article
stringlengths 0
682k
| abstract
stringlengths 146
3.69k
|
|---|---|
in an effort to develop effective vaccines against pathogens that severely affect humans, the concept of original antigenic sin (oas) has become a guiding light, making sense of baffling observations on the infection profiles of foreign pathogens and vaccine efficacies in humans. oas was first described by davenport. to explain antibody responses that were generated after influenza virus infection in people of different age groups (1). it was then suggested that antibody - forming mechanisms appear to be directed by initial childhood infections, such that exposure to antigenically related strains later in life results in progressive reinforcement of the primary antibody. according to this suggestion, oas might ' freeze ' the immune repertoire against a pathogen (2). the repertoire freeze mechanism of oas is understood as part of the hard - coded immune memory responses against a potential recurring pathogen (3). recent research has shown that though it appears to be pathogen - dependent, such a memory response is also found during innate immune responses, and is not limited to adaptive immunity (4). this mechanism would protect the host from the pathogen like a well - trained defense team. immunity against measles, mumps, and smallpox, among others, is a good example of memory responses that provide lifetime protection after a single natural infection or an effective vaccination (45). unfortunately, most pathogens adapt to this immune program by constantly changing their surface molecules. the reason why oas is stigmatized as ' sin ' is its interference with the nave immune response against variants of the pathogen (6). in this review, we introduce the concept of oas as a type of ' immune repertoire freezing ', the result of which can have both positive and negative impacts on immune responses against pathogens and on the course of diseases caused by such agents. the epitome of memory responses in the immune system is the rapid production of antibodies of different isotypes and effector cytokines such as ifn - g or interleukins, by antigen specific b lymphocytes (b cells) and the cognate thymus - derived lymphocytes (t cells), respectively (7). phenotypically defined memory b and t cells have been shown to divide more rapidly than naive cells (789). oas, a process of repertoire freeze in memory responses (3101112) are shown in fig. 1. when an antigen specific receptor (bcr) on the outer surface of b cells recognizes its cognate antigen of a pathogen, the b cell captures and processes the pathogen by presenting pieces of the antigen onto major histocompatibility complex class ii (mhc ii) molecules. a single b cell recognizes a single antigen on a pathogen, but can present as many as antigens of the pathogen on mhc ii molecules for recognition of cd4 + t cells via a cognate t cell receptors (tcrs). through this interaction, both antigen - specific b and t cells can proliferate and differentiate into plasma or memory b cells and effector or memory t cells, respectively, depending on environments of the interaction (131415). when an antigenic variant of the same pathogen appears, it is likely to be captured by memory b cells, which can recognize a conserved or cross - reactive recognition site (epitope) of the pathogen rather than by a nave b cells. this is because memory b cells are expanded clones against the same specific antigen from the previous exposures to the antigen, whereas nave b cells originate from unique vdj recombinations, resulting in a repertoire that might not efficiently respond to a specific epitope. before affinity maturation through a somatic hypermutation process, in part mediated by t cells, the affinity of the target to the bcr on the nave b cells is generally low (16). therefore, even though antigen - specific nave b cells recognize a dominant antigenic site, they might not have an advantage in terms of competition for antigen capture over cross - reactive memory b cells. furthermore, memory immune responses might help to rapidly clear the pathogen through limiting the availability of the antigen for variant specific nave b cells (1718). serum antibody, fc receptor (fcr)-mediated non - specific capture, or presentation of the mhc ii antigens by antigen presenting cells (apcs) bearing other fcr, such as macrophages and dendritic cells (dcs) (19), are also likely to further enrich antigen - specific memory t cells from a previous exposure, rather than antigen - specific nave t cell activation, this occurs for the previously stated reason, specifically, that of better availability of memory t cells than antigen - specific nave t cells. as shown in fig. 1, it is conceivable that a dominant antigenic site - specific nave b cells happen to encounter the cognate epitope before the clearance of the pathogen by the cross - reactive memory b cell responses. this would be followed by activation of cognate memory t cells from previous exposures. although the dominant response is repertoire freeze, antibody diversification may occur against different influenza strains through time (1), which can suggest that the frozen repertoire can melt and be imbued with some diversity. with regard to the memory immune response, increased diversity is an important concept for vaccine design. while oas is harnessed by many universal influenza vaccine strategies (2021222324), oas - mediated generation of cross - reactive, non - neutralizing antibodies against pathogens such as dengue virus can be a cause of enhanced disease severity after the second infection, which represents a hurdle for vaccine development (22526). the conceptual aim of a universal vaccine is to achieve optimal memory b cell and/or t cell responses toward a conserved epitope of a recurring and constantly changing pathogen, through a single immunization. however, it appears natural for the pathogen to change its surface antigenic region for survival, because the region typically harbors an immunodominant epitope, which poses a dilemma for universal vaccine strategies. in table i, we summarize, albeit not extensively, the aspects of viral vaccine design as they relate to mechanisms of oas, assuming recurring infections by the same pathogen with antigenic variation. overcoming oas is an important issue in terms of a vaccine development against recurring pathogens such as seasonal influenza viruses, because a vaccine strategy stimulating repertoire diversification would change the efficacy of the vaccine upon the appearance of variant strains. conceivably, a repertoire freeze can be somewhat overcome by removing the limitation of antigen availability, even though there can be practical limitations to this. the use of more antigens for an inactivated influenza vaccine was shown to be associated with higher influenza - specific antibody titers in the serum of vaccinated hiv patients, compared to that observed with a lower number of antigens (27). a cohort study of healthy adults vaccinated with a virus - like, virosomal, trivalent inactivated influenza vaccine (tiv ; including antigens from h1n1, h3n2, and influenza b viruses) or with a split tiv showed higher influenza - specific igm responses with the split vaccine cohort compared to that with the virosomal vaccine cohort (28). in the same study, hiv patients in the virosomal vaccine cohort showed qualitatively similar immune responses as healthy subjects, and a difference was only quantitatively identified. igm is the first antibody isotype secreted by short - lived plasma cells, and is generated in the initial proliferation and expansion phase in antigen - specific naive b cells, before a t cell - mediated isotype class switch occurs (29). because of this, igm responses might be considered representative of nave immune responses. similarly, there have been reports demonstrating that a live - attenuated influenza vaccine (laiv) is more effective in children, whereas the split tiv is more effective in adults (303132). it is likely that the split tiv could allow the immune system of adults, harboring the accumulated effects of oas, to expand its diversity, compared to that with laiv. split tiv can minimize the oas - dominated ' winner takes all ' situation in the competition for antigen capturing (fig. 2). in the case of split / subunit vaccines for adults, some subdominant but conserved epitopes can be exposed to nave or memory b cells that can be activated by cognate memory t cells. although no dna vaccine has been licensed against influenza, it could potentially work like split / subunit and live vaccines. if such dna is for non - specific expression and for the release of encoded viral proteins, its vaccine effects will theoretically be similar to those of split / subunit vaccines. for dna delivery, targeting to apcs, memory b cells, and t cells can be achieved, which could result in the laiv - like effects without the aforementioned ' winner take all ' competition for antigens, which might eventually support repertoire diversification. it appears that the vaccine preparation method can determine the magnitude of nave immune responses, or in other words, repertoire diversification, as shown in table i. such repertoire diversification efforts might give a chance to the dominant epitopes of a predicted variant, which could undergo further variation. however, in the context of immune memory generated by such strategies against conserved subdominant epitopes, whether corresponding conserved epitope - specific memory b cells will be able to gain access to the antigen beyond dominant epitope cross - reactive memory b cells in the event of a new variant infection (3334), is another issue (fig. regardless of the methods of vaccination, upon exposure to an unpredicted variant pathogen, clearance may occur through a ' good ' oas or, a ' good ' oas and/or the development of a diversified immune repertoire from nave immune responses against the variant epitopes by prolonged exposure to the pathogen. this implies that the pathogen could have enough time to grow and harm the host before being cleared. the evidence for ' good ' (or beneficial) oas is difficult to discern. in the cases of influenza vaccination, a mismatched vaccine is not ' optimally ' protective, although the mismatch often stems from a difference of only a few amino acids in the globular heads of the hemagglutinin between the vaccine strain and the circulating strain (353637). however, as observed during the 2009 h1n1 influenza pandemic, even if mismatched, vaccination with a tiv (including seasonal h1n1 virus components) in the previous season proved to be beneficial, as unvaccinated individuals suffered more severe disease outcomes (31). this suggests that marginal but beneficial cross - reactivity from oas can help to fight against the influenza virus. the 2009 h1n1 influenza pandemic helped us gain a better understanding of immune responses against influenza virus infection. when donor sera taken before and after seasonal influenza vaccination (2007 - 08 or 2008 - 09 season) were analyzed for cross - reactivity to the pandemic 2009 h1n1 influenza virus (p2009 h1n1), adults older than 60 were shown to have a high rate of preexisting immunity (38). interestingly, the sera of older adults taken before seasonal vaccination showed a higher microneutralization antibody titer against p2009 h1n1 than against the seasonal h1n1 ; in addition, the titer against p2009 h1n1 increased slightly after seasonal vaccination, which was understandably not to the level of antibody titer increase against seasonal h1n1. individuals born closer to 1918 showed a higher protective microneutralization titer against p2009 h1n1 (38), suggesting that specific humoral immunity against the influenza virus can be very long lasting. it is very likely that immune memory to the conserved epitope(s) of the 1918 and p2009 h1n1 strains has been continuously boosted through years of infections with variant h1n1 strains through the mechanism of oas. although impossible to confirm, and as suggested by the need for seasonal vaccinations, it is very likely that the continually boosted 1918 h1n1 oas memory is beneficial but not sufficient to defend against continuously changing seasonal variants. such immune memory was fully protective (assuming that microneutralization is indicative of protection against the virus in vivo) only when similar viruses were presented. so far, we have discussed cases suggesting the beneficial effects of oas against influenza viruses. however, it is apparent that continuous boosting of conserved epitopes through recurrent infections by variant viruses, does not offer complete protection against a new variant infection ; although it sounds like a circular argument, because of lack of protection, infections recur. otherwise, seasonal vaccination against new variants of the influenza virus would be unnecessary (39). the challenge of a universal vaccine design appears to be the optimization of the ' good ' oas. a memory b cell repertoire specific for difficult - to - access subdominant conserved epitopes of influenza virus can not be adequately generated in the first place, or not recalled efficiently, or potentially have negative effects on the nave immune responses against a particular variant. we discussed previously that the generation of a memory b cell repertoire against conserved but difficult - to - access epitopes could be conceptually achieved through a suitable vaccine preparation method. 3) ; the potential for this repertoire to contribute to adverse outcomes during influenza virus infection has not been adequately studied.. however, animal models can not appropriately and exhaustively model the history of vaccination and infection in humans. comparison of the two h1n1 influenza pandemics of 1918 and 2009 appears to be educational. in terms of diseases severity, the two pandemics are incomparable ; while some 50 million deaths were estimated in the 1918 pandemic, the estimated number of influenza - related deaths during the 2009 pandemic was no higher than yearly seasonal influenza - related deaths (40). in the case of the 2009 pandemic, although in vitro assays showed marginal cross - reactivity between the sera of seasonal tiv - vaccinated healthy adults and p2009 h1n1, seasonal vaccination was associated with less severe disease outcomes (31). this suggests that some protection was afforded either by the non - neutralizing antibodies against the conserved epitopes potentially through the fcr - mediated protective responses (41), or by the memory t cell responses against the conserved epitopes, or by both. in the case of 1918, records revealed that more young adults (presumably with robust health) succumbed to the virus than the children and the elderly individuals (42), suggesting that oas might have resulted in adverse effects in immunocompetent adults and that potentially beneficial immune memory in the elderly was protective. interestingly, in young adults, p2009 h1n1 resulted in a 2~4-fold greater risk of severe outcomes, specifically those requiring intensive care and mechanical ventilation, compared to seasonal influenza (43). this suggests that the 1918 pandemic was actually recapitulated on a small scale during the 2009 pandemic. obviously, the 1918 pandemic was not the first human encounter with the influenza virus (44). we can assume that individuals must have had some level of immunity against the influenza virus through recurring natural infections, which could be considered a form of whole virus vaccination. from such type of vaccination, we can conceptually assume (fig. 1 and table i) that people in 1918 had very little b cell memory against conserved but subdominant epitopes of the influenza virus, but undoubtedly had some cd4 and cd8 t cell memory against conserved epitopes of the virus. if oas had mediated an adverse immune response, involved in the severity of the disease caused by the 1918 h1n1 virus infection, apart from the high virulence of the virus (45), the key contributing factors must have been cross - reactive non - neutralizing memory b cell responses against a dominant epitope or memory t cell responses against conserved epitopes. an important question is whether memory cd4 and cd8 cells that recognize conserved epitopes cause harmful effects in response to an infective viral variant. protection against the influenza virus through cd4 and cd8 t cell immunity alone was demonstrated in mice (4647). however, although memory cd4 and cd8 cells persist for a long time through homeostatic proliferation (1048), cross - protective resident memory cd8 t cells in pulmonary tissues, which are specific for the influenza virus, were shown to be short - lived (495051). these observations from experiments using mice have limitations ; however, they appear to partly explain why infections recur, regardless of conserved epitopes of internal influenza proteins that can potentially generate universally protective memory cd8 t cells. memory cd4 t cells against conserved epitopes can conceptually function as a " double - edged sword " when faced with a variant ; the cross - reactive oas responses of memory b cells against dominant epitopes, with the help of memory cd4 t cells recognizing conserved epitopes, can be beneficial or damaging (i.e. ' good ' oas or ' bad ' oas). whether a non - neutralizing cross - reactive oas response, with the help of memory cd4 t cells against conserved epitopes, contributed to such devastating manifestations of the1918 h1n1 pandemic h1n1 (5253) is a matter of speculation. however, the well - documented effect of ' bad ' oas in dengue virus infection could provide some clues for this issue. infection with a dengue virus can be asymptomatic or result in dengue fever (df) or dengue hemorrhagic fever (dhf). substantial evidence has associated dhf with secondary infection of a serotype of the dengue virus different from the virus to which an individual has already been exposed. the most widely accepted hypothesis for the pathogenesis of dhf is antibody - dependent enhancement (ade) of dengue virus infection (reviewed in (25)). ade depends on pathogen binding antibodies and antibody binding complement proteins and their receptors such as fcrs and complement receptors. therefore ade is observed mainly with pathogens that efficiently infect fcr - bearing myeloid lineage cells, such as dendritic cells and macrophages (2). dc - sign is a universal receptor for the dengue virus, and dc - sign - expressing immature dcs were shown to be the initial site of infection (54). dengue virus can also infect other fcr - bearing cells of the immune system, such as mature dcs and macrophages. dengue virus - infected human endothelial cells are capable of antibody - dependent complement activation and undergo apoptosis (55). although conceptually feasible, it is not clear whether the dengue virus - antibody - complement - complement receptor complex on the cell surface can actually enhance infection of dengue virus in endothelial cells. however, a similar ade mechanism has been observed during infections with other viruses like hiv (2). it has been shown that human endothelial cells are highly susceptible to dengue virus infection (56). uninfected endothelial cells might also participate in the disease process via complement receptors on endothelial cells and platelets that can mediate inflammatory responses (5758) ; however, the infected endothelium, in the presence of cross - reactive antibodies, might resemble the endothelium of a host experiencing graft rejection (59). ade by itself is not thought to correlate with disease severity and dhf ; complement activation by virus - antibody or antigen - antibody complexes is a feature of severe dengue infection, and it is temporally related to plasma leakage (6). immune responses against dengue viruses are not very different from immune responses against other viruses such as influenza virus. there are conserved features and differences among the variants, and accordingly, inevitable oas can occur. an individual infected with one type of dengue virus never succumbs to the same type of dengue virus infection because of its long - lasting homotypic protective immunity against the primary strain (6). however, when the same individual is infected with different serotype of dengue virus, serotype cross - reactive memory b and t cells from the prior exposure become activated. however, these cross - reactive responses are not protective, and are even detrimental. it was shown that highly cross - reactive monoclonal antibodies against dengue viruses could be potently neutralizing at an optimal concentration but resulted in ade at a suboptimal concentration (60). it appears that cross - reactive antibodies are not necessarily inherently defective in their neutralization capacity ; however, cross - reactive antibodies incapable of virus neutralization are harnessed by the dengue viruses for ade. if this outcome is dependent on an optimal ratio of antibody to pathogen, ade is theoretically possible for any pathogen that can productively infect fcr- and complement receptor - bearing cells (2). non - neutralizing antibodies against the influenza virus were shown to be protective (41), most likely through fcr and complement - mediated pathways. however, in the case of dengue virus infection, cells that are involved in such protective pathways augment virus infection and are sources of disease - causing soluble factors (6). differences between dengue and influenza viruses in this regard, might result in different oas effects. influenza viruses have not been shown to productively infect fcr - bearing immune cells or endothelial cells in humans (61). however, inflammatory responses originating from virus - antibody - complement - complement receptor complexes on pulmonary endothelial cells and other fcr- and complement receptor - bearing myeloid lineage cells (5762) can not be ruled out. conceptually, this situation could unfold anytime an optimal or protective ratio of antibody versus pathogen is disrupted by a rate increase in the number of pathogens that is higher than the rate of production of potentially protective cross - reactive or cognate antibodies (62). we might suggest the possibility of ' bad ' oas in the 1918 h1n1 pandemic, and likely in some cases of the p2009 h1n1 outbreak, based on insight from ' bad ' oas with the dengue virus. rapid virus replication could occur based on the unusually high virulence of the 1918 h1n1 virus (45). this would rapidly mobilize cross - reactive memory b cell responses in young adults, which were not sufficient for neutralization but still generated large amounts of immune complexes, with the rapidly replicating virus. this, in combination with the reaction with complement - complement receptors on pulmonary endothelial cells and myeloid lineage cells such as macrophages and neutrophils, could have resulted in massive inflammatory responses. reported symptoms of infection with the 1918 influenza virus suggest that this scenario was very likely ; autopsies and physician reports during the 1918 pandemic described symptoms of hemorrhagic tracheitis, bronchitis, and edematous hemorrhagic bronchopneumonia (53). this suggests that when an influenza virus replicates quickly, non - neutralizing cross - reactive antibodies generated from a memory response can potentially be more detrimental than the nave immune reaction (62). however, it is unreasonable to expect an immunocompetent adult to not have any oas against the influenza virus. conceptually, the appearance of an unusually virulent, fast replicating influenza virus variant in a vaccine mismatch situation, could recapitulate disease severity seen in the 1918 pandemic in infected immunocompetent adults. oas can be harnessed to defend against a pathogen, or a pathogen can harness oas to gain entry into the host cell through the mechanism of ade. oas might also result in exaggerated inflammatory responses when there is disparity between the pathogen proliferation rate and the protective potential against the pathogen, which could be provided by cross - reactive memory b cells. the normally protective cross - reactive memory b cell responses of oas being turned into ' self - destructive ' modes of immune complex formation with a pathogen, during ' battle ' against a fast replicating pathogen appears to be the inevitable casualties of the ' war ' between the human immune system and pathogens. from an evolutionary point of view, mhc diversity in humans might represent a mobilization against such event ; but from the individual point of view, young adults who have an oas repertoire against influenza viruses, potentially through many natural infections and even without vaccination, could become casualties. the possibility of recapitulating the disease severity of the 1918 pandemic exists, even if on a micro scale, as the influenza virus circulates every season. therefore, sustained surveillance for identifying an unusually virulent influenza virus variant should be continued. | the human immune system has evolved to fight against foreign pathogens. it plays a central role in the body 's defense mechanism. however, the immune memory geared to fight off a previously recognized pathogen, tends to remember an original form of the pathogen when a variant form subsequently invades. this has been termed ' original antigenic sin '. this adverse immunological effect can alter vaccine effectiveness and sometimes cause enhanced pathogenicity or additional inflammatory responses, according to the type of pathogen and the circumstances of infection. here we aim to give a simplified conceptual understanding of virus infection and original antigenic sin by comparing and contrasting the two examples of recurring infections such as influenza and dengue viruses in humans. |
when there is a mass such as a congenital anomaly or lymphangioma in the oral cavity of a pediatric patient, the airway can be compressed and intubation can be difficult. wa, usa) is a laryngoscope with a micro - video camera and a 7-inch display monitor. it can be used in conventional intubation, but is most commonly used when larynx exposure is difficult as in situations when there is a cervical spine motion restriction or difficulty with mouth opening. conventional endotracheal intubation methods can be difficult with a mass present in the oral cavity. we have successfully used a glidescope and a rigid stylet to perform endotracheal intubation in a pediatric patient with a mass at the tongue base that had made mask ventilation and tracheal intubation difficult. a 12 months - old female infant (78 cm in height, 10 kg in weight) presented to the hospital with a chief complaint of left mouth floor swelling. she was born with a mass at the tongue base but had not received treatment. ct scan showed a cystic mass, 50.04 45.69 mm in size, at the floor of the mouth on the left side, with invasion of the right side of the tongue base (fig. the esophagus was deviated to the right and the trachea appeared compressed. on arrival at the operating room, standard monitoring including noninvasive blood pressure, electrocardiogram, pulse oximetry, due to expected difficulty in tracheal intubation, a glidescope for pediatric patients was prepared. after the patient was preoxygenated with 100% oxygen for one minute, anesthesia induction was started with thiopental sodium 50 mg and nimbex 1.0 mg. however, the tongue mass situated on the left was large and extended to right side of the tongue base, preventing the tongue to slide to the left during insertion of laryngoscope. a cormack - lehane grade iv classification was established, therefore a glidescope was used to undertake tracheal intubation. however, even after insertion of the oral airway and attempted ventilation, insufficient ventilation due to the mass that took up 2/3 of the oral space and airway obstruction caused by the large tongue led to arterial oxygen saturation dropping below 30% and a decrease in heart rate to 50 beats / min. after several attempts, the patient was successfully ventilated and arterial oxygen saturation was normalized. following sufficient preoxygenation, the glidescope was gently inserted between the teeth at the midline and was advanced in the direction of the vallecula. however, because of the mass at the tongue base, it was difficult to expose the vocal cord and with cormack - lehane grade ii classification established. tracheal intubation was first attempted by matching an endotracheal tube angulation to a glidescope curve using a commercialized plastic coated malleable metal stylet. however, we could not approach the laryngeal opening because the stylet could not withstand the strength and was bent, due to the limited oral cavity space and the wide angle between the glidescope and the laryngeal opening. after two failed tries, an i d 3.5 mm endotracheal tube with a tracheal balloon was inserted using an od 2.8 mm non - malleable metal stylet, which was prepared beforehand (fig. 2). to avoid trauma from the rigid stylet, it was removed after the end of the tube passed the vocal cord and the tube was fixed. breath sounds in both lungs were checked by auscultation and the tube was fixed 13 cm away from the teeth. the surgery had been planned an in - traoral approach, but because of concern for complications given the large mass, an external approach was used. an irregularly shaped cystic mass with bloody discharge, about 5 4 cm in size, was dissected. there were no respiratory problems following anesthesia and the patient was transferred to the recovery room after regaining consciousness and following extubation. most lymphangiomas are diagnosed at birth. this patient was diagnosed with a mass on left mouth floor at birth. the mass gradually grew in size, eventually involving the right side of the tongue base, and caused the deviation of esophagus and trachea. furthermore, the tongue became hard and enlarged such that it could not be pushed it to left side when inserting the laryngoscope. the space between laryngoscope and hard palate was so narrow that movement of intubation tube was limited. we decided to use the glidescope for tracheal intubation because we could not approach the vallecula with a macintosh direct laryngoscope. following the initial macintosh laryngoscope approach, arterial oxygen saturation dropped below 30% due to difficulties in mask ventilation, leading to an extremely dangerous situation. the authors had considered and were prepared for the possibility of inadequate mask ventilation due to the large mass. we had anticipated that tracheal intubation could be difficult before the induction of general anesthesia. after the first failed attempt, we had difficulty with mask ventilation and arterial oxygen saturation dropped to below 30%. to prepare for this potentially catastrophic complication in a patient with a large lymphangioma, preparation of advanced airway equipment oral airways of multiple sizes and laryngoscope blades of multiple sizes need to be prepared. according to thompson el al., number 9 adult oral airway could be needed for nine - year - old child with large tongue base. when mask ventilation is inadequate, inserting an lma to initiate ventilation before attempting endotracheal intubation is an option but may be difficult with a mass in the oral cavity and tracheal deviation. in particular, the distal portion of glidescope with a camera is 5060 in angle. therefore, a stylet is essential to accomplish steep passage from the mouth to the vocal cords. when undertaking tracheal intubation in adults, a glidescope -specific rigid stylet makes the intubation tube approach much easier, however, in children, there is a greater risk of trauma and the intubation tube size is so diverse that there are no commercialized rigid stylets. the commonly used general stylets are too flexible and tend to bend easily with slight force. in this case, the tongue could not be pushed back because of the mass and thickness of the tongue. in such situations, where the vocal cords can only be exposed after the tongue is pushed far back with a glidescope, exerting force on the stylet is necessary for the intubation tube to reach the laryngeal inlet. therefore a rigid stylet that can support the curve of the intubation tube is required. the new stylet for pediatrics is shaped with pvc coated non - malleable metal plant support fixture to match the curve of the glidescope. this stylet has an outer diameter of 2.8 mm but because it does not bend, it was much more convenient to use and much easier to approach the laryngeal opening. it is known that twisting the stylet into a spiral or a cork - screw shape and rotating it while intubation makes it simpler. although this maneuver can overcome the difficult angulation, the tracheal tube has to be rotated 180. therefore, risk of airway injury can not be excluded. in one case, intubation was achieved using a maneuver, in which endotracheal tube with a sharply curved malleable stylet was inserted through the glottis, and then rotated 180 to permit passage down the trachea. even when the glidescope glottis view is good, intractable impingement at the anterior tracheal wall can make tracheal intubation difficult and having the stylet angulation as 90 rather than 60 allows intubation to be done much faster and easier. bonefils fiberscope can also be used, particularly when the intraoral space is too confined. according to cooper. in a study with 728 people, 4% (26 people) failed intubation even with cormack - lehane grade 1 view, and cho and kil also showed that despite a good view of the larynx, there were difficulties in tracheal intubation in 25 out of 120 people. they reported that in patients with a small mouth, the space created by the blade and the mouth is narrow, causing difficulties in endo - tracheal tube insertion. therefore inserting the glidescope near the left corner of the mouth, even if there is a slight deviation of the laryngeal more space for tube insertion and makes tube insertion simpler. endotracheal tubes have anterior angulation and therefore, for the tube to traverse the glottis and advance into to the trachea, the stylet has to be withdrawn several centimeters. in the case presented, tracheal intubation was performed with the stylet placed 1 cm behind the end of the tube and was fixed after the tube was 1 cm into the laryngeal opening. while confirming the position of the tube with a glidescope, the stylet was removed and the tube was inserted into the appropriate place. when using a glidescope for tracheal intubation in pediatrics, it is recommended that a malleable metal stylet be used to prevent trachea or tissue trauma. however, a small and narrow oral cavity, a large tongue, or especially a mass in the mouth can make it difficult to manipulate the laryngoscope and ett into the oral cavity. as in the case | lymphangioma is a congenital malformation of lymphatic system and often involves the oral cavity. when lymphangioma is located on the mouth floor and enlarges, it can compress the airway and make intubation difficult. the glidescope video laryngoscope is sometimes used in routine intubation, but is most commonly used in difficult or failed intubation. we report a pediatric patient with a difficult intubation due to a large tongue base mass. the airway was compromised due to limited intraoral space, large mass at the tongue base, and glottis distortion. oral approach was not successful with the macintosh laryngoscope. in this case, a rigid stylet was made to match the glidescope curve and the endo - tracheal tube was inserted through the glottis under glidescope guidance. we believe that, even in pediatric patients, a rigid stylet is necessary when intubation at a sharp posterior angulation to the trachea is difficult during glidescope approach. |
double - j (dj) stents are used to drain urine from the kidney to the bladder and are effective in managing and preventing upper urinary tract (ut) obstruction in various urological conditions (1). the most common indication of stenting is to prevent and relieve upper ut obstruction (2, 3). the known complications of dj stent include encrustation, fragmentation, proximal and distal migration, dysuria, and frequency (1). most of these complications are self - limited and can be managed with suitable urologic interventions and supportive medical management (2 - 4). we reported a rare and serious case of vascular migration of a stent to the pulmonary artery, with a long - time remained. the patient was a 47-year - old man with a history of long - lasting renal colic from four months before his admission. the surgeon had difficulty passing the ureteroscope through the intramural ureter and, with frequent manipulation, a 0.035 guidewire was passed through the intramural ureter, after which a dj stent of 4.8f-30 cm was inserted over the guidewire. kub was performed after the procedure for control of the location of the dj, but the resident did not diagnose abnormal pathway of the stent. he then developed gross hematuria for two days and, after passing a large clot in urine, the hematuria stopped, and he had no further urinary symptoms. after two weeks, he came to the clinic, and the surgeon planned to remove the dj stent in the operating room by cystoscopy. the cystoscope was passed into the bladder, but the stent could not be visualized there. migration of the stent to another anatomical position, such as the ureter or retroperitoneal, or vascular migration was suggested. the patient was referred to the radiology department, where kub and chest x - ray (cxr) was performed. the stent had an abnormal pathway, probably entering into the inferior vena cava (figure 1). cxr showed abnormal density that could have been the shadow of the stent (figure 2). the x - ray revealed an abnormal pathway of the double - j stent that probably entered into the inferior vena cava. the arrow shows the position of the ureteral stone, 8 6 mm in size, at the ureterovesical junction. the patient was referred to the angiography department. in fluoroscopy, during pulmonary angiography, the dj stent was seen completely in the pulmonary artery. the tip of the stent was fixed, which may have been due to wedging in the pulmonary artery branch, thrombus formation in this site, or other causes (figure 3). other laboratory data including cbc, bun, esr, crp, and creatinine were normal. blood culture was requested, and prophylactic antibiotic and anticoagulant therapies were performed for the patient. there are two methods to remove endovascular foreign bodies : open surgery and intravascular retrieval (5 - 9), and it was planned to remove the stent percutaneously. 10 french right femoral sheath was used, and pulmonary angiography was performed (figure 4). a multipurpose 7f catheter was used to try to release the fixed left tip of the stent, but frequent manipulation was not successful. the right distal tip of the stent was captured by peripheral snare, and the stent was retrieved successfully without any complication. when the peripheral snare was introduced percutaneously from the femoral sheath, and the tip of the stent was captured by it. the common symptoms and probable complications following dj stent insertion include lower ut symptoms, loin pain, hematuria, ut infection, vesicoureteral reflux (vur), stent malposition, luminal obstruction, ureteral erosion or necrosis, stone formation, encrustation, fracture, and migration proximally and distally in the urinary system (4, 10). stent placements can be prone to vessel erosion, and in rare situations, intravascular migration of the dj stent has been reported (6, 10). michalopoulos. reported pulmonary thromboembolism immediately after surgery from migration of a stent into the heart and left pulmonary arterial system after pyelolithotomy and antegrade insertion of a pigtail ureteral stent. the stent was removed percutaneously by using the femoral vein as an access site (7). percutaneous removal of the migrated stent was performed under fluoroscopic guide (5). however, in two other case reports, the stent was removed successfully via cardiopulmonary bypass (6, 8). although placement of a ureteral stent is easy, serious complications may occur during or after such a procedure (5 - 9). in this case, the surgeon blindly passed a 0.035 guidewire through the intramural ureter, when it probably passed into the submucosa and then the iliac vessel. second, use of hydrophilic wire can prevent passing the wire into the submucosal layer. moreover, dj stent insertion under fluoroscopic guide can reduce these complications. in the absence of fluoroscopy if abnormal position of the stent is suspected, other diagnostic methods, such as ct with iv contrast, can confirm or disprove the diagnosis. finally, clinicians should pay attention to warning symptoms of the patient, such as significant hematuria and severe abdominal pain. in this case, the stent was completely in the pulmonary arteries. multiple treatment options can be used for this situation, such as percutaneous removal by snare catheter, when possible, and open surgery. because of the good condition of the patient and available expertise for endovascular intervention, it was decided to remove the stent by the endovascular method with femoral access. if expertise for endovascular intervention is not available, open surgical removal is an alternative, safe method. intravascular migration of dj stents is a rare but serious complication. when there is doubt, complementary diagnostic procedures and early intervention are recommended. percutaneous removal of a migrated stent under fluoroscopic guidance by snare catheter from femoral access is a safe and effective treatment. | double - j (dj) stents are the main tools used in urological practice for prevention and treatment of obstruction. stenting is also mandatory after complicated ureteroscopy or tul (transureteral lithotripsy). known complications are upper migration of dj stents into the kidney and lower migration to the bladder. in a man with an impacted right lower ureteral stone, a dj stent was placed because the ureteroscope was not passed from an intramural ureter. we reported a very rare complication of dj ureteral stent placement with intravascular migration to the pulmonary arteries, which was removed percutaneously through the right femoral vein under fluoroscopic guidance. |
as part of our ongoing effort to expand the scope of cross - coupling reactions of alkyl electrophiles, we have pursued a strategy wherein the nucleophilic coupling partner includes a pendant olefin ; after transmetalation by such a substrate, if -migratory insertion proceeds faster than direct cross - coupling, an additional carbon carbon bond and stereocenter can be formed. with the aid of a nickel / diamine catalyst (both components are commercially available), we have established the viability of this approach for the catalytic asymmetric synthesis of 2,3-dihydrobenzofurans and indanes. furthermore, we have applied this new method to the construction of the dihydrobenzofuran core of fasiglifam, as well as to a cross - coupling with a racemic alkyl electrophile ; in the latter process, the chiral catalyst controls two stereocenters, one that is newly generated in a -migratory insertion and one that begins as a mixture of enantiomers. |
|
malaria is a major public health problem with 300500 million new infections each year and an estimated 584,000 deaths from malaria were reported worldwide, with most (90%) of the deaths occurring in africa. the decline of susceptibility of plasmodium falciparum to chloroquine and sulfadoxine - pyrimethamine in many high - transmission areas resulted in the change of drug use policy in africa. in democratic republic of congo (drc), current recommendation therapy for severe malaria in drc is artemisinin - based combination therapy (act) ; mainly, artesunate - amodiaquine has been recommended formally as a first - line antimalarial regimen since 2005. however, this policy is not controlled and the use of antimalarials without a prescription can have adverse effects on chemosensitivity in kinshasa, the drc. the aim of the present study was to assess the self - medication against malaria infection in population of congolese students living in kinshasa, drc. this cross - sectional study was carried out in university of kinshasa, kinshasa, drc. medical records of all students with malaria admitted to centre de sant universitaire (csu) of university of kinshasa from january 1, 2008, to april 30, 2008, were reviewed retrospectively. csu is a primary level centre located in the city of university of kinshasa, kinshasa, drc, and serving an estimated 30,000 students. students who experienced an episode of malaria and presented the following criteria, axillary temperature > 38.0c with positive plasmodium falciparum parasites in thick blood smears and absence of febrile conditions caused by diseases other than malaria, were included in this study. students who took an antimalarial malaria parasitaemia was confirmed with thick blood smears stained giemsa and examined for trophozoites of plasmodium falciparum. the following information was collected and analyzed : (1) age and gender and (2) nature, dosage, and duration of antimalarial treatment. statistical analysis was performed using the statistics software spss for windows (15.0 spss, chicago). data are represented as means sd when the distribution was normal and median with range when the distribution was not normal. frequencies of different parameters of self - medication are expressed as proportions (%). during the study period, 458 students had been admitted in our centre and 133 (29.0%) had a diagnostic of malaria infection. the median age of the patients was 25.4 years (range : from 18 to 36 years). self - medication was associated with the ingestion of artemisinin - based combination treatments (acts) in 14 cases (50%), sulfadoxine / pyrimethamine (sp) in 9 cases (32.1%), and quinine in 5 cases (19.9%). to our knowledge, the present study is the first attempt to examine the notion of self - medication with antimalarials drugs in a university of central africa. in kinshasa, malaria is highly endemic, stable with a perennial transmission. university of kinshasa is located in one of four districts of kinshasa, district of mont amba in the west region of this urban area. prevalence of anopheles gambiense was higher than that in other districts of the town [69 ]. in this report this high figure shows the existence of a gap in the health care system including the freedom to buy drugs without prescription in pharmacies. recent study in drc reported parasite genotyping which showed high frequencies of dihydrofolate reductase (dhfr) and dihydropteroate synthase (dhps) molecular sp - resistance markers, with 57% of the samples showing more than three mutations linked to sp resistance. self - medication with quinine was found in 20% of students. in national health care policy this rate is high for a molecule reserved for severe disease in congolese health care policy in management of malaria. a recent study supports our concerns and shows the appearance of an intermediate level of resistant forms to amino alcohols in the city of kinshasa compared with other areas of africa. in the drc however, with an important self - medication, surveillance of efficacy of these drugs becomes a necessity since here there are recent concerns that the efficacy of such therapies has declined on the thai - cambodian border. in our series, 50% of students used acts in self - medication. in comparison with our general population, fever treatment with acts another crucial health problem is counterfeit antimalarials, mainly act and sulfadoxine - pyrimethamine in developing countries as democratic republic of congo. this situation increases the risk of artemisinin and sp resistance developed by the use of subtherapeutic dosage of these drugs. self - medication remains an important public health problem in high school students of kinshasa. the recommendations of the national program against malaria are not sufficiently known in these communities. this should draw the attention of all partners involved in the fight against malaria in drc. the academic community should be a priority target for the information campaign about the disease and the dangers of self - medication and risk - taking counterfeit drugs. training and information actions must be reinforced for a better care of malaria and to preserve efficacy and safety of acts and quinine in drc. | aim. to assess the self - medication against malaria infection in population of congolese students in kinshasa, democratic republic of congo (drc). methods. a cross - sectional study was carried out in university of kinshasa, kinshasa, democratic republic of congo. medical records of all students with malaria admitted to centre de sant universitaire of university of kinshasa from january 1, 2008, to april 30, 2008, were reviewed retrospectively. results. the median age of the patients was 25.4 years (range : from 18 to 36 years). the majority of them were male (67.9%). artemisinin - based combination treatments (acts) was the most used self - prescribed antimalarial drugs. however, self - medication was associated with the ingestion of quinine in 19.9% of cases. no case of ingestion of artesunate / artemether in monotherapy was found. all the medicines taken were registered in drc. in this series, self - prescribed antimalarial was very irrational in terms of dose and duration of treatment. conclusion. this paper highlights self - medication by a group who should be aware of malaria treatment protocols. the level of self - prescribing quinine is relatively high among students and is disturbing for a molecule reserved for severe disease in congolese health care policy in management of malaria. |
