathetic chain (sympathicotomy) on the body of the third and fourth ribs, followed by thermoablation of the segment isolated between the ribs. the patients underwent clinical assessment on five occasions : before the operation for their inclusion in the study, one week, one month, six months and at least twelve months after the operation. the last assessment was occurred between 12 and 34 months after the operation, with a mean of 20 months. all the questionnaires were answered without any medical interference. during the postoperative follow - up, the following parameters were evaluated : presence or absence of palmar anhydrosis via the patient s report and confirmation from physical examination ; presence or absence of compensatory hyperhidrosis, with evaluation of location and severity when present via the patient s report and confirmation from physical examination. the severity of the compensatory hyperhidrosis reported spontaneously by the patients was graded as severe or non - severe. severe compensatory hyperhidrosis was considered to consist of visible and embarrassing compensatory sudoresis that necessitated more than one change of clothing during the day. the patients degree of satisfaction was measured by means of the quality - of - life protocol described by amir.12. in this protocol, quality of life was initially classified into five different satisfaction levels, and obtained as the summed total score from the protocol (range from 20 to 100). when the total was greater than 84, the quality of life was considered very poor ; from 69 to 84, poor ; from 52 to 68, good ; from 36 to 51, very good ; and from 20 to 35, excellent. the post - operative evaluation (one month, six months and 20 months) was classified into five different satisfaction levels, and obtained as the summed total score from the questionnaire. when the total was greater than 84, the quality of life was considered much worse ; from 69 to 84, a little worse ; from 52 to 68, the same ; from 36 to 51, a little better ; and from 20 to 35, much better.12,13 statistical analysis : the chi - square or fisher exact test was used to investigate the association between the type of surgery and the possible results and complications by means of 2x2 contingency tables. the statistical tests comparing the types of surgery with the variables of interest (palmar anhydrosis, incidence and severity of compensatory hyperhidrosis and quality of life) were performed for each of the assessment times. one patient presented transitory right - side horner s syndrome, probably due to heat transmission while releasing adherent tissue at the apex of the lung. a follow - up visit one month after the operation showed that this condition presented complete regression. only one patient was not discharged from the hospital on the day following the operation (due to thoracic drainage). there were two patients in the t2 group and one in the t3 group who were lost from follow - up. we observed that all 30 patients who underwent sympathectomy at the t2 level and 29 of the 30 patients in the t3 group presented palmar anhydrosis at the return visits (one month, six months and 20 months). one patient in the t3 group did not present any improvement in palmar hyperhidrosis, even at the return visit one month after the operation. with a diagnostic hypothesis of technical failure, this patient underwent a new operation using thermoablation at the same level (t3) but without improvement of the palmar hyperhidrosis. currently, this patient is receiving clinical treatment with anticholinergics and has achieved a small clinical improvement in the hyperhidrosis. all 28 patients in the t2 group and 28 patients in the t3 group who were still undergoing follow - up 20 months after the operation (three cases lost from follow - up) continued to present palmar anhydrosis. the incidence of compensatory hyperhidrosis observed during the patients evolution is shown in table 2. one month after the operation, compensatory hyperhidrosis was observed in 26 patients in the t2 group (86.66%) and in 27 in the t3 group (90%). six months after the operation, all patients in the t2 group had some degree of compensatory hyperhidrosis and only one patient in the t3 group did not present it (96.6%). twenty months after the operation, all patients in both groups presented some degree of compensatory hyperhidrosis. the patients in the t3 group presented a lower degree of compensatory hyperhidrosis in the assessments one month (p 80%). corroborating the data from that study, miller.11 retrospectively analyzed 50 cases that underwent sympathicotomy at the t2 rib. it was found that 99% of the cases presented therapeutic success and that compensatory hyperhidrosis only occurred in six patients (12%), of which four experienced sudoresis at rest and two after exercise. the data obtained from our study differ from the above data, since there was high and similar incidence of compensatory hyperhidrosis in the t2 and t3 groups (100%). our data corroborate studies that correlate the severity of compensatory hyperhidrosis with higher resection levels ; there was greater incidence of severe compensatory hyperhidrosis (46.4%) in the t2 group as compared to 13.8% in the t3 group at the end of the follow - up (p = 0.007). several studies have reported an improvement in quality of life following sympathectomy, despite the painful postoperative period and the presence of compensatory hyperhidrosis in most cases.34,35 in both groups in our study, the preoperative quality of life was very poor, without any difference between the groups (median of 92 in the t2 group and 87.5 in t3). after the operation, we observed a notable improvement in quality of life (from 92 to 26 in the t2 group and from 87.5 to 29 in t3). despite the difference in severity of compensatory hyperhidrosis between the groups, there was no difference in clinical satisfaction subsequent to the procedure, as seen through the notable improvements in quality of life in both groups one month and six months after the operation (median of 23 after one month and 24 after six months, in both groups), and 20 months after the operation (median of 26 in the t2 group and 29 in t3). the best way of dealing with compensatory hyperhidrosis would be to not cause it.11 indications for hyperhidrosis treatment need to be made carefully and patients need to be advised regarding the results of the operation and its complications, and the fact that no perfect surgical technique is currently available.17 adequate and detailed information for patients will lead to increased satisfaction after the operation ; this is an essential part of the treatment.13 sympathectomy at the t2 and t3 levels provided adequate long - term treatment for palmar hyperhidrosis. the most frequent complication was compensatory hyperhidrosis, which presented chronologically stable incidence and severity over the course of the study. despite the greater severity of compensatory hyperhidrosis in the t2 group, the two groups presented similar improvements in quality of life, probably related to achieving palmar anhydrosis. because of the lower severity of compensatory hyperhidrosis, we prefer the t3 level for treating palmar hyperhidrosis. | objectiveto compare two surgical techniques (denervation levels) for sympathectomy using video - assisted thoracoscopy to treat palmar hyperhidrosis in the long-term.methodsfrom may 2003 to june 2006, 60 patients with palmar hyperhidrosis were prospectively randomized for video - assisted thoracoscopic sympathectomy at the t2 or t3 ganglion level. they were followed for a mean of 20 months and were evaluated regarding their degree of improvement of palmar hyperhidrosis, incidence and severity of compensatory hyperhidrosis and its evolution over time, and quality of life.resultsfifty-nine cases presented resolution of the palmar hyperhidrosis. one case of therapeutic failure occurred in the t3 group. most of the patients presented an improvement in palmar hyperhidrosis, without any difference between the groups. twenty months later, all patients in both groups presented some degree of compensatory hyperhidrosis but with less severity in the t3 group (p = 0.007). compensatory hyperhidrosis developed in most patients during the first month after the operation, with incidence and severity that remained stable over time. an improvement in quality of life was seen starting from the first postoperative evaluation but without any difference between the groups. this improvement was maintained until the end of the follow-up.conclusionboth techniques were effective for treating palmar hyperhidrosis. the most frequent complication was compensatory hyperhidrosis, which presented stable incidence and severity over the study period. sympathectomy at the t3 level presented compensatory hyperhidrosis with less severity. nevertheless, the improvement in quality of life was similar between the groups. |
a 15-year - old boy diagnosed as intracranial germ cell tumor underwent surgery, followed by cranial radiotherapy (45 gy) and later treated with bleomycin, etoposide and cisplatin(bep) regimen. after third cycle of chemotherapy, he developed asymptomatic erythematous rashes over the back, chest and thighs, which later subsided with persistence of hyperpigmentation [figure 1 ]. hyperpigmentation of flagellate erythematous rash over the back and thigh bleomycin is a chemotherapeutic antibiotic associated with various skin related toxicities such as raynaud 's phenomenon, flagellate erythema, and sclerodermoid reaction. in the acute stage they are erythematous rashes later may persist as hyperpigmentation marks. other conditions which may be associated with flagellate erythema are docetaxel, adult still 's disease, dermatomyositis and ingestion of shiitake mushrooms. during the acute phase, topical with or without oral steroids | bleomycin is a chemotherapeutic antibiotic used in various malignancies. its toxicity is mainly lung and skin with marrow sparing effect. here we would like to describe a characteristic skin reaction developed because of bleomycin in a case of intracranial germ cell tumor. flagellate erythema which is a self - limiting toxic reaction can cause residual hyperpigmentation. |
microbial keratitis is a serious condition that could result in corneal scar, corneal perforation, and even blindness. microbial keratitis usually occurs in the presence of predisposing factors, such as ocular trauma, ocular surface diseases, and contact lens wear. the demographics and microbiological profile of microbial keratitis vary across countries and different studies have been published across the world. major studies have been conducted in hyderabad, india, miami, usa, and oxford, uk. shifting trends in the microbiological profile of keratitis have been reported in studies in some parts of the world [5, 6 ]. therefore, it is important to carry out studies periodically to review local organisms and sensitivities. for instance, increasing resistance to fluoroquinolones has been reported in a study in florida and a recent study in toronto found a decreasing trend in the percentage of gram - positive bacteria in the past 11 years. the last hong kong - based study on incidence and risk factors for microbial keratitis the purpose of the current study is to examine the demographics, risk factors, microbiological results, and treatment given for adult microbial keratitis patients requiring admission to a university hospital in hong kong from january 2010 to june 2012. this is a retrospective review conducted for a single centre to isolate cases with presumed infective microbial keratitis. patients were identified using the electronic record system and patients who were admitted between january 2010 and june 2012 with a discharge diagnosis matching either corneal ulcer (icd-9 code : 370.00) or corneal disorder due to contact lens (icd-9 code : 371.82) were identified. microbial keratitis was defined by the presence of a corneal infiltrate > 1 mm in size with or without overlying epithelial defect. specimens were placed on glass plates for gram stain and also on blood agar, chocolate agar, sabouraud agar, and thioglycollate broth. in cases that were nonresponsive to treatment and clinically suspicious of acanthamoeba, culture the sex, age, risk factors, corneal scraping culture results and sensitivity profiles, and antibiotics prescribed were recorded and analyzed. among the 51 patients, 29 (57%) were male and 22 (43%) were female. the mean age was 41.6 20.3 years (range 20 to 86 years). regarding the risk factors, 23 patients (45%) were contact lens wearers, 6 (12%) had corneal foreign body, 5 (10%) had recurrent corneal erosion, and 4 (8%) had corneal graft (table 1). the cases with corneal erosions and bullous keratopathy were not related to contact lens use. among the 23 contact lens wearers, 7 (30%) used monthly disposable contact lens, 10 (43%) used 2-week disposable lens, one (4%) used daily disposable lens, and two (7%) used colored contact lens. three patients practiced overnight wear, one patient reused a daily disposable contact lens, and one patient cleansed the contact lens every 2 - 3 days. the mean age for contact lens wearers was 27.7 6.7 years, which was significantly lower than the mean age of non - contact lens wearers (p < 0.05). gram - positive organisms were cultured in 17 eyes and gram - negative organisms were cultured in 11 eyes. the other pathogens were coagulase - negative staphylococcus (4 patients, 13%) and staphylococcus aureus (2 patients, 7%). out of the pseudomonas ulcers with sensitivity profile done, all were sensitive to gentamicin and ciprofloxacin. one sample showed intermediate sensitivity to ticarcillin and clavulanate but no antibiotic resistance was identified. out of the 23 contact lens related ulcers, pseudomonas aeruginosa was the pathogen in 13 cases (57%). only one patient was given monotherapy upon admission, while the rest were given combined therapy. thirty - three patients were prescribed ceftazidime + tobramycin, 11 patients were prescribed vancomycin + tobramycin, and two patients were prescribed vancomycin + ceftazidime, while three patients had acyclovir ointment in addition to fortified antibiotics. two culture negative patients were given natamycin and amphotericin, respectively, as fungal keratitis was suspected. visual acuities of hand motion and counting finger were assigned a decimal visual acuity of 0.005 and 0.014 according to the freiburg visual acuity test. visual acuity of light perception or no light perception could not be quantified and was excluded from the calculation of the average visual acuity. at one month and three months after presentation, the average logmar visual acuity improved to 0.34 and 0.26, respectively. due to patients defaulting follow - up or being discharged from clinic, visual acuities of only 37 and 19 patients were documented at one month and three months, respectively. among the 19 patients, in our study, contact lens wear was the most important risk factor, accounting for 45% of all cases with microbial keratitis. for example, contact lens wear accounted for 34% and 50% of microbial keratitis in studies in australia and france, respectively. in contrast, trauma was the major risk factor for microbial keratitis in developing countries. trauma accounted for 48%, 53%, and 83% of the microbial keratitis cases in paraguay, south india, and eastern india, respectively. patients often had injury during farming and higher rates of injury were reported during the harvesting season. in our study, 3 (13%) out of the 23 contact lens wearers with microbial keratitis reported overnight wearing of lenses. in a study by lam. in 2002, overnight wear was identified as a significant risk factor for microbial keratitis (p < 0.0001). in a study conducted by yildiz. in contrast to our previous studies, none of the patients used orthokeratology lens for the current review period [15, 16 ]. this may be a result of the enhanced public awareness and education on the risks following our previous media reports and publications. however, in a recent hong kong series of pediatric ocular surface infections, 9 (7%) out of 138 patients used orthokeratology lens. in our study, 59% of corneal scrapings yielded positive cultures. this rate may be related to the fact that patients were often given topical antibiotics by general practitioners or at the accident and emergency department prior to presentation in our clinic. studies in germany, australia, texas, and oxford yielded culture positive rates of 43%, 49%, 53%, and 54%, respectively. pseudomonas aeruginosa was the most common pathogen, similar to a study conducted in hong kong 11 years ago. urban population. according to two studies in taipei [20, 21 ], two studies in singapore [22, 23 ], and one study in bangkok, pseudomonas aeruginosa was the most prevalent pathogen, accounting for 29%42% of microbial keratitis cases. this was different from studies conducted in australasia, north america, canada, and europe, where staphylococci were the most common bacteria. in particular, for three studies conducted in france, switzerland, and turkey, the prevalence of staphylococciwas as high as 52 to 60%. there was no documented case of fungal infection in our series. this was very different from studies conducted in more rural areas, where more people practiced agriculture and therefore fungal infection was much more prevalent. in eastern india, fungal infections accounted for 67% of microbial keratitis cases. aspergillus accounted for 60% of fungal cultures in eastern india and fusarium accounted for 73% of fungal cultures in a study in hyderabad, india. the absence of fungal keratitis in our series might be attributed to the fact that majority of the patients came from an urban background and did not have a history of trauma with vegetative material as is classically seen in cases with fungal keratitis. furthermore, acanthamoeba keratitis is not very commonly seen in our setting nowadays possibly due to an enhanced level of knowledge regarding contact lens care amongst the general population in hong kong. also, majority of acanthamoeba keratitis cases are being treated on an outpatient basis in our setting. resistance to erythromycin, clindamycin, cloxacillin, and cotrimoxazole was reported in four samples. these antibiotics are seldom used in the treatment of microbial keratitis in our centre. no resistance to fluoroquinolones was demonstrated in our study, in contrast to reports from the united states and india [28, 29 ], which showed persistent resistance to fluoroquinolones. there are several limitations of the present study. as this is a retrospective study, clinical data such as the exact percentage of patients who received antibiotic treatment before presentation were not available. some of the suspected cases of microbial keratitis might have been sterile contact lens related inflammatory infiltrates. in addition, the sizes of infiltrate were not documented in all cases and thus it was not possible for a more detailed analysis. moreover, patients with less severe microbial keratitis managed in the outpatient eye clinic were not included in this study, thus limiting the sample size of our study. in summary, our study showed that contact lens wear remained the major risk factor for microbial keratitis in hong kong and pseudomonas aeruginosa is the commonest bacterium isolated. this is comparable to a study conducted in hong kong 11 years ago and other studies conducted in east asia. | purpose. to evaluate the recent trends in demographics, risk factors, and microbiological profiles of microbial keratitis at a university hospital in hong kong. design. retrospective review. methods. the medical records of 51 patients admitted to the prince of wales hospital for microbial keratitis from january 2010 to june 2012 were reviewed. demographics, risk factors, clinical features, microbiological results, and treatment were recorded. data was analyzed and compared to our historical sampled data collected 11 years ago. results. the mean age of patients was 41.6 20.3 years. contact lens use was the major risk factor (45%), followed by injury (12%). the culture positive rate was 59%, of which 37% were gram - positive organisms and 53% were gram - negative organisms. pseudomonas aeruginosa (50%) and coagulase - negative staphylococcus (13%) were the most commonly isolated pathogens. no resistance to fluoroquinolones was identified. conclusions. our study showed that contact lens wear remained the major risk factor for microbial keratitis in hong kong and pseudomonas aeruginosa remained the commonest bacterium isolated. this is comparable to our historical data and other studies conducted in east asia. |
road traffic injuries (rtis) are responsible for approximately 1.2 million deaths worldwide and 50 million injuries each year. rti rates are particularly high in the developing world due to poorly maintained road networks and motor vehicles. these rates are projected to rise as developing countries become increasingly motorized.timely provision of emergency medical care can significantly reduce morbidity and mortality and also plays a significant role in post - injury outcome. rapid urban growth in developing countries has outpaced the development of health infrastructure, including trauma centers, leading to potential delays in trauma care. one possible solution is to identify and designate other emergency care facilities (ecf) as lower level trauma facilities to receive trauma patients with less severe injuries. many such facilities are not prepared to take care of trauma because of lack of equipment or government incentives. an absence of emergency medical transport may become a barrier to care in developing countries. in guinea - bissau, 20 of 125 acutely ill children died either on their way to hospital or while waiting in the reception area of an outpatient clinic. in malaysia, a team assessing the value of the risk coding system in pregnancy concluded that better communications, a more effective transport system, and better emergency care in hospitals were needed in order to reduce maternal mortality. it has three government - designated trauma centers (tc) and numerous 24-h ecf. ambulance services are available in the city the largest one being provided by edhi. we set out to determine the time taken to reach a government - designated tc from the areas with the highest numbers of rtis compared to an alternative 24-h ecf. we also sought to determine whether the ecfs had the supplies and equipment required for basic trauma care. there are only three major government - designated tcs for the 16 million residents of karachi, which will be the sixth most populous city in the world by 2015. karachi is divided into 18 administrative units called towns. we identified five towns as the ones from where 50% of the total rtis four points were selected from the northern, southern, eastern, and western extremes of each town. the fifth town, being larger than the others, was first divided into two halves after which the four compass points were selected. a private car with a professional driver was used between 1300 and 1700 hours to travel from the selected point to the nearest tc used by the people of that town. the reason for using a private car was that taxi cabs and private cars are the most commonly used modes of transport by emergency victims in our setting. two stopwatches were used to measure the time one for time taken to travel to the nearest ecf and the second one for the time taken to reach the government - designated tc. the second part of the study involved determining the availability of basic trauma care at the ecfs where a given patient could have been taken on his way to tcs. we administered the questionnaire to the most senior doctor in charge of the emergency department at the ecf. this questionnaire asked about the availability of basic items required for management of circulation and shock, airway insufficiency, and spinal injury, for diagnosis and monitoring, safety for health care personnel, pain control, and medicines. each item in the questionnaire was rated according to the following scoring system : 0 if absent or present only sometimes and 1 if present at all times. the area included in our study was 121.7 km and had a population of 3,109,192 representing 3% of karachi s land area, 20% of karachi s population, five towns, and all three major government - designated tcs. for all 24 we have readings to the tc, and for 16 we have readings to the nearest ecf. for the remaining 8 points, the tc was the nearest health care facility ; therefore, we do not have ecf readings for those points. the time taken to reach the tc from the selected points ranged from a minimum of 4 min to a maximum of 31 min. the distance from a landmark to the nearest major tc ranged from 1 km to 10.6 km. the average time taken to reach the nearest ecf was 4.7 min (see table 1 and fig. 1). the difference in times was significant with a p value of < 0.005 (95% confidence interval : 4.8612.3 min). table 1times to tcs and ecfsvariablemean (sd)quartiles255075time taken to reach tc, min (n = 24)13.3 (2.5)81119time taken to reach ecf, min (n = 16)4.3 (2.4)347tcs trauma centers, ecfs emergency care facilitiesfig. 1map : time to way stations and major trauma centers from select accident hot spots in karachi, pakistan, 2006 times to tcs and ecfs tcs trauma centers, ecfs emergency care facilities map : time to way stations and major trauma centers from select accident hot spots in karachi, pakistan, 2006 the staff at 13 ecfs were interviewed. most (almost 90%) had the basic equipment for management of airway, oxygen supply, and iv fluids. of 13, 9 (70%) had pain medications such as morphine and only 6 (45%) possessed a cervical spine collar (see table 2). table 2availability of supplies at ecfsequipment% of small ecfs having the item (n = 13)oral or nasal airway100laryngoscope92endotracheal tube92bag - valve - mask92oxygen supply (cylinder, concentrator, or other source)100crystalloid92colloids92intravenous infusion set (lines and cannulas)92external pressure for bleeding92basic immobilization (sling, splint)100spine board46immobilization : c - collar, backboard46tetanus prophylaxis (toxoid, antiserum)92oxygen100morphine (or equivalent)69normal saline solution (0.9% isotonic)85urinary catheter with collection bag92plain films92gloves92gowns80sharps disposal69 availability of supplies at ecfs the city has only three tcs and travel times are over 30 min within a maximum distance of 10 km from the tc. for distant areas in the city (i.e., the remaining 97% of the area covered), travel times to these tcs will be much higher. the city has a poor road infrastructure and public transport vehicles are prone to frequent accidents. the ambulances are staffed by drivers with no training in emergency trauma care or basic life support. the ambulances are typically equipped with a radio and a stretcher and in some cases with an oxygen tank, a suction machine, and a however, they have no communication with the hospital and do not follow any treatment protocols. the dispatch center then instructs the ambulance service nearest to the site to send an ambulance. the ambulance then picks up the patient and transports him or her to the nearest tc. our results, surprisingly, show travel times that are much lower than we expected at the outset of our study. the reason could be the variability in traffic at different times of the day. it is very likely that the travel time will be different at other times of the day and on weekends. the level of medical facilities is an important factor affecting the number of people killed in road traffic accidents, which cost pakistan about 260 million per annum. until recently, trauma patients were exclusively taken to government - designated tcs with a medicolegal department. this means that there are more hospitals available to cater to the needs of trauma patients and are on an average 4.5 min away from any given location. however, essential items such as cervical spine collar, spine board, and pain medications such as morphine are not universally available at the ecfs. this becomes an important issue where more than 70% of the population earns less than $ 2 per day. the true usefulness of ecfs will become apparent only after they become better equipped and receive incentives to provide trauma care. we are therefore unable to comment on seasonal, monthly, off - peak, and peak hour variability. we relied on the response of the doctors in the ecfs regarding the presence of supplies at all times and did not check and confirm the inventory of the ecfs at that time. further studies need to be done to determine the differences in patient outcome depending on whether they use an ecf or tc and to establish guidelines for the appropriate referral, transfer, and management plans for different patients. the present system in our city only has level 4 ttcs that are the three tcs. in order to establish an organized trauma system, hospitals other than designated major tcs need to be upgraded to receive and treat less acutely ill patients. our study shows that ecfs are located at sites that can be reached within convenient times from accident hot spots and may be able to serve as such if equipped adequately. | backgroundrapid urban growth in developing countries has outpaced the development of health infrastructure, including trauma centers, leading to potential delays in trauma care. this study was conducted in karachi, a city of 16 million people in pakistan.aimsour aim was to determine the time taken to reach the nearest 24-h emergency care facility (ecf) and the government - designated trauma center (tc). we also sought to determine the availability of supplies and equipment required for basic trauma care at these centers.methodswe selected five towns in karachi that had the highest number of road traffic injuries (rtis) (as identified through medicolegal records). we then measured the time taken to reach the nearest ecf and the government - designated tc from four compass points within each town. we also asked about the equipment and supplies used in basic trauma care.resultsall three tcs in karachi were located in the selected towns and were within 5.010.5 km of each other. the transport times to the 3 tcs were an average of 13.3 min (7.1) and to the 16 ecfs an average of 4.7 min (2.4) (p value < 0.00). most ecfs did not have all equipment and supplies necessary for basic trauma care ; 90% had the basic equipment for management of airway, oxygen, and iv fluids, 70% had morphine, and 45% had c - spine collars.conclusionsvital time is lost in reaching a government - designated tc. ecfs might be an alternative option, but are not fully equipped and funded to provide adequate trauma care to all. |
colorectal cancer (crc) is one of the most commonly diagnosed and lethal cancers worldwide. in many years, crc accomplishment has been explained as a multistep process that requires the accumulation of genetic / epigenetic aberrations in signal transduction pathways. a growing body of evidence is increasingly supporting the idea that human cancers can be considered as a stem cell (sc) disorder. the existence of cancer scs (cscs) was established in hematologic malignancies and recently in several human solid tumors including crc. according to the csc concept, crc originates from a small fraction of cancer cells that show self - renewal and pluripotency and is capable of initiating and sustaining tumor growth. recent studies demonstrate that cd133, a cell surface antigen, has been widely used as a marker for identification and isolation of colorectal cscs from malignant colorectal tissues. these studies suggest that crc clone is organized as a hierarchy that originates from rare scs with cd133 phenotype. these cells described to be responsible for tumor initiation, progression, maintenance, metastasis, and the relapse of the crc. furthermore, since the most of the current cellular data of colorectal cscs such as cell size, complexity of intracellular structure, sphere formation ability, and aldehyde dehydrogenases (aldh) enzyme activity have been restricted to cell line studies as well as little is known about these features in cscs separated from colorectal tumor tissues, therefore, a better realizing of cellular properties of cscs isolated from patient specimen is aiding in understanding of the behavior of colorectal cscs, as the root of cancer, and devising innovative and novel therapeutic strategies. the present study aimed to investigate and compare cellular characteristics of both cd133 and cd133 cell subsets isolated from both human primary and liver metastatic colorectal cancers. human tumor tissues were obtained from twenty consenting patients (age range : 4579 years) undergoing colorectal resection [table 1 ] according to the internal review and the ethics boards of the isfahan university of medical sciences, isfahan, iran. the patients cancer status in both primary tumor site and liver was carefully evaluated for the location and extent of the cancer by a surgeon during surgery. once the disease was localized to a surgically resectable area of the liver, patients were treated by wedge excision, segmentectomy, lobectomy, or extended lobectomy (trisegmentectomy) depending on the extent of disease. twenty colorectal cancer specimens from the histologic diagnostic assessment and sampled by pathologists were collected in serum free - dulbecco 's modified eagle 's medium (dmem) containing 25 units / ml of penicillin and 25 g / ml of streptomycin (at 4c) and transferred to the laboratory within 30 min of surgery and immediately mechanically and enzymatically disaggregated. patient description and tumor characteristics in the laboratory, cancer tissues were extensively washed in phosphate - buffered saline (pbs) containing antibiotics penicillin (500 iu / ml), streptomycin (500 g / ml), and amphotericin b (1.25 g / ml). to prepare single - cell suspension, tumor tissues were minced into tiny fragments (~2 mm), followed by enzymatic digestion with 1.5 mg / ml collagenase, 20 g / ml hyaluronidase for 1 h at under continuous shaking at 37c. cells were then filtered sequentially through 70 m and 40 m cell strainers, followed by a wash with excess macs buffer. red blood cells were lysed during a brief exposure to ammonium chloride (5 min at 4c) and washed again with excess macs buffer. all materials were obtained from sigma, usa, exception macs buffer from miltenyi biotec, germany. cell suspensions were incubated with a monoclonal cd133 antibody labeled with microbeads (miltenyi biotech) for 30 min at 4c, and cd133 cells were enriched using a minimacs magnet and ms columns (miltenyi biotech). briefly, magnetic labeling with 1 l cd133/1 microbeads/1 million cells was performed using the miltenyi biotec cd133 cell isolation kit. ten microliters of cd133 - 2-pe (fluorochrome - conjugated mouse monoclonal igg1, clone 293c3 ; miltenyi biotec) was added for an additional 30 min to evaluate the efficiency of magnetic separation by flow cytometry. after incubation, cells were washed in macs buffer (miltenyi biotec gmbh, germany) and centrifuged at 300 g for 10 min. magnetic cell separation was carried out on the minimacs column (miltenyi biotec) and the column was washed with macs buffer to remove unbound cells. after magnetic sorting, both cell subsets were counted on a neubauer counting chamber and cell viability was assessed using trypan blue exclusion. aliquots of cd133 and cd133 sorted cells were evaluated for purity by flow cytometry with an facscalibur machine (bd biosciences, san diego, usa). cd133 and cd133 sorted cell populations were resuspended in dmem / f12 with growth hormones and supplements. both postsorted cd133 and cd133 cell compartments, as described above, were plated in 96-well plates (orange inc., united kingdom.) at a density of 100,000 cells per well in specific sc medium dmem / f12 supplemented with glucose 6 mg / ml, nahco3 1 mg / ml, hepes 5 mm, l - glutamine 2 mm, heparin 4 g / ml, bsa 4 mg / ml, bfgf 10 ng / ml, egf 20 ng / ml, apotransferrin 100 g / ml, insulin 25 g / ml, putrescin 9.6 g / ml, sodium selenite anhydrous 30 nm, and progesterone 20 nm (sigma, usa) without serum. plates were gently spun at 500 rpm for 5 min at room temperature following plating. plates were cultured in vitro (37c and 5% co2) for more than 28 days and media was replaced every 2 days. after reaching a confluency of 70%, cscs colonies were splitted by the mechanical method through several ups and downs. cell pellet was resuspended in 3 mm edta plus 0.05 mm dithiothreitol in pbs or in 0.05% trypsin plus 0.02% edta until the cells were not well dissociated and incubated at 37c. after an incubation time of 5 min, specific medium for supernatant was discarded and the pellet containing cscs was resuspended in the specific medium for next subcultures and passages. moreover, to evaluate cell colony formation capacity in a specific medium, sphere formation assay was carried out. colony formation in such specific medium is representative of self - renewal activity of given cells. aldh activity is a marker commonly used to isolate scs, particularly cscs and it was originally designed to isolate viable hematopoietic scs. to describe aldh activity of both cd133 and cd133 cancer cell subsets, the assay is thought to specifically detect aldh isoform aldh1a1 activity. to assess aldh activity of the two cell subsets, the aldefluor assay kit (stemcell technologies, canada) was utilized. the basis for this assay is that uncharged aldh substrate (bodipy - aminoacetaldehyde [baaa ]) is taken up by living cells via passive diffusion. once inside the cell, baaa is converted into negatively charged bodipy - aminoacetate (baa) by intracellular aldh. baa is then retained inside the cell, causing the cell to become highly fluorescent. only cells with an intact cell membrane briefly, cd133 and cd133 cells were harvested, placed in aldefluor assay buffer (2 10/ml) and incubated with the aldefluor substrate for 45 min at 37c to allow substrate conversion. as a negative control for all experiments, an aliquot of aldefluor -stained cells was immediately quenched with 1.5-mm diethylaminobenzaldehyde, a specific aldh inhibitor. cells were analyzed using the green fluorescence channel on a bd facscalibour flow cytometer (bd inc. k562 cell line as an aldh - positive sc fraction was labeled and assayed for aldh activity in order to optimize and validate the flow cytometry protocol. human tumor tissues were obtained from twenty consenting patients (age range : 4579 years) undergoing colorectal resection [table 1 ] according to the internal review and the ethics boards of the isfahan university of medical sciences, isfahan, iran. the patients cancer status in both primary tumor site and liver was carefully evaluated for the location and extent of the cancer by a surgeon during surgery. once the disease was localized to a surgically resectable area of the liver, patients were treated by wedge excision, segmentectomy, lobectomy, or extended lobectomy (trisegmentectomy) depending on the extent of disease. twenty colorectal cancer specimens from the histologic diagnostic assessment and sampled by pathologists were collected in serum free - dulbecco 's modified eagle 's medium (dmem) containing 25 units / ml of penicillin and 25 g / ml of streptomycin (at 4c) and transferred to the laboratory within 30 min of surgery and immediately mechanically and enzymatically disaggregated. in the laboratory, cancer tissues were extensively washed in phosphate - buffered saline (pbs) containing antibiotics penicillin (500 iu / ml), streptomycin (500 g / ml), and amphotericin b (1.25 g / ml). to prepare single - cell suspension, tumor tissues were minced into tiny fragments (~2 mm), followed by enzymatic digestion with 1.5 mg / ml collagenase, 20 g / ml hyaluronidase for 1 h at under continuous shaking at 37c. cells were then filtered sequentially through 70 m and 40 m cell strainers, followed by a wash with excess macs buffer. red blood cells were lysed during a brief exposure to ammonium chloride (5 min at 4c) and washed again with excess macs buffer. all materials were obtained from sigma, usa, exception macs buffer from miltenyi biotec, germany. cell suspensions were incubated with a monoclonal cd133 antibody labeled with microbeads (miltenyi biotech) for 30 min at 4c, and cd133 cells were enriched using a minimacs magnet and ms columns (miltenyi biotech). briefly, magnetic labeling with 1 l cd133/1 microbeads/1 million cells was performed using the miltenyi biotec cd133 cell isolation kit. ten microliters of cd133 - 2-pe (fluorochrome - conjugated mouse monoclonal igg1, clone 293c3 ; miltenyi biotec) was added for an additional 30 min to evaluate the efficiency of magnetic separation by flow cytometry. after incubation, cells were washed in macs buffer (miltenyi biotec gmbh, germany) and centrifuged at 300 g for 10 min. magnetic cell separation was carried out on the minimacs column (miltenyi biotec) and the column was washed with macs buffer to remove unbound cells. after magnetic sorting, both cell subsets were counted on a neubauer counting chamber and cell viability was assessed using trypan blue exclusion. aliquots of cd133 and cd133 sorted cells were evaluated for purity by flow cytometry with an facscalibur machine (bd biosciences, san diego, usa). cd133 and cd133 sorted cell populations were resuspended in dmem / f12 with growth hormones and supplements. both postsorted cd133 and cd133 cell compartments, as described above, were plated in 96-well plates (orange inc., united kingdom.) at a density of 100,000 cells per well in specific sc medium dmem / f12 supplemented with glucose 6 mg / ml, nahco3 1 mg / ml, hepes 5 mm, l - glutamine 2 mm, heparin 4 g / ml, bsa 4 mg / ml, bfgf 10 ng / ml, egf 20 ng / ml, apotransferrin 100 g / ml, insulin 25 g / ml, putrescin 9.6 g / ml, sodium selenite anhydrous 30 nm, and progesterone 20 nm (sigma, usa) without serum. plates were gently spun at 500 rpm for 5 min at room temperature following plating. plates were cultured in vitro (37c and 5% co2) for more than 28 days and media was replaced every 2 days. after reaching a confluency of 70% cell pellet was resuspended in 3 mm edta plus 0.05 mm dithiothreitol in pbs or in 0.05% trypsin plus 0.02% edta until the cells were not well dissociated and incubated at 37c. after an incubation time of 5 min, specific medium for supernatant was discarded and the pellet containing cscs was resuspended in the specific medium for next subcultures and passages. moreover, to evaluate cell colony formation capacity in a specific medium, sphere formation assay was carried out. colony formation in such specific medium is representative of self - renewal activity of given cells. aldh activity is a marker commonly used to isolate scs, particularly cscs and it was originally designed to isolate viable hematopoietic scs. to describe aldh activity of both cd133 and cd133 cancer cell subsets, the assay is thought to specifically detect aldh isoform aldh1a1 activity. to assess aldh activity of the two cell subsets, the aldefluor assay kit (stemcell technologies, canada) was utilized. the basis for this assay is that uncharged aldh substrate (bodipy - aminoacetaldehyde [baaa ]) is taken up by living cells via passive diffusion. once inside the cell, baaa is converted into negatively charged bodipy - aminoacetate (baa) by intracellular aldh. baa is then retained inside the cell, causing the cell to become highly fluorescent. only cells with an intact cell membrane can retain baa, so only viable cells can be identified. briefly, cd133 and cd133 cells were harvested, placed in aldefluor assay buffer (2 10/ml) and incubated with the aldefluor substrate for 45 min at 37c to allow substrate conversion. as a negative control for all experiments, an aliquot of aldefluor -stained cells was immediately quenched with 1.5-mm diethylaminobenzaldehyde, a specific aldh inhibitor. cells were analyzed using the green fluorescence channel on a bd facscalibour flow cytometer (bd inc. k562 cell line as an aldh - positive sc fraction was labeled and assayed for aldh activity in order to optimize and validate the flow cytometry protocol. the present effort enrolled 20 patients, aged 45 years or older (mean age, 63.25 years ; range : 4579) [table 1 ]. to assess cell size and complexity of intracellular structure of cd133 and cd133, sorted cd133 and cd133 cell subsets were analyzed by flow cytometry. forward - angle light scatter (fsc) and side - angle light scatter (ssc) were used for cell size and complexity of intracellular structure, respectively. figure 1a and b represent cell size and complexity of intracellular structure analyses, respectively. culturing of both cell compartments revealed that cd133 cells isolated from primary colon cancers were able to grow in specific medium while cd133 cells were unable to form colonies in specific serum free medium. interestingly, both cd133 and cd133 cells isolated from liver metastatic colon cancers were grown in specific serum - free medium [figure 1c ]. (d) aldehyde dehydrogenases enzyme activity of cd133 cell subset isolated from primary colorectal cancer sample, (e) aldehyde dehydrogenases enzyme activity of cd133 cell subset isolated from liver metastatic colorectal cancer sample, (f) aldehyde dehydrogenases enzyme activity of cd133 cell subset isolated from primary colorectal cancer sample, and (g) aldehyde dehydrogenases enzyme activity of cd133 cell subset isolated liver metastatic colorectal cancer sample the assay demonstrated that cd133 cells show aldh enzyme activity while cd133 cells isolated from primary colon cancer samples do not show aldh enzyme activity. figure 1d g are representatives of flow cytometric analysis of aldh enzyme activity in both cd133 and cd133 cell subsets. in this study, we showed that phenotypic isolation of colon cscs is not reliable and it should be further validated by their growth capacity in a specific cell culture. moreover, herein, we also described the possibility of an interconversion between differentiated colon cancer cells and colon cscs, a phenomenon that is more likely due to tumor microenvironment cues. this highlight the importance of cancer microenvironment cues in this phenomenon and potential of tumor microenvironment - modulating agents in cancer therapy.. some important distinct features of scs are slowly cycling or fast cycling during homeostasis in vivo, low intracellular complexity (low ssc values), small size (low fsc values) with poor differentiation, and potential of high proliferation ability after injury or placement. a great deal of study revealed that hematological cancers and most of the solid tumors such as colorectal cancer contain a subpopulation which possess characteristics associated with normal scs specifically the ability to give rise to all cell types found in a particular cancer sample. in fact, this subset of cancer cells in some cancers exhibited higher tumorigenicity and proposed to cause relapse and metastasis by giving rise to new tumors. these cells were isolated and identified by different approaches from cell surface markers and cell culture methods to ability of dye elimination. currently, identification and isolation of cscs are largely dependent on the presence of specific cell surface markers, although the expression of such markers depends on various factors (e.g., the cell differentiation states and microenvironment factors). many of the markers utilized to identify cscs are derived from the surface markers known to be present on normal scs. one of these markers, cd133, is a well - described cscs marker in various types of cancers including colorectal cancer. in this study, we speculated that if we could evaluate some cellular characteristics in two different cell subsets, an appropriate estimation would be available for cancer therapies and progression. moreover, the study of these cellular characteristics in cancer cell subsets might be a suitable indicator for the evaluation of treatment outcome and even prediction of cancer relapse. in our study, we used the cd133 antigen as a csc marker in order to identify, isolate, and further investigate some cellular characteristics within human colon cancer tissues. in this study, we reported cell size and complexity of intracellular structure of two (cd133 and cd133) cell subsets isolated from human colorectal cancers. the results reported here clearly show that cd133 cells are bigger and more complex than cd133 cells. these observations are in agreement with previous sc theory demonstrating scs are small size with poor differentiation, and low complexity of intracellular structure. furthermore, intriguingly obtained results from sphere formation and aldh enzyme activity assays revealed that contrary to our first assumption, cd133 cell subsets isolated from liver metastatic colorectal cancer samples, similar to cd133 cell subsets isolated from both primary and liver metastatic colorectal cancer samples, were able to form sphere in vitro and exhibited aldh enzyme activity. our latter result would be indicated the ability for cd133 cell subsets to produce cd133 cell subsets and surprisingly also cd133 cells to produce cd133 cells, especially in metastatic state. these findings would be consistent with an earlier investigation where it exhibited that during the metastatic transition, cd133 tumor cells might give rise to the more aggressive cd133 subset, which is also capable of tumor initiation in nod / scid mice. such a dynamic evokes one possibility, there is a dynamic relation between cd133 and cd133 subpopulations and allows for interconversion between the two states. this equilibrium may be switched bidirectionally by tumor niche cues that influence the probability of interconversion between the cd133 and cd133 cell compartments. another more recent study showed that there is a dynamic relationship among subpopulations of human breast cancer for a given phenotypic state over time. this study was explained by observations using markov model in which cancer cells can be transit between phenotypic states (herein, for example, cd133 and cd133 subpopulations) stochastically. according to this model, it has predicted that given certain conditions, any subpopulation of cancer cells come back to equilibrium based on phenotypic compartments over time and cscs originate from non - scs (herein, cd133 cancer subpopulation). collectively, these findings demonstrate that cancers are heterogeneous and also a phenotypic interconversion may be existing in populations of cancer cells which are greatly affected by tumor microenvironment cues. the role of cscs niche in cancer therapeutic strategies should be precisely considered and targeted. it seems that targeting of cscs niche is as pivotal as or more pivotal than targeting of cscs themselves. nowadays, current cancer therapies are emphasizing on eradication or differentiation of cscs as a therapeutic strategy in tumor - derived cscs ; however, it would be predicted that recurrence of cancers will be inevitable because although they may target cscs, the cancer niche is in the original state, in turn, normal tissue - resident scs or progenitors will be exposed to already existing transforming cues and maybe lead to new cscs formation and finally cancer relapse. it seems that new therapies should be directed against both cscs niche and neoplastic scs or their niche at least. the concept of the role of cscs niche and its targeting appear to be a pivotal approach for treatment and/or cure of cancers. ultimately, an understanding of the cscs niche in addition to the cscs themselves lead to a better understanding of the therapeutic approaches for future cancer therapy. all authors contributed in the conception of the work, conducting the study, revising the draft, approval of the final version of the manuscript, and agreed for all aspects of the work. all authors contributed in the conception of the work, conducting the study, revising the draft, approval of the final version of the manuscript, and agreed for all aspects of the work. | background : it is supposed that human colorectal cancer consists of a phenotypically distinct population of tumorigenic cancer cells known as cancer stem cells (cscs) which play a pivotal role in cancer progression, maintenance, metastasis, and the relapse. the aim of this effort was to investigate and compare biological characterizations of cd133 + with cd133 cell subsets isolated from both primary and metastatic human colorectal tumors.materials and methods : using our optimized protocols, unfixed colorectal tumors were enzymatically and mechanically dissociated into single cells followed by evaluation of postdigestion viability. the obtained single cell suspensions were then subjected to cell sorting using magnetic beads according to cd133 marker. the resultant cd133 + and cd133 cell subsets were cultured in specific cell culture medium followed by aldehyde dehydrogenases (aldh) activity assessment and flow cytometric analyses.results:the results demonstrate that cd133 + cells have smaller size and lower complexity of intracellular structure, sphere formation ability, and aldh enzyme activity while cd133 cells isolated from primary colon cancer samples were not able to form a sphere and did not show aldh enzyme activity. intriguingly, cd133 cells isolated from metastatic colorectal cancer specimen were able to form a sphere and shown aldh enzyme activity. the present study indicates that our results are in agreement with sc theory and possibility of the existence of cellular plasticity among cancer subpopulations should be portrayed.conclusion:we also conclude that this cellular plasticity is greatly affected by tumor microenvironment cues and the role of cscs niche in cancer therapeutic strategies should be precisely considered. |
there is growing concern about the marked inadequacy of osteoporosis care for patients who suffer a fragility (low - energy) fracture. hip fractures increase exponentially with age and are associated with impaired mobility, loss of independence, increased hospitalizations, and mortality for up to one in four women during the year following the fracture. evidence shows that risk of fracture is increased in those who have had a first fracture. a report from a danish registry indicates that for patients with a hip fracture there was a 6-fold increase in risk of second hip fracture for women and a 9-fold increase for men. an analysis of data from two longitudinal studies in the united states showed that hip fracture patients had a 2.5-fold increased risk of subsequent self - reported fragility fracture other than hip. in the united states, although approximately 90% of patients with hip fractures have osteoporosis, only 19% of them receive postfracture evaluation or therapy for osteoporosis. moreover, a survey of databases of health maintenance organizations indicates that this is a widespread problem. this study evaluates the effectiveness of the brigham fracture intervention team (b - fit) initiatives, new in - hospital care initiatives designed to address osteoporosis evaluation and in - hospital management. these care pathways include a discharge initiative and several versions of admissions initiatives. because of our earlier finding of vitamin d deficiency in patients admitted with a hip fracture, these initiatives include elements to identify and manage vitamin d deficiency. the goal is to attend to underlying musculoskeletal pathology that resulted in the fracture and to launch that care by the admitting orthopedic surgeons. it is well appreciated that prolonged vitamin d deficiency in adults results in osteomalacia and hypovitaminosis d myopathy with diffuse pain, increased risk of falls and fractures, and nondisplaced pseudofractures. in addition, hyperparathyroidism secondary to hypovitaminosis d increases bone resorption and further reduces bone mineral density. these consequences of chronic vitamin d deficiency, osteomalacia, osteopenia, and osteoporosis are each associated with increased fracture risk [911 ]. it was our goal to translate those clinically relevant research findings into hospital - based initiatives to improve the care of patients admitted with a fragility fracture. a multidisciplinary team of orthopedic surgeons, endocrinologists, and investigators developed and revised admission and discharge initiatives to evaluate and address the osteoporosis and vitamin d status of patients admitted with a fragility fracture of the hip. these in - hospital care elements involved cooperation between orthopedic surgeons and endocrinologists, clinician training and reinforcement, and evolution with computer assistance. effectiveness of these b - fit initiatives was evaluated with audits of four annual cohorts of patients. with an irb - approved protocol and its annual review, medical records of patients 50 years of age who were admitted with fragility fracture of the hip and proximal femur were examined. cohorts comprised patients who were admitted during the last five months of each of 4 years in order to ensure comparable appraisals in light of interim modifications made in the admission pathway and potential seasonal variations. revisions were introduced early in calendar years so that they would be well established by the time of the annual evaluation. each patient 's record was reviewed by a board - certified orthopedic surgeon to verify that the fracture represented a fragility (low energy) fracture. after review, patients with avascular necrosis (n = 2), high energy traumatic fracture (n = 3), or fracture of unspecified etiology (n = 2) were excluded. 2 cohort, two patients died of unrelated medical causes while in hospital and thus were not available for analysis of discharge effectiveness. the first surgeon - initiated initiative was introduced as additions to the pre - existing computer - based discharge order - set for fracture patients. the b - fit discharge initiative prompts the surgeon to give written and oral instructions for daily calcium with vitamin d (600 mg elemental calcium with 200 iu vitamin d3, bid), a daily multivitamin (with 400 iu vitamin d3 and 66 mg calcium), additional daily vitamin d (400 iu vitamin d3), and an outpatient osteoporosis evaluation (table 1). the admission initiative was introduced early in year 1 in the form of a training session for orthopedic attendings and residents, distribution of laminated pocket cards, and follow - up emails to train the rotating orthopedic residents. it instructs the surgeon to order tests for serum calcium, albumin, and 25-hydroxyvitamin d [25ohd ] (nichols advantage prior to january 1, 2005 ; thereafter diasorin liaison), to start daily calcium carbonate with vitamin d3 (600 mg elemental calcium with 200 iu vitamin d3, bid), a daily multivitamin (with 400 iu vitamin d3 and 66 mg calcium), and to order an endocrinology consultation. a computer - assisted reminder was deployed to appear as a pop - up screen in the fracture service database program when the details of the admission were entered and met the study criteria (fragility fracture of the hip / femur and age 50 years). the amendment also added the order for administration of one oral dose of 50,000 iu vitamin d2. with irb approval and annual review, medical records were inspected for past medical history, elements of admission and discharge instructions, and details of the discharge regimen. effectiveness of admission initiative was defined as the percent of patients who had a measurement of 25ohd during hospitalization. secondary analyses were made of percents of subjects with a record of an endocrine consultation, of administration of 50,000 iu vitamin d2 while hospitalized, or with a record of past medical history of a diagnosis of osteoporosis. effectiveness of discharge initiative was defined as the percent of patients who were provided with instructions for calcium / vitamin d. statistical analysis was performed with graphpad instat version 3.00 for windows 95, graphpad software inc. categorical data are reported as frequencies and continuous data are reported as the mean standard deviation, unless otherwise specified. cohorts of 57, 41, 42, and 41 subjects fulfilled the study criteria (fragility fracture of the femur and older than 50 years) in the designated period in years 1, 2, 3, and 4, respectively (table 1). review of comorbidities prior to hospitalization for fracture revealed that 15% had a pre - existing diagnosis of osteoporosis and 17% had a diagnosis of hypothyroidism. of the subjects that had been tested for serum 25ohd concentration, 78% were found to be insufficient, having serum levels 65 year of age. data associating lower vitamin d levels with reduced muscle strength and increased risk of falls as well as evidence for reduced lower extremity function one year after a hip fracture provide additional impetus for ensuring that hip fracture patients are evaluated and optimally treated for vitamin d insufficiency. early in year 2, the admission initiative was amended to include administration of a single oral dose of 50,000 iu vitamin d2, the most available and inexpensive form of high - dose vitamin d. the rationale to initiate correction of vitamin d status as soon as possible was twofold : to ensure proper healing of the fracture and to address the underlying skeletal disease and risk of falls and subsequent fractures. risk for fracture nonunion is also associated with metabolic and endocrine abnormalities. in a recent study in which adult patients with unexplained fracture nonunion were evaluated by an endocrinologist, the most common new diagnosis was vitamin d deficiency (68%), followed by thyroid abnormalities (24%), and hypogonadism (22%). in this study, epidemiological data indicate the relationship between low vitamin d status and risk of falls and fracture. a recent meta - analysis of the literature from randomized controlled trials revealed that trials that had used 700 or 800 iu per day of vitamin d plus calcium showed efficacy in reducing fracture risk by 26%, compared with calcium or placebo, whereas trials with 400 iu vitamin d / day were not effective. this was reaffirmed in a larger meta - analysis that included data from 63 897 individuals. furthermore, from publications that included measurement of serum 25ohd, it is clear that antifracture efficacy increases with higher achieved 25(oh)d levels ; levels above 30 ng / ml were achieved with 700800 iu vitamin d3. there is some information about the co - occurrence of osteomalacia and osteoporosis in the elderly. osteomalacia is diagnosed as the presence of excess osteoid and decreased mineralizing surfaces by histomorphometric analysis of nondecalcified histology. in a 1974 publication, histological osteomalacia in iliac crest biopsies 39% of men at the time of proximal femoral fracture. in a 1990 histomorphometric analysis of iliac crest biopsies in elders with femoral neck fracture, a recent histomorphometric study of biopsies from osteoporotic subjects showed an increase in osteoid thickness that was inversely correlated with serum 25ohd and emphasizes the importance of avoiding vitamin d insufficiency. although there are clinical tools to diagnose and therapeutic options to treat low bone density, osteoporosis remains underdiagnosed and seriously undertreated. barriers to diagnosis and care of osteoporosis in patients with fragility fractures include uncertainties about clinical responsibility, the need for multidisciplinary medical teams, implementing computer - based tools, clinical expertise as recommendations for osteoporosis care evolve, and impact of other comorbidities upon treatment plan. various means have been suggested to enhance osteoporosis care in fracture patients, including interventions by primary care practitioners and in outpatient postfracture clinical settings [26, 27 ]. in a recent report from a community - based multispecialty partnership, the delivery of osteoporosis care was increased after developing an information systems enhancement that automatically referred orthopedic fracture patients to an osteoporosis care service. less has been published about in - hospital initiatives, as they generally require paradigm shifts in large organizations. a retrospective analysis of hip fracture patients admitted to a tertiary care academic medical center in the united states showed that 17% were discharged on calcium in 2000, compared with 4% in 1995. in a series of patients hospitalized for fragility hip fracture in 2000, 10 of 75 (13%) were given a new prescription for osteoporosis medication while hospitalized. a subsequent randomized study from that team compared effectiveness of two interventions during hospitalization : in the control intervention, patients received a pamphlet on fall prevention ; in the study intervention, patients had a 15-minute discussion about osteoporosis evaluation with a research nurse and were provided with a list of questions for their primary medical physician about osteoporosis evaluation and treatment, followed with a telephone reminder 6 weeks after hospitalization about the need to address osteoporosis. evaluation by telephone at 6 months showed that 42% of those in the study group had received attention for osteoporosis, compared with 19% in the control group. another osteoporosis consultation team reported that 53% of 59 patients with fragility hip fracture were not seen by the team because the initiating consultation request was not made. evaluation of three care models in different health - care environments also concluded that effectiveness increased when new personnel, such as an osteoporosis nurse practitioner, assumed the responsibility of coordinating patient education, laboratory tests, and communication between orthopedic staff and primary care physicians. a pilot initiative from the american orthopaedic association used web - based training of orthopedic surgeons for process improvement measures and patient counseling, including calcium and vitamin d. those interventions had little effect on measures of osteoporosis management, but resulted in significant improvements in counseling and documenting the patients ' osteoporosis risk factors. expansion of that program was said to require new support mechanisms or personnel to ensure that presentation with an osteoporotic fracture launches appropriate standard of osteoporosis care. this study highlights the importance of vitamin d in patients with fragility fractures. identifying and correcting underlying osteoporosis in patients who present with fragility fracture are aimed to reducing the risk for additional fractures and disability [35, 36 ]. the consulting endocrinologist is the team member who is responsible for evaluating potential causes of secondary osteoporoses, in light of information that 80% or more hip fracture patients have medical conditions that are associated with increased fracture risk. an in - hospital report of 25ohd 20 ng / ml is addressed with an additional 50,000 iu ergocalciferol before discharge and then 50,000 iu per week for another 6 weeks with retesting thereafter. an in - hospital level of 20 to 25 ng / ml is addressed with a prescription for 50,000 units twice per month. the consulting endocrinologist also assesses risk for hypercalcemia, hypercalciuria, and nephrolithiasis with calcium and creatinine values and identifies patients with other contraindications for high - dose vitamin d, including sarcoidosis or granulomatous disease. hypercalcemia is rare in the settings of hypovitaminosis d and low urinary calcium excretion, and, as we reported for an earlier series, patients with hip fracture tend to have lower circulating calcium levels than age and gender matched controls. the endocrinologist also discusses with the patient the need for posthospitalization osteoporosis evaluation and management. an in - hospital prescription for weekly ergocalciferol is automatically carried forward into the discharge summary. in this study, only 15% of subjects had a previous diagnosis of osteoporosis and some patients were admitted with a previous prescription for bisphosphonates. evidence indicates that bisphosphonates may produce hypocalcemia in the presence of vitamin d insufficiency and that responsiveness to bisphosphonate is reduced in the presence of secondary hyperparathyroidism with vitamin d insufficiency. zoledronic acid (5 mg infusion once per year) is an option for patients with a recent hip fracture and is fda - approved for secondary prevention of fractures. recent evidence evaluating the timing of zoledronic acid administration post - hip fracture indicates decreased fracture reduction efficacy in subjects treated within 2 weeks of their fracture repair, compared with later treatment. there is some information from animal studies about bisphosphonates not inhibiting early stages of fracture healing. studies in ovariectomized rat models showed that administration of alendronate at the time of fracture resulted in larger callus formation, but with more woven than lamellar bone compared with control ovariectomized animals. in a study with rats, a single dose of carbon - labeled zoledronic acid after a fracture demonstrated the greatest accumulation in the external fracture callus. although the clinical significance of those findings is not known, there is a concern that early intravenous administration of zoledronic acid would lead to greater uptake at the fracture site than in the rest of the skeleton and possibly interfere with remodeling and maturation of the healing bone. in vitamin d sufficient hip fracture patients, in the absence of contraindications like esophagitis or gastric disorders, it may be practical to initiate therapy with oral bisphosphonates upon hospital discharge. for all bisphosphonates, vitamin d sufficiency should be documented before initiation of therapy ; for intravenous zoledronic acid, it may be convenient to schedule the follow - up vitamin d test and the infusion at the time of outpatient appointments with the orthopedic surgeon or the endocrinologist. in conclusion, effectiveness of in - hospital admission and discharge initiatives requires communication and cooperation among orthopedic surgeons, endocrinologists, and other physicians, training and reinforcement, computer assistance, audits, and evolution. this study shows the beneficial results of self - evaluation and systems analyses to identify opportunities for improvement. the prevalence of vitamin d insufficiency observed in this study reaffirms the importance of incorporating vitamin d recommendations in fragility fracture care initiatives. orthopedic surgeons who treat patients with acute fragility fracture are in ideal position to initiate in - hospital multidisciplinary care pathways aimed at reducing the sequelae and preventing other fractures. | we designed, implemented, and revised the brigham fracture intervention team (b - fit) initiatives to improve in - hospital care of fracture (fx) patients. effectiveness was evaluated for 181 medical records of 4 cohorts in four successive years of consecutive patients who were admitted with a fragility hip fx. the discharge initiative (di) (computer - based) includes 1200 mg calcium and 1000 iu vitamin d3 daily. the admission initiative (ai) was introduced one year later with reminders for serum 25ohd measurement, initiation of daily calcium (1200 mg) and vitamin d (800 iu), and an order for endocrinology consultation, with an amendment for a computer - assisted reminder and a dose of d2 (50 000 iu). initially, the computer - based di was more effective (67%) than the surgeon - driven ai (33%, p <.001). after introduction of a computer - assisted reminder, ai effectiveness increased to 68%. the marked prevalence of vitamin d insufficiency reaffirms the importance of incorporating vitamin d recommendations in fx care pathways. |
several species of bacteria have been linked to chronic infections of colon and have been shown to increase the risk of colon cancer. streptococcus bovis has been evaluated as one of the possible etiologic agents for colorectal cancer. s. bovis is a gram - positive bacterium, which is considered as a normal inhabitant of the human gastrointestinal tract but is less frequently present than other streptococcus species. whatever, s. bovis has been shown to be an increased cause of endocarditis and bacteraemia and found to be associated with gastrointestinal diseases [36 ] or with the colorectal cancer [710 ]. although a number of bacteria have been associated with cancer, their possible role in carcinogenesis is unclear. in some cases helicobacter pylori may cause stomach cancer [11, 12 ] since animal models have demonstrated koch 's third and fourth postulates for the role of h. pylori in the causation of stomach cancer. moreover, it has been found also that salmonella typhi is associated with gallbladder cancer and escherichia coli with crohn 's disease as well as colon cancer [15, 16 ]. mccoy and mason first reported a case of the association between streptococcal endocarditis and colon cancer in 1951. many studies have examined the presence of s. bovis in stool samples obtained from patients with colorectal cancer to find a relationship between this bacterium and the risk of colorectal cancer. in 1977, klein. found a significantly strong association of s. bovis in stool samples of patients with colon cancer compared with healthy controls and patients with nonmalignant gastrointestinal disease. in contrast, other studies did not find any significant association between faecal s. bovis and human colorectal cancer [2124 ]. the aims of the current study were to isolate s. bovis from stool specimens collected from patients with malignant and non - malignant gastrointestinal diseases and from a healthy group to compare the association of the bacterium in malignant and non - malignant gastrointestinal diseases and to determine the susceptibility of the isolated strains to different antimicrobial agents. stool specimens were collected in sterile containers before the initiation of therapy from inpatients with malignant and non - malignant gastrointestinal diseases in ibn - sina specialized hospital, khartoum, sudan. the stool samples were from 28 inpatients with malignant gastrointestinal diseases (table 1), 27 inpatients with non - malignant gastrointestinal diseases (table 2), and 50 controls. 20 out of the 50 controls were outpatients who came to the gastric intestinal tract clinic suffering from the gastrointestinal tract problems and the medical examination and laboratory tests showed that they did not have any type of cancer. the inpatients and the 20 controls were working in agriculture and animal husbandry and aged between 25 and 65 years. 5% of each inpatients and controls aged from 25 to 50 years and 95% aged from 51 to 65 years. 30 out of the 50 controls were apparently - healthy farmers aged 5086 years and the mean age was 64 10 years. the stool samples were collected during the medical survey for infectious and tropical diseases organized by university of medical sciences and technology in sudan from gezira agriculture scheme with a population of 40 thousand people. the stool samples were cultured on macconkey agar plates (himedia limited, bombay) and incubated aerobically at 37c overnight. antimicrobial susceptibility to penicillin and trimethoprim - sulfamethoxazole was carried out on the isolated strains by disk diffusion method on mueller - hinton agar plates (himedia limited, bombay). sensitivity of bacteria to each antibiotic was carried out by measuring the diameter of inhibition of bacterial growth around the disc. a diameter of 26 mm was considered as the cut - off point for sensitivity for the penicillin and a diameter of 24 mm for the trimethoprim - sulfamethoxazole according to national committee for clinical laboratory standard (nccls) method. test was used for significant prevalence of s. bovis in stool specimens from patients with malignant or with non - malignant gastrointestinal diseases. the statistical analysis was also performed to compare between presence of s. bovis in stool specimens from patients with noncolonic cancer and with non - malignant gastrointestinal diseases. stool specimens were collected from fifty - five patients with malignant and non - malignant gastrointestinal diseases and from fifty persons as control group. the specimens were examined to the prevalence of streptococcus bovis strains and their susceptibility to the used antibiotics. all the isolated s. bovis strains were found to be sensitive to penicillin and trimethoprim - sulfamethoxazole with diameter of inhibition from 26 to 32 mm and from 24 to 32 mm, respectively. s. bovis was not detected in the control group but it was detected in the inpatients aged 5165 years. bacteriological analysis of stool specimens from the patients with malignant gastrointestinal diseases showed that out of 28 specimens s. bovis was isolated from 10 patients. six positive were from patients with carcinoma of the stomach, and one positive was from each patient with carcinoma of rectum, pancreas, colon, and liver. the prevalence of s. bovis in stool from the patients with carcinoma in stomach, rectum, pancreas, colon, polyps, and hepatocytes was 55%, 25%, 14%, 50%, 0%, and 50%, respectively (table 3). analysis of stool specimens from the patients with non - malignant gastrointestinal diseases showed that out of 27 specimens s. bovis was isolated from 5 patients. two positive from patients with liver cirrhosis, two positive from patients with obstructive jaundice, and one from patient with portal hypertension were found. the prevalence of s. bovis in stool from the patients with crohn 's disease, liver cirrhosis, obstructive jaundice, portal hypertension, and viral hepatitis was 0%, 28%, 33%, 14%, and 0%, respectively (table 4). from analysing the prevalence of s. bovis in stool from the patients with malignant and non - malignant gastrointestinal diseases and healthy controls was 36%, 18%, and 0%, respectively (figure 1). the statistical analysis showed that the prevalence of s. bovis in stool specimens from patients with malignant or with non - malignant gastrointestinal diseases was statistically significant (p value of test was 0.02). colorectal cancer is the fourth most common cancer among men and third most common among women worldwide. a large number of previous studies point to association of s. bovis with gastrointestinal diseases [5, 6 ] and cancer of the human colon. the current study finds a correlative relationship between existence of s. bovis and malignant gastrointestinal diseases since prevalence of the bacterium in stool from the patients with carcinoma in stomach, rectum, colon, and hepatocytes was 55%, 25%, 50%, and 50%, respectively. in comparison, the prevalence of s. bovis in stool from the patients with crohn 's disease, liver cirrhosis, obstructive jaundice, portal hypertension, and viral hepatitis was 0%, 28%, 33%, 14%, and 0%, respectively. from analysis the prevalence of s. bovis in stool from the patients with malignant and non - malignant gastrointestinal diseases and healthy controls was 36%, 18%, and 0%, respectively. the test statistical analysis showed that the prevalence of s. bovis in stool specimens from patients with malignant or with non - malignant gastrointestinal diseases was statistically significant (p = 0.02). the current findings confirm the previous data that correlated the association of s. bovis with colorectal cancer specially klein study 1977 and the later studies [1820 ]. in contrast to the literature regarding an association with colorectal cancer, less is written about associations of s. bovis with other gastrointestinal diseases or with other cancers except klein study 1977 but klein 1987 reported also the lack of association of s. bovis with noncolonic gastrointestinal carcinoma. however, alazmi., 2006 found that s. bovis bacteremia in adults was frequently associated with hepatic dysfunction, and zarkin., postulated a triad of s. bovis bacteremia, liver disease, and colonic pathology whereby the liver disease might account for the increased fecal carriage, entry to the portal venous system, or passage from the portal to systemic circulation of s. bovis. in this context, our findings add more information about the association of s. bovis with non - malignant gastrointestinal diseases and with non - colonic cancer : since the current study isolated s. bovis from the stool of patients with liver cirrhosis, obstructive jaundice, and portal hypertension (table 4) and the bacterium was isolated from stool of patients with carcinoma in stomach, rectum, and hepatocytes (table 3), the association of s. bovis with non - malignant gastrointestinal diseases or with noncolonic cancer was not significantly different by test (p > 0.05). however, klein 1977 isolated s. bovis from stool of patients with inflammatory bowel disease, other gastrointestinal disorders and noncolonic neoplasms and he found that presence of s. bovis in stool of patients with non - colonic cancer was not significantly different from that in controls. tjalsma and colleagues detected immune reactions against s. bovis antigens in sera of 11 out of 12 colon cancer patients and in 3 out of 4 patients with colon polyps. they found that one of the diagnostic antigens represents a surface - exposed heparin - binding protein that, according to their speculation, might be involved in the attachment of s. bovis to tumor cells. they claim that profiling of the humoral immune response against s. bovis infections may represent a promising diagnostic tool in early detection of human colon cancer. however, research has not yet determined if s. bovis is a causative agent of colon cancer or if preexisting cancer makes the lumen of the large intestine more hospitable to s. bovis outgrowth. previous findings (reviewed in) suggest an active role of s. bovis in the promotion of intestinal carcinogenesis when adult rats were treated with azoxymethane for 2 weeks and subsequently received injections with either s. bovis bacteria or wall - extracted antigens twice weekly. the authors observed progression of preneoplastic lesions, enhanced expression of proliferation markers, and increased production of interleukin-8 in the colonic mucosa in these rats. the same group used a partially purified s. bovis s300 fraction representing 12 different proteins and triggered the synthesis of proinflammatory proteins (human interleukin-8 and prostaglandin e2), correlated with the in vitro overexpression of cyclooxygenase-2 in human colon carcinoma cells and in rat colonic mucosa. these data could point to a role of oxygen radicals in colon carcinogenesis induced by a chronic infection with s. bovis. the mechanism could be similar to the one suspected for the development of gastric carcinomas after persisting h. pylori infections since a cecropin - like h. pylori peptide, hp (220), was found to be a monocyte chemoattractant and activated the monocyte nadph oxidase to produce oxygen radicals. presently it would still be important to know whether the increased presence of s. bovis in colonic cancers and polyps results from the preferential bacterial colonization of these cancers and their precursors or whether s. bovis represents a carcinogen that is causally involved in gastrointestinal cancer. however, our study presents a significant association of streptococcus bovis with malignant gastrointestinal diseases. the significant association of s. bovis with malignant gastrointestinal diseases compared to its association with non - malignant gastrointestinal diseases presented in this study confirms the previous studies about the association between this bacterium and colorectal cancer and may support the idea that there is correlation between this bacterium and the malignant gastrointestinal diseases. | streptococcus bovis is a gram - positive bacterium causing serious human infections, including endocarditis and bacteremia, and is usually associated with underlying disease. the aims of the current study were to compare prevalence of the bacterium associated with malignant and nonmalignant gastrointestinal diseases and to determine the susceptibility of the isolated strains to different antimicrobial agents. the result showed that the prevalence of s. bovis in stool specimens from patients with malignant or with nonmalignant gastrointestinal diseases was statistically significant. this result may support the idea that there is correlation between s. bovis and the malignant gastrointestinal diseases. |