today, deep - water benthic habitats, i.e. those areas below the euphotic zone at a water depth of more than c. 200 m, account for more than 65% of the earth 's surface. however, these regions are much more difficult to access than shallow waters and thus, despite considerable effort during the past decades, they remain much less explored. usually, major tectonic movements are needed to expose ancient deep - water sediments at the surface. because of deposition at great water depths and tectonic displacement, the fossil record in these sediments often suffers from significant diagenetic loss and deformation. furthermore, due to low primary productivity, nutrients in deep - water settings mostly are scarce and macrobenthic organisms do not form dense populations. as a result, fossils of deep - water organisms commonly occur scattered and in low abundance, and collecting representative samples requires detailed investigation of large rock exposures. during the mesozoic, because they evolved comparatively rapidly, ammonites are used widely as biostratigraphic markers and many outcrops of mesozoic deep - water sediments have thus been sampled extensively. this careful collecting has often yielded representative samples of the rare autochthonous benthic deep - water organisms, which is the case for the bivalves detailed herein. the lower cretaceous deposits of the puez area in the dolomites (southern calcareous alps, south tyrol, italy) were first sampled for fossils during the late nineteenth century, and the geologists victor uhlig (1888) and haug, 1888, haug, 1889 published initial descriptions of the geology and fauna of these sediments. during the last decade (20032012), the puez cretaceous strata were re - sampled intensively by italian and austrian scientists, mostly bed by bed. in addition to an impressive number of more than 1200 ammonites, these workers also collected rare echinoids, solitary corals, brachiopods, and bivalves (lukeneder and aspmair, 2006, lukeneder, 2008, lukeneder, 2010). these bivalves, comprising allochthonous epibionts as well as autochthonous deep - water inhabitants, are described in detail and illustrated herein, and their palaeoecological requirements are discussed. today, the lower cretaceous sediments of the higher dolomites are preserved as relics, either in pure limestone facies (biancone formation ; e.g., mayer and appel, 1999) or in marl to marly limestone facies (puez formation ; lukeneder, 2010). the puez formation, preserved predominantly on the puez - odle - gardenaccia plateau (fig. 1), was deposited on triassic hauptdolomit or lower cretaceous rosso ammonitico puezzese limestones (lukeneder and aspmair, 2006, lukeneder, 2010, lukeneder, 2011). in the puez area, cone - shaped hills up to 150 m high are formed by the puez formation and are overlain by tectonically emplaced slivers of triassic dachstein limestone up to 10 m thick, that have acted as a protection against erosion (lukeneder and aspmair, 2006, lukeneder, 2010). as described in detail by lukeneder (2010), the section of the puez formation at puez comprises marls and (marly) limestones that are approximately 120 m thick. the puez formation can be subdivided into three members that were deposited during a time span from the late valanginian to the early cenomanian (fig. 2). the first, the puez limestone member, consists of approximately 50 m of marly limestones, which are late valanginian to late barremian in age. the second, the puez redbed member, is only 9 m thick and comprises foraminiferal wackestones to packstones of aptian age, while the third, the puez marl member, consists of approximately 57 m of alternating marl and limestone beds, dated as early aptian to early cenomanian. biostratigraphic data were obtained from ammonoids (lukeneder, 2012) and nannofossils (e. halsov, pers. the dolomites (permian to late cretaceous in age) comprise an integral, inner part of the fold - thrust belt (backthrust belt) of the southern alps in northern italy, and emerged as a result of the deformation of the tethyan passive continental margin of adria (bosellini., 2003, castellarin., 2006). during the early cretaceous, the dolomites formed part of the trento plateau which was situated on the eastern flank of the lombardian basin (bosellini., 2003, lukeneder, 2008), at a palaeolatitude of 2030 n (muttoni., 2005). the puez area is located within the dolomites in the northernmost part of the trento plateau. the cretaceous sediments of the puez area formed on a submarine plateau, the puez - odle - gardenaccia plateau. for a more detailed geological overview of the puez area, most of the specimens described herein derive from systematic bed - by - bed collection of fossils at the puez locality in the years between 2003 and 2012. with the exception of oysters, which originate from the late aptian part of the puez marl member, all specimens have been collected from the puez limestone member and are dated as early to late barremian (fig. 2). a few additional individuals of parvamussium are available from old, stratigraphically unconstrained nhmw collections and from the holdings of the naturmuseum sdtirol (bolzano, south tyrol, italy). a single large parvamussium from correlative deposits of the barremian puez limestone member at the ra stua locality north of cortina d'ampezzo, province of belluno altogether, only 30 rock samples with bivalves from piz de puez have been studied, although some samples contain multiple inoceramidae and dimyidae. due to poor preservation, oysters could not be counted (see details below). class bivalvia linnaeus, 1758subclass pteriomorphia beurlen, 1944 (emend. boss, 1982)order myalinida h. paul, 1939superfamily inoceramoidea c. giebel, 1852family inoceramidae c. giebel, 1852genus inoceramus j. sowerby, 1814 type species. inoceramidae have only been mentioned twice, in open nomenclature, in previous studies on the puez formation (haug, 1888, lukeneder and aspmair, 2006). class bivalvia linnaeus, 1758 subclass pteriomorphia beurlen, 1944 (emend. boss, 1982) order myalinida h. paul, 1939 superfamily inoceramoidea c. giebel, 1852 family inoceramidae c. giebel, 1852 genus inoceramus j. sowerby, 1814 type species. inoceramidae have only been mentioned twice, in open nomenclature, in previous studies on the puez formation (haug, 1888, lukeneder and aspmair, 2006). inoceramids from the early half of the early cretaceous are generally poorly known and illustrated, and are commonly described from relatively limited, deformed and incompletely preserved material. interpretation of many specimens is hampered further by the impact of taphonomic artifacts, whereby different modes of preservation interact with shell structures to produce taxonomically misleading morphologies (crampton, 2004). for all these reasons, the taxonomy of early cretaceous inoceramidae remains problematic and the large number of nominal taxa is in need of revision. some important and relevant publications that review or figure hauterivian to aptian inoceramids include pergament, 1965, pokhialainen, 1969, pokhialainen, 1972, pokhialainen, 1985, glazunova, 1973, crame, 1985, dhondt, 1992 and lazo (2006). nine adult specimens derived from a single rock sample (nhmw 2013/0292/00010009), and a single juvenile right valve (nhmw 2013/0292/0010). preserved as flattened internal moulds with patches of the external, prismatic calcite shell layer retained. complete specimens : l (max) = 55 mm ; h (max) = 52 mm ; most specimens are fragmentary ; the largest fragment measures approximately 90 mm in height. description. inequivalved ; juvenile left valve probably moderately inflated (as judged from flattened material) and becoming weakly inflated with growth ; right valve uniformly weakly inflated. outline obliquely elliptical to ovate, with height exceeding length (descriptive terminology follows crampton, 1996, fig. 30 ; crampton and gale, 2009, fig. 2). moderately prosocline ; growth axis infracrescent in early growth stages and becoming weakly retrocrescent in adult stages. adult sculpture of irregularly and widely spaced, very low, rounded, and indistinct commarginal folds. a single juvenile individual (fig. 3a) has weak but regularly spaced folds restricted to the earliest growth stage (22 according to retowski (1893) and 3334 according to arkadiev and bogdanova (2012). pecten (amusium) sokolowi retowski, 1893 is slightly smaller than parvamussium pizpuezense n. sp. and has almost straight radial internal costae, whereas they are distinctly antimarginal in the new species. pecten (amusium) sokolowi has only up to 70 external radial costellae and much weaker commarginal lirae than p. pizpuezense n. sp. as far as we are aware, no additional species of parvamussium have been described from tethyan cretaceous rocks in europe. the turonian to maastrichtian boreal species parvamussium inversum (nilsson, 1827) reaches only up to 8 mm in length and height, and is thus distinctly smaller than p. pizpuezense n. sp. moreover, it lacks radial ornamentation on the left valve (griepenkerl, 1889, dhondt, 1971). johnson (1984) revised the jurassic propeamussiidae from europe and adjacent regions and recognised three species, which he assigned to the genus propeamussium ; however, that author did not discuss the relationships between propeamussium, parvamussium and allied genera. from his descriptions, however, it becomes clear that the jurassic species all retain at least a weak byssal notch in adulthood and thus belong to parvamussium according to the taxonomic concept applied herein. this observation is supported by waller (2006), although he regarded the early to middle jurassic representatives of the propeamussiidae as intermediate between the triassic genus filamussium waller, 2006 and the late jurassic to recent parvamussium, based on differences in the ordering of calcite prisms. since waller (2006) did not establish a separate genus for early to middle jurassic taxa, we herein continue to treat the respective species as representatives of parvamussium. parvamussium pizpuezense n. sp. differs from the three jurassic species in being longer than high, in its inaequilateral shell and in its left valve that is more densely ornamented with more than 100 radial costellae and commarginal lirae. additionally, the late pliensbachian to early bajocian (see johnson, 1984) parvamussium laeviradiatum (waagen, 1868) clearly differs from all other congeners in its dorsally extended, horn - like auricles in the right valve. this species was placed in a separate genus, varientolium, by andreeva (1966). parvamussium laeviradiatum and the late pliensbachian to bathonian p. pumilum (lamarck, 1819) also differ from p. pizpuezense n. sp. in having no more than 13 near - straight radial internal costae ; no additional internal costae are intercalated. the late jurassic (late oxfordian to early tithonian) parvamussium nonarium (quenstedt, 1857) has slightly antimarginal internal costae and intercalary costae, but differs from p. pizpuezense n. sp. in being much smaller, and in having much coarser reticulate ornamentation on the left valve. an additional species not mentioned by johnson (1984), pecten spendiarovi abel, 1897, from the kimmeridgian to tithonian klentnice beds of northeast austria (schneider., 2013), probably also belongs to parvamussium. it is much more slender than p. pizpuezense n. sp. and has radial external costellae on both valves, according to the drawings of abel (1897) ; the holotype of p. spendiarovi could not be traced in vienna, and may be lost. several mesozoic species of parvamussium from the circum - pacific area (california, japan, indonesia, thailand) were discussed in detail by sundberg (1989) and saengsrichan. these all are distinctly smaller than p. pizpuezense n. sp. and differ in the number and arrangement of internal costae and external disc ornamentation. extraordinarily large parvamussium species (l > 90 mm) with 13 internal costae extending from umbo to approximately 70% of shell height. material. holotype, a large articulated specimen from the upper lower barremian of the puez limestone member at piz de puez (nhmw 2013/0292/0037). paratype, a medium - sized left valve from the same unit at ra stua, north of cortina d'ampezzo, belluno province, veneto (museo paleontologico l = 92 mm ; h = 87 mm ; paratype : l = c. 65 mm ; h = c. 63 mm [paratype measurements based on photograph ]. type locality. piz de puez, dolomites, south tyrol, italy and ra stua, north of cortina d'ampezzo, province of belluno, veneto, italy. shell exceptionally large (l (max) = 92 mm), semi - translucent ; slightly longer than high ; anterior, ventral and posterior shell margins well rounded, forming a subcircular segment ; dorsal shell margin straight. apical angle c. 115. auricles comparably large, almost perfectly trigonal ; posterior auricle significantly larger than anterior one. posterior auricle ornamented with growth lines, becoming more prominent, almost plicate, just below the dorsal margin. extraordinarily large parvamussium species (l > 90 mm) with 13 internal costae extending from umbo to approximately 70% of shell height. material. holotype, a large articulated specimen from the upper lower barremian of the puez limestone member at piz de puez (nhmw 2013/0292/0037). paratype, a medium - sized left valve from the same unit at ra stua, north of cortina d'ampezzo, belluno province, veneto (museo paleontologico l = 92 mm ; h = 87 mm ; paratype : l = c. 65 mm ; h = c. 63 mm [paratype measurements based on photograph ]. type locality. piz de puez, dolomites, south tyrol, italy and ra stua, north of cortina d'ampezzo, province of belluno, veneto, italy. shell exceptionally large (l (max) = 92 mm), semi - translucent ; slightly longer than high ; anterior, ventral and posterior shell margins well rounded, forming a subcircular segment ; dorsal shell margin straight. apical angle c. 115. auricles comparably large, almost perfectly trigonal ; posterior auricle significantly larger than anterior one. posterior auricle ornamented with growth lines, becoming more prominent, almost plicate, just below the dorsal margin. shell interior ornamented with initially seven (?) and finally up to 11 near - straight radial internal costae in adulthood. new costae inserted across anterior and posterior parts of shell during ontogeny. outside of left valve ornamented with up to c. 120 slightly irregular, sinuous, radial costellae. earlier growth stage ornamented with c. 60 costellae only ; additional set of costellae gradually but almost simultaneously emerging from shell surface at shell height of c. 55 mm. no commarginal lirae present ; growth lines irregular, faint. posterior and central portions of dissolved apron removed during preparation. outside of right valve, including potential byssal notch, unknown. remarks. the unique combination of the most conspicuous features of parvamussium mordsdrum n. sp., i.e. its extraordinary size and the ornamentation of c. 120 costellae, clearly distinguish this species from all other jurassic and cretaceous species of the genus. a single disc fragment with remnants of shell from the barremian puez limestone member (nhmw 2012/0292/0038). measurements. shell exterior with nine, equally - spaced, narrow radial incisions obviously not corresponding to internal costae. shell ornamented with numerous (> 150) slightly sinuous radial lines of regularly spaced, minute pits. since major portions of the shell, including the entire hinge region, are lacking, a comprehensive description and accurate identification are impossible. certainly, the specimen belongs to a distinct, third species of pectinid affinities. obviously all three shells were originally of calcitic mineralogy, making a placement within the pteriomorphia very likely. due to the poor preservation, confident identifications are impossible. subclass, order, family and genus indet.bivalvia indet.fig. 12. material. a single external mould of a left (?) valve (nhmw 2013/0292/0042). measurements. l = 23 mm ; h = 19 mm. description. shell subcircular in outline, with slight postero - dorsal slope and faintly indicated postero - ventral flexure ; almost flat. it seems that this specimen is barely compressed, since the growth lines appear regular and undistorted. obviously the specimen did not possess calcitic shell portions, since calcitic shells, even those of the fragile, translucent propeamussiidae, are perfectly preserved in the puez sediments, whereas aragonite is entirely dissolved. the specimen is preserved inside the body chamber of a specimen of the ammonite phyllopachyceras ladinum. remarks. the unique combination of the most conspicuous features of parvamussium mordsdrum n. sp., i.e. its extraordinary size and the ornamentation of c. 120 costellae, clearly distinguish this species from all other jurassic and cretaceous species of the genus. a single disc fragment with remnants of shell from the barremian puez limestone member (nhmw 2012/0292/0038). measurements. shell exterior with nine, equally - spaced, narrow radial incisions obviously not corresponding to internal costae. shell ornamented with numerous (> 150) slightly sinuous radial lines of regularly spaced, minute pits. since major portions of the shell, including the entire hinge region, are lacking, a comprehensive description and accurate identification are impossible. certainly, the specimen belongs to a distinct, third species of pectinid affinities. obviously all three shells were originally of calcitic mineralogy, making a placement within the pteriomorphia very likely. due to the poor preservation, confident identifications are impossible. a single external mould of a left (?) valve (nhmw 2013/0292/0042). measurements. l = 23 mm ; h = 19 mm. description. shell subcircular in outline, with slight postero - dorsal slope and faintly indicated postero - ventral flexure ; almost flat. it seems that this specimen is barely compressed, since the growth lines appear regular and undistorted. obviously the specimen did not possess calcitic shell portions, since calcitic shells, even those of the fragile, translucent propeamussiidae, are perfectly preserved in the puez sediments, whereas aragonite is entirely dissolved. the specimen is preserved inside the body chamber of a specimen of the ammonite phyllopachyceras ladinum. the type locality of the puez formation has been sampled intensely during the last 10 years. given that more than 1200 ammonite specimens have been collected over this period (lukeneder and aspmair, 2006, lukeneder, 2008), the fact that fewer than 50 bivalves have been recovered seems surprising. furthermore, only a part of the bivalve fauna from the puez formation comprises autochthonous elements. even these individuals belong to several successive benthic communities of early to late late barremian age. however, as already outlined above, population densities of deep - water bivalves commonly are low and our relatively comprehensive collection from the puez formation provides a rare opportunity to study such a fauna. the calcitic shells of atreta and the small oysters were cemented to the external surface of aragonitic ammonite shells that are now dissolved. thus, we can not tell whether the bivalves settled on live or dead ammonites. for the oysters, which attached on both sides and on the venter of the ammonite shell, it seems likely that they cemented to a live or at least floating cephalopod. moreover, atreta and the oysters were filter feeders and needed a considerable amount of suspended organic matter to survive. the near - total absence of filter - feeding organisms from the bottom community, however, suggests that bottom waters were nutrient depleted. inoceramid palaeobiology remains poorly understood, but these bivalves were apparently distributed widely from inner shelf to abyssal depths, although it seems that they were probably most abundant close to continental landmasses and oceanic islands (crampton, 1996 and references therein). they were epifaunal to semi - infaunal suspension feeders that could occupy a wide range of substrate types. obliquely elongate forms, such as inoceramus sp. from the puez formation, may have been semi - infaunal, whereas more circular taxa are likely to have been fully epifaunal recliners (crampton, 1996). some species are likely to have been byssate, at least at early growth stages, although it is not known whether this was the case for the taxa described here. many inoceramids were apparently tolerant of dysaerobic conditions (e.g., sageman, 1989), which explains their presence in some strata lacking other shelly faunas. however, there is no evidence for dysaerobic conditions from those layers of the puez formation that have yielded bivalve fossils. they have adapted to a carnivorous life style, preying on copepoda (hicks and marshall, 1985), foraminifera, and different kinds of eggs and larvae (morton and thurston, 1989). this is reflected in a small, reduced stomach, and strongly modified gills that have lost their filtering capacity (morton and thurston, 1989, waller, 2006, mikkelsen and bieler, 2008). most extant species in the propeamussiidae inhabit bathyal or abyssal zones (knudsen, 1970, mikkelsen and bieler, 2008), and their carnivorous life style clearly represents an adaptation to such environments in which suspended nutrients are usually scarce. apart from the propeamussiidae, only some poromyida, which thrive predominantly in similar habitats, have developed carnivorous feeding strategies (e.g., knudsen, 1979, poutiers and bernard, 1995). related to their feeding habits, most propeamussiids, including parvamussium, are free - living recliners, capable of swimming (waller, 2006). the shell of the propeamussiid right valve consists of an inner layer of crossed lamellar aragonite, a very thin middle layer of lathic or foliated calcite, and an outer layer of columnar prismatic calcite. in contrast, the shell of the left valve is composed of only two layers, i.e. an inner layer of crossed - lamellar aragonite and an outer layer of foliated calcite (waller, 2006). the internal costae in both valves consist of lathic calcite and are embedded in the aragonitic inner layer. a major part of the hinge elements is also composed of aragonite. this complex microstructure pattern explains the unique preservation of some of the specimens described above. in most specimens, furthermore, the internal costae became detached from the remainder of the shell, and are now commonly transposed onto the internal mould, simply because of a better adhesion to the marly sediment than to the smooth interior of the calcitic shell (fig. moreover, the external ornament of the shells can be traced from interior view mainly because of the lack of the aragonitic shell portions (fig. the shape and arrangement of the internal costae varies from almost straight and radial as seen in parvamussium mordsdrum n. sp., to distinctly antimarginal as in p. pizpuezense n. sp. to date however, new internal costae are formed at the anterior and posterior ends of the disc in species with straight internal costae, whereas they are usually inserted between existing costae in species with antimarginal costae. moreover, the growth of radial vs antimarginal costae must have involved different modes of shell morphogenesis, as has been suggested for shell folds by crampton and gale (2009 and references therein). the fossil record of the propeamussiidae starts in the middle to late triassic (hautmann, 2001, waller, 2006 ; a carboniferous first occurrence date was proposed by mikkelsen and bieler 2008, but has not been supported by data) and, despite the relative scarcity of well - preserved deep - water assemblages, is largely continuous through all stages to the present day. the great majority of propeamussiids has been recorded from (fossil) bathyal environments (e.g., lffler, 1999, dijkstra and gofas, 2004, del ro., 2008, dijkstra and maestrati, 2008, dijkstra and maestrati, 2010, harzhauser., 2011), although the family exhibits a total depth range from the intertidal zone down to c. 5000 m (waller, 2006). it has been proposed that the propeamussiidae thrived in shallow neritic environments until the early cenozoic and subsequently retreated to greater water depths (damborenea, 2002, del ro., 2008). evidence from the puez formation of the dolomites (piz de puez and ra stua) as well as from the montagne des voirons (pictet and loriol, 1858), however, suggests that several species of parvamussium already were adapted to life at greater water depths during the early cretaceous. cenozoic records of propeamussiids from shallow waters should be regarded with caution, since they may have come from regions that are subject to vigorous coastal upwelling, as has been suggested for lower pliocene deposits at velern - antena and velern - carretera (estepona region, southern spain ; aguirre., 2005) that have yielded abundant propeamussiids (lozano francisco, 1997, studencka., 2012) ; thus, these records may represent exceptions from the rule. waller (2006) and mikkelsen and bieler (2008) noted general sizes of up to 120 mm, but did not cite any particular species or references. huber (2010) indicated a maximum shell height of 90 mm, measured for the recent propeamussium dalli (e.a. regardless of precise upper limits, it is clear that parvamussium pizpuezense n. sp. is medium sized, whereas parvamussium mordsdrum n. sp., reaching 92 mm in length, clearly ranges into the top size class for the family. obviously, evolutionary size increase in the sense of cope 's rule is not the driving force of gigantism in propeamussiids, since exceptionally large taxa occur throughout the evolutionary history of the group (waller, 2006). more likely, specific environmental factors, which remain unknown, may have promoted evolution of large species. in total, a single individual of p. mordsdrum n. sp. and 16 specimens of parvamussium pizpuezense n. sp. from the puez formation at piz de puez have been collected (including those stored at naturmuseum sdtirol, bolzano, which were not examined in detail for the present study). thus, propeamussiidae account for a major portion of the autochthonous benthic fauna of the puez formation. coincidentally, no shallow - water taxa are recorded from the respective sediments, which may clearly indicate deposition at significant depths. the large individual of p. mordsdrum n. sp. provides indirect evidence of a rich meiofauna (potentially including inoceramid larvae), which generally is the preferred prey of the glass scallops. in addition to bivalves, the autochthonous fauna of the puez formation comprises benthic foraminifera, scleractinia (cycloseris ?), serpulidae (glomerula ?), ostracoda, brachiopoda (pygope, triangope), ophiuroidea and echinoidea (lukeneder and aspmair, 2006, lukeneder, 2008). discoid solitary corals of the genus cycloseris ? settled exclusively on dead ammonite shells and achieved a maximum diameter of more than 40 mm ; such corals are inferred to have lived for several years (lukeneder, 2008 ; compare also hamel., 2010). similar conditions can be deduced from pygopid brachiopods, which are usually also inferred to have favoured low - energy, deep - water environments with low sedimentation rate (kzmr, 1993, lukeneder, 2002 ; compare also vrs, 2005). bivalvia from the lower cretaceous puez formation at the type locality, piz de puez (dolomites, south tyrol, northern italy), occur in very low abundance. given the amount of sedimentary rock screened over the past decade, however, the bivalves examined here, numbering fewer than 50, are inferred to represent a reasonably comprehensive sample of the once - living fauna. small oysters and atreta have been found attached to the outside of ammonite shells and are interpreted to be allochthonous elements. however, the collection also provides insight into an autochthonous mesozoic deep - water bivalve community, which is dominated by glass scallops of the genus parvamussium. the abundant parvamussium pizpuezense n. sp. and the rare, giant p. mordsdrum n. sp. presumably were adapted to low - nutrient deep - water conditions, living as epifaunal - reclining carnivores and preying on various meiofauna. scarce epifaunal, suspension - feeding inoceramidae probably indicate occasional recruitment of larvae into an environment with low levels of suspended organic matter. the two new species of parvamussium from the dolomites and the contemporary p. agassizi (pictet and loriol) from southern france clearly show that several members of this genus had adapted to deep - water environments as early as the early cretaceous, and thus occupied a similar ecological niche to their modern counterparts. | a bivalve assemblage from the lower cretaceous puez formation at the type locality, piz de puez (dolomites, south tyrol, northern italy) is described. given the large amount of sedimentary rock screened during the course of this study, the < 50 bivalves examined here, although occurring in very low abundance, are considered to represent a reasonably comprehensive sample. the assemblage provides insight into an autochthonous, mesozoic, deep - water bivalve community, which was dominated by glass scallops. two species are described as new, parvamussium pizpuezense n. sp. and the giant p. mordsdrum n. sp. presumably, they lived as epifaunal - reclining carnivores and preyed on various meiofauna, occupying a similar ecologic niche as their modern counterparts. scarce epifaunal, suspension - feeding inoceramidae entered only by occasional recruitment of larvae into an environment that is inferred to have been characterised by low levels of suspended nutrients. |
in the movie contagion, laurence fishburne (as ellis cheever), chief of special pathogens at the centers for disease control, tells jennifer ehle (as ally hextall), an epidemiological intelligence service officer coordinating research on the fictional henipavirus mev-1, to move all research from bsl-3 (biosafety level 3) to bsl-4. she, in turn, calls elliott gould (as ian sussman), a university professor and virologist, telling him to cook his samples. he protests, saying that restricting work to a few bsl-4 laboratories will slow progress. gould acquiesces but continues his research, ultimately finding a way to grow the virus and make a vaccine. gould s character is loosely based on my experiences during the west nile virus outbreak in 1999. although our team identified the causative agent, political wrangling delayed permitting and shipment of the virus to our laboratory. to expedite diagnostics and drug development, given this history, many of my colleagues may expect that i would support gain - of - function research on the avian influenza virus h5n1 at bsl-3. they would be wrong. in both the fictional and west nile virus examples,, we do not know whether gain - of - function research will lead to a virus that is capable of sustained human - to - human transmission. furthermore, to our knowledge, the strains developed and in development do not exist outside specialized laboratories in a few major centers with expertise in influenza virus research. other authors featured in this issue address the risk - to - benefit ratio of conducting h5n1 gain - of - function research. for the purposes of this discussion, i will assume the work is going forward and focus my arguments on where the research should be conducted. my views reflect on - the - ground experience with the severe acute respiratory syndrome (sars) pandemic of 2003, 10 years as director of the northeast biodefense center (the largest national institutes of health regional center of excellence for biodefense and emerging diseases), director of the world health organization collaborating centre for diagnostics in zoonotic and emerging infectious diseases, and cochair of the national biosurveillance advisory subcommittee. they are, nonetheless, my views rather than those of the people and organizations i serve. first, for readers less conversant with biocontainment, it may be helpful to have some insights into centers for disease control and prevention (cdc) classification criteria (1). bsl-3 is a level of containment used for clinical, diagnostic, research, or production facilities wherein work is done with indigenous or exotic agents that have the potential for respiratory transmission that may cause serious and potentially lethal infection. design and operational protocols in bsl-3 containment address hazards to personnel related to inadvertent inoculation, ingestion, and exposure to infectious aerosols. bsl-3-ag, an augmented form of bsl-3 containment, addresses concern about the risk of environmental exposure to pathogens of consequence to agriculture by adding filtration of supply and exhaust air, sewage decontamination, exit personnel showers, and facility integrity testing. bsl-4 containment is used for work with dangerous and exotic agents that pose a high individual risk of life - threatening disease that may be transmitted via the aerosol route and for which there is no available vaccine or therapy. bsl-4 guidelines mandate daily inspection of facilities and equipment, extensive training, and monitoring of personnel for signs and symptoms of infectious disease. they also specifically require date and time logs of when personnel and materiel enter and exit containment. i do not mean to imply that investigators working at bsl-3 or bsl-3-ag are nonchalant or poorly trained or that they fail to monitor their staff or equipment ; however, training, monitoring, and access controls are not as rigorous as at bsl-4. in 2009, the general accounting office reported that the number of bsl-3 laboratories in the united states increased from 415 in 2004 to 1,362 in 2008 (2). we have no accurate information concerning the number of bsl-3 and bsl-3-ag laboratories worldwide ; nonetheless, it is likely to be much larger. in 2011, the national research council committee of international security and arms control reported the existence of 24 bsl-4 laboratories worldwide, with 12 in the united states alone, of which 6 were operational (4). between 2003 and 2009, the cdc recorded 395 potential release events in u.s. i am unable to find comprehensive data on similar events worldwide. even if we accept (as i do) that the laboratories now working on h5n1 gain - of - function research at bsl-3-ag are state of the art with respect to the quality of facilities, training, and screening of personnel and materiel, the challenge remains that other groups with access to bsl-3-ag containment that are not as well equipped or experienced can argue that they too are competent to pursue similar research without the additional burden of bsl-4 containment. my experience suggests that counterarguments to the effect that only investigators in more economically developed countries can work at lower levels of containment will be dismissed in the developing world as arrogant. in lieu of a shift to bsl-4, it may be feasible to introduce specific requirements for research at bsl-3-ag for agents with pandemic potential, particularly research concerned with a gain of function that enhances virulence or transmissibility. such requirements could be developed by the world health organization as an extension of the international health regulations circular laboratory biorisk management : strategic framework for management 20122016 (6). given the implications for humankind, whatever course we pursue must be developed with global consultation and oversight. | abstractthe discussion of h5n1 influenza virus gain - of - function research has focused chiefly on its risk - to - benefit ratio. another key component of risk is the level of containment employed. work is more expensive and less efficient when pursued at biosafety level 4 (bsl-4) than at bsl-3 or at bsl-3 as modified for work with agricultural pathogens (bsl-3-ag). however, here too a risk - to - benefit ratio analysis is applicable. bsl-4 procedures mandate daily inspection of facilities and equipment, monitoring of personnel for signs and symptoms of disease, and logs of dates and times that personnel, equipment, supplies, and samples enter and exit containment. these measures are not required at bsl-3 or bsl-3-ag. given the implications of inadvertent or deliberate release of high - threat pathogens with pandemic potential, it is imperative that the world health organization establish strict criteria for biocontainment that can be fairly applied in the developing world, as well as in more economically developed countries. |
female urethral cancer (uca) is a rare malignancy ; it accounts for approximately 1% of all female urological cancer (1). initial signs of uca, such as voiding symptoms and bloody spotting, are ignored in most patients with female uca because they are not pathognomonic. in fact, voiding symptoms and bloody spotting are common indicators of non - malignant conditions in normal healthy females. despite improvements in diagnostic imaging, delayed diagnosis remains a challenge in these patients (2). because initial diagnosis is delayed, female uca patients often present with large and advanced lesions at initial diagnosis, which results in poor prognosis (3). more importantly, because female uca is rare, the key prognostic factors remain poorly defined, and optimal therapeutic strategies are primarily based on limited evidence (4). given these challenges, all available evidence should be shared and discussed so that the current knowledge base about female uca is improved. additionally, previous studies were largely based on western populations, so more evidence is required to improve our understanding of female uca in asian countries. in this study, we evaluated 19 cases of female uca in korea and reported useful information about clinical features, treatment, and prognostic factors. we reviewed medical records of 21 consecutive patients diagnosed with female uca at our institution between august 1991 and april 2012. after two cases were excluded due to undefined histologic features, we finally examined 19 patients of female uca. we evaluated the following variables associated with patient characteristics : age, initial presenting symptoms, procedure type, whether or not the patient received adjuvant therapy, histologic type, tumor size and location, recurrence and sites, whether or not the patient received salvage therapy, and recurrence - free (rfs), cancer - specific (css) and overall survival (os). tumor location was classified as proximal, distal, and whole urethral involvement, as in a previous report (5). proximal tumors were defined as tumors limited to the proximal two - thirds of the urethra, while tumors were classified as " distal " if they were limited to the distal one - third of the urethra. pathological stages were determined according to the 7th edition of the american joint committee on cancer (ajcc) staging system (6). stage ta, t1, and t2 tumors with n0 and m0 were defined as low stage tumors, while stage t3 and t4 tumors with n1 - 2 and m1 were classified as high stage tumors (6). however, in cases where there was no documentation of pathological t stage, clinical t stage was used. local recurrence was defined as cancer reappearance at the operative sites or in the pelvic cavity, and distant recurrence was tumor relapse at other sites besides the pelvic cavity. the kaplan - meier method was used to calculate survival outcomes (rfs, css, and os) after initial treatment, and log - rank tests were used to determine statistically significant differences between survival curves. we used a cox proportional hazards model to identify significant predictors of survival outcomes according to clinicopathological variables. we rejected the 2-sided null hypothesis that there was no significant difference in cases where the p value was less than 0.05. consistently, we rejected the null hypothesis if the 95% confidence interval (ci) of point estimates excluded 1. all statistical analyses were performed using spss software, version 19.0 (ibm corp., armonk, ny, usa) and graphpad prism (graphpad software inc., la jolla, ca, usa). the institutional review board (irb) of seoul national university hospital approved this study (approval number : h-1406 - 072 - 588). because this study was conducted retrospectively the institutional review board (irb) of seoul national university hospital approved this study (approval number : h-1406 - 072 - 588). because this study was conducted retrospectively the median patient age at the time of diagnosis was 59.0 yr, and the median follow - up duration was 87.0 months. voiding symptoms and blood spotting were the most common and only 1 patients had no symptoms. with regard to tumor staging, 9 patients (47.4%) had low stage tumors and 10 patients (52.6%) had high stage tumors. additionally, the pathological findings were histologically diverse. 1 is a flow chart of the types of primary and adjuvant therapy used to treat patients. while 5 patients underwent biopsies without other surgical procedures, 14 patients underwent surgery including pelvic exenteration, urethrectomy, and local mass excision. for the 7 patients who received adjuvant therapy, such as radiation and systemic chemotherapy, there was no dominantly employed modality. overall, 57.9% of these patients (n=11) experienced tumor recurrence after primary therapy. the rates of lymph node and bone metastases were the same (27.7%), and these were the most common sites of recurrence. summarized information for all 19 patients evaluated in this study is also provided in table 2. s1 shows the oncological outcomes (rfs, css, and os) of the patients in this study. the 5-yr rfs, css, and os rates were 34.8% (standard error [se ] 22.7%-46.9%), 58.9% (se 46.8%-71.0%), and 58.9% (se 46.8%-71.0%). all oncological outcomes were significantly different between patients with low stage (stage i - ii) and high stage cancer (stage iii - iv) (fig. 2). when patients were classified by t stage, patients with advanced t stages (t3) had poor survival outcomes for rfs, css and os compared to patients with localized tumors (t2) (fig. patients with positive lymph nodes also had worse survival outcomes by all measurements compared to node - negative patients (fig. 4). however, only rfs, but not css and os, was worse in patients with tumors involving the entire urethra compared to patients with proximal or distal tumors (fig., we used a cox proportional hazards ratio regression model (table 3). in this analysis, positive lymph node status and advanced t stage (t3) were the significant factors for prediction of all oncological outcomes. additionally, tumor location (entire urethral involvement) was the significant predictor only for rfs, and not for css or os. in the present study, we examined the clinical experiences of 19 patients with female uca at a single tertiary institution. despite the small sample size and retrospective nature of this study, it is important to report all available evidence so that we can improve our understanding of this rare malignancy. notably, we found that cancer stage based on the ajcc classification, t stage, and lymph node status were associated with remarkable differences in rfs, css, and os between patient groups in kaplan - meier analysis. patients with high stage tumors (stage iii - iv), advanced t stage (t3), and positive lymph nodes had poor outcomes as indicated by all analyzed survival outcomes (rfs, css, and os) compared to their counterparts. importantly, lymph node positivity and advanced t stage were significantly predictive for poor outcomes in all survival estimates in cox regression analysis. additionally, involvement of the entire urethra remained as a predictor of rfs, but not css or os. champ. (7) analyzed the female uca patients in the surveillance, epidemiology, and end results (seer) database and reported that older age, pathological t stage, lymph node positivity, and non - squamous histology were significantly related to poor css. (5) suggested that pathological t stage was a strong predictive factor for rfs and css. pathological findings about lymph node status were also shown to predict survival in their study. a single center study by thyavihally. (8) reported that patients with early stage cancer (stage i - ii) according to the ajcc staging guidelines for female uca had better survival outcomes compared to patients with advanced stage tumors (stage iii - iv), regardless of the treatment modality. although other variables such as tumor size, histologic type, and treatment modality were not associated with any oncological outcomes in the present study, these factors have been reported as significant prognostic factors for female uca by other studies. bracken. (3) evaluated 81 cases of female uca and found that patients with large tumors (> 4 cm) had a lower 5-yr survival rate (about 13%) compared to patients with small tumors (< 2 cm), (about 60%). proximal tumors and lesions that involve the whole urethra have commonly been shown to be associated with poor oncological outcomes compared to distal lesions (9). 10) reported that all patients with proximal urethral tumors died, while 50% of patients with distal urethral tumors survived. the histologic type of female uca has also been suggested as a key determinant of prognosis (2711). the predominant tumor types are squamous cell carcinoma and urothelial carcinoma, and localized tumors of these histologic types are associated with better survival outcomes compared to tumors of less common histologic types, such as adenocarcinoma (21213). in a study by meis. (14), most patients with adenocarcinoma had locally advanced disease involving adjacent tissues or lymph node metastasis, and approximately 60% of these patients experienced cancer - related death within 2 yr of diagnosis. (1) examined 72 females with primary uca and reported that primary stage, lymph node status, and tumor site were key independent predictors of survival, but histologic type was not. (5) also found that tumor histology was not a significant predictor of recurrence or survival for female uca patients. they noted that pathological stage was the most important factor for prediction of prognosis. in our analysis, nearly half of the patients (n=9 ; 42.9%) were diagnosed with adenocarcinoma at the time of presentation ; these patients tended to have poor oncological outcomes, though the results were not statistically significant (data not shown). as discussed in previous studies, therapeutic policies are typically determined by tumor size, location, and aggressiveness (4). for example, surgical resection or radiation can be applied to small (< 2 cm) distal lesions, while a combination of radical surgery and radiation therapy is recommended for more advanced stage disease (1516). our results consistently demonstrated that patients who underwent aggressive surgery and received adjuvant radiation had mainly larger tumors (3 - 4 cm) and tumors that involved the entire urethra. although multimodal treatment with surgery, radiation, and systemic chemotherapy could be beneficial for selected patients with advanced stage cancer, the role of adjuvant chemotherapy has not yet been definitively shown to improve oncological outcomes (25). in the present study, 2 patients with advanced stage lesions received chemoradiotherapy. despite the use of combination therapy, these patients experienced tumor recurrence to the bone and inguinal lymph node, respectively, and eventually died as a result of their uca. second, 5 urologic surgeons managed female uca patients at our institution during the long study period. therefore, there was some difference in the treatment and follow - up protocols for the patients with this rare malignancy. finally, although this is the largest report of female uca in korea, the statistical power of this study was limited by insufficient number of cases. in conclusion, high stage, advanced t stage, and lymph node positivity are associated with poor prognosis for all analyzed survival outcomes (rfs, css, and os) in female uca patients after primary treatment. furthermore, lymph node status and t stage are significantly predictive of all survival outcomes. therefore, early diagnosis and management with early identification of this rare malignancy can improve the overall prognosis of uca patients. despite the limited case number, our results provide valuable information that expands the current knowledge about clinicopathological characteristics and factors that predict long - term prognosis of uca patients. (a) recurrence - free survival, (b) cancer - specific survival, and (c) overall survival of female urethral cancer patients. (a) recurrence - free survival, (b) cancer - specific survival, and (c) overall survival of female urethral cancer patients according to tumor location analyzed by the kaplan - meier method and log - rank tests. | the aim of this study was to evaluate female urethral cancer (uca) patients treated and followed - up during a time period spanning more than 20 yr at single institution in korea. we reviewed medical records of 21 consecutive patients diagnosed with female uca at our institution between 1991 and 2012. after exclusion of two patients due to undefined histology, we examined clinicopathological variables, as well as survival outcomes of 19 patients with female uca. a cox proportional hazards ratio model was used to identify significant predictors of prognosis according to variables. the median age at diagnosis was 59 yr, and the median follow - up duration was 87.0 months. the most common initial symptoms were voiding symptoms and blood spotting. the median tumor size was 3.4 cm, and 55% of patients had lesions involving the entire urethra. the most common histologic type was adenocarcinoma, and the second most common type was urothelial carcinoma. fourteen patients underwent surgery, and 7 of these patients received adjuvant radiation or systemic chemotherapy. eleven patients experienced tumor recurrence after primary therapy. patients with high stage disease, advanced t stage (t3), and positive lymph nodes had worse survival outcomes compared to their counterparts. particularly, lymph node positivity and advanced t stage were significant predictive factors for all survival outcomes. tumor location was the only significant predictor for recurrence - free survival. although our study included a small number of patients, it conveys valuable information about this rare female urologic malignancy in a korean population.graphical abstract |