arachnoid cysts in the brain usually have an indolent course unless complicated by headache, seizures, increasing head circumference, behavioral disturbances, ocular, motor, speech disorders, and sudden cyst changes such as acute cyst expansion, sudden hemorrhage into the cyst, subdural hematoma, or subdural hygroma. rupture of arachnoid cyst causing subdural hygroma is very rare, with few case reports. we herein present a clinical case, radiology, and discussion of asymptomatic middle cranial fossa arachnoid cyst in a 15-year - old male child who presented with raised intracranial features following a trivial trauma. a 15-year - old male child presented with complaints of headache, visual blurring, and projectile vomiting for 20 days duration. the child had a history of trivial fall about 10 days prior to onset of headache, with no loss of consciousness. on examination, the child had bilateral florid papilledema and right lateral rectus palsy. there were no other focal deficits or signs of meningeal irritation. computed tomography (ct) scan of the brain showed a left middle fossa, galassi type 3 arachnoid cyst, with bilateral subdural hygroma / hematoma (chronic), bilateral diffuse cerebral edema, and mass effect causing compression of both frontal horns [figure 1 ]. magnetic resonance imaging (mri) of the brain showed bilateral collection in the subdural space, hypo on t1w [figure 2 ] and hyper on t2w [figure 3 ] images, matching with the intensities of cerebrospinal fluid (csf) with widened sylvian fissure on the left side and a compressed temporal lobe on the left side, suggestive of arachnoid cyst with subdural hygroma and mass effect. computed tomography scan plain, axial section showing hypodense region compressing the temporal horn with bilateral subdural hygroma magnetic resonance imaging brain t1w image showing subdural hypointensity in the temporal region and bilateral convexities compressing temporal and frontal lobes on the left side suggestive of arachnoid cyst with subdural hygroma and mass effect magnetic resonance imaging brain t2w image showing subdural hyperintensity in the temporal region and bilateral convexities compressing temporal and frontal lobes on the left side suggestive of arachnoid cyst with subdural hygroma and mass effect left pterional craniotomy, evacuation of hygroma, fenestration of cyst into suprasellar cistern, and marsupialisation of the cyst was performed. the patient developed pseudomeningocele, which was managed with lumbar csf drainage for 5 days and was discharged without any deficits. the postoperative imaging showed resolution of the subdural hygroma with small extradural and subgaleal collection of the csf [figure 4 ]. the postoperative imaging showed resolution of subdural hygroma with small extradural and subgaleal collection of cerebrospinal fluid arachnoid cysts are considered intra - arachnoidal in location and account for 1% of the intracranial mass lesions. they can develop anywhere in the cerebrospinal axis but have a predilection toward the middle cranial base. they are usually asymptomatic, but may present with raised intracranial pressure, focal neurologic deficits, or seizures. being indolent and slowly growing, most of the arachnoid cysts can be managed conservatively, reserving surgical intervention for symptomatic lesions. intra - cystic hemorrhage and subdural rupture of the veins running over the surface of the cyst are well described. subdural rupture of the arachnoid cyst per se,[46 ] either traumatic or spontaneous, is sparingly reported with about 21 cases documented in literature. even a minor trauma can cause rupture of the cyst as seen in the present case, where the patient fell down while playing, without any loss of consciousness. the gradual seepage of the csf from the cyst into the subdural space, probably through a flap- valve effect, caused a gradual rise in the intracranial pressure. ruptures are usually asymptomatic in areas other than the cysts in the middle cranial fossa. however, immediate operative intervention was warranted in view of raised intracranial pressure and progressive neurologic deterioration. | intracranial arachnoid cysts developing in relation to the cerebral hemispheres and middle cranial fossa are usually incidental or asymptomatic. however, most of the clinically active cysts present with seizures because of chronic compression. presentation as raised intracranial pressure due to cyst rupture into the subdural space is a rare clinical entity. we herein present a case of an asymptomatic arachnoid cyst with rupture into the subdural space bilaterally and presenting as raised intracranial pressure. |
the pubertal growth spurt is considered to be an advantageous period for certain types of orthodontic treatment and should be taken into account together with orthodontic treatment planning13. because of the wide individual variation in the timing of the pubertal growth spurt, chronological age is an unreliable guide for assessment of children development status5. other parameters, such as growth velocity, secondary sex changes, dental development and skeletal ossification, have proven to be more accurate17. the standard method to evaluate skeletal maturity has been the use of hand - wrist radiographs, matching the overall pattern of the subject 's maturation to a set of reference patterns, available in an atlas9,15. skeletal maturation is generally determined by evaluating either the stage of ossification of bones of the hand and wrist, due to the large number of different types of bones available in these areas, or the ossification onset of the ulnar sesamoid7. however, to avoid taking additional radiographs, the cervical vertebrae, as seen on routine lateral cephalograms, have been used to determine the skeletal maturity11,14,18. it is well known that the lateral view of cervical vertebral bodies changes with growth. in 1972, lamparski14 stated that the cervical vertebrae were as statistically and clinically reliable in assessing skeletal age as the hand - wrist technique10. in recent years, several authors4,911,18 have reported a high correlation between cervical vertebrae maturation and skeletal maturation of the hand - wrist. it has been found that cervical vertebrae could offer an alternative method for assessing maturity without the need of hand - wrist radiographs. however, cervical vertebrae were used to evaluate growth in a subjective manner because the method consisted of a qualitative comparison between the patient radiographs and the images contained in the atlas. mito,.16 (2002) established a new method for objectively evaluating skeletal maturation on cephalometric radiographs. a regression formula was determined to obtain cervical vertebral bone age based on ratios of measurements of the third and fourth cervical vertebral bodies. the purpose of this study was to apply the formula developed for japanese children to brazilian children and determine whether skeletal maturation using cephalometric radiographs could be used in this population as well. the study population was selected from patient files of the oral radiological clinic of the dental school of piracicaba, brazil. a total of 238 children (128 girls and 110 boys) aged 7.0 to 15.9 years had cephalometric and hand - wrist radiographs taken on the same day (table 1). none of these patients presented with congenital or acquired malformations of the cervical vertebrae or hand - wrist. the research protocol was approved by the ethics in research committee of the dental school of piracicaba and parental written informed consent was obtained for enrollment of the children in the study. all radiographs were taken with the same x - ray equipment at the same distance and using the same exposure factors. the hand - wrist radiographs were evaluated by the tanner - whitehouse (tw3) method, which assessed specific ossification centers of the hand and wrist (radius, ulna, and selected metacarpals and phalanges) leading to their classification into one of several stages. intra - operator error was calculated according to dahlberg 's formula3 using 10 cephalometric and 10 hand - wrist radiographs selected at random, which were re - assessed 10 days later. the formula for calculating cervical vertebrae bone age in japanese people was determined by a stepwise multiple regression analysis, with chronological age as a dependent variable and ratios of measurements in the third and fourth cervical vertebral bodies as independent variables, as follows : cervical vertebral bone age (cvba) = - 0.20 + 6.20 (ah3/ ap3) + 5.90 (ah4/ap4) + 4.74 (ah4/ph4), where ah is the anterior vertebral body height, ph is the posterior vertebral body height and ap is the anteroposterior vertebral body height (figure 1). all cephalometric radiographs were used to calculate cervical vertebral bone age, which were initially traced by hand on mate acetate film and evaluated by the same operator. bone age was assessed by the tw3 method and was used as a gold standard to determine the reliability of cervical vertebral bone age. using dahlberg 's formula3 for all cephalometric and hand - wrist radiographs, the intra - operator error was 0.01 and 0.09 months for male and 0.02 and 0.03 months for female, respectively, indicating sufficient accuracy of the measurements. based on an exploratory analysis of the data and confirmation that they had a normal distribution, an analysis of variance (anova) was used to compare cervical vertebral bone age, bone age and chronological age. all statistical analyses were performed using the sas statistical software (sas institute inc., the analysis of brazilian female children data showed that there was a statistically significant difference (p0.05) was found between cervical vertebral bone age and bone age (table 2). on the other hand, the analysis of brazilian male children data showed a statistically significant difference (p0.05) was found between chronological age and bone age for males (table 3). child development depends on individual differences in the magnitude of growth and time required to reach maturity. therefore, it is very important to identify the individual maturational levels. by evaluating the maturational periods, the clinician can make a decision on the treatment procedures and timing in a very suitable way13. it has long been recognized though that chronological age does not necessarily correlate with maturational age13. in spite of this knowledge, hand - wrist radiographs have been used for determination of children maturation and subsequent evaluation of growth potential during puberty. the information from hand - wrist radiographs has been used in different ways to evaluate the bone age of a child. the greulich - pyle method8 has been criticized in that it may be difficult to decide which standard to choose because of the differential rate of maturation in different bones12. acheson,.1 (1966) compared the reliability of the tanner - whitehouse method versus the greulich - pyle standards and concluded that a smaller inter - operator variance was found with the greulich - pyle method and a slightly smaller intra - operator variance with the tanner - whitehouse method. in this study, bone age was assessed by the tanner - whitehouse (tw3) method20 and was used as a gold standard to determine the reliability of cervical vertebral bone age. one of the main reasons for the rising popularity of the method is that cervical vertebral maturation can be assessed on lateral cephalometric radiographs, which is a type of film used regularly in orthodontic diagnosis2. however, almost all previous evaluations with cervical vertebrae on cephalometric radiographs used the lamparski method14, which evaluates growth in a subjective manner. this method takes into account morphological characteristics of the cervical vertebrae, as concavity of the lower border and height and shape of the vertebral bodies. the shapes of the cervical vertebral bodies of c3 and c4 change at each level of skeletal development. at first, they are wedge shaped, then changed to rectangular, next to square shape. also, the vertical dimensions increase and inferior vertebral borders, which are flat at the beginning and become concave when they mature10. san - roman,.19 (2002) reported that the morphological vertebral parameter best able to estimate the maturation was the concavity of the lower border of the body. therefore, concavity assessment was as accurate as the hassel and farman 's classification, and better than lamparski 's classification to assess skeletal maturation. the parameter applied in the present study was the measurement of vertebral bodies in order to solve or at least minimize the doubts inherent to all subjective cervical vertebral maturation methods. thus, the method developed by mito,.16 (2002) used in this study was of great importance because it established a formula for objectively evaluating skeletal maturation on cephalometric radiographs. these authors16 found that cervical vertebral bone age reflects skeletal maturity because it approximates bone age. however, their study population consisted of japanese girls only. in the present study, we measured bodies of the third and fourth vertebrae and calculated the cervical vertebral bone age. the japanese stepwise multiple regression showed that this formula can be used for female patients only because no statistically difference (p>0.05) was found between cervical vertebral bone age and bone age. differently, the formula can not be used for male patients because there was a significant difference (p<0.05) between cervical vertebral bone age and bone age, which shows considerable sex - dependent differences in the growth patterns. a new method for objectively evaluating cervical vertebral bone age in males is already being developed by our research team. the findings of the present study suggest that the method for objectively evaluating skeletal maturation on cephalometric radiographs by determination of vertebral bone age can be applied to brazilian females only. the development of a new method to objectively evaluate cervical vertebral bone age in males is needed. | objective : the purpose of this study was to investigate whether skeletal maturation using cephalometric radiographs could be used in a brazilian population.material and methods : the study population was selected from the files of the oral radiological clinic of the dental school of piracicaba, brazil and consisted of 128 girls and 110 boys (7.0 to 15.9 years old) who had cephalometric and hand - wrist radiographs taken on the same day. cervical vertebral bone age was evaluated using the method described by mito and colleagues in 2002. bone age was assessed by the tanner - whitehouse (tw3) method and was used as a gold standard to determine the reliability of cervical vertebral bone age. an analysis of variance and tukey 's post - hoc test were used to compare cervical vertebral bone age, bone age and chronological age at 5% significance level.results:the analysis of the brazilian female children data showed that there was a statistically significant difference (p0.05) was found between cervical vertebral bone age and bone age. differently, the analysis of the male children data revealed a statistically significant difference (p<0.05) between cervical vertebral bone age and bone age and between cervical vertebral bone age and chronological age (p<0.05).conclusions : the findings of the present study suggest that the method for objectively evaluating skeletal maturation on cephalometric radiographs by determination of vertebral bone age can be applied to brazilian females only. the development of a new method to objectively evaluate cervical vertebral bone age in males is needed. |
in healthy women of child - bearing age the protective mucosa in the vagina is populated with microflora typically dominated by lactobacilli, and their dominance over pathogenic anaerobes is positively associated with vaginal health. the majority of healthy women evidence only lactobacillus in the vagina. the function of lactobacilli is to maintain an environment that limits the growth of pathogenic microorganisms1. bacterial vaginosis (bv) represents the most common vaginal syndrome affecting fertile, premenopausal and pregnant women, with an incidence rate ranging from 20 to 50 per cent2. bv is not caused by one specific pathogenic microorganism, but rather by an imbalance of vaginal microbiota. in bv lactobacilli are replaced by gardnerella vaginalis, atopobium vaginae, prevotella, veillonella, megasphaera and other anaerobic microorganisms difficult to culture3. in bv the overgrowth of anaerobes produces noxious substances like polyamines and other compounds that trigger the release of pro - inflammatory cytokines interleukin (il)-1 and il-84. bv is frequently disregarded since the symptoms are often absent or insignificant ; however, the clinical consequences can be important. alterations in vaginal microbiology have been associated with many pathological conditions including late miscarriage and premature birth5. preterm birth is a major obstetric problem and a leading cause of neonatal morbidity and mortality. therefore, the bacterial biota of the human vagina can have a profound impact not only on the health of women but also on that of their neonates. a change in the vaginal microbiota has been also associated with pelvic inflammatory disease (pid) and cervicitis and is a risk factor for urinary tract infection and for the acquisition of sexually transmitted disease (std)67. an increasing body of data now indicates that abnormal vaginal flora lacking lactobacilli facilitates the acquisition of infections by parasites like trichomonas vaginalis and bacteria such as neisseria gonorrhoeae and chlamydia trachomatis8. moreover, several longitudinal observational studies have demonstrated that the absence of vaginal lactobacilli, as assessed by culture or gram stain, is an independent risk factor for viral sexually transmitted infections (stis) such as hiv, papillomavirus and herpes simplex virus infections79. bv may predispose to the acquisition of stis upon exposure because the local cytokine production associated with bv may facilitate the acquisition of infections. bv can profoundly affect, with different mechanisms, all the phases of a woman 's life in relation to reproduction, before pregnancy, during fertilization, through and at the end of pregnancy (fig. the bacterial biota of the human vagina can influence neonatal health by increasing the possibility of maternal - foetal and maternal - neonatal transmission of infections. bacteria, fungi, viruses and parasites are able to interfere with the reproductive function in both sexes. in female, c. trachomatis and n. gonorrhoeae are certainly involved in cervical, tubal, and peritoneal damage, while herpes simplex cervicitis is less dangerous10. bv can directly affect fertility, since an ascending dissemination of the involved species may lead to tubal factor infertility. stis (like chlamidiosis) may be present without symptoms or with symptoms that are mild and transient, but these may have severe long - term consequences such as infertility and ectopic pregnancy11. c. trachomatis is a major cause of tubal obstructions, lacerations and ectopic pregnancy. stds can also result in acute pelvic inflammatory disease (pid) which in turn can lead to sterility10. treatment for bv in non pregnant women involves oral or local administration of metronidazole or clindamycin and varies in efficacy from 48 to 85 per cent for absence of infection three or more weeks after treatment5. the long - term cure rate is low, bv recurs in up to 40 per cent of women within three months after initiation of antibiotic therapy and in up to 50 per cent of women after six months12. there are several unpleasant side effects and disadvantages associated with these therapies, including superinfections with pathogenic microorganisms and susceptibility of lactobacilli to clindamycin1314. more importantly, some vaginal pathogens, particularly g. vaginalis and anaerobic bacteria, have shown increasing drug resistance15. the use of probiotics to re - establish a physiological microbial flora of the female urogenital tract has long been under consideration and is now supported by some clinical evidence. the rationale for the use of probiotics in women is based on the genitourinary regulatory role played by the vaginal health microbiota and the need for restoration of this microbial ecosystem after insult16. lactobacilli are the organisms commonly used as probiotics. for probiotic applications to the urogenital tract to be successful, lactobacillus strains (lactobacillus brevis cd2, l. salivarius fv2 and l. plantarum fv9), present in florisia vaginal tablets - a probiotic product for vaginal use - have been selected for properties relating to mucosal colonization, i.e. their ability to adhere at high levels to human epithelial cells and to temporarily colonize the human vagina, for the production of antimicrobial compounds effective towards bv - related microorganisms and for the capacity to inhibit pathogen binding to the cell membrane1718. florisia vaginal tablets have been assessed for effectiveness in the treatment of symptomatic bacterial vaginosis in a double blind, placebo - controlled clinical trial. treatment with the probiotic preparation was 61 per cent effective in eliminating bv and 50 per cent effective in restoring it must be emphasized that the therapy, although not typically pharmacological but entirely probiotic, achieved a cure rate in the lower range of typical pharmacological therapies. the efficacy of vaginal probiotic treatment on the recurrence rate of bv has also been evaluated2021. lactobacillus supplementation (ecovagvaginal capsules containing l. gasseri lba eb01-dsm 14869 and l. rhamnosus lbp pb01-dsm 14870) after clindamycin treatment did not improve the efficacy of bv therapy during the first month of treatment, but it significantly reduced the recurrence rate of bv at 6 months from initiation of treatment20. moreover, probiotic prophylaxis with vaginal capsules containing l. rhamnosus, l. acidophilus, and streptococcus thermophilus (probaclac vaginal) resulted in lower recurrence rates for bv in women with a history of recurrent bv21. spandorfer investigated abnormal vaginal flora and vaginal pro - inflammatory cytokines in women with idiopathic infertility undergoing in vitro fertilization. a correlation between bacterial vaginosis, elevated il-1 and il-8, and idiopathic infertility was demonstrated. a recent study conducted in india evaluated the effectiveness of probiotic lactobacilli (florisia vaginal tablets) on vaginal health and pro - inflammatory cytokines23. as shown in table i, vaginal cytokines were significantly reduced in women cured from bv as well as in women that resulted not cured from bv (ncw) after probiotic treatment. the beneficial effect of lactobacilli treatment on local pro - inflammatory cytokines observed in the presence of a still altered vaginal microbiota suggests that probiotic administration could reduce the consequences of the host response to microbial products even in the absence of a substantial restoration of a healthy vaginal microbiota. effect of probiotic vaginal tablets on cytokine concentration recently it has been demonstrated that the lipopolysaccharide (lps) receptor, toll like receptor 4 (tlr4), and peptidoglycan receptor, tlr2, are expressed in human sperm24. the authors demonstrated that after recognizing bacterial endotoxins, the activated tlrs reduce sperm motility, induce sperm apoptosis and significantly impair the potential for fertilization. many microorganisms seem to be involved in male reproductive failure in various ways, and to different degrees of statistical association. infections of the male genito - urinary tract may cause a microbial colonization of the semen that may affect sperm motility and viability. however, the presence of an altered microbiota in the female genital tract may also affect the fertilization potential. it has been demonstrated that genital discharges of asymptomatic infertile women are characterized by the presence of gardnerella vaginalis, enterobacteriaceae or enterococci and streptococcus agalactiae25. studies from our group indicated that products released by escherichia coli, enterococcus faecalis, staphylococcus epidermidis and candida albicans, common opportunistic microorganisms of the female genital tract, strongly reduced sperm motility (table ii). it is possible to hypothesize that bacterial cell wall components are responsible for the detrimental effect exerted by gram positive and gram negative bacteria on sperm motility. the negative effect caused by c. albicans suggests that other mechanisms could be also involved. effect of common opportunistic microorganisms of the female genital tract on sperm motility in the presence of a healthy vaginal microbiota, opportunistic microorganisms are in very low numbers. the absence of lactobacilli and their by - product lactic acid triggers an increase of vaginal ph, thereby disrupting physiological mechanisms that might inactivate or contain the pathogens1626. moreover, lactobacilli are able to produce other bacteriostatic and bactericidal compounds (h2o2, bacteriocins) capable of killing bacteria. a commercially available lactobacilli mixture (florisia cd pharma india pvt. ltd. india) showed a bactericidal effect on common opportunistic microorganisms of the female genital tract. as shown in table iii, e. faecalis and s. epidermidis were inactivated after 3 h co - incubation with physiological concentrations of lactobacilli whereas e. coli and c. albicans were unaffected. the inhibition was exerted without any effect on ph values suggesting that properly selected lactobacilli may be of prophylactic value in preventing various urogenital disorders in women. bactericidal effect of florisia probiotic lactobacilli on common opportunistic microorganisms of the female genital tract a study by barbonetti evaluated the effect of florisia probiotic lactobacilli on sperm motility and viability. the rationale for this study was based on the increased concentration of il-1 in vaginal environment of bv - affected women that could trigger the generation of reactive oxygen species (ros). ros - induced lipid peroxidation, affecting membrane integrity and flexibility, represents a major factor in the aetiology of sperm dysfunction, because it impairs both tail motion and sperm - oocyte fusion. in this study, fluorophore - loaded sperm samples were preincubated with the probiotic mix in a transwell system in which two independent compartments are delimited by a 0.4-m pore membrane. motile sperm suspension and viable lactobacilli were placed on the lower and the upper compartments of the chamber, respectively. after 30 min of incubation, sperm lipid peroxidation was induced by exposure to ferrous sulphate added to the lower compartment and lipid peroxidation was evaluated by flow cytometry. pretreatment with lactobacilli prevented sperm lipid peroxidation induced by ferrous sulphate and the detrimental effect exerted on both cell motility and viability. the same group evaluated the protective effects of vaginal probiotic lactobacilli on the sperm damage induced by different microorganisms, frequently present in the vaginal environment. using the transwell system, they demonstrated that sperm co - incubation for 1 h with lactobacillus strains (l. brevis cd2, l. salivarius fv2 and l. plantarum fv9), present in florisia vaginal tablets eliminated the negative impact exerted by microorganisms on sperm motility and viability (fig. 2). these preliminary in vitro results indicate the potential for vaginal probiotic lactobacilli to improve the fertilization potential of the female host in the presence of vaginal disorders. sperm motility was evaluated with computer - aided semen analysis (casa) and sperm vitality was evaluated under light microscope by the eosin technique, after coincubation of motile spermatozoa with e.coli (3 10 cfu / ml), s. epidermidis (3 10 cfu / ml), e. faecalis (3 10 cfu / ml) or c. albicans (0.5 10 cfu / ml. to avoid direct contact between motile spermatozoa and microorganisms, co - incubations were carried out in a transwell system, where two independent compartments are delimited by a 0.4 m pore membrane. overall significance for treatment variations : p<0.01 with anova ; and # p<0.05 vs untreated and vs samples with florisia (tukey 's studentized range - honestly significant difference). case - control and cohort studies have shown that bv in pregnant women is associated with several adverse health outcomes. besides obstetrical complications, unrecognized chlamydial and gonococcal infections and virus reactivation during pregnancy can determine maternal - foetal or maternal - infant transmission. the centers for disease control have recommended that only patients at high risk for preterm delivery specifically only those with a previous history of a spontaneous preterm birth should be treated with antibiotics if they are found to have bacterial vaginosis528. metronidazole is the drug of choice and multiple studies and meta - analyses have not demonstrated a consistent association between metronidazole use during pregnancy and teratogenic or mutagenic effects in infants. however, metronidazole is a pregnancy category b drug since animal studies have revealed no evidence of harm to the foetus, but no adequate, well - controlled studies among pregnant women have been conducted. probiotic use to treat bv during pregnancy could represent an effective alternative option to antibiotics. several recent studies have indicated that exposure to probiotics during pregnancy is safe. in 2009, a meta - analysis and systematic review of randomized controlled trials of probiotic use in more than 1500 pregnant women did not report an increase in adverse foetal outcomes29. there was no increase in the incidence of miscarriages or malformations and no significant difference in birth weight, gestational age, or the incidence of cesarean section. similar results were obtained from randomized control trials on more than 2000 pregnant women published following the above meta - analysis30. oral administration of multistrain probiotics (vsl#3) to improve pregnancy outcomes has recently been tested in a pilot study, with some success in terms of modulating immune parameters and the vaginal microbiota31. the use of selected probiotic strains can eliminate bv and also exert an antiviral effect, thus reducing viral load and preventing foetal and neonatal infection. vaginal lactobacilli are shown to inhibit herpes simplex type 2 (hsv-2) replication in culture cells32. it was demonstrated that highly adhesive lactobacillus strains inhibited hsv-2 infection when present during virus adsorption and all the tested strains significantly reduced virus yield when present during hsv-2 multiplication. in a subsequent study the mechanisms of l. brevis antiviral activity towards hsv-2 was evaluated33. bacterial extract from l. brevis cells and l. brevis cell wall strongly inhibited hsv-2 replication. the inhibitory activity was resistant to high temperature and protease digestion and appeared to be associated with compounds with a molecular weight higher than 10,000 kda. s - layer removal from l. brevis cells strongly reduced the antiviral activity of both bacterial extract and cell wall fragments. it was concluded that the inhibitory activity was due to a heat - resistant non protein cell surface bacterial component. indigenous microorganisms can help the host overcome infection, maintain vaginal health and prevent infections of the reproductive tract. the administration of beneficial microorganisms (probiotics) can also aid recovery from infection and restore and maintain a healthy vaginal ecosystem, thus improving female health also in relation to reproductive health. | the human vaginal microbiota plays an important role in the maintenance of a woman 's health, as well as of her partner 's and newborns. when this predominantly lactobacillus community is disrupted, decreased in abundance and replaced by different anaerobes, bacterial vaginosis (bv) may occur. bv is associated with ascending infections and obstetrical complications, such as chorioamnionitis and preterm delivery, as well as with urinary tract infections and sexually transmitted infections. in bv the overgrowth of anaerobes produces noxious substances like polyamines and other compounds that trigger the release of pro - inflammatory cytokines interleukin (il)-1 and il-8. bv can profoundly affect, with different mechanisms, all the phases of a woman 's life in relation to reproduction, before pregnancy, during fertilization, through and at the end of pregnancy. bv can directly affect fertility, since an ascending dissemination of the involved species may lead to tubal factor infertility. moreover, the increased risk of acquiring sexually transmitted diseases contributes to damage to reproductive health. exogenous strains of lactobacilli have been suggested as a means of re - establishing a normal healthy vaginal flora. carefully selected probiotic strains can eliminate bv and also exert an antiviral effect, thus reducing viral load and preventing foetal and neonatal infection. the administration of beneficial microorganisms (probiotics) can aid recovery from infection and restore and maintain a healthy vaginal ecosystem, thus improving female health also in relation to reproductive health. |
patients with lumbar pain have greater atrophy of the deep trunk muscles than healthy subjects and they also have weakened proprioceptive senses, which trigger spinal instability, which in turn becomes the cause of recurrent lumbar pain1. lumbar stability is a prerequisite element that enables movement of the limbs by maintaining the spine upright in postural changes and under loading2. muscles that contribute to lumbar stability include the transversus abdominis, and the internal, and external obliques of the abdomen, quadratus lumbrum and multifidus of the trunk posterior region, and the pelvic floor muscle3, 4. in particular, the multifidus and the transversus abdominis are activated faster than the other muscles when the human body moves, adjusting trunk balance, and the bilateral internal obliques are important for maintaining the lateral stability of the spine and spinal bending ability. various lumbar stability exercises have been used to maintain and improve lumbar stability through isometric contraction of the abdomen and the lumbar region. bridge exercise, one of lumbar spine exercises, is a closed kinetic chain, weight bearing exercise, which induces contraction of the multifidus and transversus abdominis. it also improves the coordination of the large muscles of the body surface surrounding the trunk, and is effective at recovering adjustment capabilities of the trunk3, 5. abdominal drawing - in contracts the transversus abdominis and the internal obliques and induces concurrent contraction of the muscles during lumbar stability exercise, reducing excessive lumbar lordosis or pelvic anterior tilt that may occur during bridge exercise2. recent research concerning lumbar stability exercise has used equipment such as an unstable base, a balance plate, a ball for treatment, and a sponge pad. osullivan.7 noted that performing stabilization exercises in a dynamic environment, for example, using a ball for treatment rather than a static environment, maximized balance ability. page8 also observed that exercise using an unstable device was effective for postural control and recovery of the somatic senses. previous studies compared trunk stability using an abdominal drawing - in method during bridge exercise or compared trunk stability and muscle activity using bridge exercise on an unstable base of support. however, research that compares lumbar stability and the thickness of abdominal muscles by conducting bridging exercise with an abdominal drawing - in method on stable and unstable bases of support has been lacking. accordingly, this study of support examined the effects of the abdominal drawing - in bridge exercise using a pressure biofeedback device on different bases on the thickness of trunk and abdominal muscles and lumbar stability. thirty young adults (2 males, 28 females) were recruited for this study. subjects were randomly and equally assigned to a stable bridge exercise group (sbeg) (1 male, 14 female) and an unstable bridge exercise group (ubeg) (1 male, 14 females). those who had problems with muscles, the skeletal system, or the nervous system or had pain in the lumbus or the pelvis during ordinary activities, or could not performt bridge exercise because they had pain in the knees or ankles were excluded. the intent of this study and the content of the entire experiment were sufficiently explained to the subjects and voluntary consent was to participation was received from them. the meansd age, height, and weight of the sbeg were respectively 19.870.35 years, 162.846.62 cm, and 58.349.36 kg, and the meansd age, height, and weight of the ubeg were respectively 20.620.42 years, 162.744.85 cm, and 57.379.73 kg. analysis of gender was made with the test, and that of age, height, and weight was conducted with the independent t - test. the subjects performed a bridge exercise using an abdominal drawing - in method on a stable base and an unstable base. in order to provide an unstable base for the bridge exercise using an abdominal drawing - in method of an airex balance pad (alcan - airex ag, sins, switzerland) with a width of 50 cm, length of 41 cm, and height 6, the subjects opened both arms to form an angle of about 30 degrees, with the knee joints bent at 90 degrees, and placed the palms on the base. then with the knees and feet shoulder width the head and the neck were maintained straight with the eyes looking at the ceiling. the subjects held up the pelvis according to the tester struction of hold up the buttocks and maintained the posture for 15 seconds (contraction) according to the tester instruction of maintain the position and lowered the pelvis to the ground for 5 seconds (relaxation) according to the tester instruction of place down. at this moment the tester directed the subjects to draw in the navel in the upper posterior direction (lumbar direction) so that the abdominal area slightly subsided. ten repetitions of this process were considered one set and a total of six sets were conducted3. this study employed ultrasonic diagnostic equipment (mysonou5, samsung medison, korea) in order to examine changes in the thicknesses of the trunk and abdominal muscles prior to and after the bridge exercise using an abdominal drawing - in method. a 12 mhz linear probe was used and the measured area was marked during the first measurement in order to measure the same position. the subjects relaxed the abdominal area and comfortably lay in a supine position on the testing board. the probe was transversely placed on the top of the iliac chest, and moved toward the center of abdomen. the probe was stopped where all of the external obliques, internal obliques, and transversus abdominis were visible. the thickness of the internal obliques and transversus abdominis was measured at a point 13 mm moved distal from the region where the fascias of the muscles met9. for the measurement of the multifidus, the subject lay comfortably in the prone position, and the probe was placed perpendicularly on the left transverse process of the fourth lumbar spine. the thickness from the left transverse process to the surface muscles was measured10. the subjects were instructed to abstain from talking, laughing, or chewing during the data collection period and all images were captured and measured at maximal inspiration. in order to evaluate static and dynamic lumbar stability prior to and after the bridge exercise using an abdominal drawing - in method, contractibility of the transversus abdominis was measured using a pressure biofeedback unit (pbu) (stabilizer, chattanooga group inc., hixson, usa)11. the pbu is an inelastic 16.724.0 cm sack that can be inflated is connected to a pressure gauge, and excessive changes in pbu pressure show that movement of the lumbar pelvic area is not being adjusted. for the measurement of static lumbar stability (sls), subjects lay in the prone position on hard ground and the pbu was placed below the navel at the midpoint between the bilateral anterior superior iliac spines. at a pbu baseline pressure of 70 mmhg, the subject pulled in their abdomen as maximally as possible for 10 seconds without moving the lumbus or hip joint, relieving pressure in the pbu. for the measurement of dynamic lumbar stability (dls), the subjects lay in the supine position. at a pbu was placed 2 cm below the posterior superior iliac spine vertically from the lumbar spine. with the baseline pressure of 40 mmhg, the hip and knee joints of one leg were bent and the foot was placed on the ground and the hip joint was abducted to about 45 degrees. the changes in pbu were measured and recorded when the subject returned to the starting position12. in order to minimize the sway of the trunk during measurement, spss version 12.0 (spss, chicago, il, usa) was used for the statistical analysis of the data. the independent t - test was conducted in order to compare the general characteristics of the two groups, and the paired t - test was performed in order to compare the muscle thickness and lumbar stability of each group between prior to and after the exercise of each group. the independent t - test was used in order to compare muscle thickness and lumbar stability between the groups prior to and after the exercise. p<0.05 ; sbeg stable bridge exercise group ; ubeg unstable bridge exercise group ; tra transversus abdominis ; io internal obliquus abdominis ; sls static lumbar stability ; dls dynamic lumbar stability according to the comparison of the pre - intervention and post - intervention results of the sbeg and the ubeg, only tra was significantly different in the sbeg ; however, tra, io, sls, and dls were significantly different in the ubeg (p<0.05) (table 1). according to the comparison of the results the sbeg and the ubeg at pre - intervention, and post - intervention, and the change between pre- and post - intervention, none of the items were significantly different (p < 0.05) (table 2). this study compared the effects of bridge exercise using an abdominal drawing - in method on stable and unstable bases of support on the thicknesses of lumbar and abdominal muscles and lumbar stability. the purpose of spinal stability exercise is to protect spinal joints from repetitive micro - damage caused by the muscles around the spine, pain from spinal instability, and degenerative spinal changes5. the abdominal drawing - in method is effective at activating abdominal muscles, in particular, the transversus abdominis4. susan.12 reported that ultrasonography of the transversus abdominis showed activation of the muscle after abdominal drawing - in exercise. stevens.5 reported that bridging exercise with the lumbar spine in the neutral position increased activity of the abdominal muscles, but did not significantly increase activity of the multifidus. this result is consistent with those of the present study which the thickness of the transversus abdominis significantly increased (p<0.05) when the bridge exercise using an abdominal drawing - in method was performed on different bases. on the other hand, we consider this is because compensation bridge exercise using the abdominal drawing - in method increased activity of the abdominal muscles and minimizes substitutions, such as through increased lumbar lordosis, relatively reducing action by erector spinae muscles such as the multifidus. cholewicki and mcgill13 observed that stability indexes of the lumbar spine during performance of different tasks were higher in tasks that placed a lot of load on the lumbar spine. when instability in the base of support increases, more muscles for stability and balance maintenance, and more load on the lumbar spine increases muscle contraction14. this result is consistent with those of the present study in which bridge exercise on the unstable base significantly increased (p<0.05) dynamic and static lumbar stability relative to bridge exercise on the unstable base. adjusting the degree of difficulty of the bridge exercise on the unstable base, inducing greater trunk muscle activity, and improving lumbar stability may have resulted in a better exercise effect than exercise on the stable base of support. lumbar pain triggers fast contraction of the abdominal muscles and impairs muscle function, and compared to healthy subjects, lumbar pain patients muscle recruitment patterns are modified15 resulting in instability between spinal segments. therefore, in clinical treatment of lumbar pain patients, conducting lumbar stability exercise using an abdominal drawing - in method minimizing compensation by the lumbar spine, should be effective at increasing muscle strength and the spinal instability of the lumbar region. | [purpose ] we examined the effects of an abdominal drawing - in bridge exercise using a pressure biofeedback unit on different bases on the thickness of trunk and abdominal muscles, and lumbar stability. [subjects ] thirty healthy young adults (2 males, 28 females) took part in this study. the subjects were randomly and equally assigned to a stable bridge exercise group and an unstable bridge exercise group. [methods ] the subjects performed bridge exercises using an abdominal drawing - in method on a stable base and on an unstable base, and changes in their abdominal muscle thickness and on the stable and on unstable bases lumbar stability were evaluated. [results ] after the intervention, the stable bridge exercise group showed a statistically significantly increased muscle thickness in the transversus abdominis, and the unstable bridge exercise group showed significantly increased muscle thicknesses of the transversus abdominis and internal obliques in static and dynamic lumbar stability. the unstable bridge exercise group showed significant increase after performing the exercise. [conclusion ] lumbar stability exercise, with the compensation of the lumbar spine minimized, using an abdominal drawing - in method on an unstable support of base is effective and efforts to prevent the compensation may induce a greater exercise effect. |
the bottom or opposing wall of the uticulo - endolymphatic (bast s) valve is the moving and thus functional part of the valve. this structure was discovered by bast, who called it the utriculo - endolymphatic valve. the morphology of the valve has been researched in humans and several mammalians [1, 5, 10 ]. bast himself suggested the closure of the utricular duct as the main function [3, 4 ]. bachor and karmody follow bast s view, postulating that decreasing pressure in the whole endolymphatic system, secondary to collapse of the ductus reuniens, causes closure of the valve to prevent more loss of endolymph from the utricular system. zechner proposes that dysfunction of the valve causes endolymphatic hydrops. in this paper orthogonal - plane fluorescence optical sectioning (opfos) microscopy [6, 1517 ] was used to obtain detailed three - dimensional reconstructions of bast s valve and the surrounding region in the intact guinea pig inner ear, as it is a technique capable of visualizing bone as well as soft tissue structures with high resolution, and is non - invasive. two healthy female albino guinea pigs (harlan laboratories, uk), weighing 450 g, were used. animal care and use were approved by the experimental animal committee of groningen university, protocol no. after decapitation the bullas were dissected and fixated in a 10% formalin solution, neutrally buffered. decalcification in ethylenediaminetetraacetic acid 10% solution (edta ; sigma, ed5ss, ph 7.4) took place at a temperature of 50c in a microwave oven (t / t mega microwave histoprocessor, milestone) in eight sessions of 6 h. after decalcification the bullas were again rinsed with aqua - dest and dehydrated in a graded seven - step ethanol series (30%, 50%, 70%, 90%, 96%, 100%, and 100%). spalteholz fluid, a 5:3 solution of methyl salicylate (sigma, m-6752) and benzyl benzoate (sigma, b-6630), was thereafter used to achieve transparency of the specimen. the clearing process consisted of application of a succession of spalteholz - ethanol solutions, 24 h each. the spalteholz fluid fraction in the clearing session was 25%, 50%, 75%, 100%, 100%, respectively. hereafter the specimen was dyed in a fluorescent dye bath of rhodamine - b isothiocyanate (ritc ; sigma, r-1755). the dye bath was prepared by dissolving 1.0 mg / ml ritc into ethanol, followed by dilution in spalteholz fluid to a final dye concentration of 5 10 mg / ml [15, 16 ] (voie 2003). a schematic diagram of the optical setup of our custom - made opfos imaging device is shown in fig. 1. laser light, originating from a green frequency doubled nd : yvo4 neodymium - laser (model dpgl-2050, suwtech), with an emission wavelength of 532 nm and 52 mw maximal power, is expanded into a parallel beam of 28 mm diameter by a galilean beam expander (be, model 336, spectra - physics). the broadened and spatially filtered light falls onto a specially designed cylindrical lens (cl, custom - made by litetec ltd., essex, uk) of 30 30 mm and 80 mm focal length, which focuses the light along a single dimension (z), thus creating a hyperbolic light pattern along the x - axis. near the center of this focus, we can locally approximate the light intensity profile as a sheet of light in the x y plane, which will perform virtual slicing of a specimen object (o). in the plane where the object is sectioned by the sheet of light, the specimen emits fluorescence light, which is recorded by a ccd - camera (c, firewire fo442bic, foculus) in the direction orthogonal to the light plane. in this way, a 2d image of a virtual section within the object is obtained. for the specimen to be compatible with the opfos method, the above described specimen preparation is necessary to make the object transparent, refraction index matched and fluorescent. in our setup the specimen is positioned inside a container with optical quality glass windows at the laser and ccd side, and filled with spalteholz fluid, and can be positioned within the container by an object translation stage (ots). between recordings the object (and not the container) is moved along the z - axis in small slicing steps with a high - precision dc - motor driven translation stage with position encoder (m112.1 high - resolution micro - translation stage with c862 mercury ii dc - motor controller, pi polytec). a long working distance microscope objective lens (ol) with good numerical aperture (m plan apo 5, na = 0.14, mitutoyo) projects the fluorescence image on the ccd. a colour filter (kenko r1 sr-60) placed before the objective lens blocks scattered laser light and transmits fluorescence light. (be : beam expander, fs : field stop, cl : cylindrical achromat, o : object, ots : object translation stage, fts : focusing translation stage, ol : objective lens with colour filter, ccd = charge coupled device camera) orthogonal - plane fluorescence optional sectioning (opfos) set - up. (be : beam expander, fs : field stop, cl : cylindrical achromat, o : object, ots : object translation stage, fts : focusing translation stage, ol : objective lens with colour filter, ccd = charge coupled device camera) the virtual slicing is performed by a plane with 3 m 1/e-thickness resolution in the center of the image and slightly thicker at the edges (less than 10 m), with slicing steps of 2 m, followed by storage in a personal computer. the two - dimensional stored images were processed with an imod (http://bio3d.colorado.edu/imod) software package for 3d - reconstruction. input of relevant contours in each 2d - image was manually performed with a writing tablet (wacom cintiq 15x). two healthy female albino guinea pigs (harlan laboratories, uk), weighing 450 g, were used. animal care and use were approved by the experimental animal committee of groningen university, protocol no. after decapitation the bullas were dissected and fixated in a 10% formalin solution, neutrally buffered. decalcification in ethylenediaminetetraacetic acid 10% solution (edta ; sigma, ed5ss, ph 7.4) took place at a temperature of 50c in a microwave oven (t / t mega microwave histoprocessor, milestone) in eight sessions of 6 h. after decalcification the bullas were again rinsed with aqua - dest and dehydrated in a graded seven - step ethanol series (30%, 50%, 70%, 90%, 96%, 100%, and 100%). spalteholz fluid, a 5:3 solution of methyl salicylate (sigma, m-6752) and benzyl benzoate (sigma, b-6630), was thereafter used to achieve transparency of the specimen. the clearing process consisted of application of a succession of spalteholz - ethanol solutions, 24 h each. the spalteholz fluid fraction in the clearing session was 25%, 50%, 75%, 100%, 100%, respectively. hereafter the specimen was dyed in a fluorescent dye bath of rhodamine - b isothiocyanate (ritc ; sigma, r-1755). the dye bath was prepared by dissolving 1.0 mg / ml ritc into ethanol, followed by dilution in spalteholz fluid to a final dye concentration of 5 10 mg / ml [15, 16 ] (voie 2003). a schematic diagram of the optical setup of our custom - made opfos imaging device is shown in fig. 1. laser light, originating from a green frequency doubled nd : yvo4 neodymium - laser (model dpgl-2050, suwtech), with an emission wavelength of 532 nm and 52 mw maximal power, is expanded into a parallel beam of 28 mm diameter by a galilean beam expander (be, model 336, spectra - physics). the broadened and spatially filtered light falls onto a specially designed cylindrical lens (cl, custom - made by litetec ltd., essex, uk) of 30 30 mm and 80 mm focal length, which focuses the light along a single dimension (z), thus creating a hyperbolic light pattern along the x - axis. near the center of this focus, we can locally approximate the light intensity profile as a sheet of light in the x y plane, which will perform virtual slicing of a specimen object (o). in the plane where the object is sectioned by the sheet of light, the specimen emits fluorescence light, which is recorded by a ccd - camera (c, firewire fo442bic, foculus) in the direction orthogonal to the light plane. in this way, a 2d image of a virtual section within the object is obtained. for the specimen to be compatible with the opfos method, the above described specimen preparation is necessary to make the object transparent, refraction index matched and fluorescent. in our setup the specimen is positioned inside a container with optical quality glass windows at the laser and ccd side, and filled with spalteholz fluid, and can be positioned within the container by an object translation stage (ots). between recordings the object (and not the container) is moved along the z - axis in small slicing steps with a high - precision dc - motor driven translation stage with position encoder (m112.1 high - resolution micro - translation stage with c862 mercury ii dc - motor controller, pi polytec). a long working distance microscope objective lens (ol) with good numerical aperture (m plan apo 5, na = 0.14, mitutoyo) projects the fluorescence image on the ccd. a colour filter (kenko r1 sr-60) placed before the objective lens blocks scattered laser light and transmits fluorescence light. (be : beam expander, fs : field stop, cl : cylindrical achromat, o : object, ots : object translation stage, fts : focusing translation stage, ol : objective lens with colour filter, ccd = charge coupled device camera) orthogonal - plane fluorescence optional sectioning (opfos) set - up. (be : beam expander, fs : field stop, cl : cylindrical achromat, o : object, ots : object translation stage, fts : focusing translation stage, ol : objective lens with colour filter, ccd = charge coupled device camera) the virtual slicing is performed by a plane with 3 m 1/e-thickness resolution in the center of the image and slightly thicker at the edges (less than 10 m), with slicing steps of 2 m, followed by storage in a personal computer. the two - dimensional stored images were processed with an imod (http://bio3d.colorado.edu/imod) software package for 3d - reconstruction. input of relevant contours in each 2d - image was manually performed with a writing tablet (wacom cintiq 15x). figure 2a shows an opfos image of a cross - section of part of the guinea pig inner ear. 2a inside the dashed box, in which bast s valve and its surrounding structures are clearly visible. the opposite walls are adjacent to perilymph (hypodense ; compliant). connective tissue (medium density ; non - compliant) is present inside the lip of bast s valve and between the upper side of the utricule and bone. figure 2c is another opfos image, showing bast s valve in detail. 2(a) 2d opfos - image of the region around bast s valve and the utricular duct, obtained with another opfos setup than for (c) and following. the dashed box is shown in a larger magnification in (b), (b) dashed box in (a) shown in a larger magnification, (c) 2d opfos - image of bast s valve. the arrows point toward very narrow passages (a) 2d opfos - image of the region around bast s valve and the utricular duct, obtained with another opfos setup than for (c) and following. the dashed box is shown in a larger magnification in (b), (b) dashed box in (a) shown in a larger magnification, (c) 2d opfos - image of bast s valve. the arrows point toward very narrow passages figure 3 shows a 3d - reconstruction of the entrance of bast s valve as seen from inside the utricle. figure 4 shows a 3d - reconstruction of walls of bast s valve and the utricular duct. the shape of the utricular duct at the utricular side is that of a flattened funnel. the shape of the utricular duct at the utricular side is that of a flattened funnel. this funnel runs into a very narrow duct 3d - reconstruction of bast s valve as seen from inside the utricule 3d - reconstruction of walls of bast s valve and the utricular duct. the shape of the utricular duct at the utricular side is that of a flattened funnel. this funnel runs into a very narrow duct figure 5 is a 3d - reconstruction of part of the outer walls of the utricle and utricular duct. it again shows the small caliber of the utricular duct in relation to the size of surrounding structures. 53d - reconstruction of part of the outer walls of the utricle and utricular duct. note the small caliber of the utricular duct in relation to the size of surrounding structures 3d - reconstruction of part of the outer walls of the utricle and utricular duct. note the small caliber of the utricular duct in relation to the size of surrounding structures in the 3d opfos - reconstruction of the entrance of bast s valve, shown in fig. 3, the lip of the valve appears as a relatively rigid structure. in a comparable scanning electron microscopy (sem) image the entrance of the valve is visible as a narrow slit in the utricular wall. the valve lip is filled with connective tissue (fig. this is even better visible in fig. 6, which is a light microscopy (lm) image. this figure also clearly shows that the bottom of the valve has a thickness of only one cell - layer, and is as result highly compliant. fig. 6light microscopy image of lip and bottom of bast s valve light microscopy image of lip and bottom of bast s valve schuknecht and belal showed that the corium of the valve consists of fibroblasts and fibrocytes. based on the study of 170 human temporal bones these authors propose that the valve is closed in normal ears and that its anatomical structure is ideally suited to permit the occasional egress of excessive accumulation of endolymph to be processed in the endolymphatic sac, while preventing an excessive loss of endolymph with the possible consequence of membrane distortions and interference with the motion mechanics of the vestibular sense organs. opening of the valve, still according to schuknecht and belal, would then be accomplished by pressure displacement of the outer membraneous wall away from the more rigid inner valve lip. bast himself was not sure about the valve being opened or closed in the normal situation. he writes : as a matter of fact in many histological sections the epithelium of the valve is in contact with the opposing wall of the slit - like opening of the duct which suggests that such a closure may exist, at least at times, in the living ear. on the one hand he supposed that a high perilymphatic pressure could close the valve by moving the opposing wall against the valve lip, as shown in fig. 7. on the other hand he proposed closing of the valve lip against the opposing duct wall in the case of a relatively greater intra - utricular pressure. in this case he supposes that it is not the tip of the valve that moves, because it is bulky, but that the valve lip rotates at its base, where it is made up of loose perilymphatic tissue. 7possible mechanism of valve closure (black arrows) or valve opening (grey arrows) possible mechanism of valve closure (black arrows) or valve opening (grey arrows) in our opinion the latter mechanism is less likely, considering the observation that the valve opening in 3-d reconstruction is a rigid arch - like structure (fig. 3), and not a flap hinged at its base, that could close an underlying opening. the latter mechanism may be inspired by 2-d pictures, like fig. 2b, c and 6, where the valve tip appears as a flap - like structure. the rigidity of the valve tip was also noticed by scheerer and hildmann, who also thought it to be improbable that this structure can function as a valve. the walls of the endolymph filled spaces in the inner are highly compliant. as a result the pressure difference between endolymph and perilymph are negligible in the normal situation. if the valve is open it seems, at first impression, easy to understand how an increase of perilymphatic pressure will close the valve by compression of its bottom, as is shown in fig. 7 however, an increasing perilymphatic pressure will also increase the endolymphatic pressure inside the utricule and force endolymph out through the slit - like opening and prevent closure of the valve [11, 18 ]. as can be seen in figs. 4 and 5 the utricular duct has a diameter in the order of 10 m at its narrowest passage, preventing rapid flow of endolymph and possibly protecting the sensitive vestibular receptors against large fluid shifts in a short time. konishi found an open utriculo - endolymphatic valve in guinea pigs with an (experimental) endolymphatic hydrops. it is conceivable that an excess of endolymph will force the base of the valve opening away from the lip, as shown in fig. 7. in future work, high - resolution opfos (hropfos) with slicing, a resolution of 2 m is feasible and may reveal even more detail. the use of opfos imaging techniques and graphical 3d - reconstruction of the uticulo - endolymphatic (bast s) valve and its surroundings has given some additional insight in its functioning. it is most likely that opening or closure of the valve occurs through movement of the flexible base away from or toward the relatively rigid valve lip. | the utriculo - endolymphatic valve was discovered by bast in 1928. the function of bast s valve is still unclear. by means of orthogonal - plane fluorescence optical sectioning (opfos) microscopy 3d - reconstructions of the valve and its surrounding region are depicted. the shape of the duct at the utricular side is that of a flattened funnel. in the direction of the endolymphatic duct and sac this funnel runs into a very narrow duct. the valve itself has a rigid arch - like configuration. the opposing thin, one cell - layer thick, utricular membrane is highly compliant. we propose that opening and closure of the valve occurs through movement of the flexible base / utricular membrane away from and toward the relatively rigid valve lip. |
hypertension is the major factor responsible for the most deaths worldwide (around 7 million or 12.8% per year) and this is 46% more than tobacco usage, the next major risk factor. from an epidemiological and clinical perspective, blood pressure at the higher end of the normal population distribution is associated with an increased risk of cardiovascular mortality and morbidity. but clinical risk assessment is based on a predefined threshold at which the quantitative blood pressure phenotype in converted into a binary trait (hypertension) and management strategies are directed towards blood pressure reduction below this threshold at which the risk of excess cardiovascular events is abolished. hence large - scale efforts to dissect the genetic underpinnings of hypertension are justified. while the causation of hypertension is multifactorial with both genetic and environmental components, the purpose of this paper is to discuss the genetic determinants of high blood pressure and gwas study design. for any genetic study, whether studying blood pressure as a quantitative trait or the qualitative hypertension phenotype depends on whether one follows the pickering argument that blood pressure is inherited as a graded character, and hence a complex non - mendelian trait, or the platt suggestion that hypertension is a qualitative abnormality and a simple mendelian disease. the observed normal unimodal distribution of blood pressure and its complex multifactorial aetiology support studies of blood pressure as a quantitative phenotype. according to the latter argument, if hypertension is a dichotomous risk trait, one would expect a bimodal distribution and this is not observed. however both approaches are useful and complementary in the genetic dissection of this trait which has so far been extremely resistant to the gwas approach. there are multiple strands of evidence showing that genetic factors contribute to blood pressure and hypertension. firstly, the normal distribution of blood pressure in the general population indicates the presence of multiple environmental and genetic factors and thus a polygenic aetiology. secondly, rare monogenic forms of hypertension associated with major defects in renal salt handling prove that gene mutations can cause hypertension leading to a hypothesis that minor variations in these genes may contribute to the common essential hypertension. finally from a population perspective, there is considerable evidence from twins and family aggregation studies indicating the presence of a heritable component. it is estimated that around 30% of variation in blood pressure is due to genetic factors. hypertension is about twice as common in individuals who have one or two hypertensive parents, and blood pressure is more closely correlated in monozygotic than dizygotic twins [4, 5 ]. in the montreal adoption study investigators compared blood pressure correlation between biological sibling pairs and adoptive sibling pairs (as well as parent - child correlations). sbp correlation coefficients were 0.38 and 0.16 for biological and adopted siblings, respectively, and dbp coefficients 0.53 compared with 0.29 respectively. two measures that are commonly used to assess the genetic component of a trait are heritability (h) which is the fraction of variation in disease susceptibility due to genetic factors, and sibling recurrent risk (s) which is the degree of elevated risk of disease for a sibling of an affected individual compared with a member of the general population. the heritability of clinic systolic blood pressure is around 1540% and 1530% for clinic diastolic blood pressure [7, 8 ] ; whereas for ambulatory night - time systolic and diastolic bp the heritabilities are 69% and 51%. it is pertinent to point out that though the heritability estimates are considerable, this does not equate to magnitude of genetic effect. this is because the denominator in the estimate of heritability comprises measurement error and variances attributable to genes, shared environment, unshared environment and unmeasured determinants. this is illustrated by the example above where minimizing measurement errors by using ambulatory night - time values inflates the heritability estimates. heritability is also a property of the population studied and low heritability estimates would suggest that genetic mapping would be difficult for that phenotype. the sibling recurrent risk of hypertension is around 1.21.5, indicating a phenotype with modest genetic effect. the field of common complex disease genetics has in recent years moved from linkage to association study design because association analysis has far greater power to detect variants of modest effect and of lower frequency. the monogenic diseases are examples of diseases which are under very strong negative selection primarily because they affect fitness and are less likely to be transmitted to the next generation. the monogenic mendelian forms of hypertension are thus rare, and responsible gene mutations are highly penetrant, and under very strong selection which keeps them at low frequencies with high levels of allelic heterogeneity. in contrast, susceptibility variants involved in essential hypertension are likely to have low or medium penetrance and are probably not subject to such strong selection resulting in lower allelic heterogeneity and greater prevalence of the trait. to detect loci conferring a genotypic relative risk of 1.5 (minor allele frequency (maf) = 0.1) by linkage analysis requires an estimated 67,816 affected sibling pairs (asps) whereas detection is possible through association with just 2218 singletons. moreover it is easier to recruit participants from the general population (than families as required for linkage), and there are fewer sampling restrictions in some disease categories such as late onset. association studies are typically performed in unrelated population samples (although it is possible to conduct them on related individuals). for qualitative traits they measure statistical association between a disease (phenotype) and genetic marker (genotype) directly by comparing allele frequencies of cases and controls. the aim is to establish whether a particular allele occurs in cases, compared with controls, more frequently than expected by chance. quantitative traits, for example, blood pressure, cholesterol, and glucose, are assessed for association using linear regression. this measures the association between a phenotype and a marker allele (or tag snp), which is correlated with the true causal allele due to linkage disequilibrium (ld). linkage disequilibrium is defined as the statistical association, within gametes in a population, of the alleles at two loci it is assumed that typically a causal variant will not have been typed in gwas which take advantage of ld to genotype a set of tag snps as proxies for the entire set of snps. the amount of ld between two loci is summarised by the metric r (squared correlation coefficient for each snp) which varies between 0 and 1. the maximum r can be used to translate coverage (measure of how well the snps that are part of a genotyping set capture all known variants) to the sample size that is required for an indirect association study. to cover unobserved loci well an r value of 0.8 with typed loci are more likely to be inherited together because they are physically close to each other on the chromosome. but this is not necessarily the case ; studies have shown that levels of local ld vary, with some adjacent snps being independent despite their proximity and others of 100 kb apart being in a high or a significant ld. patterns of ld are affected by many factors such as population growth, population structure, admixture, natural selection, genetic drift, rate of recombination and mutation, and gene conversion. traditionally association studies tested hypotheses based on candidate genes, for which there was prior evidence (of known physiological pathways that affect the phenotype in question) that a genetic variant influenced disease risk. there are several potential reasons for this, which highlight the drawbacks of candidate gene studies : the wrong genes may have been selected ; the causative genes may be upstream or downstream from the genes studied ; discovery of genetic variants in novel pathways is not possible as candidate gene studies rely on a priori information regarding disease mechanisms. in addition to the above there are the possibilities of population stratification, phenotypic and locus heterogeneity, and insufficient sample size : problems common to candidate gene studies and gwas. finally the snps studied might not provide complete coverage of the variants within the genes. the chance of detecting genetic variants that influence common disease depends on the underlying genetic architecture. that is to say, the number of susceptibility alleles, whether they are common or rare, their frequency, and whether their action is neutral or deleterious. common alleles and those of high frequency are of course easier to detect, as are deleterious alleles. the entire gwas strategy is based on the common disease common variant (cdcv) hypothesis, that the causative genes for common diseases have relatively simple allelic spectra, that is, one or a few predisposing alleles of relatively high frequency. for gwas it has been suggested that, as a rough guide, snps should meet a threshold of maf 1% or maf 5% to be considered common. as yet there is insufficient empirical evidence to determine the validity of the cdcv hypothesis, and arguments for and against have been put forward. these are crucial to research using snp mapping to predict common disease risk, which assumes that the theory is by and large accurate (linkage studies of families or asps, by contrast, are robust to allelic heterogeneity). a key part of the argument against the cdcv hypothesis rests on the fact that the risk of common disease depends on the interaction of many genes and environmental factors. in particular late - onset disorders of high prevalence in modern western society have been heavily influenced by changes in lifestyle factors such as diet and physical activity, and not by common disease - predisposing alleles. the risk conferred by any one factor, whether genetic or environmental, is weak and most cases are not predominantly determined by genetic variance. on the other hand, the relative risks observed in family members (a more rapid than linear decline in risk with increasing distance of relationship) support the conclusion that the majority of risk is due to a modest number of loci with common disease - predisposing alleles. the existing evidence suggests that alleles of both high and low frequency play a part in common disease [1722 ]. wang. have argued against making a distinction between rare and common disease - predisposing alleles. instead they propose that the allelic spectrum of disease associated variants be considered in the context of all variants in the human genome. in this framework the neutral model is that the allelic spectrum of disease variants and that of all variants are the same. most susceptibility variants would be rare (maf 1% would still account for more than 90% of genetic differences between individuals and therefore make a significant contribution to phenotypic variation. common diseases vary in their allelic spectra depending on the evolutionary forces exerted upon them ; nevertheless it is estimated that each will likely have hundreds of common and rare variants contributing to their familial clustering. the international hapmap project is a global consortium mapping all common snps in different populations across the world. the availability of snp maps from hapmap led to a revolution in the dissection of common diseases and traits based on the common disease common variant hypothesis using the gwas approach. this is a hypothesis - generating approach where no assumptions are made regarding the location or function of the causal variant. the dense genotyping chips that are now available contain hundreds of thousands of tag snps and offer increasingly better coverage of the human genome (whether within or outside genes). adequate coverage requires 300 000 snps with more needed for african samples due to greater genetic diversity in those populations and thus less ld [24, 25 ]. though there is some concern that a set of tag snps that were selected in one population may not perform well in another [11, 14 ], the availability of dense snp arrays will overcome this. there is also evidence of good tag snp transference across populations [26, 27 ]. this is especially true for different populations within the same continent ; the greatest disparities are between african and non - african samples. while gwass scan the genome for association signals without selecting for gene regions, jorgenson and witte have argued for a gene - centric approach to gwas. the reasons they outline are the following : genic variants are more likely to be functionally important than nongenic ; variants in many genes are in lower ld than those outside genes so may be difficult to capture through indirect association. by focusing solely on genes and not the whole genome the genic approach has greater power to detect variants within genes but suffers from a loss of power for nongenic variants. despite this jorgenson and witte demonstrated empirically using hapmap data that it is more efficient in detecting causal variants than the indirect whole - genome approach when related to genotyping burden. their suggestion of the best overall gwas approach is to combine indirect genotyping data with gene - based snps in high priority regions, or alternatively to use a more stringent ld threshold in genic regions to over - capture genic snps. a limitation of gwas is that they are very expensive, especially with the large sample sizes that are required for small effects. however, technological advancements are rapidly reducing the cost of genotyping. in a bid to further reduce costs, some researchers have adopted a two - stage gwas study approach. in stage 1 a proportion of the samples are genotyped on all markers, and then in stage 2 a proportion of these markers are genotyped in the remaining samples. another approach to make studies more economical is the use of common controls for several groups of different disease cases. this was recently demonstrated by the wellcome trust case control consortium (wtccc). in 2008 donnelly summarised all gwas recorded at that time in the national human genome research institute catalogue, which amounted to more than 300 replicated associations for more than 70 common diseases and quantitative traits. as of september 2009, there were more than 500 published gwas at p 5 10 (see figure 1). by convention statistical significance using frequentist methods is determined using the p - value threshold of.05, with values below this considered significant (i.e., there is evidence to reject the null hypothesis of no effect). this is not appropriate for gwas because the large number of tests performed increases the chance of type i error. an alternative threshold, proposed by risch and merikangas and now widely adopted, is p 100) that are unrelated to the question of interest to assess artefactual association [48, 5153 ]. a scaling factor is then applied to the association results to adjust for the level of ethnic variation observed. a similar approach is structure assessment (sa), which too uses unlinked genetic markers for detection but then attempts to match homogeneous subgroups of the sample for association analysis within these subpopulations [5457 ]. it is assumed that any significant association observed within a subpopulation can not be due to population structure ; there is an issue, however, about how many subpopulations to apply since they are a theoretical concept. explicit detection / correction methods by principal components analysis have also been employed [58, 59 ]. due to the large number of markers genotyped in gwas it is possible to detect low levels of stratification. however, a caveat to all of these detection methods is that with a large enough sample size even small biases will be statistically significant and may lead to overcorrection. this is partly due to the so - called winner 's curse, which is a bias whereby genetic effect size estimates are overestimated in initial discovery studies of disease - predisposing variants. the degree of effect size inflation can be reduced or eliminated by increasing sample size, and several correction methods have been proposed (e.g., [60, 61 ]). technical bias can occur if cases and controls are not genotyped and analysed together in the same way. it is also thought that poor choice of controls and population stratification affect data quality and therefore play a part in replication failure. meta - analyses that have examined replication failure indicate that in the majority of instances false positives are to blame [17, 62 ]. replication of gwas findings is as important as replication of candidate gene associations, if not more so. the large number of snps studied in gwas and resulting volume of statistical tests performed increases the likelihood of observing type i errors, that is, false positives. in 2007 an nci - nhgri (national cancer institute and the national human genome research institute in the us) working group on replication in association studies published an excellent summary of their recommendations on the reporting of initial association studies and criteria for replication. there are certain situations in which there are insufficient participant numbers for replication, such as rare diseases or environmental exposures. these concerns do not affect most association studies of common diseases, though, so usually replication is advised. a strategy that increases power over that of individual studies and may be more cost effective than replication is meta - analysis of genome wide datasets [64, 65 ]. this collaborative way of working is increasingly common as investigators attempt to detect loci with smaller effects. to date there have been few gwas of hypertension and/or blood pressure, with varying degrees of success in detecting associations with genetic variants. the wtccc, made up of over 50 british research groups, conducted a gwas study of 2000 cases each for 7 complex diseases of major public health importance ; bipolar disorder, coronary artery disease, crohn 's disease, hypertension, rheumatoid arthritis, type 1 diabetes, and type 2 diabetes. these were compared with 3000 shared common controls that came from two sources : 1500 from the 1958 british birth cohort and 1500 blood donors that were recruited for the project. the 2000 hypertension cases were unrelated participants from the british genetics of hypertension (bright) study. over the entire genome there were 21 snps identified with p values lower than the genome wide significance threshold of 5 10. of these, 10 were known associations. unfortunately, of the 7 diseases of interest, hypertension could be described as the loser in that it was not associated with any snps at p < 5 10. moreover there was no evidence for any of the variants previously associated with hypertension (at least partly due to some not being well tagged by the affymetrix chip, for example, promoter of the wnk1 gene). there were, however, a similar number and distribution of marginal results (with p - values between 10 and 10) to the other case groups. it was speculated that the lack of a positive result for hypertension in the wtccc study may have been due to poorly tagged variants or that hypertension may have few common risk alleles with larger effect sizes. due to the high prevalence of hypertension and its existence on the continuum of blood pressure some of the controls may have been misclassified cases. it was estimated that the misclassification of 5% of controls (i.e., if 5% of controls were in fact undiagnosed cases) would translate to a loss of power equivalent to a 10% reduction in sample size. this is because of the dilution of any observable genetic difference, caused by the blurring of the distinction between cases and controls. considering the expense of genome - wide association analysis and the anticipated relatively small effect sizes any reduction in power poses a serious problem. moreover individuals with blood pressure in the mid - range of normotension (that is not considered to pose a risk clinically) may still be at increased risk in relation to individuals with low - blood pressure. two recent studies that have had considerably more success are the global blood pressure genetics (global bpgen) consortium study, conducted by newton - cheh. (2009), and the cohorts for heart and aging research in genome epidemiology (charge) consortium study, conducted by levy. but in contrast to the wtccc, these were studies of blood pressure as a quantitative trait and on hypertension. both had very large discovery samples, providing sufficient power to overcome variations in genotyping platform, participant ascertainment and method of blood pressure measurement between component studies. each dealt with the confounding effect of antihypertensive medication by adding 15 mmhg to recorded sbp and 10 mmhg to dbp for those who were on such treatment. in the global bpgen discovery gwas (n = 34,433) two snps achieved p < 5 10 (considered genome wide significance for this analysis). once these and borderline significant findings were meta - analysed with validation data there were eight loci associated with either dbp or sbp genome - wide. the initial gwas was not conducted for hypertension due to lack of power, so instead the significant loci were examined in planned secondary analysis (n range = 57,41099,802). in the secondary samples all eight alleles showed association with hypertension in the same direction of effect as continuous blood pressure. it should be noted that all of the reported associations translate to a very small change in blood pressure, approximately 1 mmhg per allele sbp or 0.5 mmhg per allele dbp. however, the effects of multiple variants can be combined to produce a meaningful change in population cardiovascular risk. taking a genome wide significance threshold of p < 4 10, the charge discovery gwas (n = 29,136) identified 13 significant snp associations for sbp, 20 for dbp, and ten for hypertension. there is quite a bit of overlap between phenotypes with many of the top hits attaining significance in the same direction of effect for more than one phenotype. the top ten loci for sbp, dbp, and hypertension (30 in total) in the charge cohort were checked for significance in the global bpgen results. one snp for sbp, four for dbp, and one for hypertension were assessed for independent replication in global bpgen. five snps out of this six attained p <.008, the threshold for external replication in global bpgen. when the results for the same 30 snps in both studies were analysed together by meta - analysis, there were four associations of genome wide significance (p < 5 10) for sbp, six for dbp, and one for hypertension. again effect sizes were very small, approximately 1 mmhg change in sbp per allele or 0.5 mmhg change in dbp per allele. the remaining published studies have demonstrated far less success in identifying genetic variants that are associated with either hypertension, sbp, or dbp. many have not observed any snps that reached genome - wide significance [66, 67, 7375 ]. one possible reason for this failure in some studies is that hypertension and/or blood pressure were not the primary trait of interest, or not of a priori interest when the cohort was recruited therefore phenotyping may not have been necessarily thorough. another possibility is that there were not enough snps studied to provide sufficient coverage of the whole genome ; in some studies fewer than 100 000 snps passed quality control measures [66, 67, 74 ]. table 1 summarises the most significant hits from gwas of hypertension and/or blood pressure published since 2007 (other than wtccc, global bpgen, and charge), along with meta - analysed discovery and replication results if replication was attempted. one study conducted by sabatti. is omitted from the table because the authors did not publish any results for blood pressure, instead reporting that analysis of blood pressure did not produce any genome - wide significant results. however it was not the primary trait of interest ; the authors also studied triglycerides, hdl, ldl, crp, glucose, insulin, and bmi.. failed to find any associations of genome - wide significance but had limited genomic coverage, studying just 70,897 and 79,447 snps, respectively. furthermore the discovery sample employed by wang. was small at 542 participants. the vast majority of gwas thus far have been conducted on samples of caucasian individuals of european ancestry. one of the few studies to examine african americans was that of adeyemo.. their initial findings were promising ; however replication was either not attempted (in the case of sbp) or the replication findings were in the opposite direction of effect (dbp and hypertension). following an initial dearth of positive results from gwas of hypertension and blood pressure, the methodological advancement and achievements of recent studies provide optimism and guidance for continued work in this area. where to now in the search for further novel gene polymorphisms ? one approach that has been proposed to increase the likelihood of detecting genetic effects is the recruitment of hypercontrols and individuals with severe hypertension. this requires high fidelity phenotyping, with the overall study design comparing cases and controls at the extreme high and low ends, respectively, of the blood pressure distribution. this would markedly reduce the risk of misclassification bias and thus minimise any resultant loss of power. much of the unexplained variation in blood pressure may be due to rare variants that are undetectable through traditional gwas case - control study design. however, intensively genotyped samples are becoming available from the 1000 genomes project, an open resource catalogue of human genetic variation. the project is run by an international consortium and aims to describe over 90% of genetic variation down to 1% maf. to date the genomes of more than 1000 individuals have been sequenced (with planned expansion to 2000 individuals in 2010) and around 10 million novel variants identified. the resource will enable the study of low frequency variants and aid fine mapping of regions of interest. furthermore, next - generation deep sequencing technology is now available which will also increase the chances of rare variant detection. all of this is carried out with the ambition to improve the diagnosis and treatment of this widespread condition. | despite its significant genetic component, the study of hypertension by genome - wide association presents more challenges than other common complex diseases. its high prevalence, heterogeneity, and somewhat unclear definition are the challenges that need to be overcome on one hand. on the other hand, there are issues of small effect sizes and pleiotropism that are not specific to hypertension alone but nonetheless magnify the problems of genetic dissection when coupled with phenotypic misclassification. we discuss issues of study design and summarise published genome - wide association studies (gwass) of hypertension and blood pressure. with careful study design and analysis success is possible, as demonstrated by the recent large - scale studies. following these, there is still further scope to advance the field through high fidelity phenotyping and deep sequencing. |
localized gingival growths are one of the most frequently encountered lesions in the oral cavity and peripheral ossifying fibroma (pof) is one of them. pof is a focal, reactive, non - neoplastic tumor like growth of the soft tissue that often arises from the interdental papilla. though the etiopathogenesis is uncertain, an origin from cells of the periodontal ligament has been suggested. it tends to occur in the 2 and 3 decades of life, with the peak prevalence between the ages of 10 and 19 years. a 30-year - old female patient reported with the complain of discomfort during chewing and speaking due to a growth in the left lower posterior region of the jaw, which started as a small papule approximately 8 months ago and gradually increased in size with time to attain present size. her medical history was non - significant and no h / o any medication at that time. intraoral examination revealed an approximately 2 cm 2 cm sessile, non - tender, firm, pale pinkish growth present on the interdental gingiva in relation to the mandibular left canine - premolar region [figures 1 and 2 ]. the lesion was extending from mesial of left lateral incisor to the mesial of left first premolar and up to the level of the occlusal surface, causing occlusal interference. radiographically, there was angular bone loss in relation to mandibular left canine and premolar with displacement of mandibular left canine [figure 3 ]. clinical presentation of the lesion with pathologic migration of 33, left side view clinical presentation of the lesion, lingual view intraoral periapical radiograph of 33, 34 showing angular bone loss the differential diagnosis included irritation fibroma, pyogenic granuloma and pof. based on the clinical and radiographic findings, the provisional diagnosis of irritation fibroma was made. the periodontal treatment plan included patient education and motivation for oral hygiene instructions and quitting the habit, scaling and root planing, reevaluation and surgical excision of the lesion under local anesthesia. after 1 week of scaling and root planing, a reevaluation and surgical excision down to the periosteum were performed [figure 4 ] and periodontal dressing was placed [figure 5 ]. patient was given post - operative instructions and was prescribed with analgesic (tablet ibuprofen-400 mg tds every 4 - 6 h as needed for pain) and antimicrobial rinse (0.2% chlorhexidine gluconate twice - a - day for 1 week). the excised tissue [figure 6 ] was placed in 10% neutral buffered formalin and sent for the histopathologic examination. immediately after excision, left side view periodontal dressing placed, left side view biopsy specimen microscopically consisted of hyperplastic parakeratinized stratified squamous epithelium with thin, long and anastomosing rete ridges and fibrous connective tissue containing several irregularly shaped trabeculae of bone, droplets of basophilic cementum - like material and numerous plump fibroblasts [figure 7 ]. histopathological slide (40) showing basophilic cementum - like material and numerous plump fibroblasts at 1 week post - operative visit, patient presented for periodontal dressing removal and follow - up examination. patient is on regular follow - up at 6 months post - operative without any recurrence [figure 9 ]. post - operative 1 week showing uneventful recovery, left side view post - operative 6 months with no recurrence of the lesion and repositioning of 33, left side view the reasons for considering periodontal ligament origin for pof include exclusive occurrence of pof in the gingiva (interdental papilla), the proximity of gingiva to the periodontal ligament and the presence of oxytalan fibers within the mineralized matrix of some lesions. excessive proliferation of mature fibrous connective tissue is a response to gingival injury, gingival irritation, subgingival calculus or a foreign body in the gingival sulcus. chronic irritation of the periosteal and periodontal membrane causes metaplasia of the connective tissue and resultant initiation of formation of bone or dystrophic calcification. almost two - third of all cases occur in females, with a predilection for the anterior maxilla. hormonal influences may play a role, given the higher incidence of pof among females, increasing occurrence in the 2 decade and declining incidence after the 3 decade. the size of the pof ranges from 0.4 to 4.0 cm and whites (71%) are more frequently affected than blacks (36%). histologically, when bone and cementum - like tissues are observed, the lesions have been referred to as cemento ossifying fibroma. the term cemento ossifying has been referred to as outdated and scientifically inaccurate. moreover, on h and e staining it is difficult to the distinguish histologically between cementum and bone. mineralized products in the form of trabeculae of woven and/or lamellar bone, cementum like material and dystrophic calcification are noticed. radiopaque foci of calcifications have been reported to be scattered in the central area of the lesion, but not all lesions demonstrate radiographic calcifications. underlying bone involvement is usually not visible on a radiograph. in rare instances, superficial erosion of bone the following features are usually observed during the microscopic examination : (1) intact or ulcerated stratified squamous surface epithelium ; (2) benign fibrous connective tissue with varying numbers of fibroblasts ; (3) sparse to profuse endothelial proliferation ; (4) mineralized material consisting of mature, lamellar or woven osteoid, cementum - like material or dystrophic calcifications ; and (5) acute or chronic inflammatory cells in lesions. moreover, histopathologically, lamellar or woven osteoid pattern predominates ; hence, the term pof is considered more appropriate. the carbon dioxide laser can effectively excise the lesion and has been shown to allow diagnostic microscopic evaluation with a minimal distortion of the biopsy sample. the advantages of laser excision are minimal post - surgical pain and no need for suturing the biopsy site. this precise tissue destruction can also result in partial or incomplete removal of the base of the pathologic lesion, which can lead to recurrence. thus, surgical excision including the involved periodontal ligament and periosteum is the preferred treatment, which was performed in this case. pof is a benign, slowly progressive lesion, with limited growth. clinically difficult to diagnose, so histopathologic confirmation is mandatory. complete surgical excision down to the periosteum is the preferred treatment and as the recurrence rate is high (8 - 20%), close post - operative follow - up is required. | localized gingival growths are one of the most frequently encountered lesions in the oral cavity, which are considered to be reactive rather than neoplastic. different lesions with similar clinical presentation make it difficult to arrive at a correct diagnosis. these lesions include pyogenic granuloma, irritation fibroma, peripheral giant cell granuloma, peripheral ossifying fibroma (pof). among these lesions, an infrequently occurring gingival lesion is the pof. considerable confusion has prevailed in the nomenclature of pof due to its variable histopathologic features. this is a case presentation of a 30-year - old female with gingival overgrowth in the mandibular left canine - premolar region. clinically, the lesion was asymptomatic, firm, pale pinkish and sessile. surgical excision of the lesion was done followed by histopathologic confirmation with emphasis on the clinical aspect. given the rate of recurrence for pof being 8 - 20%, close post - operative follow - up is required. |
an 18-year - old male patient presented with pneumothorax on postoperative day four after the minimally invasive repair of pectus carinatum. the pectus carinatum repair was performed using the sandwich technique, which involves a 33.02-cm press - molded internal bar and a 30.48-cm press- molded external bar (fig. a small- bore central venous access catheter was inserted to relieve the pneumothorax in a less invasive manner. a chest computed tomography scan indicated the presence of multiple bullae at the apex of the upper lobe of the right lung. on postoperative day seven after the pectus repair, three days after the development of pneumothorax, we decided to remove the bullae through video - assisted thoracoscopic surgery (vats) because the lung collapse was persistent. under general anesthesia, using double - lumen endotracheal intubation with the patient in the left lateral decubitus position, a 10-mm thoracoscopic port was placed at the eighth intercostal space of the middle axillary line, below the pectus bar insertion level in order to avoid bar interruption. a 2-cm working incision was made at the fourth intercostal space of the anterior axillary line and a 5-mm working port incision was made at the subscapular tip area of the posterior axillary line for a three - port vats approach. vats exploration using a 30 thoracoscope (karl storz endoscope ; karl storz, tuttlingen, germany) revealed minimal hemothorax and multiple apical multiple bullae as indicated by the preoperative computed tomography scan. a finding that we did not anticipate was that the middle lobe of the right lung was entrapped between the chest wall and the pectus bar. adhesion was present around the pectus bar and the entrapped lung, but we did not observe air leakage at that moment (fig. the entrapped lung was separated from the adhesion and carefully pulled out of the pectus bar. however, a portion was injured, and it had to be resected with endostaplers (tristapler ; covidien, norwalk, ct, usa). an air leak test confirmed that both resected areas of the apex and the entrapped middle lobe were airtight. bio - absorbable felt (neoveil ; gunze, osaka, japan) was used to cover the lesions, followed by glue injection on the resected lesions. pectus deformity repair using pectus bars is a standard operation to correct pectus excavatum that has been widely performed since its development in 1998 by donald nuss. pneumothorax is one of the early postoperative complications of this procedure, and is caused by an incidental lung injury or air that was retained during the surgical procedure. in order to prevent this early complication, we routinely insert hemovac catheters into the bilateral pleural cavities in cases of the parallel insertion of two bars, intrapleural procedures, such as suturing for the placement of hinge plates, or in adult cases. however, primary spontaneous pneumothorax, caused by the rupture of subpleural blebs or bullae, may occasionally occur in combination with pectus repair. in such instances, it is difficult to determine the etiology of the pneumothorax and the subsequent treatment strategy. initially, pneumothorax can be conservatively managed by chest tube or catheter insertion, but prolonged air leakage or recurrent pneumothorax must be treated by thoracoscopic wedge resection. lung entrapment by surgical hardware is sharply distinct from usual cases of trapped lung, in which a part of the lung is unexpandable due to pleural inflammation, the development of adhesion after a surgical procedure, such as coronary artery bypass surgery, or pleural diseases including empyema, hemothorax, tuberculosis, and pleuritic. the entrapment of part of the lung can occur in pectus repair using pectus bars, and it may be difficult to recognize without surgical exploration. our vats finding, although it was incidentally discovered during a surgical procedure for pneumothorax, clearly demonstrated that the lung was caught between the pectus bar and the chest wall in our patient. in our case, a sizable portion of the parenchyma of the right middle lobe was caught between the pectus bar and the anterior chest wall, with adhesions formed around it. the cause of pneumothorax was uncertain in this case because no definitively identifiable ruptured bullae were leaking air at the time of surgery. although the air leak points in the entrapped lung were also uncertain, we thought that the damaged lung may have been leaking air, which may have been the cause of the pneumothorax. our surgical approach, therefore, combined resecting all bullae that we encountered and relieving the lung entrapment, which was ultimately accompanied by the removal of some damaged lung tissue. we report a case of spontaneous pneumothorax involving lung entrapment in a pectus bar and multiple bullae in the lung. this case demonstrates that pectus repair may be complicated by lung entrapment in the pectus bar. | we report a case of an entrapped lung after the pectus bar repair of a pectus deformity. the entrapped lung was found incidentally during video - assisted thoracoscopic surgery (vats) for pneumothorax. based on vats exploration, multiple bullae seemed to be the cause of the pneumothorax, but the entrapped lung was suspected to have been a cause of the air leakage. |
apparent shortfalls between the supply of health professionals and demand for their services can be addressed in four main ways : (i) increasing training places ; (ii) improving retention of qualified people in the workforce ; (iii) improving productivity of the existing workforce and (iv) managing demand. in this study, we focus on the second of these avenues. published research, based on the australian 2006 census of population and housing, on the gap between the number of persons qualified in a health care profession and the number working in that profession. this research showed varying levels of retention across health professions across the working life - span. for some professions, most of those qualified were working in the profession immediately post - graduation and were still employed in their occupation at age 60 (e.g. optometry 85% and 58%, respectively). while for others, a minority was employed immediately post - graduation and into their 60s (e.g. social work 40% and 21%, respectively). the australian health workforce advisory committee (ahwac) also identified large gaps between the number of people with qualifications and the number working in their occupation. health. attrition in the allied health workforce has been attributed to various factors including family responsibilities, burnout, poor work environment, limited graduate or early career employment opportunities and absence of career paths with acceptable remuneration and opportunities to apply high level skills and capabilities. a growing number of allied health graduates are entering expanding post - graduate medical programs. while a valid pathway into medicine, this increases the effective cost of training the allied health workforce. we define the real cost of training the practitioner workforce as the total cost of training (incurred by the student, government and clinical facilities) averaged over the expected years in clinical practice, for each health profession. losses to the health workforce during and following training increase the real cost of training per working health professional. the various resources put into training are spread over fewer professional years of service, reducing the return on the training dollars spent (all else equal). the traditional response to workforce shortfalls has been to increase training places, but for occupations with high student drop - out and poor workforce retention, this can prove an expensive way of delivering additional health professionals. recent australian and canadian health workforce modelling studies have found that improving retention is critical to reducing projected shortages of the nursing workforce. there is a large literature on issues relevant to health workforce retention, such as changes in working hours, temporal changes in productivity, explanations of intention to stay or leave, factors predicting retirement and strategies to improve skill mix. while it is known that the cost of education and training varies across disciplines, what has not been reported is how student retention and time in the workforce affect the real cost of training the health workforce. the aim of this research was to estimate the expected working life in selected health professions, using data on qualification and employment status collected in the 2011 australian census. we also assess what this means for return on investment in training the health workforce, expanding on research by leach. as far as we can ascertain, this is the first attempt in australia, and possibly internationally, to model the expected length of a clinical career and relate this to training cost. the true cost of training per year of employment in each of 16 health professions is estimated and compared. this contributes to an understanding of how retention influences the cost of achieving a multidisciplinary workforce. we focus on those health professions involved in community - based multidisciplinary care for common chronic conditions (table 1). core allied health in the 2006 ahwac report and allow for qualifications to be mapped onto a health occupation. table 1.percent of persons with a non - school qualification in selected health occupations who were employed in that occupation, by age group. australia, 2011.2024 (%) 2529 (%) 3034 (%) 3539 (%) 4044(%)4549 (%) 5054 (%) 5559 (%) 6064 (%) 6569 (%) 7074 (%) 75 + (%) allied oral health51454646424542443723134audiology5472646551584947171600dentistry48586365656163655846246general nursing6163595654504844331341general medicine/ general practice656652495055585854443112nutrition and dietetics3544393334333327261980occupational therapy7676635655564945271220optometry84827774817478756649277pharmacy78756665646265594829164physiotherapy8577676669736762442293podiatry9289848179738072422375radiography8585807674756963452481speech pathology8883706561656055322360data source : abs 2011 census of population and housing.apersons in australia who reported a non - school qualification in a field of study whose main occupation in the previous week matched the field of study. australian standard classification of education (asced), field of education classifications were mapped to australian and new zealand standard classification of occupations (anzsco) as follows : audiology speech professionals and audiologists ; dentistry dentist ; general nursing generalist medical practitioner ; nutrition and dietetics (only including those with degree qualifications)dietician (this category includes both dieticians and nutritionists) ; occupational therapy occupational therapist ; optometry optometrist and orthoptist, pharmacy pharmacists, physiotherapy physiotherapists, podiatry podiatrists, speech professional and audiologist.bcensus data can not separate allied oral health occupations presenting them jointly as dental hygienists, technicians and therapists ; this group has been mapped to combined qualification data of persons who identify a non - school qualification in dental technology, dental studies not further defined / not elsewhere classified.ccombined data of persons who identify a non - school qualification in general medicine and general practice. due to census coding limiting to a general practice qualification would underestimate the general practice workforce. when the two qualification categories are combined, the number of generalist medical practitioners is similar to the total of registered hospital non - specialists and gps in the 2011 nhwds registration data.dlimited to pharmacy qualification at bachelor level and above, to exclude non - registrable qualifications of pharmacy assistant roles expanded with the opening of new pharmacy schools in australia in recent years. dietetics and nutrition qualifications are grouped together in the census. included nutrition and dietetics qualifications were limited to bachelor degree level and above for the purposes of this table. percent of persons with a non - school qualification in selected health occupations who were employed in that occupation, by age group. persons in australia who reported a non - school qualification in a field of study whose main occupation in the previous week matched the field of study. australian standard classification of education (asced), field of education classifications were mapped to australian and new zealand standard classification of occupations (anzsco) as follows : audiology speech professionals and audiologists ; dentistry dentist ; general nursing generalist medical practitioner ; nutrition and dietetics (only including those with degree qualifications)dietician (this category includes both dieticians and nutritionists) ; occupational therapy occupational therapist ; optometry optometrist and orthoptist, pharmacy pharmacists, physiotherapy physiotherapists, podiatry census data can not separate allied oral health occupations presenting them jointly as dental hygienists, technicians and therapists ; this group has been mapped to combined qualification data of persons who identify a non - school qualification in dental technology, dental studies not further defined / not elsewhere classified. combined data of persons who identify a non - school qualification in general medicine and general practice. due to census coding limiting to a general practice qualification would underestimate the general practice workforce. when the two qualification categories are combined, the number of generalist medical practitioners is similar to the total of registered hospital non - specialists and gps in the 2011 nhwds registration data. limited to pharmacy qualification at bachelor level and above, to exclude non - registrable qualifications of pharmacy assistant roles expanded with the opening of new pharmacy schools in australia in recent years. dietetics and nutrition qualifications are grouped together in the census. included nutrition and dietetics qualifications were limited to bachelor degree level and above for the purposes of this table. the gap between reported qualifications and workforce participation was derived from the australian bureau of statistics (abs) 2011 census of population and housing, using the table builder pro tool. the census provides almost total coverage of the population, with employment and education questions having response rates of 9599%. the census asks respondents the main field of study of their highest non - school qualification and the occupation in their main job in the week prior to census night, also coded into industry classifications. the proportion of persons with a qualification in a healthcare field who were identified as working in the occupation with the same name was extracted (see table 1 note (a) for explanation). employment by sector was established from the variable public or private employer (options private sector ; government national, state / territory or local ; employer type not stated). owner / manager of an incorporated or unincorporated business. undergraduate costs were estimated from 2015 course fees for domestic full - fee paying university students in victoria (obtained from university websites). student attrition rates for 2012 were obtained from the australian government department of education and training (det) for this study. mean university education costs per completing student by profession were calculated by applying det completion rates to the multiple possible education pathways, weighted by enrolment. estimating the costs of undergraduate clinical training in hospitals and other health services is part of the work of the independent hospital pricing authority teaching, training and research inquiry, yet to be completed. in its absence, we took published daily payment rates by discipline multiplied by the mean discipline - specific clinical placement days. three professions must complete an internship following graduation to practice independently audiology, medicine and pharmacy (plus medical radiation under some education pathways). a recent report of the australian health ministers advisory council treats interns as a cost with no compensating contribution, which we also adopt. the cost is thus calculated as the sum of intern salaries (including wage on - costs), plus a premium to cover the costs of supervision, education and training facilities. the cost of education and training of an entry - level health professional is thus the sum of university fees, undergraduate clinical training and graduate internship (where required for independent practice). to estimate the expected mean number of years in the health profession, we created a model using census data. the model draws on the change over the working life span (from age 20 to 80 years) in the proportion of persons with qualifications in a field still working in their occupation. although the census data are cross - sectional, the model in effect treats the distribution of those in an occupation as if it were a cohort based on a well - established technique used by the abs to calculate life expectancy. the reduction in the proportion working in an occupation across age groups is assumed in the first instance to represent retiring is multiplied by the estimated average years of service, from mid-20 s which shows that the vast majority of students graduate by age 30. the weighted sum of each age group s contribution to years of service as they retire provides the estimate of the expected mean number of years of service for that profession. temporary exits are dealt with in a secondary analysis, drawing on the census data and implied return to work in the peak child bearing years (30 to 40 years) to adjust downwards expected years in the profession. the total estimated cost of education and training, accounting for student attrition is then divided by the expected years of service to provide an estimated cost of training per year working as a health professional. independent testing of core assumptions and model outputs was conducted using the national health workforce dataset (nhwds), collected routinely as part of national registration of health practitioners. the nhwds was not the primary data source in this study as the data are limited to the registered allied health professions and there are only three years of data. these data were used to test the assumed age of first entering the professional workforce and the mean time lost to temporary exits. there was considerable variability across the health professions in the proportion of people who work in the health professions for which they are qualified, both immediately post - graduation and across a working life span. the proportion of qualified professionals working in their occupation soon after graduation varied from less than 45% of graduate dieticians, 76% of occupational therapists and 92% of podiatrists. retention of older workers similarly varied with 66% of optometrists and 58% of dentists still working in the 60 to 65 year age range compared to only 17% of audiologists (table 1). university fees for nursing and allied health pathways cost between $ 100,000 and $ 176,000 per person, while as expected, medicine and dentistry are the most expensive at over $ 350,000 per completing student. the high clinical training costs of a paid internship, in addition to clinical placements, added significantly to the cost of creating an audiologist, pharmacist and medical practitioner (table 2). table 2.estimated cost per year of clinical practice selected health professions, australia, $ 2015.university education cost per completing student, $ clinical training cost per health professional, $ estimated total training cost/ completing professional, $ mean expected years of serviceestimated cost per year of clinical practice, $ audiologists173,87099,276273,14626.510,304dental hygienists28,965419933,16425.61295dental prosthetists41,896419946,09525.61799dentists321,42530,759352,18431.611,158dieticians145,1057934153,03914.910,277general medical practitioners317,473134,256451,72924.518,432medical radiation practitioners158,48613,432171,91830.35672nutritionists111,1200111,12013.28398occupational therapists144,80210,974155,77621.57239optometrists167,8927550175,44236.04870oral health therapists129,4048397137,80125.65379orthoptists167,4625306172,768nanaorthotists and prosthetists155,7336949162,682nanapharmacists129,13468,927198,06128.37004physiotherapists162,65810,598173,25627.06419podiatrists153,5909461163,05131.55170psychologists176,04013,023189,063nanaregistered nurses96,27010,435106,70519.75406speech pathologists134,1438180142,32330.34695data sources : created using data from websites of victorian universities, department of education and training, health workforce australia, department of health and human services of victoria, victorian clinical training council and abs census of population and housing. notes na = insufficient granulation of census data prevented analysis of expected years in the occupation for a number of health professions.athe average age of graduation for each discipline, based on det graduate data was used in the model to estimate number of years in that occupation. we note that most (85%) of new graduates across the subject disciplines are aged 2029 years (range from 70% for nursing to 97% for pharmacy). years of service rounded to the one decimal place.ballied oral health professions are grouped together in the census as dental hygienists, technicians and therapists. thus dental hygienists, prosthetists and oral health therapists were grouped together in estimating the expected mean years of service.cdietetics and nutrition qualifications are grouped together in the census. bachelor level and above were used to delineate dietetics qualifications, while all qualifications were included in nutrition models acknowledging that there is likely much overlap between the two professions among bachelor and above qualifications captured in the census. expected mean years of service model for pharmacy was also limited to qualifications bachelor level and above in line with course costs used and to avoid data being skewed by non - registrable qualifications. estimated cost per year of clinical practice selected health professions, australia, $ 2015. data sources : created using data from websites of victorian universities, department of education and training, health workforce australia, department of health and human services of victoria, victorian clinical training council and abs census of population and housing. na = insufficient granulation of census data prevented analysis of expected years in the occupation for a number of health professions. the average age of graduation for each discipline, based on det graduate data was used in the model to estimate number of years in that occupation. we note that most (85%) of new graduates across the subject disciplines are aged 2029 years (range from 70% for nursing to 97% for pharmacy). allied oral health professions are grouped together in the census as dental hygienists, technicians and therapists. thus dental hygienists, prosthetists and oral health therapists were grouped together in estimating the expected mean years of service. bachelor level and above were used to delineate dietetics qualifications, while all qualifications were included in nutrition models acknowledging that there is likely much overlap between the two professions among bachelor and above qualifications captured in the census. expected mean years of service model for pharmacy was also limited to qualifications bachelor level and above in line with course costs used and to avoid data being skewed by non - registrable qualifications. the estimated expected mean time working in the occupation also varied considerably across professions, generally estimated at between 20 and 30 years, but with dietetics and nutrition lower at 14.9 years and optometry higher at 36 years (table 2). the high cost of training in dentistry is thus in part offset by longer periods in the workforce with an estimated cost per year of service at $ 11,158. compared with the real cost of training allied health practitioners, the differential is considerably less than the training cost differential (table 2). on the other hand, the cost of medical training per year in the profession is still very high at an estimated $ 18,432. for most allied health professions and registered nurses, the cost per year of working life to train was estimated at between $ 5000 and $ 10,000. the annualized cost was lower for allied oral health workers, due to a modest training cost and good workforce retention. speech pathologists, medical radiation practitioners, optometrists and podiatrists all with more than 30 years expected practice implied a good return on investment in their training. the dietetics workforce, due to low retention, had one of the higher costs of training per year of practice (figure 1). figure 1.cost of training and education per expected year of clinical of practice, selected professions. data source : estimated total training cost per completing professional divided by mean expected years of service, from table 2 above. cost of training and education per expected year of clinical of practice, selected professions. data source : estimated total training cost per completing professional divided by mean expected years of service, from table 2 above. we sought to explore possible reasons for the highly divergent retention rates across health professions that we could test with the census data. a possible explanation for variation in expected professional working life was opportunity for private practice and self - employment. we tested both of these and found a significant positive association between the proportion of the workforce located in the private sector and the expected time in their occupation (figure 2). working in the private sector explained 58% of the variance in expected working years (r= 0.5795, p =.006). the likelihood of being self - employed was also positively related to time in the occupation (r= 0.334, p =.043) and to remain in the occupation past the age of 65 years (r= 0.323, p =.041). figure 2.expected years of service in selected health occupations by percent employed in the private sector, australia in 2011.data source:(a) percent of persons with a non - school qualification working in the relevant occupation, who reported working in private sector employment in the 2011 abs census.(b) adjusted average years of service from table 2. expected years of service in selected health occupations by percent employed in the private sector, australia in 2011. (a) percent of persons with a non - school qualification working in the relevant occupation, who reported working in private sector employment in the 2011 abs census. gaps between the numbers of qualified health professionals and those working continue to be observed in a range of professions since originally observed by leach. when graduates do not work in the profession in which they are trained, it does not necessarily mean the training was wasted, but it does mean that the cost of training the workforce is increased. using the census as our primary data source has some limitations. individuals who switch disciplines and practice in the field of the lower qualification will be identified as not working in their field of study (defined by the higher qualification). for some professions, the mapping between qualification and occupation is not tight, in which cases, level of qualification and job description were used to assist. in other fields such as occupational therapy, podiatry and physiotherapy, the educational pathways and occupational match are precise giving perhaps greater confidence in our modelled estimates. psychology was excluded from our study, as from the census data we were unable to establish whether a qualification was consistent with clinical registration. qualifications may have been obtained overseas and may or may not be recognized for clinical practice in australia, potentially accounting for some of the observed gap between qualifications and employment (rather than retention). conversely, practitioners who train in australia and then leave, will contribute to training costs, but will not be captured as losses to the workforce since they will not appear in the census. international movement of health professionals is a complex supply issue and would be a desirable extension to this analysis. for example, retention patterns have been inferred from cross - sectional data, as is the convention in life expectancy calculations. longitudinal data are an alternative approach, but require many decades of data and still rely on assumptions in modelling forward. age upon entering the profession and loss to temporary exits were estimated based on the age distribution of students and the pattern of workforce participation over time. the underpinning logic was tested using registration data where available (for optometry, physiotherapy, medical radiation practice, occupational therapy, pharmacy and podiatry). this alternative analysis, which allowed a more precise estimate of mean time in temporary exits and age of entry, estimated expected professional years lost to temporary exits within 2% of the estimate using the census data. given results are based on the australian census, estimates can be updated every five years. our model does not incorporate productivity or hours worked, which are presumed to be exogenous. the efficiency of delivering healthcare is a much larger question, of which workforce retention is just one component, but one which is separable and as such capable of independent analysis. in terms of the cost of training, in the absence of comprehensive costing estimates for the clinical component of training, which is inherently complex, the findings of this research could be used to inform health workforce planning and policy, in particular workforce retention across occupations. to illustrate with dietetics, there are 450 graduates annually from dietetics courses across australia. with an expected period in their occupation of 14.9 years, this is an expected 6705 dietician workforce years from the graduating cohort. if an increase in the workforce of practising dieticians of 25% is sought to address the large and increasing burden of diet - related disease, this could be achieved by training an additional 112 students annually, at a cost of $150,000 per graduating student, an on - going investment of nearly $ 17 million per year. alternatively, the government and industry could implement retention strategies to increase expected time in the dietetic workforce by 3.7 years (up to 18.6 years) to achieve the additional 25% workforce capacity. this could potentially be achieved in a shorter time frame, at lower cost and create a more experienced workforce. just the government share of the training cost estimate (50% of $ 17 m on - going) could fund an extra 85 + dietician positions across australia a strategy that would certainly promote retention and create much needed additional service capacity. if those resources went into additional training, that would not fund a single additional dietician service. it is likely to be high in countries with high health workforce losses to emigration. such losses will increase the cost of training per working health professional and possibly result in health workforce shortages. better knowledge about the drivers of poor workforce retention and translation into strategies that would extend working life as a health professional are needed. the finding that those occupations based more in the private sector work longer in their occupation points to links between retention and features of private practice, such as potentially an attractive salary, flexibility and greater control over one s career. while calls for more research into the causes of poor retention across much of allied health are not new, this study adds weight to the need for more research in this area, but more particularly action to enhance retention, specifically in those occupations where it is low. the author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article. the author(s) disclosed receipt of the following financial support for the research, authorship, and/or publication of this article : the authors received funding from the department of health and human services, victoria, australia, to support the research. the department in no way influenced the study design, approach to its conduct or interpretation of results. | objectiveswe explored the real cost of training the workforce in a range of primary health care professions in australia with a focus on the impact of retention to contribute to the debate on how best to achieve the optimal health workforce mix.methodsthe cost to train an entry - level health professional across 12 disciplines was derived from university fees, payment for clinical placements and, where relevant, cost of internship, adjusted for student drop - out. census data were used to identify the number of qualified professionals working in their profession over a working life and to model expected years of practice by discipline. data were combined to estimate the mean cost of training a health professional per year of service in their occupation.resultsgeneral medical graduates were the most expensive to train at $ 451,000 per completing student and a mean cost of $ 18,400 per year of practice (expected 24.5 years in general practice), while dentistry also had a high training cost of $ 352,180 but an estimated costs of $ 11,140 per year of practice (based on an expected 31.6 years in practice). training costs are similar for dieticians and podiatrists, but because of differential workforce retention (mean 14.9 vs 31.5 years), the cost of training per year of clinical practice is twice as high for dieticians ($ 10,300 vs. $ 5200), only 8% lower than that for dentistry.conclusionsreturn on investment in training across professions is highly variable, with expected time in the profession as important as the direct training cost. these results can indicate where increased retention and/or attracting trained professionals to return to practice should be the focus of any supply expansion versus increasing the student cohort. |
it is the most potent toxin known, with as little as 30100 ng potentially fatal to a human adult (peck 2009). there are seven types of botulinum neurotoxin (types a g), which are formed by the gram - positive anaerobe clostridium botulinum and some strains of c. butyricum and c. baratii. types a, b, e, and f neurotoxins have been associated with human pathology (austin and dodds 2000 ; peck 2006). clostridium botulinum is a heterogeneous species that comprises four phylogenetically and physiologically distinct bacteria (c. botulinum groups i iv), with groups i and ii associated with human botulism (austin and dodds 2000 ; peck 2009). strains of group i (proteolytic) c. botulinum form type a, b, or f neurotoxin, with many strains carrying genes for two neurotoxins, and in some cases also forming two neurotoxins. strains of group ii (nonproteolytic) c. botulinum form type b, e, or f neurotoxins, but there are currently no reports of strains carrying more than one neurotoxin gene (macdonald. one interpretation for this observation would be that horizontal transfer of the neurotoxin genes occurs less frequently in group ii c. botulinum than it does in group i c. botulinum. recent genetic analysis has identified a number of neurotoxin subtypes, with particular subtypes often found only in one group of c. botulinum (smith. 2005 ; hill. for example, strains of group ii c. botulinum type f, which are the subject of this study, exclusively carry the type f6 neurotoxin gene, whereas strains of group i c. botulinum type f carry a neurotoxin gene, which can be of types f1f5, and strains of c. baratii all carry the type f7 neurotoxin gene (raphael. the neurotoxin has several accessory proteins, the genes for which are adjacent and form the so - called neurotoxin gene cluster. there are two classes ; the ha - cluster encodes the neurotoxin, a nontoxic - nonhaemagglutinin protein, and three hemagglutinins ; and the orf - x - cluster encodes the neurotoxin, a nontoxic - nonhaemagglutinin protein, and four other proteins (orf - x1, orf - x2, orf - x3, and p47) of unknown function (hill. in addition, clusters often contain the gene for a regulatory sigma factor, botr. when chromosomally located, botulinum neurotoxin gene clusters are usually flanked by fragments of mobile elements, an observation which has raised the possibility that they may have been acquired by horizontal gene transfer (sebaihia. neurotoxin gene clusters can also be located on bacteriophages (group iii c. botulinum) and plasmids (groups i, ii, and iv). horizontal acquisition of neurotoxin gene clusters must occur relatively rarely on an evolutionary timescale, based on the knowledge that in group i, c. botulinum neurotoxin gene clusters are found at only three different chromosomal locations, and more dramatically in both group ii c. botulinum type e and in c. butyricum type e, the neurotoxin gene cluster has been inserted directly into rara, a recombination - associated gene (hill. 2009). recent work in our laboratory studied the genetic relationship between members of group ii c. botulinum using a whole - genome dna microarray. this study extended the observations of others that strains of group ii c. botulinum type b and type f are closely related but that group ii c. botulinum type e strains form a distinct clade (stringer. reference genome sequences were already available for group ii c. botulinum type b (eklund17b) and type e (strains beluga and alaska), so we decided to sequence the genome of each type f strain from our microarray study to explain this close relationship with type b strains. five strains of group ii (nonproteolytic) c. botulinum type f were used in this study (table 1). three historical strains have been widely studied by previous authors, whereas two strains were recently isolated from scallops (peck. 2010). before use, all strains were checked for purity by growth on peptone - yeast - glucose - starch (pygs) and reinforced clostridial medium with 5% (w / v) skim milk agar plates incubated under aerobic and anaerobic atmospheres (carter. table 1strains of group ii (nonproteolytic) clostridium botulinum type f6 used in this studystrainmaterial from which strain isolated (country, year)received fromeklund 202fpacific sediments (ca, the united states, 1965)j. crowther (unilever research)hobbs ft10atlantic herring from moray firth (scotland, uk, 1970s)j. crowther (unilever research)craig 610salmon from columbia river (or, the united states, 1965)j. crowther (unilever research)ifr 06/001scallops (canada, 2006)isolated at ifrifr 06/005scallops (canada, 2006)isolated at ifr strains of group ii (nonproteolytic) clostridium botulinum type f6 used in this study genomic dna was purified from exponentially growing cells cultured in pygs medium as described previously (carter. library construction and genome sequencing was carried out by the genome analysis centre (tgac), norwich research park, uk, on the illumina miseq platform, which produces longer sequencing reads than previous illumina platforms (miseq personal sequencer, illumina at http://www.illumina.com/systems/miseq.ilmn, last accessed may 21, 2013). all sequencing reads were assembled to generate an improved high - quality draft sequence (chain. sequences were loaded into vector nti advance 11 (invitrogen), and for each genome, the contig that contained the type f6 toxin gene cluster was identified. pairwise alignments of homologous contig regions were performed using the vector nti program alignx, which uses the clustalw algorithm. the artemis comparison tool (act) was used for whole - genome comparisons (carver. open reading frames (orfs) of minimum 150-bp length, identified using standard vector nti software set to use atg, gtg, and ttg start codons were annotated using blastn, blastp, and domain enhanced lookup time accelerated (delta)-basic local alignment search tool (blast) programs from the national center for biotechnology information (ncbi) website (http://blast.ncbi.nlm.nih.gov/blast.cgi, last accessed may 21, 2013). predicted coding sequences (cdss) were not included in the annotation if they showed no obvious homology to known cdss or gene products and had no obvious ribosome binding sites upstream of any start codon. genbank accession numbers for each 50-kb region are kc516868 (ifr 06/001), kc516869 (ifr 06/005), kc516870 (craig 610), kc516871 (eklund 202f), and kc516872 (hobbs ft10). five strains of group ii (nonproteolytic) c. botulinum type f were used in this study (table 1). three historical strains have been widely studied by previous authors, whereas two strains were recently isolated from scallops (peck. 2010). before use, all strains were checked for purity by growth on peptone - yeast - glucose - starch (pygs) and reinforced clostridial medium with 5% (w / v) skim milk agar plates incubated under aerobic and anaerobic atmospheres (carter. table 1strains of group ii (nonproteolytic) clostridium botulinum type f6 used in this studystrainmaterial from which strain isolated (country, year)received fromeklund 202fpacific sediments (ca, the united states, 1965)j. crowther (unilever research)hobbs ft10atlantic herring from moray firth (scotland, uk, 1970s)j. crowther (unilever research)craig 610salmon from columbia river (or, the united states, 1965)j. crowther (unilever research)ifr 06/001scallops (canada, 2006)isolated at ifrifr 06/005scallops (canada, 2006)isolated at ifr strains of group ii (nonproteolytic) clostridium botulinum type f6 used in this study genomic dna was purified from exponentially growing cells cultured in pygs medium as described previously (carter. 2011). library construction and genome sequencing was carried out by the genome analysis centre (tgac), norwich research park, uk, on the illumina miseq platform, which produces longer sequencing reads than previous illumina platforms (miseq personal sequencer, illumina at http://www.illumina.com/systems/miseq.ilmn, last accessed may 21, 2013). all sequencing reads were assembled to generate an improved high - quality draft sequence (chain. sequences were loaded into vector nti advance 11 (invitrogen), and for each genome, the contig that contained the type f6 toxin gene cluster was identified. pairwise alignments of homologous contig regions were performed using the vector nti program alignx, which uses the clustalw algorithm. the artemis comparison tool (act) was used for whole - genome comparisons (carver. open reading frames (orfs) of minimum 150-bp length, identified using standard vector nti software set to use atg, gtg, and ttg start codons were annotated using blastn, blastp, and domain enhanced lookup time accelerated (delta)-basic local alignment search tool (blast) programs from the national center for biotechnology information (ncbi) website (http://blast.ncbi.nlm.nih.gov/blast.cgi, last accessed may 21, 2013). predicted coding sequences (cdss) were not included in the annotation if they showed no obvious homology to known cdss or gene products and had no obvious ribosome binding sites upstream of any start codon. genbank accession numbers for each 50-kb region are kc516868 (ifr 06/001), kc516869 (ifr 06/005), kc516870 (craig 610), kc516871 (eklund 202f), and kc516872 (hobbs ft10). dna sequences of five different strains of group ii c. botulinum type f6 (table 1) were assembled into contigs from illumina miseq data. 2013) by showing that the majority of the group ii c. botulinum type f6 genome is very similar in content and organization to that of the group ii c. botulinum type b strain eklund17b and rather less similar to that of group ii c. botulinum type e strains alaska and beluga. this is exemplified in figure 1, in which an act comparison between regions of chromosomal dna of strains eklund17b, ifr 06/001, and alaska demonstrates the reduced synteny with the latter strain. there was no evidence for the type f neurotoxin gene cluster being carried by a plasmid. 1.group ii clostridium botulinum chromosomal dna act comparisons of the 50-kb neurotoxin cluster locus of type f6 strain ifr 06/001 (b) with type b strain eklund17b (a) and type e strain alaska (c). red bars denote regions sharing a high degree of sequence identity ; the two thinner red bars linking section a with b are due to homology between the two versions of the topb gene, one present as a newly acquired gene, one as the original disrupted version. a similar duplication of homology is seen for the topb gene (clh_1538) of alaska (c, box i). color code for features : 1) red, neurotoxin gene / cluster sequence ; 2) blue, bacteriophage dna ; 3) purple, plasmid dna ; 4) yellow, is4 elements ; and 5) green and black, sequences unrelated to mobile dna elements or toxin cluster genes, with black features apparently acquired horizontally. greatest synteny is seen between strain 06/001 (b) and eklund17b (a) : cds / features 18 and 3642 are homologs of eklund17b (nrp [norwich research park ]) cdss cb17b1604 - 1610 and cb17b1610 - 1617 (all sharing > 90% identity). cdss 1924 : neurotoxin cluster genes orf - x3, orf - x2, orf - x1, p47, nontoxic nonhemagglutinin gene, and type f6 neurotoxin gene, respectively. features 32 and 35 (red boxes) : fragments of type b neurotoxin gene and type e neurotoxin gene, respectively. chromosomal regions of type e strain alaska homologous to the 50-kb toxin cluster locus of strain 06/001 are scattered due to poorer synteny ; three main regions are depicted (section c). box ii : clh_1115 - 1105 (7990% identity, note lack of homology with orf - x2, clh_1114). the type e3 neurotoxin gene of alaska, clh_1110 shares homology with strain 06/001 at two locations ; the 3-end of the type f6 neurotoxin gene (cds 24) plus the nonfunctional type e neurotoxin gene fragment (feature 35). group ii clostridium botulinum chromosomal dna act comparisons of the 50-kb neurotoxin cluster locus of type f6 strain ifr 06/001 (b) with type b strain eklund17b (a) and type e strain alaska (c). red bars denote regions sharing a high degree of sequence identity ; the two thinner red bars linking section a with b are due to homology between the two versions of the topb gene, one present as a newly acquired gene, one as the original disrupted version. a similar duplication of homology is seen for the topb gene (clh_1538) of alaska (c, box i). color code for features : 1) red, neurotoxin gene / cluster sequence ; 2) blue, bacteriophage dna ; 3) purple, plasmid dna ; 4) yellow, is4 elements ; and 5) green and black, sequences unrelated to mobile dna elements or toxin cluster genes, with black features apparently acquired horizontally. greatest synteny is seen between strain 06/001 (b) and eklund17b (a) : cds / features 18 and 3642 are homologs of eklund17b (nrp [norwich research park ]) cdss cb17b1604 - 1610 and cb17b1610 - 1617 (all sharing > 90% identity). cdss 1924 : neurotoxin cluster genes orf - x3, orf - x2, orf - x1, p47, nontoxic nonhemagglutinin gene, and type f6 neurotoxin gene, respectively. features 32 and 35 (red boxes) : fragments of type b neurotoxin gene and type e neurotoxin gene, respectively. chromosomal regions of type e strain alaska homologous to the 50-kb toxin cluster locus of strain 06/001 are scattered due to poorer synteny ; three main regions are depicted (section c). box ii : clh_1115 - 1105 (7990% identity, note lack of homology with orf - x2, clh_1114). the type e3 neurotoxin gene of alaska, clh_1110 shares homology with strain 06/001 at two locations ; the 3-end of the type f6 neurotoxin gene (cds 24) plus the nonfunctional type e neurotoxin gene fragment (feature 35). a 50-kb region from each c. botulinum type f6 genome containing the neurotoxin gene cluster was compared. apart from 10 single - nucleotide polymorphisms (snps) and one 15-bp deletion, all 50-kb sequences were identical, suggesting that group ii c. botulinum type f strains are clonal, deriving from one rare event. all sequence differences mapped to the eklund 202f genome (table 2) ; this agrees with observations made by hielm. (2010) using 16s rrna sequencing that eklund 202f differs slightly from other group ii c. botulinum type f strains. in our recent comparative genomic microarray analysis, eklund 202f was also found to be slightly divergent from other group ii c. botulinum type f strains (stringer. table 2sequence differences within strains of group ii clostridium botulinum type f6snp / deletionco - ordinategenet - c68intergenicg - a529sensory transduction protein kinaset - a1,855sensory transduction protein kinasec - t1,938sensory transduction protein kinasea - g5,582intergenica - g29,314type f6 neurotoxinatgattttgaagaag (deletion)36,85036,8645-flank of type b neurotoxin fragmentg - a40,549intergenicc - t47,283exonuclease / helicasea - c48,699mate efflux family proteina - g49,015mate efflux family proteinnote.all sequence differences were found in the genomic dna of strain eklund 202f. numbering refers to the 50-kb region of all strains except for eklund 202f, the coordinates of which differ after the 15-bp deletion at position 36850. sequence differences within strains of group ii clostridium botulinum type f6 note.all sequence differences were found in the genomic dna of strain eklund 202f. numbering refers to the 50-kb region of all strains except for eklund 202f, the coordinates of which differ after the 15-bp deletion at position 36850. each of these 50-kb regions contains an apparently foreign insertion of 34.4-kb dna sequence, which has disrupted the topb gene, encoding dna topoisomerase iii (fig. this enzyme decatenates the newly replicated bacterial chromosome and is essential for survival. in the other group ii c. botulinum genomes currently available in databases (eklund17b, beluga, alaska), only one copy of topb exists. comparison with closely related topb sequences showed that although the type f6 topb is split by the 34.4-kb inserted dna, the full cds is still present ; the n - terminal 109 codons border the 5-flank of the dna insertion, whereas its 3-flank is defined by the remaining 620 codons. thus, the original foreign dna acquisition event did not rearrange or duplicate the sequence of the target site. the disrupted topb was found to have been replaced by a new copy, carried within the inserted dna (see later). percent g + c was analyzed and did not vary any more within the 34.4-kb region than it did in the flanking regions (data not shown). this suggests that the new dna is the result of homeologous horizontal gene transfer(s), that is, it has been acquired from an organism closely related to the recipient rather than from a completely unrelated bacterium (fall. 2007). predicted cdss within the 34.4-kb foreign dna were examined for evidence of the history of the insertion event (fig. prime suspects at its 5-end were three contiguous regions encoding site - specific recombinases / bacteriophage integrases or remnants thereof (cdss 911, fig. significantly, after a short interval (529 bp) is an intact topb gene (cds 12, fig. most interestingly, this topb gene is more closely related to those of c. beijerinckii (76% amino acid identity) and c. butyricum (75% amino acid identity) than to those of group ii c. botulinum. the insertion of neurotoxin cluster dna into a gene together with replacement of the same gene by another copy has precedent ; as mentioned earlier in group ii c. botulinum type e and c. butyricum type e strains, the location of the type e neurotoxin gene cluster appears to be the result of insertion events that split the rara gene at codon 102 in both species (hill. the rara gene product is a resolvase involved in recombination or transposon insertion events, and hill. (2009) speculated that this might have played a part in these two independent insertion events. is it possible that the topb gene, whose product is also involved in dna manipulation, may have acted as a target for foreign dna insertion via a similar mechanism ? intriguingly, blast results for the most 5 of the three integrase - like cdss (cds 9, fig. 1b) of the newly acquired piece of dna suggest that its gene product is a member of the xerd family, which in escherichia coli acts in concert with xerc to perform a similar function to that of topb, that is, conversion of dimeric chromosomes into monomers (blakely. located 4.2 kb after the intact topb gene is a type f6 neurotoxin gene in a complete orf - x - cluster (cdss 1924, fig. (2011) for the group ii c. botulinum type f6 strain ibca66 - 5436. all the type f6 strains described in this study, together with ibca66 - 5436 and all group ii c. botulinum type e neurotoxin clusters lack the sigma factor botr gene. interestingly, botr is present in the orf - x - cluster of the group i c. botulinum type f strains langeland and 230613 (hill. 2011), but its presence and position in the orf - x - cluster of c. baratii type f has yet to be established (raphael. 2010). the neurotoxin gene cluster in the group ii c. botulinum type f described in this study spans 13.55 kb from the 3-end of the orf - x3 gene to the 3-end of the type f6 neurotoxin gene. it is flanked at its 5-end by two is4 element - related regions (cdss 17, 18) and at its 3-end by remnants of a bacteriophage integrase / recombinase (cds 26, fig. the type f6 neurotoxin genes in strains hobbs ft10, craig 610, ifr 06/001, and ifr 06/005 were identical, whereas strains eklund 202f and ibca66 - 5436 share a single snp in the 27th codon where there is an a g transition changing an aaa (lysine) codon to a gaa (glutamate) codon (table 2). except for this one snp, the remainder of the neurotoxin gene cluster is identical for the five type f6 strains examined in this study and for ibca66 - 5436. this high similarity of the neurotoxin gene cluster implies that strain ibca66 - 5436 will also fall into this same clonal group. indeed, 16s rrna sequence data places ibca66 - 5436 in the same clade as hobbs ft10 and craig 610 (raphael. 2010). only 3.7 kb from the type f6 gene is a 1 kb cds that begins with sequence distantly related to a phage integrase ; unexpectedly, blastp hits for the predicted product of a 270-codon region further downstream were to the receptor binding domain of the botulinum neurotoxin heavy chain (feature 32, fig. the top three hits were to type g neurotoxin, associated with strains of group iv c. botulinum (c. argentinense) (terilli. 2011) ; however, the amino acid identity was only 35%, with 22 gaps. this makes use of a subset of the ncbi s conserved domain database and should produce better quality alignments (boratyn. 2012). using delta - blast, all the top hits (30% identity but only 18 gaps) were to the heavy chain of type b neurotoxins, at residue positions approximately 10091291. based on this evidence, the dna sequence is annotated as deriving from a type b neurotoxin gene. located 242 bp after the type b neurotoxin gene fragment is a truncated (130 of the expected 170190 codons) cds for signal peptidase i, closely followed by a partially deleted is4 sequence containing reading frame errors (cdss 33, 34, fig. the reconstructed is4 orf encodes 311 amino acid residues, for which the best blastp hits (52% identity) were to is4 elements of c. cellulovorans 743b. the remains of is mobile elements are often found associated with c. botulinum neurotoxin gene clusters, usually not only at their 5- and 3-flanks but also sometimes within the gene cluster itself (hill. the fact that there are phage integrase genes at one end of the dna insertion, and transposable element dna at the other end, as is also the case for the intact type f6 neurotoxin cluster, makes it difficult to speculate on the exact mechanism for insertion of the foreign dna as these two different mobile elements and the cdss contained within their borders provide evidence for several such events in this region, not merely one. adjacent to the inactive is4 element is a 736-bp fragment of dna containing a disrupted orf (feature 35, fig. after correction of reading frame errors, the original orf encodes 247 amino acid residues with 81% identity to a type e neurotoxin (delta - blast alignment to residues 8841,130 of most type e neurotoxins). the closest relatives to this type e fragment are the recently described type e9 neurotoxin of group ii c. botulinum, followed by the type e5 neurotoxin of c. butyricum. interestingly, as with group ii c. botulinum type f6, the chromosomal dna of the strain that forms type e9 neurotoxin was reported as being more closely related (99%) to that of eklund17b than to other group ii c. botulinum type e strains (94%) (raphael. alignment of predicted peptides for the type b and type e gene fragments with complete type b and type e neurotoxin reference sequences shows that both of these fragments partially overlap, spanning approximately the same region of the neurotoxin heavy chain. this shows that a single neurotoxin gene from the ancestral gene cluster has not been disrupted by insertion of new dna ; rather, two completely different neurotoxin genes have been disrupted in successive rounds of recombination at this locus. the observations that the rest of the chromosome is most similar to that of a group ii c. botulinum type b, and that the cds for the type b neurotoxin fragment is more degraded (30% amino acid identity) than that of the type e fragment (81% amino acid identity), suggests that the original bacterium was probably a group ii c. botulinum type b strain. a further 335 bp after the type e gene fragment, the c - terminal fragment of the disrupted topb gene marks the end of the 34.4-kb dna insertion and the return to synteny with eklund17b (cdss 3642, fig. because the cdss that flank the 34.4-kb insertion show such close synteny with eklund17b, it would be interesting to examine this region in other group ii c. botulinum strains for evidence of genetic recombination. unfortunately, at present, nothing can be said regarding the frequency of use of this topb locus for insertion of neurotoxin gene clusters in group ii c. botulinum type b, as the only available genome is that of eklund17b, which carries its neurotoxin gene cluster on a plasmid. in their study of plasmid borne neurotoxin gene clusters in group i and group ii c. botulinum type b, franciosa. (2009) identified two other group ii type b strains, which bear their neurotoxin gene cluster on a plasmid, as do group ii c. botulinum type b strains cdc 3875 and ifr 05/025 that we have recently sequenced (data not shown). although the type b and type e neurotoxin genes discovered in this study are incomplete, this report is the first to describe evidence of more than one neurotoxin gene in group ii c. botulinum and completely changes the view that members of this group are less recombinogenic than those of group i, at least with respect to neurotoxin gene cluster sequences. we also identify the topb gene as a chromosomal locus for a c. botulinum neurotoxin gene cluster that has not been described previously. the simplest explanation for the evolution of this type f6 clonal group is that the original ancestor was a group ii c. botulinum type b strain, either with a chromosomally located neurotoxin gene cluster or because all type b strains so far examined seem to possess a plasmid - based neurotoxin gene cluster, one where this cluster has integrated into the chromosome. this received dna from a strain containing a type e gene cluster, followed by the most recent event, where a complete type f6 gene cluster was inserted. in each case, the previous neurotoxin gene was inactivated, so there still remains to be found a group ii c. botulinum bearing two functional neurotoxin genes, unlike the situation in group i c. botulinum where several such strains are reported. it should be emphasized that the above is only the simplest predicted course of events. at least two different types of mobile element have been involved in these genetic exchanges on at least two different occasions. because the newly acquired topb gene is more like that from c. butyricum or c. beijerinckii, it is possible that not all partners in these dna swapping events were c. botulinum. genetic exchange between bacteria must be evidence that at some stage they shared an environment ; group ii c. botulinum, c. butyricum, and c. beijerinckii are all saccharolytic anaerobes, so this speculation has at least some biological relevance. it has been shown that members of group ii c. botulinum type f6 are closely related. the series of recombination events needed to deliver them has probably occurred just once to give a clonal group that has spread around the world. it is also possible that strains with evidence of other recombinational events at the topb hot spot exist but have not yet been described. perhaps, the recently described group ii c. botulinum type e9 strain cdc 66177 (raphael. 2012), which has chromosomal dna more closely related to that of eklund17b than to other group ii c. botulinum type e strains mirrors one of the evolutionary stages of group ii c. botulinum type f6, although the insertion site in this case is again the rara gene. to date, the only available genome sequence for group ii c. botulinum type e strains is for strains alaska and beluga, and these both lack evidence for the partial type b gene fragment described in this work. further genetic clues to enable us to unravel the complex evolutionary route that has resulted in the present group ii c. botulinum type f6 strains will be uncovered as the genomes of more group ii c. botulinum are examined. | genome sequences of five different group ii (nonproteolytic) clostridium botulinum type f6 strains were compared at a 50-kb locus containing the neurotoxin gene cluster. a clonal origin for these strains is indicated by the fact that sequences were identical except for strain eklund 202f, with 10 single - nucleotide polymorphisms and a 15-bp deletion. the essential topb gene encoding topoisomerase iii was found to have been split by the apparent insertion of 34.4 kb of foreign dna (in a similar manner to that in group ii c. botulinum type e where the rara gene has been disrupted by a neurotoxin gene cluster). the foreign dna, which includes the intact 13.6-kb type f6 neurotoxin gene cluster, bears not only a newly introduced topb gene but also two nonfunctional botulinum neurotoxin gene remnants, a type b and a type e. this observation combined with the discovery of bacteriophage integrase genes and is4 elements suggest that several rounds of recombination / horizontal gene transfer have occurred at this locus. the simplest explanation for the current genotype is that the ancestral bacterium, a group ii c. botulinum type b strain, received dna firstly from a strain containing a type e neurotoxin gene cluster, then from a strain containing a type f6 neurotoxin gene cluster. each event disrupted the previously functional neurotoxin gene. this degree of successive recombination at one hot spot is without precedent in c. botulinum, and it is also the first description of a group ii c. botulinum genome containing more than one neurotoxin gene sequence. |
you are an intensivist in an institution that performs solid organ transplantations. in an effort to provide patients and families with increased opportunities to donate their organs, the institution has recently developed a policy for donation after cardiac death (dcd). with the new dcd policy, organ donation is offered to patients and their families in a controlled setting when death occurs immediately following the withdrawal of life - support. based on your understanding of organ donation, you are aware there are certain medications (for example, inotropes to maintain tissue perfusion) and certain management practices that may allow the donated organs to have better outcome. you wonder about the ethics of starting interventions that will have no benefit to the dying patient but will benefit the organs that are about to be donated. jason phua and tow keang lim what medications and interventions are started in potential donors before death for the sole purpose of making the organs more viable in dcd, and how do they affect organ function ? firstly, inotropes and vasopressors are crucial for the preservation of organ perfusion in patients in shock. the majority of potential donors are hypotensive before cardiac death, and hypotension worsens graft function. secondly, anticoagulants such as heparin decrease the risk of thrombosis after the circulatory arrest and the negative consequences on organ function. to maximize effectiveness, heparin thirdly, vasodilators such as phentolamine may enhance organ blood flow and lower the incidence of delayed renal graft function. more controversial practices are the administration of thrombolytics and antemortem cannulation in preparation for the administration of cold preservation solution. although rarely performed in europe, these practices are endorsed by major american and canadian transplantation and ethical guidelines [3,7 - 9 ]. indeed, most american dcd centres consider heparin administration at the time of withdrawal of life - sustaining treatment as the current standard of care. the acceptability of these practices should be evaluated according to beauchamp and childress ' four moral principles. as far as beneficence is concerned, none of these practices benefit the donors, at least not physically, since they will die regardless of the treatment provided. most of the opposition to these practices, however, stems from the second principle of nonmaleficence. there is concern that anticoagulants and thrombolytics may cause bleeding and that vasodilators may cause hypotension and therefore hasten death. nevertheless, there is no evidence that heparin leads to sufficient bleeding after the withdrawal of life - sustaining therapies to cause death. the guidelines, however, do state that heparin should only be used in patients with low bleeding risks, and phentolamine should only be used in patients without significant hypotension. the most important moral principle in dcd, however, is arguably that of autonomy. if the potential donor or his / her designate gives informed consent for these organ - preserving measures with a clear understanding of their possible side effects, who are healthcare professionals to object ? critics point to the lack of large randomized controlled trials to validate these measures. as the data available are very suggestive, however, while we await these trials (which may never be performed) the onus is on us to institute these measures to prevent any organs from going to waste. this is all the more crucial when one considers the last moral principle of justice, and the fact that these organs are a scarce resource. to conclude, we believe that starting certain medications and interventions such as inotropes, vasopressors, heparin and phentolamine in potential donors for the sole purpose of making the organs in dcd more viable is an acceptable practice, provided they are used in patients with a low risk for side effects and that informed consent is provided. david a zygun and christopher j doig the ethical principle of the ' rule of double effect ' provides moral justification for the provision of certain forms of care at the end of life that result in death. a practical example of this principle is the use of narcotics for pain relief, although respiratory depression and death are potential consequences. application of this principle requires all four conditions to be met : the act must not belong to a category of acts considered evil ; the good effect (for the patient), and not the bad effect, must be intended ; the bad effect must not be a means to the good effect ; and there must be a proportionally good reason for bringing about the bad effect. this principle has also been used to justify antemortem interventions in dcd, but do these interventions meet these necessary elements ? the benefit of dcd is primarily to organ recipients and society [13 - 15 ]. this is evident in the published literature, where the common justification for dcd is to increase the supply of organs. furthermore, the organ most likely to be recovered in dcd is the kidney, which will result in significant cost savings to healthcare systems by removing a patient from dialysis. although there are some data that families may gain benefit from dcd, such as avoidance of delayed regret for missing the opportunity to donate organs or the desire that donation will ease their grief, these reasons are also not for the benefit of the patient. is there potential harm to the donor (a hastening of death as a primary consequence) ? most dcd donors are individuals with neurological injury, and heparin poses more than a theoretical risk of precipitating or exacerbating intracranial haemorrhage and hastening death. phentolamine, a potent vasodilator, may precariously decrease blood pressure and hasten haemodynamic collapse in any icu patient, and would be particularly harmful in a patient with impaired cerebral autoregulation. there are other interventions that might also be considered, such as intravenous fluid administration to maintain urine output (would this be acceptable if the patient has concomitant hydrostatic pulmonary oedema ?). simply, none of these interventions would be reasonably provided outside the setting of dcd, all are credibly associated with potential harm to the dying patient, and the perceived benefit of dcd may be directly gained through the harm caused (a more rapid death). the principle of ' double effect ' is suggested as an appropriate ethical framework to support antemortem interventions in dcd donors. the requisite elements of this principle are not met, and this principle can not be used as a moral justification. as such, antemortem interventions with a risk to harm the patient violate the moral duty to ' first do no harm ', and should not be condoned. finally, invoking the principle of double effect places this principle in jeopardy as a reasonable justification for many appropriate interventions in palliative care treatment ; if this principle is brought into disrepute, it may be harmful to palliative care patients, society and the practice of medicine. jason phua and tow keang lim some argue that by facilitating a successful dcd such antemortem interventions benefit the donor by fulfilling his / her wishes, benefit the donor 's family by easing their grief, and benefit the recipient. we propose that instead of focusing on this doctrine, these interventions should be evaluated according to beauchamp and childress ' moral principles. we reiterate that any bad effects of heparin and phentolamine must not be exaggerated without medical evidence. these interventions benefit dcd by improving organ viability, not by causing ' a more rapid death '. david a zygun and christopher j doig violation of the principle of beneficence has been acknowledged. with nonmaleficence, absence of evidence of harm does not equal proof of absence of harm ; the incidence of harm from heparin is credible and has not been systematically examined. a standard of practice to use heparin without good clinical evidence of benefit and lacking measurement of potential harm is not a credible argument. most potential dcd candidates are not competent to consent. families as proxy are not acting in the patient 's autonomous interest in consenting to treatment that will not benefit and may harm the patient, irrespective of benefit of family or another third party (society, organ recipient). importantly, the statement ' they will die regardless of the treatment ' is not factual. finally, justice requires an equal share of not only benefits, but also of burden. given premortem intervention requires the dying patient to solely bear the burden ; justice can not be elicited to support such interventions. | several hospitals have been developing programmes for organ donation after cardiac death. such programmes offer options for organ donation to patients who do not meet brain - death criteria but wish to donate their organs after withdrawal of life - support. these programmes also increase the available organ pool at a time when demand exceeds supply. given that potential donors are managed in intensive care units, intensivists will be key components of these programmes. donation after cardiac death clearly carries a number of important ethical issues with it. in the present issue of critical care two established groups debate the ethical acceptability of using medications / interventions in potential organ donors for the sole purpose of making the organs more viable. such debates will be an increasingly common component of intensivists ' future practice. |