gastric cancer is the fifth most common cancer among males and seventh most common cancer among females in india. the aggressiveness of the disease and need for improvement in therapeutic options is discerned by the fact the gastric cancer is the second most common cause of cancer death globally. the high incidence of local and distant recurrence even in patients with completely resectable gastric cancer indicates the systemic spread of cancer very early in the disease, thus emphasizing the need for multimodality treatment including surgery, radiotherapy, and chemotherapy for treating the disease. a high incidence of gastric cancer has been reported from southeast asia, most commonly from japan, china, and south korea, and this has been attributed to the consumption of preserved food containing carcinogenic nitrates. the incidence of gastric cancer in india is overall less compared to the worldwide incidence. the age - adjusted rate (aar) of gastric cancer among urban registries in india is (3.013.2) compared to the worldwide aar (4.195.5).[36 ] worldwide and more so in the developed world, there has been a decline in the incidence of gastric cancer and this has been attributed to improved food hygiene, sanitation, and food preservation techniques. the regional variation in incidence and presentation can be ascertained by the fact that gastric cancer in south indian males has been reported to be more common and occurring a decade before their north indian counterparts. differences in some dietary pattern and use of tobacco and alcohol have been considered as potential risk factors. in a case control study from trivandrum, a high consumption of rice and chili, and consumption of high - temperature food were found to be independent risk factors for gastric cancer in multivariate analysis. in a study from hyderabad comparing 94 gastric cancer patients and 100 normal age- and sex - matched controls, smoking (p<0.01) and alcohol (p<0.05) were significantly associated with gastric cancer. the incidence of gastric cancer in mizoram has been reported to be the highest in india. the aar in males and females has been reported at 50.6 and 23.3, respectively. hospital - based data from mizoram have shown gastric cancer to be the most common cancer accounting for 30% of all cancer cases. the male - to - female ratio was 2.3:1 ; the median age for males was 58 years and that for female was 57 years. the high prevalence of gastric cancer in mizoram has been attributed to dietary and possibly some unknown genetic differences. in a case control study from mizoram among the cases, the risk of stomach cancer was significantly high in current smokers (odds ratio (or), 2.3 ; 95% confidence interval (ci), 1.48.4). higher risks were seen for meiziol (a local cigarette) smokers (or, 2.2 ; 95% ci, 1.3 - 9.3). tuibur (tobacco smoke - infused water), used mainly in mizoram, was associated with the risk of stomach cancer among current users in both univariate and multivariate models (or, 2.1 ; 95% ci, 1.33.1. in another report from chennai, alcohol consumption and use of pickled food were found independent risk factors for gastric cancer. on the other hand, hospital - based data are prone to selection and referral bias and hence the above results need to be viewed with caution. in another hospital - based study from kashmir, there was no association found between gastric cancer and helicobacter pylori infection in 1314 patients. similar to mizoram, the incidence was higher in males and the cancer occurred most commonly in the fifth decade of life. the most common site of tumor was the body of stomach (40.7%) followed by the pylorus (35.5%). in conclusion, the epidemiology of gastric cancer suggests that it is not a single disease or caused by a single factor, but a combination of genetic, sociocultural, and environmental factors in a given region dictates its presentation. gastric cancer can broadly be classified as intestinal or diffuse as proposed by lauren. based on histological findings. it can also be classified according to the anatomic site as proximal (cardia, fundus, and gastroesophageal junction) and distal (pylorus). interestingly, the incidence of proximal cancers is increasing in the developed world in concordance with the increase in esophageal cancers suggesting that these might have similar risk factors and pathologies. pylori, a gram - negative bacteria, is associated with gastric mucosal infection. in underdeveloped countries with poor hygienic conditions, 50 - 90% of the population h. pylori has been attributed to cause distal gastric cancers and it is believed that the overall decline in gastric cancers and more so distal cancers worldwide is due to reduction and eradication of h. pylori infection with improved sanitation. however, it should be assumed that countries with a very high prevalence should have the highest incidence but this is not true as asia and africa although with a high incidence of h. pylori infection have a low incidence of gastric cancer. this asian or african paradox suggests that h. pylori by itself can not cause gastric cancer and various other factors are needed for causation. it is also believed that the poor study design and inaccuracies in techniques quantifying h. pylori may account for such paradoxical results. various etiological factors including smoking, alcohol, nitrates, and h. pylori have been proposed as causative factors for gastric cancer. subtotal gastrectomy is the preferred modality in distal cancers and total or proximal gastrectomy is preferred in proximal cancers. a tumor - free resection margin of at least 4 cm is needed for the adequacy of the surgery. patients are considered surgically unresectable if there is evidence of metastasis or locoregional spread involving the peritoneum or encasement of major vessels. there is a considerable controversy regarding the role and extent of lymphadenectomy in gastric cancer. extensive lymphadenectomy also called as d2 dissection is widely practiced in far eastern countries like japan and korea. the survival advantage and decreased mortality seen with d2 lymphadenectomy by japanese surgeons has not been translated in western countries. data from europe and usa have shown that more conservative d1 lymphadenectomy is equal to d2 lymphadenectomy in terms of overall survival with lesser morbidities. a middle path approach of less aggressive d2 lymphadenectomy also called as modified d2 lymphadenectomy excludes splenectomy and pancreatectomy and has been found to be equivalent to d2 lymphadenectomy. surgical skills and the volume of surgery done in a center also influence the outcomes of lymphadenectomy ; results with d2 lymphadenectomy are better in japan because of more experienced surgeons and large volume of surgeries for gastric cancer. a minimum of 15 lymph nodes should be sampled by the surgeon and reported by the pathologist for an adequate pathological staging. a study from tata memorial hospital, mumbai, the study included 159 patients with resectable gastric cancer who underwent radical gastrectomy with d2 lymphadenectomy. the median number for lymph nodes dissected was 15 and the rate of major morbidity was 4.4% with the mortality due to surgery being 1.25%. this study shows that indian surgeons in high - volume centers can achieve results comparable to best centers in the west. a significant proportion of patients with completely resected gastric cancer still relapse locally as well as at distant sites, suggesting that gastric cancers tend to metastasize early in the course of the disease. chemotherapy can be used prior to surgery to shrink the tumor and make it operable ; this is called neoadjuvant chemotherapy (nact). the only randomized control trial on perioperative chemotherapy was the magic trial conducted by the medical research council, uk. the trial randomized 503 patients between surgery alone and surgery and perioperative chemotherapy with epirubicin, cisplatinum, and 5-flurouracil (ecf). patients who received perioperative chemotherapy had better overall survival and progression - free survival in comparison to patients who underwent surgery alone. twenty - five percent of patients in the study had cancer of the gastroesophageal junction or lower esophagus. there are very little data from randomized control trial (rct) in adjuvant chemotherapy in gastric cancer. a japanese study has showed improved survival with s1, a prodrug combining fluropyrimidine (tegafur) with oxonic acid, in patients with stage 2 and 3, completely resected gastric cancer. the drug is not easily available outside japan. significant proportion of indian patients present with inoperable, locally advanced, or metastatic gastric cancer. these patients have an incurable disease and the role of chemotherapy in them is purely palliative. various chemotherapeutic agents have shown an activity in gastric cancer ; typically, these agents have a response rate of 1020% when used individually. the commonly used chemotherapy drugs are cisplatinum, 5-flurouracil, capecitabine, paclitaxel, epirubicin, docetaxel, paclitaxel, oxaliplatin, and irinotecan. chemotherapy combinations are preferred to single agents for a faster response, although toxicity increases with the use of combination chemotherapy. chemotherapy in metastatic gastric cancer improves the overall survival when compared to best supportive care. however, the median survival with various chemotherapy combinations or single agents has ranged from 9 to 11 months. significant proportions of indian patients present with advanced gastric cancer and have a poor performance status, which makes their tolerability to chemotherapy poor. a phase 2 study from aiims, new delhi, evaluated low - dose cisplatinum (15 mg / m), etoposide (40 mg / m), and paclitaxel (50 mg / m), cep, chemotherapy given on day 1 and 4 every 3 weeks in 33 patients with locally advanced or metastatic gastric cancer. a total of 26 of 33 patients showed response to cep chemotherapy (2 complete responses, 21 partial responses, and 3 stable diseases). the median age of the patients was 52 years ; a median of two cycles of chemotherapy was given and the median overall survival and progression - free survival was 10 months and 8 months, respectively. the incidence of grade 3 and 4 toxicity was 35% (most common being neutropenia) ; overall the chemotherapy was well tolerated. this study suggests that patients with advanced disease can also benefit from combination low - dose chemotherapy. the role of nact has also been explored in indian patients with unresectable gastric cancer. in a study from aiims, new delhi, 10 patients with locally advanced unresectable gastric cancer received nact with two cycles of cisplatin (30 mg / m2) and 5-fluorouracil (1000 mg / m2). eight of them showed objective response, six could undergo curative surgery, and the median survival was 10 months (range 160 months). a combination of chemotherapy and radiotherapy has been very effective in certain malignancies like head and neck cancers and anorectal cancers. preoperative chemoradiotherapy looks attractive as it has the potential to downsize tumors and make unresectable gastric cancer resectable. in a phase 3 study by stahl., patients with unresectable gastric cancer were randomized to preoperative chemotherapy followed by surgery or induction chemotherapy followed by preoperative chemo - radiotherapy and surgery. patients in the chemo - radiotherapy group had a statistically significant higher pathological complete response rate (15.6% vs. 2%), with the overall survival at 3 years showing a trend toward better survival with chemo - radiotherapy (47.4% vs. 27.7%). even in patients with resectable gastric cancer, preoperative chemo - radiotherapy improves pathological complete response rates and increases the success of d2 lymphadenectomy. postoperative chemo - radiotherapy was evaluated in the swog9008/int-0116 trial, now famously referred as the macdonald trial. the trial included 556 patients with adenocarcinoma of stomach and lower gastroesophageal junction, stage 14 (nonmetastatic) operated tumors. the chemo - radiotherapy protocol included 5-flurouracil and folinic acid (bolus regime) given in a schedule of one cycle before radiotherapy, two cycles concurrent with radiation, and two cycles after the completion of radiotherapy. patients in the chemo - radiotherapy arm had a better overall survival (50% vs. 41%, p=0.05), 3 years relapse - free survival (48% vs. 31%), and lesser local recurrence (19% vs. 29%). this study showed that the chemo - radiotherapy can be effective as adjuvant treatment in gastric cancer. however, the macdonald trial has faced several criticisms some of which include inadequate surgery as only 10% of patients underwent d2 lymphadenectomy, and 54% underwent a less extensive d1 dissection. critics argue that a more extensive surgery would have probably negated the advantage obtained from chemo - radiotherapy. there are no published data on radiotherapy or chemo - radiotherapy in gastric cancers from india and all our practice has been based on findings of the western literature. there is an urgent need for well - designed randomized control trials on chemotherapy and chemo - radiotherapy from the indian subcontinent, as we believe that the biology of gastric cancer from the subcontinent differs from the rest of the world. extrapolating data from the rest of the world might not serve the best interests of our patients. targeted therapy including monoclonal antibodies and tyrosine kinase inhibitors have shown efficacy in various solid tumors in breast, lung, and colon cancer. her2 belongs to the human epidermal growth factor receptor family and its function is blocked by the monoclonal antibody trastuzumab. the toga study was a phase 3 rct, which evaluated trastuzumab along with cisplatin and 5-flurouracil therapy in 594 patients with her2-positive advanced gastric cancer. trastuzumab addition to chemotherapy improved the overall survival significantly (13.5 months vs. 11.5 months). there were no increased adverse effects with trastuzumab therapy. subtotal gastrectomy is the preferred modality in distal cancers and total or proximal gastrectomy is preferred in proximal cancers. a tumor - free resection margin of at least 4 cm is needed for the adequacy of the surgery. patients are considered surgically unresectable if there is evidence of metastasis or locoregional spread involving the peritoneum or encasement of major vessels. there is a considerable controversy regarding the role and extent of lymphadenectomy in gastric cancer. extensive lymphadenectomy also called as d2 dissection is widely practiced in far eastern countries like japan and korea. the survival advantage and decreased mortality seen with d2 lymphadenectomy by japanese surgeons has not been translated in western countries. data from europe and usa have shown that more conservative d1 lymphadenectomy is equal to d2 lymphadenectomy in terms of overall survival with lesser morbidities. a middle path approach of less aggressive d2 lymphadenectomy also called as modified d2 lymphadenectomy excludes splenectomy and pancreatectomy and has been found to be equivalent to d2 lymphadenectomy. surgical skills and the volume of surgery done in a center also influence the outcomes of lymphadenectomy ; results with d2 lymphadenectomy are better in japan because of more experienced surgeons and large volume of surgeries for gastric cancer. a minimum of 15 lymph nodes should be sampled by the surgeon and reported by the pathologist for an adequate pathological staging. a study from tata memorial hospital, mumbai, the study included 159 patients with resectable gastric cancer who underwent radical gastrectomy with d2 lymphadenectomy. the median number for lymph nodes dissected was 15 and the rate of major morbidity was 4.4% with the mortality due to surgery being 1.25%. this study shows that indian surgeons in high - volume centers can achieve results comparable to best centers in the west. a significant proportion of patients with completely resected gastric cancer still relapse locally as well as at distant sites, suggesting that gastric cancers tend to metastasize early in the course of the disease. chemotherapy can be used prior to surgery to shrink the tumor and make it operable ; this is called neoadjuvant chemotherapy (nact). the only randomized control trial on perioperative chemotherapy was the magic trial conducted by the medical research council, uk. the trial randomized 503 patients between surgery alone and surgery and perioperative chemotherapy with epirubicin, cisplatinum, and 5-flurouracil (ecf). patients who received perioperative chemotherapy had better overall survival and progression - free survival in comparison to patients who underwent surgery alone. twenty - five percent of patients in the study had cancer of the gastroesophageal junction or lower esophagus. there are very little data from randomized control trial (rct) in adjuvant chemotherapy in gastric cancer. a japanese study has showed improved survival with s1, a prodrug combining fluropyrimidine (tegafur) with oxonic acid, in patients with stage 2 and 3, completely resected gastric cancer. significant proportion of indian patients present with inoperable, locally advanced, or metastatic gastric cancer. these patients have an incurable disease and the role of chemotherapy in them is purely palliative. various chemotherapeutic agents have shown an activity in gastric cancer ; typically, these agents have a response rate of 1020% when used individually. the commonly used chemotherapy drugs are cisplatinum, 5-flurouracil, capecitabine, paclitaxel, epirubicin, docetaxel, paclitaxel, oxaliplatin, and irinotecan. chemotherapy combinations are preferred to single agents for a faster response, although toxicity increases with the use of combination chemotherapy. chemotherapy in metastatic gastric cancer improves the overall survival when compared to best supportive care. however, the median survival with various chemotherapy combinations or single agents has ranged from 9 to 11 months. significant proportions of indian patients present with advanced gastric cancer and have a poor performance status, which makes their tolerability to chemotherapy poor. a phase 2 study from aiims, new delhi, evaluated low - dose cisplatinum (15 mg / m), etoposide (40 mg / m), and paclitaxel (50 mg / m), cep, chemotherapy given on day 1 and 4 every 3 weeks in 33 patients with locally advanced or metastatic gastric cancer. a total of 26 of 33 patients showed response to cep chemotherapy (2 complete responses, 21 partial responses, and 3 stable diseases). the median age of the patients was 52 years ; a median of two cycles of chemotherapy was given and the median overall survival and progression - free survival was 10 months and 8 months, respectively. the incidence of grade 3 and 4 toxicity was 35% (most common being neutropenia) ; overall the chemotherapy was well tolerated. this study suggests that patients with advanced disease can also benefit from combination low - dose chemotherapy. the role of nact has also been explored in indian patients with unresectable gastric cancer. in a study from aiims, new delhi, 10 patients with locally advanced unresectable gastric cancer received nact with two cycles of cisplatin (30 mg / m2) and 5-fluorouracil (1000 mg / m2). eight of them showed objective response, six could undergo curative surgery, and the median survival was 10 months (range 160 months). a combination of chemotherapy and radiotherapy has been very effective in certain malignancies like head and neck cancers and anorectal cancers. preoperative chemoradiotherapy looks attractive as it has the potential to downsize tumors and make unresectable gastric cancer resectable. in a phase 3 study by stahl., patients with unresectable gastric cancer were randomized to preoperative chemotherapy followed by surgery or induction chemotherapy followed by preoperative chemo - radiotherapy and surgery. patients in the chemo - radiotherapy group had a statistically significant higher pathological complete response rate (15.6% vs. 2%), with the overall survival at 3 years showing a trend toward better survival with chemo - radiotherapy (47.4% vs. 27.7%). even in patients with resectable gastric cancer, preoperative chemo - radiotherapy improves pathological complete response rates and increases the success of d2 lymphadenectomy. postoperative chemo - radiotherapy was evaluated in the swog9008/int-0116 trial, now famously referred as the macdonald trial. the trial included 556 patients with adenocarcinoma of stomach and lower gastroesophageal junction, stage 14 (nonmetastatic) operated tumors. the chemo - radiotherapy protocol included 5-flurouracil and folinic acid (bolus regime) given in a schedule of one cycle before radiotherapy, two cycles concurrent with radiation, and two cycles after the completion of radiotherapy. patients in the chemo - radiotherapy arm had a better overall survival (50% vs. 41%, p=0.05), 3 years relapse - free survival (48% vs. 31%), and lesser local recurrence (19% vs. 29%). this study showed that the chemo - radiotherapy can be effective as adjuvant treatment in gastric cancer. however, the macdonald trial has faced several criticisms some of which include inadequate surgery as only 10% of patients underwent d2 lymphadenectomy, and 54% underwent a less extensive d1 dissection. critics argue that a more extensive surgery would have probably negated the advantage obtained from chemo - radiotherapy. there are no published data on radiotherapy or chemo - radiotherapy in gastric cancers from india and all our practice has been based on findings of the western literature. there is an urgent need for well - designed randomized control trials on chemotherapy and chemo - radiotherapy from the indian subcontinent, as we believe that the biology of gastric cancer from the subcontinent differs from the rest of the world. extrapolating data from the rest of the world might not serve the best interests of our patients. targeted therapy including monoclonal antibodies and tyrosine kinase inhibitors have shown efficacy in various solid tumors in breast, lung, and colon cancer. her2 belongs to the human epidermal growth factor receptor family and its function is blocked by the monoclonal antibody trastuzumab. the toga study was a phase 3 rct, which evaluated trastuzumab along with cisplatin and 5-flurouracil therapy in 594 patients with her2-positive advanced gastric cancer. trastuzumab addition to chemotherapy improved the overall survival significantly (13.5 months vs. 11.5 months). there were no increased adverse effects with trastuzumab therapy. the incidence of gastric cancer is decreasing in developed countries and more proximal cancers are reported. however, among the major population - based cancer registries in india, only mumbai and chennai have reported a decline in incidence. a shift from distal to proximal as the site of disease has not been reported from india. though the aar of gastric cancer is low in majority of pbcr, the absolute number is still high because of the size of india 's population. however, when we search for the contribution of the indian scientific fraternity to the world medical literature for gastric cancer, it is clear that a lot more is to be done ; the possible reason may be a busy clinical schedule or lack of initiatives. clinicians need to take out time from their busy clinical schedule and devote more time to research for the larger benefit to the society. there is an urgent need for research in various aspects of gastric cancer from india including epidemiological and therapeutic areas. we suggest that the scientists / clinicians from high - incidence areas take lead in this regard and we are sure that they will the support from well - recognized academic centers and other government agencies in this aspect. chemotherapy and radiotherapy protocols designed to meet the requirement of our population should be designed and validated in prospective trials so as to confirm the benefit of adjuvant chemo - radiotherapy or and evaluate the tolerance and effectiveness of newer aggressive chemotherapy regimes containing docetaxel or epirubicin combined with standard cisplatinum and 5-flurouracil. | the incidence of gastric cancer in india is low compared to developed countries, though there are certain geographical areas (southern part and northeastern states of country) where the incidence is comparable to high - incidence areas of world. despite the large number of patients being treated for gastric cancer, there are not sufficient publications discussing associated risk factors and outcomes in these patients. this article discusses relevant indian epidemiological and clinical studies about gastric cancers. this article also highlights the gap in publication from india and developed countries regarding gastric cancer and stresses on collaborative efforts of the indian scientific community to conduct epidemiological, pathological, and clinical studies to have a new standard of care for indian patients. |
the dengue virus is a single - stranded rna virus of the flaviviridae family causing dengue fever and dengue hemorrhagic fever. dengue encephalopathy is usually secondary to multisystem derangement like shock, hepatitis, coagulopathy, and concurrent bacterial infection. dengue encephalitis is a different entity, which occurs due to direct neuronal infiltration by the dengue virus. we report a case of dengue shock syndrome with encephalitis, with peculiar mri findings. a 17-year - old girl presented with a history of high - grade fever and rigors for three days. she had two episodes of vomiting, generalized headache, and altered sensorium, lasting for 15 to 20 minutes, few hours prior to admission. there was no significant past medical history. on admission she was febrile, with a temperature of 101f, pulse of 132 / minute, blood pressure of 90 / 40 mmhg (map-60 mmhg) and cold extremities. on pulse she was pale, and skin rash, edema, icterus, and clubbing were absent. first dose of third generation cephalosporin was given empirically in view of the possibility of bacterial infection. investigations revealed hemoglobin (hb) of 14.5 g / dl, packed cell volume (pcv) of 45, white blood cell count (wbc) of 7100 / cumm, with neutrophils 64%, lymphocytes 34%, and monocytes 2%. the platelet count was 1.35 lacs / cumm and esr was 48 mm at the end of one hour. u / l, sgpt-182u / l. serum albumin was 3.65 gm / dl, and inr was 2.0. blood urea nitrogen was 39 gm / dl with creatinine of 1.4 mg / dl. there was evidence of metabolic acidosis with blood lactate 2.00 mmol / l on initial blood gas. no hypoxia or hypercapnia was seen ; x- ray chest and 2 d echocardiography were normal. ultrasonography (usg) showed evidence of bilateral minimal pleural effusion with mild ascites. the patient 's blood pressure and urine output improved after initial resuscitation with crystalloids. a few hours later, this young girl had an episode of generalized tonic - clonic seizure with unresponsiveness. she was intubated and ventilated in view of the poor level of consciousness after the seizure. it showed [figure 1 ] extensive parenchymal hyperintense lesions in the bilateral cerebellar cortex, vermis of the cerebellum, entire pons and midbrain, bilateral medial temporal lobes, and both thalami, on t2 and fluid attenuated inversion recovery (flair) images. these lesions look hypointense on t1w images, hyperintense on flair images, and dark on the adc map. small foci of hemorrhage in the thalamic lesions looking hypointense, were seen on the t2 gre images. t 2 flair and t2-weighted images showing involvement of thalamus, pons, and cerebellum, with presence of hemorrhage on t2 and restricted diffusion on dwi cerebrospinal fluid (csf) analysis was done. igg / igm antibodies for dengue were positive in the serum as also on the dna polymerase chain reaction (pcr) for dengue. titers for hepatitis viruses were negative (hav, hev, hbsag, hcv). serum procalcitonin was 0.3 ng / ml (negative less than 0.5 ng / ml). her liver functions improved subsequently, and serum ammonia and electrolytes were within normal limits. she remained comatose even after correction of shock, hepatitis, metabolic acidosis, and coagulopathy. the mri brain findings were in favor of the possibility of direct extensive neuronal injury. although the mri brain findings were in favor of je, csf analysis was negative for je. therefore, the possibility of viral encephalitis due to dengue was strongly suspected. during the hospital course, she developed multiorgan dysfunction, shock, and acute respiratory distress syndrome (ards). empirical antibiotics and antimalarials were continued till reports of the causative agent were obtained, and then withdrawn. table 2 shows her investigations over the next 10 days. in spite of all the treatment she continued to remain comatose, with hemodynamic compromise, and expired on the eleventh day after admission dengue virus infections are among the most common cause for hospital admissions in western maharashtra. it is estimated that 50 to 100 million infections and 25,000 fatalities occur worldwide every year. the world health organization (who) surveillance shows that the global incidence is rising. numerous neurological manifestations like transverse myelitis, myositis, and gullian - barre syndrome have been reported. dengue encephalopathy is a well - recognized and common entity, the incidence ranging from 0.5 to 6.2 %. the possible mechanisms are liver failure (hepatic encephalopathy), cerebral hypoperfusion (shock), cerebral edema (vascular leak), deranged electrolytes, and intracranial bleeding due to thrombocytopenia or coagulopathy, which is secondary to hepatic failure. _ there are subsets of patients in whom the cause for neurological injury remains unclear even after excluding the above - mentioned indirect mechanisms. dengue is thought to be a non - neurotropic virus. however, there are reports of the demonstration of dengue virus and igm antigen in the cerebrospinal fluid (csf) of patients with encephalopathy. there are case reports by misra., from india, and solomon., from vietnam, 11 patients were seen with confirmed dengue infection, but no csf study was reported. solmon., diagnosed dengue encephalitis in nine patients, but virus or antibody was found in the csf of only two cases. kularatne., had a similar study in which they showed the association of dengue with encephalitis. on admission our patient had a history suggestive of encephalopathy with shock, coagulopathy, metabolic acidosis, and deranged liver functions. the mri findings noted in our case are most characteristic of je and not commonly seen with dengue fever. [bilateral thalamic involvement with foci of hemorrhage, with involvement of temporal lobe and brain stem ] is very uncommon with dengue. this case is presented to highlight the possible extensive involvement of the brain by dengue virus. dengue is not classically a neurotropic virus, although there is recent evidence of direct neuronal injury. dengue encephalitis must be thought of in differentials of encephalopathy, in patients with dengue. in such cases, neuroimaging and csf analysis the virus or antibody can be isolated from the serum, but the csf samples may be negative. the dengue encephalitis is thought to be benign, but can be fatal at times. the role of an antiviral in such cases needs to be further defined because of the extensive parenchymal involvement and possible unfavorable outcome. | we report a case of dengue fever with features of encephalitis. the diagnosis of dengue was confirmed by the serum antibodies to dengue and the presence of a dengue antigen in the cerebrospinal fluid. this patient had characteristic magnetic resonance imaging brain findings, mainly involving the bilateral thalami, with hemorrhage. dengue is not primarily a neurotropic virus and encephalopathy is a common finding in dengue. hence various other etiological possibilities were considered before concluding this as a case of dengue encephalitis. this case explains the importance of considering the diagnosis of dengue encephalitis in appropriate situations. |
lipomas are the most common benign mesenchymal tumors developing in any location where fat is normally present. the etiology of lipomas is uncertain and the tumors mainly affect the region of the trunk, shoulders, neck, and axilla. involvement of the oral cavity is rare, with lipomas corresponding to less than 4.4% of all benign oral soft tissue tumors. they commonly present as slow - growing asymptomatic lesions with a characteristic yellow color and soft, doughy feel in the buccal mucosa, floor of the mouth and tongue in the fourth and fifth decades, and generally with no gender predilection. oral lipomas can occur in various anatomic sites including the major salivary glands, buccal mucosa, lip, tongue, palate, vestibule, and floor of mouth. although benign in nature, their progressive growth may cause interference with speech and mastication due to tumor 's dimension. a 10-year - old female patient reported with a chief complaint of swelling on left cheek. the swelling was first noticed two years ago, which showed slow continuous gradual enlargement. intraoral examination revealed a pinkish, well - defined oval swelling measuring 2.5 3 cm present in the left buccal mucosa [figure 1 ]. on palpation, the swelling was soft, fluctuant, non - tender, mobile, and the margins were slippery under the palpating finger. the lesion was excised under local anesthesia and the excised tissue was sent for histopathological examination [figures 2 and 3 ]. showing fibrolipoma of left buccal mucosa buccal mucosa after surgical resection of the lesion microscopic examination revealed adipose tissue with compressed blood vessels embedded within dense collagen fibers. the overlying epithelium was 8 to 10 layers thick, atrophic, parakeratinized and stratified squamous type. correlating with the clinical and histopathological examination, the excised lesion was suggestive of fibrolipoma [figure 4 ]. histologic appearance of fibrolipoma [h & e, 10 ] postoperative healing of buccal mucosa the first description of oral lipoma was provided in 1848 by roux in a review of alveolar masses which he referred it as a yellow epulis. the lipoma is a very common benign tumor of adipose tissue, but its presence in the oral and oropharyngeal region is relatively uncommon with a prevalence rate of only 1/5000 adults. fibrolipoma is a microscopic variant of lipoma characterized by a significant fibrous component intermixed with lobules of fat cells. the consistency of this lesion varies from soft to firm, depending on the quantity and distribution of fibrous tissue and the depth of the tumor. the tumor has been reported to be more frequent in the buccal mucosa and buccal vestibule, and it also shows a slight predominance in females. in our case, fregnani. collected several cases and diagnosed 45.7% cases as lipomas and 39.1% cases as fibrolipomas. hereditary, fatty degeneration, hormonal basis, trauma, infection, infarction, and chronic irritation are probable representative theories to elucidate the pattern of a lipoma. the most common of these is the fibrolipoma, characterized by a significant fibrous component intermixed with the lobules of fat cells. the spindle cell lipoma is another variant that demonstrates variable amount of uniform appearing spindle cells in conjunction with a more typical lipomatous component. intramuscular lipomas are often more deeply situated and have an infiltrative growth pattern that extends between skeletal muscle bundles. this tumor can be life threatening due to obstruction of upper airway by virtue of its size as sudden asphyxia death has been reported in a case of esophageal fibrolipoma. lesions outside the oral cavity could show greater recurrence rates after surgical excision, but intraoral intramuscular lipomas, although not well - limited, rarely show recurrence if completely excised. most of lipomas develop in the subcutaneous tissues but deeper tissues may be involved as well. the complete resection should be emphasized, which is the key factor to avoid recurrence. | the lipoma is a very common benign tumor of adipose tissue, but its presence in the oral and oropharyngeal region is relatively uncommon. fibrolipoma, a histological variant of lipoma, mostly affect the buccal mucosa and causes functional and cosmetic disabilities. hence, accurate histopathological examination of lipomas is important for a correct treatment plan. this article describes a case of 10 year old girl with fibrolipoma of the buccal mucosa with a relevant review of tumors. |
author do not report any financial or personal links with other persons or organizations, which might affect negatively the content of this publication and/or claim authorship rights to this publication. | it is estimated that 3.4% of patients qualified for cholecystectomy due to cholelithiasis have a coexisting choledocholithiasis. for decades, endoscopic ascending retrograde cholangiopancreatography has been the golden diagnostic standard in cases of suspected choledocholithiasis. the method is associated with a relatively high rate of complications, including acute pancreatitis, the incidence of which is estimated to range between 0.74% and 1.86%. the mechanism of this ercp - induced complication is not fully understood, although factors increasing the risk of acute pancreatitis, such as sphincter of oddi dysfunction, previous acute pancreatitis, narrow bile ducts or difficult catheterization of vater 's ampulla are known. it has been suggested to discontinue the diagnostic endoscopic retrograde ascending cholangiopancreatography and replace it with endoscopic ultrasonography due to possible and potentially dangerous complications. endoscopic ultrasonography has sensitivity of 94% and specificity of 95% regardless of gallstone diameter, as opposed to magnetic resonance cholangiography. however, both of these parameters depend on the experience of the performing physician. the use of endoscopic ultrasonography allows to limit the number of performed endoscopic retrograde cholangiopancreatography procedures by more than 2/3. ascending endoscopic retrograde cholangiopancreatography combined with an endoscopic incision into the vater 's ampulla followed by a mechanical evacuation of stone deposits from the ducts still remains a golden standard in the treatment of choledocholithiasis. despite some limitations such as potentially increased treatment costs as well as the necessity of the procedure to be performed by a surgeon experienced in both endoscopic retrograde cholangiopancreatography as well as endoscopic ultrasonography, the diagnostic endoscopic ultrasonography followed by a simultaneous endoscopic retrograde cholangiopancreatography aimed at gallstone removal is the most efficient diagnostic and therapeutic management scheme in cases of suspected choledocholithiasis. |
in cross - sectional analyses, we evaluated the likelihood that americans with previously unrecognized pre - diabetes would meet ada consensus panel recommendations for consideration of metformin in addition to change in lifestyle. criteria for consideration of metformin included the presence of both ifg and igt, with 1 additional diabetes risk factor : age 0. among this subset (n = 2,833), we included only those who were non - hispanic black or white (to match our study population) (n = 2,057). in the nhanes 20052006 population, all subjects 12 years who were seen in the morning session were asked to have an ogtt performed. subjects were eligible for the ogtt if they had fasted overnight for at least 9 h, reported no use of oral medications or insulin for diabetes, were not pregnant, did not have hemophilia, and did not receive cancer chemotherapy in the previous 3 weeks. all blood samples for the 2-h glucose measurement were drawn between 100 and 135 min after ingestion of the glucose load. for our analysis, we included only those who were 18 years, had no known history of diabetes, were non - hispanic black or white (to match our study population), and had a survey weight value > 0 (n = 1,154). because some subjects had more than one blood pressure measurement, the average of the measurements was used for the analysis. for the sigt, nhanes iii, and nhanes 20052006 subjects, age, bmi, and a1c were categorized using the cutoffs recommended by the ada : age 6.0% (8). other risk factors for diabetes that were not specifically defined by the ada were categorized according to the american heart association / national heart, lung, and blood institute (aha / nhlbi) diagnostic criteria for metabolic syndrome (12) : presence of hypertension by history, systolic blood pressure > 130 mmhg or diastolic blood pressure > 85 mmhg, triglyceride level 150 mg / dl, and hdl cholesterol 0. among this subset (n = 2,833), we included only those who were non - hispanic black or white (to match our study population) (n = 2,057). in the nhanes 20052006 population, all subjects 12 years who were seen in the morning session were asked to have an ogtt performed. subjects were eligible for the ogtt if they had fasted overnight for at least 9 h, reported no use of oral medications or insulin for diabetes, were not pregnant, did not have hemophilia, and did not receive cancer chemotherapy in the previous 3 weeks. all blood samples for the 2-h glucose measurement were drawn between 100 and 135 min after ingestion of the glucose load. for our analysis, we included only those who were 18 years, had no known history of diabetes, were non - hispanic black or white (to match our study population), and had a survey weight value > 0 (n = 1,154). because some subjects had more than one blood pressure measurement, the average of the measurements was used for the analysis. for the sigt, nhanes iii, and nhanes 20052006 subjects, age, bmi, and a1c were categorized using the cutoffs recommended by the ada : age 6.0% (8). other risk factors for diabetes that were not specifically defined by the ada were categorized according to the american heart association / national heart, lung, and blood institute (aha / nhlbi) diagnostic criteria for metabolic syndrome (12) : presence of hypertension by history, systolic blood pressure > 130 mmhg or diastolic blood pressure > 85 mmhg, triglyceride level 150 mg / dl, and hdl cholesterol 6.0%. risk factors for diabetes that were not specifically defined by the ada were categorized according to the aha / nhlbi diagnostic criteria for metabolic syndrome (12) : presence of hypertension by history, systolic blood pressure > 130 mmhg or diastolic blood pressure > 85 mmhg, triglyceride level 150 mg / dl, and hdl cholesterol 6.0% (8). risk factors for diabetes that were not specifically defined by the ada were categorized according to the aha / nhlbi diagnostic criteria for metabolic syndrome (12) : presence of hypertension by history, systolic blood pressure > 130 mmhg or diastolic blood pressure > 85 mmhg, triglyceride level 150 mg / dl, and hdl cholesterol 8% of americans could benefit from pharmacological treatment to prevent or delay development of diabetes. use of pharmacological agents for the many americans who may benefit from preventive treatment would incur substantial costs : at current generic rates for metformin, possibly $ 4/month 12 months 24 million americans = $ 1.15 billion per year. however, several studies suggest that diabetes prevention or delay with metformin is likely to be cost - effective and/or cost - saving (24) ; further evaluation using a variety of cost analysis methods may be required to reach a definitive conclusion regarding the cost of preventive treatment. to our knowledge, our findings are the first evaluation of the proportion of relatively healthy individuals who might benefit from metformin treatment for the prevention or delay of development of diabetes. because all sigt subjects were recruited on a volunteer basis, there may have been a selection bias toward higher family history of diabetes and/or other risk factors for diabetes. however, because many sigt subjects were recruited from university and health care settings, they may also follow healthier lifestyles, which could offset such a bias. moreover, the proportion with diabetes or pre - diabetes in sigt was no higher than that in nhanes iii and was comparable to that in the more recent nhanes 20052006, both of which represent randomized, stratified samples of the american population. the morbidity, mortality, and cost of the epidemic of diabetes have prompted a call for primary prevention of diabetes in high - risk individuals by the use of metformin in addition to lifestyle changes. population, close to 1 in 12 american adults may meet the recommended guidelines for consideration of metformin treatment for diabetes prevention or delay. notably, eligibility for metformin use appeared to be almost completely determined by impaired glucose metabolism alone, because 99% of the sigt population and 96% of the nhanes populations with both ifg and igt had at least one risk factor. therefore, once the presence of both ifg and igt has been established, the presence of additional risk factors could almost be assumed, and initiation of metformin should be considered. moreover, because nearly one - third of all subjects with ifg met the criteria for metformin treatment, providers should perform ogtts in all patients with ifg to test for the presence of igt (or unrecognized diabetes) and thereby determine whether they merit consideration of metformin treatment. | objectiveto determine the proportion of the american population who would merit metformin treatment, according to recent american diabetes association (ada) consensus panel recommendations to prevent or delay the development of diabetes.research design and methodsrisk factors were evaluated in 1,581 screening for impaired glucose tolerance (sigt), 2,014 third national health and nutrition examination survey (nhanes iii), and 1,111 national health and nutrition examination survey 20052006 (nhanes 20052006) subjects, who were non - hispanic white and black, without known diabetes. criteria for consideration of metformin included the presence of both impaired fasting glucose (ifg) and impaired glucose tolerance (igt), with 1 additional diabetes risk factor : age 6.0%.resultsisolated ifg, isolated igt, and ifg and igt were found in 18.0, 7.2, and 8.2% of sigt ; 22.3, 6.4, and 9.4% of nhanes iii ; and 21.8, 5.0, and 9.0% of nhanes 20052006 subjects, respectively. in sigt, nhanes iii, and nhanes 20052006, criteria for metformin consideration were met in 99, 96, and 96% of those with ifg and igt ; 31, 29, and 28% of all those with ifg ; and 53, 57, and 62% of all those with igt (8.1, 9.1, and 8.7% of all subjects), respectively.conclusionsmore than 96% of individuals with both ifg and igt are likely to meet ada consensus criteria for consideration of metformin. because > 28% of all those with ifg met the criteria, providers should perform oral glucose tolerance tests to find concomitant igt in all patients with ifg. to the extent that our findings are representative of the u.s. population, 1 in 12 adults has a combination of pre - diabetes and risk factors that may justify consideration of metformin treatment for diabetes prevention. |
several randomized controlled trials have demonstrated a survival benefit with an implantable cardioverter - defibrillator (icd) among patients who are at high risk for sudden cardiac death in primary prevention settings. it is of major importance to identify patients who will benefit from icd implantation and generator replacement after battery depletion. from multivariate risk profiles, approximately 5060% of patients will receive an icd therapy within 911 months after implantation, including an average of 2.3 shocks / patient / year. therefore it is important for clinicians to identify the predictors of icd therapy in order to prevent icd shocks which may improve quality of life and reduce healthcare costs. the purpose of this study was to identify predictors for appropriate icd therapy using demographic and clinical characteristics in patients who have received icd for primary prevention of sudden cardiac death. as there is little information available regarding the impact of metabolic syndrome (mets) on sudden death in a heart failure population, we also sought to determine if individual components of metabolic syndrome itself are associated with appropriate icd therapy. a retrospective cohort of 321 patients with systolic heart failure undergoing icd placement for primary prevention of sudden cardiac death was queried from april 2004 to september 2008, at the regions hospital of university of minnesota medical school. all patients had icd placement based on the american heart association recommendations for primary prevention of sudden cardiac death. all patients received standard heart failure treatment including beta - blocker, angiotensin - converting enzyme inhibitors or angiotensin receptor blockers, lipid - lowering drugs, aspirin and diuretics based on the discretion of the treating physician. clinical data collected at the time of icd placement included : age, gender, smoking history, hypertension, hypercholesterolemia, and diabetes mellitus. the clinical identification of patients with mets was based on the modified criteria proposed by the national cholesterol education program - adult treatment panel iii (ncep - atpiii). patients were considered to have mets when 3 of the 5 following criteria were present : i) body mass index (bmi) 28.8 kg / m ; ii) elevated fasting glucose 110 mg / dl or drug treatment for elevated blood sugar ; iii) fasting triglycerides 150 mg / dl ; iv) reduced high - density lipoprotein cholesterol 0.05). ninetyone percent of patients with mets and 89% of patients with non - mets had ischemic cardiomyopathy (p>0.05). the mean ejection fraction was 23.47.4% with mets and 28.99.3% without mets (p=0.04). the prevalence of diabetes (49% vs. 32%, p=0.01) and chronic kidney disease (23% vs. 14%, p=0.002) were higher in patients with mets as compared to those without mets. table 1baseline patient s characteristics.all (321)mets (n=131)non - mets (n=190)p nsage (years)7211708716male (%) 656664nsejection fraction (%) 26.511.323.47.428.99.30.04bmi 28.8 kg / m (%) 5673440.001ischemic cardiomyopathy (%) 909189nsnyha heart failure class (%) ii161517ns iii7377700.04 iv111012nsdm-2 (%) 3949320.01htn (%) 6976640.03ckd (%) 1823140.002copd (%) 242225nsfasting glucose (mg / dl)1423917229121210.02hdl (mg / dl)39103274470.001triglycerides(mg / dl)1442716921125110.01systolic blood pressure (mmhg)1323114924127210.03diastolic blood pressure (mmhg)8919931786.590.07qrs duration (ms)121.226.811918.7122.124.9nsmedications (%) aspirin818379ns beta blocker889187ns acei7164750.04 arb2128160.02 diuretics2839210.01 statin616260nsacei : angiotensin converting enzymes inhibitors ; arb : angiotensin receptor blockers ; bmi : body mass index ; copd : chronic obstructive pulmonary disease ; dm : diabetes mellitus ; htn : hypertension ; hdl : high density lipoprotein ; ms : millisecond ; nyha : new york heart association ; ns : not significant (p>0.05). acei : angiotensin converting enzymes inhibitors ; arb : angiotensin receptor blockers ; bmi : body mass index ; copd : chronic obstructive pulmonary disease ; dm : diabetes mellitus ; htn : hypertension ; hdl : high density lipoprotein ; ms : millisecond ; nyha : new york heart association ; ns : not significant (p>0.05). appropriate icd therapy was delivered in 142 (44%) patients. of those, 46 (14%) cox s regression analysis was performed to obtain unadjusted hazards ratio (hr) for following variables to identify the predictors of appropriate icd therapy : age > 70 years, body mass index 28.8 kg / m, new york heart association heart failure class iii, diabetes mellitus, hdl 70 years1.29 (1.091.71)0.02male0.92 (0.611.42)0.62diabetes mellitus2.13 (1.213.43)0.01htn1.87 (0.561.87)0.54lvef 20%4.66 (2.319.34)<0.001nyha heart failure class iii1.41 (1.113.01)0.04fasting blood sugar 110 mg / dl0.93(0.461.64)0.08hdl < 402.03(1.323.42)0.002tg 1501.82(1.632.51)0.04bmi 28.8 kg / m2.56 (1.265.85)0.001ckd2.06(1.344.36)0.003copd0.91(0.411.98)0.76beta blocker therapy1.21(0.852.46)0.23bmi : body mass index ; ckd : chronic kidney disease ; copd : chronic obstructive pulmonary disease ; hdl : high density lipoprotein ; htn : hypertension ; tg : triglycerides. bmi : body mass index ; ckd : chronic kidney disease ; copd : chronic obstructive pulmonary disease ; hdl : high density lipoprotein ; htn : hypertension ; tg : triglycerides. although all components of mets other than body mass index 28.8 kg / m were not independent predictors of appropriate icd therapy, further multivariate analysis was carried out to evaluate whether mets itself was an independent predictor of appropriate icd therapy (table 3). in the multivariate analysis, after adjusting for age, sex, medications, left ventricular ejection fraction and co - morbidities, mets was found to be a significant predictor of appropriate icd therapy (or 2.01, 95% ci, 1.123.88, p=0.03). table 3multivariate logistic regression analysis showing independent predictors of implantable cardioverter - defibrillators therapy.predictorhr (95% ci)plvef 20%3.95 (2.698.11)<0.001bmi 28.8 kg / m1.96 (1.122.91)0.01ckd1.28 (1.092.13)0.02mets2.01 (1.123.88)0.03bmi : body mass index ; ci : confidence interval ; hr : hazard ratio ; mets : metabolic syndrome. bmi : body mass index ; ci : confidence interval ; hr : hazard ratio ; mets : metabolic syndrome. during our follow - up period, 29 (9%) patients died of cardiovascular causes including 19 (6%) patients who had undergone appropriate icd therapy and 10 (3%) patients who had had no icd therapy. in multivariate analysis, after adjusting for age, sex, medications and comorbidities, left ventricular ejection fraction 20% was associated with an increased hazard risk cardiovascular mortality (adjusted hr 2.66, 95% ci 1.566.07, p=0.001). in kaplan - meier analysis, patients who had appropriate icd therapy were found to have a higher incidence of cardiovascular mortality (hr= 2.26, 95% ci 1.084.67, p=0.03) than patients without any icd therapy (figure 1). figure 1kaplan - meier graph of cardiovascular mortality in patients with implantable cardioverter - defibrillators therapy as compared to patients without any implantable cardioverter - defibrillators therapy. kaplan - meier graph of cardiovascular mortality in patients with implantable cardioverter - defibrillators therapy as compared to patients without any implantable cardioverter - defibrillators therapy. in the present study, we examined predictors of appropriate icd therapy in 321 patients who received icd for primary prevention of sudden cardiac death. we identified body mass index 28.8 kg / m, left ventricular ejection fraction 20% and chronic kidney disease as the independent predictors of appropriate icd therapy. mets was also found to be independently associated with a higher incidence of appropriate icd therapy. we did not find an independent association between all individual components of mets with appropriate icd therapy in multivariate analysis. the results suggest that patients with mets are at an increased risk of ventricular arrhythmia and appropriate icd therapy to patients without mets. there is substantial evidence that mets contributes to the development of heart failure, but no data exists on the impact of mets in patients with heart failure who have received an icd. in the present study, we examined the prevalence and outcomes of the mets in the heart failure population who received icd for primary prevention of sudden cardiac death. the prevalence of mets was 41%, which exceeds that reported in the general population, but is lower than reported in heart failure populations. the prevalence of mets in a heart failure population has been reported to be 68.3% and 78% in prior studies. in our study, we found that patients who had at least one episode of appropriate icd therapy are at higher risk of subsequent cardiovascular mortality than those without any icd therapy. this indicates that patients who are at higher risk for having appropriate icd therapy are also at higher risk for cardiovascular mortality. this finding is in accordance with the findings of previous studies where cardiovascular mortality was found to be higher with mets. in a meta - analysis of 21 prospective cohort studies, patients with mets had increased cardiovascular mortality with relative risk of 1.74 (95% ci 1.292.35). another meta - analysis including 37 studies and 172,573 individuals showed that mets was associated with a relative risk of 1.78 for cardiovascular events and death (95% ci, 1.582.0). mets has also been found to be associated with an increased risk of stroke (rr 1.76 ; 95% ci 1.372.25). appropriate icd discharge was found to be higher in mets, which suggests that patients with mets are at higher risk for arrhythmic events and sudden cardiac death. these findings provide new evidence that mets is associated with an increased risk of cardiovascular events. our data suggests that patients with chronic kidney disease are more prone to develop ventricular arrythmias and receive appropriate icd therapy. in a historic cohort study, patients with chronic kidney disease were more likely to have experienced an acute myocardial infarction, angina, heart failure, stroke, and/or cardiovascular death versus those with preserved kidney function. in multivariate analysis, chronic kidney disease was the most significant independent risk factor for a cardiovascular event (hr 2.5, ci 95% 1.34.8). these patients might benefit more from the icd placement for primary prevention of sudden cardiac death than patients with normal kidney function. the increased frequency of ventricular arrhythmias and appropriate icd therapy in patients with chronic kidney disease documented in our study is in keeping with other reports in the literature. left ventricular ejection fraction was a significant risk factor for both appropriate icd therapy, ventricular fibrillation and cardiovascular mortality. this finding was in accordance with previous findings in clinical trials where left ventricular ejection fraction over 20% was found to reduce sudden cardiac death risk. in our study, we did not find an association of qrs duration with appropriate icd therapy and cardiovascular mortality. this finding is consistent with the findings of buxton. where qrs duration was not a predictor of ventricular tachycardia or ventricular fibrillation resulting in icd therapies. mets, chronic kidney disease, left ventricular ejection fraction 20% and body mass index 28.8 kg / m are significantly associated with appropriate icd therapy in patients who received icd implantation for primary prevention of sudden cardiac death. to our knowledge, this is the first study to show that mets predicts an increased incidence of appropriate icd therapy and cardiovascular mortality in a systolic heart failure cohort that underwent icd implantation for primary prevention of sudden cardiac death. although individual components of mets were not found to be independent predictor, mets itself was found to be independent predictor of appropriate icd therapy. the findings of this study highlight the importance of identifying patients with mets as aggressive treatment of these co - morbidities may decrease appropriate icd therapy which in turn may decrease hospitalizations and healthcare costs. | the purpose of this study was to evaluate predictors of appropriate therapy in patients with implantable cardioverter - defibrillators (icd) for primary prevention of sudden cardiac death. a retrospective cohort of 321 patients with systolic heart failure undergoing icd placement for primary prevention of sudden cardiac death was queried with a mean follow - up period of 2.6 years. appropriate icd therapy was defined as therapy delivered for termination of a ventricular tachyarrhythmia. appropriate icd therapy was delivered in 142 (44%) of the patients. in a multivariate model, body mass index 28.8 kg / m2, chronic kidney disease, left ventricular ejection fraction 20% and metabolic syndrome were found to be independent predictors of appropriate icd therapy. appropriate icd therapy was associated with higher cardiovascular mortality. these findings show the importance of identification of risk factors, especially metabolic syndrome, in patients following icd implantation as aggressive treatment of these co - morbidities may decrease appropriate icd therapy and cardiovascular mortality. |
living donor liver transplants (ldlt) are associated with a higher rate of biliary complications than deceased donor liver transplants (ddlt). biliary leaks and subsequent biliary strictures have been reported to occur in up to 30% of the patients undergoing ldlt. management of biliary complications involves a combination of endoscopic, radiological, and surgical procedures. endoscopic techniques are the first line of treatment with success rates of 70100% in anastomotic strictures and 5075% in non - anastomotic strictures. however, the success rate decreases in ldlt, and is only 6075% in anastomotic strictures and 2533% in non - anastomotic strictures. percutaneous techniques with a success rate of 5075% are generally considered to be the second line of management and play a key role in ldlt patients where the success rate of endoscopic techniques is less. we retrospectively analyzed the techniques and outcome of percutaneous transhepatic management of biliary anastomotic strictures in ldlt patients. we retrieved the hospital records of 400 ldlt recipients between 2007 and 2015 and identified 45 patients (11.3%) with biliary strictures with or without leaks. among them 17 patients (37.8%) (male : female = 13:4 ; mean age, 36.1 17.5 years ; range, 1067 years) treated by various percutaneous transhepatic biliary techniques alone or in combination with endoscopic retrograde cholangiopancreatography (ercp) were included in the study [table 1 ]. biliary strictures were suspected when there were clinical findings (fever, cholangitis, sepsis), biliary stain in the drainage tube, increased liver biochemical parameters (alkaline phosphatase, total bilirubin), or imaging evidence of biliary obstruction. clinical records and images clinical presentation and management of the anastomotic strictures diagram showing included and excluded patients in the study broad spectrum intravenous antibiotics (cefoperazone sodium 1 g) were administered to all patients 23 hours before the procedure. procedures were performed under conscious sedation (2.55 mg of midazolam and 50100 micrograms (mcg) of fentanyl, administered intravenously). in children, the bile duct was punctured using a 22 g chiba needle (cook inc., bloomington, in, usa) under ultrasound or fluoroscopic guidance. a cholangiogram was performed to study the level and nature of the obstruction / leak. a 0.035-inch guidewire was placed in the system using a neff - set (cook inc, bloomington, in, usa.). the crossing of the stricture was then attempted using a combination of 5 fr kumpe catheter (cook inc., bloomington, in, usa) and 0.035-inch terumo hydrophilic guidewire (terumo, tokyo, japan). if the stricture could not be crossed, an external drainage catheter was placed. after crossing the stricture, when endoscopy was not feasible, further treatment was completed percutaneously either by dilating the strictures with low profile angioplasty balloons (6 mm to 8 mm size) in multiple sittings, placing the metallic stents (8 mm 60 mm and 8 mm 37 mm size) across the stricture if balloon dilatation fails, or by simply placing the internal - external drainage catheter (8.5fr, 10.2fr size) across the stricture [figure 2 ]. in a child with biliary pleural fistula, the fistula was successfully embolized with n - butyl- 2-cyanoacrylate (nbca) from a percutaneous approach. complications were classified as major and minor according to the guidelines of the society of interventional radiology standards of practice committee. diagram showing approach to the management of biliary strictures in ldlt recipients technical success was defined as restoration of normal antegrade bile flow across the stricture and resolution of the stricture on cholangiogram. unsatisfactory dilation was defined as residual narrowing or poor / absent flow after dilatation requiring further dilatation sessions in the same treatment period to achieve technical success. a dilatation session is the dilatation of strictures, performed in a single radiological intervention. one or more dilatation were performed on the initial admission, and thereafter, on follow - up, the patient was admitted again for further dilatation sessions, if needed. the duration of treatment is the time period between the first percutaneous access of the bile duct to complete dilatation sessions, successful metallic stent placement across the stricture, and removal of ptbd drainage catheters. clinical success was defined by decrease in preprocedural elevated total bilirubin and alkaline phosphatase (alp) levels to normal values after the intervention, as well as the absence of cholangitis in the first month after treatment. the total bilirubin and alp levels were measured a day before the procedure and 46 weeks after the completion of treatment. follow - up imaging was done with either a contrast enhanced computed tomography (ct) or magnetic resonance cholangiopancreatography (mrcp), every 6 months or earlier if symptoms recurred. statistical analysis was performed using the statistical package for the social sciences version 20.0 software (ibm co., armonk, ny, usa). broad spectrum intravenous antibiotics (cefoperazone sodium 1 g) were administered to all patients 23 hours before the procedure. procedures were performed under conscious sedation (2.55 mg of midazolam and 50100 micrograms (mcg) of fentanyl, administered intravenously). in children, the bile duct was punctured using a 22 g chiba needle (cook inc., bloomington, in, usa) under ultrasound or fluoroscopic guidance. a cholangiogram was performed to study the level and nature of the obstruction / leak. a 0.035-inch guidewire was placed in the system using a neff - set (cook inc, bloomington, in, usa.). the crossing of the stricture was then attempted using a combination of 5 fr kumpe catheter (cook inc., bloomington, in, usa) and 0.035-inch terumo hydrophilic guidewire (terumo, tokyo, japan). if the stricture could not be crossed, an external drainage catheter was placed. after crossing the stricture, when endoscopy was not feasible, further treatment was completed percutaneously either by dilating the strictures with low profile angioplasty balloons (6 mm to 8 mm size) in multiple sittings, placing the metallic stents (8 mm 60 mm and 8 mm 37 mm size) across the stricture if balloon dilatation fails, or by simply placing the internal - external drainage catheter (8.5fr, 10.2fr size) across the stricture [figure 2 ]. in a child with biliary pleural fistula, the fistula was successfully embolized with n - butyl- 2-cyanoacrylate (nbca) from a percutaneous approach. complications were classified as major and minor according to the guidelines of the society of interventional radiology standards of practice committee. technical success was defined as restoration of normal antegrade bile flow across the stricture and resolution of the stricture on cholangiogram. unsatisfactory dilation was defined as residual narrowing or poor / absent flow after dilatation requiring further dilatation sessions in the same treatment period to achieve technical success. a dilatation session is the dilatation of strictures, performed in a single radiological intervention. one or more dilatation were performed on the initial admission, and thereafter, on follow - up, the patient was admitted again for further dilatation sessions, if needed. the duration of treatment is the time period between the first percutaneous access of the bile duct to complete dilatation sessions, successful metallic stent placement across the stricture, and removal of ptbd drainage catheters. clinical success was defined by decrease in preprocedural elevated total bilirubin and alkaline phosphatase (alp) levels to normal values after the intervention, as well as the absence of cholangitis in the first month after treatment. the total bilirubin and alp levels were measured a day before the procedure and 46 weeks after the completion of treatment. follow - up imaging was done with either a contrast enhanced computed tomography (ct) or magnetic resonance cholangiopancreatography (mrcp), every 6 months or earlier if symptoms recurred. statistical analysis was performed using the statistical package for the social sciences version 20.0 software (ibm co., armonk, ny, usa). the average white blood cell (wbc) count before the start of treatment was 11.9 3.1 10 per liter. sixteen patients had duct - duct anastomotic strictures and one patient had hepatico - jejunostomy stricture. twelve out of the 16 (75%) patients with duct - duct anastomoses had more than one anastomoses. ten out of 12 (83.3%) patients associated with leak had more than one duct - duct anastomoses (range, 23). the average duration of onset of stricture in patients with biliary leak was 3.97 2.68 months (1.38 months) and in patients with only strictures was 14.03 13.9 months (4.434 months). seven out of 12 patients (58.3%) initially presented with a leak, and average duration before detection of stricture in these patients was 2.2 1.5 months. in our series, 3 patients had hepatic artery occlusion in the immediate postoperative period and underwent laparotomy and revascularization. stricture in these patients manifested early at 1.93 0.60 months (1.32.5 months). in 6 patients endoscopic - guided plastic stents were placed using rendezvous technique. in 1 patient, plastic stent was placed from a percutaneous approach after crossing the stricture. in 1 patient who underwent ldlt for multifocal hepatocellular carcinoma (hcc) had recurrent hcc in the transplanted liver. he presented with stricture and a completely disrupted bile duct, and hence a covered metallic stent was placed. post stenting, the patient remained asymptomatic for 20 months. in another patient with poor response to balloon dilatation, two self - expandable metallic stents (sems) were placed. average time before stenting was 3 2.8 months and primary patency was 12 11.3 months. one patient with hepatico - jejunostomy stricture was managed successfully with two sessions of balloon dilatations alone. in a child with bronchopleural fistula one patient was managed by only internal - external drain. in 5 patients in whom we failed to cross the lesion, one of the patients who underwent the ptbd external drainage for 3.5 months and in the follow up period of 60 months remained asymptomatic. in 2 patients, follow up of 6 and 8 months, respectively, was uneventful. the average number of attempts to cross the stricture in 5 patients in whom we failed to cross the lesion 3 1 (range, 24) and in the remaining 11 patients in whom we successfully crossed the stricture, average number of attempts was 2 1 (range, 13). the mean duration of treatment in patients with only stricture was 3.62 2.05 months, and in patients with strictures associated with leaks it was 3.23 2.06 months. technical success was achieved in 12/17 (70.6%), and clinical success was achieved in 13/17 (76.5%) of the patients. the average pretreatment and posttreatment total bilirubin was 19.7 10.96 mg / dl (3.233.6 mg / dl) and 1.21 0.71 mg / dl (0.53.2 mg / dl), respectively, and pre - treatment and post - treatment alkaline phosphatase was 533.34 204.86 statistically significant decrease in bilirubin (p < 0.002) and alkaline phosphatase (p = 0.012) was seen in the posttreatment period. five patients (29.4%) died (two due to acute rejections, one metabolic acidosis, and two due to sepsis). among the 5, 3 were treated by rendezvous technique / ercp stent, 1 was treated with covered metallic stent, and 1 by only ptbd external drainage. the higher incidence of stricture in ldlt as compared to ddlt can be attributed to injury to bile ducts while resecting the right or left lobe of the liver, smaller diameter of intrahepatic bile ducts in live donor grafts, and frequent need to perform multiple ductal anastomosis. managing strictures in ldlt endoscopically is challenging because multiple duct anastomosis can lead to multiple strictures and intrahepatic strictures, and smaller duct size poses difficulties in accessing and crossing the stricture. moreover, accessing the hepatico - jejunostomy site stricture by endoscopy is technically difficult due to altered anatomy. percutaneous transhepatic interventional techniques play an important role in overcoming these challenges. in this series early anastomotic strictures may be due to the small diameter of bile ducts, size mismatch between donor and recipient bile ducts, improper surgical technique, excessive cauterization, whereas late onset anastomotic strictures are usually due to ischemic injury and subsequent healing. non - anastomotic strictures are usually multiple, longer, and can involve intra and extrahepatic bile ducts. non - anastomotic strictures are due to ischemic injury consequent to hepatic artery thrombosis or due to prolonged warm ischemia. non - anastomotic strictures can occur due to immunological causes such as chronic rejection and primary sclerosing cholangitis. in our study, 16/17 (94.11%) the onset of stricture was significantly early (3.97 2.68 months ; range : 1.38 months) when associated with leak as compared to without leak (14.03 13.9 months ; range : 4.434 months). biliary leak induces more inflammatory response around the anastomotic site leading to early onset of stricture formation. hepatic artery occlusion is usually associated with early onset of strictures due to ischemic injury to the bile duct. in our series also, the onset of stricture in 3 patients who had hepatic artery occlusion was early 1.93 0.60 months (1.32.5 months). as expected, 10/12 (83.3%) patients with leak in our study had more than one duct - duct anastomosis (range : 23). percutaneous biliary balloon dilatation (pbbd) is an effective technique of managing benign biliary strictures. after crossing, one child suffering from biliary atresia who had undergone left lobe ldlt had developed hepatico - jejunostomy stricture 34 months later. the stricture was treated with graded balloon dilatation with 6 and 8 mm balloons in two sittings over a period of 1.5 months [figure 3 ]. pbbd is useful in patients who have only strictures and may not be useful if associated with leak. a 10.5-year - old male post kasai procedure for biliary atresia underwent ldlt (left lobe) and hepatico - jejunostomy. stricture crossed (b, arrow) and graded balloon dilatation done using 6 mm and 8 mm angioplasty balloon (two sessions) (c, d, arrows). check cholangiogram 2 weeks after the last dilatation shows no residual narrowing and free flow of contrast across anastomosis (e, arrow) anastomotic leaks are usually managed by biliary diversion techniques such as placing internal - external drainage catheters percutaneously across the leak site or by placing plastic stents endoscopically. however if the leak persists because of severe ductal injury or persistent fistulas they may require major open surgery which is associated high morbidity. alternatively, various embolizing agents such as fibrin, ethanol, and coils have been used to occlude the leak or fistula. nbca is a low viscosity liquid embolizing agent that immediately polymerizes and solidifies upon contact with body fluids. have shown the effectiveness of percutaneous embolization of bile duct fistulas with nbca in 4 patients. there is a risk of spillage into normal biliary radicals, and at higher concentration there is a risk of premature cast formation. because of the high risk of nontarget embolization, the use of these embolizing agents should be limited to the persisting leaks from the peripheral small ducts. he was managed by percutaneous biliary drainage and ercp stenting for 4 months. however, the fistula persisted and was finally treated by injecting nbca through left duct approach at the fistula site. the follow - up period of 78 months showed no recurrent fistula or symptoms [figure 4 ]. a 10-year - old male with wilsons disease underwent ldlt (left lobe), developed anastamotic site stricture with biliopleural fistula after 7.5 months. initially stricture (a, d arrow) with biliopleural fistula (a, d arrowhead) was treated with ercp plastic stent (b, arrowhead). however, leak persisted (b, arrow). nbca was injected percutaneously into fistula (c, arrow) through left duct approach. follow - up mrcp 48 month later shows significant decrease in stricture (e, arrow). chest radiograph taken 78 months later shows no significant changes in the lungs (f) there is limited information available regarding the use of metallic stents in treating post transplant biliary strictures and most data suggests use of retrievable covered stent. a recent study using retrievable covered stent showed a success rate of 6070% for anastomotic strictures in ddlt. another study showed that retrievable covered stent has patency rate of 100% and plastic stents has patency rate of 80% in the treatment of anastomotic strictures after ddlt [figure 5 ]. the main limitations of using metallic stents are stent migration, and early reocclusion. in our series one of the patient had two separate anastomosis of anterior and posterior ducts and developed strictures at both the anastomotic sites. initially they were treated with graded balloon dilatation for two sessions with internal - external drainage catheter across the strictures. however, in view of residual narrowing, two sems were deployed across both the strictures [figure 6 ]. another patient had recurrent hcc in the transplanted liver along with stricture and complete duct disruption. one of the problems in patients requiring repeated interventions is the onset and progression of cirrhosis secondary to chronic cholestasis. percutaneous approach in the presence of cirrhosis and periductal fibrosis can be challenging, and metallic stents, despite their limited patency, may be the only viable option in these patients. however, the nonretrievable metallic stents should be used as a last resort when there are no other treatment options. a 44-year - old female with fulminant hepatic failure underwent ldlt (right lobe), developed stricture at two anastomotic sites after 13 months. anterior (a, arrow) and posterior sectoral ducts (b, arrow) separately punctured. the strictures crossed and graded dilatation done using 4 mm and 7 mm balloons (c, posterior duct stricture ; d, arrow anterior duct stricture) and internal - external drainage catheters placed (e, arrow, arrowhead). one month later covered metallic were deployed in both anterior (f, arrow) and posterior duct (f, arrowhead) anastomotic strictures a 17-year - old male with fulminant hepatic failure (yellow phosphorus poisoning) underwent ldlt (right lobe). he developed anastomotic site stricture with leak at 8 months (a, arrow). stricture crossed (b, c, arrow) and plastic stent deployed across the stricture site (d, arrow) percutaneously ldlt patients may need to undergo multiple duct anastomosis which makes accessibility by ercp difficult. the other scenarios in which ercp usually fails is in patients with hepatico - jejunostomies and severe strictures / complete duct disruption associated with leaks. however, in 6 patients in whom ercp initially failed were managed by rendezvous technique. percutaneous techniques are complimentary to ercp. in 5 patients, strictures could not be crossed either by ercp or percutaneously, and hence only ptbd - external drainage was performed in these patients [figure 7 ]. though ptbd - external drainage was considered as technical failure for the sake of statistical analysis, it is an important biliary diversion technique. though crossing the lesion is an important step, draining the system externally can be lifesaving in critically ill patients with failed ercp. biliary diversion decreases the volume of the bile flow across the leak site, decreasing the inflammatory process and allowing healing. a 42-year - old female with autoimmune hepatitis underwent ldlt (right lobe) with two duct - duct anastomosis. patient developed stricture with leak at anastomotic sites after 3.2 months (a, arrow, arrowhead). repeated attempts to cross the stricture by the percutaneous approach (b, arrow, arrowhead) and ercp (c, arrow, arrowhead) failed. follow - up for 60 months was uneventful in our study, technical success was achieved in 12/17 (70.6%) patients and clinical success was achieved in 13/17 (76.5%). the overall incidence of strictures and technical success of percutaneous management of these strictures is comparable to other published studies. our study shows the importance of the various percutaneous techniques available as the rescue therapy for the patients with failed ercp. one of the most critical and difficult step in the management of strictures is to cross the lesion. we looked at the average number of attempts required to cross the stricture. in 5 patients, we failed to cross the lesion and average number of attempts was 3 1 (range, 24). in the remaining 11 patients in whom we successfully crossed the stricture, though these numbers are not the true reflections of the effort and time spent on the patients, they give us a fair idea of the technical difficulty. posttreatment mean time of follow - up was 19.4 13.7 months and was available in all patients. in our series biliary complications if not appropriately managed are associated with high rate of morbidity and mortality. surgery is not the first line of treatment for patients with bile leaks and biliary stricture because mostly these patients are sick and surgery can have further high complications requiring general anesthesia and intensive postoperative care. early detection of biliary complications and appropriately managing them either by ercp or percutaneous transhepatic techniques is crucial to increase the survival of these recipients. the limitations of the study are its retrospective nature and the lesser number of patients in each category. in conclusion, percutaneous biliary techniques are effective treatment options with good outcome in ldlt patients with biliary complications and failed ercp. | aim : to retrospectively analyze the percutaneous transhepatic techniques and their outcome in the management of biliary strictures in living donor liver transplant (ldlt) recipients.materials and methods : we retrieved the hospital records of 400 ldlt recipients between 2007 and 2015 and identified 45 patients with biliary strictures. among them, 17 patients (37.8%) (male : female = 13:4 ; mean age, 36.1 17.5 years) treated by various percutaneous transhepatic biliary techniques alone or in combination with endoscopic retrograde cholangiopancreatography (ercp) were included in the study. the technical and clinical success of the percutaneous management was analyzed.results:anastomotic strictures associated with leak were found in 12/17 patients (70.6%). ten out of 12 (83.3%) patients associated with leak had more than one duct - duct anastomoses (range, 23). the average duration of onset of stricture in patients with biliary leak was 3.97 2.68 months and in patients with only strictures it was 14.03 13.9 months. in 6 patients, endoscopic - guided plastic stents were placed using rendezvous technique, plastic stent was placed from a percutaneous approach in 1 patient, metallic stents were used in 2 patients, cholangioplasty was performed in 1 patient, n - butyl- 2-cyanoacrylate embolization was done in 1 child with biliary - pleural fistula, internal - external drain was placed in 1 patient, and only external drain was placed in 5 patients. technical success was achieved in 12/17 (70.6%) and clinical success was achieved in 13/17 (76.5%) of the patients. posttreatment mean time of follow - up was 19.4 13.7 months. five patients (29.4%) died (two acute rejections, one metabolic acidosis, and two sepsis).conclusions : percutaneous biliary techniques are effective treatment options with good outcome in ldlt patients with biliary complications. |