p. falciparum pfi1780w residues 85247 or 98247, pfd1170c residues 132309, and mal8p1.163 residues 131284 were cloned in vector pgex-6p-2 (ge healthcare life sciences, glattbrugg, switzerland), and transformed into escherichia coli bl21(de3). pfe1605w residues 122335 and mal8p1.4 residues 310456 were cloned in popinf vector (oxford protein production facility, harwell, uk), and transformed into e. coli rosetta2placi. recombinant mal8p1.4 for antibody production was derived from a full - length codon - optimized gene cloned into pscodon (eurogentec, seraing, belgium) and expressed in the cherrycodon system (eurogentec). cells were grown in luria - bertani medium, supplemented with 1% (w / v) glucose for pfe1605w and mal8p1.4. for nuclear magnetic resonance (nmr) samples, cells were grown in m9 medium supplemented with nh4cl and c6 d - glucose, and after protein induction were grown for 16 h at 18c. cells were resuspended in phosphate - buffered saline (pbs ; 150 mm nacl and 20 mm na2hpo4, ph 7.4) and lysed by sonication ; lysates were spun at 24,000 g for 30 min. lysate supernatants of phist domains cloned in pgex-6p-2 were incubated with glutathione sepharose resin (ge healthcare lifesciences) equilibrated in pbs, and proteins were eluted in a 50 mm tris - cl (ph 7.8), 12 mm reduced glutathione buffer. the glutathione s - transferase (gst) tag was removed by 3c protease cleavage, followed by buffer exchange to pbs using a sephadex g-20 column (ge healthcare lifesciences). lysate supernatants of popnif - cloned phist domains were applied to a talon hitrap column (ge healthcare lifesciences) equilibrated in 20 mm na2hpo4 (ph 7.4) and 300 mm nacl and eluted with a gradient to an imidazole - containing buffer (20 mm na2hpo4, ph 7.4 ; 300 mm nacl ; and 500 mm imidazole). for pfe1605w, the his6 tag was removed by 3c protease cleavage during dialysis in 50 mm tris - cl (ph 7.5), 150 mm nacl, and 2 mm dithiothreitol (dtt), followed by dialysis in 20 mm 2-(n - morpholino)ethanesulfonic acid (mes ; ph 6.0), 50 mm nacl, and 2 mm dtt. pfe1605w was then applied to an sp ion exchange column (ge healthcare lifesciences) equilibrated in the dialysis buffer and eluted with a nacl gradient (20 mm mes, ph 6.0 ; 1 m nacl, and 2 mm dtt). for mal8p1.4, the his6 tag was removed by 3c protease cleavage, followed by dialysis in 20 mm na2hpo4 (ph 7.0), 150 mm nacl, and 2 mm dtt. final purification of all phist domains was performed by size - exclusion chromatography over a superdex s75 column (ge healthcare lifesciences) equilibrated in pbs supplemented with 1 mm dtt or buffer a (50 mm nacl ; 20 mm na2hpo4, ph 7.0 ; and 1 mm dtt). the cloning and protein production of pfemp1 intracellular segments, both full - length segments and fragments, and fluorescent labeling of the pf08_0141 ats were described earlier (32). a further 5 fluorescent - labeled full - length ats variants were produced in an analogous manner by substituting single amino acids for cysteines ; these are pff0010 (g156c), pfb1055c (q161c), pfc1120c (q182c), pf08_0103 (h154c), and pff0845c (h159c). protein identity was confirmed by matrix - assisted laser desorption ionization - time of flight mass spectrometry. unless otherwise noted, all biophysical experiments were performed in buffer a, except for analytical ultracentrifugation (auc) experiments in which 1 mm tris(2-carboxyethyl)phosphine was used instead of dtt. fluorescence polarization measurements were recorded at 20c with a 5-fam label using a pherastar fs fluorimeter (ex=485 nm, em=520 nm ; bmg labtech, ortenberg, germany). differences in fluorescence polarization were fit using a single binding model in the program origin (originlab, northampton, ma, usa). auc velocity experiments were performed on 25 m protein samples using an optima xl - i analytical ultracentrifuge (beckman coulter, fullerton, ca, usa). sedimentation velocities were recorded by measuring absorbance at 280 nm, with 200 scans every 4 min at 10c and 35,000 rpm. data were processed using sedphit (33). the protein partial specific volume was calculated from the amino acid sequence. a mosquito robot (ttp labtech, melbourn, uk) was used to set up 200-nl sized drops with a 1:1 ratio of protein to mother liquor. pfi1780w residues 85247 at a concentration of 4.0 mg / ml were mixed with 0.1 m sodium acetate (ph 4.6) and 2.0 m nacl buffer. crystals developed in 7 d were cryoprotected by a brief incubation in mother liquor supplemented with 22.5% (v / v) glycerol, flash - cooled in liquid nitrogen, and diffracted up to 2.35 at the diamond light source (harwell, uk), beamline i04. the space group was determined to be p3121 with 2 molecules / asymmetric unit. for phasing experiments, the crystals were incubated with 250 mm 5-amino-2,4,6-triiodoisophthalic acid (hampton research, aliso viejo, ca, usa) for 5 min before cooling. crystallographic data were integrated in xds (34) and scaled in scala (35). phase information for pfi1780w was obtained from a 2.44- resolution data set collected at a wavelength of 1.6531 using the diamond light source, beamline i04. phasing by single - wavelength anomalous diffraction was performed using phenix.autosol (36), which located and refined 27 iodine atoms to produce a density map with initial figure of merit of 0.51. initial model building was done with phenix.autosol (247 residues built and 184 identified). iterative model building was performed with coot (37) and refinement against the native 2.35 data was performed with buster 2.10 (38). the model and associated data have been deposited in the research collaboratory for structural bioinformatics (rcsb) protein data bank (http://www.rcsb.org) under accession number 4jle. cs - rosetta (41) structure prediction was performed on residues 306346 of atss using backbone n, hn, and c chemical shifts recorded in the presence of the pfi1780w phist domain and extrapolated to complex saturation. data were processed by talos+ (42) before input in cs - rosetta for fragment selection and generation of 12,800 models. model superposition with a 3- root mean square deviation (rmsd) cutoff yielded large clusters of which the top 3 had 1313, 943, and 719 members. these clusters showed characteristic -sheet structures but incomplete convergence due to flexible loops between strands. superposition using the most stable secondary structure elements (residues 311314, 320324, and 329333) and 1- rmsd cutoff resulted in model convergence as judged by the funnel - shaped plot of model score vs. pairwise rmsd. assignments of pfi1780w were performed at 37c using triple - resonance experiments on a 600-mhz avance iii spectrometer (bruker, newark, de, usa) with a cryogenic probehead. nmr samples for assignments consisted of 0.2 mm c / n - enriched pfi1780w residues 98247 in buffer a (ph 6.5) supplemented with 0.1 mm 4,4-dimethyl-4-silapentane-1-sulfonic acid, 0.02% (w / v) nan3, and 5% (v / v) d2o. the limited sample concentration and stability under these conditions (typical lifetime of 2 d) necessitated the use of multiple samples to obtain a sufficient signal / noise ratio. assignments have been deposited in biomagresbank (university of wisconsin, madison, wi, usa ; http://www.bmrb.wisc.edu/) under accession number 19719. perturbations in h and n chemical shifts were combined as (h, n) using the formula (h1, n15)={[(h1)complex(h1)free]2 + 0.04 [(n15)complex(n15)free]2}1/2 similar perturbations of carbonyl c resonances were expressed as (c) = (c)free (c)complex. full - length pfi1780w and pfe1605w inserts were c - terminally fused either to green fluorescent protein (gfp) into parl1a - gfp (kindly provided by t. spielmann, bernhard nocht institut, hamburg, germany ; ref. 43) or c - terminally to hemagglutinin (ha) into pbcamr_3xha (44). falciparum strain 3d7 was cultured in human 0 + erythrocytes according to standard procedures (45). transfected parasites were drug selected with either 10 nm wr99210 (jacobs pharmaceuticals, cologne, germany) or 2.5 mg / ml blasticidin (life technologies, zug, switzerland). parasite proteins were obtained through saponin lysis of synchronized parasites (510% parasitemia) after 2 sorbitol treatments within 4 h and percoll purified after 30 h. parasite aliquots were taken every 8 h. samples were run on a 12.5% (w / v) sds - page column with complete protease inhibitor cocktail (roche, rozkreuz, switzerland) and transferred to a nitrocellulose membrane (hybond - c extra ; ge healthcare lifesciences). antibodies were diluted in 5% (v / v) milk - pbs : mouse monoclonal anti - gfp (1:1000 ; roche), rabbit anti - ha (1:20 ; invitrogen, zug, switzerland), rabbit anti - mahrp1 (1:5000), rabbit anti - mahrp2 (1:1000), mouse monoclonal anti - glyceraldehyde-3-phosphate dehydrogenase (gapdh ; 1:20,000), mouse anti - pfe1605w (1:500), mouse anti - pfi1780w (1:500), and mouse anti - mal8p1.4 (1:500). binding was made visible by chemiluminescence (supersignal west pico, thermo scientific, reinach, switzerland). blood smears of infected parasite cultures were fixed in 100% acetone for 30 min (47) and blocked with 3% (v / w) bovine serum albumin. primary antibodies, rabbit anti - mahrp1 (1:500), mouse anti - pfi1780w (1:100), mouse anti - pfe1605w (1:100), mouse anti - mal8p1.4 (1:200), mouse anti - gfp (1:100, roche), and mouse anti - ats (1:50), were incubated for 1 h (48). secondary antibodies (goat anti - mouse alexa 488, goat anti - mouse alexa 594, and goat anti - rabbit alexa 594 ; invitrogen) were incubated with 1 g / ml 4,6-diamidino-2-phenylindole (dapi ; roche) for 1 h at 1:200 dilution. alternatively, irbcs were fixed with 4% paraformaldehyde (pfa)-0.01% glutaraldehyde and permeabilized with 0.1% triton x-100. slides were viewed with a zeiss lsm 700 confocal microscope (carl zeiss gmbh, jena, germany), with a 63 oil - immersion lens (1.4 numerical aperture). live parasites were imaged with a leica dm 5000b fluorescence microscope using a 100 oil immersion lens (1.4 numerical aperture) with an attached leica dfc300fx camera and leica application suite software (leica microsystems, heerbrugg, switzerland). pfe1605w - ha and pfi1780w - gfp transfected mature parasites were purified by percoll density gradient, fixed in 2% pfa-0.2% glutaraldehyde in phosphate buffer, and prepared according to tokuyasu (50). ultrathin sections (7090 nm) prepared on an fc7/uc7-ultramicrotome (leica microsystems) at 120c were immunogold - labeled with rabbit anti - ha (1:20 ; invitrogen) or rabbit anti - gfp (1:20 ; abcam, cambridge, uk) antibodies and 5 nm protein a - gold (1:70 ; umc, utrecht, the netherlands). sections were stained with 4% uranyl acetate - methylcellulose (1:9) and examined with a transmission electron microscope (cm10 or cm100 ; philips, eindhoven, the netherlands) at 80 kv. previously, we showed that intracellular segments (referred to as atss) from members of the pfemp1 family comprise a stably folded core and 3 flexible regions (32). we demonstrated that the phistc protein pfi1780w interacts with moderate strength (kd150 m) with the ats of pfemp1 variant pf08_0141. thus, we produced phist domains from proteins that had been reported as important for cytoadherence of irbcs (pfd1170c ; ref. 4), that are adjacent on the genome to the locus of pfemp1 variant pf08_0141 (mal8p1.163), or, alternatively, that were identified in proteomic studies on tethers (pfe1605w) and tested them for interactions with the ats. as a negative control, we produced a phist member that was shown not to localize to the irbc membrane and thus would not be expected to associate with the ats (mal8p1.4). polarization experiments showed that pfe1605w, a phistb member, bound fluorescently labeled ats pf08_0141 with 30-fold higher affinity (kd=50.6 m) than pfi1780w (fig. nmr experiments suggest that the phist interaction occurs at the c terminus of the ats (see below), and polarization experiments using a fluorescently labeled ats c - terminal construct (residues 293392) showed that this fragment is sufficient for strong pfe1605w binding (fig. b, c) similar titrations with different labeled pfemp1 intracellular domains and pfe1605w (b) or pfi1780w (c). binding by pfemp1 variant pff0845c was weak and could not be fit. in panel b, d) titrations of ats pf08_0141 full - length or c - terminal fragment (residues 293392) with pfe1605w. to test whether different pfemp1 members retain the pfe1605w interaction, we produced fluorescently labeled atss from pfemp1 variants pff0010, pfb1055c, pfc1120c, pf08_0103, and pff0845c, which were selected on the basis of sequence divergence (32). intriguingly, polarization experiments with pfe1605w showed up to 25-fold difference in affinities (kd range, 2.767 m ; fig. whether these differences reflect closer associations of pfe1605w with particular pfemp1 members in vivo remains to be studied ; however, time course experiments did suggest a closer association of pfe1605w with pfemp1 than pfi1780w during transport. to test whether these phist proteins are exported and to determine their subcellular localizations, they were c - terminally gfp tagged and episomally expressed in 3d7 parasites under the control of the crt promoter. the integrity of the gfp - fusion proteins was shown on western blots (fig. the full - length pfi1780w - gfp was exported to the irbc cytosol similarly to the previously reported gfp - tagged n terminus (19), but full - length pfi1780w - gfp additionally revealed fluorescence at the periphery of irbcs (fig. 2b ; top panel), suggesting a localization close or adjacent to the erythrocyte membrane (fig. 2b immunofluorescent 3-dimensional reconstructions of fixed irbcs with pfi1780w - gfp - expressing parasites showed focal fluorescence in parasite cytosol and uniform fluorescence around the biconcave rim of the irbc (fig. available gfp - tagged phist proteins only pfe1605w - gfp gave a similar fluorescent pattern except that the rim - like fluorescence was observed at discrete foci instead of a uniform signal (fig. 2b, panels 4 and 5), indicating that both pfi1780w and pfe1605w were transported close to the irbc membrane. all extracts are derived from saponin - released parasites, and the origin is indicated on top. decoration of the same western blot with gapdh as loading control is shown at bottom. b) live cell imaging of 3d7 parasites expressing pfi1780w - gfp and pfe1605w - gfp. for panels 2 and 5, the focal plane of the gfp signal was set on the surface of the irbc, and the dapi / differential interference contrast (dic) microscopy signal was kept on the previous focal plane. merge image of gfp / dapi / dic channels representing stack 32 of 69 in total. d) western blot of protein fractions of solubility assays of 3d7 parasites expressing pfi1780w - gfp and pfe1605w - gfp. lane 1, soluble proteins ; lane 2, peripheral membrane proteins ; lane 3, triton x-100 extract ; lane 4, insoluble pellet. the soluble parasite protein gapdh was found as expected in the supernatant after hypotonic lysis, and mahrp1, an integral maurer 's cleft membrane protein (51), was detected in the triton x-100 supernatant. both pfi1780w - gfp and pfe1605w - gfp lack a predicted transmembrane domain and were shown to be membrane - associated proteins by solubilization in sodium carbonate similar to mahrp2, a membrane - associated protein localizing to maurer 's cleft tethers (46). this result was further confirmed by the fluorescent labeling of the irbc membrane of a ruptured schizont expressing pfi1780w - gfp (fig. gold labeling of pfi1780w - gfp was found in proximity to the irbc membrane but was clearly absent from knobs (fig. 3c) and pfe1605w - gfp were clearly localized in knobs, and in trophozoite stage parasites, pfe1605w - gfp was also frequently found in maurer 's clefts (fig. 3d), suggesting that it localizes underneath the irbc membrane, whereas pfe1605w localizes to knobs, but both proteins seem to be transiently transported through the maurer 's clefts. shown here are postembedding immunoelectron microscopy images of irbcs expressing pfi1780w - gfp (a, b), pfe1605w - ha (c), and pfe1605w - gfp (d). white arrows, 5 nm gold. knobs (k) and maurer 's clefts (mc) are labeled. scale bars = 200 nm (a) ; 500 nm (c) ; 250 nm (b, d). specific antisera against pfi1780w (aa 80280) recognized a single band of 45 kda in agreement with its predicted mass of 45.5 kda (fig. 4a), and antisera against pfe1605w (aa 122335) recognized a band of 55 kda and a faint band of 50 kda. western blotting using samples from 6 time points of the intraerythrocytic cycle showed that both proteins were present throughout the cycle, which is in agreement with their transcription profile (52, 53). a) western blot with extracts from stage - specific parasites (hpi indicated for each lane). samples were collected at 8-h intervals and stained with antibodies recognizing pfe1605w (b), pfi1780w (c), or ats (d) and costained with dapi. we performed ifas to visualize expression and export of pfe1605w / pfi1780w throughout the intraerythrocytic cycle using tightly synchronized parasites at 6 time points (fig. 4b, c) and compared the timing of export of pfemp1 using anti - ats antibodies (fig. pfe1605w was first observed at 08 h postinfection (hpi) in a necklace of beads pattern at the parasite surface (fig. 4b ; top panel) and in young trophozoites (1624 hpi) most fluorescence was observed in the parasite with few fluorescent foci beyond the parasite 's confines. after 2432 hpi, the number of fluorescent foci in the irbc cytosol increased, and faint fluorescence was visible at the irbc membrane. schizont stage parasites showed faint fluorescent dots at the irbc membrane, similar to those seen with live cell images of pfe1605w - gfp (fig. bright fluorescent foci indicated that pfe1605w is exported via maurer 's clefts to the irbc membrane and knobs. pfemp1 is known to display a necklace of beads pattern at the parasite surface at 811 hpi (54), which was confirmed (fig. 4b). both proteins transiently associated with maurer 's clefts at 1624 hpi (ref. 4b, d) before being transferred to the irbc membrane, suggesting cotransport of pfe1605w with pfemp1. in contrast to pfe1605w, pfi1780w was found within the parasite cytosol until 2432 hpi with limited focal fluorescence in the irbc cytosol (fig. pfi1780w was exported to the irbc surface as shown in live cell imaging (fig. 2b) with no distinct intermediate locations, although a few fluorescent foci and immunoelectron microscopy data (fig. 3b) suggest that maurer 's clefts are intermediate transport compartments. to confirm the transient location of pfe1605w at maurer 's clefts, we colocalized the protein with mahrp1 in ring, trophozoite, and schizont stage parasites. while in ring stages, mahrp1 already appeared in maurer 's clefts and pfe1605w exclusively localized within the parasite cytosol (supplemental fig. pfe1605w and mahrp1 colocalized to maurer 's clefts with a partial overlap of signals, suggesting subdomains in maurer 's clefts as described previously for mahrp1 and pfemp1 (54). this is also evidence for pfe1605w transport to already formed maurer 's clefts and proof that cargo arrives at clefts independent of their formation as reported previously (54, 55). at later stages, pfe1605w dissociates from maurer 's clefts and in contrast to pfe1605w and pfi1780w, mal8p1.4, which does not interact with the ats domain (fig. the pfe1605w phist domain evaded crystallization alone or in complex with ats fragments and was unsuitable for extensive nmr analysis due to limited solubility. thus, we turned to pfi1780w, which also interacts with ats, to gain information on the phist - ats complex. to delineate the specific phist - ats interaction site, we performed nmr titrations of c / n - enriched ats pf08_0141 (32) with the unenriched pfi1780w phist domain (residues 98247). 5ac, the largest chemical shift perturbations, indicative of complex formation, span a wide region at the flexible c terminus of the ats. although sequence similarity across the c terminus of pfemp1 intracellular segments is relatively low (32), 75% of the amino acids most perturbed on pfi1780w binding are conserved (i311, i313, i330, l331, d336, i338, y339, y340, and w391) or conservatively substituted (t329, d332, e335, i372, and v390) in the majority of members of the pfemp1 family (supplemental fig. we were able to perform similar experiments on c / n - enriched ats with unenriched pfe1605w under dilute conditions and recorded the loss of ats resonance intensity in the presence of pfe1605w (supplemental fig. s3a). mapping interaction interfaces using this type of information is less sequence specific than that with the chemical shift perturbations observed with pfi1780w, as loss of resonance intensity may reflect interactions by a specific residue or its neighbors. s3b) suggest that pfe1605w affects a wide span of the ats c terminus that includes the pfi1780w interaction epitope (fig. in addition, pfe1605w makes additional contacts with the ats c terminus that span residues 303309 and 353362 ; these additional contacts may contribute to the higher ats affinity of this phist variant. a) combined perturbations of backbone amide nuclei of 0.1 mm c / n - enriched ats on titration with 0.2 mm unenriched pfi1780w phist domain. dashed line denotes the level of average perturbation plus 1 sd ; residues with perturbations above this line are considered as significantly affected. c) carbonyl perturbations of the same ats region as in panel b. residues judged as significantly affected in either amide or carbonyl perturbations are colored based on their conservation : red if identical or orange if conservatively substituted in 75% of pfemp1 members in p. falciparum isolate 3d7. d) n - heteronuclear single quantum coherence spectra overlay from 0.1 mm n - enriched pfi1780w phist domain alone (red) or in the presence of 0.2 mm unenriched ats c - terminal fragment (residues 309392, green). e) expansion of overlaid spectra from 50 m pfi1780w phist domain alone (red), in the presence of 50 m ats residues 309392 (black), after addition of 0.6 stoichiometric ratio of unenriched pfe1605w phist domain (blue), or after addition of 1.2 stoichiometric ratio of pfe1605w (green). pfe1605w addition reverses pfi1780w perturbations caused by ats binding, suggesting that the 2 phist proteins compete for the same ats binding site. f) per - residue combined perturbations of backbone amide h and n nuclei from the pfi1780w spectra shown in panel d. dashed line identifies significantly perturbed residues as in panel b. to confirm that the 2 phist proteins compete for the same ats interaction epitope, we performed nmr experiments using n - enriched pfi1780w and unenriched ats c terminus and pfe1605w (fig. 5d). perturbations on pfi1780w resonances caused by ats are reversed by pfe1605w (fig. we obtained crystals of a pfi1780w fragment spanning residues 85247 and solved the resulting structure to 2.35- resolution (supplemental table s1). the final model showed 2 protein chains forming a tight helix - swapped dimer in the crystal (fig. 6a) ; however, auc velocity experiments showed that pfi1780w is monomeric in solution under physiological conditions (fig. thus, we concluded that the dimer is a crystallization artifact and consider only the monomeric unit of the phist domain. a) crystallographic model of the pfi1780w phist domain, showing the dimer (blue and red chains). data analysis yielded a narrow distribution at 1.65 s, with best friction ratio of 1.61 and 19,919 da corresponding molecular mass. d) twist of the triple - helix bundle for pfi1780w and spectrin (rcsb 3kbt). 6c), in agreement with structure predictions (19) and circular dichroism data (32). a short initial helix (1) is followed by an antiparallel bundle of 3 long helices (24), which are up to 51 aa in length. the pfi1780w triple - helical bundle is of length (6.5 nm) comparable to that of a spectrin repeat ; however, in contrast to spectrin, it adopts a right - handed twist (fig. phist domains show remarkable sequence divergence, and pfi1780w belongs to the most variable phistc subtype of this family (19). alignment of the pfi1780w phist domain with its 5 closest relatives showed just 4% identical and 20.7% conservatively substituted residues (supplemental fig. the vast majority of these conserved amino acids, including all tryptophans characteristic of the phist family (19), are involved in the protein hydrophobic core and do not form a continuous surface area. nonetheless, the pfi1780w structural model is sufficient to model with 98100% confidence the domain structures for all members of this family using automated prediction pipelines. the chemical shift perturbations of pfi1780w on ats binding allowed us to map the binding site on the phist structure (fig. 5f). the most significant changes localized at the middle of the pfi1780w triple - helical bundle, and, in particular, over a continuous surface on helices 2 and 3 (fig. 7c and supplemental fig. the amino acids forming this ats - binding interface (k136, e138, e139, h167, f168, and q171) are not conserved between pfi1780w and pfe1605w, which probably contributes to the different ats affinities of these proteins. nonetheless, because pfi1780w and pfe1605w compete for the same ats epitope, we reasoned that an analysis of the pfi1780w - ats interaction may provide a partial model of the high - affinity complex. structure prediction for the ats c terminus and analysis of the pfi1780w - ats interaction. models were predicted for a c - terminal fragment of ats spanning residues 306346, using chemical shift restraints that correspond to the pfi1780w - complexed state of ats. a characteristic funnel shape in this plot suggests that the calculation converged to a single subset of solutions. b) schematic representation of a low - energy ats model from panel a. c) opposite views of the pfi1780w phist domain surface, with areas significantly affected by ats binding in nmr titrations shown in red. d) proposed mode of pfi1780w - ats binding based on the predicted structure of ats residues 306346. the number of ats - binding residues on pfi1780w is remarkably small compared with the broad span of perturbations observed on the ats c terminus (fig., the continuous surface identified on pfi1780w 23 can only accommodate approximately 6 aa in an extended conformation. to understand how these observations relate, we predicted the transient structure adopted by the ats c - terminal epitope (residues 306346) on pfi1780w binding using cs - rosetta (41). 7a, b, the structure prediction converged to a single sheet formed by ats residues 311314 (1), 320324 (2), 328334 (3), and 337343 (4). formation of a single sheet by ats residues 306346 may explain the widespread chemical shift changes seen in this construct on pfi1780w binding, as nearly all residues would transit from a random coil to an extended conformation. yet, at the same time, the single ats sheet could provide a relatively narrow interaction interface with pfi1780w along the -sheet edge. thus, we propose that an ats associates along one -sheet edge with pfi1780w (fig. the extensive remodeling of host erythrocytes by invading plasmodia is an impressive feat of biological engineering necessary for the parasites to grow, replicate, and evade the immune system ; thus, it has clear implications for the human host. the unique alterations induced by p. falciparum resulting in irbc cytoadherence are linked to disease severity (7). irbc remodeling involves hundreds of proteins, few interactions and even fewer structures have been examined in detail. here, we present the first structural - functional insights on phist proteins, which comprise a large subset of the p. falciparum exportome (4, 19). notably, our study suggests strong links between a specific phist member and pfemp1, the parasite receptor responsible for cytoadherence. 6), are characterized by a relatively simple -helical bundle structure, a type of protein fold that can accommodate divergent sequences and, thus, present variable surface residues to accommodate different binding requirements. the phist family in plasmodia probably serves precisely the role of a simple, easy - to - manipulate type of protein that can act to bridge or structurally support other components. phist proteins seem to have a variety of functions in the parasite (4, 20, 21, 26, 30), but this might reflect their role as interaction hubs that can bind flexible protein segments, as shown here for ats (fig. 7). thus far, the molecular evidence of phist - mediated interactions presented here and elsewhere (20, 21, 56) involves only 10% of all family members, and high - throughput molecular methods may provide a clearer picture of the phist interactome. what is the relationship of phist proteins with pfemp1 ? in a limited set of phist variants, we identified 2 members, pfi1780w and pfe1605w, that bound the pfemp1 intracellular segment (fig. 1a) ; it is likely that additional pfemp1-binding phist domains can be found among the 72 members of this family. both phist proteins described here interact with the same pfemp1 epitope but with significantly different affinities. furthermore, substantial variation in binding strength was observed, depending on specific phist / pfemp1 combinations (fig. 1b), which leads us to propose that individual phist variants might have been optimized for different groups of pfemp1 molecules. this proposal is strongly supported by transcriptomic evidence of a specific phista member (pf14_0472) up - regulated in parasites expressing pfemp1 variants binding human brain endothelial cells (26). similarly, we observed that both pfemp1-binding phist proteins localized to the irbc membrane (fig. 2b), but only pfe1605w was coexported with pfemp1 and localized in knobs (fig. (56) showed that disruption of pfe1605w, termed lymp in their study, reduced irbc cytoadherence to cd36 by 55%, while retaining knob formation and pfemp1 surface localization. further, they identified an interaction between inside - out vesicles prepared from uninfected human erythrocytes and the pfe1605w positively charged c terminus, but not its phist domain. together with the data presented here, we can now suggest at least one mechanistic role for pfe1605w and potentially for other phist proteins in cytoadherence (fig. 1) soon after export from the parasite and remains bound during trafficking to maurer 's clefts (fig. 3). when in knobs, the c - terminal segment of pfe1605w links pfemp1 with the host cytoskeleton. 7) probably complements direct ats - cytoskeletal binding (57) and ensures mechanical robustness against shear forces exerted by blood flow, thereby allowing strong cytoadherence. our proposed mechanism of pfe1605w function, connecting the c terminus of pfemp1 ats to the cytoskeleton, is illustrated. in summary, we present here the first structural insights on members of the phist family and how they function as protein interaction modules. the interaction properties of specific members could be linked to their cellular localization and trafficking pattern alongside the well characterized pfemp1, allowing the proposition of a mechanistic model of the function of phist molecules in cytoadherence. | uniquely among malaria parasites, plasmodium falciparum - infected erythrocytes (irbcs) develop membrane protrusions, known as knobs, where the parasite adhesion receptor p. falciparum erythrocyte membrane protein 1 (pfemp1) clusters. knob formation and the associated irbc adherence to host endothelium are directly linked to the severity of malaria and are functional manifestations of protein export from the parasite to the irbc. a family of exported proteins featuring plasmodium helical interspersed subtelomeric (phist) domains has attracted attention, with members being implicated in host - parasite protein interactions and differentially regulated in severe disease and among parasite isolates. here, we show that phist member pfe1605w binds the pfemp1 intracellular segment directly with kd = 5 0.6 m, comigrates with pfemp1 during export, and locates in knobs. phist variants that do not locate in knobs (mal8p1.4) or bind pfemp1 30 times more weakly (pfi1780w) used as controls did not display the same pattern. we resolved the first crystallographic structure of a phist protein and derived a partial model of the phist - pfemp1 interaction from nuclear magnetic resonance. we propose that pfe1605w reinforces the pfemp1-cytoskeletal connection in knobs and discuss the possible role of phist proteins as interaction hubs in the parasite exportome.oberli, a., slater, l. m., cutts, e., brand, f., mundwiler - pachlatko, e., rusch, s., masik, m. f. g., erat, m. c., beck, h.- p., vakonakis, i. a plasmodium falciparum phist protein binds the virulence factor pfemp1 and comigrates to knobs on the host cell surface. |
a novel oxidative n - heterocyclic carbene - catalyzed reaction pathway has been discovered. alkyl and aryl enals undergo -hydroxylation via oxygen atom transfer from electron - deficient nitrobenzenes, followed by trapping of the resultant acyl azolium by the solvent. the proposed mechanism involves a single electron transfer event to initiate the reaction followed by radical recombination. this represents a profound mechanistic departure from the established two - electron disconnects in nhc catalysis. |
|
prospective interventional case series conducted at a tertiary eye care hospital from april 2013 to april 2014. patients aged more than 18 years with a diagnosis of active hsv nsk were enrolled. ulcer measuring more than 2 mm and involving more than one - third of corneal stroma with an overlying epithelial defect were included. patients were excluded if they had been treated with antiviral therapy and/or topical or systemic steroids within the previous 6 weeks. culture positive bacterial, fungal, or parasitic infections and patients with known allergy to oral or topical acyclovir were excluded from the study. pregnant and lactating women and patients with renal insufficiency were also excluded from the study. patients who had undergone corneal surgery or any ocular surgery in the preceding 6 months were also excluded. the patients were classified as early presentation when the duration of disease was less than 6 weeks and as late presentation when more than 6 weeks duration. history of recurrent episodes of keratitis, any exacerbating or precipitating factors, and any associated systemic illness was recorded. the diagnosis of nsk was clinically based on the presence of thinning, ulceration, and dense infiltration of the stroma, accompanied by an overlying epithelial defect with minimal discharge. patient 's symptoms, visual acuity, conjunctival injection, stromal edema, size of infiltration, and severity of corneal thinning were evaluated on every visit. complete ophthalmic examination was performed by a single cornea specialist at baseline, day 3 and every week thereafter until 10 weeks. patients received a 10 weeks regimen of oral acyclovir 400 mg 5 times / day (acivir, cipla ltd, india) and topical acyclovir eye ointment 5 times / day (acivir, cipla) for 2 weeks. diluted topical prednisolone sodium phosphate eye drops in buffered isotonic aqueous solution (0.125% predforte, allergan, irvine, ca, usa) was commenced in tapering doses (starting dose of 4 times / day). primary outcome measure was a response to therapy which was clinically assessed by comparing the size of infiltrate at trial entry and after 2 weeks of systemic and topical antiviral treatment. secondary outcome measure was improvement in best - corrected visual acuity from baseline to end of 10 weeks. any surgical intervention or adverse incident occurring during the course of therapy was recorded to assess safety of the treatment. treatment failure was considered in cases where there was an increase in the area of infiltrate, appearance of fresh infiltrate, < 10% decrease in the stromal keratitis or corneal perforations requiring keratoplasty within first 2 weeks. cyanoacrylate tissue adhesive application for management of extreme thinning was noted as a surgical intervention. however, these patients continued to remain in the study and response to therapy was recorded. prospective interventional case series conducted at a tertiary eye care hospital from april 2013 to april 2014. patients aged more than 18 years with a diagnosis of active hsv nsk were enrolled. ulcer measuring more than 2 mm and involving more than one - third of corneal stroma with an overlying epithelial defect were included. patients were excluded if they had been treated with antiviral therapy and/or topical or systemic steroids within the previous 6 weeks. culture positive bacterial, fungal, or parasitic infections and patients with known allergy to oral or topical acyclovir were excluded from the study. pregnant and lactating women and patients with renal insufficiency were also excluded from the study. patients who had undergone corneal surgery or any ocular surgery in the preceding 6 months were also excluded. the patients were classified as early presentation when the duration of disease was less than 6 weeks and as late presentation when more than 6 weeks duration. history of recurrent episodes of keratitis, any exacerbating or precipitating factors, and any associated systemic illness was recorded. the diagnosis of nsk was clinically based on the presence of thinning, ulceration, and dense infiltration of the stroma, accompanied by an overlying epithelial defect with minimal discharge. patient 's symptoms, visual acuity, conjunctival injection, stromal edema, size of infiltration, and severity of corneal thinning were evaluated on every visit. complete ophthalmic examination was performed by a single cornea specialist at baseline, day 3 and every week thereafter until 10 weeks. patients received a 10 weeks regimen of oral acyclovir 400 mg 5 times / day (acivir, cipla ltd, india) and topical acyclovir eye ointment 5 times / day (acivir, cipla) for 2 weeks. diluted topical prednisolone sodium phosphate eye drops in buffered isotonic aqueous solution (0.125% predforte, allergan, irvine, ca, usa) was commenced in tapering doses (starting dose of 4 times / day). primary outcome measure was a response to therapy which was clinically assessed by comparing the size of infiltrate at trial entry and after 2 weeks of systemic and topical antiviral treatment. secondary outcome measure was improvement in best - corrected visual acuity from baseline to end of 10 weeks. any surgical intervention or adverse incident occurring during the course of therapy was recorded to assess safety of the treatment. treatment failure was considered in cases where there was an increase in the area of infiltrate, appearance of fresh infiltrate, < 10% decrease in the stromal keratitis or corneal perforations requiring keratoplasty within first 2 weeks. cyanoacrylate tissue adhesive application for management of extreme thinning was noted as a surgical intervention. however, these patients continued to remain in the study and response to therapy was recorded. the mean age of the patient was 51.53 years (range : 30 - 80 years). ten patients showed predilection for the left eye (72.92%) and three patients for the right eye (23.08%). eight patients (61.5%) were classified as early presentation and five patients (38.5%) as late presentation. dna pcr was done for all cases out of which 11 were positive (74%). the area of infiltration at presentation ranged from 2 to 31 mm with a mean of 8.52 mm (standard deviation [sd ] = 8.19 mm). three patients (23.08%) had up to one - third thinning of the corneal stroma and five patients (38.46%) had thinning up to two - third corneal stroma and rest five (38.46%) had severe thinning more than two - third corneal stroma. after 2 weeks of antiviral therapy, the area of infiltration ranged from 1 to 16 mm, with a mean of 5.12 mm (sd = 4.62 mm). area of infiltration at trial entry and at the end of 2 weeks of antiviral treatment was statistically significant (p = 0.007). ten patients (76.9%) showed complete resolution of the epithelial defect at 2 weeks. figs. (b) patient on therapy at the end of 2 weeks (5 mm). (c) image showing complete resolution at 10 weeks (a) patient at presentation (31 mm). (c) image showing complete resolution at 10 weeks (a) patient at presentation (19.5 mm). (c) image showing complete resolution at 10 weeks three eyes (23.08%) developed spontaneous perforation within the first 2 weeks. all three had prolonged the duration of presentation (more than 6 weeks), more than two - third corneal thinning and more than 8.1 mm area of infiltration. these patients responded well to antiviral therapy after application of tissue adhesive. on removal of tissue adhesive at 6 weeks visual acuity (logmar) at presentation ranged from 2.20 to 0.48 with a mean of 1.75 (sd = 0.508). at the end of 2 weeks, visual acuity ranged from 0.78 to 2.20 logmar with a mean of 1.44 (sd = 0.41). at the end of 10 weeks, visual acuity ranged from 1.40 to 0.48 with a mean of 1.087 (sd = 0.387). the improvement in visual acuity from presentation up to 2 weeks was not statistically significant (p = 0.06) ; however, it was statistically significant at the end of 10 weeks (p = 0.003). after initiation of topical steroid therapy at the end of 2 weeks, all patients showed symptomatic improvement. no patient deteriorated after initiation of topical steroid therapy. at the end of 10 weeks, all patients presented with a vascularized corneal scar indicating the complete resolution of keratitis and response to therapy. this study shows that topical and systemic acyclovir for treatment of nsk facilitated healing of ulceration. nsk, in contrast to immune - mediated stromal keratitis and stromal edema due to hsv endotheliitis is essentially an infective disease with a demonstration of live virus in the corneal stroma. this study confirmed the presence of live virus in this disease entity with 74% of the samples showing hsv1 dna in pcr in corneal scraping. the rationale to use systemic acyclovir for treatment of nsk was based on evidence in the literature that therapeutic concentrations of the drug are present in the plasma following oral administration. the heds study also showed a beneficial response to systemic acyclovir in treatment of herpetic uveitis, another condition where the live virus has been demonstrated. this study demonstrated that systemic acyclovir in addition to topical antiviral therapy is effective in treatment of nsk. there was a significant resolution of stromal infiltration within 2 weeks of initiation of therapy. however, steroids have a beneficial role in reducing the overall inflammation, discomfort, and pain of the patient. this has also been seen in this study where after initiation of topical steroids all patients showed symptomatic improvement during the course of the trial. corneal clarity improved with steroids resulting in an improvement in visual acuity. in our study, the average onset of symptoms to diagnosis was 2.5 weeks and 8 out of 13 patients were being treated as suppurative keratitis. all three patients presented late, and with more than two - third stromal thinning at enrollment of study. the regime of systemic and topical acyclovir therapy was not effective in halting the progression to perforation, in cases with extreme thinning. all patients underwent cyanoacrylate tissue adhesive for tectonic support in this group, while systemic acyclovir facilitated eradication of infection. signicant improvement of visual acuity was noted in the majority of cases in this study. however, this improvement was significant at the end of 10 weeks, during this period, topical steroid drops were also given. low - dose topical steroid therapy did not have any side effects in our study. it is unclear from this study whether only antiviral therapy alone would have resulted in similar outcomes. this study shows a beneficial effect of combination therapy of topical and systemic acyclovir in the treatment of nsk. a randomized, controlled trial is required to determine the beneficial effect of topical acyclovir and oral acyclovir alone. nsk is an uncommon but distinct clinical entity in the varied presentations of ocular hsv. the disease can have extended periods of morbidity and if left untreated can have a poor visual outcome. | purpose : to evaluate the efficacy of systemic and topical antiviral therapy in the treatment of active herpes simplex virus (hsv) necrotizing stromal keratitis (nsk).design : prospective interventional case series.methodology:patients with a diagnosis of hsv nsk based on history and clinical findings were enrolled in the study. a standard protocol was used for microbiologic investigations. ten weeks regime of systemic acyclovir and 2 weeks of topical acyclovir was given. complete ophthalmic examination was performed at every visit. outcome measures were a reduction in the area of infiltration and improvement in visual acuity.results:fifteen patients were enrolled in the study. the mean age of presentation was 51.53 years. the duration of symptoms at presentation ranged from 2 to 8 weeks. hsv1 dna polymerase chain reaction was positive in 70% cases of those tested. area of infiltration at trial entry and at the end of 2 weeks of antiviral treatment reduced significantly (p = 0.007). all patients showed a complete resolution of keratitis at the end of study.conclusion:topical and systemic acyclovir for treatment of nsk facilitates healing of ulceration. topical steroids after initial antiviral therapy are safe and decreases inflammation and improve visual recovery. early initiation of therapy has better outcomes as compared to late presentations. |
as energy expenditure does not seem to have changed substantially over the past 30 years, an increased energy intake is believed to be the main factor explaining the current obesity epidemic. it is generally assumed that energy intake has changed because of changes in the environment : compared to the 1980s, western(ized) environments are now characterized by an abundant availability of highly rewarding, generally high - fat / high - sugar foods, which are advertised aggressively. that is, everyone in the western world is now exposed continuously and heavily to food - related cues. food responsiveness is regulated in a brain network, consisting of mesolimbic and frontal brain regions, which is referred to as the reward system. communication within the brain reward network happens through neurotransmitters such as dopamine, which is thought to be primarily involved in appetitive (wanting) responses to rewarding stimuli [3 ]. several addiction theories acknowledge that a drug - related cue reactivity, and particularly the subjective experience of craving, is a central feature of addiction, involved in the inability of addicted persons to stop the drug use and in relapse. one of these theories is the incentive sensitization theory [5, 6 ]. in short, according to this theory the repeated exposure to drugs leads to a process of incentive sensitization in the dopamine - driven brain reward system. through a process of associative conditioning, not only drugs themselves, but all stimuli associated with drug use acquire incentive salience qualities. that is, the mere exposure to drug - related stimuli elicits the release of dopamine in the brain reward system, and because of this these stimuli become attention - grabbing, induce subjective craving, and ultimately elicit approach behavior. according to this theory, an attention bias to drug - related cues is, as much as subjective craving, a central feature of addiction, and is also directly related to dopamine activity in the reward system. a wealth of research shows that addicted persons (to all kinds of drugs) are generally characterized by an attention bias for relevant drug - related stimuli, which is associated with subjective craving and predicts relapse [7, 8 ]. there are similarities between addictive behavior and overeating and obesity. as addicts, persons with an overeating problem report cravings for, generally high - calorie, food and loss of control over eating. for many people, it is difficult to resist palatable, high - calorie foods, although the negative consequences of indulging in these foods are well known. relapse rates are equally high in weight loss programs as in addiction treatment programs [9, 10, 11 ]. on a neurobiological level, several studies point to similar deficits in dopamine - based reward system functioning in persons with an addiction and an overeating problem / obesity [12, 13 ]. according to some obesity researchers, neurocognitive addiction models, such as the incentive sensitization theory, might be applicable to obesity [3 ]. this means that, similar to addiction, an attention bias to rewarding foods might play an important role in the development and maintenance of overeating behavior and weight gain / obesity. during the last few years the relationship between attention bias to food - related stimuli and obesity has received increasing attention. this review gives a critical overview of studies concerning the attentional processing of food cues in obese and overweight individuals over the past 3 years (20092011). the general hypothesis of these studies is that overweight / obese individuals demonstrate an enhanced attention bias to highly rewarding, generally high - calorie foods, and that this attention bias is associated with subjective ratings of food craving. table 1 gives an overview of studies that have directly compared, otherwise healthy, overweight / obese and normal weight persons with regard to food - related attention bias. various tasks and techniques were used to assess two different components of attention to food - related stimuli : the initial orientation of attention (ie, the immediate and automatic detection of food - related stimuli) and the maintenance of attention (ie, the difficulty to disengage attention from food - related stimuli). interestingly, several studies found evidence for an enhanced oriented attention to, particularly high - calorie, food stimuli in overweight / obese persons. this was found by castellanos. and werthmann., using an eye - tracking procedure, by nijs. [16 ], using a visual probe task, and by nijs. using the amplitude of the p200 event - related potential (erp also interesting is that in some studies evidence was found for a reduced maintenance of attention, that is, an avoidance of or a shift away from high - calorie food - related stimuli in overweight / obese persons. [16 ], using the amplitude of the p300 erp, and by werthmann., who investigated the duration of initial eye fixations to food - related stimuli. an approach - avoidance tendency or a motivational ambivalence toward high - calorie food stimuli in overweight / obese persons makes sense, as these persons might experience a conflict between the desire to eat (as reflected in a strong initial orientation toward food) and the desire to lose weight (as reflected in a subsequent shift away from food). a motivational ambivalence is also seen, for instance, in unsuccessful dieters, self - reported chocolate cravers, and alcoholics who try to abstain from alcohol, suggesting that it might be a typical response to desired but substances.table 1a summary of food - related attention bias studies in ob / ow visual probe task individuals between 20092011studystudy groupsmeasure of attentionstimuliattention parameters (oriented / maintained attention)hunger / satiety interventionmain findings : difference between ow / ob and nw subjectsmain findings : positive association between attention bias and subjective cravingcastellanos. 18 ob and 18 nw womenet during performance of a vptpairs of pictures of hc / lc foods and non - food itemset direction biashunger (> 8 h) + satiety (shake 400 kcal ; within - subjects design)et direction + duration bias : direction / duration bias ~ hungeret duration biashunger : ob = nwvpt rt bias 2,000 mssatiety : reduced in nw ; retained in obwerthmann. 22 ow / ob and 29 nw womenet during performance of a vptpairs of pictures of high - fat foods and non - food itemset direction biasrestrain from eating 2 h prior to testing ; satiated with a lunch (400500 kcal) before testinget direction bias : ow / ob > nwin ow / ob : et duration bias ~ cravinget first fixation duration biaset first fixation duration bias : ow / ob nw, especially in hungerin nw : p300 bias ~ hungeret duration biasp300 bias : in ow / ob : vpt direction bias ~ hungervpt rt direction bias 100 mshunger : ow / ob nwnijs. 20 ob and 20 nw men and womenerp during a food - modified stroop taskwords, referring to hc foods and non - food itemsp200 erplight meal 2 h prior to testingp200 bias : ob > nwin ob : stroop rt bias ~ cravingin nw : p200/p300 15 long - term successful weight loss maintainers, 14 ob, 19 nwfood - modified stroop taskwords, referring to hc and lc foodsstroop rtfasting state (> 4 h)stroop rt interference hc words : successful dieters slower than ob / nw loeber. 20 ob and 20 nw men and womenvptpairs of pictures of foods and non - food itemsvpt rt bias 50 msrestrain from eating 3 h prior to testinggraham. 15 ow / ob and 21 nw womenetpairs of pictures of hc sweet foods ; hc savory foods ; lc foodset direction bias direction bias lc food : ow / ob > nw et duration biasbmi body mass index ; erp event - related potentials ; et eye tracking ; hc high - calorie ; lc low - calorie ; nw normal weight (bmi 18.525 kg / m) ; ob obese (bmi > 30 kg / m) ; ow overweight (bmi 2530 kg / m) ; rt reaction time ; vpt visual probe task a summary of food - related attention bias studies in ob / ow visual probe task individuals between 20092011 bmi body mass index ; erp event - related potentials ; et eye tracking ; hc high - calorie ; lc low - calorie ; nw normal weight (bmi 18.525 kg / m) ; ob obese (bmi > 30 kg / m) ; ow overweight (bmi 2530 kg / m) ; rt reaction time ; vpt visual probe task however, as the results in table 1 reveal, the approach - avoidance idea is not supported by all studies. results have been inconsistent and seem to depend on methodological choices and the study design. there is a large variety in study designs, which makes it rather difficult to compare directly results of different studies. moreover, one could raise questions on the validity of some of the used attention measures. in this review some issues are discussed, which could be taken into account when interpreting attention studies. in the studies summarized in table 1 attention for food - related stimuli is derived from behavior in reaction time tasks, eye tracking, electrocortical activity (erps), or a combination of these measures. among reaction time tasks the food - modified stroop task and visual probe task were used, being classic attention tasks that have been applied in various other areas of attention research [7, 21 ]. in the food - modified stroop task attention bias is derived from delayed reaction times in the color naming of food - related as compared to non - food - related words. using a food - modified stroop task, nijs. found no differences between weight groups with regard to the food - related interference effect. no differences between obese and always normal weight participants were found in the study by phelan. as well, although in this study slower reaction times to food words were found in a group of long - term weight loss maintainers with a history of overweight / obesity. these data suggest that an enhanced food - related stroop interference might not be associated with overweight / obesity per se, but rather with attempts to restrict and control food intake. as discussed by phelan., it is unclear which index of information processing is measured with the food - related stroop task. delayed reaction times might reflect an emotional distraction by the content of food - related stimuli, because these are desired or perceived as threatening, or they could reflect an avoidance of food stimuli, because these produce a conflict between the desire to eat and the desire to maintain cognitive control. this might even differ between groups : for instance, nijs. found strong positive associations between stroop interference scores and self - reported desire to eat in the obese group, but not in the normal weight group. there is also debate whether stroop interference effects reflect a fast automatic or a slower strategic process [2325 ]. in a food - modified visual probe task participants have to respond to a probe appearing at the position of one of two pictures (generally one food - related and one non - food - related), which were displayed simultaneously. faster reactions occur when attention is already drawn to the position where the probe appears. with the visual probe task it should be possible to investigate the different processes of initial orientation and maintenance of attention, simply by adjusting the presentation duration of stimulus pairs (respectively, 200 ms). however, some researchers question the usefulness of a visual probe task as an index of maintained attention. that is, when picture pairs are shown for a duration longer than 200 ms [14, 15, 16 ], this gives participants the opportunity to shift their attention back and forth between the pair of stimuli. as reaction times are measured on just one specific point in time (ie, after the picture pair has disappeared), an attention bias could as well reflect the coincident direction of the eyes to one of the stimuli at that moment. this makes it hard to interpret results from studies using the visual probe task with longer presentation durations, and it might explain why no weight group differences were found in maintained attention to food - related stimuli using such visual probe tasks [14, 15, 16 ]. in general, the visual probe task is acknowledged to be a valid measure of attentional orientation when a short presentation time (25 kg / m) and normal weight participants, whereas in the other half obese participants (bmi > 30 25 it is likely that addiction - like deficits in reward system functioning, and consequently an enhanced food cue - responsiveness, are particularly present in persons with a severe overeating / weight problem. for instance, one of the first neuroimaging studies, reporting on altered dopamine functioning in obesity, was conducted in participants with a bmi of 40 kg / m or more. in the same vein, research in addicted persons suggests that the intensity of a substance - related attention bias is directly proportional to the quantity and the frequency of the substance use. none of the mentioned studies has investigated differences between overweight and obese persons in food - related attention. moreover, it might even be the case that enhanced attention bias to food is not characteristic for all obese persons, but rather for a subgroup of obese persons, for instance persons who have more serious overeating episodes with clear loss of control over eating, such as binge eaters. there is increasing consensus that binge eating disorder might be closer related to addiction than obesity per se [3537 ]. in line with this point of view, svaldi. found, using an erp methodology, that women with binge eating disorder demonstrate enhanced attentional engagement to specifically high - calorie food pictures compared to healthy overweight controls. further, attention research in patients with eating disorders also suggests that enhanced attention bias to food is particularly seen in those patients characterized by binge eating. in addition, obese bingeing women have also been found to report more food craving than obese non - bingeing women after being exposed to food stimuli. for future attention studies, it might thus be recommended to focus on differences between obese bingeing, obese non - bingeing, overweight, and normal weight participants. on the other hand, evidence suggests that enhanced attention bias to food is not exclusively seen in persons with overweight or an eating problem, but is also present in normal weight persons with an eating style that might render them vulnerable to become obese or develop an eating disorder in future. for instance, enhanced attention bias to food stimuli has been reported in external eaters [eg, 41, 42 ], in successful and unsuccessful dieters (eg, [18, 43 ]), and in chocolate cravers. interestingly, some researchers have started to investigate causal or directional relationships between enhanced food responsiveness and weight / eating problems. for instance, calitri. found that a cognitive bias to unhealthy food words in a food - related stroop task predicted an increase in bmi over a 1-year period, whereas a cognitive bias to healthy food words was associated with a decrease in bmi. in line with addiction research, several studies investigated associations between attention bias scores and subjective craving or hunger ratings. whether positive associations are found again seems to depend on study design and methods, as well as weight group. [16 ] found positive correlations between erp measures and subjective craving (as well as acute calorie intake) in normal weight participants, but not in overweight participants. this supports the idea that erps are an adequate index of food motivation in normal weight persons, but not in overweight. in overweight participants, however, positive correlations were found between behavioral outcomes of attention (ie, visual probe task, stroop task) and craving, which was not seen in normal weight participants [16, 17 ]. reported general positive correlations between eye - tracking direction / duration bias and subjective hunger, whereas werthmann. only found a positive correlation between direction bias and subjective food craving, and this only in the overweight / obese group this implies that some attention measures might be adequate indices of food motivation in one group of persons, but not in another group. one problem, perhaps explaining inconsistent correlational findings, might be the use of self - report questionnaires. it is well known that obese persons tend to under - report, to a greater extent than normal weight persons, eating- and weight - related issues, such as their body weight and food intake. obese individuals might also tend to (purposively or not) under - report feelings of hunger or a desire to eat, perhaps because of social pressures or feelings of shame. researchers should always keep in mind that any self - report measure is unlikely to be a pure reflection of the subjective state it aims to measure, and that this might distort study results. [16 ] added a bogus taste task to their attention study, to assess direct calorie intake of participants during the exposure to high - calorie foods. the assessment of direct food intake in this way might be a more straightforward measure of motivational food responsiveness than self - report questionnaires. in the study by nijs. [16 ], only in the hunger condition overweight / obese participants consumed significantly more calories than normal weight participants. this was interpreted as overweight / obese persons being particularly hyperresponsive to food in a state of hunger. however, werthmann. did find differences between weight groups after satiation, with overweight / obese persons eating more calories than normal weights. as mentioned earlier, differences in study findings might be the result of the satiation procedure or other methodological choices. the incentive sensitization theory implies that the intensity of attention to reward - related stimuli is directly related to dopamine - based activity in the reward system. although various studies have found evidence for altered reward functioning in obese persons compared to normal weight persons (eg, [12, 13, 49 ]), few studies have investigated whether attention bias scores are directly related to activity in reward - related brain regions. to our knowledge, only one study combined the measurement of food - related attention in a behavioral task with functional neuroimaging (functional mri [fmri ]). [50 ] examined attentional bias in adolescent girls ranging from lean to obese using a food - modified attention network task. outcomes of the behavioral task correlated positively with bmi, and were thus indicative for an enhanced orientation and reallocation of attention to food stimuli in persons with a higher bmi. moreover, it was found that bmi correlated positively with activation in brain regions related to attention and particularly food reward, during initial orientation and reallocation of attention to appetizing food images. in addition, greater activation of the lateral orbitofrontal cortex (eg, involved in the evaluation of the reward value of a stimulus and decision making) during initial orientation to appetizing food cues predicted increase in bmi over a 1-year follow - up. in recent food - related attention bias studies, an interesting pattern of attention to food is seen in overweight / obese individuals, which is different from normal weight individuals : after an enhanced initial automatic orientation of attention to high - calorie stimuli (suggestive of an approach response), overweight / obese persons tend to show a more strategic attentional disengagement from these stimuli (suggestive of an avoidance response). however, as was discussed in this paper, study results are contradictory. this is possibly due to the use of different methodologies for measuring attention, which makes it difficult to directly compare study results. therefore, it is too premature to draw straightforward conclusions on the question whether overweight / obese individuals demonstrate enhanced attention to food cues and to what degree this influences further food responsiveness, such as food craving and food intake. although attention research is complex and challenging, it is of great importance to further investigate key issues, such as the identification of those (obese) persons in whom an attention bias to food is particularly present and problematic (eg, binge eaters), the exact circumstances in which an enhanced attention to food might be particularly present and problematic (eg, hunger / satiety or stress / emotions), the directional / causal relationships between food - related attention bias and food intake / weight gain, and the underlying neurobiology of food - related attention. this knowledge may be important for developing or improving prevention or treatment programs (eg, based on attention retraining), which could support obesity - prone or obese individuals in dealing with the overwhelming exposure to food cues in daily life. | the incentive sensitization model of obesity hypothesizes that obese individuals in the western world have acquired an enhanced attention bias to food cues, because of the overwhelming exposure to food. this article gives an overview of recent studies regarding attention to food and obesity. in general, an interesting approach - avoidance pattern in food - related attention has been found in overweight / obese individuals in a number of studies. however, it should be noted that study results are contradictory. this might be due to methodological issues, such as the choice of attention measurements, possibly tapping different underlying components of information processing. although attention research is challenging, researchers are encouraged to further explore important issues, such as the exact circumstances in which obese persons demonstrate enhanced attention to food, the directional relationship between food - related attention bias, overeating and weight gain, and the underlying involvement of the reward system. knowledge on these issues could help improve treatment programs. |
this means that smartphones are used as personal computers as often as they are used to make phone calls. due to conveniences in terms of portability, various smartphone functions may be utilized while walking or working. in particular, listening to music, sending messages, web surfing, and playing games are frequent activities performed while walking. performing two tasks at the same time is called dual - tasking, while performing more than two tasks simultaneously is referred to as multitasking1. walking or working while using however, such dual - tasking may lead to a fall or injury resulting from decreased cognitive ability in an accidental, unexpected situation. the ability to maintain balance in a static or dynamic situation is the basis for functional activities while performing various ordinary activities2. the dynamic balance necessary for functional activities is the result of interaction among the ankle joints, knee joints, hip joints and their surrounding muscles, and shoulder joints and their surrounding muscles. dual- tasking using a smartphone while walking, such as listening to music, sending a message, web surfing, or playing a game, is considered to affect the dynamic balance necessary for functional activities by reducing cognitive ability. most previous studies concerned electromyography3, 4 on muscles around the neck according to the forward movement of the head bone from the perspective of musculoskeletal system postural misalignment or dispersion of cognitive ability5 according to the performance of dual task. therefore, the aim of the this study was examine the effects of dual tasks while different functions of a smartphone while walking or working on dynamic balance, based on prior studies of cognitive ability dispersion while dual - tasking. the subjects of this study were 36 healthy college students (18 male, 18 female). their average age, weight, and height were 20.4 years, 63.4 kg, and 168.8 cm. the subjects had no musculoskeletal or neurological problems, listened to the overall procedure and purpose of this study, and voluntarily consented to participate in the study. their informed consent and approval from korea nazarene university s life ethics review committee (korea nazarene university irb 14 - 0417 - 02) were obtained. the samsung galaxy noteii (samsung, seoul, south korea) was used for the experiment. the star excursion balance test (sebt) was performed during single - tasking without a smartphone and during dual - tasking with a smartphone, that is, when listening to music using a smartphone, when sending a message using a smartphone, when web surfing using a smartphone, and when playing games using a smartphone. in the experiment conducted while performing a dual task using smartphone functions, subjects were assigned experiments via a casting of lots, to prevent them from learning about experimental tasks. after each experiment, the subjects rested for five minutes before going on to the next experiment. it was also used to measure the distances a leg could reach when the subjects stretched his / her nondominant leg to maximum extension in eight directions (anterior, anterior lateral, lateral, posterolateral, lateral, posteromedial, medial, anter medial) with a 45-degree interval while maintain his / her balance with the dominant leg. the sebt is a method used to measure dynamic balance, with a level of reliability (icc 0.880.96)6. hyong and kim6 presented three directions anterior, posterolateral, and posteromedial as the base directions for a simple sebt ; this study conducted the experiment based on these directions. measurements were taken for each direction and averaged values were used for analysis. due to differences in each subject s leg length, a each subject s actual leg length was measured ; the percentages of their leg length were used as the measured values7. the actual leg length were measured from the anterior superior iliac spine of the femur to the medial malleolus8. the measured values were analyzed with repeated measures analysis of variance using spss version 17.0. according to the sebt, the subjects who performed dual tasks using a smartphone saw significant changes in their dynamic balance in the three tested directions relative to those who carried out single tasks without a smartphone (p<0.05) (table 1table 1. sebt results according to the type of double task (n=36)nusmusicmessageweb surfinggameanterior (%) 99.96.796.37.2 91.77.7 927.3 89.97.2posterolateral (%) 82.410.775.610.3 69.110.2 709.8 66.710.2posteromedial (%) 73.8411.0365.111.2 57.611.6 6012.1 53.89.8nus : did not use a smartphone. a : nus, music, b : nus, message, c : nus, web surfing, d : nus, game. : p<0.05). dynamic balance decreased in all three for playing games, sending messages, web surfing, and listening to music (table 1). nus : did not use a smartphone. a : nus, music, b : nus, message, c : nus, web surfing, d : nus, game. : p<0.05 such dual - tasking reduces cognitive ability, affecting postural control. for postural control, sensation, cognition, and this study aimed to look at the effects of dual - tasking using a smart phone on dynamic balance. according to the results of measuring dynamic balance using the sebt, dynamic balance decreased in all three directions during dual - tasking using smartphone functions relative to single - tasking without using a smartphone. in addition, dynamic balance decreased in all three directions for playing games, sending messages, web surfing, and listening to music using a smartphone. playing games most significantly decreased cognitive ability, resulting in the greatest decrease in dynamic balance. this was followed by sending a message, web surfing, and listening to music in their effect on decrease in dynamic balance. in this experiment, double tasking while listening to music. in this experiment, dual - tasking was significantly significant relative to single - tasking, and caution is needed even when listening to music with a smartphone while performing other work (p<0.05). using the sebt, won1 also measured, in eight directions, dynamic balance during single - tasking without using a smartphone and during dual - tasking when listening to music, making a phone call, and sending a message. according to the dynamic balance results, sending messages most greatly decreased dynamic balance and making a phone call also led to reduced dynamic balance in the lateral direction. in the present study, dynamic balance decreased in all three directions while sending a message, with a greater decrease in dynamic balance in the posteroateral and posteromedial directions than in the anterior direction. won1 asserted that dynamic balance decreased while sending a message, and that caution was needed while performing the task. on the other hand, the present study showed that playing games reduced dynamic balance more than sending messages. in wons1 study, the dual task of listening to music did not influence dynamic balance, but it did in the present study. this differences is attributed to difference in the kind of and speed of music ; in the present study, the subjects listened to the fast - beat k - pop (korean pop) enjoyed by young people. nonetheless, in the present study the dual task of making a phone call, which had been included in the experiment by won1, was excluded due to the characteristics of the smart phone used. lacour.10 noted that, although there was no problem with postural control while performing a single task, during a dual task, postural control ability decreased ; the more difficult a cognitive task, the more reduced the postural control ability became. such an assertion is a consistent with the results of the present study. in particular, although playing game is an ordinary adolescent hobby, playing games while walking reduces cognitive ability, which decreases dynamic balance and may lead to injury. dual - tasking using a smartphone, while walking or working, which may look trivial, can be a cause of fall or injury. accordingly, performing a single task rather than employing the diverse functions of a smart phone while walking or working is considered to be a good way to present falls or injuries. a limitation of this study was that it did not take into account balance when just holding a smartphone. | [purpose ] this study aimed to compare dynamic balance with respect to completing a single task while not using smartrphone function and completing two task while using different smartphone functions, therby preventing falls or injuries resulting from completion of dual tasks. [subjects and methods ] the subjects of this study were 36 healthy males and females. the experiment was conducted for five situations : a star excursion balance test (sebt) was performed (1) during single - tasking without a smartphone and during dual - tasking with a smartphone, (2) when listening to music using a smartphone, (3) when sending message using a smartphone, (4) when surfing the web using a smartphone, and (5) when playing a game using a smartphone. the condition were the same for all five experimentes. random selection was done to prevent learing. all experiments were conducted three times, and the averaged values were used for analysis. the sebt was performed in three directions : anterior, posterolateral, and posterormedial. in consideration the differences in leg length of the subjects, their actual leg length were measured to be used as percentages. their leg length was measured from the anterior superior iliac spine of the femur to the medial malleolus. [results ] compared with single task not done using a smartphone, dynamic balance statistically significantly changed for dual tasks done using a smartphone in all three directions. dynamic balance decreased in all three directions when playing games, sending messages, web surfing, and listening to music. [conclusion ] completing two tasks using a smartphone reduced cognitive ability, decreasing dynamic balance. therefore, performing a single task rather than using the diverse functions of a smartphone while walking or working is considered a factor that can prevent falls and injuries. |
gaucher disease (gd) is an autosomal recessive lysosomal storage disorder caused by a profound deficiency in the enzyme glucocerebrosidase [gba (glucosylceramidase, acid beta - glucosidase) ec.3.2.1.45 ] (brady., 1965). the deficiency in gba results in the accumulation of its lipid substrate glucocerebroside in reticuloendothelial cells with cardinal clinical findings of hepatosplenomegaly, pancytopenia from bone marrow infiltration and osteonecrosis. three clinical forms or subtypes of gd have been reported : type i (non - neuronopathic, omim 230800), type ii (acute neuronopathic, omim 230900), and type iii (sub - acute neuronopathic, omim 231000) (beutler, e and grabowski, ga, 1995, mikosch, p, 2011). gaucher disease is a panethnic disease with an overall prevalence of 1/100,000, but higher prevalence in the ashkenazi jewish population of 1/855 with predominantly the n370s allele (guggenbuhl., 2008). mutations in the gba gene of patients with gd can result in deficiency or absence of gba enzyme activity. over 350 mutations causal to gd have been reported, including missense and nonsense mutations, insertions, deletions, complex recombinant alleles, and splice site mutations (hruska., 2008). the four most common mutations found in the gba gene are c.1226 g > a (n370s), c.1448 t > a (l444p), c.84dupg (84gg) and ivs2 + 1 g > a (ivs2 + 1), and account for > 90% of ashkenazi jewish population gd alleles, and 70% of general population gd alleles (mao., 2001). although studies of genotype phenotype correlations have revealed significant heterogeneity, some consistent patterns have emerged for prognostic and therapeutic decisions. for example, a milder phenotype is associated with the n370s allele (beutler and gelbart, 1996). alternatively, null (i.e., completely non - functional) alleles such as 84gg in combination with a severe mutation such as l444p in the second gba allele, are commonly associated with severe clinical manifestations and symptoms of the central nervous system. to date, there has been no reported case of a gaucher patient homozygous for two null alleles, e.g. 84gg/84gg, suggesting that this genotype is presumably lethal prenatally (beutler and grabowski, 1995). this report describes the identification of a novel splice site mutation ivs9 + 1 g > a, and a novel complex allele g355r / r359x, in two unrelated patients with type i gd, who are both heterozygous for the common missense mutation, n370s. the entire gba coding sequence of both patients was sequenced and the results were analyzed. we have also established a restriction fragment length polymorphism (rflp) analysis using hph1 restriction endonuclease digest to confirm the presence of the ivs9 + 1 mutation and to screen for its presence in other patients. to demonstrate that mutations g355r and r359x are in cis arrangement, i.e. within the same allele on the same chromosome, gba exon 8 in which the mutations are located was cloned and sequence analyzed. patient 1 is of english ancestry and was diagnosed at 3 years of age with gd from a bone biopsy showing gaucher cells but treatment was never sought. at 70 years of age, he pursued medical treatment of his gd. he had severe hepatosplenomegaly, thrombocytopenia (platelets 15 10/l) with a history of easy bleeding and easy bruising from minor injuries, leukopenia (leukocytes 2 10/l) and anemia [hemoglobin (hb)128 g / l ], marrow replacement on spinal mri (magnetic resonance imaging) and an elevated chitotriosidase [19,322 nmol / h / ml (normal 4120, integrated genetics, labcorp specialty testing group, santa fe, nm, u.s.a.) ]. his peripheral t - lymphocyte beta - glucosidase activity was 0.3 (reference 8.921.5 nmol / h / mg protein, floyd snyder, alberta children 's hospital, calgary, ab, canada). he also had a monoclonal gammopathy of uncertain significance (mgus) with only a mild elevation of immunoglobulin g kappa and free light chains. patient 2 was diagnosed in 1983 at age 20, when hepatosplenomegaly and mild thrombocytopenia led to a bone marrow biopsy that showed gaucher cells. acid beta - glucosidase level and mutation analysis were not done at that time. over the next 30 years, her hb and platelet count gradually decreased, the former from 125 g / l to 91 g / l by 2013, and the latter from 84 10/l to 34 10/l. past history also included easy bruising, frequent nosebleeds, menorrhagia, and mild hypertension. her spleen and liver were palpated 11 and 7 cm below the respective costal margins. beta - glucosidase level was 1 nmol / mg protein (normal 816). mri of the abdomen showed liver and spleen volumes of 1802 and 1141 cm, respectively, as well as the presence of cholelithiasis. mri of the femurs showed the classic erlenmeyer flask abnormality and evidence of marrow packing, but no necrosis or infarcts. the patient was begun on imiglucerase 30 mg / kg every 2 weeks ; as of may 2015 her hb was 129 g / l, platelets 90 10/l, and chitotriosidase 1125 nmol / h / ml. the methods for collecting dot blood samples on filter paper cards, (devost and choy, 2000) pcr amplification of gba genomic dna for sequence analysis using gba specific primers, and rflp analysis of gba mutations are described in supplementary information. in order to confirm that mutations g355r / r359x were in cis arrangement i.e. present in the same allele, exon 8 was cloned into the sequencing vector pjet1.2. one shot top10 chemically competent e. coli (life technologies, carlsbad, ca) was transformed with pjet1.2/exon 8 and transformants were selected for on low sodium lb agar containing 100 g / ml ampicillin. colony pcr was performed on 24 clones, 15 of which contained the exon 8 insert and were sequenced analyzed by europhins mwg operon. sequencing results were compared to functional gba genomic sequence from genbank (gi183011).the results revealed that in patient 1 at nucleotide position c.1226 (g.4824), there was a heterozygous a to g transition that resulted in asparagine codon (aac) being substituted by that for serine (agc) in gba amino acid residue position 370 (n370s) (fig. 1, left column and fig. c.1328 + 1, the sequence shows a heterozygous g to a transition (fig 1, right column and fig. although this substitution is intronic, it is located at the intron - exon boundary and within the spliceosome recognition sequence (mount, 1982), specifically the donor sequence. the chromatogram of both regions revealed a double peak depicting the normal and mutant sequence at the respective locations at c.1226 and c.1328 + 1, which is consistent with a heterozygous mutation (fig. these findings were confirmed by performing sequence analysis in both the forward and reverse directions (data not shown). sequence analysis of the rest of the gba coding region and intron - exon boundaries showed identity with the genbank wild type sequence. mismatch pcr using primer set m370/pbii was performed, resulting in an amplified fragment of 105 bp. as first described by beutler. (1990), the mutation n370s creates a cleavage site in this fragment and upon digestion by xhoi restriction endonuclease and electrophoresis in 6% polyacrylamide, dna fragment lengths from patient 1 at 105, 86 and 19 bp were noted, while the normal control showed only a single band at 105 bp (data not shown). nebcutter software (new england biolabs) was used to determine various restriction sites in normal and ivs9 + 1 g > a mutant alleles. the enzyme hphi was determined to cleave in 2 positions on the normal allele, but 3 on the mutant allele as mutation ivs9 after digestion with hphi, samples were run in an 8% acrylamide gel and visualized with ethidium bromide. the normal control has fragment lengths of only 145, 74 and 33 bp (fig 3, lane 4). the fragment lengths for patient 1 were revealed to be 145, 107, 74, 38 and 33 bp, which is consistent with ivs9 + 1 g > a in the heterozygous form (fig 3, lane 3). sequence analysis of patient 2 showed that mutation n370s is present in the heterozygous form with two other heterozygous point mutations : g to c at c.1180, g.4396, and t to c at c. 1192, g.4408) substituting glycine by arginine (g355r) and arginine by a premature termination (r359x), respectively. to find out whether mutations r355r and r359x are present in cis- or trans - arrangement (i.e. within the same gba allele or in different gba alleles), pcr - amplified gba exon 8 genomic dna of patient 2 was cloned into the pjet1.2 vector in e. coli top10 strain and subjected to sequence analysis. of the 15 clones sequenced, 5 contained the exon 8 mutations g355r and r359x showing both mutations in cis arrangement (i.e. on the same chromosome) as a g355r / r359x complex allele, while 10 contained the wild type exon 8 sequence indicating that the cloned fragments were from the other (exon 9 mutation n370s) gaucher allele (fig. genotyping of the gaucher mutations n370s and g353r / r359x was also performed from dot blood genomic dna of the asymptomatic mother and sister of patient 2. rflp and dna sequence analysis showed that the mother is heterozygous for mutation n370s and negative for g353r / r359x, while the sister was negative for both n370s and g353s / r359x, i.e. normal homozygous. these findings indicated that the parents of patient 2 had transmitted mutation n370s and the complex g353s / r359x allele to her, and the normal gba allele to her unaffected sister. there have been more than 350 mutations recorded to date, including 16 splice site mutations that cause gaucher disease (http://www.hgmd.org). many of these mutations, including ivs9 + 1(g > a) and g355r / r359x, are present in only one or a small number of individuals. a splice site mutation can have a range of consequences including exon skipping, activation of cryptic splice sites, creation of a pseudo - exon within a gene or intron retention (nakai and sakamoto, 1994). in the case of the highly prevalent splice site mutation ivs2 + 1 (g > a), exon 2 is entirely removed from the spliced mrna (he and grabowski, 1992). in order to assess the possible impact of the ivs9 + 1 (g > a) mutation found in patient 1 on gba mrna splicing, we used the regrna 2.0 program (http://regrna2.mbc.nctu.edu.tw/), the neural network program (http://www.fruitfly.org/seq_tools/splice.html), and the maximum entropy program (http://genes.mit.edu/burgelab/maxent/xmaxentscan_scoreseq.html) to predict how this mutation would affect rna processing. all three programs indicate that the ivs9 + 1 mutated sequence would no longer be recognized as donor splice site (please refer to supplementary information for details of the in silico analyses). additionally, the neural network and maximum entropy programs predicted that the mutation would result in a much lower splice site signal below recognition threshold. thus, the ivs9 + 1 mutation will be very disruptive for gba mrna processing and enzyme function. an alternative possibility is the activation of cryptic donor splice sites. in a study describing another exon 9 splice site mutation (c.1389 - 1 g > a), the neural network and maximum entropy programs predicted the mutated sequence would no longer be recognized as an acceptor splice site. however, when rt - pcr analysis was performed on mrnas from cultured fibroblasts, it was found that the mutation led to exon slippage of 4 nucleotides and activation of a cryptic acceptor splice site (malini., 2014). we are unable to perform similar rt - pcr analysis of fibroblast gba mrnas from patient 1 because dried dot blood on filter paper cards is the only available cell source for our study. the structure of gba has been elucidated by x - ray crystallography and provides some insight to the role of the 497 residues making up the three domains of gba polypeptide. domain i (gba amino acid residues 127 and 383414) is a -sheet containing two disulfide bridges and a glycosylation at n19, which is required for activity in vivo. domain ii (gba amino acid residues 3075 and 431497) consists of two -sheets resembling an immunoglobulin fold that may interact with saposin c, an essential activator of gba (aerts, jmfg,., 1990, dvir, h,., 2003, tamargo, rj,., domain iii (gba amino acid residues 76381 and 416430) consists of a (/a)8 tim barrel containing the catalytic site : e340, the nucleophile, and e235, the acid / base catalyst (dvir., 2003). exon 9 codes for gba amino acid residues 370424, and therefore plays a major role in the formation of the both domain i and the catalytic domain. an absence of exon 9 because of aberrant splicing would be detrimental to gba function by abolishing its activity completely. in this case, however, the second gaucher allele is the relatively mild mutation n370s (beutler, e and grabowski, ga, 1995, grace, me,., 1990) which modulates the clinical expression to a mild to moderate type 1 form. other splicing mutations have been reported in compound heterozygosity with n370s in patients with type 1 gd (dominissini, s,., 2006, the novel complex allele g355r / r359x in patient 2 will result first in a substitution of glycine by arginine, followed by a protein truncation at gba amino acid residue 359. complex alleles are often the result of reciprocal or non - reciprocal recombination events with the pseudogene (hruska., 2008). the human gba pseudogene is 96% homologous to the gba functional gene but contains a 55 bp deletion in exon 9 and a number of exonic point mutations as well as large deletions in several introns (horowitz., g355r / r359x, however, neither mutation is pseudogene - derived, and therefore, there is no evidence to suggest this is the result of a recombination event. the missense mutation g355r has not previously been reported ; however, two studies have characterized another mutation, g355d, in which glycine at gba amino acid residue 355 is substituted by aspartic acid instead of arginine. in one study, g355d in combination with l444p resulted in the neuronopathic type ii gd (tsai., these findings suggest that g355r may also have varying consequences, depending on the identity of the mutation in the second allele. in silico analysis of this mutation on the stability and function of gba using the foldx program (http://foldxsuite.crg.eu) and polyphen 2 program (http://genetics.bwh.harvard.edu/pph2/) predict that g355r would severely destabilize and damage the structure of gba (please refer to supplementary information for details of the analysis). the nonsense mutation r359x has been described as a perinatal lethal mutation when in combination with other lethal mutations such as v398f (stone., 1999), and as a parkinsonism - associated mutation (sunwoo., 2011). because r359x results in premature termination of gba translation, amino acid residues 359497 that constitute gba domain i (residue 383414), domain ii (residue 431497), and domain iii (residue 359381) that constitute the catalytic and saposin activator binding domains (dvir, h,. in addition, the transcript resulting from nonsense mutation may also be prematurely degraded via nonsense - mediated mrna decay, a post - transcriptional quality control process in eukaryotes that degrades transcripts carrying disease - causing premature termination codons (turner, ka and choy, fym, 2015, popp, mw and maquat, le, 2013). these will be detrimental to gba function and it is reasonable to postulate that the complex allele g355r / r359x might also be lethal when in combination with another severe or lethal gaucher allele. however, the second gaucher allele is the relatively mild mutation n370s which ameliorates the clinical severity and as such (as in the case of patient 1), patient 2 presents with type 1 gd, which again demonstrates the rescuing properties of n370s as we previously reported (jack., 2014). the nonsense mutation r359x has been reported in patients heterozygous for n370s, who also presented with type 1 gd (alfonso., 2007). we have identified a novel splice site mutation (ivs9 + 1 g > a) and a novel complex allele g355r / r359x in two unrelated patients with type we have also developed a rflp procedure that utilizes hph1 restriction endonuclease digest for confirmation and efficient identification of the ivs9 + 1 mutation in future patients. in silico analysis of these novel gaucher alleles showed that they are detrimental to either gba splicing and/or structure and function. however, compound heterozygosity with mutation n370s in both patients has modulated the clinical expression to a mild to moderate type 1 gaucher phenotype. | gaucher disease is an autosomal recessive lysosomal storage disorder resulting from deficient glucocerebrosidase activity. more than 350 mutations that cause gaucher disease have been described to date. novel mutations can potentially provide insight into the glucocerebrosidase structure function relationship and biochemical basis of the disease. here, we report the identification of two novel mutations in two unrelated patients with type i (non - neuronopathic) gaucher disease : 1) a splice site mutation ivs9 + 1 g > a ; and (2) a complex allele (cis) g355r / r359x. both patients have a common n370s mutation in the other allele. the splice site mutation results from an intronic base substitution (g to a, c.1328 + 1, g.5005) at the donor splice site of exon and intron 9. the complex allele results from two point mutations in exon 8 of glucocerebrosidase (g to c at c.1180, g.4396, and t to c at c. 1192, g.4408) substituting glycine by arginine (g355r) and arginine by a premature termination (r359x), respectively. in order to demonstrate that g355r / r359x are in cis arrangement, pcr - amplified glucocerebrosidase exon 8 genomic dna from the patient was cloned into the vector pjet1.2 in escherichia coli top10 strain. out of the 15 clones that were sequence analyzed, 10 contained the normal allele sequence and 5 contained the complex allele g355r / r359x sequence showing both mutations in cis arrangement. restriction fragment length polymorphism analysis using hph1 restriction endonuclease digest was established for the ivs9 + 1 g > a mutation for confirmation and efficient identification of this mutation in future patients. past literature suggests that mutations affecting splicing patterns of the glucocerebrosidase transcript as well as mutations in gaucher complex alleles are detrimental to enzyme activity. however, compound heterozygosity with n370s, a mild mutation, will lead to a mild phenotype. the cases reported here support these past findings. |
vertebral artery dissecting aneurysms (vadas) are diagnosed as a reason for subarachnoid hemorrhage (sah).14) once ruptured and causing sah, the percentage of re - bleeding of these lesions is up to 30% and is associated with a high rate of mortality.1)18) thus, early treatment is strongly recommended. the most generally recognized treatment tool is complete occlusion of the dissected lesion by open surgery or endovascular procedures. because the surgical approach is associated with high incidence of treatment - associated mortality and morbidity, endovascular procedures are favored in treatment of dissecting aneurysms of the vertebral artery (va).8)15)16) in endovascular procedures, proximal occlusion of the parent artery and embolization of the dissected segment using guglielmi detachable coils (gdcs) has proven to be an optimal method for treatment of dissecting aneurysms.5) using flow diverter devices, such as the pipeline embolization device and silk stents is a new concept for endovascular treatment of intracranial aneurysms.11) various forms of coils have been approved for use in endovascular procedures. of the available embolization coils, however, in order to achieve the trapping of lesions, fiber - coated platinum coils are generally preferred over dcs because of their convenience of use and thrombogenic characteristics.7)17) in this report, we describe the treatment of a patient using a combination of gdc and micro - tornado coil (mtc) embolization in trapping of the vada. an 80-year - old male was transferred to our emergency room, with mental deterioration after posterior neck pain and sudden severe headache (hunt and hess grade iv). computed tomography (ct) of the brain showed sah and intraventricular hemorrhages that were more predominant in cisterns around the medulla and pons than in the basal cistern (fisher grade iv) (fig. a ct source image also showed a pseudoaneurysm and intimal flap, diagnosed with a vada (fig. 2). a vertebral angiogram showed a left vada measuring 5 8 mm in size, which showed irregular narrowing and a dilated portion. the left posterior inferior cerebellar artery (pica) was visualized at the distal portion of the dissected segment of the left va (fig. endovascular coil trapping of the dissected segment was performed just after diagnostic angiography using six gdcs and two mtcs (fig. a 6 fr envoy catheter (cordis endovascular systems, bridgewater, nj) was placed in the left subclavian artery near the origin portion of the va. after placement of the guiding catheter, the patient received a bolus injection of heparin (2000 u) and control - activated clotting times were determined hourly. we planned va occlusion by trapping on both sides of the lesion, using the double microcatheter technique.9) first, an excelsior sl-10 microcatheter (boston scientific corp, natick, ma) was manipulated with the tip curved 45 and advanced into the distal left va using a synchro-14 neuro guidewire (stryker neurovascular, kalamazoo, mi). the microcatheter was advanced slowly into the lesion up to the distal end of the dissected segment of the aneurysm. the attempt to advance the other microcatheter into the proximal end of the da failed because the stenotic lesion of the proximal portion of the da was too small to pass to the other microcatheter. the right va origin portion was severely tortuous ; thus, we failed to apply the double microcatheter technique. instead, a rebar-18 microcatheter (ev3 endovascular, plymouth, mn) was advanced into the proximal portion of the stenotic lesion using a microguidewire. multiple gdcs, totaling 42 cm in length, were placed at the dilated segment and two mtcs (tornado embolization microcoil, cook incorporated, bloomington, in, proximal end diameter 3 mm distal end diameter 2 mm) were then deployed (fig. the size of mtcs was selected to match the diameter of the trapped segment. before detachment of the gdcs, after deployment of the mtcs, postoperative angiography showed complete occlusion of the dissecting aneurysm, while the left pica was sacrificed. the patient was transported to the neurological intensive care unit with no occurrence of remarkable events. an magnetic resonance (mr) angiography performed one day after the procedure showed complete occlusion of the left vada with appropriate flow to the basilar artery via the right va and no regrowth or residual portion of the aneurysm (fig. a follow - up mr image showed embolic ischemic lesions in the left cerebellum (fig. 5c), however, no neurological deficit was detected and no re - bleeding from the aneurysm was observed. vadas have a very high incidence of early re - bleeding and re - bleeding is associated with a poor prognosis and negative clinical outcome.14) considering the features of vadas and high risk, the most effective treatment is parent vessel occlusion. either surgical clipping or endovascular balloon or coil occlusion can be used.6) treatment of vadas with proximal occlusion of the parent artery by means of endovascular procedures or surgical clipping is currently widely used. however, these procedures are not always very effective, yet they have been shown to prevent re - rupture.10) open surgical procedures include clipping, wrapping, or trapping of the segment of dissecting aneurysm. however, surgical approaches generally pose a serious risk of morbidity in order to achieve their purpose. while endovascular treatments consist of deconstructive procedures and reconstructive procedures, deconstructive procedures typically include a proximal obliteration performed using gdcs, or obliteration at the dissecting segment performed using coils. on the other hand, reconstructive procedures include an aneurysm endovascular coil embolization or the combined procedure in which a stent and coil are used.12) several researchers have recently shown that even a deconstructive approach performed by endovascular treatments does not perfectly eliminate the risk of re - bleeding from vada.10) however, endovascular treatment for obliteration of the dissected segment, including both the dissecting aneurysm and parent artery, should be considered as the optimal treatment option in patients who are willing to sacrifice the parent artery and trap the dissected segment.13) improvements have been made in various forms of coils for use in endovascular procedures.3) embolization materials are being rapidly developed ; indications for endovascular treatments are more varied and widely extended. of the embolization coils, dcs are applied to specific cerebral lesions, namely intracranial aneurysms.3) the convenience of the dcs is that they can be re - captured if they are not suitable for the location of the lesion. however, dcs are expensive and endovascular treatment using dcs has low cost efficacy. for achievement of the trapping of arteries or veins, fiber - coated platinum coils are generally preferred over dcs because of the convenience of using thrombogenic characteristics.7)17) in addition, the cost of fiber - coated coils is less than 10% of that of gdcs.4) the mtc is a platinum coil with synthetic fibers (fig. 6a) used for embolization of selective vessel supply to vascular lesions ; a longer - length coil with a tornado - like cone shape maximizes coil exposure to the cross - section of the lumen for interruption of blood flow and is available for delivery with 0.018, 0.035 and 0.038 inch end - hole catheters. compared to un - coated coils, the synthetic fiber - coated coils can rise to activate thrombogenesis. advancements in microcatheters have contributed significantly to improvement of endovascular procedures and have led to a need for fiber - coated coils of 0.018 inch in diameter. mtcs are a 0.018 inch fiber - coated platinum microcoil with a proximal end diameter ranging from 3 to 10 mm and distal end diameter ranging from 2 to 4 mm. mtcs were deployed to the vascular lesion for obliteration, allowing for smooth passage of microcatheters with a 0.018 inch inner diameter. complete occlusion of the diseased portion was performed and no remarkable negative effect appeared in relation to mtc embolization. hayashi.4) have reported several cases of parent artery occlusion of intracerebral aneurysms using micro - nester coils (similar to mtcs) (fig. however, for complete obliteration, tight packing must be attained because recanalization may occur. some authors have reported that the measured rate of recanalization is up to 10%,4) and the high flow or high pressure potential of a major artery is considered a cause of recanalization.4) as we experienced minimal neurologic deficits after trapping of the va, occlusion of the pica does not always lead to neurologic complications because of the presence of rich pial anastomoses.2) although our experience is limited to a few cases, the goal of our research was to understand our experience with mtcs in treatment of vada and to assess the usefulness of mtc embolization. we report positive results using a combination of gdcs and mtcs for treatment of vada. platinum coils with synthetic fibers can be effective materials in treatment of vada in patients who require absolute occlusion or an unusual shape. | we experienced a patient with a ruptured dissecting aneurysm of the vertebral artery who was treated by trapping of the lesion using guglielmi detachable coils (gdcs) with micro - tornado coils (mtcs). an 80-year - old male was transferred with a ruptured left vertebral artery dissecting aneurysm (vada). the dissected portion of the vertebral artery was effectively trapped using gdcs and mtcs. the mtcs used for neurointervention were comprised of various types of coils and we successfully placed them into the parent artery of the dissected segment. the author suggests that this case demonstrates the usefulness of endovascular coil trapping of vadas using mtcs in achievement of embolization. |
primary spinal sarcomas arise from the spine itself, usually from a structural component such as bone or cartilage18)., they account for less than 5% of all osseous neoplasms, and less than 0.2% of all cancers24,25). dorfman and czerniak9) analyzed data on 2627 primary malignant tumors of bone including spine collected in the surveillance, epidemiology, and end results (seer) program. their tumors were osteosarcoma (35.1%), followed by chondrosarcoma (25.8%), ewing 's sarcoma (16.0%), chondroma (8.4%), and malignant fibrous histiocytoma (mfh) (5.6%). these tumors can cause significant morbidity and mortality secondary to local invasion and destruction of adjacent structures including bone, nerves, and vascular structures, and they can metastasize to distant organs19,24). tremendous advancement has been made in the surgical and medical therapy of malignant primary bone tumors19,27,34), but their spinal involvement is still associated with poor prognosis17,22). the understanding of the epidemiology of primary spinal sarcomas has been limited to small case series and controlled trials in the treatment were impossible because of their rarity23). these facts resulted in non - uniform approach in the treatment of the spinal sarcomas16,27). and, a general understanding of the presentation and survival of primary spinal sarcomas is also lacking39). for this reason the establishment of a bone tumor registry provides a valuable source of information and facilitates reasonable treatment of these tumors16,28). it was known that primary sarcomas of the spine had low survival and high recurrence rate compared to sarcoma occurring in extremity2,8,22,24,31,37,41). the radical or wide excision is required in sarcoma treatment, but it is difficult to perform the radical excision due to the risk of neural or vascular injuries7,19). in addition, high dose radiation can not be delivered to residual mass, because it may produce radiation - induced spinal cord injury3,5,16). the purpose of this study is to investigate the survival and recurrence rate of primary spinal sarcoma patients who underwent non - radical surgery plus adjuvant therapy or nonoperative treatments. study cohort was the patients who were treated in our hospital due to primary spinal sarcomas from january 2000 to december 2010. the total number of patients was 29, and their medical records and radiologic images were analyzed retrospectively. the average age of patients was 42.9 years old (range, 11 to 76 years). with regard to tumor histology, malignant peripheral nerve sheath tumor (mpnst, 8 patients) was the most prevalent, and other tumors included chondrosarcoma (6 patients), osteosarcoma (5 patients), mfh (4 patients), ewing sarcoma and synovial sarcoma (each 3 patients). regarding lesion location, 21 patients had a tumor on mobile spine (8 lesion in cervical, 10 in thoracic and, 3 in lumbar spine), while 8 patients had a tumor on rigid spine (sacrum). with regard to the lesion multiplicity, 17 patients had a single lesion where the tumor was confined to one segment at diagnosis, and 12 patients had multiple level involvement. ten patients showed distant metastasis during follow - up, and 3 patients had metastasis at diagnosis. the time for the development of distant metastasis was, on the average, 24 months. the site of distant metastasis was lung in 9 patients and brain in one patient. twenty - seven patients complained of pain and 14 patients had motor weakness at the time of diagnosis. twenty - six patients could walk at diagnosis, and 15 patients could walk also at the last follow - up. among 14 patients who could not ambulate, 10 patients could not walk due to neurologic deficit and remaining 4 patients could not walk due to intractable pain. the period for which ambulatory function was maintained was average 46 months, 13 patients could walk longer than 46 months, whereas 16 patients shorter than 46 months. in initial treatment, surgery was chosen in 17 patients, irradiation in 6 patients, and chemotherapy in 6 patients. operations were performed 44 times in a total of 23 patients and 12 patients received the surgery two or more times. as for surgical procedure, all the operations were subtotal or partial removal of tumors, not radical excision. there were 4 cases of wound infection, one case of screw malposition, one case of hypoglossal nerve palsy, and one case of pulmonary complication. as for radiation therapy, 27 patients received radiation therapy (rt) during the treatment period. conventional rt was given to 10 patients, 8 patients received stereotactic radiosurgery, and 9 patients received both of them. tumor was classified into 3 groups based on the histologic types (table 2). osteosarcoma and mfh, being known to have similar clinical behavior, belonged to first group (group i). ewing ' sarcoma and chondrosarcoma which were reported to have long survival belonged to the second group (group ii). the remaining mpnst and synovial sarcoma were included into the third group (group iii). in this study, we sought to determine overall survival (os) and progression free survival (pfs) in primary sarcoma of spine, and to document pain level changes and ambulatory status during follow - up. thirteen prognostic factors affecting survival, systemic recurrence and ambulatory function were analyzed : age (42 or 43), gender, tumor histologic type (osteosarcoma and mfh, or chondrosarcoma and ewing sarcoma, or mpnst and synovial sarcoma), lesion location (mobile spine or rigid spine), weakness at diagnosis, pain at diagnosis, ambulation at diagnosis, initial treatment method, radiation therapy, kind of irradiation, surgery, chemotherapy and distant metastasis. chi - square and fisher exact tests were used for categorical variables and student 's t test were used for continuous and ordinal variables, as appropriate. a p value 0.05 (two - tailed) the data were compiled and analyzed with the software package spss, version 14.0 (spss inc., chicago, il, usa). median of os in the study cohort was 60 months [95% confidence interval (ci), 33.17 - 86.83 months ]. 1). osteocarcoma and mfh group showed the shortest survival of 30 months (95% ci, 5.59 - 54.40 months). in group ii (ewing sarcoma and chondrosarcoma group, which was known to have the longest survival, showed median survival of 74 months (95% ci, 16.07 - 131.93 months). however, there was no statistical significance among three groups. among total 29 patients, fourteen patients died of the disease progression and two patients the medical condition unrelated to tumor progression such as sepsis or acute renal failure. statistically significant prognostic factors associated with survival were the presence of distant metastasis (table 3). the patients with distant metastasis, whose median survival was 30 months (95% ci, 7.23 - 52.77 months) showed significantly shorter survival than the cases without metastasis whose median survival was 85 months (95% ci, 57.29 - 112.71 months ; p=0.002) (fig. twenty - three out of 29 patients experienced the recurrence during the follow - up. the recurrence implies not only the local recurrence at the tumor site but also the systemic recurrence including the distant metastasis. pfs of patients was 26 months (95% ci, 14.09 - 37.91 months). there were no statistically significant prognostic factors associated with recurrence (table 4). among 27 patients who complained of pain at the time of diagnosis, pain was determined to be controlled when post - treatment vas decreased by more than two points or the amount of pain medication was reduced. mean vas fell to 4.562.10 points after the treatment with 3.892.08 point decrease (p=0.001). pain score of patients who underwent the surgical treatment was measured upon the first follow - up after the surgery. pain score of patients who received non - surgical treatments was measured within a month upon the completion of initial treatment. likewise, pain was reduced after the initial treatment, but the pain increased again with recurrence after 27 months. there were no statistically significant prognostic factors associated with the pain control. as a whole, median period during which ambulatory function was maintained was 54 months (95% ci, 43.33 - 104.67 months). statistically significant prognostic factor associated with post - treatment ambulatory function was the presence of weakness at initial diagnosis (table 5). among patients who did not show motor weakness at initial diagnosis, patients who maintained the walking ability at the last follow - up were 86.7%, which is twice as much as patients who had weakness at initial diagnosis (42.9%) (p=0.013) (fig. treatments for primary spinal sarcomas involve a multi - modality approach consisting of surgery, radiation therapy and chemotherapy12,30). the experience in the treatment of extremity sarcomas have been applied to cases of spinal sarcomas3). although great advances have been achieved in the treatment, oncological outcome in spinal sarcomas is worse than that of soft tissue sarcomas in extremities20,33,40). in extremity sarcomas, many reports on survival and recurrence vasileios.37) reported that 5-year survival rate of mfh patients was 66% and the recurrence and the metastasis rates were 31%. tural.36) reported that the recurrence rate was 23% and 5-year survival rate was 72% through retrospective study of adult ewing sarcoma patients. according to stanelle.'31)s paper, it was reported that 73% of 5-year survival rate, 65% of 10-year survival rate in synovial sarcoma and 41% of recurrence rate of this disease. arndt.2) reported 65% of 5-year survival rate in osteosarcoma. in our study, 5-year survival rate was 41%, 61% and 45% in osteosarcoma / mfh group, chondrosarcoma / ewing sarcoma group and mpnst / synovial sarcoma group, respectively. since primary spinal sarcomas are very rare diseases24,25), the standard treatment method has not been established28,34,38,39). however, treatment for osteosarcoma and chondrosarcoma is being conducted in uniform fashion. in cases of osteosarcoma postoperative adjuvant chemotherapy is sometimes done when indicated. in chondrosarcoma, chemotherapy or radiation therapy improvement in surgical approach to the entire vertebral column has made it technically feasible to resect tumors involving the spine at all levels, and the development of new instrumentation systems has enabled surgeons to reconstruct entire vertebral segments after resection27,34). but, the proximity of the dural sac, aorta, vena cava, and esophagus makes it difficult to achieve adequate negative surgical margins19). the en bloc resection of a spinal segment is a relatively recent concept, which is different from a complete piecemeal corpectomy7). it is recognized that, with rare exceptions, the rate of local recurrence depends on the adequacy of the resection, even when adjuvant therapy is used6,20,28,39). soft tissue sarcomas were further dichotomized as either high (g2) or low (g1) grade according to the classification of enneking.10) low - grade tumors are well differentiated, have few mitoses, and moderate cytologic atypia. high grade lesions are characterized by poor differentiation, a high cell / matrix ratio, and a high mitotic rate, necrosis, and microvascular invasion1,2,34,41). tumor growth and progression are variable depending on the differences in the grade of differentiation. in addition, these histological differences produce the differences in the susceptibility to radiation and the reactivity to chemotherapy, and affect the selection of adjuvant treatment. a number of studies have attempted to identify prognostic factors for survival in primary sarcomas of the spine8,22,23). damron.8) investigated the survival and epidemiologic data from the national cancer database of the american college of surgeons. they reported that 5-year survival rate was 53.9% for osteosarcoma, 75.2% for chondrosarcoma, and 50.6% for ewing 's sarcoma. mukherjee.24) analyzed overall survival and prognostic factors affecting survival time in malignant primary osseous spinal tumors. they searched the seer database to identify all registered cases of ewing sarcoma, osteosarcoma and chondrosarcoma to assess histology specific survival during the period from 1973 to 2003. total study patients were identified as 579 with chondrosarcomas, 430 with osteosarcoma, and 469 with ewing sarcomas. overall median survival was histology - specific (osteosarcoma, 11 months ; ewing sarcoma, 26 months ; chondrosarcoma, 37 months) and significantly worse in patients with distant metastasis at presentation for all tumor types. schoenfeld.29) performed a retrospective review of cases of osteosarcoma involving the spine treated. local recurrence developed in 27%, and metastasis occurred in 62%. in our study, overall survival was 30 months in the osteosarcoma and mfh group and 72 months in the ewing ' sarcoma and chondrosarcoma group, which were quite different from those from mukherjee. 's study. however, their study analyzed the data obtained from last 30 years, but our study analyzed the data from recent 10 years. two - fold increase in survival is observed between previous 30 years and recent 10 years. the reasons for the increase in survival can be summarized as follows6,11,13,19,27,33 - 35) ; 1) early detection, 2) close follow - up, and 3) development of advanced treatment modalities - en bloc resection technique, effective chemotherapeutic agents, and sophisticated radiation delivery technique. the development of advanced diagnostic techniques leads to early detection of the disease, which implies that most of patients are diagnosed without distant metastasis11,13,34). close follow - up results in early detection of recurrence, leading to survival prolongation. technical improvement in treatment modalities increased the survival. in surgical method, rao.27) compared survival rates in en - bloc spondylectomy and intralesional resection for patients with spinal sarcoma (including metastatic sarcoma). patients undergoing en - bloc resection had a median survival of 26.2 months, and those with intralesional resection had a median survival of 18.6 months. teng.35) conducted similar research targeting the patients with mfh of the spine. compared to the 14 months median survival in debulking surgery group, that of the en - bloc resection group was 25 months. both studies showed that en - bloc spondylectomy could improve tumor control and survival rate. in addition, the radiation therapy such as stereotactic radiosurgery and tomotherapy was developed and diversified, excellent local tumor control could be achieved without radiation injury to adjacent spinal cord6,19,33). it would be the best to compare the survival period based on each histologic type. however, it was impossible to compare individual histology, because the number of patients in each group was low. although mfh is different from osteosarcoma in pathological finding (no tumor bone production), it is considered to be similar in clinical course and response to chemotherapy26). even if no significant difference was found in three groups, we assume that if more cases could be collected enough to compare individual histologic type, meaningful difference might be produced. present analysis showed that overall survival was 60 months, which is varying depending on histology and recurrence rate is so high. close follow - up is required because recurrence could be within two or three years from initial diagnosis. | objectivewe have limited understanding on the presentation and survival of primary spinal sarcomas. the survival, recurrence rate, and related prognostic factors were investigated after treatment for primary sarcomas of the spine.methodsretrospective analysis of medical records and radiological data was done for 29 patients in whom treatment was performed due to primary sarcoma of the spine from 2000 to 2010. as for treatment method, non - radical operation, radiation therapy, and chemotherapy were simultaneously or sequentially combined. overall survival (os), progression free survival (pfs), ambulatory function, and pain status were analyzed. in addition, factors affecting survival and recurrence were analyzed : age (42 or 43), gender, tumor histologic type, lesion location (mobile spine or rigid spine), weakness at diagnosis, pain at diagnosis, ambulation at diagnosis, initial treatment, radiation therapy, kind of irradiation, surgery, chemotherapy and distant metastasis.resultsmedian os was 60 months, the recurrence rate was 79.3% and median pfs was 26 months. patients with distant metastasis showed significantly shorter survival than those without metastasis. no factors were found to be significant relating to recurrence. prognostic factor associated with walking ability was the presence of weakness at diagnosis.conclusionprimary spinal sarcomas are difficult to cure and show high recurrence rate. however, the development of new treatment methods is improving survival. |
tumor necrosis factor receptor - associated factors (trafs) act as adapter molecules controlling signaling pathways, such as nuclear factor kappa b (nf-b), interleukin-1 receptor (il-1r), toll - like receptor (tlr), and transforming growth factor- (tgf-) [1, 2 ]. for a long time it is important that traf6 contributes to the cd40-mediated activation of nf-b and c - jun kinase (jnk). association of traf6 with cd40 is essential for cd40-mediated il-6 expression, which could explain the requirement for membrane - bound cd40 ligand to induce il-6 production by immunocytes. the survival, regulation, and activation of immunocyte and epithelial cell, signaling through cell surface receptors to activate nf-b and mitogen - activated protein kinases (mapks) through traf6, are critical regulations of immune response. unlike traf6, the molecular mechanism of traf4 in multiple signaling pathways triggered by tnfr - related proteins remains enigmatic. it has been indicated that traf4 augments nf-b activation through glucocorticoid - induced tnfr (gitr) expression on t cells, b cells, and macrophages. as a unique traf family member mediating signal transduction by tnf, il-1r, or tlr, it is found that traf4 acts as a positive effector of bone morphogenetic protein (bmp) and the tgf- signaling pathway. the intestinal epithelium and immune cells in the gut establish active sites of immune reactivity. breakdown of homeostasis between intestinal microbiota and the mucosal immune system, together with both environmental and genetic factors, leads to inflammatory bowel disease (ibd). nf-b and tlr are considered as nodal points in the suppression and/or recruitment of immune responses in ibd. interestingly, although mechanisms of trafs in ibd are not yet fully studied, traf - related inflammatory mediators as tgf- or cd40 play critical roles in a wide array of cellular functions in ibd [9, 10 ]. recent studies in immune cells and transgenic mice regarding the role of traf4 and traf6 have revealed that they share the same binding sites, yet comprehensive study of traf4 and traf6 in ibd is still lacking. based on the hypothesis that traf4 and traf6 may be activated prior to the clinical or endoscopic activation in patients with ibd, we sought to measure traf4 and traf6 expressions to explore their potential roles in ibd patients. patients with pregnancy, colorectal resection for uc, disease involving only small bowel, poor bowel preparation as visible area of intestinal mucosa < 90%, or use of steroids, immunosuppressants, or infliximab before colonoscopic sampling were excluded. no diagnosis altered after at least 3 months of followup. endoscopic score was evaluated using simplified endoscopic score in crohn 's disease (ses - cd) or baron score for patients with cd or uc, respectively. human intestinal biopsies and blood samples were collected at division of gastroenterology and hepatology, shanghai jiao - tong university school of renji hospital medicine, in accordance, with guidelines of the research ethics committee of renji hospital, shanghai jiao tong university, school of medicine. human tissue specimens were taken from both macroscopically inflamed and non - inflamed regions of the colon. tissue specimens were put into liquid nitrogen within 10 minutes after biopsy for protein extraction or kept in rnalater (qiagen) for rna isolation. human peripheral blood was separated into plasma and peripheral blood mononuclear cells (pbmcs). plasma was obtained using commercially edta - treated tubes (gongdong medical technology co., ltd.) and pbmcs were isolated according to lymphoprep (axis - shield poc as, norway) protocol. briefly, diluted blood was overlayed over 3 ml lymphoprep and centrifuged at 800 g for 20 mins. then, pbmcs were kept in rnalater (qiagen) for rna isolation according to manufacturer 's protocol. plasma was obtained following centrifugation of whole blood for 15 minutes at 2,000 g. samples were analyzed using kits against traf4 and traf6, according to the manufacturer 's specifications (lanji biochemical and diagnostics, shanghai, china) and a microtiter plate reader was used to read absorbance at 450 nm. total rna in pbmcs and tissue samples were isolated with trizol reagent (ambion) according to the manufacturer 's protocol for cells and tissue. the quantity and quality of rna were detected using a nanodrop 1000 (nanodrop technologies, wilmington, de, usa). primers were designed with primer 5.0 (abi) software and consequently synthesized by sango biotech (shanghai) co., ltd. the primer set for traf4 was 5-aggagttcgtctttgacaccatc-3 (forward) and 5-ctttgaatgggcagagcacc-3 (reverse), with a product of 162 bps. the primer set for traf6 was 5-cctttggcaaatgtcatctgtg-3 (forward) and 5-ctctgcatcttttcatggcaac-3 (reverse), with a product of 140 bps. the primer set of gapdh was 5-gtgaaggtcggagtcaacgg-3 (forward) and 5-cctggaagatggtgatgggat-3 (reverse), which provided a product of 226 bps. cdnas were produced with primescripttm rt reagent kit (takara biotechnology dalian co., ltd.). briefly, reverse transcripts were incubated at 37c for 15 minutes and 85c for 5 seconds. sybr premix ex taq kit was purchased from takara and real - time pcr reactions were done using a stepone plus device (applied biosystems) at 95c for 10 seconds followed by 40 cycles of 95c for 5 seconds and 60c for 20 seconds according to instruction of the sybr premix ex taq kit. the expression levels of the target genes were normalized to gapdh with 2-ct method. for western blot analysis, pmbcs and tissue samples were lysed in ripa buffer (sigma) containing protease inhibitors (roche) and agitated on ice for 30 minutes. protein concentrations were determined using pierce bca protein assay kit (pierce, wohlen, switzerland). protein electrophoresis was performed according to the protocol of mini - protea iii (bio - rad). briefly, proteins were separated in 10% polyacrylamide gels (tris / glycine) and transferred onto polyvinylidene fluoride membrane (millipore). western blots were probed with antibodies against traf4 (rabbit polyclonal anti - traf4 ; 1 : 1000, santa cruz), traf6 (mouse monoclonal anti - traf6, 1 : 1000, santa cruz), and -actin (mouse monoclonal anti--actin ; 1 : 2500, santa cruz). statistical significance was determined using graphpad prism 5.0 for windows (graphpad software, san diego, ca, usa). a p < 0.05 was considered significant with either anova analysis or tukey 's multicomparison. a two - sided fisher 's exact test or test was performed to analyze discrete variables. from february 2007 to february 2010, 40 cd patients, 42 uc patients, and 40 healthy controls were included in our present study. patients with ibd indicated significantly lower body mass index (bmi) than healthy controls (p < 0.0001). the uc group contained significantly more smokers than cd patients (22 : 8, p = 0.0023). three patients with ileitis, 15 patients with ileocolitis, and 22 patients with colitis were enrolled in cd group. thirteen patients with proctosigmoiditis, 20 patients with left sided colitis, and 9 patients with pancolitis were enrolled in uc group. characteristics of included subjects were described in table 1. to investigate the diagnostic value of traf4 and traf6 in ibd, we detected levels of soluble traf4 and traf6 in plasma of ibd patients. we found that traf4 and traf6 were significantly higher both in patients with cd and uc than in healthy controls (figures 1(a) and 1(b)). however, only overexpression of soluble traf4 showed a significantly positive correlation with endoscopic disease activity index (baron score) in uc patients (spearman 's r = 0.458, p = 0.002). furthermore, we observed that traf4 showed a significantly diagnostic value in differentiating active ibd patients from healthy controls (p < 0.0001, figures 2(a) and 2(b)). although traf6 also showed a significantly diagnostic value in differentiating active cd, uc from healthy controls, the lower area under the curve (auc) predicted a less diagnostic value than traf4 (figures 2(c) and 2(d)). to identify gene expressions of traf4 and traf6 in pbmcs in patients with cd and uc, we isolated rna from pbmcs. similar to their expression in plasma, traf4 and traf6 showed significantly higher levels both in patients with cd and uc than in healthy controls (figures 1(c) and 1(d)) (all p < 0.0001). given that segmental changes can exhibit inflammation in the colon in ibd patients and that intestinal segments in endoscopic remission can appear as histologic colitis, we determined the expressions of traf4 and traf6 both in inflamed and non - inflamed intestinal mucosae. unfortunately, 3 patients with only ileitis and nine patients with pancolitis were excluded based on exclusion criteria. quantitative real - time pcr (qrt - pcr) was used to determine the gene expressions of traf4 and traf6 in inflamed and non - inflamed intestinal mucosae of ibd. it was found that traf4 and traf6 expressions were significantly higher in inflamed intestinal mucosa of patients compared to normal mucosa of healthy controls (all p < 0.0001) (figures 3(a) and 3(b)). interestingly, traf6 expressions were also significantly higher in non - inflamed tissue of ibd patients than in healthy controls, which may indicate potential preactivation of traf6 in ibd (figure 3(b)). western blotting was used to measure protein expressions of traf4 and traf6 in inflamed and non - inflamed intestinal mucosae of ibd (figure 4). our data indicate that only traf6 expressions were significantly higher in non - inflamed tissue of ibd patients than in healthy controls, although traf4 and traf6 protein expressions were significantly higher in inflamed intestinal mucosa of patients than in normal mucosa of healthy controls (all p < 0.0001) (figures 3(c) and 3(d)). similar to their gene expressions, traf4 and traf6 protein expressions were significantly increased in inflamed intestinal mucosa compare to the non - inflamed mucosa or healthy controls. also, traf6 protein expression was significantly higher in inflamed intestinal mucosa of ibd patients compared to healthy controls. in the current study, we demonstrated that two members of the traf family, traf4 and traf6, were activated in patients with ibd. although both traf4 and traf6 showed potentially diagnostic value in differentiating active cd and uc from healthy controls, only traf6 could be pre - activated in non - inflamed tissue of ibd patients. although trafs have similar overall structural features including a c - terminal receptor - binding domain and a leucine - zipper domain, their own structural difference leads to distinctive interaction with receptors [13, 14 ]. growing evidence indicates that trafs are regulated not only by their own structural features but also by the nature of their interactions, recruitment, or localization. early overexpression studies clearly indicated that traf6 contributes to the cd40-mediated activation of nf-b and other signaling molecules. nf-b activity has been upregulated in lamina propria immune cells and in epithelia of the inflamed gut in ibd. the nf-b pathway regulates inflammation, regulatory t - cell production, and dc function. however, activation of important transcriptional regulators including nf-b and the stress - activated protein kinases (sapks) mediated by traf6 requires binding to cd40. the cytoplasmic cd40 binding domain for traf6 is necessary for the cd40-mediated activation of il-6 production in monocytes and macrophages, and the proinflammatory il6 biologic network is upregulated in active ibd. moreover, experiments with immune cells or fibroblasts isolated from traf6-deficient mice indicate that traf6 is required for the cd40-mediated activation of not only nf-b but also jnk and p38 mapk signals [19, 20 ]. although cd40-mediated jnk activation in b cells seems to require cytoplasmic traf6, traf6 mutants defective in cd40 binding were able to activate the jnk pathway and upregulate cd80, indicating that traf6 may be able to contribute to certain jnk signals without the binding of cd40. jnk and mapk signaling pathways are involved in governing lymphocyte influx into the gut in ibd patients by regulating lymphocyte adhesion and transmigration. furthermore, only one study screened potential alterations of the traf6 gene in a large number of cd and uc patients but failed to identify apparent disease - causing mutations. their data suggested that traf6 may have essential roles in human biology that it might not tolerate any significant structural alterations. dendritic cells from traf4-deficient mice exhibited reduced migration both in vitro and in vivo experiments. this result indicates that traf4 could participate in immune functions by facilitating immune cell migration. interestingly, traf4 increases nf-b activation through the gitr via a traf - binding site located in the cytoplasmic domain of gitr. this domain is responsible for the inhibition of treg cells and the promotion of t - cell activation. although no nf-b activity has ever been detected via traf4 overexpression, traf4 has been implicated as an upstream molecule that regulates the jnk pathway via interaction and activation of misshapen (msn), a member of the sps1 protein kinase family. moreover, traf4 positively regulates transforming growth factor (tgf)- via potentiating bone morphogenetic protein (bmp) and nodal signaling. accordingly, traf4 is upregulated in b cells following cd40 signaling, which suggests that traf4 affected downstream of cd40 pathway. this may explain our result that traf4 expressions were not significantly different in non - inflamed tissue of ibd patients compared to healthy controls. our understanding of traf4 and traf6 functions in the present study indicates that overlapping and unique functions will ultimately be attributed to each of the trafs. to our knowledge, this paper may be the first one to combine analyzing traf4 and traf6 in ibd patients. first, the present study did not include histological criteria to distinguish non - inflamed tissue from inflamed tissue, which may confuse the microscopically inflamed tissues with non - inflamed tissues. second, the present study could not include laboratory data as esr or crp to assess activity of disease, which may lead to the potential bias of overreliance on clinical manifestations and endoscopic assessment. collectively, our data showed similar and different expression patterns of traf4 and traf6 in patients with ibd. to date | in recent years, interests combining the exploration of tumor necrosis factor receptor - associated factor 4 (traf4) and traf6 in immune cells and transgenic mice are emerging. although it has been found that traf4 and traf6 share the same traf binding sites, comprehensive study of traf4 and traf6 in inflammatory bowel disease (ibd) is still lacking. this paper shows similar and different expression patterns of traf4 and traf6 in patients with ibd. the results indicate that traf4 and traf6 are overexpressed in ibd. traf4 and traf6 play different roles in the pathogenesis of ibd. moreover, traf4 may be an indicator of endoscopic disease activity of uc and traf6 preactivation can be detected in noninflamed colonic segments. |
questing ticks were collected from vegetation by flagging in 3 regions in germany (9 sites total) in march three sites, including renatured gravel pits and walking areas near villages and cities (a c), were located in the federal state of saarland. one site in southern germany was in a natural alluvial forest north of munich, popular for hiking and dog walking (d), and in east germany (saxony), 3 sites were former brown coal surface - mining areas near the city of leipzig (e g). ongoing renaturation and flooding of the pit holes during past decades created a highly valuable recreational area with artificial lakes and surrounding meadows and forest (www.leipzigerneuseenland.de). here, sampling was carried out around lake cospuden (436 ha, fully flooded for the past 10 years, 51.5 m deep ; figure). further sampling sites were located on a renatured former waste disposal area (h), now a popular urban recreation area, and in an alluvial forest near a popular game park (i), both within leipzig. tick sampling sites in germany during 2008 and 2009 (green shading) : saarland, sites a g, in lake cospuden renatured brown coal surface - mining area (blue shading) ; site h, renatured waste disposal site (sampled april and september / october 2009) ; and site i, game park (sampled in april 2009). ticks were stored either in 70% ethanol or kept at 4c, identified to species level, and homogenized (ticks in ethanol : 2 ml eppendorf tubes [eppendorf, hamburg, germany ] with one 5-mm steel bead, 80 l phosphate - buffered saline, and in tissue lyser [qiagen, hilden, germany ] for 5 min at 30.000u / min ; live ticks : 2.0 mp precellys kit mk28, 320 l minimum essential medium cell culture medium [sigma - aldrich, taufkirchen, germany ], in a precellys 24 dual [peqlab, erlangen, germany ] for 2 5,000 rpm for 30 s, with a 15-s break). dna was extracted from each tick separately (females, males, nymphs) or in pools of 5 individuals (nymphs only) with the qiagen dna mini kit (qiagen) by using the protocol for animal tissue. quality and quantity of extracted dna were tested with a nano drop nd-1000 spectrophotometer (peqlab). ticks were screened for rickettsial dna by using a pcr amplifying part of the glta gene as described (8). some tick samples positive for rickettsia spp. were selected to amplify and determine the sequence of the outer membrane protein coding genes ompa and ompb (9). new primers were developed for the first part of the ompa gene : ompa - mmx1-for 5-acaagctggaggaagcctagc-3 ; ompa - mmx1-rev 5-tctcccgctcctttgaaaactat-3. of the 3,076 ticks collected, 1,359 were identified as d. reticulatus ticks (542 males, 817 females, from all sites except site i), 15 as d. marginatus ticks (8 males, 7 females, only at site b), and 1,702 as i. ricinus ticks (714 males, 658 females, 330 nymphs, from all sites). dna was extracted from most d. reticulatus ticks and almost half of the i. ricinus ticks (table). in the glta pcr, 849 bands of the correct size were obtained in the investigated samples (table ; 749/1,322 (56.7%) of d. reticulatus ticks ; 2/15 (13.3 %) of d. marginatus ticks ; 98/730 (13.4%17.4%) of i. ricinus ticks (772 nymphs in pools of up to 5). the rate of infection differed by tick species, sex of the tick, and collection site ; for example, the infection rate was 20.5%76.4% in female d. reticulatus ticks (table). sequencing of 24.1% (n = 205) of the glta pcr - products verified the specific amplification of rickettsial dna in 192 cases (93.6%) ; sequencing for the remaining 13 amplicons could not be determined because the sequencing result was of poor quality. in 1 i. ricinus tick from site b, 87%88% identity to r. asiatica, r. canadensis, and r. helvetica was identified, but amplification of ompa and ompb failed to further verify the species. na, not available. in the regions saarland and saxony, some of the nymphs were placed in pools of up to 5 specimens ; range of positive ticks indicates the possible minimum and maximum number of ticks positive for rickettsia spp. in a pool. from each site, 16 positive tick samples were analyzed for the ompa and ompb genes. the ompb genes of r. raoultii (n = 27), r. helvetica (n = 8), and r. slovaca (n = 2), and ompa genes of r. raoultii (n = 25) and r. slovaca (n = 2) were 100% identical in the amplified part of the respective species, regardless of geographic origin. r. raoultii from our study showed 100% identity (ompa) and 99% identity (ompb) to r. raoultii strain marne (genbank accession nos. dq365800 and dq365797) ; for r. helvetica (ompb), 100% identity to genbank entry af123725 ; and for r. slovaca, 100% identity to genbank entry af123723 (ompb), and u83454 (ompa). r. raoultii, r. slovaca, and r. helvetica were found only in d. reticulatus, d. marginatus, and i. ricinus ticks, respectively. sequences (ompa and ompb) from this study were deposited in genbank (accession nos. in germany, the most common tick is i. ricinus ; d. reticulatus ticks have a focal distribution, and d. marginatus ticks have been described on only a few occasions because the latter require warm and dry habitats (2,10,11). climate change and structural landscape changes have been discussed as reasons for the creation of new tick habitats (12). brown coal surface - mining sites of the former german democratic republic undergo extensive renaturation, thus providing new biotopes for many plant and animal species, including ticks. in germany, r. slovaca was first described in 1977 (2) and again recently (11). even though the sample size in the present study was small, comparable prevalence rates were detected (13%). r. raoultii was first detected in russia and has recently been described as a new species (13). the average infection rate of r. raoultii in this study was 56.7% and, in the renatured brown coal surface - mining sites, 80.1%. the latter rate is high in comparison with results of previous studies (11,12). r. helvetica prevalence in i. ricinus ticks was similar to results of other studies in germany (8). this finding is of major concern to public health : both r. slovaca and r. raoultii can cause tibola, even though r. slovaca is considered to be more pathogenic (7,14). a case of tibola caused by r. slovaca was identified in a human patient in an r. slovaca the pathogenicity of r. helvetica has not been fully clarified, but serologic evidence shows human infections in france (3), and dna of r. helvetica was recently identified in a patient in sweden who had meningitis (15). renaturation of industrial sites specifically provides new areas for human recreation and, simultaneously, new habitats for many plant and animal species. thus, human - made habitats may lead to increased emerging diseases, especially in tick - borne rickettsioses, because renaturation areas may form favorable biotopes for enhanced human vector interactions. | to explore increased risk for human rickettsia spp. infection in germany, we investigated recreational areas and renatured brown coal surface - mining sites (also used for recreation) for the presence of spotted fever group rickettsiae in ticks. r. raoultii (56.7%), r. slovaca (13.3%), and r. helvetica (> 13.4%) were detected in the respective tick species. |
azoospermia, the absence of sperm in the ejaculate is seen in 1015% of infertile men. examination of the testis and vas - deferens along with semen volume and serum follicle stimulating hormone (fsh) levels help in identifying the cause of azoospermia. obstruction of the ductal system is responsible for approximately 40% cases of azoospermia and in the absence of injury to vas or elective vasectomy, the obstruction is commonly at the level of the epididymis. intratesticular obstruction is less common and is attributed to obstruction of the rete testis, either inflammatory or idiopathic. microsurgical reconstruction is possible for obstruction at the level of the epididymis or vas - deferens, and thus its identification is important for managing these men. in a significant number of men the common organisms implicated are chlamydia trachomatis, neisseria gonorrhoeae, escherichia coli and mycobacterium tuberculosis. tuberculosis (tb) is a well - documented cause of male infertility in asia. tubercular infection is insidious in onset and often without overt physical symptoms and signs, making a specific diagnosis difficult. infertility may be the first sign of male genitourinary tb that is the most common extra - pulmonary form of tb. while the exact pathogenesis is not known, factors like reflux of infected urine, hematogenous spread or lymphatic spread may play a role. the globus minor is affected alone in around 40% cases, owing to greater blood supply. the vas - deferens and epididymis may become nodular and rarely may form a discharging sinus. infertility usually results from structural obstruction or anatomic distortion of the epididymis, vas - deferens or ejaculatory ducts. early detection of tb and its treatment with anti - tubercular therapy (att) may help restore sperms in the ejaculate. considering the high prevalence of tb in the developing world, the frequent absence of a contributory history and its known association with obstructive azoospermia, men with idiopathic obstructive azoospermia are often screened for tb. polymerase chain reaction (pcr) is a rapid, sensitive and specific molecular biological method for detecting mycobacterial dna in both pulmonary and extra - pulmonary samples. using in vitro diagnostics with primers targeting is6110 and mpb64 it is rapid and more sensitive than conventional methods and the sensitivity varies between 92% and 95% and specificity between 95% and 98% for different samples. these rapid tests have further added to the interest in such screening. among women, we, therefore, planned a prospective cohort study to assess the need for screening for genitourinary tb among infertile men with idiopathic azoospermia and to evaluate the impact of early treatment with att on semen parameters. infertile men (inability to conceive after at least a year of unprotected intercourse) presenting to the out - patient clinic of our tertiary care hospital were screened for inclusion. the study population included azoospermic men (azoospermia confirmed on at least two semen analysis) diagnosed to have idiopathic vaso - epididymal junction obstruction or ejaculatory duct obstruction. idiopathic vaso - epididymal junction obstruction was diagnosed if the subjects had normal testis size, bilateral palpable vas - deferens, normal secondary sexual characters, normal fsh levels and normal spermatogenesis on fine needle aspiration cytology of the testis in the absence of any known cause for azoospermia such as previous vasectomy, inguinal or scrotal trauma or surgery, orchitis, radiation or chemotherapy. men who fulfilled the above criteria, but also had a low volume ejaculate (below 1.5 ml) in the presence of normal libido and orgasm were considered to have ejaculatory duct obstruction. this group of men also underwent trans - rectal ultrasound (trus) to identify dilated ejaculatory ducts that would suggest ejaculatory duct obstruction. if ejaculatory ducts were not dilated and semen volume was persistently low, a provisional suspicion of fibrotic ejaculatory duct obstruction was made. between january 2013 and may 2014, 100 consecutive patients who fulfilled these criteria and consented for participation were screened for genitourinary tb with a kit - based semen pcr test for m. tuberculosis. if the test was positive, confirmatory tests which included semen acid fast bacilli (afb) smear, urine afb smear and culture, chest x - ray, mantoux test and ultrasound of the kidney - ureter and bladder were performed. men with a clinical and laboratory evidence of tb based on the above investigations were provided standard att for 6 months, and semen analysis was repeated at 6 months. if they were still azoospermic, they were offered assisted reproduction. men without any clinical evidence of tb and those with negative screening pcr were offered surgical reconstruction or assisted reproduction. outcome analysis included the incidence of a positive screening test, incidence of isolated pcr positivity in the absence of others symptoms, signs or laboratory evidence of tb, and the impact of att on semen analysis. this prospective, cohort study was approved by our institutional ethics committee, and all subjects provided a written informed consent for inclusion. the mean age of the 100 subjects was 30.6 years (range : 2438 years) and their mean duration of infertility was 38.2 months. totally, 7 of these 100 subjects (7%) had positive semen pcr for tb. none of these 7 had any additional laboratory test positive for tb [table 1 ]. patient profile and results four of the 7 pcr positive subjects had a history or physical findings consistent with a diagnosis of genitourinary tb. three of them had physical signs of tb that included nodular vas - deferens or epididymis in two patients and a chronic scrotal sinus in one. the fourth patient reported progressively decreasing semen volume with painful ejaculation over the last 3 years. he had a history of cervical lymphadenopathy 5 years earlier and had received 8 weeks att at that time. while none of these four patients had any laboratory confirmation of tb, they were advised att in view of their history and physical examination that was consistent with a diagnosis of tb. all four patients underwent repeat semen analysis, twice, after 6 months of att. the remaining three patients with positive semen pcr for tb had no physical findings or laboratory evidence of active tb. one of them had completed 6 months of att in the past for pulmonary tb. summary of results pcr : polymerase chain reaction for tb in semen ; att : antitubercular therapy previous history of tb was present in 7 of 100 subjects (5 pulmonary, 2 cervical lymph nodes). totally, 2 of these 7 subjects had positive semen pcr for tb including one patient with cervical tb who had received incomplete (8 weeks) att and continued to have a low volume ejaculate and one who had previously been fully treated for pulmonary tb. a total of 18 subjects had a low volume ejaculate (< 1.5 ml). our findings suggest that infertile men with obstructive azoospermia should not be screened with a semen pcr test for tb. obstruction as a cause often portends a better prognosis than testicular impairment since surgical correction of the obstruction is potentially curative. obstruction may account for 40% cases of azoospermia. in countries where vasectomy is a popular modality of sterilization, infertility resulting from tb may be due to direct involvement of epididymis, occlusion of the tubules or due to scarring and distortion of normal anatomy including that of the ejaculatory ducts when the involvement extends into the prostate. in the absence of symptoms and signs, the diagnosis of tb infertility may be the first presentation of genitourinary tb and patients may have no recollection of any other symptoms. the wide - spread prevalence of tb, its known association with infertility, and the lack of a suggestive history and signs make it appear logical that men with idiopathic infertility should be screened for tb. this is further encouraged by the availability of a plethora of investigations for tb including pcr and previous reports that treatment of tb may enable return of sperms to the ejaculate of some selected azoospermic men. on the other hand, four among these seven patients had physical findings of tb, low ejaculate volume, or a definitive history of untreated tb. the physical examination and untreated tb history would have been indications for treatment with att in these men, even without a screening pcr. however, none of them benefitted from the att in terms of infertility. we also found that trus was unable to identify obstruction in any of the 18 men with low volume ejaculate. this is in contrast to the study by raviv. who found obstructive lesions in 13 of 42 men with a low volume ejaculate. fibrotic, atrophic seminal vesicles with ejaculatory duct obstruction have been considered a feature of tb and progressively decreasing semen volume with azoospermia may be an indirect indicator of tubercular infection of the genital system. since we were unable to document tb in any of the 14 men with low volume ejaculate who did not have a simultaneous physical abnormality, however, the incidence of tb requiring treatment was 22% (4/18) in men with a low volume ejaculate, and this may form a subgroup that should be evaluated for tb. a study of infertile couples in mongolia found postinfectious obstructive azoospermia and accessory gland infection in 8.4% and 6.7% of men respectively. opined that genital tb is almost always secondary to tb elsewhere, and the mode of dissemination is usually hematogenous, lymphatic or via direct contiguity. however, in our study, in three of the four patients who were diagnosed to have genital tb and started on att we were unable to obtain a history of or document extragenital tb. ajantha., reported that pcr, which is simple and rapid, is superior to conventional methods and should be performed in all patients with extra - pulmonary tb and when combined with staining and culture, the sensitivity can be increased. three of our subjects had positive semen pcr but no other evidence of tb ; one of them had a history of treated pulmonary tb this is in contrast to the report by shah, who presented a series of 34 cases in which epididymal inflammation due to tb could be completely resolved by att and steroids in 6 of 10 men with enlarged epididymis, but no sinus and normal ejaculate volume, resulting in reversal of azoospermia. it is possible that this could be due to the early stage of diagnosis in their series, but this would need further data to support att in such men. our study is limited by the fact that this was performed at a tertiary care center with a significant delay in presentation. it is possible that early diagnosis and treatment may have helped reverse azoospermia in some men. we also did not follow - up men with positive pcr who did not receive att. it is possible that their pcr was not false positive but a sign of infection that had not yet manifest clinically in the form of physical signs.. however, it is difficult to justify att without corroborative evidence or in a clinical trial of treatment. a meticulous history and physical examination, particularly in men with low volume ejaculate may identify the subset that needs to be investigated. | objective : infertility may be the sole manifestation of genitourinary tuberculosis (tb) and men with idiopathic obstructive azoospermia are often screened for tb using semen polymerase chain reaction (pcr) test. we assessed the benefits of such screening.design:totally, 100 infertile men with idiopathic obstructive azoospermia were screened with a kit - based pcr for semen tb. confirmatory tests for tb were performed in pcr positive men before administering anti - tubercular therapy (att) for 6 months. semen analysis was repeated to assess benefits of treatment.results:seven subjects (7%) had positive semen pcr for tb. four of them had other clinical evidence of tb (history and physical signs) and were administered att. none had any improvement in semen parameters. no subject had any other laboratory evidence of tb and no other subject (96%) was administered att.conclusions:screening for tb using semen pcr did not identify any men who would have been missed on clinical evaluation and is thus not indicated in men with idiopathic obstructive azoospermia. |