the conventional surgery for curative treatment of distal gastric cancer is resection of the distal stomach with all of the greater omentum and lesser omentum. but a less invasive procedure such as laparoscopic - assisted distal gastrectomy (ladg) has become more popular as the detection rate of early gastric cancer has increased as a result of widespread regular check - ups. laparoscopic surgery has become more popular as a minimal invasive procedure and it has been well demonstrated to have the advantages of a more favorable clinical course and lower mortality and morbidity, and especially for early gastric cancer patients (1, 2). as for the techniques, ladg and conventional open gastrectomy are the same for the extent of gastrectomy and lymph node (ln) dissection. but unlike conventional open gastrectomy, the greater omentum is resected about 4 - 5 cm away from the greater curvature in ladg (2). the reasons are as follows : the possibility of omental metastasis is very low because the majority of patients who undergo ladg have early gastric cancer, and complete resection of the bulky greater omentum is technically difficult in the restricted space. partial omentectomy is sometimes performed during open distal gastrectomy (odg) because of the low potential for omental metastasis in patients with early gastric cancer and to save the operation time required for complete removal of the omentum. as odg and ladg with partial omentectomy are now being widely performed in korea and japan, it has increased the potential for omental infarction following partial omentectomy. yet there are no radiologic studies or case reports of omental infarction following odg and ladg with partial omentectomy for gastric cancer. so, we describe here the clinical features and computed tomography (ct) findings of omental infarction following partial omentectomy in open and laparoscopic - assisted distal gastrectomy and the differential diagnostic points from omental metastasis according to these two cases. a 65-year - old woman underwent odg with partial omentectomy and d1 + lymph node dissection [dissection of the group 1 nodes plus the left gastric artery, the anterior common hepatic artery and the celiac artery nodes. the grouping of lns is according to the japanese classification for gastric carcinoma (jcgc) staging system by the primary location of cancer. ] her past medical history was diabetic mellitus and hypertension for several years that were controlled with medication and she underwent endoscopic submucosal resection (esr) three times for gastric polyps. this patient was obese with a body mass index (bmi) 34.8 kg / m (an initial weight of 81.4 kg and a height of 153.2 cm). contrast enhanced abdominal ct and f - fluorodeoxyglucose (fdg) positron emission tomography - computed tomography (pet - ct) were routinely performed to evaluate tumor recurrence at six months after surgery. on the contrast enhanced axial ct scan, an ill - defined area of haziness with hyperattenuating streaky infiltration was seen in the remnant great omentum at the left subphrenic space and lateral to the stomach (fig. but it could be differentiated from carcinomatosis peritonei clinically because the lesion was locally confined to the remnant greater omentum and it was found in an early gastric cancer patient. in addition, the f - fdg pet - ct scan showed no abnormal fdg uptake at the same lesion (fig. six months after that, the follow up contrast enhanced ct scan revealed a decrease in the lesion size and there was progression from an ill - defined, heterogeneous fat density lesion to a well - defined, smaller lesion with a hyperdense rim at the left subphrenic space (fig. a 68-year - old woman underwent ladg with partial omentectomy and d1 + lymph node dissection for early gastric cancer localized in the submucosa (t1bn1m0). her past medical history was atrial fibrillation and parkinson 's disease for several years and these maladies were controlled with medication. this patient was thin with a bmi 19.7 kg / m (the initial weight of 50.4 kg and a height of 160 cm). on postoperative day 10, she developed localized right upper quadrant pain with leukocytosis of 17,090/mm. she had no fever, chills or gastrointestinal symptoms such as nausea, vomiting or diarrhea other than the right upper quadrant pain. contrast enhanced abdominal ct was performed to differentiate the causes of her acute abdominal pain. the enhanced ct scan revealed a 4 cm sized heterogeneous fat density mass with a peripheral enhancing rim and streaky infiltration in the omentum at the anterior to the pancreas head, which was a reasonable finding of omental infarction (fig. after five days, her symptoms disappeared completely and she was discharged from the hospital. after five months, she was followed up with ct and f - fdg pet - ct. the previously noted lesions had almost resolved and there was no abnormal fdg uptake except only mild omental haziness (fig. a 65-year - old woman underwent odg with partial omentectomy and d1 + lymph node dissection [dissection of the group 1 nodes plus the left gastric artery, the anterior common hepatic artery and the celiac artery nodes. the grouping of lns is according to the japanese classification for gastric carcinoma (jcgc) staging system by the primary location of cancer. ] her past medical history was diabetic mellitus and hypertension for several years that were controlled with medication and she underwent endoscopic submucosal resection (esr) three times for gastric polyps. this patient was obese with a body mass index (bmi) 34.8 kg / m (an initial weight of 81.4 kg and a height of 153.2 cm). contrast enhanced abdominal ct and f - fluorodeoxyglucose (fdg) positron emission tomography - computed tomography (pet - ct) were routinely performed to evaluate tumor recurrence at six months after surgery. on the contrast enhanced axial ct scan, an ill - defined area of haziness with hyperattenuating streaky infiltration was seen in the remnant great omentum at the left subphrenic space and lateral to the stomach (fig. but it could be differentiated from carcinomatosis peritonei clinically because the lesion was locally confined to the remnant greater omentum and it was found in an early gastric cancer patient. in addition, the f - fdg pet - ct scan showed no abnormal fdg uptake at the same lesion (fig. six months after that, the follow up contrast enhanced ct scan revealed a decrease in the lesion size and there was progression from an ill - defined, heterogeneous fat density lesion to a well - defined, smaller lesion with a hyperdense rim at the left subphrenic space (fig. a 68-year - old woman underwent ladg with partial omentectomy and d1 + lymph node dissection for early gastric cancer localized in the submucosa (t1bn1m0). her past medical history was atrial fibrillation and parkinson 's disease for several years and these maladies were controlled with medication. this patient was thin with a bmi 19.7 kg / m (the initial weight of 50.4 kg and a height of 160 cm). on postoperative day 10, she developed localized right upper quadrant pain with leukocytosis of 17,090/mm. she had no fever, chills or gastrointestinal symptoms such as nausea, vomiting or diarrhea other than the right upper quadrant pain. contrast enhanced abdominal ct was performed to differentiate the causes of her acute abdominal pain. the enhanced ct scan revealed a 4 cm sized heterogeneous fat density mass with a peripheral enhancing rim and streaky infiltration in the omentum at the anterior to the pancreas head, which was a reasonable finding of omental infarction (fig. after five days, her symptoms disappeared completely and she was discharged from the hospital. after five months, she was followed up with ct and f - fdg pet - ct. the previously noted lesions had almost resolved and there was no abnormal fdg uptake except only mild omental haziness (fig. omental infarction is the end result of impaired perfusion to the greater omentum, and this is a rare disease entity that can cause acute or subacute abdominal pain in adults (4). the cause of primary idiopathic omental infarction is unknown, but it may be related to obesity, local trauma, occupational vibration, heavy food intake, excessive exercise and the use of laxatives. obesity causes irregularly distributed accumulations of excess omental fat and the increased fat deposits outstrip the blood supply to the thickened omentum. secondary omental infarction can be induced by various causes : torsion due to adhesion between the omentum and pathologic foci such as surgical scars, inflammation, cysts and tumors, thrombosis due to hypercoagulopathy and vascular abnormalities and congestion of the mesenteric vein due to systemic diseases such as right - sided heart failure (6 - 8). omental infarction has been reported to occur more frequently on the right side, so clinically it is difficult to differentiate it from either appendicitis or cholecystitis. the reason may be that the omentum is longer and more mobile on the right side than on the left side (9). however, compared with the usual location and symptoms of the other omental infarctions, omental infarction after odg or ladg with partial omentectomy is located in the mid - line or on the left side of the abdomen and it does not show clinical symptoms at diagnosis in the majority of patients such as our case 1. this is because omental infarction is affected by the volume and anatomical location of the remnant omentum rather than the anatomical location of the ligated vessel (10). omental infarction following odg or ladg with partial omentectomy occurs at the remnant greater omentum. the residual area and the abundance of the blood supply for the remnant greater omentum are two important factors that affect the incidence of omental infarction. the blood supply of the greater omentum travels largely through the right and left gastroepiploic arteries. usually distal gastrectomy is performed in a patient with early gastric cancer that is localized in the distal stomach and there is very low possibility of omental metastasis. the left gastroepiploic lns (4sb ln) are classified to the group 3 regional lns for distal third primary gastric cancer according to the jcgc staging system, and the 4sb ln are not included in d2 dissection [grouping of lns is according to the japanese classification for gastric carcinoma (jcgc) staging system by the primary location of cancer. ] for distal third primary gastric cancer (3). so the right gastroepiploic artery is ligated in almost all cases, but on the other hand, the left gastroepiploic artery can be preserved with subtotal gastrectomy. in addition and anatomically, the greater omentum has a extensive distribution of blood vessels that supply more than the basic metabolic requirements and it sometimes has collateral vessels from the middle colic artery or the superior mesenteric artery. infarction does not usually occur even though most vessels are blocked. for these reasons, the incidence of secondary omental infarction following distal gastrectomy and partial omentectomy for gastric cancer, either open or laparoscopic assisted, is very low (10). but as laparoscopic surgery is now more commonly performed, the incidence of omental infarction following partial omentectomy with right and left gastroepiploic artery ligation has increased (7, 8). the diagnosis of omental infarction is primarily based on the ct findings of an ill - defined heterogeneous mass or interspersed fatty lesion with hyperattenuating streaky infiltration located in the omentum in the early stage, and this progresses to a well - defined, smaller lesion with a hyperdense rim in the late phase (9). these findings can mimic carcinomatosis peritonei in the early phase and peritoneal epiploic appendagitis (pea) in the late phase. clinically, it is important to distinguish omental infarction and carcinomatosis peritonei, and especially for an incidentally detected lesion without any clinical symptoms at follow up ct in gastric cancer patient after distal gastrectomy. in this situation, making the differentiation from carcinomatosis peritonei is as follows : part of the omental infarction shows normal findings on the pet scan, the localized infarcted mass is confined to the remnant omentum, it is progressively smaller in size on the follow up ct without any treatment such as chemotherapy, omental infarction shows different imaging findings depending on the clinical phase, and it appears as ill - defined heterogeneous haziness that mimic carcinomatosis peritonei in the early phase, but it gradually turns into a well - defined fatty mass with a hyper - enhancing peripheral rim that mimics pea, such as in our cases (9). the pathologic diagnosis was not established in our two patients. because the ct scans demonstrated the pathognomonic findings and a natural progressive course of this disease, the diagnosis of omental infarction was not difficult. in many cases, ct is helpful to make a confident diagnosis and so it allow conservative management, and a tissue diagnosis is uncommon. further reports on pathologic confirmation are needed to evaluate in detail the disease pathophysiology of omental infarction after odg and ladg. in conclusion, omental infarction following odg or ladg with partial omentectomy for gastric cancer is very rare, but the incidence is increasing with more widespread use of this procedure. the ct findings of omental infarction are similar to carcinomatosis peritonei in the early phase. yet omental infarction following distal gastrectomy with partial omentectomy can be discriminated from carcinomatosis peritonei by the different clinical situation, the different ct findings, the different pet - ct findings and when comparing these findings with the follow up ct. | omental infarction occurring after open and laparoscopic - assisted distal gastrectomy with partial omentectomy for gastric cancer was a very rare disease in the past, but its incidence has increased as more partial omentectomies are now being performed. but there are few case reports or radiologic studies on its increasing incidence. it is necessary to differentiate omental infarction from carcinomatosis peritonei, since both have similar imaging findings. in this report, we describe two cases of omental infarction ; each occurred after open and laparoscopic - assisted distal gastrectomy in early gastric cancer patients. partial omentectomy was performed in both cases. omental infarction following distal gastrectomy with partial omentectomy can be discriminated from carcinomatosis peritonei by comparing with different initial and follow up ct findings. |
diabetes is the most frequent endocrine disease in developed countries and one of the most common noncommunicable diseases (ncds) globally, estimated to have affected more than 371 million people in 2012 and projected to affect 552 million by 2030. it is the fourth or fifth leading cause of death worldwide with 4.8 million deaths in 2012, and its complications account for a significant portion of morbidity, mortality, and healthcare system cost burdens [13 ]. diabetes has many manifestations in the eye, of which cataract and diabetic retinopathy are the most significant cause of visual impairment and blindness, and people with diabetes are 25 times more likely than the general population to become blind. diabetic retinopathy (dr), a long - term microvascular and visually devastating diabetic complication, is estimated to be the leading cause of new blindness in working - aged adults in developed countries [4, 5 ]. many epidemiological and clinical trials have proven the impact of diabetes duration, poor glycemic control, and hypertension on the prevalence, incidence, and progression of diabetic retinopathy [6, 7 ]. although these factors explain a significant portion of the presence and progression of retinopathy and of the incidence of proliferative retinopathy, the exact pathogenesis of diabetic retinopathy is still insufficiently understood. dysfunction of retinal endothelium is thought to be a possible mechanism as it plays a crucial role in all stages of diabetic retinopathy [9, 10 ]. strategically located between blood and tissue, healthy endothelium actively regulates vascular tone and permeability, the balance between coagulation and fibrinolysis, the composition of the subendothelial matrix, the extravasation of leukocytes, and the proliferation of vascular smooth muscle. to perform these functions functional impairment of endothelial activity precedes the development of morphological alterations during the progression of diabetes and its vascular complications. this endothelial dysfunction results from reduced bioavailability of the vascular nitric oxide (no), mainly due to accelerated no degradation by reactive oxygen species (ros). although hyperglycemia, insulin resistance, hyperinsulinemia, and hyperlipidemia independently and/or simultaneously contribute to endothelial dysfunction via several different mechanisms, systemic inflammation and hemorheological alterations found in obese diabetic patients may possibly play an important role in the endothelial dysfunction and in the etiopathogenesis of diabetic retinopathy [12, 13 ]. many studies have documented the association of inflammation, haemostatic disturbance, and endothelial dysfunction with macroangiopathy in obese nondiabetic individuals and type 2 diabetic patients [14, 15 ], but only some of them have investigated the association of inflammation and endothelial dysfunction with the prevalence and progression of diabetic microangiopathy [16, 17 ]. the aim of the present study was to investigate the relationship between inflammatory and haemostatic markers, other markers of endothelial dysfunction and anthropometric parameters, and their association with diabetic retinopathy in patients with type 2 diabetes. this cross - sectional study was performed in collaboration between the department of endocrinology and metabolic diseases and the department of ophthalmology of the university clinic vuk vrhovac clinical hospital merkur in zagreb in accordance with the declaration of helsinki and approved by the hospital 's ethics committee. the patients included in the study received both written and oral information about the study and signed a written informed consent. a total of 107 patients with type 2 diabetes consecutively attending both departments over a six - month period were included in the study. patients with malignancies, immunologic, infectious inflammatory diseases, patients receiving corticosteroids or cytostatics, pregnant women, and patients with other eye diseases (mature cataract, uveitis, and age - related macular degeneration) were not included in the study. patients who inclusion criteria were invited to participate in the study. at the inclusion visit, the informed consent form was signed, blood samples for laboratory analyses were collected between 08:00 and 10:00 h after 12 h overnight fast, and complete clinical and ophthalmic examination was performed. c - reactive protein (crp) was determined by an automated immunoturbidimetric assay on an olympus au600 analyzer (olympus optical co., tokyo, japan) (reference value glycated hemoglobin value (hba1c), total cholesterol, hdl cholesterol, ldl cholesterol, and triglycerides were measured. hba1c was determined at the beginning of the study from a single venous blood sample, and hba1cmedian was obtained by statistical analysis of data from the national registry for diabetes (crodiabnet). the statistical analysis included hba1c values from venous blood samples taken from each individual patient at 3 - 4-month intervals over the past three years. total cholesterol and triglycerides were measured by the enzymatic colorimetric tests (reference values : total cholesterol 3 mg / l was found to be an independent risk factor for development of diabetic nephropathy and diabetic retinopathy, which confirmed the results of previously mentioned hoorn study. the multivariate analysis of the prime study showed that waist - to - hip ratio, but not body mass index, was an independent predictor of fibrinogen. these results were consistent with ours and results of two other cross - sectional studies suggesting that central body fat distribution is more relevant than general obesity to population correlates of fibrinogen [57, 58 ]. cederholm - williams. found higher plasma fibrinogen in diabetics than in controls and the highest fibrinogen in patients with more severe cases of retinopathy. as a direct consequence of the elevation of plasma fibrinogen they observed higher catabolic rate in diabetics than in controls and higher catabolic rate in patients with nonproliferative and proliferative retinopathy than in diabetics without retinopathy. fujisawa. suggested that an increased blood viscosity in type 2 diabetes patients due to high fibrinogen level and elevated intravessel pressure may play a role in the development of diabetic retinopathy. in our study we also found the significant differences in total cholesterol and triglycerides according to the level of body mass index. many previous epidemiologic studies have shown the association of body mass index and lipid profiles, especially higher total cholesterol and low - density lipoprotein cholesterol. recently reported negative association of bmi with high - density lipoprotein cholesterol and positive association with triglycerides. investigating the potential risk factors for retinopathy in diabetic and nondiabetic individuals, the hoorn study found positively associated prevalence of retinopathy with elevated blood pressure, bmi, total cholesterol, and triglyceride serum levels in all glucose categories. suggested that hba1c and total cholesterol are the two most important risk factors associated with clinically significant macular edema (csme) in patients with nonproliferative diabetic retinopathy whereas zoppini. proposed that triglyceride / high - density lipoprotein cholesterol (tg / hdl - c) ratio is associated with an increased incidence of retinopathy and chronic kidney disease in patients with type 2 diabetes. diabetes duration, prolonged poor glycemic control, and the resulting need for insulin therapy are the main predictors of retinopathy in patients with type 2 diabetes. the significant differences in c - reactive protein, fibrinogen, total cholesterol, and triglycerides according to the level of obesity defined by different anthropometric parameters suggest that interrelations between obesity, inflammation, haemostatic disturbance, and other risk factors may possibly play an important additional role in endothelial dysfunction involved in the pathogenesis of diabetic retinopathy. further studies that include larger number of patients and parameters such as inflammatory, haemostatic, and other markers of endothelial dysfunction are necessary to investigate whether our observations might contribute to the better understanding of the diabetic retinopathy causes and open new approaches for its prevention and treatment. | purpose. the pathogenesis of diabetic retinopathy (dr) is insufficiently understood but may possibly involve chronic, low - grade inflammation. the aim of this cross - sectional study was to investigate the relationship between inflammatory and haemostatic markers, other markers of endothelial dysfunction and anthropometric parameters, and their association with dr in patients with type 2 diabetes. methods. according to the dr status patients were divided into three groups : no retinopathy, mild / moderate nonproliferative (npdr), and severe npdr / proliferative retinopathy (pdr). results. the groups did not differ in the levels of inflammatory and haemostatic markers, other markers of endothelial dysfunction, and anthropometric parameters. after dividing the patients according to the level of obesity (defined by bmi, wc, and whr) into three groups anova showed the differences in c - reactive protein according to the wc (p = 0.0265) and in fibrinogen according to the whr (p = 0.0102) as well as in total cholesterol (p = 0.0109) and triglycerides (p = 0.0133) according to the bmi. logistic regression analyses showed that diabetes duration and prolonged poor glycemic control are the main predictors of retinopathy in patients with type 2 diabetes. conclusion. interrelations between obesity, inflammation, haemostatic disturbance, and other risk factors may possibly play an important additional role in endothelial dysfunction involved in the pathogenesis of diabetic retinopathy. |
metabolic syndrome (ms) is a disorder comprised of a combination of glucose intolerance, hypertension, dyslipidemia, and visceral fat accumulation, which promotes the development of cardiovascular diseases and atherosclerosis [1, 2 ]. inflammation, demonstrated primarily by elevated levels of serum c - reactive protein, is thought to be associated with insulin resistance and ms [35 ]. central obesity is considered to be one of the most important determinants of the low - grade chronic inflammation present in ms. adipose tissue produces proinflammatory cytokines, such as interleukin 6 (il-6), tumor necrosis factor- (tnf-), and complement factors. however, this tissue also secretes adiponectin, a protein showing antiinflammatory activity, which inhibits tnf- production, adhesion molecule expression, and nuclear transcriptional factor b signaling, a pivotal pathway in inflammatory reactions in endothelial cells [9, 10 ]. in addition, adiponectin is anti - atherogenic and is an insulin - sensitizing agent. adipose - derived tnf- may have negative effects on the expression of adiponectin and vice versa, and these two proteins also have opposite effects on insulin sensitivity [12, 13 ]. given this antagonistic relationship, obesity, and especially visceral obesity, may lead to a decreased secretion of adiponectin through feedback inhibition, thereby suppressing the beneficial effects of adiponectin on insulin sensitivity. levels of adiponectin are lower in patients with obesity, type 2 diabetes mellitus, arterial hypertension and ms [17, 18 ]. decreases in serum adiponectin levels are associated with different components of ms, and the decreased adiponectin levels appear to be related to increases in the number of ms components in both sexes. in ms pathophysiology, it is unclear whether decreased anti - inflammatory adiponectin and increased proinflammatory markers are associated and occur simultaneously in the development of this syndrome. some studies have found inverse relationships between adiponectin concentrations and proinflammatory markers [19, 20 ]. however, a recent study showed that adiponectin levels and proinflammatory status are independent. several studies have demonstrated the importance of uric acid in the physiopathology of ms [22, 23 ]. in a previous study, we verified a correlation between serum uric acid level and several components of ms, as well as its influence on oxidative stress and antioxidant defense. nevertheless, few studies to date have assessed the association of uric acid levels with adiponectinemia in ms. the knowledge of whether proinflammatory markers and uric acid levels are connected with adiponectin could be important to both the pathophysiology and therapy of ms patients. therefore, the aim of the present work was to assess which components of ms, including uric acid, and proinflammatory markers, are related to adiponectin levels in overweight and obese women with ms. ninety - one women, selected from ambulatory patients and workers of the university hospital of londrina, paran, brazil, were chosen to participate in the study. the control group included 31 healthy women, whereas the ms group was made up of 60 overweight and obese women with ms. all women in the control group had a body mass index (bmi) between 20 and 25 kg / m and did not present any of the metabolic syndrome parameters listed in the definition below. the groups were paired by age, race, smoking habit, and alcohol intake. information on the lifestyle factors and medical history of the study subjects were obtained through a clinical evaluation. ms was defined following the adult treatment panel iii criteria, when three of the following five characteristics were confirmed : (1) abdominal obesity : waist circumference 102 cm in men and 88 cm in women ; (2) hypertriglyceridemia 150 mg / dl (1.695 mmol / l) ; (3) low hdl cholesterol levels 40 mg / dl (1.036 mmol / l) in men and 50 mg / dl (1.295 mmol / l) in women ; (4) high blood pressure (130/85 mmhg) ; (5) high fasting glucose (110 mg / dl). none of the participants of the study presented thyroid, renal, hepatic, gastrointestinal, or oncological diseases, and none of the participants had a clinically evident infection or were receiving drugs for hyperglycemia, drugs known to affect lipoprotein and uric acid metabolism or inflammatory markers or hormone replacement therapy for at least 4 weeks before the study. all patients provided written informed consent, and the study protocol was fully approved by the ethical committee of the university of londrina (paran, brazil). height and weight were measured in the morning with subjects wearing light clothing but no shoes. after 5 minutes of rest, each subject had his / her blood pressure measured from the left arm with the subject in a sitting position. we considered the current use of antihypertensive medication to be an indication of high - blood pressure. body mass index (bmi) was calculated as weight (kg) divided by height (m) squared. waist circumference was measured with a soft tape on standing subjects midway between the lowest rib and the iliac crest. after fasting for 12 hours, the patients underwent laboratory blood analyses for the following factors : plasma glucose and serum total cholesterol (tc), high - density lipoprotein cholesterol (hdl - cholesterol), low - density lipoprotein cholesterol (ldl - cholesterol), triacylglycerol (tg), and uric acid and albumin levels, which were evaluated by a biochemical auto - analyzer (dimension dade ar) using dade behring kits. plasma insulin levels were determined by microparticle enzyme immunoassay (meia, axsym, abbott laboratory, wiesbaden, germany). all samples were centrifuged at 3.000 rpm for 15 minutes and plasma or serum aliquots were stored at 70c until they were assayed. interassay coefficient of variation (cv) for all assays were 35 kg / m, adiponectin levels were not significantly related to most variables of ms, except for the waist - to - hip ratio. they suggest that this finding may simply imply that body - weight factors could be more important than other factors in modulating plasma adiponectin levels in their study.. showed a stronger association between adiponectin and parameters of ms than with il-6, tnf-, and even crp. the authors concluded that adiponectin plays a key role in the development of ms and that determining serum adiponectin levels is important for the prevention and treatment of this syndrome. have not found a correlation between serum adiponectin and several proinflammatory markers in patients with an impaired glucose tolerance and type 2 diabetes mellitus. the authors suggested that hypoadiponectinemia and low - grade inflammation are independent and distinct factors. in the meantime, a growing body of evidence indicates that elevated uric acid levels are commonly associated with cardiovascular disease, and uric acid has even been suggested to have a causal role in hypertension and ms. uric acid has been shown to activate leukocytes and stimulates the production of interleukin 1-, interleukin 6 (il-6), and tnf- by mononuclear cells, and crp by cultured human vascular cells [22, 39 ]. nevertheless, our data have not shown any significant association between uric acid levels and inflammatory markers, except for adiponectin. patel. also verified that adiponectin was inversely associated with uric acid in apparently healthy young adults. the authors concluded that the functional metabolic role of adiponectin in this inverse relationship, independent of the other known biologic factors such as insulin resistance and visceral adiposity, was not clear. adiponectin was the unique inflammatory marker measured in the current study that was correlated with serum uric acid levels (an inverse correlation), and both were significantly altered in ms patients. on the other hand, adiponectin levels were not correlated with uric acid levels in the control group (data not shown). although uric acid may have a protective effect due to its antioxidant properties, it is clear that the dominant effect of uric acid in ms is deleterious. it is still unclear which of the following detrimental roles of uric acid is more important : mediating the effects of conventional risk factors in the development of the atherosclerotic disease, mediating the effects of an anti - inflammatory status, or mediating the effects of a proinflammatory status. our data, which showed an inverse relationship between adiponectin with wc and uric acid levels, reinforce the former two hypotheses. when considering the results of the present study, the following limitations must be considered : first, the small size sample did not allow for a correction for multiple testing. second, the present study was performed with pre- and postmenopausal women what could have interfered with the results, although statistical analyses have not confirmed this likelihood. nevertheless, we conducted rigorous clinical and laboratorial assessments to ensure that the control and patient groups did not present any conditions which could interfere with the research, such as chronic diseases and drugs which could influence inflammatory markers, uric acid levels, or metabolic syndrome parameters. thus, we were confident that the patients in this study had a unique diagnosis of ms. furthermore, subjects in this study were exclusively women, which were paired by age, race, smoking habit, and alcohol intake. in conclusion, patients with ms presented several increased inflammatory markers that were primarily associated with insulin resistance and abdominal adiposity. the decrease in anti - inflammatory protection and the increase in the inflammatory process seem to be independent processes in ms patients. except for an inverse correlation with adiponectinemia although a transversal study does not necessarily imply causality, it does suggest a role of uric acid in the etiology of hypoadiponectinemia in ms. | metabolic syndrome (ms) is a cluster of glucose intolerance, hypertension, and dyslipidemia with visceral fat accumulation. this study was undertaken to assess which components of metabolic syndrome (ms), including uric acid and proinflammatory markers, are related to adiponectin levels in overweight and obese women with ms. ninety - one women (60 with ms and 31 controls) were assessed in relation to classical and inflammatory parameters of ms. in comparison to controls, patients with ms showed significant differences in parameters that are typically associated with ms and in inflammatory markers. fibrinogen, crp, and c3 were positively, whereas albumin was inversely correlated with abdominal adiposity and insulin resistance. adiponectin was inversely correlated with waist circumference and uric acid levels. activities of adiponectin and proinflammatory markers are not correlated in overweight and obese women with ms. in addition to abdominal adiposity, uric acid may be implicated in a decrease of adiponectin in ms patients. |
the egg batches of h. nigrescens were collected in niigata prefecture, japan, in april 2012. arrows indicate the level of the line between epaxial muscles and hypaxial muscles. a : st 38, b : st 50, c : st 58, d : st 63a, e : st 66, f : st 68. scale bar=5 mm. and table 1table 1.specimens of hynobius nigrescens used in this studydevelopmental stagehabitatsvl(mm)st38aquatic7.27.37.5st50aquatic9.910.510.8st58aquatic12.913.514.1st63aaquatic16.817.117.2st66aquatic21.121.622.2st68terrestrial24.925.225.7snout - vent length.), as described by iwasawa and yamashita. the earliest stage used in this study was st 38, which is gill formation iii when the gills bud and balancers elongate. the larvae of st 38 swim in water by lateral undulation of trunk. the next developmental stage used in this study was st 50, which is digital differentiation iii when the balancers disappear and first and second finger primordials clearly develop. the third developmental stage used was st 58, which is digital differentiation vi when the fourth toe is clearly recognized. they swim by lateral undulation of trunk and sometimes hold the bottom by forelimbs to stabilize their body. the fourth developmental stage used was st 63a, which is full - grown larva i when the membrane between each toe disappears. the larvae of st 63a swim using lateral undulation of trunk in addition to crawl on the bottom. the fifth developmental stage was st 66, which marks the disappearance of fin ii when the dorsal fin regresses as far back as the hind limbs and small gill pieces remain. the last developmental stage used was st 68, which is completion of metamorphosis when the gills and tail fin have completely disappeared and the eyeballs protrude. samples were fixed in a straight body position in 10% formalin and were then transferred to 70% ethanol solution. arrows indicate the level of the line between epaxial muscles and hypaxial muscles. a : st 38, b : st 50, c : st 58, d : st 63a, e : st 66, f : st 68. the following groups of the trunk muscles were examined in this study : dorsal muscles, lateral hypaxial muscles and abdominal muscles. during dissection, specimens were kept wet by moistening with water to avoid drying and subsequent measurement error. when the muscle was dried, the weights of the muscle would be measured lighter than in actual, and thus, the assumed measurement error was delivered from the drying of muscles. each trunk muscle group was weighed using an electronic balance auw220 (shimadzu co., ltd., the weight ratio of each muscle group against the total weight of all measured trunk muscles was calculated. observation of trunk muscles : the components of the trunk muscles developed and changed morphologically with growth (fig. 2fig. 2.lateral views of ontogenetic changes of the trunk muscles in hynobius nigrescens. a : st 38, b : st 50, c : st 58, d-1 : st 63a after skinned, d-2 : st 63a after removed m. obliquus externus, e-1 : st 66 after skinned, e-2 ; st 66 after removed m. obliquus externus, f-1 : st 68 after skinned, f-2 : st 68 after removed m. obliquus externus. at st 38, they possessed a single thick dorsal muscle and a single thick m. ventralis (fig. at st 50, when the first and second finger primordia had developed patently, a thin m. transversus abdominis with fibers extending craniodorsally developed from m. ventralis and became ventrally enlarged (fig. the dorsal muscles were segmented by myosepta, as also observed at st 38. when the hind limbs were revealed and forelimbs were developed at st 58, a thin m. obliquus externus with fibers running caudoventrally developed along the edge of the abdominal contour line of m. transversus abdominis. from the ventral edge of m. obliquus externus, the muscle fibers of m. obliquus externus became parallel to the sagittal line (fig. 2c). at st 63a, when they crawled on the bottom in water and swam by undulation, m. obliquus externus dorsally developed to the level of the lateral line between epaxial muscles and hypaxial muscles (fig. 2d). a thin m. rectus abdominis occurred at the ventral edge of the trunk (fig. at st 66, when they crawled on the bottom in water in addition to swimming, m. rectus abdominis expanded and increased in thickness and was obviously separated from the fibers of the lateral hypaxial layers (fig. 2e). at st 68, after metamorphosis and movement to land for walking on ground, m. rectus abdominis became enlarged (fig. lateral views of ontogenetic changes of the trunk muscles in hynobius nigrescens. a : st 38, b : st 50, c : st 58, d-1 : st 63a after skinned, d-2 : st 63a after removed m. obliquus externus, e-1 : st 66 after skinned, e-2 ; st 66 after removed m. obliquus externus, f-1 : st 68 after skinned, f-2 : st 68 after removed m. obliquus externus. trunk muscle weight ratios : the muscle group weight ratios are represented in table 2table 2.ontogenetic changes of weight ratios of trunk muscles in h. nigrescensdevelopmental stageaverages of svl (mm)weight ratio (%) dorsal muscleslateral hypaxial musclesabdominal musclest387.33 0.252.2 2.347.7 2.30.0st5010.4 0.355.1 2.344.8 2.30.0st5813.5 1.155.3 1.841.7 2.23.0 0.4st63a17.0 0.656.7 2.638.3 2.94.9 0.3st6621.6 1.360.0 1.229.9 2.410.0 1.3st6825.2 1.261.4 2.322.1 3.516.5 1.4snout - vent length, mean s.e.m.. ontogenetic changes were identified in the muscle group ratios among stages. the muscle weight ratio of the dorsal muscles increased with growth from 52.2% at st 38 to 61.4% at st 68 (the averages of three samples of weight ratios of the trunk muscles : table 2). in contrast, the weight ratio of the lateral hypaxial muscles decreased with growth from > 40% at st 38, 50 and 58 to < 30% at st 66 (table 2). the weight ratio of the abdominal muscles increased with growth (table 2). at st 38 and 50, the salamander did not possess abdominal muscles, with the percentage of abdominal muscles being recorded as zero. from st 58 to 68, observation of trunk muscles : ontogenetic changes were recognized in the trunk muscles in h. nigrescens. maurer described that m. rectus abdominis arose from the ventral edges of m. obliquus internus on the timing of start of development of m. obliquus externus. in h. nebulosus, m. rectus abdominis develops from the ventral edges of m. obliquus externus and m. obliquus internus when the development of m. obliquus externus starts. in this study of h. nigrescens, m. rectus abdominis developed and enlarged from the ventral line when m. obliquus externus developed. the timing of formation of m. rectus abdominis on the ventral line in this study coincided with maurer and fujimoto. the number of lateral hypaxial muscles differed between h. nigrescens in this study and h. nebulosus in fujimoto. h. nigrescens has two layers, m. obliquus externus and m. transversus abdominis, as lateral hypaxial muscles, except for m. ventralis. in contrast, h. nebulosus has three layers : m. obliquus externus, m. obliquus internus and m. transversus abdominis, except for m. ventralis. the developmental sequence of the hypaxial trunk muscles of h. nebulosus is reported as follows : 1) m. ventralis (the ventral muscle), 2) m. obliquus internus (the inner lateral hypaxial layer) from the ventral muscle, 3) m. obliquus externus (the outer lateral hypaxial layer) and m. rectus abdominis and 4)m. transversus abdominis, which sequence was similarly observed in h. nigrescens, but m. obliquus internus does not appear and m. transversus abominis appears before m. obliquus externus and m. rectus abdominis in h. nigrescens. simons and brainerd discussed that the habitat and predominant locomotor mode of salamanders do not appear to be strong associated with the number of lateral hypaxial layers. it was suggested that the differences in the number of lateral hypaxial layers in these phylogenetically very close species, h. nebulosus and h. nigrescens suggest the presence of interspecific variation in this genus and further studies on other congeneric species are required. in this study, we observed only from lateral view. at st 38, immediate hatching, the number of lateral hypaxial layer was only one, and the layer was thick (fig. a typical fish possesses a thick trunk muscle divided into epaxial and hypaxial segments by a myosepta, but it does not show a layered structure. because the larvae of h. nigrescens locomote by swimming and they do not possess limbs at st 38, they have a single thick m. ventralis as the lateral hypaxial muscle for undulatory swimming. during later developmental stages, the thickness of m. ventralis decreased, and a thin layer of m. transversus abdominis developed from the ventral edge of m. ventralis (fig. 2b). at st 58, a thin layer of m. obliquus externus developed as one of the lateral hypaxial muscles (fig. the two lateral hypaxial muscles at this stage were thinner than m. ventralis present during early developmental stages (fig. 2c). when urodelians move to land, they need to resist both torsion and lateral bending. since resisting torsion can be absorbed by the two lateral hypaxial layers which fibers run in a cross direction with each other, the number of the lateral hypaxial muscles possibly increased from one to two with growth. furthermore, muscle fibers running across each other in the two lateral hypaxial layers strengthen the body in a manner similar to the lamination of chipboard. at st 58, when the fourth toe is clearly recognized, the muscle fibers of the lateral hypaxial muscle become longitudinal at the ventral edge of the trunk (fig. m. rectus abdominis developed and enlarged at st 58, 63a, 66 and 68 (fig. because m. rectus abdominis generally contributes to maintaining posture and sustaining the animals own weight, evolutionary acquisition of this muscle was possibly essential for terrestrial locomotion. it has been argued that typical fish do not have m. rectus abdominis because their basic trunk muscle structure is composed of epaxial and hypaxial muscles that facilitate lateral bending. because of buoyancy, the need of sustaining inward organs weight decreases in fish. then, fish does not have m. rectus abdominis which function is sustaining own weight. when adult salamanders are compared, terrestrial species and semi - aquatic species possess a separated and larger m. rectus abdominis, whereas aquatic species possess a smaller and unseparated m. rectus abdominis [14, 15 ]. [14, 15 ] suggested that a separated and larger m. rectus abdominis facilitated terrestrial locomotion by resisting gravity and that m. rectus abdominis is not essential for an aquatic lifestyle. separated m. rectus abdominis more specializes its function of sustaining own weight than unseparated ones from lateral hypaxial muscles [14, 15 ]. thus, the interspecific difference of m. rectus abdominis between aquatic and terrestrial species is parallel to the muscular differences found between the aquatic and terrestrial stages of h. nigrescens. trunk muscle weight ratios : ontogenetic changes in the weight and weight ratios of the muscle groups are given in table 2. though the actual mass of all muscle groups increased according to growth, the degree of growth was different among muscle groups. the weight ratios of the dorsal and abdominal muscles increased with growth, hence the decrease of the weight ratios of the lateral hypaxial muscles. m. dorsalis trunci, which is the largest epaxial muscle, stabilizes the trunk against sagging and torsion and increases the stiffness of the trunk during walking. because the need for stabilizing the trunk and resisting gravity on land occurs only after metamorphosis, we assume that the increase in the weight ratio of the dorsal muscles is related to the transition from water to land. the weight ratio of the lateral hypaxial muscles decreased with growth (table 2). lateral hypaxial muscles function to control torsion and lateral bending and to stabilize the body [1, 3, 4 ]. because lateral hypaxial muscles are necessary for undulatory swimming, we suggest that larvae possess larger lateral hypaxial muscles than terrestrial juveniles. after the limbs develop, the role of the lateral hypaxial muscles possibly decreases. therefore, we consider that the decreased importance of the lateral hypaxial muscles results in the decreased weight ratios of the lateral hypaxial muscles. after they are equipped with limbs, urodelians mainly locomote by undulatory swimming in addition to aquatic walking. this study suggests that they gradually modify the trunk muscles to prepare for movement on land. abdominal muscles function to prevent sagittal extension of the trunk by the action of the epaxial muscles and to sustain the body weight against gravity. abdominal muscles appeared and increased in size after the appearance of the interdigital processes in the hind limb anlage. it is possible that such growth of the abdominal muscles facilitates terrestrial life. during middle developmental stages from st 50 to st 63a, salamanders start swimming in water using their limbs (personal observations). at this stage, they depend less on the lateral hypaxial muscles and more on the dorsal and abdominal muscles. after metamorphosis, they start adapting to terrestrial life by enlarging the dorsal and abdominal muscles. in conclusion, the ontogenetic changes in the trunk muscles of h. nigrescens are linked with habitat transition from water to land, with the muscle construction changing in adaptation from aquatic swimming to resisting gravity. | we investigated ontogenetic changes in the trunk muscles of the japanese black salamander (hynobius nigrescens) before, during and after metamorphosis. given that amphibians change their locomotive patterns with metamorphosis, we hypothesized that they may also change the structure of their trunk muscles. the trunk muscles were macroscopically observed, and the weight ratios of each trunk muscle group were quantified at six different developmental stages. immediately after hatching, we found that the lateral hypaxial muscle was composed of one thick m. ventralis, from ventral edge of which m. transversus abdominis arose later, followed by m. obliquus externus and m. rectus abdominis. the weight ratios of the dorsal and abdominal muscles to the trunk muscles increased with growth. we suggest that a single thick and large lateral hypaxial muscle facilitates swimming during early developmental stages. the increase in the weight ratios of the dorsal and abdominal muscles with growth possibly assists with gravity resistance necessary for terrestrial life. |