eligible participants were insulin - nave adults (1880 years) with type 2 diabetes treated for 3 months with 1,500 mg / day metformin and a1c values of 7.010.0% or with metformin and sulfonylurea (less than or equal to half of the maximum approved dose) and a1c values of 7.08.5% (supplementary data online). the trial was conducted in 202 office- or hospital - based sites in belgium, canada, france, germany, italy, the netherlands, spain, the u.k., and the u.s. between 3 march 2009 and 19 april 2010. protocol, amendments, and informed consent documents were approved by independent local ethics committees and implemented according to good clinical practice (9) and the declaration of helsinki (10). this 38-week, open - label trial comprised a 12-week run - in followed by a 26-week, randomized, two - armed, parallel - group period for participants not achieving < 7% a1c. at run - in start, sulfonylurea was discontinued (in approximately one - third of participants), and liraglutide was initiated in 0.6-mg / day weekly increments to a final 1.8-mg / day dose (fig. two participants who had been randomized to the metformin and liraglutide control group received the wrong trial treatment. the other participant should not have been randomized as her a1c level at week 0 was < 7%. for the full analysis, these participants appear in the randomized control group, and for the safety analysis, they appear in their respective treatment groups (i.e., insulin detemir and observational groups, respectively). participants with a1c 7% at the end of run - in were randomized (1:1) to 26 weeks insulin detemir added to metformin + liraglutide 1.8 mg (randomized detemir group) or continued metformin + liraglutide 1.8 mg only (randomized control group) (see supplementary data online for randomization details). a double - blind, placebo - controlled approach was not used because titration with detemir placebo was not feasible. to determine the effects of continued treatment on initial responders, participants with a1c < 7% after run - in insulin detemir (100 units / ml) and liraglutide (6.0 mg / ml) (novo nordisk a / s, bagsvaerd, denmark) were injected subcutaneously once daily with pen devices. insulin detemir was administered with evening meals or at bedtime ; liraglutide was administered at any (consistent) time of day. insulin detemir treatment was started at 10 units and titrated by investigators on a weekly basis using a specific algorithm targeting 4.16.0 mmol / l self - measured fasting plasma glucose (fpg) values (supplementary data online). the primary end point was the change in a1c (%) from randomization (week 0) to week 26 to determine whether adding insulin detemir to metformin + liraglutide was superior to continued metformin + liraglutide. additional efficacy end points included the following : percentage of participants reaching a1c < 7 and 6.5%, fpg, postprandial plasma glucose from self - measured seven - point glucose profiles, weight, blood pressure, lipids, and percentage of participants reaching the composite end point of a1c < 7% with no weight gain or hypoglycemia (during the 26-week period). major episodes required third - party assistance, irrespective of plasma glucose levels. for the primary end point, superiority of the insulin detemir over the control group was concluded if the 95% ci upper limit for the treatment difference was < 0. assuming 20% run - in withdrawals and 40% randomization eligibility, 150 participants per group were needed to detect a 0.5% a1c between - group difference with 90% power. unless stated otherwise, efficacy end points were analyzed statistically using the full analysis set (all randomized participants with greater than or equal to one efficacy value) with missing values imputed by carrying forward the last observation. an ancova model with treatment, country, and previous oral antidiabetic therapy as fixed effects and randomization value as covariate was used to analyze change from randomization to week 26. percentages of participants reaching < 7 and 6.5% a1c were analyzed using logistic regression with the same fixed effects and covariate. a similar logistic regression model was used for the composite end point (proportion reaching < 7% a1c with no weight increase and no hypoglycemia during the 26-week period). the safety analysis set comprised all participants exposed to at least one dose of trial drug. run - in results were summarized by the randomized period treatment group (i.e., observational, randomized detemir, or randomized control), although all participants received the same run - in treatment. eligible participants were insulin - nave adults (1880 years) with type 2 diabetes treated for 3 months with 1,500 mg / day metformin and a1c values of 7.010.0% or with metformin and sulfonylurea (less than or equal to half of the maximum approved dose) and a1c values of 7.08.5% (supplementary data online). the trial was conducted in 202 office- or hospital - based sites in belgium, canada, france, germany, italy, the netherlands, spain, the u.k., and the u.s. between 3 march 2009 and 19 april 2010. protocol, amendments, and informed consent documents were approved by independent local ethics committees and implemented according to good clinical practice (9) and the declaration of helsinki (10). this 38-week, open - label trial comprised a 12-week run - in followed by a 26-week, randomized, two - armed, parallel - group period for participants not achieving < 7% a1c. at run - in start, sulfonylurea was discontinued (in approximately one - third of participants), and liraglutide was initiated in 0.6-mg / day weekly increments to a final 1.8-mg / day dose (fig. two participants who had been randomized to the metformin and liraglutide control group received the wrong trial treatment. the other participant should not have been randomized as her a1c level at week 0 was < 7%. for the full analysis, these participants appear in the randomized control group, and for the safety analysis, they appear in their respective treatment groups (i.e., insulin detemir and observational groups, respectively). participants with a1c 7% at the end of run - in were randomized (1:1) to 26 weeks insulin detemir added to metformin + liraglutide 1.8 mg (randomized detemir group) or continued metformin + liraglutide 1.8 mg only (randomized control group) (see supplementary data online for randomization details). a double - blind, placebo - controlled approach was not used because titration with detemir placebo was not feasible. to determine the effects of continued treatment on initial responders, participants with a1c < 7% after run - in insulin detemir (100 units / ml) and liraglutide (6.0 mg / ml) (novo nordisk a / s, bagsvaerd, denmark) were injected subcutaneously once daily with pen devices. insulin detemir was administered with evening meals or at bedtime ; liraglutide was administered at any (consistent) time of day. insulin detemir treatment was started at 10 units and titrated by investigators on a weekly basis using a specific algorithm targeting 4.16.0 mmol / l self - measured fasting plasma glucose (fpg) values (supplementary data online). the primary end point was the change in a1c (%) from randomization (week 0) to week 26 to determine whether adding insulin detemir to metformin + liraglutide was superior to continued metformin + liraglutide. additional efficacy end points included the following : percentage of participants reaching a1c < 7 and 6.5%, fpg, postprandial plasma glucose from self - measured seven - point glucose profiles, weight, blood pressure, lipids, and percentage of participants reaching the composite end point of a1c < 7% with no weight gain or hypoglycemia (during the 26-week period). for the primary end point, superiority of the insulin detemir over the control group was concluded if the 95% ci upper limit for the treatment difference was < 0. assuming 20% run - in withdrawals and 40% randomization eligibility, 150 participants per group were needed to detect a 0.5% a1c between - group difference with 90% power. unless stated otherwise, efficacy end points were analyzed statistically using the full analysis set (all randomized participants with greater than or equal to one efficacy value) with missing values imputed by carrying forward the last observation. an ancova model with treatment, country, and previous oral antidiabetic therapy as fixed effects and randomization value as covariate was used to analyze change from randomization to week 26. percentages of participants reaching < 7 and 6.5% a1c were analyzed using logistic regression with the same fixed effects and covariate. a similar logistic regression model was used for the composite end point (proportion reaching < 7% a1c with no weight increase and no hypoglycemia during the 26-week period). the safety analysis set comprised all participants exposed to at least one dose of trial drug. run - in results were summarized by the randomized period treatment group (i.e., observational, randomized detemir, or randomized control), although all participants received the same run - in treatment. during the run - in, 167 of 988 (17%) participants withdrew (fig. 1b) ; 76 of 167 (46%) of these withdrew due to gastrointestinal aes (7.7% of enrolled participants). of 821 participants completing the run - in, 498 (61%) reached < 7% a1c ; 323 (39%) did not and were eligible for randomization. compared with participants that did not reach the target during run - in, those reaching the target had a shorter type 2 diabetes duration and lower a1c and fpg values and more had been treated with metformin only before enrollment (table 1). at run - in completion, a1c was reduced by 1.3% in this observational group and by 0.6% in the randomized groups from a1c values at run - in start of 7.7 and 8.3%, respectively (fig. one major hypoglycemic event occurred (blood glucose level, 5.2 mmol / l) and minor hypoglycemia occurred at 0.0000.372 events per participant - year (supplementary table 2). demographics and disease characteristics at run - in start (week 12) and randomization (week 0) glycemic efficacy, changes in body weight, and insulin detemir doses. results from run - in to randomization (vertical dotted line) and from randomization to the end of the trial for change in a1c (a), change in body weight (b), and mean fpg (c). rt, randomized treatment group ; rc, randomized control group ; o, observational group. d : self - monitored plasma glucose profiles before and after breakfast, lunch, and dinner and at bedtime for the treatment and control groups at weeks 0 and 26., randomized treatment group ;, randomized control group ;, observational group. p values refer to differences between groups in the change from randomization (week 0) to week 26. e : insulin detemir dose (prescribed dose,, left ordinate) and self - measured fpg (, right ordinate) during the 26-week randomized period for the insulin detemir treatment group. nausea was the most frequently reported run - in ae (table 2) but incidences fell to < 7% in all groups after 3 weeks (supplementary table 3 and supplementary fig. one case of acute pancreatitis was reported. in another participant, with elevated calcitonin level (23.5 ng / l) before liraglutide administration, a subsequent thyroidectomy revealed an incidental thyroid neoplasm (1-mm papillary microcarcinoma) (supplementary table 4). aes during run - in and randomized period with an incidence 5% by system organ class and preferred term and summary of saes participants not reaching glycemic target had a 7.6% mean a1c at completion of the run - in period. they were then randomized to add insulin detemir to metformin + liraglutide (n = 162) or to continue unchanged metformin + liraglutide (randomized control subjects, n = 161). addition of insulin detemir further reduced a1c compared with continued metformin + liraglutide (0.51% [n = 162 ] vs. + 0.02% [n = 157 ], respectively ; estimated treatment difference [etd ] 0.52 [95% ci 0.68 to 0.36 ] ; p < 0.0001), resulting in a1c values of 7.1 and 7.5%, respectively, at week 26 (fig. 2a and supplementary tables 5 and 6), and meeting the trial s primary end point. mmol / l) than control group (0.4 mmol / l ; etd 1.7 [2.2 to 1.3 ] ; p < 0.0001) (fig. 2c). after a mean 3.5-kg weight loss during run - in, both groups experienced further modest weight reduction over the next 26 weeks : 0.16 kg with detemir and 0.95 kg without (etd 0.79 [0.081.49 ] ; p = 0.03) (fig. compared with the control group, more than twice as many in the insulin detemir group achieved < 7% a1c (17 vs. 43%, respectively ; p < 0.0001), and three times as many achieved 6.5% (6 vs. 18%, respectively ; p = 0.0016 ; logistic regression estimates) (supplementary fig. the proportion reaching the composite end point (< 7% a1c with no weight gain and no hypoglycemia) after 26 weeks was significantly greater in the insulin detemir (21%) than the control group (9% ; p = 0.0016 ; logistic regression estimates) (supplementary fig. 2). excluding one outlier in the randomized control group with 25 minor hypoglycemic episodes, minor hypoglycemia rates were 0.286 and 0.029 events per participant - year for insulin detemir and control groups, respectively (p = 0.004) (supplementary table 2). self - measured plasma glucose levels decreased in both groups, with significantly greater reductions in postprandial values in the insulin detemir versus control group (fig. etds ranged from 0.60 mmol / l (95% ci 1.12 to 0.08 ; p = 0.02) to 1.12 mmol / l (95% ci 1.72 to 0.51 ; p = 0.0003). mean prescribed insulin detemir doses increased from 10 units / day to 39.5 units / day (0.41 units / kg), whereas mean self - measured fpg decreased from 7.9 to 6.2 mmol / l (fig. prescribed insulin detemir doses were consistent with algorithm recommendations, indicating good overall adherence to the titration algorithm. there were no significant differences between groups in changes from randomization for serum lipids, except for free fatty acids (insulin detemir group, 0.11 mmol / l ; control group, 0.03 mmol / l ; etd 0.08 [95% ci 0.13 to 0.03 ] ; p = 0.002) (for more information regarding changes in lipid levels, see supplementary table 7). a total of 67% (109 of 163) and 59% (93 of 159) of participants had one or more aes, and 5.5% (9 participants ; 13 events) and 3.8% (6 participants ; 8 events) had serious aes (saes), in the insulin detemir and control groups, respectively (table 2). no pattern or clustering of saes was observed, with most being considered unlikely to be related to treatment (supplementary table 8). although more aes of increased lipase were reported with insulin detemir, a minor increase in the median serum lipase levels (below the upper limit of normal) was observed across all groups, without apparent treatment differences (supplementary table 9). one case of chronic pancreatitis occurred (control group) (supplementary table 4). the 498 participants achieving the < 7% target with metformin + liraglutide at the end of run - in were followed for another 26 weeks. this group experienced a mean 1.3% a1c reduction by the end of run - in, and 1.1% overall from start of run - in to week 26 (from 7.7% at run - in start to 6.6% at study end). the group also experienced overall reductions from start of run - in to week 26 in fpg of 2.1 mmol / l (from 9.2 mmol / l at run - in start to 7.2 mmol / l) and weight of 4.8 kg (from 99.0 kg at run - in start to 94.6 kg) (fig. 2), and improved seven - point blood glucose profiles (completers) (fig. aes for the 38-week period are summarized in supplementary table 10. in the observational group, 81% (402 of 499) of participants had aes and 7.8% (39 of 499) experienced 49 saes, with 45 considered unlikely to be related to study drug and without obvious pattern (supplementary table 8). no major hypoglycemic episodes occurred, whereas 9.0% (45 of 499) of participants experienced minor hypoglycemia (0.211 events per participant - year)., systolic blood pressure was reduced from run - in start by 3.13 mmhg in the control group, 1.65 mmhg in the insulin detemir group, and 3.33 mmhg in the observational group (supplementary table 11). heart rate was increased from run - in start to 26 weeks in all treatment groups : by 3.62 beats per minute (bpm) in the control group, 3.87 bpm in the insulin detemir group, and 3.64 bpm in the observational group (supplementary table 12). during the run - in, 167 of 988 (17%) participants withdrew (fig. 1b) ; 76 of 167 (46%) of these withdrew due to gastrointestinal aes (7.7% of enrolled participants). of 821 participants completing the run - in, 498 (61%) reached < 7% a1c ; 323 (39%) did not and were eligible for randomization. compared with participants that did not reach the target during run - in, those reaching the target had a shorter type 2 diabetes duration and lower a1c and fpg values and more had been treated with metformin only before enrollment (table 1). at run - in completion, a1c was reduced by 1.3% in this observational group and by 0.6% in the randomized groups from a1c values at run - in start of 7.7 and 8.3%, respectively (fig. one major hypoglycemic event occurred (blood glucose level, 5.2 mmol / l) and minor hypoglycemia occurred at 0.0000.372 events per participant - year (supplementary table 2). demographics and disease characteristics at run - in start (week 12) and randomization (week 0) glycemic efficacy, changes in body weight, and insulin detemir doses. results from run - in to randomization (vertical dotted line) and from randomization to the end of the trial for change in a1c (a), change in body weight (b), and mean fpg (c). rt, randomized treatment group ; rc, randomized control group ; o, observational group. d : self - monitored plasma glucose profiles before and after breakfast, lunch, and dinner and at bedtime for the treatment and control groups at weeks 0 and 26., randomized treatment group ;, randomized control group ;, observational group. p values refer to differences between groups in the change from randomization (week 0) to week 26. e : insulin detemir dose (prescribed dose,, left ordinate) and self - measured fpg (, right ordinate) during the 26-week randomized period for the insulin detemir treatment group. nausea was the most frequently reported run - in ae (table 2) but incidences fell to < 7% in all groups after 3 weeks (supplementary table 3 and supplementary fig. one case of acute pancreatitis was reported. in another participant, with elevated calcitonin level (23.5 ng / l) before liraglutide administration, a subsequent thyroidectomy revealed an incidental thyroid neoplasm (1-mm papillary microcarcinoma) (supplementary table 4). aes during run - in and randomized period with an incidence 5% by system organ class and preferred term and summary of saes participants not reaching glycemic target had a 7.6% mean a1c at completion of the run - in period. they were then randomized to add insulin detemir to metformin + liraglutide (n = 162) or to continue unchanged metformin + liraglutide (randomized control subjects, n = 161). addition of insulin detemir further reduced a1c compared with continued metformin + liraglutide (0.51% [n = 162 ] vs. + 0.02% [n = 157 ], respectively ; estimated treatment difference [etd ] 0.52 [95% ci 0.68 to 0.36 ] ; p < 0.0001), resulting in a1c values of 7.1 and 7.5%, respectively, at week 26 (fig. 2a and supplementary tables 5 and 6), and meeting the trial s primary end point. accordingly, mmol / l) than control group (0.4 mmol / l ; etd 1.7 [2.2 to 1.3 ] ; p < 0.0001) (fig. 2c). after a mean 3.5-kg weight loss during run - in, both groups experienced further modest weight reduction over the next 26 weeks : 0.16 kg with detemir and 0.95 kg without (etd 0.79 [0.081.49 ] ; p = 0.03) (fig. compared with the control group, more than twice as many in the insulin detemir group achieved < 7% a1c (17 vs. 43%, respectively ; p < 0.0001), and three times as many achieved 6.5% (6 vs. 18%, respectively ; p = 0.0016 ; logistic regression estimates) (supplementary fig. 2). similarly, the proportion reaching the composite end point (< 7% a1c with no weight gain and no hypoglycemia) after 26 weeks was significantly greater in the insulin detemir (21%) than the control group (9% ; p = 0.0016 ; logistic regression estimates) 2). excluding one outlier in the randomized control group with 25 minor hypoglycemic episodes, minor hypoglycemia rates were 0.286 and 0.029 events per participant - year for insulin detemir and control groups, respectively (p = 0.004) (supplementary table 2). self - measured plasma glucose levels decreased in both groups, with significantly greater reductions in postprandial values in the insulin detemir versus control group (fig. etds ranged from 0.60 mmol / l (95% ci 1.12 to 0.08 ; p = 0.02) to 1.12 mmol / l (95% ci 1.72 to 0.51 ; p = 0.0003). mean prescribed insulin detemir doses increased from 10 units / day to 39.5 units / day (0.41 units / kg), whereas mean self - measured fpg decreased from 7.9 to 6.2 mmol / l (fig. prescribed insulin detemir doses were consistent with algorithm recommendations, indicating good overall adherence to the titration algorithm. there were no significant differences between groups in changes from randomization for serum lipids, except for free fatty acids (insulin detemir group, 0.11 mmol / l ; control group, 0.03 mmol / l ; etd 0.08 [95% ci 0.13 to 0.03 ] ; p = 0.002) (for more information regarding changes in lipid levels, see supplementary table 7). a total of 67% (109 of 163) and 59% (93 of 159) of participants had one or more aes, and 5.5% (9 participants ; 13 events) and 3.8% (6 participants ; 8 events) had serious aes (saes), in the insulin detemir and control groups, respectively (table 2). no pattern or clustering of saes was observed, with most being considered unlikely to be related to treatment (supplementary table 8). although more aes of increased lipase were reported with insulin detemir, a minor increase in the median serum lipase levels (below the upper limit of normal) was observed across all groups, without apparent treatment differences (supplementary table 9). one case of chronic pancreatitis occurred (control group) (supplementary table 4). the 498 participants achieving the < 7% target with metformin + liraglutide at the end of run - in were followed for another 26 weeks. this group experienced a mean 1.3% a1c reduction by the end of run - in, and 1.1% overall from start of run - in to week 26 (from 7.7% at run - in start to 6.6% at study end). the group also experienced overall reductions from start of run - in to week 26 in fpg of 2.1 mmol / l (from 9.2 mmol / l at run - in start to 7.2 mmol / l) and weight of 4.8 kg (from 99.0 kg at run - in start to 94.6 kg) (fig. 2), and improved seven - point blood glucose profiles (completers) (fig. aes for the 38-week period are summarized in supplementary table 10. in the observational group, 81% (402 of 499) of participants had aes and 7.8% (39 of 499) experienced 49 saes, with 45 considered unlikely to be related to study drug and without obvious pattern (supplementary table 8). no major hypoglycemic episodes occurred, whereas 9.0% (45 of 499) of participants experienced minor hypoglycemia (0.211 events per participant - year). at 26 weeks, systolic blood pressure was reduced from run - in start by 3.13 mmhg in the control group, 1.65 mmhg in the insulin detemir group, and 3.33 mmhg in the observational group (supplementary table 11). heart rate was increased from run - in start to 26 weeks in all treatment groups : by 3.62 beats per minute (bpm) in the control group, 3.87 bpm in the insulin detemir group, and 3.64 bpm in the observational group (supplementary table 12). this large, prospective clinical study provides support for a new sequential treatment paradigm in type 2 diabetes, that is, adding a glp-1ra (liraglutide) to metformin followed (if necessary) by a basal insulin (insulin detemir) to achieve and maintain glycemic targets. with 12 weeks of liraglutide + metformin for the 39% of completers not initially achieving target, adding insulin detemir provided clinically relevant further reductions of mean a1c from 7.6 to 7.1%. a total of 43% of insulin detemir recipients then achieved the < 7% a1c target, compared with 17% continuing treatment with metformin + liraglutide. in the observational group, all of whom achieved a1c < 7% after the 12-week run - in, 74% remained at target after a further 26 weeks treatment. translated into clinical practice, and extrapolating from all patients who completed run - in, sequential intensification enabled approximately three - quarters of patients to achieve an a1c < 7%. importantly, overall, the hypoglycemia risk was very low, and insulin detemir recipients maintained the significant weight reductions achieved during liraglutide run - in rather than gaining weight as typically occurs with insulin. however, after metformin, commonly used oral agents such as sulfonylureas and thiazolidinediones carry side effects, particularly hypoglycemia and/or weight gain ; the exceptions are dipeptidyl peptidase-4 inhibitors and -glucosidase inhibitors, which are weight - neutral but appear to show less glucose - lowering activity than other agents (1,11). because glp-1ras provide greater glycemic efficacy and weight loss (6), they may be more beneficial than these oral agents after metformin, but less acceptable in some patients because of gastrointestinal side effects and the injection barrier. insulin initiation also usually causes weight gain and an increased hypoglycemia risk (1,12). in this study, however, the insulin detemir group maintained the initial weight loss achieved by adding liraglutide to metformin. subsequent intensification with insulin detemir allowed 43% of the group to reach the glycemic target. it is conceivable that more aggressive insulin titration, giving higher insulin doses, would allow even more patients to reach a1c target, but perhaps at the expense of more hypoglycemia. the incidence of confirmed minor hypoglycemia with insulin detemir in our study, 0.286 events per participant - year, was considerably lower than the 1.33.67 events per participant - year in previous trials with insulin detemir added to oral agents (13,14). although withdrawing sulfonylureas (as in the run - in) is associated with decreased hypoglycemia risks (3.2 vs. 1.6 events per participant - year, despite an increased insulin requirement) (15), initiating liraglutide before detemir may further reduce the hypoglycemia risk, perhaps by modulating endogenous glucose - dependent insulin secretion and glucagon secretion as well as body weight, thereby lowering exogenous insulin requirements. it remains unknown whether an association exists between incretin - based therapies and pancreatitis (16), but acute pancreatitis is known to be about three times more common in patients with type 2 diabetes than in the general population (17). in the present trial, two cases of pancreatitis were reported (one acute and one chronic) and neither case of pancreatitis was preceded by elevated lipase levels. reports of pancreatitis were similarly uncommon in other liraglutide studies, although imbalances in pancreatitis are noted for liraglutide and other incretin - based therapies (16,18). an initial small increase in median serum lipase below the upper limit of normal was observed across groups in the current study, and substantial fluctuations occurred over time. interpreting these changes is difficult in the absence of an active comparator or a placebo group (i.e., a group not receiving liraglutide). elevated lipase (or amylase) levels by themselves are insufficient to make a diagnosis of pancreatitis without the presence of abdominal pain and ideally confirmation with imaging studies. most commonly, no gastrointestinal symptoms were associated with fluctuations in lipase observed during this trial. we found no other published, prospective, controlled trials studying insulin added to a glp-1ra in type 2 diabetes. a few previous studies have investigated the alternative intensification sequence, adding a glp-1ra (specifically, twice - daily exenatide) to insulin (19,2022). in the only randomized, controlled trial to date, patients with more advanced disease at baseline (compared with the current study) already receiving 0.5 units / kg of insulin glargine were randomized to either add - on exenatide or continuation of basal insulin only (19). the insulin doses were optimized in both groups by further rigorous titration postrandomization. in this setting, add - on exenatide with insulin optimization was associated with a 1.7% reduction in a1c levels (from a baseline of 8.36.7% vs. 1.0% a1c reduction with basal insulin optimization only), modest weight loss, and no significant increase in risk of minor hypoglycemia. in other nonrandomized studies, a1c reductions ranged from 0.0 to 0.9% (2022). in the current study, however, adding a glp-1ra before basal insulin was also effective, offering significantly improved glycemic control, substantial weight loss, and a very low hypoglycemia rate. this intensification sequence may therefore be preferable provided that potential gastrointestinal aes can be accepted initially. it may also be preferable to initiate with a longer - acting once - daily glp-1ra, such as liraglutide, rather than a twice - daily shorter - acting glp-1ra to facilitate better compliance. more participants may have reached glycemic targets with a lower fpg target for insulin titration (23). as some participants randomized to continued liraglutide + metformin subsequently reached target without dose adjustments, it is also conceivable that fewer patients would have needed insulin with a longer run - in period. first, the study used the higher (1.8 mg) of the two liraglutide doses. the higher dose may have favored efficacy outcomes and weight loss but adversely affected tolerability (11,24). potentially, fewer patients may have withdrawn early due to gastrointestinal aes if they had been permitted to return to the 1.2-mg dose or if upward titration was conducted more slowly. second, one - third of participants were taking a sulfonylurea before the study ; this was discontinued at the start of run - in and may have negatively influenced improvements in glycemic control but favored weight loss. however, neither factor should have affected the 26-week randomized - group comparisons. moreover, discontinuation of sulfonylureas increases the trial s translational validity because many physicians add an injectable therapy only after failure of more than one oral agent, and then tend to withdraw sulfonylureas. we recognize that the randomized control group did not have a masked placebo or active comparator ; this was mainly due to logistic limitations with insulin comparators. however, we also chose not to include an active comparator to retain the focus on the efficacy and safety of adding a basal insulin to a glp-1ra in combination with metformin. it is possible that some participants were disappointed with their treatment allocation and withdrew, an effect that might not have occurred with an active comparator. it would be informative, however, if future trials adhered to the comparative effectiveness concept (25). future studies might also be of a longer duration and consider the overall costs of diabetes care (particularly the balance between the higher prices of new medications versus any potential for reduced costs associated with diabetes complications and less self - monitoring of blood glucose). a 26-week extension to the current study has been undertaken, primarily to assess longer - term treatment safety. in conclusion, in type 2 diabetes with inadequate glycemic control on metformin sulfonylurea, the addition of liraglutide was effective and safe, enabling the majority of participants to reach a1c levels < 7%, with sustained weight loss and low hypoglycemia risk. for those not reaching glycemic targets, intensification with insulin detemir provided clinically relevant additional glycemic control, sustaining previous weight loss and the very low hypoglycemia risk. | objectivewe evaluated the addition of liraglutide to metformin in type 2 diabetes followed by intensification with basal insulin (detemir) if glycated hemoglobin (a1c) 7%.research design and methodsin 988 participants from north america and europe uncontrolled on metformin sulfonylurea, sulfonylurea was discontinued and liraglutide 1.8 mg / day added for 12 weeks (run - in). subsequently, those with a1c 7% were randomized 1:1 to 26 weeks open - label addition of insulin detemir to metformin + liraglutide (n = 162) or continuation without insulin detemir (n = 161). patients achieving a1c < 7% continued unchanged treatment (observational arm). the primary end point was a1c change between randomized groups.resultsof 821 participants completing the run - in, 61% (n = 498) achieved a1c < 7% (mean change 1.3% from 7.7% at start), whereas 39% (n = 323) did not (0.6% from 8.3% at start). during run - in, 167 of 988 (17%) withdrew ; 46% of these due to gastrointestinal adverse events. at week 26, a1c decreased further, by 0.5% (from 7.6% at randomization) with insulin detemir (n = 162) versus 0.02% increase without insulin detemir (n = 157) to 7.1 and 7.5%, respectively (estimated treatment difference 0.52 [95% ci 0.68 to 0.36 ] ; p < 0.0001). forty - three percent of participants with insulin detemir versus 17% without reached a1c < 7%. mean weight decreased by 3.5 kg during run - in, then by 0.16 kg with insulin detemir or 0.95 kg without insulin detemir. in the randomized phase, no major hypoglycemia occurred and minor hypoglycemia rates were 0.286 and 0.029 events per participant - year with and without insulin detemir (9.2 vs. 1.3%).conclusionssupplementation of metformin with liraglutide and then insulin detemir was well tolerated in the majority of patients, with good glycemic control, sustained weight loss, and very low hypoglycemia rates. |
patellofemoral osteoarthritis (pfoa) commonly occurs among middle - aged and elderly people, especially among asian women. pathogenically, lower limb alignment abnormalities will result in wear and tear on cartilage in the patellar / groove joint surface, subchondral sclerosis, and osteophytosis. patellofemoral osteoarthritis is a common cause of anterior knee pain and severely reduces the quality of life. in our hospital, we treated 156 pfoa patients using arthroscopic knee joint debridement, patelloplasty, circumpatellar denervation, and release of the lateral patellar retinaculum. a total of 156 pfoa patients (62 males, 94 females ; ages 45 - 81 years, mean 66 years) were involved in this study. pfoa occurred on the left side in 73 patients and on the right side in 83 patients. the clinical manifestations included recurrent swelling and pain in the knee joint ; aggravated pain upon ascending / descending stairs, squatting down, or standing up ; positive patellar grinding tests ; pain mainly located at patellar edges ; varying degrees of quadriceps femoris atrophy ; and a sense of joint friction during activities. knee - joint x - rays showed that the space between the patellofemoral joint was narrowed, and osteophytosis was present. patellar axial slices showed that the patellofemoral joints degenerated, the space between patellofemoral joints was narrow, and the patella was inclined outwards. t2-weight and three - dimensional - fat - suppressed spoiled gradient recalled echo sequence (3d - fs - spgr) cartilage - sequence magnetic resonance imaging (mri) showed that the cartilage on the patella and femoral groove joint surface had degenerated or was lost and was mainly accompanied by slight degeneration in the menisci and tibial joints [figure 1 ]. three - dimensional fat - suppressed spoiled gradient recalled echo sequence cartilage sequence magnetic resonance imaging shows that the cartilage on the patella and groove surface degenerated (red arrow), and this degeneration was frequently complicated by slight degeneration in the menisci and tibial joints. the inclusion criteria were as follows : patients with pfoa, mainly from patella wear and osteophytosis only ; intact femorotibial joints, meniscus, cruciate ligaments, and collateral ligaments ; and normal lower - limb alignment and normal bending and stretching abilities. all procedures in this group were performed by one highly - qualified orthopedic surgeon. under local anesthesia, the surgical sites were disinfected and draped according to standard procedures, and the arthroscopy was approached from inside and outside of the knee eyes. comprehensive detection was first conducted to assess the patellar trajectory and patellofemoral articular cartilage degeneration and to classify the cartilage defect. next, the hyperplastic synovium, medial and lateral compartments, and lesions in the intercondylar fossa were cleared. the lateral patellar retinaculum was released under radio frequency, and the circumpatella was denervated [figures 2 and 3 ]. under arthroscopy, the surgeon observed the patellar trajectory, the bone blockage and cartilage wound margins affecting patellofemoral joint activities, and the osteophytes present around the ground patella. axial patellar osteophytes were cleared, and the joint space increased. after awakening from anesthesia, the patients began isometric quadriceps training. patients began straight leg raising and knee flexion and extension training and started partial weight - bearing ambulation the day after surgery. the arthroscopic articular cartilage samples before and after surgery were classified and evaluated using lysholm and kujala scores. lysholm knee scoring is globally used for the comprehensive evaluation of patellofemoral joint disorders and includes 8 items : limp, locking, pain, support, instability, swelling, difficulty in ascending stairs, and restriction in squatting. kujala scoring is used for the evaluation of patellofemoral joints and covers 13 items : limp when walking, supporting weight, walking distance, symptoms occurring when ascending or descending stairs, squatting ability and symptoms, symptoms occurring when running or jumping, symptoms occurring when kneeling down for long periods, degree of knee joint pain, anterior knee swelling, accompanying abnormal patellar activity, occurrence of thigh muscle atrophy, and restriction upon knee joint bending. the above items were tested preoperatively and again during the last follow - up to evaluate the therapeutic effects and the improvement in knee joint functions after surgery. the quantitative data were expressed as mean standard deviation and tested with the paired t - test, with the significance level set at = 0.05. a total of 156 pfoa patients (62 males, 94 females ; ages 45 - 81 years, mean 66 years) were involved in this study. pfoa occurred on the left side in 73 patients and on the right side in 83 patients. the clinical manifestations included recurrent swelling and pain in the knee joint ; aggravated pain upon ascending / descending stairs, squatting down, or standing up ; positive patellar grinding tests ; pain mainly located at patellar edges ; varying degrees of quadriceps femoris atrophy ; and a sense of joint friction during activities. knee - joint x - rays showed that the space between the patellofemoral joint was narrowed, and osteophytosis was present. patellar axial slices showed that the patellofemoral joints degenerated, the space between patellofemoral joints was narrow, and the patella was inclined outwards. t2-weight and three - dimensional - fat - suppressed spoiled gradient recalled echo sequence (3d - fs - spgr) cartilage - sequence magnetic resonance imaging (mri) showed that the cartilage on the patella and femoral groove joint surface had degenerated or was lost and was mainly accompanied by slight degeneration in the menisci and tibial joints [figure 1 ]. three - dimensional fat - suppressed spoiled gradient recalled echo sequence cartilage sequence magnetic resonance imaging shows that the cartilage on the patella and groove surface degenerated (red arrow), and this degeneration was frequently complicated by slight degeneration in the menisci and tibial joints. the inclusion criteria were as follows : patients with pfoa, mainly from patella wear and osteophytosis only ; intact femorotibial joints, meniscus, cruciate ligaments, and collateral ligaments ; and normal lower - limb alignment and normal bending and stretching abilities. all procedures in this group were performed by one highly - qualified orthopedic surgeon. under local anesthesia, the surgical sites were disinfected and draped according to standard procedures, and the arthroscopy was approached from inside and outside of the knee eyes. comprehensive detection was first conducted to assess the patellar trajectory and patellofemoral articular cartilage degeneration and to classify the cartilage defect. next, the hyperplastic synovium, medial and lateral compartments, and lesions in the intercondylar fossa were cleared. the lateral patellar retinaculum was released under radio frequency, and the circumpatella was denervated [figures 2 and 3 ]. under arthroscopy, the surgeon observed the patellar trajectory, the bone blockage and cartilage wound margins affecting patellofemoral joint activities, and the osteophytes present around the ground patella. axial patellar osteophytes were cleared, and the joint space increased. after awakening from anesthesia, the patients began isometric quadriceps training. patients began straight leg raising and knee flexion and extension training and started partial weight - bearing ambulation the day after surgery. the arthroscopic articular cartilage samples before and after surgery were classified and evaluated using lysholm and kujala scores. lysholm knee scoring is globally used for the comprehensive evaluation of patellofemoral joint disorders and includes 8 items : limp, locking, pain, support, instability, swelling, difficulty in ascending stairs, and restriction in squatting. kujala scoring is used for the evaluation of patellofemoral joints and covers 13 items : limp when walking, supporting weight, walking distance, symptoms occurring when ascending or descending stairs, squatting ability and symptoms, symptoms occurring when running or jumping, symptoms occurring when kneeling down for long periods, degree of knee joint pain, anterior knee swelling, accompanying abnormal patellar activity, occurrence of thigh muscle atrophy, and restriction upon knee joint bending. the above items were tested preoperatively and again during the last follow - up to evaluate the therapeutic effects and the improvement in knee joint functions after surgery. the quantitative data were expressed as mean standard deviation and tested with the paired t - test, with the significance level set at = 0.05. seven of the 156 patients were missed, resulting in a follow - up rate of 95.5%. during 10 - 24 (18.8 3.5) months of follow - up, the incisions all healed well, and no recurrence, infection or nerve vascular injury occurred. after surgery, the average lysholm knee score improved from 73.29 4.48 to 80.93 4.21 [table 1 ], and the kujala score improved from 68.34 6.22 to 76.48 6.54 [table 2 ]. paired t - tests based on the patellofemoral articular cartilage degeneration classification, both scores were improved significantly among patients with cartilage defects i - iii, but not among patients with cartilage defect iv. the scores for each specific item (e.g. limp, locking, instability, pain, swelling, ascending and descending stairs, squatting) were improved significantly (paired t - test) [tables 3 and 4 ]. preoperative and postoperative lysholm scores preoperative and postoperative kujala scores comparison of pre- and post - operative lysholm score about cartilage damage grading comparison of pre- and post - operative kujala score about cartilage damage grading the patellofemoral joint, composed of the patella and the femur groove, is a major component of the extension apparatus of the knee. under normal gait, the patellofemoral joint bears 0.5- to 1-fold of the body weight. however, the weight - bearing is increased to 3- to 4-fold of body weight upon walking up and down stairs and is maximized to 8-fold of body weight upon high bending. this high stress causes wear and tear in the patellofemoral articular cartilage and thus accelerates its degeneration. anterior knee pain is mainly caused by an abnormal patellar trajectory (due to congenital deformity, injury or degeneration) or patellofemoral joint malalignment. patellar subluxation alters the contact surface of the patellofemoral joint and increases the pressure on the joint surface, which leads to abnormal stress imposed on the patella, structural destruction of the cartilage collagen fibers, and finally, cartilage wear, tear and degeneration. because the patellae are rich in nerve endings, exposure of the nerve endings below the cartilage will also induce anterior knee pain. the tension on the lateral patellar retinaculum will lead to pressure on the lateral surface of the patellofemoral joint and finally to degeneration of the articular cartilage. according to lin. study, the incidence rate of pfoa among people older than 50 years is 6.3% and is higher among females. the wear and tear on the patellofemoral joint is intensified by long - term rapid and forced bending and stretching in the knee joint, which are major causes of pfoa. non - surgical treatments include limitation of movement, pharmacologic symptom relief, and injection of hyaluronic acid into the articular cavity. as the condition progresses, however, the above treatments are unable to adequately relieve pain and/or symptoms. traditional surgical therapies include advancement of the tibial tuberosity, patellofemoralarthroplasty, and total knee replacement. however, invasiveness, frequent bleeding and surgical risks limit the application of these approaches. moreover, arthroplasty is unsuitable for young patients. local blocking of the patellofemoral joint was tested among patients whose femorotibial joint, meniscus, cruciate ligaments and collateral ligaments were all intact. these patients then underwent release of the lateral patellar retinaculum to relieve the high external patellofemoral pressure for circumpatellar denervation. the results proved that the pain - killing effects were significant with few complications, despite the presence of varying degrees of cartilage defects. circumpatellar nerves include the cutaneous nerves, the superior branch of the saphenous nerve, and the joint branch of the knee extensor muscle [figure 4 ]. the superior branch of the saphenous nerve (also called the patellar branch) passes through the internal superior border of the patella into the subcutaneous prepatellar area and is located in the prepatellar skin. the joint branch of the knee extensor muscle includes the interior, medial and lateral femoral muscular branches ; the knee joint muscular branch ; and the anterior branch of the obturator nerve. the interior femoral muscular branch originates from the obturator nerve or saphenous nerve and is divided into two branches after entering the joint capsule., each nerve passes through the joint capsule, is distributed in the articular synovial area, and forms the somatic nerve and autonomic nerve network in the joint. in one study, no significant difference between the experimental and control group was observed (via microscopy) in articular cartilage thickness after the denervation of rabbit knees. moreover, there was no effect on the articular cartilage tissue structure of the knee joint nerve branch, and the knee joint partial denervation therapy was determined to be feasible. therefore, in tka and arthroscopic debridement, through synovectomy, articular branch of the patella peripheral denervation, to reduce the patellofemoral joint pain has reasonable mechanism of anatomy. the treatment of patellofemoral arthritis includes many surgical procedures, such as arthroscopic debridement, drilling or microfracture surgery, lateral retinaculum release, tibial tuberosity advancement, patella thin cut surgery, patellar resection, patellofemoralarthroplasty, and tka, many of which can be combined. arthroscopy and drilling or microfracture surgery may have an effect on mild to moderate cartilage damage, but the long - term efficacy remains unclear. simple lateral retinaculum release is only appropriate for patella displacement or tilt ; in previous studies, the force line changes were effective, but the results were controversial. the extensor force line was relatively normal in appropriate transposition within the anterior tibial tuberosity. there are reports that there is a significant pain relief effect of patella thin cut surgery for pure pfoa. however, this approach is not recommended for severe abrasions or when the patella thickness is < 20 mm. patellar resection may lead to quadriceps weakness, reducing the range of motion and leaving the femoral condyle vulnerable to trauma and without enough protection. total knee arthroplasty is a good choice for older patients, cases of severe functional limitations or bilateral knee involvement and for patients who perform mild physical labor. however, in relatively young patients or in very physically active pfoa patients, tka is not the best choice. the group of patients who received outpatient treatment to limit their activity and who received oral nsaids, glucosamine and intra - articular injections of sodium hyaluronate for more than 3 months experienced less - than - ideal relief. the 3d - fs - spgr sequence is recognized as one of the best academic cartilage mri sequences. this technique can show transparent cartilage clearly and can accurately locate not only large cartilage defects but also small superficial cartilage wear. spgr increases the contrast of articular cartilage and subchondral bone to improve the signal to noise ratio of the cartilage image, allowing the cartilage to be displayed more clearly. normal articular cartilage in the 3d - fs - spgr sequence demonstrates a significantly high signal, and in the most areas of joint cartilage, delamination can be observed. thin line, volume scanning and 3d reconstruction, and quantitative measurement of the thickness and volume of cartilage can also be performed to identify small lesions in the joint. the 3d - fs - spgr sequence has high sensitivity and specificity for knee articular cartilage degeneration that is consistent with arthroscopy. based on these findings, we can roughly judge the degeneration of articular cartilage by preoperative mri. after arthroscopic surgery in mild to moderate osteoarthritis and i - iii grade cartilage degeneration, knee pain relief was clear and the majority of joint function improved significantly. the aims of treatment of pfoa are to recover the inosculation of the patellofemoral joint, balance the soft tissues, and eliminate the primary causes for patellofemoral joint pain. patelloplasty is able to lower the patellar lateral pressure, correct the patellar motion trajectory, improve bad contact on patellofemoral joint surfaces, prevent wear and tear on the patellofemoral joint, and delay degeneration. radiofrequency burning with denervation is able to clear away a portion of the circumpatellar nerves, reduce the nerve conduction of pain, and relieve anterior knee pain. with the above treatments, we eliminated the biomechanical factors affecting knee joint activities and blocked the vicious circle of degeneration and injury. moreover, the articular cavity was washed with enough saline water to fully eliminate the worn areas and inflammatory factors and to alleviate inflammatory reactions, which were the objectives of treatment. this technique uses conventional arthroscopic electrical cauterization of peripatellar synovial tissue, partial removal of the peripheral nerve with patella osteophyte drill grinding, and grinding of the hyperplasia. this operation can remove diseased tissue while maximizing preservation of normal cartilage and synovial hyperplasia, clean up around the patella, and improve patellofemoral involution relations. the operation reduces inflammatory substances caused by the friction of the patellofemoral joint hyperplasia, thereby reducing the pain. the patella is composed of different bundle branches, but peripheral nerve distributions overlap. therefore, even if some denervation exists, it will not completely block the patellar plexus nerve, preventing sensory loss in the patellar skin. this procedure of cutting the patellar plexus nerve around the patellar cartilage does not damage the patella in front of the tissue. the main patellar vascular holes are on the front area of the patella and hence it will not result in patellar fracture, necrosis or other complications., through large randomized controlled studies, found that there was no difference between arthroscopic surgery and control subjects after treatment for osteoarthritis of the knee. thus, they concluded that arthroscopic surgery is just a placebo treatment for the disease. while this conclusion about arthroscopic techniques has a certain reference value, it was published more than 10 years ago, so it does not represent the current state of emerging technologies and new perspectives. the technique described here flushes the inflammatory factors to relieve inflammation, removes the source of patellofemoral malalignment osteophytes, and denervates nerve endings ; although it can not reverse the process of osteoarthritis, this approach was able to relieve pain and delay joint replacement surgery. however, this procedure was not very effective for patients with a low degree of cartilage defect and thus should not be their first treatment choice. the follow - up results show that among patients with degree i - iii cartilage degeneration, both lysholm and kujala scores improved significantly. in conclusion, the therapeutic effects for the treatment of pfoa with arthroscopic patelloplasty and circumpatellar denervation are closely associated with the degree of patellofemoral articular cartilage degeneration. this procedure is a minimally invasive procedure that lies between conservative treatment and joint replacement surgery. moreover, this approach is accepted by patients who do not obtain satisfactory results after conservative treatment and can not afford the financial cost of joint replacement. this technique, as a therapeutic method, is suitable for mild - to - moderate patellofemoral arthritis, relieves pain to a certain extent, improves quality of life, delays joint replacement, and delays the progression of pfoa. however, the main limitation of this procedure is that it is difficult to obtain a better curative effect for patients with more severe articular cartilage degeneration and poor knee function. the long - term effects of this procedure will require further clinical observation and research. the patellofemoral joint, composed of the patella and the femur groove, is a major component of the extension apparatus of the knee. under normal gait, the patellofemoral joint bears 0.5- to 1-fold of the body weight. however, the weight - bearing is increased to 3- to 4-fold of body weight upon walking up and down stairs and is maximized to 8-fold of body weight upon high bending. this high stress causes wear and tear in the patellofemoral articular cartilage and thus accelerates its degeneration. anterior knee pain is mainly caused by an abnormal patellar trajectory (due to congenital deformity, injury or degeneration) or patellofemoral joint malalignment. patellar subluxation alters the contact surface of the patellofemoral joint and increases the pressure on the joint surface, which leads to abnormal stress imposed on the patella, structural destruction of the cartilage collagen fibers, and finally, cartilage wear, tear and degeneration. because the patellae are rich in nerve endings, exposure of the nerve endings below the cartilage will also induce anterior knee pain. the tension on the lateral patellar retinaculum will lead to pressure on the lateral surface of the patellofemoral joint and finally to degeneration of the articular cartilage. according to lin. study, the incidence rate of pfoa among people older than 50 years is 6.3% and is higher among females. the wear and tear on the patellofemoral joint is intensified by long - term rapid and forced bending and stretching in the knee joint, which are major causes of pfoa. non - surgical treatments include limitation of movement, pharmacologic symptom relief, and injection of hyaluronic acid into the articular cavity. as the condition progresses, however, the above treatments are unable to adequately relieve pain and/or symptoms. traditional surgical therapies include advancement of the tibial tuberosity, patellofemoralarthroplasty, and total knee replacement. however, invasiveness, frequent bleeding and surgical risks limit the application of these approaches. moreover, arthroplasty is unsuitable for young patients. local blocking of the patellofemoral joint was tested among patients whose femorotibial joint, meniscus, cruciate ligaments and collateral ligaments were all intact. these patients then underwent release of the lateral patellar retinaculum to relieve the high external patellofemoral pressure for circumpatellar denervation. the results proved that the pain - killing effects were significant with few complications, despite the presence of varying degrees of cartilage defects. circumpatellar nerves include the cutaneous nerves, the superior branch of the saphenous nerve, and the joint branch of the knee extensor muscle [figure 4 ]. the superior branch of the saphenous nerve (also called the patellar branch) passes through the internal superior border of the patella into the subcutaneous prepatellar area and is located in the prepatellar skin. the joint branch of the knee extensor muscle includes the interior, medial and lateral femoral muscular branches ; the knee joint muscular branch ; and the anterior branch of the obturator nerve. the interior femoral muscular branch originates from the obturator nerve or saphenous nerve and is divided into two branches after entering the joint capsule., each nerve passes through the joint capsule, is distributed in the articular synovial area, and forms the somatic nerve and autonomic nerve network in the joint. in one study, no significant difference between the experimental and control group was observed (via microscopy) in articular cartilage thickness after the denervation of rabbit knees. moreover, there was no effect on the articular cartilage tissue structure of the knee joint nerve branch, and the knee joint partial denervation therapy was determined to be feasible. therefore, in tka and arthroscopic debridement, through synovectomy, articular branch of the patella peripheral denervation, to reduce the patellofemoral joint pain has reasonable mechanism of anatomy. the treatment of patellofemoral arthritis includes many surgical procedures, such as arthroscopic debridement, drilling or microfracture surgery, lateral retinaculum release, tibial tuberosity advancement, patella thin cut surgery, patellar resection, patellofemoralarthroplasty, and tka, many of which can be combined. arthroscopy and drilling or microfracture surgery may have an effect on mild to moderate cartilage damage, but the long - term efficacy remains unclear. simple lateral retinaculum release is only appropriate for patella displacement or tilt ; in previous studies, the force line changes were effective, but the results were controversial. the extensor force line was relatively normal in appropriate transposition within the anterior tibial tuberosity. there are reports that there is a significant pain relief effect of patella thin cut surgery for pure pfoa. however, this approach is not recommended for severe abrasions or when the patella thickness is < 20 mm. patellar resection may lead to quadriceps weakness, reducing the range of motion and leaving the femoral condyle vulnerable to trauma and without enough protection. total knee arthroplasty is a good choice for older patients, cases of severe functional limitations or bilateral knee involvement and for patients who perform mild physical labor. however, in relatively young patients or in very physically active pfoa patients, tka is not the best choice. the group of patients who received outpatient treatment to limit their activity and who received oral nsaids, glucosamine and intra - articular injections of sodium hyaluronate for more than 3 months experienced less - than - ideal relief. the 3d - fs - spgr sequence is recognized as one of the best academic cartilage mri sequences. this technique can show transparent cartilage clearly and can accurately locate not only large cartilage defects but also small superficial cartilage wear. spgr increases the contrast of articular cartilage and subchondral bone to improve the signal to noise ratio of the cartilage image, allowing the cartilage to be displayed more clearly. normal articular cartilage in the 3d - fs - spgr sequence demonstrates a significantly high signal, and in the most areas of joint cartilage, delamination can be observed. thin line, volume scanning and 3d reconstruction, and quantitative measurement of the thickness and volume of cartilage can also be performed to identify small lesions in the joint. the 3d - fs - spgr sequence has high sensitivity and specificity for knee articular cartilage degeneration that is consistent with arthroscopy. based on these findings, we can roughly judge the degeneration of articular cartilage by preoperative mri. after arthroscopic surgery in mild to moderate osteoarthritis and i - iii grade cartilage degeneration, knee pain relief was clear and the majority of joint function improved significantly. the aims of treatment of pfoa are to recover the inosculation of the patellofemoral joint, balance the soft tissues, and eliminate the primary causes for patellofemoral joint pain. patelloplasty is able to lower the patellar lateral pressure, correct the patellar motion trajectory, improve bad contact on patellofemoral joint surfaces, prevent wear and tear on the patellofemoral joint, and delay degeneration. radiofrequency burning with denervation is able to clear away a portion of the circumpatellar nerves, reduce the nerve conduction of pain, and relieve anterior knee pain. with the above treatments, we eliminated the biomechanical factors affecting knee joint activities and blocked the vicious circle of degeneration and injury. moreover, the articular cavity was washed with enough saline water to fully eliminate the worn areas and inflammatory factors and to alleviate inflammatory reactions, which were the objectives of treatment. this technique uses conventional arthroscopic electrical cauterization of peripatellar synovial tissue, partial removal of the peripheral nerve with patella osteophyte drill grinding, and grinding of the hyperplasia. this operation can remove diseased tissue while maximizing preservation of normal cartilage and synovial hyperplasia, clean up around the patella, and improve patellofemoral involution relations. the operation reduces inflammatory substances caused by the friction of the patellofemoral joint hyperplasia, thereby reducing the pain. therefore, even if some denervation exists, it will not completely block the patellar plexus nerve, preventing sensory loss in the patellar skin. this procedure of cutting the patellar plexus nerve around the patellar cartilage does not damage the patella in front of the tissue. the main patellar vascular holes are on the front area of the patella and hence it will not result in patellar fracture, necrosis or other complications., through large randomized controlled studies, found that there was no difference between arthroscopic surgery and control subjects after treatment for osteoarthritis of the knee. thus, they concluded that arthroscopic surgery is just a placebo treatment for the disease. while this conclusion about arthroscopic techniques has a certain reference value, it was published more than 10 years ago, so it does not represent the current state of emerging technologies and new perspectives. the technique described here flushes the inflammatory factors to relieve inflammation, removes the source of patellofemoral malalignment osteophytes, and denervates nerve endings ; although it can not reverse the process of osteoarthritis, this approach was able to relieve pain and delay joint replacement surgery. however, this procedure was not very effective for patients with a low degree of cartilage defect and thus should not be their first treatment choice. the follow - up results show that among patients with degree i - iii cartilage degeneration, both lysholm and kujala scores improved significantly. in conclusion, the therapeutic effects for the treatment of pfoa with arthroscopic patelloplasty and circumpatellar denervation are closely associated with the degree of patellofemoral articular cartilage degeneration. this procedure is a minimally invasive procedure that lies between conservative treatment and joint replacement surgery. moreover, this approach is accepted by patients who do not obtain satisfactory results after conservative treatment and can not afford the financial cost of joint replacement. this technique, as a therapeutic method, is suitable for mild - to - moderate patellofemoral arthritis, relieves pain to a certain extent, improves quality of life, delays joint replacement, and delays the progression of pfoa. however, the main limitation of this procedure is that it is difficult to obtain a better curative effect for patients with more severe articular cartilage degeneration and poor knee function. the long - term effects of this procedure will require further clinical observation and research. | background : patellofemoral osteoarthritis commonly occurs in older people, often resulting in anterior knee pain and severely reduced quality of life. the aim was to examine the effectiveness of arthroscopic patelloplasty and circumpatellar denervation for the treatment of patellofemoral osteoarthritis (pfoa).methods : a total of 156 pfoa patients (62 males, 94 females ; ages 45 - 81 years, mean 66 years) treated in our department between september 2012 and march 2013 were involved in this study. clinical manifestations included recurrent swelling and pain in the knee joint and aggravated pain upon ascending / descending stairs, squatting down, or standing up. pfoa was treated with arthroscopic patelloplasty and circumpatellar denervation. the therapeutic effects before and after surgery were statistically evaluated using lysholm and kujala scores. the therapeutic effects were graded by classification of the degree of cartilage defect.results:a total of 149 cases were successfully followed up for 14.8 months, on average. the incisions healed well, and no complications occurred. after surgery, the average lysholm score improved from 73.29 to 80.93, and the average kujala score improved from 68.34 to 76.48. this procedure was highly effective for patients with cartilage defects i - iii but not for patients with cartilage defect iv.conclusions:for pfoa patients, this procedure is effective for significantly relieving anterior knee pain, improving knee joint function and quality of life, and deferring arthritic progression. |
the increasing number of patients with type 2 diabetes mellitus is a prominent health problem worldwide. incretin - based therapy is one of the promising new treatments for type 2 diabetes mellitus, and has recently become a first - line drug. although side effects do not often appear with this class of drug, several adverse events have been reported so far [1, 2 ]. here, the authors report a case of generalized drug - induced skin eruption with strong itching nearly 6 months after initiation of sitagliptin. a 66-year - old male with untreated type 2 diabetes mellitus was admitted to the authors hospital following the advice of the patient s daughter. the patient s hemoglobin a1c (hba1c) level had been 7.4% in a general health check - up 3 years before. one year prior to admission, the patient s fasting glucose had risen to 126 mg / dl and his hba1c level rose up to 8.6%. a diet and exercise regimen was introduced, and sitagliptin phosphate 50 mg and metformin 500 mg were started. two months later, the patient s hba1c level had improved to 7.0% and the patient continued on the medication, and diet and exercise therapy. six months later, a rash with a locus on the upper limb began to appear. the patient applied antihistamine ointment on the skin rash, which continued to spread gradually from chest to back, and abdomen to thigh (figs. 1a, 2a, 3a, b). in some areas of the back and chest, lichenification also appeared. the itching associated with the rash also worsened, interfering with sleep during the night. however, the rash was unchanged and pruritus gradually increased. since there is a possibility of skin malignancy in eczematous skin rashes lasting for a long period of time, four months after the eruption first appeared, and just before the skin biopsy, the authors stopped the dipeptidyl peptidase-4 (dpp-4), sitagliptin, to rule out the possibility of a drug reaction, although metformin was continued. itching caused by the rash the emergence of new rash ended, and the rash itself withered after 1 week. the spread of the rash gradually shrank and the skin lesions subsided, leaving pigmentation 1 month later (figs. 1b, 2b). although discontinuation of sitagliptin was significantly effective for the skin rash, a drug - induced lymphocyte stimulation test was negative for sitagliptin. nonspecific radioimmunosorbent test for immunoglobulin e was increased to 532 iu / ml, and the percentage of eosinophil was 7.4%. two months after cessation of sitagliptin, the skin eruption had subsided (figs. 1c, 2c) and oral steroid medication was stopped, but some small eczematous eruptions continued to appear intermittently.fig. 1chest just before discontinuation of sitagliptin (a), after 1 month (b), after 2 months (c)fig. 2back just before discontinuation of sitagliptin (a), after 1 month (b), after 2 months (c)fig. 3forearm (a) and thigh (b) just before discontinuation of sitagliptin chest just before discontinuation of sitagliptin (a), after 1 month (b), after 2 months (c) back just before discontinuation of sitagliptin (a), after 1 month (b), after 2 months (c) forearm (a) and thigh (b) just before discontinuation of sitagliptin sitagliptin was the first dpp-4 inhibitor approved by the us food and drug administration (fda) in october 2006, for the treatment of type 2 diabetes mellitus. of the spontaneous adverse event reports of hypersensitivity reactions (such as anaphylaxis, angioedema, and serious skin reactions), most have occurred within the first 3 months after initiation of the treatment, with many following the first dose. according to the uppsala monitoring centre (a world health organization collaborating center) causality assessment system, the category for the present case is certain, although the appearance of the adverse event occurred about 6 months after sitagliptin initiation. in the literature, skin rash induced by sitagliptin has so far been reported in only two cases, one of persistent edematous - plaque photosensitivity and another of bullous pemphigoid ; the former a cutaneous eruption induced by a photosensitive reaction to sitagliptin that appeared about 2 weeks after starting sitagliptin but continued for almost 2 years after cessation. in the present case, the eruption appeared almost 6 months after initiation of the drug and gradually subsided after the cessation, except for small itchy erythematous eruptions that continue to appear intermittently around the sun - exposed upper chest area. because sitagliptin, like all known photosensitizers, has a phenyl ring, carbonyl group, and an absorption spectrum showing three absorption peaks (199.9, 265.0, and 400.1 nm), its photosensitive mechanism could well be responsible for the itchy edematous plaque. while both the 199.0 and 265.0 nm wavelengths are within the uv - c spectrum, the 400.1 nm absorbance peak indicates that sitagliptin also absorbs uv - a - visible light. thus, sitagliptin could cause persistent photosensitive eruption after cessation of the drug even with protection from uv light by hapten formation with subcutaneous protein. in the present case, the distribution of skin rash differs from that of typical photosensitivity, of which there is no proof of involvement. although a skin biopsy was not done in this case, varied sizes of bullae were not observed throughout the course of the rash, which contraindicates bullous pemphigoid. although metformin was used throughout the affected period, the skin eruption occurred only during the use of sitagliptin. the reports of drug - induced rash for metformin are very few despite its long history of use. in the literature, only psoriasiform and leukocytoclastic vasculitis have been reported to be induced by metformin. more observation is required over a period of time to clarify use of this class of drug and also for the outcome of this case. in the present case, the initial generalized skin eruption may have been induced by an allergic reaction to sitagliptin. close attention should be paid to patients receiving this drug with a history of urticaria, and to the development of photosensitivity. | a generalized skin eruption with strong itching was induced by sitagliptin, a dipeptidyl peptidase-4 (dpp-4) inhibitor, in a patient almost 6 months after initiation of the drug. physical examination revealed a spread of skin rash from chest to back, and abdomen and thigh. discontinuation of the drug eliminated the skin rash immediately. the emergence of new rash ended, and the rash itself withered after 1 week. the spread of the rash gradually shrank and the skin lesions subsided, leaving pigmentation 1 month later. two months after cessation of sitagliptin, the skin eruption had subsided and oral steroid medication was stopped, but some small eczematous eruptions continued to appear intermittently. although a drug - induced lymphocyte stimulation test was negative for sitagliptin, nonspecific radioimmunosorbent test for immunoglobulin e was increased to 532 iu / ml, with a percentage of eosinophil of 7.4%. sitagliptin has a phenyl ring, carbonyl group, and an absorption spectrum showing three absorption peaks (199.9, 265.0, 400.1 nm), and its photosensitive mechanism could have been responsible for the itchy edematous plaque. in the present case, the initial generalized skin eruption may have been induced by an allergic reaction to sitagliptin. close attention should be paid to patients receiving this drug with a history of urticaria, and to the development of photosensitivity. |
toll - like receptors (tlrs) are type i transmembrane receptors that are expressed on the cell membrane and are critical for the induction of downstream signals during innate immune responses to bacterial components. tlr4 is expressed in many cells, including endothelial cells, keratinocytes, epithelial cells, macrophages, neutrophils, and dendritic cells [24 ]. previous evidences demonstrated that platelet tlr4 expression modulates lipopolysaccharide- (lps-) stimulated platelet aggregation and tumor necrosis factor - alpha (tnf-) production. in addition, circulating platelet counts decrease precipitously during sepsis and the degree of thrombocytopenia associates with the serious consequence of sepsis. furthermore, platelet counts decreased under sepsis because of well - established migration into the liver and lungs [79 ]. demonstrated that platelet tlr4 is essential for platelet migration into the lungs in mice with lps - induced sepsis. lps accelerates collagen- or thrombin - induced aggregation in platelets in in vitro study ; this acceleration is associated with expression of tlr4. it has been reported that the function of platelet tlr4 is to activate neutrophil extracellular traps in septic blood, and histones may promote the generation of thrombin via platelet tlr4. thus, scientists proposed that platelet tlr4 has important roles in platelet migration, adhesion, destruction, and attraction. although the evidence indicates that tlr4 not only regulates platelet migration and shape change but also indirectly affects their aggregation, it remains to be explored whether tlr4 expression directly affects platelet aggregation and blood coagulation. previous studies demonstrated that the level of tlr4 expression on cells is associated with the early outcome of patients undergoing major surgery. in 2002, dybdahl. demonstrated that open heart surgery induces an inflammatory response and the release of heat - shock protein 70 via tlr4 signaling recently, our group demonstrated that the level of tlr4 expression on monocytes is associated with early outcomes in coronary artery bypass graft (cabg) surgery patients. it remains unclear whether the platelets regulate both blood coagulation and systemic inflammation in surgery and the expression of tlr4 on platelets is affected by the type of cardiac surgery, which may be associated with a patient 's early outcome in hospital. cabg with conventional cardiopulmonary bypass (cpb) is widely used in cardiovascular surgery. although stopping the heart and temporarily replacing its function with the heart - lung machine has associated risks, conventional cpb permits surgeons to perform coronary revascularization on a still, bloodless heart. however, evidence suggests that platelet count, aggregation, and shape change significantly decreased after conventional cpb. platelet activation and platelet injury are well - recognized phenomena occurring after cardiac surgery with cpb that may contribute to pathological postoperative bleeding and systemic oxidative stress / inflammation. to control the systemic oxidative stress and inflammatory responses as well as decrease the occurrence of postoperative complications, cardiac surgeons have devoted their efforts to developing various surgical processes, such as the off - pump technique or beating - heart cpb technique for coronary surgery. although the previous literatures indicated that off - pump technique has become an established and feasible procedure and offers a great benefit in cabg patients [12, 1721 ], the other studies also hold contrary opinion [22, 23 ]. regardless of the technique of coronary surgery, clarifying the actual molecular mechanisms of impact of the platelet function is the only way to promote the patients ' outcomes. it is well known that calpain plays important roles in the physiological activation of platelets. calpain activation regulates snares (proteins involved in the degranulation of platelets) and serca-2 (an intracellular pump required for ca signaling in platelets). previous evidences demonstrated that cardiac surgery induces oxidative stress, and oxidative stress may inhibit calpain activity. based on our evidence, the calpain - myosin 9-rab7b axis is responsible for the regulation of tlr4 in activated platelets, which is involved in platelets function. therefore, we evaluated the platelet tlr4 expression in patients who underwent cabg surgery with conventional cpb or off - pump technique and analyzed the correlation between platelet calpain activation, tlr4 expression, and drainage loss in hospital. additionally, in order to confirm the critical role of tlr4 on platelets function, we analyzed the coagulation in c57bl/6 and c57bl/6-tlr mice. this study was approved by the ethics committee at tri - service general hospital. written informed consent was obtained from 23 patients undergoing elective cabg surgery. the patients were assigned to the off - pump technique and conventional cardiopulmonary bypass (cpb) groups. cpb and off - pump technique was used in 17 and 6 patients, respectively. patients would not be included if they experienced a decreased cardiac ejection fraction (low than 50%), had undergone cardiac surgery, had a history of cardiogenic shock, had used extracorporeal membrane oxygenation (ecmo), received an intra - aortic balloon pump (iabp), or placed on a ventilator before surgery. additionally, patients with chronic bronchitis, autoimmune diseases, cancer, asthma, or rheumatoid arthritis or who were receiving anti - inflammatory drugs administration were excluded. the blood pressure was monitored using an arterial catheter. upon discontinuation of the cpb circuit or completion of proximal anastomoses, the blood samples were collected at two time points : (1) preincision and (2) at the end of the operation. whole blood samples were collected from all patients at the indicated time points and analyzed immediately. fluorescein isothiocyanate- (fitc-) conjugated mouse anti - human cd41a antibodies (becton dickinson, san jose, ca, usa) and phycoerythrin- (pe-) conjugated monoclonal mouse anti - human tlr4 antibodies (clone : hta125 ; biolegend, san diego, ca, usa) were added to 50 l whole blood and incubated in the dark for 20 min. the cd41a - positive cells were separated and detected using a bd facscanto ii flow cytometer (bd biosciences, mountain view, ca, usa) with bd facsdiva software (becton dickinson immunocytometry systems, san jose, ca, usa). a total of 3 10 cd41a - positive cells were gated for the analysis of membrane tlr4 expression. western blot analysis was performed using 50 g samples of protein to evaluate calpain-1 expression. the protein was electrophoretically transferred to polyvinylidene difluoride membrane and then blocked with 5% milk in tris - buffered saline solution (20 mm tris - hcl ph 7.5, 138 mm nacl, and 0.2% np-40) containing 0.2% tween-20. the membranes were probed using monoclonal rabbit anti - human calpain antibody (clone : hpr3319 ; epitomics co., burlingame, ca, usa), incubated with horseradish peroxidase - conjugated anti - rabbit igg (amersham, arlington heights, il, usa), and developed using the enzyme - linked chemiluminescence detection reagents (millipore, bedford, mass. -actin was used as a loading control ; the monoclonal mouse anti - human -actin antibody (clone : actn05/c4) was obtained from genetex co. (irvine, ca, usa). six male c57bl / b6 mice were purchased from biolasco co., ltd., (yi - lan, taiwan). six male c57bl/6-tlr mice (a tlr4-knockout mouse homozygous for the defective lps - response deletion allele tlr4) were purchased from the jackson laboratory (jax, 003752, bar harbor, me, usa). this study was carried out in strict accordance with the recommendations in the guide for the care and use of laboratory animals of the national institutes of health (nih publication number 85 - 23, revised 1996). the protocol was approved by the committee on the ethics of animal experiments of the taipei medical university (permit number : lac-100 - 0056). all mice were kept in microisolator cages on a 12-h day / night cycle and fed a commercial mouse chow diet (scientific diet services, essex, uk) with water ad libitum. the blood samples for biochemical measurements were collected without sedation from the mandibular artery in sodium citrate - containing tubes and separated by centrifugation. whole blood was collected from the mice through cheek - pouch bleeds and anticoagulated with 3.8% sodium citrate. platelet - rich plasma (prp) was obtained from the collected blood by centrifugation at 280 g for 8 min. the prp was gently transferred to a fresh tube, and the centrifugation was repeated at 280 g for 4 min. the platelets were isolated by filtering the resulting prp through a sepharose 2b column (sigma - aldrich, st. the washed platelets were counted using an automated blood cell counter kx-21n (sysmex, kobe, japan). platelet aggregation was performed using the turbidimetric method with a chrono - log model 560-ca dual sample lumi - ionize calcium aggregometer (chrono - log, havertown, pa, usa). approximately 500 l of a washed platelet solution containing 3 10 platelets/l in ca - free tyrode 's buffer was added to a silicon - treated glass cuvette for each experiment. platelet aggregation was measured for 5 minutes following the addition of 0.1 u / ml thrombin. the percent aggregation was calculated using aggro / link software (chrono - log, havertown, pa, usa). all buffers were prewarmed before use and platelets were kept warm at 37c all along the study. in accordance with previous studies, two rotem analyses were performed within minutes after the sample was collected, as indicated by the manufacturer 's instructions (pentapharm, munich, germany). we performed both an extrinsically activated assay using recombinant tissue factor (extem) and an extrinsically activated test using recombinant tissue factor with cytochalasin d added (fibtem). the following parameters were measured using rotem : clotting time (ct, the time from the start of the assay to clot formation with an amplitude of 2 mm), clot formation time (cft, the time from the end of ct (amplitude of 2 mm) to a clot firmness of 20 mm), maximum clot firmness (mcf, the peak strength of the clot), and maximum clot elasticity (mce, which is commonly used to assess clot strength). the platelet component of clot strength was calculated using the following equation : mcfplatelet = mcfextem mcffibtem, mceplatelet = mceextem mcefibtem, and mce = (mcf 100)/100 mcf. statistical comparisons between groups were computed using student 's t - tests and one - way anova followed by the dunnett 's test. for all statistical evaluations, differences in data with p values of < 0.05 all analyses were performed using the spss 16 statistical package (spss inc., chicago, il, usa). the preoperative characteristics of the two groups were similar, including in age, body weight, height, hypertension, hypercholesterolemia, and peripheral vascular disease. the percentages of ef in the conventional cpb and off - pump technique groups were 59.7 9.2% and 63.5 8.3%, respectively. none of the patients in the off - pump group had diabetes mellitus or peripheral vascular disease. in addition, no patient who underwent elective cabg with conventional cpb had previously experienced stroke or myocardial infarction. for patients in the cpb group, the mean total cpb time was 119.1 12.4 min, the aortic clamping (ischemia) time was 65.6 5.2 min, and the minimal esophageal temperature was maintained at 26.1 0.4c. additionally, the patients in the conventional cpb group received 30476.2 1708.0 units of heparin. the patients who underwent the off - pump technique maintained a minimal esophageal temperature of 35.8 0.3c and were administered 28142.9 4532.6 units of heparin. there were no significant differences in the number of grafts or amount of heparin used between the two groups. the percentages of circulating lymphocytes, monocytes, basophils, and neutrophils were not significantly different between the conventional cpb and off - pump technique groups before surgery. the percentages of neutrophil numbers increased significantly in both the conventional cpb group (from a basal level of 60.9 9.2% to 85.9 3.6%) and the off - pump technique group (from a basal level of 64.7 8.0% to 86.2 4.3%). the number of lymphocytes decreased significantly after coronary surgery with conventional cpb (from a basal level of 28.3 9.2% to 7.5 3.2%, resp.) and with the off - pump technique (from a basal level of 26.1 7.7% to 6.8 2.7%, resp.). the eosinophils, basophils, and monocytes did not significantly differ between the two groups after surgery. biochemical analyses indicated that liver function (levels of glutamate oxaloacetate transaminase, ast, and glutamic pyruvic transaminase, alt), kidney function (levels of blood urea nitrogen, bun, and creatinine), and inflammation (level of c - reactive protein, crp) indices did not deteriorate after cardiac surgery. patients who underwent conventional cpb exhibited higher levels of troponin i after surgery, compared with the off - pump technique group. however, the mean value of creatine kinase - mb isoform (ck - mb) was not significantly different between the conventional cpb and off - pump technique groups. washed platelets were isolated from all patients. flow cytometry was performed to analyze the tlr4 expression, and western blot analysis was used to analyze the calpain activity. table 4 indicates that patients in the conventional cpb group possessed lower tlr4 expression (cpb : 68.48 5.64% of preincision versus off - pump technique : 89.0 4.8% of preincision, p < 0.05), less drainage loss (cpb : 68.5 5.6% of preincision versus off - pump technique : 89.0 4.8% of preincision, p < 0.001), and higher prbc transfusion volume (cpb : 5.5 0.5 units versus off - pump technique : 1.1 1.1 units, p = 0.001) compared with the off - pump technique group. the platelet transfusion volume, duration of icu stay, and duration of fever were not significantly different between the conventional cpb and off - pump technique groups after cabg surgery. according to our recent results, tlr4 expression on platelets is mediated by the activity of calpain. figure 1 shows the calpain activity in all patients before and after the cabg surgery was performed. in general, inactivated calpain appears as a 80 kda of single band ; in contrast, calpain has a higher mobility 78 kda band resulted from autolysis under activated situation, which is believed to be the more active form of calpain. before cabg surgery, all patients in both the off - pump technique and conventional cpb groups expressed active calpain. while undergoing cabg surgery, all patients in the off - pump technique group continued to express active calpain. in contrast, 76.47% of patients (patient numbers 1, 2, 3, 4, 5, 6, 7, 8, 10, 11, 13, 15, and 17) in the conventional cpb group expressed inactive calpain after cabg surgery. additionally, the ratio of platelets tlr4 expression after surgery was demonstrated in figure 1. combined with the data of tr4 expression and calpain expression (figure 1), the information shown in table 5 indicates that patients in the conventional cpb group with active calpain possessed higher levels of tlr4 on platelets, less drainage loss, lower platelet transfusion volumes, shorter icu stay durations, and shorter fever duration after cabg surgery (g1 versus g2, p < 0.05 were considered statistically significant). although the calpain remained in an active state, the amounts of platelet transfusion were reduced in the off - pump technique group compared with the conventional cpb group (g1 versus g3, p < 0.05, considered statistically significant). interestingly, compared with patients who underwent the off - pump technique, the patients possessed a lower level of tlr4, higher volumes of drainage loss, and prbc / platelet transfusion as well as longer icu stay duration and shorter fever duration in the conventional cpb group with inactive calpain (g2 versus g3, p < 0.05, considered statistically significant). these results indicate that in cabg surgery with either off - pump technique or conventional cpb, patients with higher level of tlr4 may experience better early outcomes (duration of icu stay and fever, volume of drainage loss, and prbc / platelet transfusion) in hospital than the patients with lower level of tlr4, which may be mediated by activation of calpain on platelets. a previous study demonstrated that platelet tlr4 modulates coagulation by recognizing extracellular histones that promote thrombin generation. additionally, tables 15 indicate that calpain and tlr4 expression in platelets are associated with patients ' drainage loss in cardiac surgery. therefore, we further explored whether the tlr4 on platelets is associated with coagulation in mice. the wild - type c57bl/6, c57bl/6-tlr, and c57bl/6-tlr mice were used in this study. the endogenous level of tlr4 expression in the mouse platelets was first measured using western blot analysis and flow cytometry (figure 2(a)). incubating wild - type c57bl/6 mouse platelets with 0.1 u / ml thrombin resulted in approximately 47.4 5.4% aggregation within 10 minutes, whereas treating platelets with pbs did not induce aggregation (figure 2(b)). interestingly, platelets from c57bl/6-tlr or c57bl/6-tlr mice had reduced aggregation abilities after thrombin stimulation compared with those from wild - type mice (28.1 3.7% for c57bl/6-tlr and 18.5 2.5% for c57bl/6-tlr). in recent years, rotem has been used to provide a comprehensive overview of the entire clotting process by measuring the coagulation function of platelets. an extrinsically activated assay using recombinant tissue factor (extem) indicated no significant differences in the coagulation time or clot formation time between c57bl/6, c57bl/6-tlr, and c57bl/6-tlr mice. the amplitude at 5 to 30 minutes and mcf were significantly lower in c57bl/6-tlr compared with c57bl/6 (table 6). an extrinsically activated test using recombinant tissue factor plus cytochalasin d (fibtem) demonstrated that c57bl/6-tlr mice have a lower coagulation time, lower amplitude at 15 to 30 minutes, and lower mcf than c57bl/6 mice (table 7). according to a previous report, mcf and mce are commonly used to assess the platelet component of clot strength. table 8 demonstrates that both c57bl/6-tlr and c57bl/6-tlr mice have significantly lower mcfs (48.80 3.27 mm and 48.50 3.00 mm, resp.) and mces (190.89 20.79 mm and 218.37 19.54 mm, resp.) than c57bl/6 mice (mcf : 58.80 4.67 mm ; mce : 290.85 10.99 mm). these results suggest that platelet tlr4 is associated with aggregation and clot strength in c57bl/6 mice. tlr4 plays important role in platelet migration, adhesion, destruction, and attraction. in 2005, andonegui. first determined that platelets express tlr4 on their surfaces and that this phenomenon is associated with the occurrence of thrombocytopenia, indicating that the tlr4-mediated signaling pathway is involved in the cellular function of platelets. additionally, platelets may respond to endotoxin and ensnare bacteria through tlr4 to activate neutrophil extracellular traps [11, 29 ], promote migration into the lung or liver [8, 10 ], and decrease the production of rantes, angiogenin, and pdgf - ab from platelets in severe septic blood. although previous investigators demonstrated that platelets regulate inflammation via tlr4 surface expression, few studies investigated the relationship between platelet tlr4 and coagulation. explored adp - induced heat shock protein (hsp) 27 secretion and phosphorylation from granules in platelets, which mediates platelet aggregation. moreover interestingly, lps did not increase human platelet aggregation in vitro ; nevertheless, lps accelerates the collagen / thrombin - stimulated aggregation of platelets. this mechanism was mediated by tlr4 expression on platelets, and the effect of lps on platelets was indirect. in addition to tlr4, platelets also express downstream components of the tlr4-related signaling pathway complex, including tlr4/md2 and myeloid differentiation primary response gene (myd)88. through the production of interleukin- (il-) 6, prostaglandin e2, and tumor necrosis factor (tnf)-, lps induces platelet aggregation mediated by tlr4/md2/myd88 complex formation, mitogen - activated protein kinases (mapks), nuclear factor - kappa b (nf-b) activation, and cgmp production [5, 7, 34 ]. although many reports speculated that tlr4 affects platelet aggregation and regulates platelet function, we are the first group to indicate that the calpain - myosin 9-rab7b axis is liable to the regulation of tlr4-containing -granule trafficking in thrombin - induced platelets. furthermore, we demonstrated the differences of platelet function in c57bl/6, c57bl/6-tlr, and c57bl/6-tlr mice in this text, indicating the critical roles of tlr4 in platelets. we speculate that the probable mechanisms of the impact of tlr4 on clot strength in animal experiments may be mediated by hsp27 or others, and we are currently investigating the cellular and molecular mechanisms involved in this phenomena. in clinic, patients who underwent cabg surgery with inactive calpain and lower platelet tlr4 expression experienced worse early outcomes in hospital than those with active calpain and higher platelet tlr4 expression. these results indicate that the levels of tlr4 and calpain play pivotal roles in platelets function. oxidative stress - mediated cytokines production was considered to be the main factor causing inflammation after cardiac surgery. the expression of many cytokines, including tnf-, il-6, and monocyte chemotactic protein- (mcp-) 1, increased during and after cpb. except for cytokine production, stimulations such as aortic - clamping ischemia, ischemia - reperfusion injury, blood cell attachment to the foreign surfaces of the oxygenator / cpb tube, and artificial surgical trauma may play important roles in postoperative inflammation ; therefore, off - pump bypass graft operation significantly reduces oxidative stress and inflammation. although clinicians still have differences of opinion on the advantages / disadvantages of the off - pump technique and conventional cpb for patients who undergo cardiac surgery [22, 23, 36, 37 ], at least, the patients in both the conventional cpb and off - pump groups had good early outcomes (little drainage loss, short icu stay, and fever durations) in hospital as long as they expressed the active form of calpain after cabg surgery rather than the inactive form of calpain. this indeed indicates that maintaining active calpain is an important factor in patient recovery after cardiac surgery. in contrast, the patients with active calpain in the conventional cpb group still required larger blood transfusion volumes than the patients in the off - pump technique group, which may result from the cessation of pumping blood cells. recently, we also undertook to distinguish the influences of foreign surface contamination by the cpb tube and oxygenator, surgical incisive trauma, and cardiac ischemia by comparing cytokine production and early outcome during conventional cpb technique and the off - pump technique in patients. however, cpb - associated immune suppression results from the changes in tlr4 capacity on monocytes and neutrophils. it is still remained to be elucidated that the causes result in tlr4 downregulation in platelets. during the process of cardiac surgery with cpb, mechanical force (pressure from rolling pump) therefore, the transfusion of prbc and fresh platelet is essential for the patients who are undergoing cpb. according to the results in table 5, patients with cpb really receipted more transfusion of prbc and platelet comparing to patients in off - pump technique group. interestingly, patients with activated calpain in cpb group had similar level of early outcomes and platelet tlr4 expression to the patients in off - pump technique group. in contrast, even though the patients with inactivated calpain in cpb group receipted more platelet and prbc transfusion, they also had worse early outcomes comparing to patients with activated calpain. therefore, we can not exclude the importance and effects of blood transfusion for patients with cardiac surgery in this study, and we still have the opinion that the calpain activation and tlr4 expression in platelets are associated with early outcomes. hyperglycemia and diabetes mellitus really induce oxidative stress which result in complex complications in many sickle situations. the major finding of the previous study is that diabetes mellitus is associated with the activation of calpain. however, the opposite evidence demonstrated that cardiac surgery induces oxidative stress, and oxidative stress may inhibit calpain activity. in our results, mellitus patients (patient numbers 3, 5, and 10) also have inactive form of calpain after cpb. although diabetes mellitus may be associated with patient 's postsurgical outcomes, we also speculate that diabetes mellitus may not be a factor in regulation of platelets calpain activity in cpb. calpain is responsible for platelet shape change, clotting, and aggregation, which are mediated by the activation of cytoskeleton proteins. previous report demonstrated calpain with the important roles in regulating cytoskeletal signaling in vwf - activated platelets. calpain also regulates the activation of the extracellular fibrinogen - binding function of iib3 and the platelet aggregation resulting in cleavage of integrin 3. platelet - derived growth factor may suppress oxidative stress induced calpain activation in neurons. presently, the causes of inactive calpain in the majority of patients (82.35%) treated with conventional cpb are unknown ; it is also unclear why 17.64% of the patients undergo calpain activation. there are many proteases with critical roles in the stability and assembly of cytoskeletal signaling complexes that may result in the phosphorylation of proteins, association of the receptor with the cytoskeleton, and a consequent increase in the calpain activity. whether the pressure force of pumping, aortic - clamping ischemia, ischemia - reperfusion injury, or attachment of the foreign cpb circuit during conventional cpb disrupts these normal conditions in platelets remains to be elucidated. through further studies, we expect that patients ' early outcomes may be improved and promoted by adjusting the activation of calpain in platelets after cardiac surgery with conventional cpb. our results highlight the important roles of tlr4 in blood coagulation and platelet function in clinic and in c57bl/6 mouse. of clinical relevance, we also explored novel roles for calpain and tlr4 in platelets, which are associated with patients ' early outcomes in cardiac surgery. these results also provide a basis for further controlling calpain activation and tlr4 expression as a therapeutic strategy to avoid coagulopathic and thrombocytic disorders after cardiac surgery. | human platelets express toll - like receptors (tlr) 4. however, the mechanism by which tlr4 directly affects platelet aggregation and blood coagulation remains to be explored. therefore, in this study, we evaluated the platelet tlr4 expression in patients who underwent cabg surgery ; we explored the correlation between platelet tlr4 expression and the early outcomes in hospital of patients. additionally, c57bl/6 and c57bl/6-tlrlps/ mice were used to explore the roles of platelet tlr4 in coagulation by platelet aggregometry and rotation thromboelastometry. in conclusion, our results highlight the important roles of tlr4 in blood coagulation and platelet function. of clinical relevance, we also explored novel roles for platelet tlr4 that are associated with early outcomes in cardiac surgery. |
ocular toxoplasmosis is a common inflammatory eye disease and a major cause of posterior uveitis worldwide. the importance of toxoplasmosis is even greater in brazil, where the prevalence and severity of ocular disease are higher than those in the rest of the world. a study conducted in brazil showed that 90% of newborns with congenital toxoplasmosis had clinical signs at birth. the success of infection caused by t. gondii is based on a delicate balance between the host immune response, which tries to clear the parasite, and the immune evasion strategies or immunomodulation elicited by the parasite, which enables the ultimate survival of both the parasite and the host. a number of different host cells and compartments are involved in the immune response to t. gondii, and the interplay between these cells is crucial to resistance to the parasite [59 ]. scarce immunological data on ocular disease in humans is available and these studies have mainly focused on the t. gondii - specific t - cell response in vitro. the analysis of systemic specific cellular response to t. gondii antigen in patients without and with active / cicatricial ocular lesions in acquired or congenital disease has described controversial data on the role of proinflammatory response in this scenario. yamamoto and colleagues have characterized the immune response in adult patients with ocular disease due to congenital infection and have suggested that these patients may show tolerance toward the parasite by decreased proinflammatory response along with lower lymphoproliferative index. in contrast, fatoohi and colleagues show that systemic cellular response to t. gondii does not differ between adult patients without and with presumed congenital ocular toxoplasmosis in regard to t - cell activation and proinflammatory cytokine production. despite recent advances in toxoplasmosis immunology, relatively little attention has been focused on the immunological events related to the congenital toxoplasmic retinochoroiditis in infant patients. considering these previous reports, this work aimed at characterizing the ex vivo systemic immunophenotypic profile of innate and adaptive cell subsets during the early phases of congenital toxoplasmosis and its association with the absence / presence of active / cicatricial retinochoroiditis in infants. the protocols conducted in this study were approved by the local ethics committee (federal university of minas gerais, protocol 298/06) and written informed consent was obtained from all mothers of infants included in this study. this study was part of a prospective investigation on neonatal screening for congenital toxoplasmosis conducted by a multidisciplinary research group (ufmg congenital toxoplasmosis brazilian group). from november 1, 2006, to may 31, 2007, a total of 146,307 children were tested for anti - t. gondii igm antibodies in dried blood samples on filter paper using the toxo igm kit (q - preven, symbiosis, leme, brazil). confirmative plasma / serum tests were run in 220 infants and their mothers in cases with positive or underterminated screening results. the mothers and infants were tested for iga (enzyme - linked immunosorbent assay) and igg and igm anti - t. gondii (enzyme - linked fluorometric assay, elfa - vidas, biomrieux sa, lyon, france). out of these 220 cases, 190 infants tested positive by confirmative exams and for the persistence of anti - t. all infants included in this study received medical care by a general clinical physician with experience with infectious diseases and the physical examination did not reveal any alteration. ophthalmologic evaluation was performed by two retina / uveitis specialists assisted by a trained nursing professional according to a standardized protocol as reported elsewhere. infants also underwent a through pediatric examination, neuroimaging studies (cranial radiographs or transfontanel ultrasound ; computer - assisted tomography in selected cases), hearing assessment, and ophthalmologic evaluation. peripheral blood samples from 105 infants (45 12 days of age ; 53% male, 47% female) were collected to obtain leukocytes. these infants were classified into two groups : (i) group toxo (infected infants), which comprised 83 infants diagnosed with congenital toxoplasmosis who had positive confirmative tests and persistent specific igg antibodies, and (ii) group ni (control noninfected infants), which comprised 22 infants who tested negative by igg anti - t. gondii. among the 83 children from group toxo, 15 infants presented active retinochoroidal lesions (arl), 27 had simultaneous active and cicatricial retinochoroidal lesions (acrl), 17 had cicatricial retinochoroidal lesions (crl), and 24 had no retinochoroidal lesions (nrl). peripheral blood from infants with congenital toxoplasmosis (toxo) and noninfected infants (ni) was processed, and leukocyteswere used for ex vivo protocols, as previously described. monoclonal antibodies (mabs) were used for labeling cell surface molecules, for t and nkt lymphocytes (anti - cd3, anti - cd4, and anti - cd8), b lymphocytes (anti - cd5, anti - cd19, and anti - cd23), monocytes (anti - cd14, anti - cd16, anti - cd32, and anti - cd64), nk- and nkt - cells (anti - cd16, anti - cd56), anti - hla - dr (activation), conventional t - cells (anti - tcr), and gamma - delta t - cells (anti - tcr), labeled with fluorescein isothiocyanate (fitc), phycoerythrin (pe), or tri - color (tc), which were purchased from invitrogen life technologies (carlsbad, ca, usa). this was a descriptive transversal study that applied three data analysis approaches for observational investigation of the immunological profile associated with distinct clinical manifestations of congenital toxoplasmosis, referred to as (1) conventional statistical analysis, (2) biomarker signature analysis, and (3) biomarkers network. the two later approaches have been shown as relevant to detect, with high sensitivity, putative minor changes in the immunological profiles that are not detectable by conventional statistical approaches. statistical analyses were conducted using graphpad prism 5.0 software (graphpad software, san diego, ca, usa). considering the nonparametric nature of all data sets, statistical analyses between the toxo and ni groups were performed by the mann - whitney test. additional analyses among the toxo subgroups were performed by the kruskal - wallis test, followed by dunns ' multiple comparison test. data sets are presented as scatter distributions over median values (bars) for toxo and ni groups. data from the toxo subgroups analysis were presented in box - plot format, highlighting the median together with the minimum and maximum values. in all cases, the use of this approach was adapted from a pioneering study in order to identify relevant differences in the peripheral blood phenotypic signatures between the groups. in this data analysis, initially, the whole universe of data of each cell subset was used to calculate the global median value used as the cut - off to classify infants as with low or the following cut - offs were used to categorize each infant as presenting low or high levels of a given cell subset : moncd16 = 125.0 cells / mm, moncd16dr = 86.2 cells / mm, moncd32 = 78.8 cells / mm, moncd64 = 186.6 cells / mm, nk - cells = 1195.2 cells / mm, nkcd16cd56 = 441.2 cells / mm, nkcd16cd56 = 526.0 cells / mm, nkcd16cd56 = 85.4 cells / mm, cd3cd56 = 2.43%, cd3cd56 = 1.06%, cd3cd16 = 73.8 cells / mm, nkt - cells = 50.3 cells / mm, cd3 = 4590.5 cells / mm, tcr = 3991.6 cells / mm, tcr = 452.4 cells / mm, tcd4 = 2850.2 cells / mm, tcd8 = 1862.6 cells / mm, tcd4cd8 = 38.8 cells / mm, tcd4dr = 466.5 cells / mm, tcd8dr = 1471.6 cells / mm, bcd19 = 1523.0 cells / mm, bcd5 = 851.3 cells / mm, bcd5 = 576.7 cells / mm, and bcd23 = 959.0 cells / mm. once the cut - offs for each biomarker were established, we selected infants with high biomarker counts and assembled the data using gray - scale diagrams to calculate the frequency of those for each clinical group. radar charts were constructed to characterize the overall frequency of infants with high levels of a given innate or adaptive immune cell population. graphpad prism 5.00 software (san diego, usa) was used for graphical arts. biomarker networks were assembled to assess the association between cell subpopulations (monocytes, nk - cells, nkt - cells, t - cells, and b - cells) and their subsets for each clinical group. significant correlations representing the interaction between biomarkers tested were compiled using the open source software cytoscape (version 2.8 ; http://www.cytoscape.org), as previously reported. biomarker networks were constructed using circle layouts with each biomarker being represented by a specific cartoon (monocytes ; nk- and nkt - cells ; t - cells and b - cells). connecting edges display the underscore as negative, moderate, and strong, as proposed previously. the correlation index (r) was used to categorize the correlation strength as negative (r r 0.68). graphpad prism 5.00 software (san diego, usa) was used for the data analysis. the analysis of hematological parameters demonstrated that toxo is accompanied by relevant leukocytosis with increased monocyte and lymphocyte counts. further categorization of infants, according to their ophthalmological records, showed that these changes were particularly observed in arl patients. no significant differences were observed in the nrl and crl subgroups (table 1). when evaluating monocyte subsets, our results demonstrated that infants in the toxo group presented an increase of cd14cd16 macrophage - like and cd14cd16hla - dr proinflammatory monocytes (figure 1(a)). in fact, the increase in cd14cd16hla- dr proinflammatory monocytes was particularly observed in the arl subgroup when compared with ni controls (figure 1(a)). furthermore, analysis of fc-r expression by monocytes (figure 1(b)) showed that toxo displayed relevant changes in cd32 and cd64 expression on the surface of these cells. analysis of the toxo subgroups demonstrated that the crl infants, in particular, had decreased cd32 and increased cd64 expression when compared with ni control group (figure 1(b)). figure 1(c) shows representative flow cytometric histogram analyses of the cd32 and cd64 expression observed in the toxo and ni groups. data regarding total cd3cd16cd56 nk - cells revealed an increased absolute count in peripheral blood samples from the toxo group. analysis of nk - cell subsets showed an increase in all nk - cell subsets in the toxo group, including cd3cd16cd56, cd3cd16cd56, and cd3cd16cd56 cells (figure 2(a)). analysis of toxo subgroups demonstrated that whereas total cd3cd16cd56 nk - cells were enhanced in the arl subgroup, cd3cd16cd56 nk - cells were expanded in the acrl and crl subgroups compared with the ni and nrl patients, respectively (figure 2(a)). analysis of nkt - cell subsets showed a significant increase in both the cd3cd16 and cd3cd56 cell subpopulations in the toxo group compared with the ni group. in fact, cd3cd16 cells were particularly expanded in the arl and acrl subgroups, whereas cd3cd56 cells were significantly increased in the arl and crl subgroups compared to ni controls (figure 2(b)). to characterize the major phenotypes related to the distinct functional features of nk - cells, we investigated the frequency of cd56 cytotoxic and cd56 immunoregulatory cell subsets. our findings demonstrated a decreased percentage of cd3cd16cd56 cells along with the expansion of cd3cd16cd56 cells in the toxo group compared to the ni group. additional analysis revealed that cd3cd16cd56 cells were reduced in all toxo subgroups, while cd3cd16cd56 cells were particularly expanded in the arl subgroup compared to the ni group (figure 2(a)). our data showed that toxo patients presented increased counts of activated cd4hla - dr t - cells along with cd4cd8 t - cells, cd19 b - cells, and cd19cd5 b1-cells compared to ni patients (figures 3(a) and 3(b)). additionally, our data demonstrated that cd4 t - cell counts were increased in the arl subgroup compared to the crl subgroup. moreover, cd4hla - dr cells were particularly increased in the arl and acrl subgroups compared to the ni group (figure 3(a)). no changes in b - cell subsets were observed among the toxo subgroups (figure 3(b)). our data demonstrated increased counts of tcr cells, cd8 t - cells, and particularly activated cd8hla - dr t - cells in the toxo group. analysis of toxo subgroups demonstrated that tcr cells, cd8 t - cells, and activated cd8hla - dr t - cells, in particular, were increased in all groups with retinochoroidal lesions (arl, acrl, and crl). to further characterize the immunological profile associated with distinct clinical manifestations of congenital toxoplasmosis, we assembled the overall phenotypic biomarker signature of peripheral blood innate / adaptive immune cells using the innovative / nonconventional data analysis approach referred to as the biomarker signature of innate and adaptive immunity compartments in the peripheral blood of infants with congenital toxoplasmosis (figure 4). our data demonstrated that, in the ni group, most biomarkers were confined to frequencies below 50%, except moncd32, cd3-cd56, and cd4 t - cells. however, in all toxo subgroups, most biomarkers were confined to frequencies above 50%. specifically, the nrl subgroup predominantly showed enhancement of b - cell related biomarkers (bcd19, bcd5, bcd5, and bcd23) along with tcd3, tcr, and nkt - cells in the innate immune compartment. by contrast, the crl subgroups predominantly showed increases in the frequency of innate immunity biomarkers (moncd16, moncd16dr, moncd64, nk - cells, cd16cd56, cd16cd56, cd16cd56, cd3cd56, cd3cd16, and nkt - cells but not moncd32 and cd3cd56) along with t - cell related biomarkers (tcr, tcd4, tcd8, tcd4cd8, and tcd8dr). the profile of the arl subgroup was of particular interest, with an enhanced frequency of biomarkers in both the innate and adaptive immune compartments. all biomarkers included in this investigation were found to be increased to above 50% in the arl infants evaluated, except for moncd32 and cd3cd56. the acrl subgroup showed an overall biomarker signature similar to that observed in the arl subgroup, with minor changes mainly in the nk- and b - cell subsets. exploratory analysis of biomarker networks demonstrated that although some axes intrinsic of innate and adaptive immunity were preserved in all clinical groups, some connections were lost in the toxo subgroups (figure 5). in the ni group, nk- and a relevant shift of nk - cell connections toward t - cells was observed in the arl subgroup along with a selective loss of connections with the b - cell compartment (figure 5). the acrl subgroup clearly showed a transitional profile between the arl and crl subgroups with nk - cell connections focusing on t - cells and restoring the connections with b - cells (figure 5). the fact that the nrl and crl subgroups displayed a higher number of significant interactions and a more complex and imbricated biomarker network was outstanding. it was clear that the nrl subgroup showed relevant interaction between monocytes and other cell subsets (nkt-, nk-, and b - cells) mediated by negative correlations and a relevant role of nk - cell connections focusing on t- and b - cells (figure 5). in the crl subgroup, a strong correlation axis could be identified, with the pivotal participation of several nk - cell subsets interacting with t- and b - cells along with strong connections of cd8 t - cells with a broad range of cell subsets (figure 5). retinochoroiditis in humans caused by t. gondii is the most frequent clinical manifestation of congenital and acquired parasite infection [14, 15 ]. the disease typically presents as a unilateral focal necrotizing lesion in the presence of adjacent scars. the common occurrence of toxoplasmic retinochoroiditis is believed to be under the influence of the status of the host immune response, the genotype of infective parasite strains, and the host genetic background [17, 18 ] ; however, the participation of cellular components that lead to the establishment of this ocular manifestation has not been addressed well in humans. the presence of active, active / cicatricial, or cicatricial lesions observed in the infants of our cohort is consequence of multiple factors, which may include parasite virulence and retinotropism of t. gondii in brazil, individual susceptibility as well as the t. gondii - specific immune response in the infants of our cohort. another possibility is that the time of infection during pregnancy may impact the outcome of distinct retinochoroidal lesions. the premise that putative infection by parasites with diverse virulence and/or atypical / recombinant genotypes leads to different manifestation of ocular toxoplasmosis was not confirmed by our parasitology team, as shown by carneiro., moreover, preliminary results regarding igm reactivity as well as igg avidity do not support the hypothesis that time of infection during pregnancy may influence the occurrence of distinct patterns of retinochoroidal lesions (paper in preparation). the development of an adequate innate immune response is important for infection control and reduction of toxoplasmosis - associated injuries, primarily retinochoroiditis. however, the initial stages of congenital infection are unclear, and most studies mainly refer to work with experimental models [2022 ]. the present study is a great opportunity to understand the major and minor changes in peripheral blood leukocyte subpopulations in infants with congenital toxoplasmosis. although the analysis of in vitro t. gondii - specific immune response is highly relevant to understand the role of the parasite - derived antigens essential to elucidate the mechanism underlying the immunopathogenesis of ocular toxoplasmosis, we believe that the ex vivo analysis particularly in the absence of exogenous stimuli is highly relevant to map the events that take place in vivo and may point out putative biomarkers useful to comprehend the systemic network involved in the immunopathogenesis of ocular toxoplasmosis. infants were selected through a newborn screening program, and therefore, no information about gestational age when the congenital infection occurred was available. our results showed an increase in the populations of monocytes and lymphocytes in infants with congenital toxoplasmosis. it is known that monocyte recruitment is essential in restricting the growth of t. gondii in murine models of toxoplasmosis [6, 23 ]. however, other studies show that these cells as well as dendritic cells are strong candidates for the intracellular transport of t. gondii in the blood as a trojan horse. moreover, the activity of monocytes must be carefully controlled because excessive production of inflammatory cytokines and nitric oxide (no) can result in severe immunopathology. the increase in the population of monocytes was observed only in the active lesion groups, suggesting that the persistence of the immune response mediated by monocytes is directly related to the pathology observed in these infants. an increase in proinflammatory monocytes (cd14cd16hla - dr) in infants with congenital toxoplasmosis was observed. previous studies have shown that inflammatory monocytes produce il-12 in vitro and in vivo when stimulated with t. gondii [6, 7 ], and it has also been proposed that these cells contribute to the direct control of t. gondii through the production of no, which inhibits parasite replication. increased proinflammatory monocytes in infected infants, particularly in those with active retinochoroidal lesions, are indicative of a strong and persistent proinflammatory response. nk - and nkt - cells are other innate populations involved in immunity against t. gondii that are increased in infants with congenital toxoplasmosis compared with noninfected children. our results showed an increase in the population of cd56 cells in infants with active lesions when compared with an important decrease in the immunoregulatory nk subset, expressing cd56. the increase in this population and in subsets of nk- and nkt - cells is an important feature of the innate immune responses against the parasite. analysis of the adaptive immune response showed that cd4 t lymphocytes are apparently associated with the active lesion phenotype. although several studies have demonstrated the importance of cd4 t - cells in infection control, the production of proinflammatory cytokines, mainly by cd4 t cells, is related to the morbidity of toxoplasmosis [27, 28 ]. moreover, we observed that an increase in cd8 t - cells was associated with the presence of retinochoroiditis in infants. cd8 t - cells play a major role as effector lymphocytes against the parasite and in killing infected macrophages and macrophages exposed to soluble parasite antigens. our results show that the increase in cd8 t - cells could also be an important biomarker of morbidity in infected infants. the results observed in infected infants suggest maturation of the immune response against t. gondii. the increases in lymphocyte populations and in subpopulations of monocytes and nk - cells are important in controlling parasitemia. however, exacerbation of the proinflammatory response may also be damaging to infants and, therefore, a determining factor in the pathology observed. only infants with active lesions showed increased leukocyte counts (specifically monocytes, nk - cells, and lymphocytes). moreover, the same children also showed increased subpopulations of proinflammatory monocytes and active nk - cells. it is important to consider, however, that future studies with proper validation of the immunological subsets are still needed in order to support their predictive value and specificity as putative biomarkers of ocular involvement in congenital toxoplasmosis. studies on the immune response in human infections by t. gondii, particularly in newborns, are rare. this work provides important findings regarding the immune response to congenital toxoplasmosis, which indicated immunomodulation possibly associated with local control of retinochoroiditis. future studies with proper validation of the immunological subsets are still needed in order to support their predictive value and specificity as putative biomarkers in the ocular congenital toxoplasmosis. | toxoplasma gondii is the main infectious cause of human posterior retinochoroiditis, the most frequent clinical manifestation of congenital toxoplasmosis. this investigation was performed after neonatal screening to identify biomarkers of immunity associated with immunopathological features of the disease by flow cytometry. the study included infected infants without nrl and with retinochoroidal lesions (arl, acrl, and crl) as well as noninfected individuals (ni). our data demonstrated that leukocytosis, with increased monocytes and lymphocytes, was a relevant hematological biomarker of arl. immunophenotypic analysis also revealed expansion of cd14+cd16+hla - drhigh monocytes and cd56dim cytotoxic nk - cells in arl. moreover, augmented tcr+ and cd8 + t - cell counts were apparently good biomarkers of morbidity. biomarker network analysis revealed that complex and intricated networks underscored the negative correlation of monocytes with nk- and b - cells in nrl. the remarkable lack of connections involving b - cells and a relevant shift of nk - cell connections from b - cells toward t - cells observed in arl were outstanding. a tightly connected biomarker network was observed in crl, with relevant connections of nk- and cd8 + t - cells with a broad range of cell subsets. our findings add novel elements to the current knowledge on the innate and adaptive immune responses in congenital toxoplasmosis. |
some earlier works from this laboratory were concerned with electrosorption and electroreactivity of small organic molecules at well - ordered pt single - crystal surfaces, including : aliphatic oximes [1, 2 ] and guanidinium [g / nh2 = c(nh2)2]-type ions [35 ]. with respect to g ions, their presence in solution was revealed in substantial effects on the voltammetric profiles for upd of h, both in acidic and in alkaline media, owing to two - dimensional interaction effects between the adsorbed organic cations and electrosorbed bi(sulfate) (or oh) species. these effects were also characterized in detail by in situ fourier transform infrared spectroscopy (ftir) experiments at pt(111) and (100) planes, as well as by alternate current (ac) impedance spectroscopy kinetic investigations, carried out in 0.5 m h2so4 solution at the (100) surface. urea [o = c(nh2)2 ] is a structure - related molecule to that of guanidine. hence, climent. in refs. and examined in situ ftir and cyclic voltammetry behavior of urea in 0.1 m hclo4 at pt(100) and (111) planes, respectively. urea was shown there to undergo dissociative electrosorption on the surface of pt in an anodic (1- or 2-electron transfer) oxidation process [6, 7 ]. similar cyclic voltammetry experiments on adsorption of urea in hclo4 at various low - index pt surfaces were reported by rubel.. in addition, important radiochemistry measurements [9, 10 ] were conducted in order to facilitate derivation of the potential and concentration dependence of urea coverage on pt, including the surface structure for the urea adlayer on pt(100) plane. the key aim of this work was to present the kinetic aspects of the process of electrosorption of urea on the pt(100) plane in 0.5 m h2so4, especially in reference to those recently reported for guanidinium cations under analogous experimental conditions. the above was accomplished through derivation of the faradaic resistance and electrosorption pseudocapacitance components associated with upd of h and electrosorption of u, carried - out at several working electrode potentials. pt single - crystal of the (100) orientation was prepared from 1 mm diameter 99.9985 % pt wire (aesar / puratronic) by employing the techniques and procedures for preparation of pt single crystals developed by clavilier.. high - purity, aqueous 0.5 m h2so4 solution was prepared from sulfuric acid of highest purity available (seastar chemicals) with water derived from an 18.2 m direct - q3 uv ultrapure water system from millipore. poland) was used to prepare acidic solutions, at a concentration of 1 10 m u. all prepared solutions were de - aerated with high - purity argon (ar 6.0 grade, linde), which was also purged above the solutions during impedance measurements. ac impedance measurements were conducted by means of the solartron 12,608 w full electrochemical system, consisting of 1,260 frequency response analyzer (fra) and 1,287 electrochemical interface. all potential measurements were referred to the potential of a reversible hydrogen electrode (rhe), in the same test solution. the 1,260 fra generator provided an output signal of known amplitude (5 mv) and the frequency range was usually swept between 1.0 10 and 0.1 hz. the instruments were controlled by zplot 2.9 software for windows (scribner associates, inc.). presented impedance results were obtained through selection and analysis of representative series of experimental data. reproducibility of such - obtained results was typically below 10 % from one measurement to another. the impedance data analysis was performed with zview 2.9 software package, where the spectra were fitted by means of a complex, nonlinear, least - squares immitance fitting program, levm 6, written by macdonald. figure 1 below presents the adsorption behavior of urea (at a concentration of 6 10 m u) at the pt(100) plane in 0.5 m h2so4. the adsorption effects of u are characterized by the potential range for upd of h being squeezed and considerably (by ca. the voltammetric behavior of urea is analogous to that previously reported for guanidinium ions at the pt(100) surface [3, 4 ]. 1) could conveniently be explained in terms of attractive, ion pairing interactions between co - adsorbed urea molecules and hso4 ions (see structure 1 below) thus referring to those previously examined for the g ion by means of cyclic voltammetry and ftir measurements in refs. and.fig. 1cyclic voltammograms for pt(100) in 0.5 m h2so4 recorded at a sweep rate of 50 mv s and in the presence of u at the concentration indicated ; voltammograms were recorded on the third cycle (from ref.) 2a complex plane impedance plot for pt(100) in contact with 0.5 m h2so4 in the presence of 1 10 m u recorded at 293 k for the stated potential value. the solid line corresponds to representation of the data according to the equivalent circuit shown in fig. b bode phase - angle plot for impedance behavior at pt(100) in contact with 0.5 m h2so4 in the presence of 1 10 m u, for the stated potential value (other details as in fig. 2a) cyclic voltammograms for pt(100) in 0.5 m h2so4 recorded at a sweep rate of 50 mv s and in the presence of u at the concentration indicated ; voltammograms were recorded on the third cycle (from ref.) a complex plane impedance plot for pt(100) in contact with 0.5 m h2so4 in the presence of 1 10 m u recorded at 293 k for the stated potential value. the solid line corresponds to representation of the data according to the equivalent circuit shown in fig. b bode phase - angle plot for impedance behavior at pt(100) in contact with 0.5 m h2so4 in the presence of 1 10 m u, for the stated potential value (other details as in fig. 2a) although at the pt(100) plane, the recorded voltammetric behavior of u was comparable with that observed for the g ions, on the (111) surface, urea was suggested to exhibit significantly reduced ion pairing interactions with bi(sulfate) species than the corresponding guanidinium ions. however, it has to be stressed that it is predominantly sulfate (not bisulfate) species that becomes adsorbed on the pt(111) plane in sulfuric acid solution (see recent works by su., by garcia - araez., and by yeh.). thus, in this case, no attractive interactions between the adsorbed, unprotonated urea molecules and sulfate species could be envisaged [contrast to the behavior at the (100) plane, see structure 1 again ]. consequently, for the (111) plane, the recorded displacement of the voltammetric profile in the presence of urea (see fig. 7a in ref.) is most likely the result of partial protonation of urea in the supporting electrolyte (please note that about 10 % of u molecules at ph 1 exist in a cationic form [3, 4, 6 ]). the above - made conclusions get support from the previously performed ftir experiments in the presence of urea, which indicated considerably less extensive chemisorption of u on the pt(111) surface, as compared to that exhibited at the (100) plane. the impedance behavior of urea, at a concentration of 1 10 m u in 0.5 m h2so4 at the pt(100) plane is shown in fig. 2a and b and in table 1. thus, the impedance behavior of u at potentials close to that of the capacitive peak in fig. 1 (200, 250, 300, and 350 mv vs. rhe) is characterized by the appearance of two partial semicircles and a capacitive line at an inclination to the z axis different from 90. the smaller semicircle (see the impedance spectrum recorded at 300 mv in inset to fig. 2a), observed at high frequencies, corresponds to the process of upd of h (in relation to the charge transfer resistance, rh), and the part of a large - diameter semicircle (see fig. 2a again), observed throughout the intermediate frequency range, is associated with the charge transfer process (with respect to the ru parameter in table 1) accompanying electrosorption of urea on the pt surface (see eq. 1 below). moreover, existence of two maxima is clearly discernible in the corresponding bode phase - angle plot in fig. 2b (please evaluate the fitting quality by the derived chi - squared : parameter values given in table 1).fig. 3equivalent circuit for an adsorption process such as upd of h, exhibiting faradaic pseudocapacitance, cph, charged via a faradaic resistance, rh in the presence of co - adsorbed urea (ru and cu components), in a parallel combination with the double - layer capacitance, cdl, jointly in series with an uncompensated solution resistance, rs ; w diffusional warburg element, employed as an empirical termtable 1resistance and capacitance parameters for upd of h and the process of electrosorption of u molecule (at a concentration of 1 10 m) on pt(100) plane in 0.5 m h2so4 (recorded at 293 k), obtained by finding the equivalent circuit which best fitted the impedance data, as shown in fig. 3 (refers to the recorded chi - squared parameter values by the zview fitting software)e / mvrh/ cm10cph / f cm10cdl / f cmru/ cm10cu / f cm2000.45 0.01395.7 3.328.5 1.7267.0 6.5304.5 6.34.7 102500.55 0.02378.8 3.836.5 1.9133.1 5.62,089 959.4 103001.85 0.03159.4 1.743.2 1.8148.8 3.2291.4 5.55.6 103504.70 0.2261.8 2.055.4 2.2513.8 12.6205.2 3.97.2 10 equivalent circuit for an adsorption process such as upd of h, exhibiting faradaic pseudocapacitance, cph, charged via a faradaic resistance, rh in the presence of co - adsorbed urea (ru and cu components), in a parallel combination with the double - layer capacitance, cdl, jointly in series with an uncompensated solution resistance, rs ; w diffusional warburg element, employed as an empirical term resistance and capacitance parameters for upd of h and the process of electrosorption of u molecule (at a concentration of 1 10 m) on pt(100) plane in 0.5 m h2so4 (recorded at 293 k), obtained by finding the equivalent circuit which best fitted the impedance data, as shown in fig. 3 (refers to the recorded chi - squared parameter values by the zview fitting software) as compared to the case of pure 0.5 m h2so4 supporting electrolyte (e.g., see table 1 in ref.), the kinetics of the process of upd of h have become significantly slowed down in the presence of u, beyond the potential of 250 mv vs. rhe (table 1). a significant increase of the rh parameter (from 0.45 cm at 200 mv to 4.70 cm at 350 mv) can be explained in terms of the ion pairing mechanism (originally proposed for the g ions in ref.), where the presence of surface - adsorbed bisulfate species, arising at significantly lower electrode potentials together with co - adsorbed u molecules (structure 1), appreciably influences the kinetics of upd of h on this pt plane. in addition, changes of the hydrogen adsorption capacitance (cph) strictly follow those of the rh parameter ; thus, the cph dramatically declines (table 1) from 395.7 f cm (at 200 mv) to 61.8 f cm (at 350 mv).1 on the other hand, the adsorption charge transfer resistance for urea (ru) reaches its minimum value of 133.1 cm at the potential close to that of the peak current density in fig. 1 (250 mv), which implies that the kinetics of adsorption of u on the pt(100) plane are dramatically slower than those of upd of h on this surface. again, minimum of the ru value coincides with a very large value (2,089 f cm) of the adsorption pseudo - capacitance parameter (cu), recorded at the potential of 250 mv. furthermore, the recorded double - layer capacitance values (cdl) in table 1 oscillate between ca. these cdl values are considerably higher than 20 f cm, i.e., a commonly quoted double - layer capacitance value in literature for smooth and homogeneous surfaces [16, 17 ], which implies some contribution to the recorded cdl from the adsorption capacitance components (table 1). moreover, an observed deviation from the purely capacitive, 90 phase angle behavior (also expressed by depressed the phenomenon of capacitance dispersion is typically visualized as corresponding either to slow adsorption / desorption processes or as the effect of increasing pt surface inhomogeneity, especially important when extensive potentiostatic impedance measurements take place [1820 ]. all fittings of the recorded impedance data were performed by means of the double - adsorbate equivalent circuit (see fig. 3) with employment of a warburg diffusional element (w), regarded here as an empirical term involved in the kinetics of urea electrosorption on the pt(100) plane.fig. 4total capacitance (ctotal) as a function of the applied potential (vs. rhe) for the desorption of h and adsorption of u (at a concentration of 1 10 m) on pt(100), in contact with 0.5 m h2so4 solution. the solid line corresponds to the ctotal calculated from the cv profile (ctotal = current density / sweep rate) and the experimental points are the impedance - derived values of total capacitance total capacitance (ctotal) as a function of the applied potential (vs. rhe) for the desorption of h and adsorption of u (at a concentration of 1 10 m) on pt(100), in contact with 0.5 m h2so4 solution. the solid line corresponds to the ctotal calculated from the cv profile (ctotal = current density / sweep rate) and the experimental points are the impedance - derived values of total capacitance as an internal check on the impedance results, fig. 4 below shows total capacitance, ctotal, where ctotal = cdl + cp (adsorption pseudocapacitance components), as a function of potential for the adsorption behavior of u on the pt(100) single - crystal surface. this figure compares ctotal obtained from the impedance results with that directly calculated from the voltammetric profile [5, 22 ] under comparable experimental conditions (1 10 m u). it can be seen in fig. 4 that the ctotal values are in fairly good agreement with each other for all four probing potential values.structure 1ion pairing interactions between co - adsorbed urea molecules and hso4 ions ion pairing interactions between co - adsorbed urea molecules and hso4 ions with respect to the impedance behavior previously recorded in the presence of the guanidinium cation, the process of electrosorption of urea at the pt(100) plane is characterized by significantly increased values of the charge transfer resistance parameter (ru vs. rg+ in ref.). in fact, the ru / rg+ ratio comes to ca. 5.6 for the minimum electrosorption resistance values, recorded for u and g species, respectively. the above strongly supports the formerly derived conclusions on the ion pairing (dipole dipole type) between the electrosorbed u molecules and bisulfate species being significantly weaker than the corresponding g / hso4 (ion dipole) interactions (not particularly evident from the comparative : u vs. g cyclic voltammetry behavior for this pt plane). in this respect, the electrochemical behavior of urea on the pt(100) plane is somewhat analogous to that recorded for n, n - dimethyl - guanidinium (dmg) cation in ref.. figure 1 below presents the adsorption behavior of urea (at a concentration of 6 10 m u) at the pt(100) plane in 0.5 m h2so4. the adsorption effects of u are characterized by the potential range for upd of h being squeezed and considerably (by ca. the voltammetric behavior of urea is analogous to that previously reported for guanidinium ions at the pt(100) surface [3, 4 ]. 1) could conveniently be explained in terms of attractive, ion pairing interactions between co - adsorbed urea molecules and hso4 ions (see structure 1 below) thus referring to those previously examined for the g ion by means of cyclic voltammetry and ftir measurements in refs. and.fig. 1cyclic voltammograms for pt(100) in 0.5 m h2so4 recorded at a sweep rate of 50 mv s and in the presence of u at the concentration indicated ; voltammograms were recorded on the third cycle (from ref.) 2a complex plane impedance plot for pt(100) in contact with 0.5 m h2so4 in the presence of 1 10 m u recorded at 293 k for the stated potential value. the solid line corresponds to representation of the data according to the equivalent circuit shown in fig. b bode phase - angle plot for impedance behavior at pt(100) in contact with 0.5 m h2so4 in the presence of 1 10 m u, for the stated potential value (other details as in fig. 2a) cyclic voltammograms for pt(100) in 0.5 m h2so4 recorded at a sweep rate of 50 mv s and in the presence of u at the concentration indicated ; voltammograms were recorded on the third cycle (from ref.) a complex plane impedance plot for pt(100) in contact with 0.5 m h2so4 in the presence of 1 10 m u recorded at 293 k for the stated potential value. the solid line corresponds to representation of the data according to the equivalent circuit shown in fig. b bode phase - angle plot for impedance behavior at pt(100) in contact with 0.5 m h2so4 in the presence of 1 10 m u, for the stated potential value (other details as in fig. 2a) although at the pt(100) plane, the recorded voltammetric behavior of u was comparable with that observed for the g ions, on the (111) surface, urea was suggested to exhibit significantly reduced ion pairing interactions with bi(sulfate) species than the corresponding guanidinium ions. however, it has to be stressed that it is predominantly sulfate (not bisulfate) species that becomes adsorbed on the pt(111) plane in sulfuric acid solution (see recent works by su., by garcia - araez., and by yeh.). thus, in this case, no attractive interactions between the adsorbed, unprotonated urea molecules and sulfate species could be envisaged [contrast to the behavior at the (100) plane, see structure 1 again ]. consequently, for the (111) plane, the recorded displacement of the voltammetric profile in the presence of urea (see fig. 7a in ref.) is most likely the result of partial protonation of urea in the supporting electrolyte (please note that about 10 % of u molecules at ph 1 exist in a cationic form [3, 4, 6 ]). the above - made conclusions get support from the previously performed ftir experiments in the presence of urea, which indicated considerably less extensive chemisorption of u on the pt(111) surface, as compared to that exhibited at the (100) plane. the impedance behavior of urea, at a concentration of 1 10 m u in 0.5 m h2so4 at the pt(100) plane is shown in fig. thus, the impedance behavior of u at potentials close to that of the capacitive peak in fig. 1 (200, 250, 300, and 350 mv vs. rhe) is characterized by the appearance of two partial semicircles and a capacitive line at an inclination to the z axis different from 90. the smaller semicircle (see the impedance spectrum recorded at 300 mv in inset to fig. 2a), observed at high frequencies, corresponds to the process of upd of h (in relation to the charge transfer resistance, rh), and the part of a large - diameter semicircle (see fig. 2a again), observed throughout the intermediate frequency range, is associated with the charge transfer process (with respect to the ru parameter in table 1) accompanying electrosorption of urea on the pt surface (see eq. 1 below). moreover, existence of two maxima is clearly discernible in the corresponding bode phase - angle plot in fig. 2b (please evaluate the fitting quality by the derived chi - squared : parameter values given in table 1).fig. 3equivalent circuit for an adsorption process such as upd of h, exhibiting faradaic pseudocapacitance, cph, charged via a faradaic resistance, rh in the presence of co - adsorbed urea (ru and cu components), in a parallel combination with the double - layer capacitance, cdl, jointly in series with an uncompensated solution resistance, rs ; w diffusional warburg element, employed as an empirical termtable 1resistance and capacitance parameters for upd of h and the process of electrosorption of u molecule (at a concentration of 1 10 m) on pt(100) plane in 0.5 m h2so4 (recorded at 293 k), obtained by finding the equivalent circuit which best fitted the impedance data, as shown in fig. 3 (refers to the recorded chi - squared parameter values by the zview fitting software)e / mvrh/ cm10cph / f cm10cdl / f cmru/ cm10cu / f cm2000.45 0.01395.7 3.328.5 1.7267.0 6.5304.5 6.34.7 102500.55 0.02378.8 3.836.5 1.9133.1 5.62,089 959.4 103001.85 0.03159.4 1.743.2 1.8148.8 3.2291.4 5.55.6 103504.70 0.2261.8 2.055.4 2.2513.8 12.6205.2 3.97.2 10 equivalent circuit for an adsorption process such as upd of h, exhibiting faradaic pseudocapacitance, cph, charged via a faradaic resistance, rh in the presence of co - adsorbed urea (ru and cu components), in a parallel combination with the double - layer capacitance, cdl, jointly in series with an uncompensated solution resistance, rs ; w diffusional warburg element, employed as an empirical term resistance and capacitance parameters for upd of h and the process of electrosorption of u molecule (at a concentration of 1 10 m) on pt(100) plane in 0.5 m h2so4 (recorded at 293 k), obtained by finding the equivalent circuit which best fitted the impedance data, as shown in fig. 3 (refers to the recorded chi - squared parameter values by the zview fitting software) as compared to the case of pure 0.5 m h2so4 supporting electrolyte (e.g., see table 1 in ref.), the kinetics of the process of upd of h have become significantly slowed down in the presence of u, beyond the potential of 250 mv vs. rhe (table 1). a significant increase of the rh parameter (from 0.45 cm at 200 mv to 4.70 cm at 350 mv) can be explained in terms of the ion pairing mechanism (originally proposed for the g ions in ref.), where the presence of surface - adsorbed bisulfate species, arising at significantly lower electrode potentials together with co - adsorbed u molecules (structure 1), appreciably influences the kinetics of upd of h on this pt plane. in addition, changes of the hydrogen adsorption capacitance (cph) strictly follow those of the rh parameter ; thus, the cph dramatically declines (table 1) from 395.7 f cm (at 200 mv) to 61.8 f cm (at 350 mv).1 on the other hand, the adsorption charge transfer resistance for urea (ru) reaches its minimum value of 133.1 cm at the potential close to that of the peak current density in fig. 1 (250 mv), which implies that the kinetics of adsorption of u on the pt(100) plane are dramatically slower than those of upd of h on this surface. again, minimum of the ru value coincides with a very large value (2,089 f cm) of the adsorption pseudo - capacitance parameter (cu), recorded at the potential of 250 mv. furthermore, the recorded double - layer capacitance values (cdl) in table 1 oscillate between ca. these cdl values are considerably higher than 20 f cm, i.e., a commonly quoted double - layer capacitance value in literature for smooth and homogeneous surfaces [16, 17 ], which implies some contribution to the recorded cdl from the adsorption capacitance components (table 1). moreover, an observed deviation from the purely capacitive, 90 phase angle behavior (also expressed by depressed the phenomenon of capacitance dispersion is typically visualized as corresponding either to slow adsorption / desorption processes or as the effect of increasing pt surface inhomogeneity, especially important when extensive potentiostatic impedance measurements take place [1820 ]. all fittings of the recorded impedance data were performed by means of the double - adsorbate equivalent circuit (see fig. 3) with employment of a warburg diffusional element (w), regarded here as an empirical term involved in the kinetics of urea electrosorption on the pt(100) plane.fig. 4total capacitance (ctotal) as a function of the applied potential (vs. rhe) for the desorption of h and adsorption of u (at a concentration of 1 10 m) on pt(100), in contact with 0.5 m h2so4 solution. the solid line corresponds to the ctotal calculated from the cv profile (ctotal = current density / sweep rate) and the experimental points are the impedance - derived values of total capacitance total capacitance (ctotal) as a function of the applied potential (vs. rhe) for the desorption of h and adsorption of u (at a concentration of 1 10 m) on pt(100), in contact with 0.5 m h2so4 solution. the solid line corresponds to the ctotal calculated from the cv profile (ctotal = current density / sweep rate) and the experimental points are the impedance - derived values of total capacitance as an internal check on the impedance results, fig. 4 below shows total capacitance, ctotal, where ctotal = cdl + cp (adsorption pseudocapacitance components), as a function of potential for the adsorption behavior of u on the pt(100) single - crystal surface. this figure compares ctotal obtained from the impedance results with that directly calculated from the voltammetric profile [5, 22 ] under comparable experimental conditions (1 10 m u). it can be seen in fig. 4 that the ctotal values are in fairly good agreement with each other for all four probing potential values.structure 1ion pairing interactions between co - adsorbed urea molecules and hso4 ions ion pairing interactions between co - adsorbed urea molecules and hso4 ions with respect to the impedance behavior previously recorded in the presence of the guanidinium cation, the process of electrosorption of urea at the pt(100) plane is characterized by significantly increased values of the charge transfer resistance parameter (ru vs. rg+ in ref.). in fact, the ru / rg+ ratio comes to ca. 5.6 for the minimum electrosorption resistance values, recorded for u and g species, respectively. the above strongly supports the formerly derived conclusions on the ion pairing (dipole dipole type) between the electrosorbed u molecules and bisulfate species being significantly weaker than the corresponding g / hso4 (ion dipole) interactions (not particularly evident from the comparative : u vs. g cyclic voltammetry behavior for this pt plane). in this respect, the electrochemical behavior of urea on the pt(100) plane is somewhat analogous to that recorded for n, n - dimethyl - guanidinium (dmg) cation in ref.. application of ac impedance spectroscopy to study adsorption behavior of urea at pt(100) single - crystal surface provided support for the cooperative : u / hso4 electrosorption mechanism for u (also with respect to significance of upd of h), based on the impedance - derived charge transfer resistance and capacitance components. moreover, significantly increased values of the adsorption charge - transfer resistance for urea (with respect to those previously recorded for guanidinium ion at pt(100) plane in ref.) suggest considerably slower electrosorption of urea (and respectively weakened u / hso4ion pairing) than that previously reported for g on this pt plane. | the present paper reports an alternate current impedance spectroscopic study on adsorption of urea (u) at pt(100) single - crystal surface, examined in 0.5 m h2so4 supporting electrolyte. the resulted information provided confirmation of the role of electrosorption of urea on the pt(100) plane through evaluation of the associated charge transfer resistance and capacitance parameters. obtained impedance results were compared to those previously recorded for guanidinium cation (g+) under analogous experimental conditions, especially with respect to the so - called ion pairing mechanism, as originally proposed for the g+ ion and bi(sulfate)/oh species, based on the voltammetric and in situ fourier transform infrared spectroscopy results. |
the existing treatment options for mild to moderate alzheimer s disease (ad) patients are limited to a small number of fda - approved pharmaceuticals, including the acetylcholinesterase inhibitors (acheis) tacrine, donepezil, galantamine, and rivastigmine. these compounds prevent the degradation of acetylcholine (ache) and consequently increase the concentrations of this neurotransmitter in the synaptic cleft to ultimately enhance cholinergic neurotransmission (lleo., 2006). a more recently approved medication is the n - methyl - d - aspartate (nmda)-receptor antagonist memantine, which protects against glutamate excitotoxicity (hynd., 2004 ; sonkusare., 2005 ; parsons., 2007) and also inhibits pathological reactions of the tau protein (such as hyperphosphorylation and aggregation ; li., 2004). the important caveat for all of these treatment options is that none of them afford significant long - term symptomatic relief provide hope for a cure. to address this, there are numerous compounds currently in various phases of clinical trial, and even more in preclinical development, which are believed may offer some hope for a tangible clinical benefit in ad. we have recently published an extensive review of these compounds (biran., 2009), the majority of which target one or both of the primary aggregating proteins implicated in the pathogenesis of ad. while there are a multitude of compounds currently in clinical trial that focus on a variety of cellular targets, the majority have been developed around the principles of the amyloid cascade hypothesis (adlard., 2009). it has come to pass, however, that many of the compounds that were heralded as the shining light of ad therapeutics have stumbled in the final phases of clinical testing, casting a shadow over the field (golde., 2011). principle among the high profile failures have been ; tramiprosate (alzhemed), an inhibitor of a oligomerization ; tarenflurbil (flurizan), a gamma - secretase modulator ; semagacestat (ly450139 dihydrate), a gamma - secretase inhibitor ; and latrepirdine (dimebon), which has a plethora of biological effects, but whose main biological efficacy may derive from an effect on mitochondria. these have formed the basis for several commentaries (karran., 2011 ; sperling., 2011) on the state of ad clinical trials and therapeutics, and will not be discussed here. what these failed trials do suggest, however, is that compounds whose mechanism of action is to solely target the beta - amyloid protein, and hence which can be considered to be classical approaches (masters and beyreuther, 2006), may not represent the optimal approach to the treatment of ad. compounds that provide greater and longer - lived symptomatic relief or which represent more global / holistic approaches by targeting a number of key aspects of the disease process may represent better drug candidates than the classical approaches. to this end, there is ever - increasing evidence for the efficacy of metal chaperones in the treatment of ad (duce., 2011). metal chaperones (or metallochaperones) are compounds that function to shuttle metal ions to specific intracellular target proteins. this facilitation of metal transport is distinct from metal chelators or buffers, which function to exclude or deplete metals from discrete cellular compartments to thereby limit biological interactions of key metal ions. cumulatively, however, these processes serve to maintain tight regulatory control over cellular metal ion homeostasis such that the intracellular concentration of freely available metal ions (such as copper and zinc) is close to zero. the components involved in these processes include transporters (such as ctr1 for copper and zip for zinc), channels (such as voltage gated calcium channels), and pumps (such as calcium - atpase), which allow the transport of metal ions across biological membranes ; endocytosis of protein : metal complexes (such as transferrin : iron) into the cell and chaperones (such as ccs for copper), which escort metals into the cell. these, and other, processes involved in the highly complex process of metal trafficking and homeostasis have been critically reviewed elsewhere (ba., 2009) and will not be discussed here. levels is essential in limiting potentially deleterious interactions of redox active transition metal ions, which are implicated in the pathogenesis of a number of disorders including ad (sayre. the involvement of metal ions in disease extends the breadth from being involved in creating an adverse cellular milieu (which among other things, may promote cell death through the activation of particular pathways that lead to degeneration) through to direct involvement in the generation and toxicity of the principle toxic moiety in diseases such as ad. given the compelling evidence for the critical role of copper and zinc in both precipitating and potentiating ad (adlard and bush, 2006 ; adlard. 2011), attempts to modulate the metal : ad interaction are an emerging therapeutic strategy. (2002), for example, demonstrated that the ablation of the synaptic zinc transporter [zinc transporter 3 (znt3) ; palmiter., 1996 ; cole., 1999 ] in tg2576 mice [a mutant human amyloid precursor protein (app) over - expressing ad mouse model ] resulted in a loss of vesicular zinc in glutamatergic synapses and a concomitant reduction in both a plaques (number and/or percentage area occupied within the brain) and insoluble a burden. these data are supported by more recent reports that have clearly defined a role for zinc in synaptic pathways critically affected in ad (adlard., 2010), and indeed, the 3xtg mouse model of ad has shown a gender - dependent alteration in vesicular zinc - related plasticity (nakashima., 2010). (2009) have also demonstrated that a oligomers are attracted to zinc emanating from the glutamatergic synapse, and that this can then occlude the nmdar2b receptor and thus affect downstream signaling pathways. in another study, by phinney. (2003), tgcrnd8 mice (a double mutant human app over - expressing ad mouse model) were crossed with tx mice to generate mice with a mutation in the transport protein (atpase7b) that loads copper into secretory vesicles (lutsenko and petris, 2003). this resulted in elevated brain copper levels and a concomitant significant reduction in the number of dense cored plaques in the cortex and hippocampus. while such genetic approaches are unlikely to become a therapeutic option for the treatment of ad, it does highlight the relevance of targeting metal ions in this disease. in addition to the modulation of endogenous factors such as these and others (such as metallothioneins), there have been numerous attempts at modulating metal levels within the cns through dietary modification and pharmacological intervention. utilizing the app23 mouse line (a mutant human app over - expressing ad mouse model), bayer. (2003) demonstrated that 3 months of elevated dietary copper intake was sufficient to remediate the copper deficit present in the app23 mouse model, and to also lower a burden. similarly, increasing the dietary intake of zinc in both the tgcrnd8 (for 5 months) and tg2576 (for 11 months) mice (linkous., 2009) resulted in a reduction in a burden and a histological reduction in plaque size (which was also paradoxically associated with impaired performance on behavioral assessments of cognition). demonstrating that mice over - expressing mutant human app and presenilin 1 (ps1 ; app / ps1) maintained on a zinc - deficient diet for 3 months had a significant elevation in a plaque burden and a histological increase in plaque size. cumulatively, these data highlight the dynamic nature of ad - like pathology in the various mouse models and importantly, identify a critical role for metal ion homeostasis in the pathogenesis of disease. this complexity, however, is exacerbated by the apparent interaction between metals such as copper and zinc. a recent study (railey., 2011), for example, demonstrated that the cognitive deficits observed in zinc - supplemented mouse models of ad can be overcome by parallel copper supplementation. furthermore, high levels of dietary zinc can inhibit the intestinal absorption of copper (sandstead, 1995) and lower cortical copper levels (flinn., 2005), while wilson s disease (a copper - overload disorder) is effectively treated with dietary zinc (sinha and taly, 2008). thus, any biological effects derived from the modulation of a particular metal species may, in fact, be affected by a consequent alteration in a different metal ion. these data also suggest that a singular mechanistic approach is unlikely to afford the long - term benefit required for a truly effective and disease modifying therapeutic as in the brief discussion above, it is clear that homeostatic deficits in metal ions need to be rectified, but at the same time, the elimination of metals from discrete cellular targets / zones (e.g., the synapse) also modifies the progression of disease [but this may come at a cognitive cost as is implied from the data showing that reductions in synaptic zinc levels reduce plaque burden in tg mice (lee., 2002), but also result in severe cognitive deficits when ablated in wt animals (adlard., 2010) ; the cognitive effect of znt3 ablation in tg mice has yet to be assessed ]. thus, highly targeted approaches that either increase or decrease a particular metal ion may be inherently confounded. in this ionophores and metal - protein attenuating compounds) may represent the sweet spot of metal - targeted therapeutics for ad because they foster the maintenance and/or restoration of metal ion homeostasis which then impacts a raft of healthy and pathological cellular pathways that ultimately promotes such context - dependent modulation of metal levels may prove critical for long - term therapeutic strategies that target metal ions. a number of metal - targeted approaches have been employed in both preclinical animal studies and human clinical trials, and we have critically reviewed these recently (duce., 2011). however, one of the more promising chaperone candidates that has an evolving literature, particularly surrounding its mechanism of action, is pbt2 (prana biotechnology). utilizing both tg2576 and app / ps1 animals, we have previously demonstrated that varying pbt2 treatment paradigms (acute and chronic dosing) result in significant decreases in histological a plaque burden, a significant decrease in biochemical a load and a significant decrease in interstitial fluid a levels (adlard., 2008). alzheimer s equation is the loss of functional tau resulting from its hyperphosphorylation (and subsequent formation of intracellular neurofibrillary tangles), and to this end, we have demonstrated that pbt2 significantly decreases the levels of phosphorylated tau in animal models of ad (adlard., 2008). thus, the compound has the potential to modulate both major hallmark pathologies in the ad brain. these pathologies, while central to the clinical diagnosis of ad and also reported to be critical to the pathogenesis of disease, are ultimately important more for their downstream effects on normal brain function / cellular pathways. in this regard, ad has often been referred to as a disease of disconnection, where the loss of synaptic connections gradually erodes memory and other higher order cognitive functions to drive the symptomatic presentation of disease (potentially as a direct consequence of the deposition of a). if a therapeutic were to have an effect on a or tau in the absence of any subsequent downstream improvement in critical disease measures (e.g., memory) and their associated anatomical correlates (e.g., synapses and dendritic spines), then the approach would be fundamentally limited and not provide any level of long - term disease modification. in this respect, we have demonstrated that pbt2 significantly increases synaptophysin levels (a surrogate marker for synapses) in transgenic mouse models of ad (adlard., 2008), in addition to restoring hippocampal dendritic spine density in both young and old transgenic mouse models of ad (adlard., 2011). these effects occurred in conjunction with a restoration in the levels of key synaptic proteins involved in cognition, such as nmda receptors as well as elements of the bdnf pathway. preliminary in vitro evidence supported the notion that pbt2 acts in a metal - dependent manner to regulate neurite outgrowth and nmda receptor protein levels (adlard., 2011), and this has been further defined in a more recent study examining the mechanisms of action of pbt2 (crouch., 2011), as described below. pbt2 treatment of sh - sy5y cells has been shown to result in a metal - dependent phosphorylation of glycogen synthase kinase 3 (gsk ; which may occur via an inhibition of the phosphatase calcineurin, whose other substrates such as creb and camkii are also modulated by pbt2) which subsequently inhibits the activity of gsk, one of the major tau kinases in the brain (lei., 2011). importantly, the metals translocated into the cell by pbt2, which can also activate numerous other cellular pathways involved in neuronal and synaptic health, can be effectively sourced from protease - resistant extracellular a:zn aggregates, which themselves then become subject to degradation by endogenous clearance mechanisms such as matrix metalloproteases after the metal is removed from the a. this highlights the biological relevance of the activity of pbt2, and also clearly demonstrates the notion that pbt2 has multiple metal - dependent activities that affect several different key aspects of the ad cascade, including the triad of a, tau and cognition. cumulatively, these specific effects on disease - related pathways and endpoints are likely to represent the major underlying mechanism for the rapid pbt2-dependent reversal of the cognitive impairment observed in vivo (adlard., 2008). these in vitro and in vivo studies showing potential efficacy for this metal chaperone in targeting both biomarkers and the major symptomatic feature of disease are supported by an emerging clinical literature. the safety and efficacy of pbt2 was assessed in a small [n = 29 placebo ; n = 20 low dose pbt2 (50 mg / day) ; n = 29 high dose pbt2 250 mg / day ] 12 week, double - blind and placebo - controlled trial (lannfelt., the safety profile for pbt2 was favorable and it also showed a significant modulation of biomarkers and clinical endpoints. specifically, pbt2 treatment significantly decreased csf levels of a142 in a dose - dependent manner, as compared to the placebo group. cognitive testing, which included adas - cog, mmse and a neuropsychological test battery (ntb), revealed that the high dose treatment group had a significant improvement in executive function compared to the placebo - treated group. further analysis of the cognitive data (faux., 2010) revealed that, based upon a ranking analysis, the high dose treatment group had a significantly higher proportion of patients showing improvement on the ntb composite z - score and executive factor z - score as compared to the placebo group, with the adas - cog data also approaching significance (p = 0.056). there are ongoing ad trials with pbt2, with a 12 month phase ii imaging trial currently recruiting. this study is designed to assess the anatomical correlates of pbt2 treatment, specifically looking at the effect of pbt2 on a plaque load in the living human brain, as well as to consolidate the evidence for longer - term cognitive benefits of this compound (www.pranabio.com). much larger phase iii trials will then be required to definitively establish the efficacy of pbt2 for the treatment of ad. this is a significant hurdle for any new compound to pass, and only in testing will it be established if pbt2 is any different to the other promising phase ii candidates that have not met expectations in phase iii trials. taken together, these data provide compelling evidence for the efficacy of metal - targeted approaches in the treatment of ad, and also specifically point to the use of metal chaperones as being one particularly effective strategy. in this review we have highlighted the reported activities and potential for pbt2, an 8-hydroxy quinoline compound. a recent screen of 200,000 compounds in a yeast model system identified this class of compound as being particularly effective at preventing proteotoxicity. it was also identified that different 8-hydroxy quinolines exhibited distinct activities on metal ion homeostasis and metalloprotein activities (subtle changes to the molecular backbone evinced significant changes in biological activity), implicating the therapeutic potential for different 8-hydroxy quinolines against a range of different neurodegenerative disorders (tardiff., thus, while metal chaperones such as pbt2 may prove efficacious in the treatment of ad and a host of other disorders that are characterized by metal ion dyshomeostasis, it will remain crucial to identify the optimal metal chaperone for a given disorder, and to also treat at the right stage of disease. the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. | as evidence for the role of metal ion dysregulation in the pathogenesis of multiple cns disorders grows, it has become important to more precisely identify and differentiate the biological effects of various pharmacological modulators of metal ion homeostasis. this is particularly evident in disorders such as alzheimer s disease (ad), where the use of metal chaperones (that transport metals), as opposed to chelators (which exclude metals from biological interactions), may prove to be the first truly disease modifying approach for this condition. the purpose of this mini - review is to highlight the emerging notion that metal chaperones, such as pbt2 (prana biotechnology), modulate a variety of critical pathways affecting key aspects of the ad cascade to provide a more holistic approach to the treatment of this disease. |
the prevalence of human immunodeficiency virus (hiv) among adults (above 14 years) in nigeria is estimated to be 3.6%.1 with a population of approximately 150 million, 3.3 million adults lived with hiv / aids in nigeria at the end of 2009. patients infected with hiv have one thing in common ; a deficit in cell mediated immunity, resulting predominantly from a significant reduction in the number of circulating cd4 + t cells. the mechanism by which the virus depletes these cells is not clearly understood and remains one of the most fundamental and controversial issues in aids research. a plausible mechanism involves binding to, and signaling through, cd4 and chemokine receptor molecules on resting cd4 lymphocytes and other cell types of hiv, inducing upregulation of l - selectin and fas. on returning to blood, these resting hiv - signaled cd4 cells home very rapidly back to peripheral lymph nodes and axial bone marrow where they are subsequently induced into apoptosis.2 hiv - infected patients may also develop haematological disorder. this disorder commonly affects all the three cell lines causing anaemia, leucopenia and thrombocytopenia with bone marrow dysplasia being the most common pathology encountered in such patients.3 anaemia in hiv infection may be caused by the same three basic mechnisms that cause anaemia in the general population : decreased production of red cells due to nutritional deficiency of iron, folic acid and vitamin b12 ; renal disorders such as hiv - associated nephropathy (hivan) causing decreased production of endogenous erythropoietin ; bone marrow suppression by proinflammatory cytokines (il-1 and tnf) and antiretroviral drugs such as zidovudine ; increased red cell destruction due to autoantibodies causing autoimmune haemolysis, haemophagocytic syndrome and disseminated intravascular coagulation ; blood loss that may be associated with neoplastic diseases such as kaposi sarcoma in the gastrointestinal tract or with gastrointestinal lesions that accompany opportunistic cytomegalovirus infection and severe immune - mediated thrombocytopenia.4 the haemolysis in aiha is mainly extravascular, but complement - mediated intravascular haemolysis may occur. the usual laboratory features include reticulocytosis and a positive direct antiglobulin test (dat) which detects the antibody coating the red blood cell surface.5 the blood film exhibits polychromasia and spherocytosis, the latter, a hallmark of the disease. despite the high frequency of anaemia and a positive dat in hiv - infected patients, lack of reticulocytosis despite bone marrow hyperplasia may lead to underdiagnosis of aiha.67 reports from africa had shown that aiha is very rare.8910 the rare occurrence may be due to the fact that acquired autoimmune disorders are not common in many parts of africa and according to salawu and durosinmi (2002), africans that develop autoimmune diseases may have hereditary predisposition.8 this view was also supported by volberding.9 and olayeni. who reported a frequency of 3.06% in benin city, nigeria.10 the aim of this study was to demonstrate the frequency of aiha in a cohort of adult nigerian hiv - infected subjects attending the aids prevention initiative nigeria (apin) clinic of the lagos university teaching hospital (luth) and to see if the presence or not of aiha is related to the severity of the disease with regard to the cd4 cell count and haemoglobin concentration. the aims of this study were (1) to determine the prevalence of autoimmune haemolytic anaemia in hiv - infected patients, and (2) to compare the haematological and immunological characteristics of subjects with anaemia and those without. this study was carried out among hiv - infected subjects attending the lagos university teaching hospital (luth), nigeria, after obtaining an informed consent from each participant. inclusion criteria included patients with seropositivity for hiv 1 or 2, and haemoglobin concentration 10 g / dl for controls. all subjects who refused to give consent or were aged less than 14 years were excluded from the study. about 5 mls of venous blood was drawn from each subject into sodium ethylene diamine tetra - acetate (edta) specimen bottles. this sample was used to measure full blood count parameters by sysmex analyzer model kx-21n, made by sysmex coorporation, kobe, japan, and for reticulocyte count and dat. data was analysed using statistical soft ware packages : spss for windows (version 11.5 : spss inc, chicago, il). descriptive statistics, x2 test and student t test were used as appropriate. the critical level of significance the mean age of subjects with anaemia was 36.3 0.5 years and that of subjects without anaemia was 36.1 0.8 years. the age range with the highest number of subjects in both groups was 25 - 40 years and females dominated the study in the two groups. demographic characteristics of subjects table 2 shows that the mean hb concentration of subjects with anaemia was 8.6 1.1 g / dl and 12.4 1.4 g / dl in those without anaemia. subjects with anaemia had lower mean cd4 cell count (284.3 cells/l) and higher mean reticulocyte per cent (1.5%) than the non - anaemic subjects with mean cd4 cell count of 387.2 and mean reticulocyte count per cent of 1.1%. comparison of mean values of haemoglobin, cd4 cell count and reticulocyte% in study group and control group table 3 shows the distribution of reticulocyte count per cent, cd4 cell count and dat among the subjects. the frequency of reticulocytosis (reticulocyte count > 2.5%) was higher in the subjects with anaemia when compared with the control group, as 45 (18%) of the anaemic group had reticulocyte count > 2.5% compared to 2 (2%) of the non - anaemic group. distribution of reticulocyte count, cd4 cell count and direct antiglobulin test among the subjects furthermore, more subjects with anaemia had a lower cd4 cell count than those without. of the 250 hiv - positive subjects with anaemia, 81 (32.4%) had a cd4 cell count 2.5), 16.4% (9 of 55) of subjects within the age range of 41 - 50 years had reticulocytosis, and 6.7% (1 of 15) of the subjects above 50 years had reticulocytosis. the association between reticulocyte count and age of the subjects was statistically insignificant with p = 0.6349. about 82.2% (37 of 45) of the female subjects compared to 17.8% (8 of 45) of the males had reticulocytosis. the association between reticulocyte count and sex of subjects was also not statistically significant (p = 0.0555). table 5 shows association between direct antiglobulin test (dat) and age of hiv - infected subjects with anaemia. the two subjects belonged to the age groups 41 years and above (p = 0.0339). furthermore, though not statiscally significant (p = 0.5118), the two dat - positive subjects were both females but none of them met the criteria that define autoimmune haemolytic anaemia. association between direct antiglobulin test (dat) and age of hiv - infected subjects with anaemia about 16.0% (13 of 81) of subjects with cd4 cell count 200 cells/l, also had reticulocytosis. that none of the subjects met the criteria that define autoimmune haemolytic anaemia (aiha) is in agreement with earlier studies which reported that aiha is rarely seen in hiv infection in africa. this may partly be attributed to the fact that acquired autoimmune disorders are not common in many parts of africa and that africans that develop autoimmune diseases may have hereditary predisposition.8 this view that was also supported by volberding., who in their study observed that aiha is not common in patients with hiv infection.9 it may also partly be due to the suggestion of a presence of anti - erythrocyte autoimmunity without haemolysis in a large number of hiv - infected patients.10 the prevalence of positive dat of 0.6% (2 of 350) found in this study is in contrast with previous studies by de angelis., and koduri., who reported the prevalence of positive dat in hiv - infected patients ranges between 18 and 43%.1011 the two subjects that screened positive to dat in our study, had low mean haemoglobin concentration compared with the mean haemoglobin concentration of those that were dat negative. although not statiscally significant, this observation corroborates the report by lai., who in a study they carried out in roma, italy, observed that patients with positive dat have low average haemoglobin levels when compared to those who are dat - negative.12 our finding also confirmed the observation by de angelis., who reported that dat - positive patients have lower haemoglobin levels than dat - negative patients.13 it was noticed that the two subjects that screened positive to dat were females this agrees with observation by jacobson., who reported that autoimmune conditions are common in females.14 furthermore, that these two subjects were above the age of 40 years, and have a low reticulocyte count may be as a result of decreased erythropoiesis that occurs with increasing age. since the two subjects also had severe immunosuppression (cd4 cell count < 200 cells/l), it may also be due to bone marrow hypoplasia seen primarily in patients with advanced stages of hiv infection.10 however, though the two subjects had severe immunosuppression, we found no statistical significant association between dat and cd4 cell count in this study. we observed that subjects with reticulocytosis were more in the anaemic subjects than in the non - anaemic subjects. it is possible that the cause of anaemia in some of these patients is haemolysis from other conditions such as malaria which is endemic in our environment. 2006).15 it may also be due to infection by human parvovirus b19 which invades erythroid progenitor cells and then replicates extensively, ultimately lysing the infected cell causing severe chronic anaemia.16 autoimmune haemolytic anaemia in hiv infection is a rare complication in our geographical location. for financial and logistics reasons the sample size was not large enough. | background : despite a high frequency of anaemia, a positive direct antiglobulin test (dat) and bone marrow hyperplasia hiv - infected patients, lack of reticulocytosis may cause underdiagnosis autoimmune haemolytic anaemia (aiha) in them. this study was carried out to determine the prevalence of autoimmune haemolytic anaemia in hiv - infected patients and to compare the haematological / immunological characteristics of subjects with anaemia and those without.materials and methods : a total of 350 hiv - infected subjects attending the lagos university teaching hospital who consented were recruited for the study. this included 250 subjects with anaemia (haemoglobin concentration < 10 g / dl) as cases and 100 subjects without anaemia as controls. five milliliters of venous blood drawn from each subject was used for the full blood count, reticulocyte count and dat.results:subjects with anaemia had lower mean cd4 cell count (284.3 cells/l) and higher mean reticulocyte per cent (1.5%) than the non - anaemic subjects. the frequency of reticulocytosis was higher in female subjects than in males. only 0.8% (2 of 250) of the study group screened positive to dat, p = 0.0339. none of the subjects in control group screened positive to dat.conclusion:autoimmune haemolytic anaemia is a rare complication of hiv infection in our geographical location. |