although breast cancer is the most common cancer among women in both developed and developing countries, it has a higher survival rate than other cancers (15). improvements in the breast cancer survival rate over recent decades have been attributed to progressive developments in early diagnosis and use of adjuvant therapies (68), and, according to the findings of various studies, the number of cancer survivors likely will double by 2030 (8, 9). however, the growing number of breast cancer survivors may experience many psychological issues resulting from the disease. in addition, cancer treatment may disrupt the patient s life for a prolonged period. generally, cancer is considered as a chronic stressor event that influences the patient s life (1012). it has been reported that a cancer diagnosis impacts different dimensions of patients lives, including psychological, social, physical, and spiritual dimensions (13), causing long - lasting aftereffects on the quality of life (14). for instance, cancer diagnosis often is accompanied with distress, such as unwanted intrusive thoughts about cancer for patients (15), and it may lead to emotional reactions and psychological challenges, such as anxiety, hopelessness and despair, fear of dying, sense of aloneness, and sexual and body - image problems. in addition, it can impact patients relationships and change their lives (1618), thereby causing an overall decrease in the quality of life (19). women in this situation have to deal and cope with all of these problems to adjust to their diagnosis, and they must deal with the loss of breast tissue, any side effects of adjuvant therapy, and generally with their new life circumstances (19, 20). the relationship between coping strategies and quality of life among women with breast cancer has been recognized in numerous publications (2123). there are various coping theories that may be used by breast cancer survivors, including lazarus theory of appraisal, stress, and coping and ursin s theory of cognitive - behavioral coping. according to lazarus theory of appraisal, stress, and coping, coping can be defined as constantly changing cognitive and behavioral efforts to manage specific external and/or internal demands that are appreciated as a stressor. problem - focused coping, behavior directed at solving the problem or situation, such as active coping, planning, seeking social (instrumental) support, and suppression of emotions (24). there are also emotion - focused coping, behavior directed at changing the emotional reactions to the problem or situations that include various defensive and avoidant strategies (25). these may include seeking social (emotional) support, turning to religious support, and denial (24). in ursin s theory of cognitive - behavioral coping, coping is defined as positive response outcome expectancy implying a generalized positive attitude to a person s capacities to handle s stressful situation, independent of the particular strategy used. in this definition, ursin indicated that coping efforts are based on a reasonably correct perception of reality, whereas defensive mechanisms are based on distortions of reality (26). as bernnan reported in the social - cognitive transition model of adjustment to cancer, adjustment is an ongoing process of learning from, and adapting to the many changes that an individual faces as a result of living with, and receiving treatment for cancer. the degree of adjustment depends on the combined effects of coping responses, social support, and cognitive appraisal of the cancer experience (27). since the coping process is highly specific to the person, her culture and her social factors (28), we aimed to synthesize up - to - date evidence about the type of coping strategies used by primary breast cancer survivors. the following selection criteria were applied about the type of studies, participants, and coping strategies in this systematic review. studies published in the english language were included in this systematic review. only qualitative or quantitative studies with observational designs that had assessed coping strategies to adjust with the breast cancer by survivors were included. the first rationale for this selection was to study the ways of coping that breast cancer patients frequently used, whereas, in the interventional studies, researchers propose or make decisions to do specific intervention(s) to help patients cope with their situations. second, we attempted to assess whether coping strategies vary among different conditions, such as settings, ethnicity, age, and the stage of the disease. eligible articles that mentioned implicitly or explicitly any kind of coping strategies used by patients with primary breast cancer were reviewed, and the coping strategies were divided into problem and/or emotion - focused categories according to the essence of the behaviors or efforts. a list of relevant keywords was used to obtain the articles. the keywords included various terms, such as breast cancer, breast malignancy, coping strategies, coping behaviors, coping skills, and adjustment. then, a systematic literature review was conducted in google scholar, pubmed, scopus, wiley online library, and psycinfo (from january 2000 to july 2015) and relevant quantitative (except for clinical trials, review articles, and meta - analysis studies) and qualitative studies were selected. finally, we included those papers that addressed the coping strategies that were used by primary breast cancer survivors to achieve adjustment with the disease. the following selection criteria were applied about the type of studies, participants, and coping strategies in this systematic review. studies published in the english language were included in this systematic review. only qualitative or quantitative studies with observational designs that had assessed coping strategies to adjust with the breast cancer by survivors were included. the first rationale for this selection was to study the ways of coping that breast cancer patients frequently used, whereas, in the interventional studies, researchers propose or make decisions to do specific intervention(s) to help patients cope with their situations. second, we attempted to assess whether coping strategies vary among different conditions, such as settings, ethnicity, age, and the stage of the disease. eligible articles that mentioned implicitly or explicitly any kind of coping strategies used by patients with primary breast cancer were reviewed, and the coping strategies were divided into problem and/or emotion - focused categories according to the essence of the behaviors or efforts. the keywords included various terms, such as breast cancer, breast malignancy, coping strategies, coping behaviors, coping skills, and adjustment. then, a systematic literature review was conducted in google scholar, pubmed, scopus, wiley online library, and psycinfo (from january 2000 to july 2015) and relevant quantitative (except for clinical trials, review articles, and meta - analysis studies) and qualitative studies were selected. finally, we included those papers that addressed the coping strategies that were used by primary breast cancer survivors to achieve adjustment with the disease. electronic database searching resulted in 2390 articles (after removing duplicates), including 1,271 from google scholar, 189 from pubmed, 484 from scopus, 156 from wiley online library, and 290 from psycinfo. then, 1,700 articles were excluded because of their research methods (e.g., review articles, meta - analyses, and clinical trials), unrelated titles, text language, or the wrong population. ultimately, 20 studies met the inclusion criteria of our study and were included in the review. in all, we reviewed 15 quantitative and five qualitative articles. the scores ranged from 0 to 9, and all of the articles selected for the present study had comparable quality scores ; the details of the studies characteristics and newcastle ottawa quality assessment scales scoring are presented in table 1. sample sizes of the studies that were included varied from 55 to 847 and 19 to 45 in selected quantitative and qualitative studies, respectively. in relation to demographic characteristics, all of the studies except three reported the mean age of patients, which ranged from 43 to 59. totally, the most common coping strategies that patients with primary breast cancer used in the studies were seeking social support (9 studies) (2937), positive reframing and reappraisal behaviors as problem - focused strategies (7 studies) (31, 32, 40, 43, 44, 30, 46), religious / spirituality - focused efforts (8 studies) (29, 31, 35, 3841), emotional expression as positive emotion - focused strategies (3 studies) (32, 42, 43), and avoidance and distraction as avoidance - orientated strategies (6 studies) (20, 30, 33, 40, 44, 45). in addition, it was found that emotional coping reactions were stable during the different phases of the disease, including after cancer diagnosis, pre - surgery, and after the adjuvant therapy period, while cognitive coping strategies varied during the aforementioned periods. it seemed that chemotherapy had the strongest influence on the use of coping strategies (46). it also was mentioned that coping response seemed to vary during different phases of the disease due to the decreasing level of anxiety over time (36). educational level was reported as an important demographic factor that predicted the use of instrumental - based ways of coping and social support, and it was found that higher educational level and lower age were identified as related factors with the use of cognitive defense coping strategies and, therefore, the reduced use of social support (47). in addition, in another study, a positive relationship was found between emotion - based coping response and low educational level (40). in a study that assessed ways that black and white women used to cope with breast cancer, it was identified that most of the black women low socioeconomic status and the late stage of breast cancer at the initial diagnosis. these women were more likely to use coping strategies that included suppressing emotions, wishful thinking, and positive reappraisal, but also, it was reported that avoidance was somewhat more common among patients with early - stage disease (43). in another study that compared the common coping strategies of african - american, hispanic, and non - hispanic white women reported that the ways of coping varied across the different ethnicities. in the mentioned study, it was found that religious coping strategies were the most frequent strategy among african - american and hispanic women, while most non - hispanic white women used humor to cope with their disease (48). the benefits of problem - focused coping strategies were confirmed by the coping theorists, and these strategies included active acceptance, positive reframing, and turning to religion and spirituality. in addition, problem - focused strategies mostly were used in situations in which the women had a sense of control of the stressor and felt that they could do something constructive about it (24). as we reviewed, drageset., in their qualitative content analyses study, extracted the main themes realted to the ways of coping of 19 women with breast cancer, including step - by - step, pushing away, business as usual, enjoying life, dealing with emotions, preparing for the worst, and positive focus. they noted that it seemed to the main purpose of these patients to avoid being overwhelmed by emotional reactions (49). in a cross - sectional study, explored the common coping strategies of 360 patients in three phases after cancer diagnosis, and they mentioned that positive problem solving mostly was used as their coping response, followed by seeking social support and escape / avoidance (30). khalili., in their cross - sectional quantitative study that was performed among 62 iranian women with a diagnosis of breast cancer, reported that religion, acceptance, planning as problem - focused and self - distraction, avoidance, and denial as an emotion - based way of coping were the most frequent coping responses of patients in their study (40). a prospective longitudinal assessment of coping strategies was done among younger women with breast cancer by danhauer. in 2009. the participants were 268 women with diagnoses of breast cancer who were studied in the first stage and 246 women in the second stage with the mean age of 43.2. the coping strategies that these patients used were assessed through a ways of coping - cancer (woc - ca) questionnaire. the results indicated that positive cognitive restructuring was the most common strategy that women used, and keeping feelings to oneself was reported as the minimum used coping strategy. they also found that coping strategies varied over time ; for instance, they mentioned that seeking social support, spirituality, wishful thinking, and making changes decreased over time among participants (31). in 2007, li. performed a quantitative study of 100 chinese women with diagnoses of breast cancer in order to identify the coping strategies they used. they found that the chinese women with breast cancer mostly used planning, positive reframing, and self - distraction to cope with their illness (45). the positive effect of social support on illness - related distress, such as the distress related with a breast cancer diagnosis, and patients emotional wellbeing is evident in the literature (50). we found evidence that indicated that seeking social support was common among breast cancer patients, especially after the cancer diagnosis and in the pre - surgery stage when the patients were feeling more stress and anxiety (31, 33, 34). in 2002, nosarti., in their prospective cohort study of 74 women with breast cancer who had a mean age of 59.4, aimed to identify the adjustment ways of these patients. they used the mini mental adjustment to cancer (mini mac) instrument to identify the strategies that women with primary breast cancer used to adjust to their disease. the patients were assessed at two points, i.e., immediately after their diagnosis of breast cancer diagnosis and three months later. they reported that a fighting spirit and stoic acceptance were the common ways that the patients used to adjust, and it was mentioned that the presence of social support may result in a successful adjustment in first year after the diagnosis (36). in 2011, in another study with the same goal, silva. noted that, when patients were informed about their breast cancer diagnosis, they experienced the greatest anxiety than in the other phases of the disease, and they used ways of coping, such as seeking social support and cognitive strategies, that were linked to the psychological well - being of the patients (34). in a cross - sectional study of 86 african - american women with primary breast cancer diagnosis in which strategies for coping with a cancer diagnosis were assessed with the ways of coping questionnaire, the results showed that positive reappraisal and seeking social support were used frequently as coping strategies (32). conducted a prospective study that compared the different coping strategies that were used during the acute and chronic phases and their effectiveness with respect to psychological adjustment. in the study, they assessed 151 women at one day before surgery, and they conducted follow - up assessments of 106 of the women six months later. they reported that the patients used the same ways of coping to adjust during the acute and chronic phases and that there was a decrease in the use of instrumental ways of coping and a stability of the distraction and palliative ways of coping in the chronic phase (33). kim. examined the impact of social support on the coping strategies used by women with breast cancer and its impact on their emotional well - being. they assessed the coping strategies of 231 women with breast cancer using the brief cope questionnaire and reported that the level of social support had a major impact on the selection of coping strategies (self - blame or positive reframing) (50). avoidance - orientated coping strategies were introduced with two dimensions, i.e., 1) efforts to avoid, deny, and suppress negative emotions and 2) distraction. these strategies mostly were considered to be inferior strategies, but they may provide a short period of temporary relief (51). a prospective cohort study was conducted among women with breast cancer in 2004 by hack. to assess the long - term relationship between coping responses and psychological adjustment to a breast cancer diagnosis. they used the coping response inventory to measures cognitive and behavioral ways of coping according to approach and avoidance coping responses, i.e., logical analysis, positive reappraisal, social support, problem - solving and cognitive avoidance, resigned acceptance, emotional discharge, respectively. the results of their study indicated that patients who used cognitive avoidance strategies, such as passive acceptance and resignation, were at significant risk for poor long - term psychological adjustment (20). conducted research on the relationships of avoidance coping and cortisol rhythm disruption among 57 breast cancer patients with the mean age of 52. they used the brief cope inventory and found that maladaptive psychological responses to breast cancer diagnosis, such as avoidance coping strategies, were associated with cortisol rhythm disruption (44). in addition, a positive relationship was reported in the literature between avoidance coping strategies and pre - surgical distress among women with breast cancer diagnosis (20, 52). it was emphasized that avoidance coping strategies may have a positive effect for coping with short - term stressors, but, in the long term, they generally have been related with increased distress (53). patients often use emotion - focused coping strategies when they feel that the stressor is something they must endure (24). coping through emotional ways, such as expressing emotions, was found to be related with higher quality of life among patients with breast cancer (54). reynolds. performed a prospective cohort study among a large population of patients with breast cancer in the u.s. and reported that there was a positive association between emotion - based coping strategies and emotional expression with the rate of survival (43). another study, which was conducted among 57 egyptian women with breast cancer diagnosis using the brief cope inventory, found that acceptance, religion, and emotional support were the most frequently - used coping strategies (42). the same results were reported by hervatin., who also emphasized the stability of the emotional coping response of these patients over the time of the disease (46). the expression of emotions was identified as having a positive effect on patients psychological status (20, 49, 54), but it may have a unfavorable impact on the breast cancer patients sense of coping (49). the positive impact of religious beliefs and spirituality was reported on patient illness adjustment (41). in our review, two studies included measures of religious / spiritual coping strategies and their impact on the general well - being and adjustment to the illness among women with breast cancer. it was mentioned that most women used positive religious coping (i.e., partnering with god or looking to god for strength, support, or guidance), and a minority used negative religious coping (i.e., feeling abandoned by or anger at god), which may predict poor mental health in women with breast cancer (39). the same results were reported in another study, and it was reported that using religion and spirituality as resources and ways of coping was common among patients, and it also may have a role in the long - term adjustment to cancer by providing emotional comfort and a sense of hope (41). there were limited literature references with qualitative designs that studied coping strategies that women with primary breast cancer diagnosis have used to adjust to the disease during the past 15 years. in 2006, talegani. performed a qualitative study to assess the coping behaviors of women in iran who had an early diagnosis of breast cancer. they conducted semi - structured interviews with 19 women with primary breast cancer diagnosis and realized that the frequently used coping efforts included resorting to religious beliefs, thinking about the disease, accepting the reality of the disease, and finally seeking support from significant others. they stated that the most prevalent coping strategies among women were positive thinking and religious faith (35). the same researcher conducted qualitative research with the grounded theory design and performed 45 interviews with patients with primary breast malignant tumor in different phases of the disease to investigate patients experiences with adjustment to the situation. the study s findings encompassed eight themes from the patients experiences of adjustment, i.e., perceived threat to live, religious aspects, supportive dimensions, will to recover, increase in endurance, barriers to efforts leading to health, living with the disease with tolerance, and inhibitors and facilitators of tolerance(37). in the same qualitative study that was done among omani women with breast cancer diagnosis in 2013, the results showed that the patients used various coping strategies, including denial, optimism, withdrawal, islamic beliefs and practices, and the support of family members and healthcare providers. it is recognized that islamic beliefs and practices were common coping strategies that women used (29). the coping strategies also were studied by goldblatt. among arab (muslim and christian) women with breast cancer diagnosis. the experiences of the women were categorized as family comes first, the woman and her family. that is the dilemma, whether faith in god is a source of coping and constructing new meanings after recovering from cancer (38). the benefits of problem - focused coping strategies were confirmed by the coping theorists, and these strategies included active acceptance, positive reframing, and turning to religion and spirituality. in addition, problem - focused strategies mostly were used in situations in which the women had a sense of control of the stressor and felt that they could do something constructive about it (24). as we reviewed, drageset., in their qualitative content analyses study, extracted the main themes realted to the ways of coping of 19 women with breast cancer, including step - by - step, pushing away, business as usual, enjoying life, dealing with emotions, preparing for the worst, and positive focus. they noted that it seemed to the main purpose of these patients to avoid being overwhelmed by emotional reactions (49). in a cross - sectional study, explored the common coping strategies of 360 patients in three phases after cancer diagnosis, and they mentioned that positive problem solving mostly was used as their coping response, followed by seeking social support and escape / avoidance (30). khalili., in their cross - sectional quantitative study that was performed among 62 iranian women with a diagnosis of breast cancer, reported that religion, acceptance, planning as problem - focused and self - distraction, avoidance, and denial as an emotion - based way of coping were the most frequent coping responses of patients in their study (40). a prospective longitudinal assessment of coping strategies was done among younger women with breast cancer by danhauer. in 2009. the participants were 268 women with diagnoses of breast cancer who were studied in the first stage and 246 women in the second stage with the mean age of 43.2. the coping strategies that these patients used were assessed through a ways of coping - cancer (woc - ca) questionnaire. the results indicated that positive cognitive restructuring was the most common strategy that women used, and keeping feelings to oneself was reported as the minimum used coping strategy. they also found that coping strategies varied over time ; for instance, they mentioned that seeking social support, spirituality, wishful thinking, and making changes decreased over time among participants (31). in 2007, li. performed a quantitative study of 100 chinese women with diagnoses of breast cancer in order to identify the coping strategies they used. they found that the chinese women with breast cancer mostly used planning, positive reframing, and self - distraction to cope with their illness (45). the positive effect of social support on illness - related distress, such as the distress related with a breast cancer diagnosis, and patients emotional wellbeing is evident in the literature (50). we found evidence that indicated that seeking social support was common among breast cancer patients, especially after the cancer diagnosis and in the pre - surgery stage when the patients were feeling more stress and anxiety (31, 33, 34). in 2002, nosarti., in their prospective cohort study of 74 women with breast cancer who had a mean age of 59.4, aimed to identify the adjustment ways of these patients. they used the mini mental adjustment to cancer (mini mac) instrument to identify the strategies that women with primary breast cancer used to adjust to their disease. the patients were assessed at two points, i.e., immediately after their diagnosis of breast cancer diagnosis and three months later. they reported that a fighting spirit and stoic acceptance were the common ways that the patients used to adjust, and it was mentioned that the presence of social support may result in a successful adjustment in first year after the diagnosis (36). in 2011, in another study with the same goal, silva. noted that, when patients were informed about their breast cancer diagnosis, they experienced the greatest anxiety than in the other phases of the disease, and they used ways of coping, such as seeking social support and cognitive strategies, that were linked to the psychological well - being of the patients (34). in a cross - sectional study of 86 african - american women with primary breast cancer diagnosis in which strategies for coping with a cancer diagnosis were assessed with the ways of coping questionnaire, the results showed that positive reappraisal and seeking social support were used frequently as coping strategies (32). conducted a prospective study that compared the different coping strategies that were used during the acute and chronic phases and their effectiveness with respect to psychological adjustment. in the study, they assessed 151 women at one day before surgery, and they conducted follow - up assessments of 106 of the women six months later. they reported that the patients used the same ways of coping to adjust during the acute and chronic phases and that there was a decrease in the use of instrumental ways of coping and a stability of the distraction and palliative ways of coping in the chronic phase (33). kim. examined the impact of social support on the coping strategies used by women with breast cancer and its impact on their emotional well - being. they assessed the coping strategies of 231 women with breast cancer using the brief cope questionnaire and reported that the level of social support had a major impact on the selection of coping strategies (self - blame or positive reframing) (50). avoidance - orientated coping strategies were introduced with two dimensions, i.e., 1) efforts to avoid, deny, and suppress negative emotions and 2) distraction. these strategies mostly were considered to be inferior strategies, but they may provide a short period of temporary relief (51). a prospective cohort study was conducted among women with breast cancer in 2004 by hack. to assess the long - term relationship between coping responses and psychological adjustment to a breast cancer diagnosis. they used the coping response inventory to measures cognitive and behavioral ways of coping according to approach and avoidance coping responses, i.e., logical analysis, positive reappraisal, social support, problem - solving and cognitive avoidance, resigned acceptance, emotional discharge, respectively. the results of their study indicated that patients who used cognitive avoidance strategies, such as passive acceptance and resignation, were at significant risk for poor long - term psychological adjustment (20). conducted research on the relationships of avoidance coping and cortisol rhythm disruption among 57 breast cancer patients with the mean age of 52. they used the brief cope inventory and found that maladaptive psychological responses to breast cancer diagnosis, such as avoidance coping strategies, were associated with cortisol rhythm disruption (44). in addition, a positive relationship was reported in the literature between avoidance coping strategies and pre - surgical distress among women with breast cancer diagnosis (20, 52). it was emphasized that avoidance coping strategies may have a positive effect for coping with short - term stressors, but, in the long term, they generally have been related with increased distress (53). patients often use emotion - focused coping strategies when they feel that the stressor is something they must endure (24). coping through emotional ways, such as expressing emotions, was found to be related with higher quality of life among patients with breast cancer (54). reynolds. performed a prospective cohort study among a large population of patients with breast cancer in the u.s. and reported that there was a positive association between emotion - based coping strategies and emotional expression with the rate of survival (43). another study, which was conducted among 57 egyptian women with breast cancer diagnosis using the brief cope inventory, found that acceptance, religion, and emotional support were the most frequently - used coping strategies (42). the same results were reported by hervatin., who also emphasized the stability of the emotional coping response of these patients over the time of the disease (46). the expression of emotions was identified as having a positive effect on patients psychological status (20, 49, 54), but it may have a unfavorable impact on the breast cancer patients sense of coping (49). the positive impact of religious beliefs and spirituality was reported on patient illness adjustment (41). in our review, two studies included measures of religious / spiritual coping strategies and their impact on the general well - being and adjustment to the illness among women with breast cancer. it was mentioned that most women used positive religious coping (i.e., partnering with god or looking to god for strength, support, or guidance), and a minority used negative religious coping (i.e., feeling abandoned by or anger at god), which may predict poor mental health in women with breast cancer (39). the same results were reported in another study, and it was reported that using religion and spirituality as resources and ways of coping was common among patients, and it also may have a role in the long - term adjustment to cancer by providing emotional comfort and a sense of hope (41). there were limited literature references with qualitative designs that studied coping strategies that women with primary breast cancer diagnosis have used to adjust to the disease during the past 15 years. in 2006, talegani. performed a qualitative study to assess the coping behaviors of women in iran who had an early diagnosis of breast cancer. they conducted semi - structured interviews with 19 women with primary breast cancer diagnosis and realized that the frequently used coping efforts included resorting to religious beliefs, thinking about the disease, accepting the reality of the disease, and finally seeking support from significant others. they stated that the most prevalent coping strategies among women were positive thinking and religious faith (35). the same researcher conducted qualitative research with the grounded theory design and performed 45 interviews with patients with primary breast malignant tumor in different phases of the disease to investigate patients experiences with adjustment to the situation. the study s findings encompassed eight themes from the patients experiences of adjustment, i.e., perceived threat to live, religious aspects, supportive dimensions, will to recover, increase in endurance, barriers to efforts leading to health, living with the disease with tolerance, and inhibitors and facilitators of tolerance(37). in the same qualitative study that was done among omani women with breast cancer diagnosis in 2013, the results showed that the patients used various coping strategies, including denial, optimism, withdrawal, islamic beliefs and practices, and the support of family members and healthcare providers. it is recognized that islamic beliefs and practices were common coping strategies that women used (29). the coping strategies also were studied by goldblatt. among arab (muslim and christian) women with breast cancer diagnosis. the experiences of the women were categorized as family comes first, the woman and her family. that is the dilemma, whether faith in god is a source of coping and constructing new meanings after recovering from cancer (38). this review indicated that seeking social support was the main coping strategy that women with primary breast cancer diagnosis used, especially at the early phase following the diagnosis of breast cancer. in addition, women in the early stage of the disease often tended to use religious strategies to cope with their disease due to enhanced anxiety and distress during the period immediately after the diagnosis. some demographic factors are indicative of the ways patients confront their cancer, such as the patient s educational level and ethnicity. in addition, the coping strategies that patients use in different phases of the disease vary, and patients often used different approaches to deal with the situation. the relationship between the use of coping strategies and the patients psychological adjustment has been confirmed in various studies. the use of coping strategies is recommended because they empower patients who are confronted with a cancer diagnosis and have an important role in their psychological adjustment to the illness and treatment - related complications. the knowledge about coping response of patients to cancer may be useful in designing intervention programs aimed to assist them in dealing with the various challenges imposed upon them by their illness. in addition, cultural differences should be considered in these programs because culture has an impact on the choice of and use of coping strategies. | introductioncoping with breast cancer is an important health issue that results in adjustments to the disease in survivors. the present systematic review aims to synthesize the evidence about the coping strategies used by women who are primary breast cancer survivors to adjust to their new situations in their lives.methodssearches were conducted using google scholar, pubmed, scopus, wiley online library, and psycinfo, using the terms breast cancer, breast malignancy, coping strategies, coping behaviors, and adjustment from january 2000 to july 2015. only relevant studies in english were selected at the end of the search. only those papers were selected that focused on coping strategies / behaviors that were used by breast cancer survivors.resultssearching the electronic databases resulted in 2390 articles. ultimately, 20 studies met the inclusion criteria of the present study and were included in the review. two reviewers independently reviewed all relevant articles using the same inclusion criteria. the reviewers completed a quality assessment using the newcastle ottawa quality assessment scales for observational studies. the more frequent coping strategies that patients with breast cancer used in the studies were 1) seeking social support (9 studies), 2) positive reframing and reappraisal behaviors as problem focused strategies (7 studies), 3) religious / spirituality - focused efforts (8 studies), 4) emotional expression as positive emotion - focused strategies (3 studies), and 5) avoidance and distraction as avoidance orientated strategies (6 studies). women with different ethnicities and educational levels used different coping strategies with breast cancer, and they used different strategies in different phases of the disease.conclusionthis systematic review revealed that seeking social support and emotion - focused efforts were the main coping strategies that women with breast cancer diagnosis used, especially in the early phase of breast cancer diagnosis. this information about the coping responses of patients may be useful in designing interventional programs to assist other women in dealing with the various challenges imposed upon them by their illness. |
nonmuscle - invasive bladder cancer seldom shows distant metastasis. in addition, it is extremely rare for bladder cancer staged as ta under the international union against cancer guidelines to result in distant metastasis. we present the case of a patient with a distant pulmonary metastasis of ta bladder cancer ; the patient did not have a history of muscle - invasive disease. we review the literature concerning non - muscle - invasive bladder cancer with distant metastasis and discuss management and treatment outcomes. a 66-year - old man had been diagnosed with ta bladder cancer 6 years before he complained of dry cough in july 2009. he had a history of recurrent non - muscle - invasive bladder tumors and had therefore undergone 7 transurethral resections (turs) and had received intravesicular chemotherapies (8 cycles of weekly mitomycin - c after the 4th tur and 5 cycles of biweekly pirarubicin after the 5th tur). all tumors were < 1 cm, well pedunculated, and papillary. the number of tumors ranged from 1 to 6 in each respective tur. the pathological findings of all turs indicated the presence of urothelial carcinoma (stage ta without carcinoma in situ, grade 1 or 2) without lymphatic or vascular invasion. the last tur in january 2009 showed the same findings as the previous turs, i.e., there were 3 tiny papillary tumors located at the right lateral wall, at the posterior wall, and adjacent to the left ureteral orifice, and pathological examination indicated results similar to those of the previous turs. chest radiography at 6 months after the last tur detected a round nodule (diameter, 7.5 cm) in the right lower lung. we carefully rechecked the chest radiograph obtained in april 2008, which showed a small nodule (diameter, 1 cm) in the same area. the initial diagnosis based on the computed tomography findings was primary lung cancer (fig. the histopathologic features of the pulmonary lesion and the tur specimen of the bladder cancer were qualitatively similar. immunohistochemistry showed that both the tur specimen and the pulmonary lesion were positive for the urothelium - specific protein uroplakin ia (up - ia) (fig. subsequently, he received 2 cycles of postoperative chemotherapy with the same gemcitabine and cisplatin regimen reported by von der maase.. although we had planned 3 cycles of chemotherapy, the patient refused the third course. his bladder cancer recurred at 3 and 8 months after chemotherapy and hence he underwent tur both times. the results of the pathological examination were the same results as for the previous turs. two and a half years after chemotherapy, chest and abdominal computed tomography once every 3 months detected no recurrence of the pulmonary lesions or other distant metastasis. for nonmuscle - invasive bladder cancer, the probability of recurrence at 5 years ranges from 31% to 78%, whereas the risk of distant metastasis is extremely low. matthew. reviewed cases of more than 1,000 patients treated for bladder cancer, regardless of the stage, and identified 9 patients with superficial urothelial carcinoma and distant metastatic disease (including 3 patients with stage pta disease). three patients underwent radical cystectomy, and muscle invasion was not identified on pathological examination. because vessels are absent in the bladder mucosa, it is thought that ta bladder cancer does not have the potential for lymphatic or hematogenous metastasis. several iatrogenic mechanisms of metastasis in clinically diagnosed ta cancer have been postulated : microscopic invasion by an understaged tumor, intravascular dissemination of tumor cells during transurethral resection, and degeneration of the basal membrane caused by intravesicular therapy. histopathologic features of non - keratinized squamous - cell carcinoma of the lung are similar to those of urothelial carcinoma. uroplakins (ups) are urothelium - specific proteins and have 4 subtypes : ia, ib, ii, and iii. reported that up - ia has higher sensitivity for urothelial carcinoma than ups ii and iii. they investigated the expression of up - ia in primary and metastatic urothelial carcinoma. among primary and metastatic lesions, the detection rate of up - ia was 96.8% and 72.2%, respectively. up - ia can be a promising marker for identifying urothelial carcinoma. to the best of our knowledge, 15 cases of non - muscle - invasive bladder cancer with distant metastasis have been reported in the english literature. all patients with bone metastasis (including 2 with stage pta disease) died shortly after diagnosis, and 1 patient with solitary brain metastasis died less than 3 months after brain surgery. on the other hand, as indicated in table 1, the outcomes in most patients with lung metastasis were good, except for 1 patient (stage ta, grade 2) who died 1 month after diagnosis. other studies have demonstrated a good prognosis in 3 patients with ta bladder cancer and lung metastasis after a combination of lobectomy and neoadjuvant or adjuvant chemotherapy [7 - 9 ]. death due to pulmonary metastasis of ta bladder cancer has not been reported, because the malignant potential of the metastatic lesions is low, and metastatic lesions can be completely resected with ease. although the effects of adjuvant chemotherapy remain undetermined, some authors have reported that adjuvant chemotherapy may contribute to the removal of systemically circulating cancer cells. a combination of complete resection of the lung lesions and systemic chemotherapy may lead to good prognosis for patients with non - muscle - invasive bladder cancer. | a 66-year - old man with a history of multiple transurethral resections for recurrent bladder tumors, staged as ta according to the international union against cancer staging guidelines, presented with a complaint of dry cough. a round nodule with a diameter of 7.5 cm was detected in the lung by chest computed tomography, and a video - assisted thoracoscopic lobectomy was performed. pulmonary metastasis of recurrent bladder cancer was diagnosed by immunohistochemistry staining for the urothelium - specific protein uroplakin ia. subsequently, 2 cycles of systemic chemotherapy were administered. two and a half years after treatment, no recurrence of pulmonary lesions has been detected. a combination of complete resection of pulmonary lesions and systemic chemotherapy may result in a good prognosis for patients with non - muscle - invasive bladder cancer. |
during recent decades methicillin - resistant staphylococcus aureus (mrsa) have emerged as human nosocomial pathogens throughout the world. mrsa were found to colonize and infect various animal species comprising horses [24 ], cows, dogs and cats [6, 7 ], rabbits and other companion animals. a special focus was put on the isolation of mrsa from pigs in several countries including the netherlands, denmark, france, canada, the usa and singapore [915 ]. although in the majority of reports pigs were colonized, but not infected by mrsa, some studies also described the development of mastitis or urinary tract infections in the animals. molecular typing showed that the porcine mrsa isolates were mostly associated with clonal complex (cc) 398 by multilocus sequence typing (mlst), corresponding to s. aureus protein a (spa) types t011, t034, t108, t1451 and relatives [9, 13 ]. consecutively, several reports suggested transmission between pigs and humans causing mrsa colonization in 2345% of pig - farmers [14, 17, 18 ] and 4.6% of pig - care veterinarians. a porcine mrsa reservoir therefore might exert manifold influence on human healthcare. since mrsa cc398 will potentially cause severe infections in humans [20, 21 ], contact to pig - farming might represent a risk - factor for the development of mrsa - associated illness. moreover, as studies indicated the entrance of mrsa in the food chain, e.g. via contamination of carcasses during the slaughtering process or via secondary contamination by slaughterhouse staff, the potential of these mrsa to cause foodborne disease has to be evaluated. apart from a direct pathogenic impact for carriers, patients colonized with mrsa originating from the livestock - reservoir might introduce antibiotic - resistant pathogens into the hospitals. as mrsa screening strategies in hospitals are usually based upon on - admission swabbing of patients who are attached to classical nosocomial risk factors for mrsa carriage, the established search policies might fail to detect patients with a livestock - related mrsa - acquisition. currently, there is growing concern about mrsa colonization of livestock in germany, but, besides a first pilot study, no further data are available. in order to elucidate this issue, we performed a prevalence study on mrsa colonization among pigs at randomly selected farms in germany in an area with a high density of pig production. the mrsa isolates were characterized using spa typing, mlst, sccmec typing and detection of important s. aureus toxin - encoding genes. furthermore, the importance of an import of livestock - related mrsa into hospitals in countries with medium or high mrsa prevalence, as described for germany, is currently unknown. in consequence, we performed a retrospective case control study among patients admitted to a tertiary - care hospital situated in the region in which the prevalence study was carried out. in this case control study, we included patients carrying such mrsa spa types identified among regional pigs at admission to the hospital. as a control group, we chose patients colonized with other mrsa spa types hitherto not associated with livestock. for both groups we assessed classical nosocomial risk factors for mrsa carriage and asked for a status of contact to pigs, cattle, horses, sheep or other animals. the comparison of risk factors among patients in the case group and the control group shall clarify whether patients carrying presumptive livestock - related mrsa types are likely to be colonized via transmission from animals. from april 2007 to november 2007 we collected nasal swabs from weaned pigs living on 40 different randomly chosen pig farms (25 farrowing farms, 4 rearing farms and 11 farrow - to - finishing farms) on the german side of the euregio, situated in the central dutch - german border area. the farms were situated in the following districts according to the nomenclature of territorial units for statistics (nuts) (http://ec.europa.eu/comm/eurostat/ramon/nuts) : dea34, dea37, dea35, dea29, dea1b, dea14, dea15, dea1d, dea1e, dea1f. the average animal density was 1,277 pigs (range 3753400 pigs) in the farrowing and farrow - to - finish units and 1,900 pigs (range 18002000 pigs) on the rearing farms. on each farm we derived 40 swabs from weaned piglets. after 24-h enrichment culture in selective broth, all cultures were streaked onto columbia - blood agar and a chromogenic medium for the detection of mrsa (biomrieux, marcy letoile, france). presumptive s. aureus colonies were confirmed by coagulase tube test, by use of vitek2 automated systems (biomrieux) and by s. aureus - specific pcr. strains with ambiguous results in phenotypic tests were analyzed by 16 s rrna gene sequencing. methicillin - resistance was tested by cefoxitin disc agar diffusion and was confirmed by meca - specific polymerase chain reaction as described. susceptibility to antimicrobial agents was tested by vitek2 automated systems according to recommendations of the manufacturer. the presence of the panton - valentine leukocidin (pvl) encoding genes (luks - pv, lukf - pv) was determined as described elsewhere. genes of other members of the staphylococcal bicomponent leukotoxin family (lukm, luke, lukd) were tested as published. detection of genes of the members of the staphylococcal pyrogenic toxin superantigen (ptsag) family including the toxic shock syndrome 1 gene (tst), classical and newly described enterotoxin and enterotoxin - like genes (sea, seb, sec13, sed, seg, seh, sei, sej, sem, sen and seo), exfoliative toxin genes (eta, etb and etd) as well as of genes of the epidermal cell differentiation inhibitor family (edina, edinb and edinc) and the accessory gene regulatory loci (agri, agrii, agriii and agriv) was carried out using previously reported methods [31, 32 ]. all mrsa isolates were typed by s. aureus protein a (spa) sequence - based typing as described. multilocus sequence typing (mlst) was performed on one isolate of each different spa type. typing of sccmec elements of types i to iv was carried out for one isolate of every spa type from every farm using a pcr approach, including a combination of different pcrs. to demonstrate sccmec - elements of type v, we used primers type vf / type vr, as described by zhang., and primer pair ccrc9f 5-cacttaatccatgtacacag-3 and ccrc - r. the university hospital mnster (uhm) is a 1300-bed maximum care teaching hospital in the central part of the dutch - german border area. its referral area mostly comprises the regions involved in the screening at pig farms. the mrsa database (ridom staphtype, wrzburg, germany) of the uhm includes spa typing results of every first mrsa isolate of each patient for isolates obtained from january 2005 to december 2008. the isolates were obtained from admission screening cultures from the nasopharynx and non - infected skin of patients at the uhm. screening was performed by swabbing of defined risk patients according to the national german guideline (www.rki.de, version 1.12.99 and comment 12.11.04) between january 2005 and june 2006 and was then replaced by a general nasal screening of all patients at admission. we searched the uhm database for mrsa isolates which were derived from screening samples and which were characterized by spa types which were identified on regional pig farms in this study (t011, t034, t108, t1451, t2510). using a standardized questionnaire, we interviewed randomly selected patients from whom such presumptive livestock - related mrsa spa types were isolated (n = 100 patients, case group). as a control group, we randomly chose a corresponding group of patients (n = 100) from whom mrsa with other than known livestock - associated spa types were isolated from screening specimens the patients were asked whether they shared one or more of the following classical nosocomial risk factors for mrsa acquisition at the time when the mrsa was detected for the first time : contact to another person with mrsa carriage or infection, prescribing of any antibiotics during the previous 6 months, hospitalization for > 24 h within the past 6 months, direct transfer of the patient from long - term care facilities to the admitting hospital, need for long - term care, presence of indwelling devices (urinary catheters, intravenous catheters, percutaneous gastrostomies, postsurgical drains), presence of skin lesions (ulcers, eczema, other wounds), need for haemodialysis. furthermore, the age of the patient, contact to horses, sheep, cattle, pigs and pets (e.g. cats, dogs) were assessed. for statistical analysis with spss statistics 17.0 (spss, chicago, il, usa), data were entered into an excel database (microsoft, redmond, wa, usa). univariate analysis was performed using chi - square test or fisher exact test for ordinal variables and student s t - test for continuous variables. all risk factors associated with a different distribution among the case and control groups with a p - value 24 h within the past 6 months, direct transfer of the patient from long - term care facilities to the admitting hospital, need for long - term care, presence of indwelling devices (urinary catheters, intravenous catheters, percutaneous gastrostomies, postsurgical drains), presence of skin lesions (ulcers, eczema, other wounds), need for