because of their unique ability to self - renew while retaining pluripotency, human embryonic stem cells (hescs) are considered an invaluable resource in regenerative medicine. stem cell mediated repopulation of diseased muscles and hesc- or induced pluripotent stem cells (ipsc)-derived generation of skeletal muscles for in vitro disease modeling are key goals of studies aimed at identifying treatments and elucidating the pathogenesis of many neuromuscular diseases. however, these studies have been challenged by the resistance of hescs to convert into skeletal muscle cells and by the paucity of information regarding the molecular regulation of hesc - commitment toward skeletal myogenesis. indeed, previous attempts to generate skeletal muscle progenitors from hescs revealed that only embryoid body (eb)-derived progenies or mesenchymal cells are competent to activate skeletal myogenesis following ectopic expression of transcriptional activators (e.g. pax3 or myf5) or by exposure to specific culture conditions. we have previously shown that the swi / snf component, baf60c (encoded by smarcd3), is an essential component of the transcriptional machinery that allows myod - mediated activation of muscle - specific loci. we have recently discovered that the selective absence of baf60c confers onto hescs the resistance to myod - mediated activation of skeletal myogenesis that is otherwise observed in baf60c expressing somatic cells, a process commonly referred to as myogenic conversion. forced expression of baf60c enables myod to directly activate skeletal myogenesis in hescs, upon specific culture conditions, with baf60c and myod imposing an epigenetic signature that commits hescs towards the myogenic lineage. of note, previous proteomic analysis revealed the selective absence of baf60c, among the swi / snf components, in escs. we used this knowledge to impose an epigenetic commitment of hescs onto the myogenic lineage, leading to the generation of a homogeneous population of skeletal myoblasts that could be aggregated to form three - dimensional contractile structures (myospheres) that functionally mimic miniaturized skeletal muscles. indeed, our method of generating skeletal muscle progenitors from hescs relies on the epigenetic commitment of hescs to the myogenic lineage, which is phenotypically latent until cells are exposed to differentiation signals, such as cell aggregation and culture in differentiation medium (see specific protocol). this strategy permits the expansion of a homogeneous population of hescs that are epigenetically committed to skeletal muscle lineage and suitable to formation of three - dimensional contractile myospheres that recapitulate histological and functional properties of skeletal muscles. the myospheres provide the first evidence of miniaturized muscles exploitable for a disease in a dish derived ipscs, these myospheres have the potential to elucidate longstanding developmental questions and the pathogenesis of rare diseases, in addition to offering the tremendous potential as a tool for high throughput screening of therapeutic compounds. we also note that one immediate readout of myosphere analysis could be provided by immunohistochemistry on sections, as described in a jove protocol by gomes. recommendations before starting in order to ensure high efficiency of infection, plate hescs for infection on feeder - free conditions (figure 2a) to eliminate cellular competitors during the viral uptake. indeed, mefs are notoriously easier to infect as compared to hescs and are competent for myod - mediated conversion. thus, eliminating mefs from hesc cultures increases the infection rate.it is recommended to have high titer lentiviruses to ensure high efficiency of infection. options to improve efficiency of infection are discussed in the section " checking infection".prepare matrigel - coated plates by adding 1 ml of 1 mg / ml matrigel in each well and leave at least 1 hr at rt (or o / n sealed at 4 c if prepared the day before). in order to ensure high efficiency of infection, plate hescs for infection on feeder - free conditions (figure 2a) to eliminate cellular competitors during the viral uptake indeed, mefs are notoriously easier to infect as compared to hescs and are competent for myod - mediated conversion. options to improve efficiency of infection are discussed in the section " checking infection ". prepare matrigel - coated plates by adding 1 ml of 1 mg / ml matrigel in each well and leave at least 1 hr at rt (or o / n sealed at 4 c if prepared the day before). infection procedure day before the infection add he s cell cloning & recovery supplement in the medium at 1,000x dilution (2 mm final concentration). day 0 - infection with baf60c note : perform the infection of hescs with baf60c first followed by infection with myod. dissociate a well of a 6-well plate of hescs grown as colonies in a single - cell suspension by incubation with 1 ml of tryple for 5 min at 37 c.transfer suspension to a 15-ml tube, add 9 ml of hesc medium and centrifuge for 5 min at 1,200 rpm.during the centrifugation, prepare the infection mix in a clean tube by adding to 1 ml of mtesr1, polybrene (6 mg / ml) and he s cell cloning & recovery supplement (2 mm).re - suspend the cell pellet (approximately 5 x 10 - 1 x 10 cells from one confluent well of hescs) with 1 ml of infection mix and plate onto a 6-well low attachment plate, which prevents the cells from adhering to the plastic.add baf60c - ires - gfp virus at 10moi and incubate 3 hr in the incubatorcollect the cell suspension containing the viruses and divide equally in two matrigel - coated wells. then add 2 ml of mtesr1 + he s cell cloning & recovery supplement to each well and leave o / n in the incubator. day 1 carefully remove the medium containing the virus and replace with 2 ml of mtesr1and he s cell cloning & recovery supplement. day2 - infection with myod before proceeding check the fluorescence status of the cells under a fluorescence microscope to make sure to have a high efficiency of infection. if not, see the section " checking infection".if the cells have reached at least 80% of confluence, proceed as follows ; otherwise wait for an additional day prior to proceeding.remove the medium and add 1 ml of tryple reagent to dissociate the cells. incubate 5 min at 37 c.repeat as described from1.2.2.2 - 1.2.2.6 adding myod virus at 10moi. day 3 carefully remove the medium containing the virus and replace with 2 ml of mtesr1and he s cell cloning & recovery supplement.plate mefs on matrigel coated plates at 2.5 x 10/cmfor the next day to allow propagation of the infected cells. day 4 remove the medium and add 1 ml of tryple reagent to dissociate the cells. incubate 5 min at 37 c.transfer the cells in a 15-ml falcon tube, add 9 ml of hesc medium and centrifuge for 5 min at 1,200 rpm.remove the supernatant and re - suspend in 6 ml of hesc medium.remove the medium from the mefs - containing 6-well plate and plate hescs at 1:2 split ratio, dispensing 3 ml for each mefs - containing well. when the colonies reach confluence, some of the wells of myod / baf60c - infected cells can be frozen in liquid nitrogen as a reserve stock. freezing medium includes 90% of kosr and 10% dmso plus 2 mm he s cell cloning & recovery supplement. the remaining wells can be then exposed to the differentiation protocol - see below for description. if more cells are needed to produce more myospheres, infected hescs can be propagated further as follows : remove the medium and incubate with 1 ml of 1 mg / ml collagenase iv for 5 min at 37 c.remove collagenase iv and add 1 ml of hesc medium.under a dissection microscope scrape the colonies with a 10 ml tip.collect the chunks of colonies in a 15-ml tube and allow to sediment for 3 min. then remove the supernatant, resuspend in hesc medium and plate on mefs plates using a ratio 1:4. day before the infection add he s cell cloning & recovery supplement in the medium at 1,000x dilution (2 mm final concentration). add he s cell cloning & recovery supplement in the medium at 1,000x dilution (2 mm final concentration). day 0 - infection with baf60c note : perform the infection of hescs with baf60c first followed by infection with myod. dissociate a well of a 6-well plate of hescs grown as colonies in a single - cell suspension by incubation with 1 ml of tryple for 5 min at 37 c.transfer suspension to a 15-ml tube, add 9 ml of hesc medium and centrifuge for 5 min at 1,200 rpm.during the centrifugation, prepare the infection mix in a clean tube by adding to 1 ml of mtesr1, polybrene (6 mg / ml) and he s cell cloning & recovery supplement (2 mm).re - suspend the cell pellet (approximately 5 x 10 - 1 x 10 cells from one confluent well of hescs) with 1 ml of infection mix and plate onto a 6-well low attachment plate, which prevents the cells from adhering to the plastic.add baf60c - ires - gfp virus at 10moi and incubate 3 hr in the incubatorcollect the cell suspension containing the viruses and divide equally in two matrigel - coated wells. then add 2 ml of mtesr1 + he s cell cloning & recovery supplement to each well and leave o / n in the incubator. dissociate a well of a 6-well plate of hescs grown as colonies in a single - cell suspension by incubation with 1 ml of tryple for 5 min at 37 c. transfer suspension to a 15-ml tube, add 9 ml of hesc medium and centrifuge for 5 min at 1,200 rpm. during the centrifugation, prepare the infection mix in a clean tube by adding to 1 ml of mtesr1, polybrene (6 mg / ml) and he s cell cloning & recovery supplement (2 mm). re - suspend the cell pellet (approximately 5 x 10 - 1 x 10 cells from one confluent well of hescs) with 1 ml of infection mix and plate onto a 6-well low attachment plate, which prevents the cells from adhering to the plastic. add baf60c - ires - gfp virus at 10moi and incubate 3 hr in the incubator collect the cell suspension containing the viruses and divide equally in two matrigel - coated wells. then add 2 ml of mtesr1 + he s cell cloning & recovery supplement to each well and leave o / n in the incubator. day 1 carefully remove the medium containing the virus and replace with 2 ml of mtesr1and he s cell cloning & recovery supplement. cells will start clumping as shown in figure 2b. carefully remove the medium containing the virus and replace with 2 ml of mtesr1and he s cell cloning & recovery supplement. day2 - infection with myod before proceeding check the fluorescence status of the cells under a fluorescence microscope to make sure to have a high efficiency of infection. if not, see the section " checking infection".if the cells have reached at least 80% of confluence, proceed as follows ; otherwise wait for an additional day prior to proceeding.remove the medium and add 1 ml of tryple reagent to dissociate the cells. incubate 5 min at 37 c.repeat as described from1.2.2.2 - 1.2.2.6 adding myod virus at 10moi. before proceeding check the fluorescence status of the cells under a fluorescence microscope to make sure to have a high efficiency of infection. if not, see the section " checking infection ". if the cells have reached at least 80% of confluence, proceed as follows ; otherwise wait for an additional day prior to proceeding. day 3 carefully remove the medium containing the virus and replace with 2 ml of mtesr1and he s cell cloning & recovery supplement.plate mefs on matrigel coated plates at 2.5 x 10/cmfor the next day to allow propagation of the infected cells. carefully remove the medium containing the virus and replace with 2 ml of mtesr1and he s cell cloning & recovery supplement. plate mefs on matrigel coated plates at 2.5 x 10/cmfor the next day to allow propagation of the infected cells. day 4 remove the medium and add 1 ml of tryple reagent to dissociate the cells. incubate 5 min at 37 c.transfer the cells in a 15-ml falcon tube, add 9 ml of hesc medium and centrifuge for 5 min at 1,200 rpm.remove the supernatant and re - suspend in 6 ml of hesc medium.remove the medium from the mefs - containing 6-well plate and plate hescs at 1:2 split ratio, dispensing 3 ml for each mefs - containing well. when the colonies reach confluence, some of the wells of myod / baf60c - infected cells can be frozen in liquid nitrogen as a reserve stock. freezing medium includes 90% of kosr and 10% dmso plus 2 mm he s cell cloning & recovery supplement. the remaining wells can be then exposed to the differentiation protocol - see below for description. if more cells are needed to produce more myospheres, infected hescs can be propagated further as follows : remove the medium and incubate with 1 ml of 1 mg / ml collagenase iv for 5 min at 37 c.remove collagenase iv and add 1 ml of hesc medium.under a dissection microscope scrape the colonies with a 10 ml tip.collect the chunks of colonies in a 15-ml tube and allow to sediment for 3 min. then remove the supernatant, resuspend in hesc medium and plate on mefs plates using a ratio 1:4. transfer the cells in a 15-ml falcon tube, add 9 ml of hesc medium and centrifuge for 5 min at 1,200 rpm. remove the supernatant and re - suspend in 6 ml of hesc medium. remove the medium from the mefs - containing 6-well plate and plate hescs at 1:2 split ratio, dispensing 3 ml for each mefs - containing well. when the colonies reach confluence, some of the wells of myod / baf60c - infected cells can be frozen in liquid nitrogen as a reserve stock. freezing medium includes 90% of kosr and 10% dmso plus 2 mm he s cell cloning & recovery supplement. the remaining wells can be then exposed to the differentiation protocol - see below for description. if more cells are needed to produce more myospheres, infected hescs can be propagated further as follows : remove the medium and incubate with 1 ml of 1 mg / ml collagenase iv for 5 min at 37 c. remove collagenase iv and add 1 ml of hesc medium. under a dissection microscope scrape the colonies with a 10 ml tip. collect the chunks of colonies in a 15-ml tube and allow to sediment for 3 min. then remove the supernatant, resuspend in hesc medium and plate on mefs plates using a ratio 1:4. checking infection while propagating the cells, it is recommended to plate the infected cells in a smaller scale to harvest for rna analysis and perform protein expression analysis by immunofluorescence in order to check for biomarkers that reflect the correct biological status at each stage (see representative results). for high titer lentiviruses the percentage of expected infected cells should be at least 80%.to ensure high efficiency, the lentiviral vectors can be modified, introducing a fluorescent selection marker and/or an antibiotic resistance. our lentiviral plasmid expressing baf60c also carries gfp fluorescence.sorting hescs for a fluorescent marker. in the case of low efficiency of infection is recommended to use fluorescence activated cells sorting (facs - sorting) to enrich for cells expressing baf60c virus and then infect the cells with high titer myod virus. add he s cell cloning & recovery supplement in the medium the day before the sorting.the day of the sorting, dissociate the cells by tryple (as described at day 0) and resuspend the cells in ko replacement serum plus he s cell cloning & recovery supplement in facs-tubes.at the end of the sorting, collect the cells in ko replacement serum and plate on mefs plates adding he s cell cloning & recovery supplement. while propagating the cells, it is recommended to plate the infected cells in a smaller scale to harvest for rna analysis and perform protein expression analysis by immunofluorescence in order to check for biomarkers that reflect the correct biological status at each stage (see representative results). for high titer lentiviruses the percentage of expected infected cells should be at least 80%. to ensure high efficiency, the lentiviral vectors can be modified, introducing a fluorescent selection marker and/or an antibiotic resistance. our lentiviral plasmid expressing baf60c also carries gfp fluorescence. sorting hescs for a fluorescent marker. in the case of low efficiency of infection is recommended to use fluorescence activated cells sorting (facs - sorting) to enrich for cells expressing baf60c virus and then infect the cells with high titer myod virus. add he s cell cloning & recovery supplement in the medium the day before the sorting.the day of the sorting, dissociate the cells by tryple (as described at day 0) and resuspend the cells in ko replacement serum plus he s cell cloning & recovery supplement in facs-tubes.at the end of the sorting, collect the cells in ko replacement serum and plate on mefs plates adding he s cell cloning & recovery supplement. add he s cell cloning & recovery supplement in the medium the day before the sorting. the day of the sorting, dissociate the cells by tryple (as described at day 0) and resuspend the cells in ko replacement serum plus he s cell cloning & recovery supplement in facs - tubes. at the end of the sorting, collect the cells in ko replacement serum and plate on mefs plates adding he s cell cloning & recovery supplement. induction and differentiation procedure day 0 - eb induction make sure, before starting differentiation from baf60c / myod - infected hescs, to have high number of colonies in the well (figure 2c).for each well remove the medium, wash with pbs and add 1 ml of 1 mg / ml collagenase iv. incubate for 5 min at 37 c.remove collagenase and add 1 ml of eb medium.under a dissection microscope quickly mechanically dissociate the colonies into 400 - 800 cell aggregates by scraping with a 10-ml tip.collect the chunks of colonies in a 15-ml tube and allow to sediment for 3 min. remove the supernatant, re - suspend in 3 ml of eb medium and transfer the cell suspension to one well of a 6-well low attachment plate. if big chunks are present, break them by gently pipetting up and down with a 5-ml pipette, 3 - 4 times. if the cell death is very high (many floating cells and debris) replace the medium by collecting the aggregates in a 15-ml tube by gravity and plate them with 3 ml of fresh eb medium, otherwise proceed as follows.add 1.5 ml of fresh eb medium in the wells day 2 change the medium by collecting the aggregates from the wells in a 15-ml tube. let them settle down for 2 min.remove the supernatant, replace with 3 ml of fresh eb medium and redistribute on the same wells. collect the aggregates as described in 2.1.3.1 and wash once with 2 ml of pbs ; allow the aggregated to sediment.remove pbs and add 3 ml of dm medium ; plate on the same wells. day 6 - day 20 from d6 to d20 replace the medium with fresh medium every 3 days. day 0 - eb induction make sure, before starting differentiation from baf60c / myod - infected hescs, to have high number of colonies in the well (figure 2c).for each well remove the medium, wash with pbs and add 1 ml of 1 mg / ml collagenase iv. incubate for 5 min at 37 c.remove collagenase and add 1 ml of eb medium.under a dissection microscope quickly mechanically dissociate the colonies into 400 - 800 cell aggregates by scraping with a 10-ml tip.collect the chunks of colonies in a 15-ml tube and allow to sediment for 3 min. remove the supernatant, re - suspend in 3 ml of eb medium and transfer the cell suspension to one well of a 6-well low attachment plate. make sure, before starting differentiation from baf60c / myod - infected hescs, to have high number of colonies in the well (figure 2c). for each well remove the medium, wash with pbs and add 1 ml of 1 mg / ml collagenase iv. remove collagenase and add 1 ml of eb medium. under a dissection microscope quickly mechanically dissociate the colonies into 400 - 800 cell aggregates by scraping with a 10-ml tip. collect the chunks of colonies in a 15-ml tube and allow to sediment for 3 min. remove the supernatant, re - suspend in 3 ml of eb medium and transfer the cell suspension to one well of a 6-well low attachment plate. if big chunks are present, break them by gently pipetting up and down with a 5-ml pipette, 3 - 4 times. if the cell death is very high (many floating cells and debris) replace the medium by collecting the aggregates in a 15-ml tube by gravity and plate them with 3 ml of fresh eb medium, otherwise proceed as follows.add 1.5 ml of fresh eb medium in the wells check the size of colonies and the cell death before proceeding. if big chunks are present, break them by gently pipetting up and down with a 5-ml pipette, 3 - 4 times. if the cell death is very high (many floating cells and debris) replace the medium by collecting the aggregates in a 15-ml tube by gravity and plate them with 3 ml of fresh eb medium, otherwise proceed as follows. add 1.5 ml of fresh eb medium in the wells day 2 change the medium by collecting the aggregates from the wells in a 15-ml tube. let them settle down for 2 min.remove the supernatant, replace with 3 ml of fresh eb medium and redistribute on the same wells. remove the supernatant, replace with 3 ml of fresh eb medium and redistribute on the same wells. collect the aggregates as described in 2.1.3.1 and wash once with 2 ml of pbs ; allow the aggregated to sediment.remove pbs and add 3 ml of dm medium ; plate on the same wells. collect the aggregates as described in 2.1.3.1 and wash once with 2 ml of pbs ; allow the aggregated to sediment. remove pbs and add 3 ml of dm medium ; plate on the same wells. day 6 - day 20 from d6 to d20 replace the medium with fresh medium every 3 days. checking myosphere differentiation before proceeding further, it is recommended to check the efficiency of myogenic differentiation within the myospheres by making sections of the myospheres embedded in o.c.t. perform an immunofluorescence staining for myogenic markers such as myognenin (clone f5d, dshb) and myosin heavy chain (clone mf20, dshb) (see representative results). tip ! to be successful with the staining for myogenin on eb sections it is critical to perform antigen retrieval by treatment with sodium dodecyl sulfate (sds) 0.5% for 5 min. additionally, it is possible to use this protocol for the double staining using f5d and mf20 antibodies. before proceeding further, it is recommended to check the efficiency of myogenic differentiation within the myospheres by making sections of the myospheres embedded in o.c.t. perform an immunofluorescence staining for myogenic markers such as myognenin (clone f5d, dshb) and myosin heavy chain (clone mf20, dshb) (see representative results). it is critical to perform antigen retrieval by treatment with sodium dodecyl sulfate (sds) 0.5% for 5 min. additionally, it is possible to use this protocol for the double staining using f5d and mf20 antibodies. esc medium dmem - f12 1 mm l - glutamine 20% knockout serum replacement medium (kosr) 0.1 mm nonessential amino acids (neaa) 50 u / ml penicillin / streptomycin (pen / strep) 0.1 mm beta - mercaptoethanol 8 ng / ml basic fibroblast growth factor (bfgf) eb medium dmem f12 1 mm l - glutamine 15% fbs 5% horse serum dm medium dmef f12 1x its liquid media supplement 1x n-2 supplement recommendations before starting in order to ensure high efficiency of infection, plate hescs for infection on feeder - free conditions (figure 2a) to eliminate cellular competitors during the viral uptake. indeed, mefs are notoriously easier to infect as compared to hescs and are competent for myod - mediated conversion. thus, eliminating mefs from hesc cultures increases the infection rate.it is recommended to have high titer lentiviruses to ensure high efficiency of infection. options to improve efficiency of infection are discussed in the section " checking infection".prepare matrigel - coated plates by adding 1 ml of 1 mg / ml matrigel in each well and leave at least 1 hr at rt (or o / n sealed at 4 c if prepared the day before). in order to ensure high efficiency of infection, plate hescs for infection on feeder - free conditions (figure 2a) to eliminate cellular competitors during the viral uptake indeed, mefs are notoriously easier to infect as compared to hescs and are competent for myod - mediated conversion. options to improve efficiency of infection are discussed in the section " checking infection ". prepare matrigel - coated plates by adding 1 ml of 1 mg / ml matrigel in each well and leave at least 1 hr at rt (or o / n sealed at 4 c if prepared the day before). infection procedure day before the infection add he s cell cloning & recovery supplement in the medium at 1,000x dilution (2 mm final concentration). day 0 - infection with baf60c note : perform the infection of hescs with baf60c first followed by infection with myod. dissociate a well of a 6-well plate of hescs grown as colonies in a single - cell suspension by incubation with 1 ml of tryple for 5 min at 37 c.transfer suspension to a 15-ml tube, add 9 ml of hesc medium and centrifuge for 5 min at 1,200 rpm.during the centrifugation, prepare the infection mix in a clean tube by adding to 1 ml of mtesr1, polybrene (6 mg / ml) and he s cell cloning & recovery supplement (2 mm).re - suspend the cell pellet (approximately 5 x 10 - 1 x 10 cells from one confluent well of hescs) with 1 ml of infection mix and plate onto a 6-well low attachment plate, which prevents the cells from adhering to the plastic.add baf60c - ires - gfp virus at 10moi and incubate 3 hr in the incubatorcollect the cell suspension containing the viruses and divide equally in two matrigel - coated wells. then add 2 ml of mtesr1 + he s cell cloning & recovery supplement to each well and leave o / n in the incubator. day 1 carefully remove the medium containing the virus and replace with 2 ml of mtesr1and he s cell cloning & recovery supplement. day2 - infection with myod before proceeding check the fluorescence status of the cells under a fluorescence microscope to make sure to have a high efficiency of infection. if not, see the section " checking infection".if the cells have reached at least 80% of confluence, proceed as follows ; otherwise wait for an additional day prior to proceeding.remove the medium and add 1 ml of tryple reagent to dissociate the cells. incubate 5 min at 37 c.repeat as described from1.2.2.2 - 1.2.2.6 adding myod virus at 10moi. day 3 carefully remove the medium containing the virus and replace with 2 ml of mtesr1and he s cell cloning & recovery supplement.plate mefs on matrigel coated plates at 2.5 x 10/cmfor the next day to allow propagation of the infected cells. day 4 remove the medium and add 1 ml of tryple reagent to dissociate the cells. incubate 5 min at 37 c.transfer the cells in a 15-ml falcon tube, add 9 ml of hesc medium and centrifuge for 5 min at 1,200 rpm.remove the supernatant and re - suspend in 6 ml of hesc medium.remove the medium from the mefs - containing 6-well plate and plate hescs at 1:2 split ratio, dispensing 3 ml for each mefs - containing well. when the colonies reach confluence, some of the wells of myod / baf60c - infected cells can be frozen in liquid nitrogen as a reserve stock. freezing medium includes 90% of kosr and 10% dmso plus 2 mm he s cell cloning & recovery supplement. the remaining wells can be then exposed to the differentiation protocol - see below for description. if more cells are needed to produce more myospheres, infected hescs can be propagated further as follows : remove the medium and incubate with 1 ml of 1 mg / ml collagenase iv for 5 min at 37 c.remove collagenase iv and add 1 ml of hesc medium.under a dissection microscope scrape the colonies with a 10 ml tip.collect the chunks of colonies in a 15-ml tube and allow to sediment for 3 min. then remove the supernatant, resuspend in hesc medium and plate on mefs plates using a ratio 1:4. day before the infection add he s cell cloning & recovery supplement in the medium at 1,000x dilution (2 mm final concentration). add he s cell cloning & recovery supplement in the medium at 1,000x dilution (2 mm final concentration). day 0 - infection with baf60c note : perform the infection of hescs with baf60c first followed by infection with myod. dissociate a well of a 6-well plate of hescs grown as colonies in a single - cell suspension by incubation with 1 ml of tryple for 5 min at 37 c.transfer suspension to a 15-ml tube, add 9 ml of hesc medium and centrifuge for 5 min at 1,200 rpm.during the centrifugation, prepare the infection mix in a clean tube by adding to 1 ml of mtesr1, polybrene (6 mg / ml) and he s cell cloning & recovery supplement (2 mm).re - suspend the cell pellet (approximately 5 x 10 - 1 x 10 cells from one confluent well of hescs) with 1 ml of infection mix and plate onto a 6-well low attachment plate, which prevents the cells from adhering to the plastic.add baf60c - ires - gfp virus at 10moi and incubate 3 hr in the incubatorcollect the cell suspension containing the viruses and divide equally in two matrigel - coated wells. then add 2 ml of mtesr1 + he s cell cloning & recovery supplement to each well and leave o / n in the incubator. dissociate a well of a 6-well plate of hescs grown as colonies in a single - cell suspension by incubation with 1 ml of tryple for 5 min at 37 c. transfer suspension to a 15-ml tube, add 9 ml of hesc medium and centrifuge for 5 min at 1,200 rpm. during the centrifugation, prepare the infection mix in a clean tube by adding to 1 ml of mtesr1, polybrene (6 mg / ml) and he s cell cloning & recovery supplement (2 mm). re - suspend the cell pellet (approximately 5 x 10 - 1 x 10 cells from one confluent well of hescs) with 1 ml of infection mix and plate onto a 6-well low attachment plate, which prevents the cells from adhering to the plastic. add baf60c - ires - gfp virus at 10moi and incubate 3 hr in the incubator collect the cell suspension containing the viruses and divide equally in two matrigel - coated wells. then add 2 ml of mtesr1 + he s cell cloning & recovery supplement to each well and leave o / n in the incubator. day 1 carefully remove the medium containing the virus and replace with 2 ml of mtesr1and he s cell cloning & recovery supplement. cells will start clumping as shown in figure 2b. carefully remove the medium containing the virus and replace with 2 ml of mtesr1and he s cell cloning & recovery supplement. day2 - infection with myod before proceeding check the fluorescence status of the cells under a fluorescence microscope to make sure to have a high efficiency of infection. if not, see the section " checking infection".if the cells have reached at least 80% of confluence, proceed as follows ; otherwise wait for an additional day prior to proceeding.remove the medium and add 1 ml of tryple reagent to dissociate the cells. incubate 5 min at 37 c.repeat as described from1.2.2.2 - 1.2.2.6 adding myod virus at 10moi. before proceeding check the fluorescence status of the cells under a fluorescence microscope to make sure to have a high efficiency of infection. if not, see the section " checking infection ". if the cells have reached at least 80% of confluence, proceed as follows ; otherwise wait for an additional day prior to proceeding. day 3 carefully remove the medium containing the virus and replace with 2 ml of mtesr1and he s cell cloning & recovery supplement.plate mefs on matrigel coated plates at 2.5 x 10/cmfor the next day to allow propagation of the infected cells. carefully remove the medium containing the virus and replace with 2 ml of mtesr1and he s cell cloning & recovery supplement. plate mefs on matrigel coated plates at 2.5 x 10/cmfor the next day to allow propagation of the infected cells. day 4 remove the medium and add 1 ml of tryple reagent to dissociate the cells. incubate 5 min at 37 c.transfer the cells in a 15-ml falcon tube, add 9 ml of hesc medium and centrifuge for 5 min at 1,200 rpm.remove the supernatant and re - suspend in 6 ml of hesc medium.remove the medium from the mefs - containing 6-well plate and plate hescs at 1:2 split ratio, dispensing 3 ml for each mefs - containing well. when the colonies reach confluence, some of the wells of myod / baf60c - infected cells can be frozen in liquid nitrogen as a reserve stock. freezing medium includes 90% of kosr and 10% dmso plus 2 mm he s cell cloning & recovery supplement. the remaining wells can be then exposed to the differentiation protocol - see below for description. if more cells are needed to produce more myospheres, infected hescs can be propagated further as follows : remove the medium and incubate with 1 ml of 1 mg / ml collagenase iv for 5 min at 37 c.remove collagenase iv and add 1 ml of hesc medium.under a dissection microscope scrape the colonies with a 10 ml tip.collect the chunks of colonies in a 15-ml tube and allow to sediment for 3 min. then remove the supernatant, resuspend in hesc medium and plate on mefs plates using a ratio 1:4. transfer the cells in a 15-ml falcon tube, add 9 ml of hesc medium and centrifuge for 5 min at 1,200 rpm. remove the supernatant and re - suspend in 6 ml of hesc medium. remove the medium from the mefs - containing 6-well plate and plate hescs at 1:2 split ratio, dispensing 3 ml for each mefs - containing well. when the colonies reach confluence, some of the wells of myod / baf60c - infected cells can be frozen in liquid nitrogen as a reserve stock. freezing medium includes 90% of kosr and 10% dmso plus 2 mm he s cell cloning & recovery supplement. the remaining wells can be then exposed to the differentiation protocol - see below for description. if more cells are needed to produce more myospheres, infected hescs can be propagated further as follows : remove the medium and incubate with 1 ml of 1 mg / ml collagenase iv for 5 min at 37 c. remove collagenase iv and add 1 ml of hesc medium. under a dissection microscope scrape the colonies with a 10 ml tip. collect the chunks of colonies in a 15-ml tube and allow to sediment for 3 min. then remove the supernatant, resuspend in hesc medium and plate on mefs plates using a ratio 1:4. checking infection while propagating the cells, it is recommended to plate the infected cells in a smaller scale to harvest for rna analysis and perform protein expression analysis by immunofluorescence in order to check for biomarkers that reflect the correct biological status at each stage (see representative results). for high titer lentiviruses the percentage of expected infected cells should be at least 80%.to ensure high efficiency, the lentiviral vectors can be modified, introducing a fluorescent selection marker and/or an antibiotic resistance. our lentiviral plasmid expressing baf60c also carries gfp fluorescence.sorting hescs for a fluorescent marker. in the case of low efficiency of infection is recommended to use fluorescence activated cells sorting (facs - sorting) to enrich for cells expressing baf60c virus and then infect the cells with high titer myod virus. add he s cell cloning & recovery supplement in the medium the day before the sorting.the day of the sorting, dissociate the cells by tryple (as described at day 0) and resuspend the cells in ko replacement serum plus he s cell cloning & recovery supplement in facs-tubes.at the end of the sorting, collect the cells in ko replacement serum and plate on mefs plates adding he s cell cloning & recovery supplement. while propagating the cells, it is recommended to plate the infected cells in a smaller scale to harvest for rna analysis and perform protein expression analysis by immunofluorescence in order to check for biomarkers that reflect the correct biological status at each stage (see representative results). for high titer lentiviruses the percentage of expected infected cells should be at least 80%. to ensure high efficiency, the lentiviral vectors can be modified, introducing a fluorescent selection marker and/or an antibiotic resistance. our lentiviral plasmid expressing baf60c also carries gfp fluorescence. sorting hescs for a fluorescent marker. in the case of low efficiency of infection is recommended to use fluorescence activated cells sorting (facs - sorting) to enrich for cells expressing baf60c virus and then infect the cells with high titer myod virus. add he s cell cloning & recovery supplement in the medium the day before the sorting.the day of the sorting, dissociate the cells by tryple (as described at day 0) and resuspend the cells in ko replacement serum plus he s cell cloning & recovery supplement in facs-tubes.at the end of the sorting, collect the cells in ko replacement serum and plate on mefs plates adding he s cell cloning & recovery supplement. add he s cell cloning & recovery supplement in the medium the day before the sorting. the day of the sorting, dissociate the cells by tryple (as described at day 0) and resuspend the cells in ko replacement serum plus he s cell cloning & recovery supplement in facs - tubes. at the end of the sorting, collect the cells in ko replacement serum and plate on mefs plates adding he s cell cloning & recovery supplement. induction and differentiation procedure day 0 - eb induction make sure, before starting differentiation from baf60c / myod - infected hescs, to have high number of colonies in the well (figure 2c).for each well remove the medium, wash with pbs and add 1 ml of 1 mg / ml collagenase iv. incubate for 5 min at 37 c.remove collagenase and add 1 ml of eb medium.under a dissection microscope quickly mechanically dissociate the colonies into 400 - 800 cell aggregates by scraping with a 10-ml tip.collect the chunks of colonies in a 15-ml tube and allow to sediment for 3 min. remove the supernatant, re - suspend in 3 ml of eb medium and transfer the cell suspension to one well of a 6-well low attachment plate. if big chunks are present, break them by gently pipetting up and down with a 5-ml pipette, 3 - 4 times. if the cell death is very high (many floating cells and debris) replace the medium by collecting the aggregates in a 15-ml tube by gravity and plate them with 3 ml of fresh eb medium, otherwise proceed as follows.add 1.5 ml of fresh eb medium in the wells day 2 change the medium by collecting the aggregates from the wells in a 15-ml tube. let them settle down for 2 min.remove the supernatant, replace with 3 ml of fresh eb medium and redistribute on the same wells. collect the aggregates as described in 2.1.3.1 and wash once with 2 ml of pbs ; allow the aggregated to sediment.remove pbs and add 3 ml of dm medium ; plate on the same wells. day 6 - day 20 from d6 to d20 replace the medium with fresh medium every 3 days. day 0 - eb induction make sure, before starting differentiation from baf60c / myod - infected hescs, to have high number of colonies in the well (figure 2c).for each well remove the medium, wash with pbs and add 1 ml of 1 mg / ml collagenase iv. incubate for 5 min at 37 c.remove collagenase and add 1 ml of eb medium.under a dissection microscope quickly mechanically dissociate the colonies into 400 - 800 cell aggregates by scraping with a 10-ml tip.collect the chunks of colonies in a 15-ml tube and allow to sediment for 3 min. remove the supernatant, re - suspend in 3 ml of eb medium and transfer the cell suspension to one well of a 6-well low attachment plate. make sure, before starting differentiation from baf60c / myod - infected hescs, to have high number of colonies in the well (figure 2c). for each well remove the medium, wash with pbs and add 1 ml of 1 mg / ml collagenase iv. remove collagenase and add 1 ml of eb medium. under a dissection microscope quickly mechanically dissociate the colonies into 400 - 800 cell aggregates by scraping with a 10-ml tip. collect the chunks of colonies in a 15-ml tube and allow to sediment for 3 min. remove the supernatant, re - suspend in 3 ml of eb medium and transfer the cell suspension to one well of a 6-well low attachment plate. if big chunks are present, break them by gently pipetting up and down with a 5-ml pipette, 3 - 4 times. if the cell death is very high (many floating cells and debris) replace the medium by collecting the aggregates in a 15-ml tube by gravity and plate them with 3 ml of fresh eb medium, otherwise proceed as follows.add 1.5 ml of fresh eb medium in the wells check the size of colonies and the cell death before proceeding. if big chunks are present, break them by gently pipetting up and down with a 5-ml pipette, 3 - 4 times. if the cell death is very high (many floating cells and debris) replace the medium by collecting the aggregates in a 15-ml tube by gravity and plate them with 3 ml of fresh eb medium, otherwise proceed as follows. add 1.5 ml of fresh eb medium in the wells day 2 change the medium by collecting the aggregates from the wells in a 15-ml tube. let them settle down for 2 min.remove the supernatant, replace with 3 ml of fresh eb medium and redistribute on the same wells. change the medium by collecting the aggregates from the wells in a 15-ml tube. remove the supernatant, replace with 3 ml of fresh eb medium and redistribute on the same wells. collect the aggregates as described in 2.1.3.1 and wash once with 2 ml of pbs ; allow the aggregated to sediment.remove pbs and add 3 ml of dm medium ; plate on the same wells. collect the aggregates as described in 2.1.3.1 and wash once with 2 ml of pbs ; allow the aggregated to sediment. remove pbs and add 3 ml of dm medium ; plate on the same wells. day 6 - day 20 from d6 to d20 replace the medium with fresh medium every 3 days. checking myosphere differentiation before proceeding further, it is recommended to check the efficiency of myogenic differentiation within the myospheres by making sections of the myospheres embedded in o.c.t. perform an immunofluorescence staining for myogenic markers such as myognenin (clone f5d, dshb) and myosin heavy chain (clone mf20, dshb) (see representative results). it is critical to perform antigen retrieval by treatment with sodium dodecyl sulfate (sds) 0.5% for 5 min. additionally, it is possible to use this protocol for the double staining using f5d and mf20 antibodies. before proceeding further, it is recommended to check the efficiency of myogenic differentiation within the myospheres by making sections of the myospheres embedded in o.c.t. perform an immunofluorescence staining for myogenic markers such as myognenin (clone f5d, dshb) and myosin heavy chain (clone mf20, dshb) (see representative results). to be successful with the staining for myogenin on eb sections it is critical to perform antigen retrieval by treatment with sodium dodecyl sulfate (sds) 0.5% for 5 min. additionally, it is possible to use this protocol for the double staining using f5d and mf20 antibodies. esc medium dmem - f12 1 mm l - glutamine 20% knockout serum replacement medium (kosr) 0.1 mm nonessential amino acids (neaa) 50 u / ml penicillin / streptomycin (pen / strep) 0.1 mm beta - mercaptoethanol 8 ng / ml basic fibroblast growth factor (bfgf) eb medium dmem f12 1 mm l - glutamine 15% fbs 5% horse serum dm medium dmef f12 1x its liquid media supplement 1x n-2 supplement the critical steps to control (indicated by the arrows) are the efficiency of the infection in hescs and the myogenic conversion within the myospheres. in our experiments we usually infect the cells with baf60c and facs - sort 72 hr after the infection to enrich for the population expressing baf60c. when the cells reach around 70 - 80% of confluence, we infect with myod lentivirus. after the first infection it normally takes two or three days for the cells to reach that confluence. figure 1b shows expression levels of the exogenous genes as fold induction relative to hescs not infected. figure 1c shows the expression and distribution at the protein level of the factors introduced. baf60c expression is shown as gfp fluorescence, while myod expression is detected by immunofluorescence with a myod antibody. we consider day 0 the day we start the differentiation of infected hescs into eb - like aggregates. after 15 days in dm medium, a portion of the myospheres (usually one entire well) is embedded in o.c.t. figure 1d shows representative staining for myogenin and myosin heavy chain in an optimal myogenic differentiation. myospheres can have different or unusual shapes, perhaps as a result of fusion with smaller myospheres. starting from day 10, it is possible to observe sporadic contraction in the myospheres (see movie 1 and 2). b) mrna levels of the exogenous genes in hescs infected with baf60c and myod (h9-bm) monitored by qrt - pcr and expressed as fold induction, as compared to mock infected hescs (h9-ctr). c) immunofluorescence images showing myod staining (red) and baf60c fluorescence (green) due to the ires - gfp element in the vector. d) immunofluorescence performed on myosphere sections stained for myogenin (myog), myosin heavy chain (myhc) and counterstained for dapi (see immunofluorescence details). representative pictures of cell appearance at different stages of the protocol from the infection (part i) to the differentiation (part ii). scale bar is 100 m. whereas eb - like structures from d1 to d5 are mostly circular in shape (d), myospheres grown over 15 days according the scheme in figure 1a present an unpredictable shape and are heterogeneous in culture ; see two examples in e and f. the protocol proposed here describes how to generate three - dimensional clusters of contractile myofibers (myospheres) directly from hescs. the strategy proposed has the unprecedented and extraordinary potential to produce mini muscles in suspension that can be suitable as a " disease in a dish " model for both screening assays and developmental studies. moreover, the method to generate myospheres from hescs is straightforward and does not require any facs - sorting step during the differentiation, which typically has a negative impact on the yield of cells recovered. besides, a sorting procedure during the differentiation would interfere with the aggregation since it implies a dissociation of the eb into single cells. the method proposed is based on the epigenetic reprograming of hescs with specific factors, myod and baaf60c, which are not expressed in pluripotent embryonic stem cells. myod and baf60c provide the " core " protein complex that marks the genomic loci from which transcription proceeds to activate the skeletal myogenic program. the two factors are delivered to the cells by means of lentiviral infections and it is therefore critical to obtain a high efficiency of infection of both factors in all cells. this can be achieved by using high titer viruses or viruses endowed with selection markers. culture conditions also play an important role in optimizing the extent of the myogenic differentiation. we propose a serum - based differentiation protocol for the differentiation of myod / baf60c expressing hescs into clusters of myogenic precursors, followed by incubation in serum - free defined medium (containing insulin transferrin - its) to achieve conversion of myogenic precursors into skeletal myotubes. however, it is possible that other defined media can achieve an equal or better myogenic differentiation. one current limitation of the protocol is that it relies on the use of fetal bovine serum, which, besides containing many animal proteins and substances, shows lot - to - lot variations. this may result in lower efficiency or heterogeneity of myogenic conversion within myospheres. of note, not all the eb - like structures derived from baf60/myod - expressing hescs are myospheres ; namely, some are eb - like aggregates fully composed of myofibers. the number of myospheres normally derived from hescs expressing baf60c and myod can vary from 30 to 60% as estimated by immunostaining on eb sections performed at the end of the protocol (see results). a potential approach to enrich a culture dish for only myospheres would be to use a myogenic reporter. this would facilitate discarding the partially or not differentiated eb - like clusters and selecting only the myospheres. lastly, a better understanding of the mechanisms underlying the temporal requirements of the factors introduced would be useful to improve the method of delivery. for example, if baf60c and myod are required only for short time to " kick " the cells in the right direction, methods based on modified mrna delivery might be applied. by contrast, if the factors are required for a longer time before the cells exploit their endogenous proteins, an episomal approach would be recommended to eliminate variability and uncontrolled effects due to integration in the genome. finally, we note that it is mandatory to express baf60c prior to or at the same time as myod (never after) in order to achieve hesc conversion into skeletal muscles. the requirement for prior expression of baf60c presumably relies on its role in pre - setting the epigenetic landscape for proper myod chromatin distribution through the genome. as such, future protocols might be improved by compounds or other manipulations that promote baf60c expression in hescs. | generation of a homogeneous and abundant population of skeletal muscle cells from human embryonic stem cells (hescs) is a requirement for cell - based therapies and for a " disease in a dish " model of human neuromuscular diseases. major hurdles, such as low abundance and heterogeneity of the population of interest, as well as a lack of protocols for the formation of three - dimensional contractile structures, have limited the applications of stem cells for neuromuscular disorders. we have designed a protocol that overcomes these limits by ectopic introduction of defined factors in hescs - the muscle determination factor myod and swi / snf chromatin remodeling complex component baf60c - that are able to reprogram hescs into skeletal muscle cells. here we describe the protocol established to generate hesc - derived myoblasts and promote their clustering into tridimensional miniaturized structures (myospheres) that functionally mimic miniaturized skeletal muscles7. |
one of the most essential components of the evaluation programs on children 's health status is investigation of their developmental skills. nowadays, social changes, advancements in medical sciences, burdensome economic condition, and disabling changes in the families have resulted in occurrence of behavioral, social, and educational problems in children, which can have a negative effect on their development and lead to challenges in their childhood and adolescence period. there is no accurate estimation about the prevalence of developmental disorders in the general population of iranian children. but few studies conducted in this context show a relatively high prevalence of these disorders among the children. one of the most appropriate childhood periods to investigate developmental skills is between 36 and 60 months of age. during this period, the child has a rapid pace of development in physical, motor, cognitive, verbal, and socio - psychological skills. absence of such an important information resource for determination of children developmental status results in a defective assessment. numerous studies have recently shown that parents can yield accurate information about their children 's developmental status, regardless of their different socio - economic status, geographical location of residence, or even their level of education. a study conducted in boston in 2009 showed that routine use of parents information in assessment of children 's developmental status can facilitate early diagnosis of their developmental disorders, as the afore - mentioned study led to detection of 61.6% of these children with developmental disorders. parents participation in these assessments also yields valuable information about their children 's development and, therefore, helps them have relevant and logical expectations from their children. in addition, with regard to the high costs of children 's developmental status assessments conducted by the specialists, completion of the developmental skills questionnaire to assess large groups of children in the initial stages of assessment is more cost effective. the american academy of pediatrics recommends assessment of developmental skills in health care centers from the first week of life and at ages of 2 weeks, 2, 4, 6, 9, 12, 15, and 18 months, 2, 2.5, and 3 years, and once a year until the age of 6 years, and every 2 years between 6 years of age and adolescence period for all children. in iran, assessment of growth and development is conducted in health care centers by health aids in rural areas and by technicians or bachelors of health in urban areas. in the series of assessments that continue until the age of 8 years, the children are routinely assessed concerning their weight gain and height, but are less assessed with regard to their developmental trend. therefore, a delayed development in children is diagnosed at higher ages (entrance to primary school) in iran compared to other countries. the researcher has witnessed inadequate attention paid to children 's developmental skills during her attendance in health care houses, health care centers, and daycare centers in isfahan. therefore, with regard to irrecoverable complications of delayed assessment of children 's developmental skills at different ages, this study aimed to determine the developmental skills of 36 - 60-month - old children in isfahan daycare centers. firstly, the list of all daycare centers in 14 districts in isfahan (based on municipal categorization) was obtained from the isfahan province welfare office, and a daycare center was selected through convenient random sampling from each district. the name list of children aged 36 - 60 months was extracted from the selected daycare center, and 14 children were selected from the extracted list as the subjects in each daycare center. inclusion criteria were children with iranian nationality, born and residing in isfahan, living with their biological parents, no chronic diseases in children or parents, and the parents who voluntarily accepted for their children 's participation in the study. the number of the subjects was calculated as 196 children by the following formula and with a confidence interval of 1.96, power of 0.84, and d = 0.25 : finally, from each municipal district, one daycare center was selected, and from each daycare center, 14 children meeting the inclusion criteria were selected. one of the researchers attended the daycare center, introduced herself to the manager, and then met the parents and gave them enough explanations about the research goals during an orientation session. the researcher ensured the parents about the confidentiality of their children 's data, and after the parents signed a written consent form, they were explained how to complete the questionnaires and were asked to return the completed questionnaires to the daycare manager within 2 - 3 days. the data collection tools were a demographic information questionnaire and the third version of ages and stages questionnaire. this (each) questionnaire has been prepared for developmental skills assessment at a specific age rank, so insufficient knowledge of parents about the normal pattern of child development could not leads to their miss judgment. therefore, most of the researches who intend to investigate children 's developmental skills through their parents reports use this questionnaire. this test includes 19 questionnaires for 19 different age groups (4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 27, 30, 33, 36, 42, 48, 54, and 60 months) and is completed by the parents. in the present study, the questionnaires specific for the age groups of 36, 42, 48, 54, and 60 months were used. for instance, the questionnaire for the age of 36 months can be used for children aged 35 - 37 months. each questionnaire contains 30 questions in five domains : communications, gross motor, fine motor, problem solving, and personal - social (each domain contains six questions). yes indicates the child can thoroughly do the activity, not yet indicates the child has not done the activity yet, and the response yes is scored 10 points, sometimes is scored 5 points, and the response no is scored zero. the total score is separately calculated for each domain and is compared with the cut - off point related to that domain and in the same age group (scores in each domain range 0 - 60 points). if the score of each developmental domain is less than or equal to the related cut - off point, it shows that the child probably has delayed development and needs to refer for more evaluation and follow - up. the questionnaire has been designed in a way that the people with even primary school education can understand the items well. the questionnaire of ages and stages is an internationally valid tool with a sensitivity of 82 - 89% and specificity of 77 - 92%. in iran, translation, equalization, and standardization of the questionnaire were conducted in 2002 and 2008 under the supervision of ministry of health, treatment and medical education, unisef, exceptional child education and training organization, population and family health office, and exceptional child research center. its validity, reliability, and power of test for diagnosis of developmental disorder were reported to be 0.84, 0.94, and over 96%, respectively. in addition, a study was conducted in tehran in 2006 with the goal of standardization and validation of ages and stages questionnaire and the cronbach 's alpha was calculated to be 0.79, showing its scientific reliability. after collection of the completed questionnaires, the related score for each child was calculated by one of the researchers. data were analyzed by descriptive statistical methods. cut - off points for each developmental domain based on age groups scientific and ethical considerations of this study has been approved by isfahan university of medical sciences. scientific and ethical considerations of this study has been approved by isfahan university of medical sciences. in this study, 103 male (52.6%) and 93 female (47.4%) children (out of total number of 196 subjects) participated. 29.6% of the children were in the age group 59 - 61 months, 24.5% in the age group 53 - 55 months, 18.9% in the age group 47 - 49 months, 16.3% in the age group 41 - 43 months, and 10.7% were in the age group 35 - 37 months. mean age of entering a daycare center was 38.06 (sd = 11.85) months and mean hours of attendance in the daycare center was 4.4 (sd = 1.3) h / day. 58.6% and 50.5% of the subjects fathers and mothers had a university educational degree, respectively. most of the subjects (91.2%) had normal birth weight (2500 - 4000 g). the obtained results showed that in making communication, gross motor, fine motor, problem solving, and personal social domains, 1.5%, 3.1%, 7.7%, 7.7%, and 2% of the children scored below or equal to the cut - off point. the highest frequency was for delays in development in the domains of fine motor and problem solving [table 2 ]. distribution of subjects scores based on cut - off points in different developmental domains mean and statistical indices of subjects different developmental domains scores the obtained results showed that some of the subjects had obtained scores lower than or equal to the cut - off points in all developmental domains and needed a follow - up. this was more frequent in fine motor and problem - solving domains, compared to others. in the study of kerstjens. on 544 dutch children aged 46 months, the subjects needed a follow - up in all domains, especially in gross motor. in the study of nelson. on 1171 children aged 36 - 60 months among the general population and in the study of troude. on 179 children aged 36 months among the general population, some of the subjects obtained scores less than or equal to the cut - off point and needed a follow - up, especially in fine motor domain. the frequency distribution of children with developmental delay in the present study was different from the above - mentioned studies in gross motor, fine motor, and personal - social domains (either higher or lesser). cultural differences including methods of child breeding, parental style, families socio - economic status, etc. meanwhile, in the domain of making communication, the number of the studied children in isfahan who needed follow - up was less than that in all the afore - mentioned countries, and in the domain of problem solving, it was more. different sample sizes and subjects characteristics in the above - mentioned studies and in the present study may have played a role in the observed difference. dorre., in a study on 114 children aged 4 - 60 months with a history of hospitalization in neonatal intensive care unit (nicu) in arak, iran, used ages and stages questionnaire and showed that making communication was the most frequent developmental disorder among subjects. a lower percentage of children needed follow - up in all developmental domains in the present study compared to dorre. ali akbari., in an investigation on the correlation between high - risk pregnancy with developmental retardation in 356 children of age 4 - 60 months in isfahan, showed that the subjects had major problems in fine motor and gross motor domains. but in the present study, the subjects needed a follow - up in fine motor and gross motor domains. comparison of the present study with the other studies conducted in iran also showed a different prevalence in developmental retardation among the children. comparison of the mean developmental scores of the subjects in the present study with those of kerstjens. 's study shows that the mean scores in the domains of communication, gross motor, and fine motor were higher in the present study compared to their study, although they were lower in problem - solving domain and equal in personal - social domain. a reason for this difference can be the different characteristics of the subjects, as in kerstjens. 's study, 72.9% of the subjects (1510 out of 2072) had a history of being pre - term, but in the present study, mothers were unaware of their children 's history of being pre - term and 6% (n = 13) of the subjects had birth weight lower than 2500 g. as the history of prematurity and low birth weight can negatively affect the trend of development, it can be the reason for lower score of children 's development obtained in kerstjens. 's study, compared to the present study. on the other hand, in the present study, 58.6% of the mothers had university education, whereas 28.5% of the mothers had university education in kerstjens. as the mothers level of education can affect their understanding of the questionnaire items or their accountability in giving responses to the questions, it can be a reason for the different results obtained in these two studies, although cultural differences and their effects should not be ignored. the obtained results showed that the children needed developmental follow - up mostly in fine motor, problem - solving, and gross motor domains. therefore, the health care centers staff should pay a close attention to this issue and teach families the related developmental skills, especially in these domains. the developmental status of the children in different age groups should be regularly monitored, as timely diagnosis of developmental problems and initiation of proper treatment can prevent many of the disabilities occurring to these children in future. | background : assessment of developmental skills is one of the most essential components of children 's health evaluation. since several pubertal disorders are caused by parental negligence in diagnosis, prevention, and treatment of childhood problems, failure to make a timely diagnosis of these problems could have adverse effects on the health of children in future. this study was conducted to determine the developmental skills of 36 - 60-month - old children in isfahan.materials and methods : in this cross - sectional study, 196 children, aged 36 - 60 months, were recruited through random cluster sampling. ages and stages questionnaire was filled for each subject by their parents (father, mother, or both), and the frequency of developmental delay was determined based on cut - off points. the data were analyzed by descriptive statistics using spss 20.0.results:about 52.6% of the children were male. mean age of the children was 50.71 (sd = 8.16) months. the abnormal findings were in the five domains of communication (1.5%), gross motor (3.1%), fine motor (7.7%), problem solving (7.7%) and personal - social (2%).conclusions : the results suggest that some of the children had scores below or equal to the cut - off points and needed more evaluation by a professional person. the domains in which the children had problems were fine motor, problem solving, and gross motor. therefore, health staff should pay more attention to assessment of these domains and parents should be trained to develop their children 's skills in these domains. |
summarydeficits in prefrontal cholinergic function are implicated in cognitive impairment in many neuropsychiatric diseases, but acetylcholine s specific role remains elusive. rhesus monkeys with selective lesions of cholinergic input to prefrontal cortex were unimpaired in tests of decision - making and episodic memory that require intact prefrontal cortex, but were severely impaired on a spatial working memory task. these observations are consistent with a specific role for prefrontal acetylcholine in working memory. |
|
in addition to the known harmful effects caused to the human body, the oral cavity is directly affected by the smoking habit. several studies have demonstrated that tobacco is, per se, a risk factor in the etiology of periodontal disease, with a local and systemic effect9,28. a positive association between cigarette smoking and acute necrotizing ulcerative gingivitis (anug) was first reported over 4 decades ago23. recent studies have confirmed a greater prevalence of attachment loss2,25, recession2, severe destructive periodontal disease9,12 and less favorable response to nonsurgical2,25 or surgical2 periodontal treatment in smokers, as compared to non - smokers. additionally, it seems difficult to discern the effect caused by tobacco from that provoked by bacterial infection15. in this regard, recent knowledge on plaque formation is controversial as for the possibility that smoking may interfere with the natural occurrence of plaque accumulation on dental surfaces. regarding periodontal blood supply, several studies related to plaque - induced gingivitis, showed a reduction of clinical signs10,11, with a smaller propensity for gingival bleeding7,8,10, owing to vascular changes caused by smoking7. clinical and epidemiological studies also reported that most refractory periodontal condition cases occur in smokers and that there is a dose - dependant relation, in which, the greater the quantity of cigarettes smoked a day and the duration of the smoking habit, the greater the periodontal bone loss9. therefore, the purpose of this study was to compare periodontal clinical parameters of probing depth (pd), clinical attachment level (cal), gingival index (gi), gingival bleeding index (gbi), plaque index (pi) and gingival recession (gr) between smoking and non - smoking groups and correlate these parameters between groups. the sample was composed of 55 subjects, being 29 smokers (55.2% females and 44.8% males) and 26 non - smokers (65.4% females and 34.6% males). the participants were recruited from private practices in the city of cascavel, pr, brazil. the patients attended a lecture on periodontal disease, tobacco as a risk factor on the oral cavity and were given information on the research project. the study design and informed consent form were approved by the ethics in research committee of the dental school of bauru, university of so paulo (process number 019/2002/fob). the criteria for sample screening were : 1) non - smokers and smokers between 30 and 50 years of age ; 2) smokers of approximately 1 pack or more of cigarettes / day ; 3) absence of systemic or acute periodontal alterations ; 4) no periodontal treatment in the previous 6 months ; 5) no antibiotic therapy within the previous 8 months ; 6) at least one region with periodontal pocket of 5 mm or more, in a posterior tooth. patients were given no instruction on hygiene and oral physiotherapy, and no procedure of basic preparation was carried out, not to interfere with clinical data collection. the following clinical parameters were evaluated : probing depth (pd), clinical attachment level (cal), gingival index (gi - le19), gingival bleeding index (gbi - ainamo and bay3), plaque index (pi - silness and le27) and gingival recession (gr). the measurements were performed with a michigan (hu - friedy pc15 usa) millimeter manual periodontal probe, in six sites of each tooth (distobuccal surface, center of vestibular surface, mesiobuccal surface, distolingual surface, center of lingual surface and mesiolingual surface). in order to minimize the variability of the examination, during assessment of pi27, mesial (m) and distal (d) measurements were made only in the buccal surface because the palatal / lingual surfaces were indirectly seen with a buccal mirror, according to the technique proposed by silness and le 27. all clinical periodontal parameters (pd, cal, gi, gbi, pi and gr) were analyzed statistically by regions (ps = postero - superior ; as = antero - superior ; pi= postero - inferior ; ai = antero - inferior). multiple regression analysis was performed for comparison between smokers (n=26) and non - smokers (n=29), using age and gender as the control variables and adopting a 5% significance level. a sample size of 26 patients is capable of proving a difference of 1.7 times the standard deviation, for a significance level of 5% and a statistical power of 80%.calculations were performed using the spss statistical software version 13.0 (spss inc, chicago, il, usa). for all situations evaluated, there was a trend towards greater pd (figure 1) and cal (figure 2) means for the smoking group. gi means (figure 3) were greater in the non - smoking group, with statistical significance in all regions (p<0.05). although there were no statistically significant differences between smoking and non - smoking groups, there was an overall trend towards greater gbi means, almost always, for non - smokers (figure 4). regarding pi means between smokers and non - smokers (figure 5), greater plaque accumulation was observed for the smoking group. in relation to gr, there was no constancy of greater values for smokers or non - smokers and, in none of the situations there were statistically significant differences (figure 6). comparing the group of smokers, as for the number of missing teeth (table 1), taking into account posterior / anterior and superior / inferior regions, the differences were not significant statistically, though there was a tendency for greater upper tooth loss in smokers and greater lower tooth loss in non - smokers. regarding the variables analyzed between the groups of smokers and non - smokers, table 2 shows a mean age of 40 years old, a greater participation of females and a mean of 24.5 cigarettes smoked a day. in addition to bacterial plaque, other factors can modify the host response, predisposing the individual to a higher risk of periodontal disease. among the factors considered as fundamental in the host resistance - bacterial aggression interrelation, hereditary predisposition, age, systemic conditions, stress, drugs and tobacco may be cited. nowadays, it is known that the action of tobacco in the periodontium might predispose the individual to various periodontal diseases7,11,13,14,16 and not only to anug23. however, the large number of studies in this field is justified by the fact that the effects of cigarette smoking on the periodontal status have not been completely elucidated. the age range of the study subjects was delimited in order to exclude those either too young or too old. this approach was important for the sample as an effort to minimize aspects related to overage, which might influence the periodontal conditions. on the other hand, the effects of smoking (time of action) might be less expressive in younger individuals, so they were also excluded, establishing a mean age of 40 years old (table 2). however, in many of them, the examinations are carried out by different professionals and data are obtained only from some sites of the mouth, such as the use of cpitn4,12. it is noteworthy that all records of the study were accomplished by a single examiner, previously calibrated by the kappa test, which is important for an accurate standardization, especially in the examinations where the subjectivity load is critical. the results of the present study, in which clinical parameters were considered, showed an evident negative influence of tobacco, particularly for pd (figure 1) and cal (figure 2). there was a tendency of greater pd and cal means in all regions analyzed in smokers, in relation to non - smokers. it should be highlighted that, in a previous study2, the prevalence of greater pds occurred for smokers of cigarettes, cigars or pipe, alike. stoltenberg,.28 (1993) found 5 times more periodontal pockets = 3.5 mm in smokers, in the proximal surfaces of all upper teeth, with no qualitative differences in the microbiota of smokers and non - smokers. a smaller pd reduction in all regions after nonsurgical periodontal therapy and a greater difference for the antero - superior region was observed by preber and bergstrm24 (1985). as for maintenance therapy, jansson and hagstrm15(2002), found greater pd in subjects who interrupted the treatment, independently of the smoking habit. when the tobacco variable was considered, the authors demonstrated that smokers with no periodontal support therapy had higher risk of periodontitis progression. the results obtained by haffajee and socransky14 (2001) were similar to those of this study. the authors examined the clinical characteristics of periodontal disease and standards of insertion loss among usual smokers, occasional smokers and those who had never smoked, in 6 sites per tooth, in all teeth, excluding the third molars. the study showed that this parameter was more significant in usual smokers than in the other 2 groups, particularly, in the palatal upper sites and in antero - inferior teeth. according to the authors, these greater attachment losses observed in these sites suggested the possibility of a local effect of cigarette. in the present investigation, the dose - reaction relation may have influenced the results of this variable as well because the study subjects smoked 24.5 cigarettes / day on the average (table 2). in this context, martinez - canut,.20 (1995) also related the cigarette dose - reaction to cal, showing a direct relation of greater insertion loss with the increase in the number of cigarettes consumed. although it was not within the scope of this study, another less favorable parameter in smokers is the insertion gain, following periodontal therapy. ah,.1 (1994) evaluated the effect of tobacco on clinical response to surgical and non - surgical periodontal therapy between smokers and non - smokers. there are some evidences that tobacco may be associated with less expressive signs and symptoms in periodontal inflammation, such as gingival bleeding, erythema and edema, indicating a suppressive influence in inflammatory response7,8,10,11,13,17. in this study, the comparative analysis of gi (figure 3), between smokers and non - smokers, with a mean age of 40 years, showed that in all analyzed situations, there were greater values for non - smokers, which reflects a greater clinical inflammatory exuberance, in this group. these greater means in non - smokers may be related to the nicotine 's vasoconstrictor effect. several articles are consistent with this work, revealing that the clinical signs of inflammation are less evident in smokers7,11,14,17,21. other researches reported that the dose - dependent reaction would attenuate the clinical signs, proportionally to tobacco consumption20. on the other hand, some works did not demonstrate a relation with the gingival conditions, in subjects with gingival health6 or presented with periodontal disease7. some more ancient works, correlated the gi, not considering the oral hygiene standards, showing a greater inflammation evidence in smokers21,23,26. in this context, 5(1987) presented the effects of cigarette on blood flow, causing a significant increase and not a decrease in gingival blood circulation, concluding that the theory that smoking would damage the gingival blood flow might not be true in smokers. however, this result might be related to the reduced age of the subjects participating in the experiment (19 to 25 years old). as for gbi (figure 4), although no statistically significant differences were found, there was a general trend to more bleeding sites in the non - smoker group, and, as observed for the gi, the clinical aspects seem to be masked by tobacco. goultschin,.12 (1990) compared individuals with mean age similar to that of the population of this study, showing that smokers had smaller gbi means than non - smokers. the authors attributed this finding to a reduction in the gingival flow, caused by nicotine. another essential aspect in this clinical analysis is the bacterial plaque accumulation (figure 5). it is important to highlight that the study subjects were given no instruction on oral hygiene along the research, not to bias data collection. however, in all analyzed situations, there was a general trend for greater pi means for smokers. when comparing pi and gi in smokers, no inflammatory characteristics this fact may be related to nicotine 's vasoconstrictor effect, causing a decrease in the blood flow and masking the local inflammation. the findings of this study are in agreement with those of ah1, while other authors have found similar plaque scores4,7,10,11,17,28, a hypothesis that smokers may be less motivated to keep a high - quality oral hygiene6,10 or did not show a significant difference in plaque accumulation8,9,18,21,26 when the groups were matched by oral hygiene. other studies9,18 showed that there was no significant difference in the pi means, for smoking and non - smoking individuals, with the same oral hygiene level. bergstrm,.9 (1991) suggested a direct influence of tobacco on periodontal health, independently of plaque infection. it is noteworthy that the qualitative difference in bacterial plaque has also been addressed in the present study. some authors do not show this association13,16,17, while others confirm the difference in microbiological quality6,22. this difference in the prevalence of anaerobic species would also explain the greater periodontal destruction severity in smokers than in non - smokers14. while assessing gingival recessions between smokers and non - smokers (figure 6), it was not possible to detect significant differences for any of the analyses. evidently, it can not be stated categorically, based on the results of the present study, that tobaccoism does not interfere with gingival recession ; however, the multiple factors involved in the etiology of gingival recessions, which were not addressed in this study, should be considered. in this regard, albandar,.2 (2000) found greater prevalence of recessions, with =3 mm gingival, in smokers of cigarette, pipe and cigars, as compared to non - smokers. another goal of this study was to compare the number of missing teeth by area (anterior and posterior) and arch (upper and lower) in the smoking and non - smoking groups (table 1). in this aspect, it was not possible to establish a significant condition for any of the situations. nevertheless, there was a tendency for a greater upper tooth loss in smokers and a greater lower tooth loss in non - smokers. a previous epidemiological study4 examined the periodontal condition and the smoking habits of 1,093 individuals in the 35 - 75-year - old age range, concluding that smoking is a significant risk factor for dental loss. the same condition has reported in relation to types of tobacco by albandar,.2 (2000), who suggested that smokers of cigarette, cigar or pipe present a greater prevalence of periodontal problems and greater dental loss than non - smokers. all aspects discussed hereby are of paramount importance in the prevalence of tobacco as a periodontal risk factor. in general, various other subjects must be considered and further research should be carried out in order to elucidate the divergences existing on the interrelation tobacco - periodontal disease. based on the methodology employed and considering its limitations, it may be concluded that : 1. tobaccoism may aggravate the probing depth (pd), the clinical attachment level (cal) and the plaque index (pi) ; 2. the gingival indexes (gi) and gingival bleeding (gbi) might suffer interference fromtobaccoism and be masked ; 3. gingival recessions (gr) alone are not clearly associated with tobaccoism ; 4. in smokers | given that tobacco smoking habit is a risk factor for periodontal diseases, the aim of this study was to compare clinical periodontal aspects between smokers and non - smokers. the clinical status were assessed in 55 patients, 29 smokers and 26 non - smokers, aged 30 to 50 years, with mean age of 40. the clinical parameters used were : probing depth (pd), plaque index (pi), gingival index (gi), clinical attachment level (cal), gingival recession (gr) and gingival bleeding index (gbi) for arches (upper and lower) and teeth (anterior and posterior). tooth loss was also evaluated in both groups. multiple regression analysis showed : tendency of greater probing depth and clinical attachment level means for smokers ; greater amount of plaque in smokers in all regions ; greater gingival index means for non - smokers with clinical significance (p<0.05) in all regions. although, without statistical significance, the analysis showed greater gingival bleeding index means almost always for non - smokers ; similar gingival recession means in both groups and tendency of upper tooth loss in smokers and lower tooth loss in non - smokers. the findings of this study showed that clinical periodontal parameters may be different in smokers when compared to non - smokers and that masking of some periodontal signs can be a result of nicotine 's vasoconstrictor effect. |
Subsets and Splits
No saved queries yet
Save your SQL queries to embed, download, and access them later. Queries will appear here once saved.