haemodialysis. furthermore, the age of the patient, contact to horses, sheep, cattle, pigs and pets (e.g. cats, dogs) were assessed. for statistical analysis with spss statistics 17.0 (spss, chicago, il, usa), data were entered into an excel database (microsoft, redmond, wa, usa). univariate analysis was performed using chi - square test or fisher exact test for ordinal variables and student s t - test for continuous variables. all risk factors associated with a different distribution among the case and control groups with a p - value 81 years3973971.0nanaindwelling devices128828720.0080.327 (0.1051.024)0.055hospitalization46547030 81 years3973971.0nanaindwelling devices128828720.0080.327 (0.1051.024)0.055hospitalization46547030<0.001nanacontact with human mrsa carriers89213870.356nanachronic need for nursing care3972377<0.0010.065 (0.0080.524)0.010skin lesions59523770.0010.247 (0.0601.009)0.052contact with pets78224852<0.001nanacontact with horses19815950.0052.955 (0.83410.473)0.093contact with cattle2575397<0.0018.607 (1.72942.854)0.009contact with pigs6238694<0.00120.455 (7.83164.386)<0.001contact with sheep2982980.689nanana not availablep value resulting from univariate (chi - square or fisher exact test) analysis ; all factors with p < 0.2 were included in the initial regression modelodds ratio (95% confidence interval, ci) and p value of variables included in the final logistic regression model during the previous 6 months results of univariate analysis and results of logistic regression. number of patients in the case group (presumptive livestock - related mrsa spa types) and the control group (other than livestock - related mrsa spa types) sharing several potential risk factors for mrsa carriage p value resulting from univariate (chi - square or fisher exact test) analysis ; all factors with p < 0.2 were included in the initial regression model odds ratio (95% confidence interval, ci) and p value of variables included in the final logistic regression model during the previous 6 months in 2003, a new mrsa clone exhibiting mlst cc398 (spa types t108, t011 and relatives) emerged among patients in dutch hospitals. since the occurrence of this mrsa type was shown to be epidemiologically linked to regions with a high density of pig farming, and as screening of pigs yielded high colonization rates, it was assumed that pigs might be a potential zoonotic source for mrsa transmissions. it is unknown how often pigs at german farms, which are major european pig producers (eurostat yearbook 2008, http://epp.eurostat.ec.europa.eu), are colonized with mrsa. in this study, we identified mrsa colonization in pigs on 70% of the regional farms. this corresponds to data from the netherlands where 2380% of the pig farms were affected [9, 38 ], and it clearly reflects that porcine mrsa colonization is a common phenomenon on farms in germany, at least in the study area. however, genotypic investigations on mrsa isolates from pigs with acute diseases (urinary tract infection, skin infection, metritis mastitis agalactia syndrome) and screening of clinical specimens and cadavers recently indicated that other german geographic regions may also be involved. molecular typing revealed that the regional pigs isolates were associated with a subset of spa types associated with mlst cc398, agr type i and sccmec types v and iv, as observed in other countries [9, 18 ]. all isolates derived from pigs in this study did not harbour genes encoding exfoliative toxin, the toxic shock syndrome toxin 1 and enterotoxins. moreover, the porcine isolates lacked leukocidal toxin genes luke / lukd, lukm and the pvl - encoding luks / lukf. these results confirm previous investigations and suggest a low capacity of regionally disseminated porcine mrsa subtypes to induce toxin - mediated diseases among humans. the importance of these findings is highlighted against the background that mrsa cc398 have entered the food chain and an outbreak of foodborne disease caused by enterotoxin - producing mrsa exhibiting a different (non - cc398) molecular type has been described previously. hence, a close surveillance of s. aureus from different species and from food samples should reveal the potential emergence of toxin - producing mrsa isolates. logistic regression modelling in our case control study yielded that, in addition to contact with pigs, contact with cattle was also independently associated with an increased risk for mrsa cc398 colonization. this finding confirms recent observations by van loo. who also found a correlation of human mrsa cc398 carriage and contact to cattle. since no data on the prevalence of mrsa among cattle on german farms are published, further studies are warranted to investigate this issue. it has previously been observed that rates of antimicrobial resistance in the commensal flora of (pig) farmers are significantly higher than in the general population. the recent emergence of mrsa among farmers therefore might reflect another facet of a long - known phenomenon. nevertheless, we showed that the proportion of mrsa with presumptively livestock - associated spa types among all mrsa isolated from admission screenings at the uhm increased from 13% in 2005 to 22.4% in 2008. this proportion is higher than suggested by national german surveillance data [20, 41 ]. it has been confirmed that mrsa cc398 are not only found locally at the uhm, but are frequently isolated from admission screenings in an entire region of northwestern germany [42, 43 ]. the high burden of this mrsa subtype might therefore primarily reflect a regional situation, which could be explainable by the fact that the region involved is the area with the highest pig density (number of pigs / km) in germany (information.medien.agrar e.v., we showed a significant association of the spa types t011 and relatives with contact to pigs and cattle. we recognize the limitations (recall bias) inherent within this study type and state that our findings, which represent correlation data, are not suitable for proving a direct transmission of mrsa between animals and humans. however, we demonstrated that 36% of presumptive livestock - related mrsa carriers lacked classical risk factors hitherto used for admission screening of patients. moreover, carriers of mrsa cc398 in this study comprised younger patient groups who are usually less frequent carriers of mrsa and less frequently associated with classical mrsa risk factors. this raises the question of whether commonly used recommendations for admission screening are convenient to detect patients harbouring livestock - associated strains. therefore, we favour considering adding contact to livestock as a risk factor to the admission screening schedule for hospitals, at least in regions with a high density of farming. otherwise the floodgates for a clonal spread of mrsa cc398 could be opened in these regions. furthermore, efforts of molecular mrsa surveillance and reports on prevalence will fail to reflect the actual epidemiological situation. in the netherlands, current reports show that an adaptation of the on - admission mrsa screening protocol in this manner revealed that 32% of pig - exposed patients admitted to a dutch hospital were colonized by mrsa. this led to a three - fold increase in the local mrsa incidence in a predominantly agriculturally structured region. moreover, our observation that the increase of mrsa cc398 at the uhm was related to the introduction of a new local mrsa search policy performing screening in all patients, irrespective of risk factors, emphasizes the importance of the risk patient definition for the identification of these isolates. this is highlighted by the threat that continuous introduction of mrsa cc398 to the hospital setting, might cause nosocomial spread to patient groups with underlying comorbidities and thereby facilitate infections. this threat has recently been increased by the first nosocomial outbreak of mrsa st398 in a dutch hospital. apart from giving impetus to antimicrobial resistance import to hospitals, colonization with mrsa cc398 might set livestock - exposed persons under risk of developing severe s. aureus cc398-associated infections [21, 46 ]. first, this highlights the special need to consider mrsa as causative agents when treating such patient groups. second, it raises the question as to whether the implementation of preventive measures (consequent alcoholic hand disinfection, wearing of gloves and prevention of dust inhalation) could forestall mrsa colonization of livestock - exposed workers. in conclusion, our findings confirm that mrsa associated with spa type t011 and relatives can be found on german pig farms and indicate that livestock might represent a relevant source for mrsa imports to hospitals. | the aim of this study was to evaluate the prevalence and molecular characteristics of methicillin - resistant staphylococcus aureus (mrsa) among pigs and estimate the impact of this animal reservoir on human healthcare. nasal swabs were derived from 1,600 pigs at 40 german farms. the mrsa were characterized using s. aureus protein a (spa) typing, multilocus sequence typing (mlst) and detection of toxin genes. in a retrospective case control study, we compared risk factors for the carriage of mrsa between patients carrying spa types found among regional pigs and patients with other mrsa molecular types. pigs carrying mrsa were identified on 70% of the farms (spa types t011, t034, t108, t1451 and t2510, all associated with mlst sequence type st398). contact to pigs and cattle were independent risk factors for the carriage of these spa types in patients at hospital admission. our results indicate that livestock represents a relevant reservoir for the import of mrsa into regional german hospitals. |
within influenza viral particles, the intricate balance between host cell binding and sialic acid receptor destruction is carefully maintained by the hemagglutinin (ha) and neuraminidase (na) glycoproteins, respectively. a major outstanding question in influenza biology is the function of a secondary sialic acid binding site on the na enzyme. through a series of brownian dynamics (bd) simulations of the avian n1, human pandemic n2, and currently circulating pandemic (h1)n1 enzymes, we have probed the role of this secondary sialic acid binding site in the avian n1 subtype. our results suggest that electrostatic interactions at the secondary and primary sites in avian na may play a key role in the recognition process of the sialic acid receptors and catalytic efficiency of na. this secondary site appears to facilitate the formation of complexes with the na protein and the sialic acid receptors, as well as provide ha activity to a lesser extent. moreover, this site is able to steer inhibitor binding as well, albeit with reduced capacity in n1, and may have potential implications for drug resistance or optimal inhibitor design. although the secondary sialic acid binding site has previously been shown to be nonconserved in swine na strains, our investigations of the currently circulating pandemic h1n1 strain of swine origin appears to have retained some of the key features of the secondary sialic acid binding site. our results indicate possible lowered ha activity for this secondary sialic acid site, which may be an important event in the emergence of the current pandemic strain. |
|
hyper - immunoglobulin m syndrome (higm) is a rare heterogeneous group of disorders, 70% of which are due to cd40-ligand deficiency. these patients are susceptible to recurrent sinopulmonary infections and opportunistic infections, especially pneumocystis jiroveci pneumonia. bronchiectasis is characterized by abnormal dilated thick - walled bronchi that are inflamed and colonized by bacteria. after excluding cystic fibrosis, tuberculosis and congenital lung abnormalities on searching the literature for the youngest and only case of higm with bronchiectasis, we could found data of a 7-year - old girl published by montella. to the best of our knowledge, the case described here is the youngest case of higm-1 presenting with bronchiectasis and, possibly, pj pneumonia. a 5-year - old boy, born of consanguineous (4 degree) marriage, presented with complaints of productive cough and right ear discharge since 1 year, fever and respiratory distress for 25 days and oral thrush since 20 days. he had a history of five admissions in various hospitals for pneumonia since the age of 1 year. he also had a history of repeated diarrhea (six to seven episodes every year) since the age of 6 months. antitubercular therapy was given on an empirical basis at the age of 2.5 years, without any significant improvement. two of his elder male siblings died because of recurrent pneumonia and diarrhea at the age of 2 years and 8 years. onset of recurrent pneumonia and diarrhea in both the siblings was at about 8 months of age. on examination, his heart rate was 120/min, respiratory rate was 66/min, spo2 was 91% (on room air) and grade 2 clubbing was present. right side maxillary area tenderness and right ear discharge (yellowish - green) were also noted. his blood counts revealed total leukocyte count -27,000/cc (p75) and the platelet counts and erythrocyte sedimentation rate were normal. arterial blood gas revealed ph -7.32, pco2 -53.1 mmhg, pao2 -60 mmhg and hco3 -26.9 liver function test, renal function tests and coagulation profile were normal. the serum lactate dehydrogenase level (ldh) was raised. on bronchoscopy, the right bronchial tree showed collapse of some sub - segmental bronchi and proximal bronchiectasis. high serum igm level and no detectable serum levels of igg and iga [table 1 ] suggested higm syndrome. his whole blood flow cytometry revealed reduced expression of cd40l (cd154) on activated t lymphocytes after stimulation [table 1 ] thus confirming the diagnosis of higm-1. chest roentgenogram performed 1 month before the admission and at the time of admission showed persistent opacity in the right middle zone. high - resolution computed tomography (hrct) of the chest demonstrated bronchiectatic changes in the right lower lobe, right middle lobe, left lower lobe and lingular lobe [figure 1a and b ]. (a) areas of ground - glass haze and nodular air space lesions in a branching pattern (tree in bud) in the right lower lobe, dilated and thickened bronchi in the left lower lobe, lingular lobe and right middle lobe. (b) ground - glass haze in the right lung with air space lesions in the right lower lobe the patient presented with severe respiratory distress, for which he was put on mechanical ventilation. intravenous (iv) ceftriaxone and cloxacillin were started in addition to nebulizations with 3% saline and chest physiotherapy. on the basis of culture sensitivity (pseudomonas growth) iv liposomal amphotericin b and co - trimoxazole was given in view of probable invasive candidiasis and pj pneumonia, respectively. he did respond to the treatment well, and was discharged in satisfactory condition and is in regular follow - up. he is getting oral co - trimoxazole prophylaxis, ivig therapy (600 mg / kg ever 4 weeks), salbutamol and budesonide inhalation with mdi and spacer and 3% saline nebulization followed by chest physiotherapy at home. x - linked higm syndrome results due to defects in class switch recombination caused by mutations in the cd40 ligand and nuclear factor kb essential modifier (nemo). t cell functions are also affected in both cd40l and nemo deficiency, which explains the associated opportunistic infections. nemo gene defect was ruled out in our case due to the absence of ectodermal dysplasia, mycobacterial infection, osteopetrosis and lymphedema. higm-1 usually presents around 6 - 9 months of age (when maternal antibodies decrease below the protective level) with recurrent sinopulmonary bacterial infections, opportunistic infections and recurrent diarrhea. management of bronchiectasis includes antibiotics, bronchodilators, inhaled steroids, mucolytics and chest physiotherapy, along with treatment of underlying disorder. the goal of therapy is to mobilize secretions and to reduce the infectious and inflammatory load, thereby preventing progression of airway destruction. pj pneumonia is being reported as the presenting feature in about 40% of higm-1 patents. festic. reported elevated ldh in 29 of 30 patients with non - hiv pj pneumonia. the classic presentation of pcp is a bilateral interstitial pattern, which may be characterized as finely granular, reticular or ground - glass opacities. in the described patient, there was markedly elevated serum ldh level with ground - glass haze on contrast - enhanced computed tomography of the chest [figure 1a and b ], suggesting interstitial pneumonitis and hypoxemia suggesting possibility of pj pneumonia. however ; we could not recover pj trophozoites and cysts in the bronchoalveolar lavage, which may be explained by the fact that bal (bronchoalveolar lavage) could only be performed after initial stabilization of the patient and co - trimoxazole was started empirically on the basis of raised ldh level with pneumonia and hypoxemia. appropriate treatment of infections and regular ivig therapy (every 3 - 4 weeks) is considered the mainstay of therapy. boiled drinking water to prevent cryptosporidium infection and co - trimoxazole prophylaxis to prevent pj pneumonia should be given. the only curative treatment currently available for higm-1 is allogeneic hematopoietic cell transplantation (hct). early diagnosis and appropriate management of recurrent / persistent pneumonia in cases of higm-1syndrome may prevent development of bronchiectasis, a serious complication that limits the success of bone marrow transplantation, a definite cure of higm-1 syndrome. | the x - linked hyper - immunoglobulin m syndrome (higm-1) is a rare genetic disorder characterized by elevated serum igm levels and low to undetectable levels of serum igg, iga and ige. these patients characteristically present with recurrent sinopulmonary infections and recurrent diarrhea. they also have high susceptibility for pneumocystis jiroveci (pj) pneumonia. herein, we report a case of hgm-1 in a 5-year - old boy who presented with bronchiectasis and, possibly, pj pneumonia. the diagnosis was established on the basis of clinical features, immune profile, whole blood flow cytometry and history of two male sibling 's death due to recurrent pneumonia and diarrhea. |
the intestinal absorption of the nephrotoxic environmental pollutant cadmium increases markedly when iron stores are depleted. this may be mediated by an up regulation of the recently identified mucosal transporter dmt1 (nramp2 or dct1) for divalent cations. we tested whether the highly increased iron absorption in hereditary hemochromatosis (hh) was accompanied by an enhanced absorption of cadmium and lead. cadmium and lead in blood and iron status markers were determined in 21 nonsmoking subjects with hh genetically tested for the hfe mutations and in 21 nonsmoking controls matched for age and sex. in subjects with hh on maintenance phlebotomy treatment, blood concentrations of cadmium, but not lead, were significantly higher than in paired controls. there was a strong age - independent positive association between blood cadmium and the number of years of phlebotomy treatment. blood lead showed a similar but less pronounced consequence of treatment. all hh subjects with lower blood cadmium than the corresponding controls had either no mutation in the hfe gene, were not phlebotomized, or were phlebotomized for only a limited time. our findings indicate that the treatment rather than the disease increased the cadmium uptake in homozygous hh. further studies are needed to confirm whether the disease decreased cadmium absorption and whether the absorption was dependent on the genotype.imagesfigure 1figure 2 |
|
excessive sweating is a medical condition in which a person sweats much more than needed. the medical name of this disorder is hyperhidrosis known as a common dermal problem that affects people of all ages and leads to negative impact on the quality of life. during the last decades, several studies have shown that in many cases of hyperhidrosis there is no evidence of systemic disease. therefore, most treatments are temporary and symptomatic therapy. according to iranian traditional medicine (itm), this study has reviewed itm textbooks, such as canon of medicine and exir - e - azam as well as scientific references and databases of modern medicine (isi, pubmed, etc.) with specific keywords. in modern medicine, hyperhidrosis has been defined as an abnormal excessive sweating, which is either primary (idiopathic) or secondary to other systemic diseases such as hyperthyroidism, neurological condition or heart disease. current modalities for treatment are topical anti - perspiration, iontophoresis, botox injection (botulinum toxin type a) and eventually thoracic sympathectomy as the last therapeutic modalities. from the viewpoint of the iranian traditional medicine as a holistic doctrine, hyperhidrosis etiologies include overfilled and repletion of body due to the accumulation of humors, excessive intake of food, excessive dilated skin pores, vigorous exercise, or physical activity. therefore, therapeutic plan for hyperhidrosis was based on its cause, which includes reduction in the amount of food, increasing physical activity, purging the body from the excess humors and adjustment in temperament. hyperhidrosis is not an important or dangerous disorder ; however, due to the negative impact on quality of life and failure to achieve perfect answer in modern medicine treatments it seems that the recommendations of iranian traditional medicine will be helpful to control this disorder. | background : excessive sweating is a medical condition in which a person sweats much more than needed. the medical name of this disorder is hyperhidrosis known as a common dermal problem that affects people of all ages and leads to negative impact on the quality of life. during the last decades, several studies have shown that in many cases of hyperhidrosis there is no evidence of systemic disease. therefore, most treatments are temporary and symptomatic therapy. according to iranian traditional medicine (itm), different approaches are mentioned for hyperhidrosis.methods:this study has reviewed itm textbooks, such as canon of medicine and exir - e - azam as well as scientific references and databases of modern medicine (isi, pubmed, etc.) with specific keywords. contents and related concepts were classified and results prepared.results:in modern medicine, hyperhidrosis has been defined as an abnormal excessive sweating, which is either primary (idiopathic) or secondary to other systemic diseases such as hyperthyroidism, neurological condition or heart disease. current modalities for treatment are topical anti - perspiration, iontophoresis, botox injection (botulinum toxin type a) and eventually thoracic sympathectomy as the last therapeutic modalities.from the viewpoint of the iranian traditional medicine as a holistic doctrine, hyperhidrosis etiologies include overfilled and repletion of body due to the accumulation of humors, excessive intake of food, excessive dilated skin pores, vigorous exercise, or physical activity. therefore, therapeutic plan for hyperhidrosis was based on its cause, which includes reduction in the amount of food, increasing physical activity, purging the body from the excess humors and adjustment in temperament.conclusion:hyperhidrosis is not an important or dangerous disorder ; however, due to the negative impact on quality of life and failure to achieve perfect answer in modern medicine treatments it seems that the recommendations of iranian traditional medicine will be helpful to control this disorder. |
paraneoplastic syndromes (ps) represent a heterogeneous group of disorders that reflect the remote effects of cancer arising in any specific organ system. some ps affect the nervous system and may precede the detection of the actual cancer by months or even years ; they can also be indicative for the specific site of the primary cancer. subacute cerebellar degeneration of paraneoplastic origin occurs in approximately two thirds of female patients aged = 50 years. paraneoplastic cerebellar atrophy (pca) is a rare syndrome that is mainly observed in patients with gynecologic cancers and is characterized by widespread loss of purkinje cells. clinically, patients may present with predominant or isolated gait ataxia and evidence of truncal and hemispheric cerebellar dysfunctions such as diplopia, vertigo, lack of coordination, dysarthria and nystagmus. pca can precede or follow the diagnosis of cancer and has been described in patients with malignancies of the breast, ovary, endometrium or fallopian tube [1, 3 ]. purkinje cell degeneration is associated with circulating anti - purkinje cell antibodies (anti - yo). interestingly, in gynecologic cancer patients with cerebellar degeneration, tumor cells express the corresponding purkinje cell antigens. here, we report a case of a patient in whom cerebellar ataxia led to the diagnosis of a multifocal recurrent low - grade endometrial stromal sarcoma (ess) with sex - cord elements following a disease - free period of 16 years. a 66-year - old patient was referred to our neurology department with a 3-year history of slowly progressing gait ataxia, truncal imbalance, blurred vision due to saccadic eye movements, horizontal and vertical gaze - evoked nystagmus (fig. sixteen years prior to this admission, the patient underwent an abdominal hysterectomy with bilateral salpingo - oophorectomy (bso) for a symptomatic fibroid uterus. postoperative follow - up and annual screening exams were uneventful, and the patient took estrogen - based hormone replacement therapy (hrt). on admission, an mri scan of the brain showed a cerebellar atrophy mainly involving the upper vermis (fig. 2b). on ct scans of the chest and abdomen, bilateral pulmonary and subpleural metastases infiltrating the eighth and ninth thoracic vertebrae were observed (fig. the cerebrospinal fluid contained 2 leukocytes/l, was negative for malignant cells and oligoclonal bands, and showed a normal protein content and a normal igg index of 0.4. investigations on vitamin e, neurotropic viruses and bacterial agents were negative. in order to determine the tumor entity leading to the pulmonary and bone metastases, a ct - guided biopsy of the pulmonary lesions was performed, showing that the lesions were metastases of the formerly diagnosed low - grade ess, again containing sex - cord elements (fig. cells were expressing cd10, had a low mitotic rate with 6 mitoses/10 hpf, and 80% were expressing estrogen receptor and 10% progesterone receptor. screening for the antineuronal antibodies anti - hu, anti - ri, anti - yo, anti - cv2, anti - antiphysin and anti - ma2 in the patient 's serum by igg immunoblotting showed no significant result. nevertheless, due to the patient 's cerebellar dysfunction combined with the cerebellar atrophy, we performed an additional immunohistochemical staining which also disclosed no affinity of the patient 's serum to paraffin sections of human cerebellum, excluding the presence of anti - hu and anti - yo cerebellar antibodies. owing to the clinically suspected paraneoplastic origin of the cerebellar atrophy, the slight progression of the metastases within 4 months as evident on a follow - up ct scan of the lungs, and the unlikely response to chemotherapy due to a low proliferation index, the decision of the interdisciplinary tumor board was to perform surgical debulking in order to remove all evident sites of tumor recurrence. in a first operation, a left inferior lobectomy and a mediastinal node dissection were performed, removing 3 metastases up to 6 cm in diameter and 44 negative lymph nodes. synchronously, a subpleural metastasis infiltrating the eighth and ninth thoracic vertebrae was removed, with residual macroscopic disease requiring postoperative focal radiation therapy. four weeks later, after an uneventful postoperative course, 3 wedge resections of the right superior, middle and inferior lobe as well as a lymph node dissection were performed, removing 7 metastases up to 3 cm in diameter and 5 negative lymph nodes. the patient was discharged at day 10. in the first follow - up visit after the radiotherapy, she complained of shortness of breath in consequence of the reduced total lung volume. she was counselled to quit her hrt and was prescribed anastrozole as adjuvant therapy with the intention to delay further recurrence. after 3 months of follow - up, she is now without evidence of tumor. on repeated neurological examination, there was a virtually complete resolution of ataxia, but the oculomotor abnormalities persisted (fig. our patient presented with clinical signs of slowly progressing ataxia which prompted us to a broad search, including for a neoplastic cause. in fact, we found prominent thoracic metastases of an ess which had been treated with hysterectomy 16 years earlier. in accordance with a ps ess together with benign endometrial stromal nodules represent a subgroup of endometrial stromal tumors derived from uterine mesenchymal tissue (who classification 2003) and are composed of cells resembling the endometrial stroma in its proliferative phase. they are rare, accounting for only 6 - 20% of all uterine sarcomas and 0.2% of all uterine malignancies. tumors previously termed high - grade ess are now called poorly differentiated or undifferentiated uterine sarcomas, whereas low - grade tumors are still labelled ess according to the current definition. recently, the international federation of gynecology and obstetrics (figo) introduced a new classification and staging system in which leiomyosarcomas and ess, due to their similar biology, are classified in 1 staging group (figo 2009). both ess and esn may contain so - called sex - cord elements, first reported by clement and scully, and have been divided into 2 groups : ess with sex cord - like elements (estscle) and uterine tumors resembling ovarian sex - cord tumors (utrosct). for utrosct, sex - cord differentiation is dominant or complete (> 50%). estscle contain focal sex cord - like areas in a background of an otherwise typical endometrial stromal nodule or ess. they show an earlier tumor spread, have higher recurrence rates and a worse prognosis compared to utrosct. both can be considered as polyphenotypic neoplasias most likely derived from pluripotent mesenchymal progenitor cells. accordingly, the tumor of the patient in this report can be classified as estscle. they may present with vaginal bleeding, abdominal pain, or an enlarged uterus which can be misinterpreted as a fibroid uterus. since the endometrium is also involved in most cases, curettage can lead to the correct diagnosis. ess show an indolent growth and recur even at early stages in 36 - 56% of cases [6, 9 ]. recurrences have been reported from 3 months to 23 years after the initial diagnosis, but the median time to recurrence ranges between 65 (stage 1) and 9 months (stages 3 and 4), respectively, so that long - term follow - up is mandatory. ess show a considerably benign biology as indicated by 5-year survival rates of 62 - 93%, depending on stage and differentiation. sites of recurrence are mainly the pelvis or other intraperitoneal locations, but distant metastases, as in our case, are frequently located in the lungs. due to the rarity of these tumors, information is only available from case reports ; general treatment recommendations or guidelines based on prospective studies do not exist. recently, amant. have given a comprehensive overview of current treatment options. a preoperative noninvasive staging using ct or mr imaging can detect metastatic spread and is mandatory for correct staging. total hysterectomy in combination with bso and careful abdominal exploration is commonly accepted as treatment of choice for early - stage cases confined to the uterus (stage i - ii). since most ess express hormone receptors, bso appears to be a logical treatment for a hormone - sensitive tumor. however, its actual benefit has not been demonstrated, as some studies could not find a survival difference in women with ess treated with or without bso, so that especially in young women with small tumors some authors recommend an individualized approach. although lymph node involvement can already be found at early stages in approximately 6 - 9% of patients, a routine systematic pelvic and periaortic lymph node dissection does not appear to provide a survival benefit ; thus, only suspicious or enlarged nodes should be removed under the aspect of cytoreduction [11, 12 ]. retrospectively, the patient presented in our report underwent standard initial surgery including total hysterectomy and bso. considering the generally benign course of the disease, in cases of recurrence repeated surgeries aiming to remove all manifestations are also a viable treatment option. as ess expresses both estrogen and progesterone receptors, some authors suggested that adjuvant - targeted hormonal treatment with either progestins [e.g. medroxyprogesterone (250 mg / d) or megestrol (160 mg / d) ] or aromatase inhibitors can reduce recurrence rates [12, 13 ]. sequential administration of progestins (megestrol acetate) followed by an aromatase inhibitor (letrozole or anastrozole) has also been reported to stabilize or improve the course of the disease. however, there exist no prospective studies investigating adjuvant hormonal treatment for ess ; additionally, there is no consensus regarding the treatment duration or the potentially additional effect of bso. speculate in their small case series that estrogen replacement after the diagnosis of ess might be associated with a poor outcome. chemotherapy should be reserved for hormone receptor - negative cases, cases with progression or recurrence under progestin or aromatase inhibitor therapy, or those cases progressing into a high - grade malignancy. combined adjuvant chemotherapy with cisplatin and adriamycin has been shown to improve the survival rate in high - risk patients. in a previous gog study, also ifosfamide (1.5 g / m on days 15 every 3 weeks) was effective in the therapy of women with chemotherapy - nave, metastatic or recurrent ess, with an overall response rate of 33.3%. additionally, combinatory chemotherapies containing ifosfamide 2 g / m, epirubicin 40 mg / m and cisplatin 60 mg / m, or doxorubicin 50 mg / m and ifosfamide 5 g / m/24 h every 3 weeks were shown to lead to a clinical response in metastatic disease. due to the rarity of these tumors, information is only available from case reports ; general treatment recommendations or guidelines based on prospective studies do not exist. recently, a preoperative noninvasive staging using ct or mr imaging can detect metastatic spread and is mandatory for correct staging. total hysterectomy in combination with bso and careful abdominal exploration is commonly accepted as treatment of choice for early - stage cases confined to the uterus (stage i - ii). since most ess express hormone receptors, bso appears to be a logical treatment for a hormone - sensitive tumor. however, its actual benefit has not been demonstrated, as some studies could not find a survival difference in women with ess treated with or without bso, so that especially in young women with small tumors some authors recommend an individualized approach. although lymph node involvement can already be found at early stages in approximately 6 - 9% of patients, a routine systematic pelvic and periaortic lymph node dissection does not appear to provide a survival benefit ; thus, only suspicious or enlarged nodes should be removed under the aspect of cytoreduction [11, 12 ]. retrospectively, the patient presented in our report underwent standard initial surgery including total hysterectomy and bso. considering the generally benign course of the disease, in cases of recurrence repeated surgeries aiming to remove all manifestations are also a viable treatment option. as ess expresses both estrogen and progesterone receptors, some authors suggested that adjuvant - targeted hormonal treatment with either progestins [e.g. medroxyprogesterone (250 mg / d) or megestrol (160 mg / d) ] or aromatase inhibitors can reduce recurrence rates [12, 13 ]. sequential administration of progestins (megestrol acetate) followed by an aromatase inhibitor (letrozole or anastrozole) has also been reported to stabilize or improve the course of the disease. however, there exist no prospective studies investigating adjuvant hormonal treatment for ess ; additionally, there is no consensus regarding the treatment duration or the potentially additional effect of bso. speculate in their small case series that estrogen replacement after the diagnosis of ess might be associated with a poor outcome. chemotherapy should be reserved for hormone receptor - negative cases, cases with progression or recurrence under progestin or aromatase inhibitor therapy, or those cases progressing into a high - grade malignancy. combined adjuvant chemotherapy with cisplatin and adriamycin has been shown to improve the survival rate in high - risk patients. in a previous gog study, also ifosfamide (1.5 g / m on days 15 every 3 weeks) was effective in the therapy of women with chemotherapy - nave, metastatic or recurrent ess, with an overall response rate of 33.3%. additionally, combinatory chemotherapies containing ifosfamide 2 g / m, epirubicin 40 mg / m and cisplatin 60 mg / m, or doxorubicin 50 mg / m and ifosfamide 5 g / m/24 h every 3 weeks were shown to lead to a clinical response in metastatic disease. ps of the nervous system may accompany malignant tumors and require early identification and effective treatment of the underlying neoplasm. cerebellar degeneration and its concomitant symptoms have been associated with various gynecologic malignancies and therefore require increased awareness of both neurologists and gynecologists. we showed that pca can also occur in combination with late recurrent ess. | we report a 66-year - old woman with slowly progressive ataxia due to cerebellar atrophy. imaging studies revealed multiple lesions in both the lungs and dorsal subpleural space. a biopsy identified the lesions as metastases of a low - grade endometrial stromal sarcoma containing sex - cord elements. the histological appearance was identical to a uterine tumor the patient was treated for with hysterectomy 16 years before. the metastases were removed surgically, and after 3 months ataxia had regressed. we conclude that the presenting cerebellar degeneration in this patient resulted from the metastatic recurrence of the endometrial tumor. |
. they can be either pedunculated or sessile and are more common in the extremities. we present a case of 18 year female, who came with a swelling in right groin since 2 years which was diagnosed to be osteochondroma on x - ray and magnetic resonance imaging. excision biopsy was done as the patient wanted it to be removed for cosmetic purpose and confirmed it to be non - malignant osteochondroma. thus osteochondroma of the pelvis should be kept in mind as a differential diagnosis when evaluating mass in pelvis.. they can be either pedunculated or sessile and are more common in the extremities, i.e. distal femur, proximal tibia and proximal humerus in decreasing order. indications for excision are cosmetic deformity, pressure symptoms on neuro - vascular bundle or malignant transformation to chondrosarcoma which is rare. osteochondroma of the pubic ramus is rare entity and the actual incidence is not known. it can present as a solitary lesion or as a part of multiple hereditary exostosis. pelvic osteochondromas can present as compressive neuropathy or compressive symptoms on urethra, bladder or other vital structures and so on. on the contrary a pubic bone mass may need to be removed in young females which might be prominent at labia for cosmetic reasons as in our case. an 18 year female came to the out - patient department with complaints of swelling in right groin since 5 years which was insidious in onset, small in size initially but grew over last 5 years and was noticeable to the patient., there was a bony hard swelling 3 5 cms in size in the groin at the pubic tubercle of the right side. plain x - ray s of pelvis ap, inlet and outlet view (fig.1 to 3) and magnetic resonance imaging (fig 4 & 5) showed bony growth of 543746 mm in size in transverse, craniocaudal and anteroposterior dimension which was arising from right superior pubic ramus and was extrapelvic in situation with a cartilage cap of 4 mm. 6) was taken and as the soft tissue was retracted cartilage cap of the osteochondroma was seen (fig. manual palpation was done and one more piece was found which was then excised (fig. 9). inguinal ligament was closed in layers maintaining the external iliac ring with continuous sutures to prevent future inguinal hernia (fig. osteochondromas are benign tumors which have an unknown etiology. it is considered as a developmental physeal abnormality rather than a primary bone neoplasm. a few theories have been suggested which include virchow theory, muller theory, keith theory, and a few more. the most common sites are metaphysis of long bones like distal femur, proximal tibia and proximal humerus. osteochondromas can also be found as a part of multiple hereditary exostosis which is thought to be associated with ext1 and ext 2 gene. osteochondromas are as such an incidental finding in patients and only a few are symptomatic. it is usually present in growing age and the growth of the mass stops after skeletal maturity. various studies have mentioned about the size of cartilage cap as a predictor for malignancy with a cartilage cap of more than 2 cm after skeletal maturity indicative of malignant transformation. pre operative investigations and planning in patients presenting with a bony neoplasm must be done. pre - operative x - rays and mri were done for our patient to see the extent and measure the cartilage cap of the osteochondroma. pelvic osteochondroma involving ilium has been reported in literature which caused nerve root compression and had to be removed. osteochondroma of the pubic symphisis has been reported which was removed due to bladder outlet obstruction. thus with a thorough search in literature we concluded that it is a rare entity and it was diagnosed due to the compressive symptoms caused by it. here in our case the swelling near the private part was the cause for the patient to seek medical help. there were no compressive symptoms either on vessels or on urinary tract which was confirmed by arterial doppler and micturating cysto - urethrography. a similar case was reported by qaisrani gh and associates which was also present on superior pubic ramus and was removed for cosmetic deformity. complete en - bloc removal of the mass was done in our case for cosmetic reasons and she is being followed up regularly. even after 1 year there has not been any recurrence of the lesion. benign osteochondromas are usually incidental findings and are removed most commonly for cosmetic purposes with a very low incidence of recurrence if removed after skeletal maturity. also pelvic osteochondromas are rare entity but it has to be kept in mind for any bony mass when looking for differentials. pelvic osteochondromas are rare entity but it has to be kept in mind for any bony mass when looking for differentials. | introduction : osteochondroma are benign neoplasms which arise from small cartilage nodules within the periosteum. they can be either pedunculated or sessile and are more common in the extremities. they rarely develop in bones like scapula, feet, hands and pelvis. management of the lesion is by en - bloc excision.case report : we present a case of 18 year female, who came with a swelling in right groin since 2 years which was diagnosed to be osteochondroma on x - ray and magnetic resonance imaging. excision biopsy was done as the patient wanted it to be removed for cosmetic purpose and confirmed it to be non - malignant osteochondroma. there has been no recurrence even after 1 year of follow up.conclusion:thus osteochondroma of the pelvis should be kept in mind as a differential diagnosis when evaluating mass in pelvis. also these have to be removed when they pose cosmetic problems. |
as demand for food and energy grows, innovative ways to meet demand while enhancing environmental quality will be needed. anaerobic digesters (ads) can produce renewable energy from livestock manure, prevent the release of methane, and reduce air and water pollution, and digested manure can be applied to crops as a fertilizer.(1) most ads in the u.s. sell electricity and digested manure, but the net present value of most systems is insufficient to promote widespread adoption. placing an economic value on the climate, energy, and environmental benefits that ads provide can help to accelerate their deployment. deployment of renewable energy technologies grows under climate policy compared to business - as - usual.(4) although support for ads in the u.s. has been limited,(5) countries such as china,(6) india,(7) and germany (8) have higher rates of ad adoption, mostly due to government support and financial incentives. the incentives currently available at the local, state, and federal levels in the u.s. have stimulated some ad projects. comprehensive inclusion of the ghg mitigation benefits and low - carbon energy generation of ad projects within a federal climate and energy policy would further enhance prospects for new projects. although economic and environmental models have tested the integration of many renewable energy technologies, a rigorous evaluation of ads within a computable general equilibrium model has yet to be completed. we used an economic model to test the effects of a representative climate stabilization policy on the penetration of ads as a ghg mitigation and low - carbon energy generation technology in the u.s. engineering and life - cycle data were used to calculate the cost of electricity from a typical ad system. spatially explicit livestock density maps(13) and state - level methane emissions data(14) were used to estimate potential electricity generation capacity and emissions reductions from livestock manure. the climate policy scenarios simulated in the economic model included a reference case and an emissions reduction of 50% below 2005 levels by 2050.(4) as carbon dioxide equivalent (co2e) emissions prices increased under more stringent caps, ad systems became competitive, in part, because of additional credits for methane mitigation. unlike most other low - carbon energy sources, ads deliver additional nonmarket environmental benefits. the mit emissions prediction and policy analysis (eppa) model was used to test a range of scenarios to quantify the economic and environmental responses to the introduction of ads. eppa is a recursive dynamic, multiregional, multisector computable general equilibrium model that simulates the world economy.(30) the model has been applied to a range of policy - relevant topics including energy legislation, health,(32) biofuels,(9) agriculture,(33) and alternative energy technologies.(34) in this study, we compared the impacts of three scenarios on the use of electricity from ads as a substitute for more carbon - intensive sources. anaerobic digesters are introduced into the model as a low - carbon alternative technology, in which the electricity produced competes with traditional electricity sources based on the levelized cost of electricity (lcoe) across sources with additional consideration of intermittency and experience with technology.(35) the lcoe takes into consideration the capital, operations, and fuel costs of electricity produced over the lifetime of the plant.(12) with no climate policy in place, alternative electricity generation technologies such as solar and wind power are one to four times more expensive than fossil - fuel - based generation.(12) we compare three scenarios in eppa to gauge the impact of ads under climate legislation. the first, or reference scenario, assumed no climate policy. the policy scenarios described in refs (4) and (31) cover the range of recent congressional proposals and are referred to by the cumulative number of ghg emission allowances each policy issues between 2012 and 2050. the policy specified an economy - wide emissions cap on all ghgs beginning in 2010. the 2010 cap was 95% of 2005 emissions in 2010 and was progressively lowered to 50% of 2005 emissions by 2050. version 5 of eppa disaggregates the agricultural sector into separate crop, livestock, forestry, and biofuels production structures as described by ref (36). we modified the model to include livestock manure output and separate livestock production into traditional livestock, for which manure is treated as a byproduct, and livestock for which manure can potentially be used in ads. detailed changes to the model are described in the supporting information (si) methods and figure s1. livestock within the new production function is eligible for offsets from reduced emissions of methane, and income from the sale of electricity. the ad production structure employs capital, labor, and intermediate inputs from other industries to produce electricity (figure s1). ads enter endogenously in eppa when they become economically competitive with other forms of generation. similar to other technologies within eppa, ads are parameterized using bottom - up engineering, life cycle and fuel cost data.(11) there are several types of ads currently in use that range in size from 50 to 2800 kw (n = 55, mean = 573).(37) acknowledging that there are several digester designs that operate best with certain feedstocks or in certain geographies, we based our analysis on capital cost data from horizontal plug flow ads, as the most data were available from this technology.(37) the lcoe from ads is determined by two factors : capital costs and transportation costs. ads exhibit capital cost trends similar to other energy generation technologies : larger, centralized units are less expensive to operate per unit of energy produced.(38) data collected by epa agstar on generator capacity and capital costs exhibit a power law relationship (r = 0.911).(39) we assumed that each system had a postdigestion solids separation system and hydrogen sulfide (h2s) treatment at an added cost of 9.5% of capital costs.(39) although centralized ads might be less expensive to operate, there are additional logistical and coordination factors that need to be considered for optimal day - to - day management. there are currently more centralized ads outside the u.s. as ad size increases, the amount of manure needed to supply the generator increases proportionally. large ad systems often require manure inputs from several farms in order to take advantage of lower capital costs per kwh for larger generator systems. we assumed that the manure input from multiple sources was optimized for total solid content, ph, and other physical characteristics important to the digestion process. the cost of hauling large amounts of manure can be a significant portion of the final lcoe. in this study, we represent the trade - off between low capital cost with high transportation cost of larger systems, and high capital cost with low transportation cost of smaller systems, by including 1000, 500, and 250 kw ads and spatially grouping manure resources according to system size. for each system, we assumed that 50% of the manure was available on - site, while the other half was transported via truck.(42) we further assumed that biogas was combusted on - site at 40% thermodynamic efficiency, and the electricity generated was sold to a utility at market prices averaged across users and states. waste heat collected from the generator was used to maintain the digester within the mesophilic temperature range (38 c). we assumed that digested manure was used as a fertilizer substitute, but not given an economic value. lcoe values for each digester size were computed using the methods described in ref (12) with operations and maintenance assumed to be 3% of capital costs (table s2). manure availability was estimated using spatially explicit maps of livestock density, manure production and management parameters, and identification of areas with high manure densities. gridded densities of cattle, pigs, and poultry available at 0.05 spatial resolution (5 km) adjusted to match faostat 2005 national totals for the u.s. were used to estimate livestock populations.(13) reference (14) provided state - level parameters on the excretion rate of volatile solids, maximum methane producing capacity, and typical animal mass needed to calculate methane production for dairy cattle, beef cattle, swine, and poultry in each state. the u.s. department of agriculture national agricultural statistics service quickstats database(47) provided a breakdown of state swine and poultry data by animal type, while the cattle enteric fermentation model(48) provided the distribution of cattle types. it was assumed that all manure was available for digestion, except manure from animals managed in pastured systems, as manure collection would be uneconomical under current conditions. given these data, statewide coefficients for methane production potential were computed for each livestock group over the contiguous u.s. to determine the manure input for a typical ad, the proportion of potential methane for each livestock type was used to compute the percentage of manure input into a typical digester. using ref (14) manure management data, average methane emissions from livestock manure not diverted to an ad were calculated as the potential project offset value. to assess the full lcoe of ads, costs for digesters that transport manure from off - site given the gridded methane production potential, clusters were identified that met the minimum amount of methane needed for a given digester size and were contained in the smallest number of contiguous grid cells. the arcgis spatial order tool constructed a peano curve over the input data set to quantify the proximity of a given cell to its neighbors. next, the arcgis collocate tool grouped points based on the spatial order value until a specified threshold of methane production potential was met. clusters of grid cells less than 900 km in area were identified as areas compact enough to support an ad without excessive manure hauling costs. remaining clusters were separated into groupings less than 225, 400, 625, and 900 km, and it was assumed that each cluster was square and manure densities were higher in cells closer to the central cell (where the ad would be located). transport distances were calculated by summing the distance of every cell to the central cell. transport costs for each cluster size were computed with distance - cost hauling relationships from refs (40 and 49). we first identified clusters of grid cells that met the biogas requirements of a 1000 kw ad and were within a reasonable transportation distance (900 km), and the remaining cells were recursively analyzed to identify clusters that met the biogas production potential threshold for 500 and 250 kw ads. for ads of each size, we determined the lcoe by calculating the weighted average of ad clusters from each of the four transportation distance categories. we assumed that manure located near an ad of a particular size could not be used in an ad of a different size. this approach is suitable for determining the potential methane production potential across a region, but has limitations for siting a specific ad. over two billion cattle, swine and poultry in the u.s. produce manure that can be diverted to ads to produce energy and then used as fertilizer. our estimates show that manure collected and deposited in lagoons or pits currently has the potential to produce 11 000 megawatts (mw) of electricity, while manure from pastured animals could produce an additional 7000mw with modified collection practices. in our core scenarios, only manure collected and stored in lagoons or pits, and not pasture manure, is available for use in ads. the greatest density of manure available for ads is located in the southeast, midwest, and western regions, and 14% of electricity demand in iowa and nebraska could potentially be met by ads. readily available manure resources can contribute over 11 000 mw of electricity generation potential. each colored grid cell is included in a cluster less than 900 km that can support an ad of a given capacity. electricity cost for each cluster is based on ad capital costs and manure transportation costs. ad electricity generation is initially uncompetitive with conventional electricity but enters as the cost of conventional electricity rises. economies of scale for ads, and variable distances between manure sources and ads, result in a range of generation costs for electricity from manure. we first identified three potential ad sizes based on manure density : 1000, 500, and 250 kw. we estimate that, ignoring transport costs, a 1000 kw ad is able to produce electricity at $ 0.086/kwh, while a 250 kw ad is 58% more expensive at $ 0.136/kwh. the cost to transport manure ranges from 30 to 53% of total electricity cost (capital + transportation cost), based on digester size and transportation distance. transportation costs are $ 0.060/kwh for the smallest (225 km) and $ 0.096 for the largest (900 km) clusters. total electricity costs range from $ 0.128/kwh to $ 0.204/kwh, which is 1.52 to 2.44 times the cost of conventional electricity in the base year (2004) of our modeling framework. electricity from ads competes with electricity from traditional sources based on generation costs. under a climate policy that includes emissions from all sectors, electricity from fossil fuels becomes more expensive, and renewable and low - carbon electricity sources become more competitive. we consider a policy where between 2010 and 2050 the emissions cap is progressively reduced. under the cap, the price per tonne of emissions increases to $ 316/tco2e (figure 3a, table s3) by 2050. this co2e price is much higher than prices currently observed in the e.u., but is consistent with other studies that consider emission limits that decrease over time.(50) co2e prices increase faster in the later years of the scenario, as more costly emission reductions are put into place. there is a sharp increase in the co2e price after 2045, as prior to this date the cap is largely met by switching electricity generation from coal to gas, but more radical measures are required to meet the cap after this date. the availability of ads reduces co2e prices by $ 42 in 2050 relative to when ads are not available, since ads are able to produce energy less expensively than other low - carbon energy technologies and reduce agricultural methane emissions. by 2050, relative to a scenario with climate policy without ads, ads displace electricity from natural gas combined cycle (0.1 petawatt - hours, pwh) and wind (0.03 pwh) in 2050. simulated u.s. note : advanced fossil includes natural gas combined cycle (ngcc), ngcc with sequestration, integrated gasification with combined cycle and sequestration, and wind with gas backup. changes in reference and policy scenarios until 2050 for (a) carbon prices, (b) economic welfare, (c) livestock greenhouse gas emissions, and (d) greenhouse gas mitigation (there is a net increase in ghgs from electricity production between 2020 and 2025 when ads displace expensive, low - carbon). under the climate policy, ads are first introduced in 2025 when the price of co2e is $ 76/tonne and electricity is $ 0.15/kwh. in the first year ads are economically available, assuming that potential ad electricity generation is maximized, they produce 0.1 pwh of electricity, which is 2.6% of national electricity generation. in 2050, ads contribute 0.24 pwh of electricity, or 5.5% of national generation (figure 2, figure s2). this increase is mainly driven by the expansion of the livestock sector, but the introduction of more costly ad electricity generation as the price of electricity increases also plays a role. compared to the climate policy scenario without ads, the livestock sector grows faster when ads are available, as increased profits from electricity sales and methane mitigation credits are realized. as carbon prices rise, the cost to produce electricity from ads becomes competitive with other electricity generating technologies and ad market penetration increases. the least expensive electricity is available from 1000 kw ads, which enter in 2025. electricity production from 500 kw and 250 kw begins in, respectively, 2035 and 2040. changes in consumer welfare, measured as equivalent variation changes in annual income, are often used as an indicator to measure the economic effects of a policy.(51) not accounting for climate benefits, welfare under climate policy (without ads) decreased by 3.5% relative to the reference scenario in 2050 (figure 3b). when ads were included, welfare increased by 0.2% ($ 33 billion), as they provided an additional mitigation option. this indicator of consumer welfare measures only changes due to the cost of ghg mitigation, and does not take into account potential social and environmental benefits of implementing this technology. manure collected and managed under anaerobic conditions releases methane, a potent ghg. by diverting the manure to ads, an opportunity to capture and combust enables livestock operations to sell emissions permits, thereby increasing the economic viability of the projects. by 2050, ads are able to mitigate 151 million metric tons (mt) of co2e, mostly from methane abatement (figure 3c, table s3). in the reference scenario, the livestock sector emits 477 mt co2e of methane in 2050, which is reduced to 250 mt co2e under a climate policy without ads as technologies are used to mitigate livestock emissions. if electricity from ads displaces an electricity generation technology with higher emissions intensity per unit of electricity, then additional ghgs are mitigated. in 2050, 31 this was mainly due to a decrease in electricity generation from natural gas - combined cycle (ngcc) and under the emissions cap, economy - wide emissions remained constant. interestingly, ads do not necessarily displace high - carbon electricity production, such as coal. in our framework electricity generation sources the electricity mix is determined endogenously so as to minimize the cost of meeting the emissions cap. when ads are available (and are profitable), ads reduce the co2 price, which reduces the costs of electricity from high - carbon sources, relative to when ads are not available. our results demonstrate the potential for climate policy to hasten the use of ads, both to reduce ghg emissions from livestock and to produce renewable energy. by including ads within an economic modeling framework, we illustrated the opportunity for a win win scenario where, by providing incentives for the ghg benefits of digester operation, there are additional nonmarket benefits, even though they were not explicitly incentivized. although capital costs are a major barrier to further introduction of ads, there are opportunities to improve the efficiency of manure collection, processing, and subsequent biogas combustion that would increase the economic competitiveness of the technology. most ad systems are currently installed at livestock operations with existing manure management strategies that may not be optimal for biogas extraction. further research, development, and innovation is needed to design manure collection systems that simultaneously maximize biogas production and animal well - being, while minimizing the release of nutrients and ghgs. siting ads near energy - intensive industries would allow for better utilization of the waste heat from the combustion process. although livestock that spend a majority of their time on pasture were excluded from our core scenarios, financial incentives to produce biogas may spur development of pasture - based manure collection systems that allow for both grazing and manure collection. these systems would realize both the environmental and animal welfare benefits of pasturing animals, and the economic benefits of biogas production. the assumptions and core data that are the backbone of eppa are routinely updated to the latest state of the science (si and refs (4 and 31). while we parameterized the model with values from the literature, and conducted sensitivity analyses, many social, economic, and environmental trends can not be modeled with certainty far into the future. we assumed that there were no major changes in consumer preferences, but as we move into an increasingly energy and resource constrained future, these assumptions may be optimistic. therefore, less manure may be available for ads in the future than in our estimates. additionally, concern over environmental and health impacts of meat consumption may also reduce future livestock production. although we only considered livestock manure as an input to ads, they can also break down many other forms of organic wastes to produce biogas, often at higher rates of biogas production per unit input than manure, as manure has already been digested by the animal.(54) co - digesting other organic materials with manure can relieve pressure on other waste processing facilities and increase biogas production without greatly increasing the size and capital costs of the digester.(55) several municipalities already collect household food scraps and waste grease, and digestion of these materials could increase ad profitability and further reduce the environmental impact of waste disposal.(56) we derived model parameters for ad ghg mitigation and electricity generation from published sources, but we acknowledge that there remains uncertainty about methane emission rates from livestock under different management practices.(57) even if methane credits increased by 30%, which we considered in a sensitivity analysis, electricity generated by ads only increased by 0.003 pwh in this scenario, and 500 kw ads became economical five years earlier (table s6). improved methods to measure ghg emissions from livestock, e.g. ref (58), will be needed to improve upon currently used generalized emissions models. life cycle assessment is one tool that can be used to assess the release of ghgs and nutrients from a farm that can lead to implementing the most effective mitigation options.(58) even in the absence of a broad climate policy that prices carbon, there are other mechanisms to encourage installation of additional ad capacity. several states have implemented renewable portfolio standards that have driven the adoption of alternative energy sources.(59) germany uses a feed - in - tariff to guarantee competitive prices for energy produced from ads, and is a global leader in biogas production.(54) california s low carbon fuel standard (lcfs) ranks transportation fuels by their life - cycle carbon intensity. for illustration, biogas from dairy ads can be used as a transportation fuel if it undergoes upgrading and compression. it is then comparable to traditional compressed natural gas with one - fifth the carbon intensity because a credit is applied to the biogas owing to decreased methane emissions compared to traditional manure management techniques.(60) some ad projects are intended to reduce other environmental impacts such as nutrient runoff, and ghg emissions may be a secondary concern. ads can provide energy for a single household, as seen in india and china, or up to several thousand households such as in toronto, canada.(61) while the technology is scalable, decisions regarding sites, operations, and sources of digestable material are outside the context of this study. our approach matched digester sizes (1000, 500, 250 kw) to resource density in order to minimize the capital investment and transportation costs per unit of energy generation. while this approximation is useful at a national level, each potential ad project will need to survey the availability and cost of manure and organic materials for codigestion to maximize the environmental and economic efficiency of the project. using a computable general equilibrium model in this context allows us to investigate the interactions among sectors, illustrated here in the novel linkages between agriculture and energy production. while economic welfare decreased across all scenarios relative to the reference, the climatic benefits were excluded from these values, mostly because such calculation will suffer from much greater uncertainty and lack of information than on the cost side. additionally, there are few metrics to quantify nonclimatic environmental benefits from ads and thus these were excluded from the analysis.(62) caution should be used when applying the results of this study to a specific project, since they are estimated across the entire economy and the projected changes in welfare do not include all costs and benefits to society. many of the fuel sources used today have social and environmental impacts that are not accounted for in standard economic transactions. similar externalities exist within the agricultural sector, which will increase as livestock operations expand. implementing a climate policy that places a value on carbon will ease the transition from diverting livestock manure to ads to provide energy. as the external costs of fossil fuel energy are realized throughout the economy, the environmental cobenefits of ad further increase the societal value of avoiding traditional manure management. | livestock husbandry in the u.s. significantly contributes to many environmental problems, including the release of methane, a potent greenhouse gas (ghg). anaerobic digesters (ads) break down organic wastes using bacteria that produce methane, which can be collected and combusted to generate electricity. ads also reduce odors and pathogens that are common with manure storage and the digested manure can be used as a fertilizer. there are relatively few ads in the u.s., mainly due to their high capital costs. we use the mit emissions prediction and policy analysis (eppa) model to test the effects of a representative u.s. climate stabilization policy on the adoption of ads which sell electricity and generate methane mitigation credits. under such policy, ads become competitive at producing electricity in 2025, when they receive methane reduction credits and electricity from fossil fuels becomes more expensive. we find that ads have the potential to generate 5.5% of u.s. electricity. |
strabismus is an important medical condition with a prevalence ranging between 2% and 4% in the general population, which affects the population and causes severe complications.13 in most forms of strabismus, patients motor fusion mechanisms are anomalous or are inadequate for the maintenance of ocular alignment. therefore, eyes inability to work together causes a reduced or absent binocular vision.4 however, in some cases in which the angle of strabismus is very small, the motor fusion amplitudes appear to be normal, whereas sensory fusion mechanisms exhibit pronounced clinical deficiencies. this form of strabismus with very small angles of deviation and relatively high degrees of binocularity has been classified as microstrabismus.59 the onset of strabismus when the visual system is mature can cause diplopia or confusion, while its onset when the visual system is immature can cause cortical suppression and then amblyopia.10,11 stereoacuity testing is an important tool in the evaluation of vision, in order to identify the highest form of binocular coordination that can be assessed. high levels of stereoacuity are thought to influence the acquisition of sensorimotor skills in early childhood. since stereopsis is theoretically reduced in strabismus, this condition should be easily detected by a stereo test.1214 stereoacuity tests have been used in large population - based studies as screening tools to detect strabismus, since these tests are relatively fast, inexpensive, well accepted by both adults and children patients, and easily administrated by nonophthalmologist operators.15 however, so far there is neither general consensus nor internationally approved guidelines concerning the use of stereo tests as a screening tool for strabismus. nowadays, in the clinical practice a combination of different methods, as hirschberg corneal light reflex test, cover testing, worth four - dot test, the 4 prism diopter (pd) base - out test, is used to diagnose strabismus.4,1417 the application of one of these procedures alone may be insufficient to confirm the diagnosis of the disease. the present study was undertaken to assess a challenging method of screening for strabismus, in order to make an early diagnosis of strabismus and therefore to apply an early treatment, either medical or surgical, reaching a better prognosis. our experience revealed that stereo tests are a potentially useful method of screening for strabismus, considering they are easy and fast to perform and well accepted by most patients. a total of 143 caucasian subjects, 74 males (52%) and 69 females (48%), aged between 4 years and 78 years (mean age 19.0915.12 years) were examined at our strabismus service (scientific institute san raffaele hospital, milan, italy) and included in this observational cross - sectional study. in this study, patients were consecutively admitted and the selection of the study group was done according to inclusion and exclusion criteria. subjects recruited in this study were representative of the general population, either affected by strabismus, including microstrabismus (ten patients) and intermittent forms of strabismus (six patients), or healthy volunteers. all patients were thoroughly informed about the purpose of the research, participation was totally voluntary, and informed consent was obtained from all participating individuals. the study protocol complied with the declaration of helsinki. amblyopia was defined as an interocular difference in visual acuity between the two eyes $ 2 lines, using snellen charts, not attributable to any underlying structural abnormality of the eye or visual pathway. these young children could have shown a lack of collaboration that could have influenced the statistical data. all patients underwent both ophthalmological and orthoptic examinations, including stereo tests, hirschberg corneal light reflex test, worth four - dot test, the 4 pd base - out test, cover testing, bruckner test, visual acuity, automated refraction under 1% tropicamide cycloplegia, and also posterior pole evaluation. all patients were tested with all of the four stereo tests most frequently used in europe and italy : lang i, lang ii, titmus, and tno. the tests were administrated in a randomized order, by a unique operator, who appeared to be masked to the results of both ophthalmological and orthoptic examinations. the fail pass threshold was chosen according to the instructions of each test s manual (lang i, lang ii, tno fail pass threshold).14,16 lang i is a stereo test based on a combination of the random - dot technique and cylindrical gratings, consisting of a card measuring 9.5 cm 14.5 cm that contains pictures of a cat, a star, and a car, which represent disparities of 1,200, 600, and 550 seconds of arc, respectively. the test is administrated at 40 cm of distance ; it does not require red / green or cross - polarized filters. incorrect naming or no identification of one or more stereoscopic figures was considered a fail (lang i cut - off). we consider the test negative when patients named dog pointing to the image of the cat. lang ii stereo test is based, as well, on the random - dot technique. it consists of a card measuring 9.5 cm 14.5 cm that contains pictures of an elephant, a car, and the moon, which represent disparities of 600, 400, and 200 seconds of arc, respectively. this stereo test contains a control figure (a star), which is visible monocularly. incorrect naming or no identification of one or more stereoscopic figures was considered a fail (lang ii cut - off). we considered the test negative when patients responded turtle pointing to the car or when the elephant was named as a bear or, we considered only the second (circles) and third (animals) part, with a disparity ranging from 800 to 100 seconds of arc. failure to identify circle number 5 (100 seconds of arc) or animal a, b, or c was considered a fail (titmus cut - off). the tno stereo test was based on the random - dot technique, as in lang i and ii. we examined the first three plates, which represent hidden objects, easily identified by subjects with a good stereopsis. the first three plates are simple test plates with a retinal disparity of 1,900 seconds of arc. the dissociation is given by color instead of cross - polarized filters as in the titmus test. failure to identify just one of the hidden objects in each plate was considered a failure (tno cut - off). a complete ocular and orthoptics evaluation was performed by a second operator, who appeared masked to the results of stereo tests. diagnosis of strabismus was assessed by a combination of cover test, hirschberg corneal light reflex test, worth four - dot test, and 4 pd base - out test.4,1417 the cover test is used to dissociate binocular fusion and determine the full deviation, tropia plus phoria. the hirschberg test, or corneal light reflex test, assesses eye alignment by noting the location of the corneal light reflex within the pupil. with normal orthotropic alignment, the light reflexes are slightly decentered nasally, but they are symmetrically located within each pupil. the worth four - dot test consists of two green lights, one red light, and one white light. another normal response is one red light, two green lights, and one light that flickers between green and red. patients with acquired strabismus and diplopia will see five lights : three green and two red. patients with cortical suppression report seeing either three green lights or two red lights, depending on which eye is fixing.. the results of this test will tell the examiner if there is diplopia or suppression, suggesting a nondiscernible central stereoscopic vision. the association of worth four - dot test with the other two tests allowed us to identify microstrabismus also. in children younger than 10 years (54 patients), the 4 pd base - out test was performed to complete the evaluation. this test consists of placing a 4 pd base - out prism over one eye. in normal subjects, patients without motor fusion and large regional suppression show no movement of either eye when the prism is placed over the nondominant eye and a version movement of both eyes in the direction of the apex of the prism when the prism is placed over the fixing eye. patients with the monofixation syndrome and a small central scotoma usually show no movement when the 4 pd prism is placed over the nondominant eye. refraction measurements were conducted on all subjects included in the study after a pharmacological cycloplegia with the instillation of one drop of tropicamide 1%, three times, 5 minutes apart. the receiver operating characteristic (roc) analysis and the corresponding area under the curve were reported for stereoacuity tests in detecting strabismus. specificity, sensitivity, and both positive and negative predictive values (npvs) were calculated for each stereo test, and the corresponding 95% confidence intervals (cis) were reported. all data were processed using the ibm spss statistics, version 2.0 (spss inc., chicago, il, usa). all the 143 patients examined were included in this report and none were excluded, since all subjects were able to complete either the stereoacuity testing or the orthoptic and ophthalmological evaluation. in other words, all patients underwent all the examinations and tests and none of them left the study because of being incapable of finishing the tests. the mean age of patients enrolled in the study was 19.0915.12 years (age range 478 years). there were slightly more males (74, 52%) than females (69, 48%) in the sample. among all patients included in the study, 59 (41%) were affected by strabismus and 84 (59%) were nonstrabismic healthy volunteers, tested by hirschberg corneal light reflex test, cover testing, and worth four - dot test. ten patients were affected by microstrabismus and six patients were affected by intermittent strabismus. as already described in the previous paragraph, in some selected cases (54 patients), the 4 pd base - out test was performed in order to complete the diagnosis of strabismus. in our study, lang i achieved the highest sensitivity, settled at 89.8% (95% ci 79.295.6), compared with lang ii (84.7%, 95% ci 73.292), titmus (83.1%, 95% ci 71.390), and tno (79.7%, 95% ci 67.688.1). furthermore, lang i appeared to be the most specific stereo test with a specificity of 95.2% (95% ci 8898.5), whereas lang ii achieved a specificity of 79.8% (95% ci 69.987). titmus and tno showed the least specificity, 83.3% (95% ci 73.889.9) and 86.9% (95% ci 77.992.7), respectively. the results for positive predictive value (ppv) were 93% (95% ci 82.897.7) for lang i, 74.6% (95% ci 6383.6) for lang ii, 77.8% (95% ci 6686.4) for titmus, and 81% (95% ci 6989.2) for tno. in this study, lang i was found to be the most testable (93%, 95% ci 85.397) compared to lang ii (88.2%, 95% ci 78.893.9), titmus (87.5%, 95% ci 78.393.3), and tno (85.9%, 95% ci 76.891.9). the authors found lang i to be the stereo test with higher sensitivity (89.8%), specificity (95.2%), ppv (93%), and npv (93%). the area under roc curve analysis revealed a statistically significant superiority of lang i test in detecting strabismus, including microstrabismus, when compared with all the other tests : 0.92 versus 0.82, 0.83, and 0.83 for lang i, lang ii, titmus, and tno, respectively (p=0.0001) (figure 2). currently, there is neither general consensus nor internationally approved guidelines concerning stereo tests as a screening tool for strabismus. poor documentation of stereo anomalies and unreported selection of participants disclose a serious problem in the clinical desire to generalize results of binocular vision research to a wider population. previous works on the screening of strabismus using stereo tests have shown disparate results regarding their application as a screening tool and the most useful among all.14,1726 stereoacuity has been measured by various tests, and there are conflicting reports on their validity in the evaluation of strabismic and microstrabismic patients. there is some agreement that tests based on the random - dot technique, such as the tno and lang tests, are superior to the titmus and randot stereo tests. this belief is supported by the evidence that the stereo tests based on the random - dot technique analyze real stereopsis generated from truly binocular interaction.26 ohlsson studied five different stereo tests, lang ii, frisby, randot, titmus, and tno, for the screening of strabismus and amblyopia. none of these tests were suitable as screening tests because sensitivity for strabismus was lower than 80%, while ppvs were lower than 40% for all the stereo tests. furthermore, these young patients were screened with a large number of tests in the same day. moreover, in a further study, ohlsson presented the effectiveness of lang ii stereo card as a screening tool for amblyopia and strabismus in children aged between 12 years and 13 years. authors claimed that lang ii is not considered an effective method of screening for strabismus because it does not reliably distinguish between nonstrabismic patients and children affected by both strabismus and microstrabismus. furthermore, lang ii reported a sensitivity of 82% and a ppv lower than 40%. ohlsson suggested that the low sensitivity could be caused by the memorization of images. lang ii was also studied by huynh in order to assess the accuracy of this stereo test as a screening tool for strabismus. the test achieved a sensitivity of 29% (95% ci 2631) in the diagnosis of strabismus. in conclusion, the authors did not recommend the sole use of lang ii stereo test in the screening of strabismus. in literature, there are few data related to the effectiveness of lang i stereo test in the detection of strabismus.18,21 most of the previous papers in literature analyzed stereo tests as screening for both strabismus and amblyopia. therefore, results regarding the effectiveness of stereo tests in the diagnosis of strabismus could appear partially masqueraded. in order to assess the relative diagnostic abilities of the four tests, we only analyzed the effectiveness of stereo tests for strabismus, excluding subjects affected by amblyopia, as already described in the previous paragraph. in our study, we have tested the applicability of lang i in the screening of strabismus, compared to the effectiveness of three other stereo tests, lang ii, titmus, and tno. we did not find any difference of compliance related to the age of the subject tested. both strabismic and microstrabismic patients and healthy volunteers demonstrated high compliance, and none of them were excluded from the study for lack of collaboration. this point is supported by the exclusion from the study sample of children younger than 4 years, because children older than that age should possess the cognitive strategies to interpret the most difficult pictures presented to them through stereo tests. moreover, heron found that performance on the randot and tno tests was adult - like in 7-year - old children. hofstetter and bertsch28 could not find any age - related differences in stereo threshold tested in 242 subjects aged between 8 years and 46 years. using the area under the curve of roc curves, we determined the individual tests capacity to detect strabismus, and then compared the four tests. lang i stereo test showed the highest sensitivity (89.8%), specificity (95.2%), ppv (93%), and npv (93%) compared to the other stereo tests examined (lang ii, titmus, and tno). it is not easy to determine the parameters that point to why lang i resulted superior to the others. possible explanations could be as follows : lang i is easier and faster to perform, it does not need red / green or cross - polarized filters, and as a random - dot test it does not present monocular clues (which, for example, are present in the contour stereoacuity tests like titmus). the most difficult thing is to explain the different results between lang i and lang ii : they are both random dot, they both do not need filters, and furthermore, lang ii seconds of arc (600 - 200) should correspond to a higher sensitivity of lang ii compared to lang i seconds of arc (1,200 - 550), which can correspond to a lower sensitivity of lang i. a hypothesis could be that when we test a patient with lang ii, he / she directs his / her attention mostly on the star visible monocularly, misinterpreting the other figures. our findings on the effectiveness of stereo tests in the diagnosis of strabismus differ from previously published data and in comparison to the other studies showed some advantages. first of all, we selected a homogeneous sample, including just patients affected by strabismus and excluding subjects affected by amblyopia or other forms of ocular diseases. for this reason, our results were not affected by disparities due to amblyopia and other pathologies. patients younger than 4 years were excluded from the study. these young children could have shown a lack of collaboration conditioning the statistical data. moreover, tests were presented to patients in a randomized order, avoiding that the order of the presentation could interfere with the analysis. in addition, the operator performing stereo tests was the same throughout the duration of this observational study. furthermore, the operator performing stereo tests could not be influenced by the result of ocular and orthoptics evaluation, since he was masked to the results of the visits. finally, we underline that for the first time lang i stereo test was compared to lang ii, titmus, and tno and the diagnosis of strabismus was confirmed by a combination of hirschberg corneal light reflex test, cover testing, worth four - dot test, and the 4 pd base - out test. no other previous studies used all these tests together in order to make strabismus diagnosis. on the other hand first of all, we mention the smaller sample size compared to the other studies and the exclusion of children younger than 4 years. these young patients were excluded because of the difficulty in interpreting their answers to stereo tests to confirm the diagnosis. the poor collaboration could affect the results, creating discrete disparities in the statistical calculations. the diagnosis of strabismus in early childhood is useful so as to perform an early treatment, either medical or surgical. another limitation is the validity of stereo tests only for the diagnosis of constant strabismus and not for intermittent strabismus. in fact, according to our hypothesis, the rate of false negatives could be caused by the inclusion in the study group of subjects affected by intermittent strabismus (especially intermittent exotropia). therefore, these forms of strabismus could contribute to lower the rate of sensitivity of the stereo tests studied. in consideration of the high sensitivity, specificity, ppvs, and npvs of lang i and the homogeneity of the results, we believe that this stereo test could be suitable for the screening of strabismus. such comforting results have never been reached before, in any of the previous studies. based on these findings, we can suggest the use of lang i stereo test in the screening of patients older than 4 years. we understand that a good and effective screening test should include children younger than 4 years, and for this reason, it is desirable for the future to evaluate if stereo tests could be used to screen these patients. our aim is to find a screening test for these children, not affected by poor age - related compliance, since the early diagnosis of strabismus is important in the management of the disease. nevertheless, these preliminary results should be confirmed by increasing our study population and reducing the age limit as much as possible to apply stereo tests earlier, in order to obtain a more useful and applicable screening test. we gave special attention to identifying a screening test for strabismus because this disease is a medical condition with a relevant prevalence in the general population (2%4%), causing severe complications when untreated, depending on the age of onset. the most disabling of these complications is amblyopia because it is irreversible if diagnosed when the plastic period of the development of the visual pathway is over. high levels of stereoacuity are thought to affect the development of the sensorimotor system in early childhood. in our study, we considered lang i in comparison to the other stereo tests for the first time and remarked that lang i resulted in a stereo test with the highest sensitivity (89.8%) for strabismus, which is statistically significant compared to the other stereo tests. lang i demonstrated to be fast, inexpensive, affordable, acceptable by all participants, easy to perform, and could be administrated by nonophthalmologists like pediatricians and orthoptists. for these reasons, we suggest the application of lang i stereo test as a screening method for strabismus in patients older than 4 years. | purposeto compare four stereo tests (lang i, lang ii, titmus, and tno) and assess their effectiveness. the main focus of this study is to identify the most useful stereo test as a challenging tool in the screening of strabismus.patients and methodsa total of 143 caucasian subjects, 74 males (52%) and 69 females (48%), aged between 4 years and 78 years (mean age 19.0915.12 years) were examined at our strabismus service (scientific institute san raffaele hospital, milan, italy) and included in this observational cross - sectional study. subjects recruited in this study were either affected by strabismus, including microstrabismic patients, or healthy volunteers. subjects affected by ophthalmological diseases, other than strabismus, were excluded. all patients underwent both ophthalmological and orthoptic examination, including stereo tests, hirschberg corneal light reflex test, worth four - dot test, the 4 prism diopter base - out test, cover testing, bruckner test, visual acuity, automated refraction under 1% tropicamide cycloplegia and thereafter, posterior pole evaluation.resultsall data were processed using the ibm spss statistics, version 2.0, to perform all statistical calculations. the main finding of this study is that lang i stereo test achieved the highest sensitivity (89.8%) and specificity (95.2%) in detecting strabismus, including microstrabismus as well, compared to all the other stereoacuity tests. furthermore, lang i is the stereo test with the highest positive predictive value and negative predictive value, both greater than 90%.conclusionthe stereo test with the highest sensitivity, specificity, positive predictive value, and negative predictive value is lang i. these results suggest its applicability as a screening test for strabismus in people older than 4 years. |
etec, the causative agent of travelers ' diarrhea, is the most common bacterial diarrheal disease of children in latin america, asia and africa, and it is contracted upon ingestion of contaminated food or water. it is estimated that this disease is responsible for 400 million cases annually resulting in 300 000 deaths of preschool children. e. coli becomes enterotoxigenic upon acquisition of a plasmid or plasmids containing the heat - stable enterotoxin or the cholera - like exotoxin, which is commonly termed the heat - labile enterotoxin (lt). both toxins are responsible for inducing fluid loss and electrolyte imbalance in the host. facilitating infection and subsequent colonization, etec also acquires a plasmid encoding for the pili or fimbriae referred to as colonization factor antigens (cfas), which mediate the colonization of e. coli in the gastrointestinal tract. the cfa pili are a heterogenous group of fimbrial adhesins responsible for adherence to small intestinal epithelial cells via their fimbriae or long, hairlike projections extending from the bacterial cell surface to epithelial mannose - containing glycoproteins. this adherence is generally host - specific for intestinal epithelium. while a specific natural receptor for cfa / i fimbriae has yet to be identified in the small intestine, some studies suggest that in eukaryotes a sialylated glycoprotein is the receptor, although others suggest that epithelial mannose - containing glycoproteins and/or glycosphingolipids may also serve as receptors. the low incidence rates in adults from etec - endemic regions have correlated with the presence of anti - lt and anti - cfa antibodies (abs), suggesting that acquired immunity to these virulence factors are protective. epidemiological studies show that children aged 2 million people worldwide. the frequency of ms is thought to be age and gender dependent, as it most frequently affects young and middle - aged adults and occurs twice as often in females as in males. although not considered fatal, ms can progress into considerable neurological disability, impacting the quality of life, and resulting in a shortened lifespan. experimental autoimmune encephalomyelitis (eae) is one of the best and most frequently studied rodent model that mimics the neuropathology and clinical disease of ms. eae manifests as an ascending disease in the spinal cord where initial symptoms begin as a limp or paralyzed tail, followed by rear leg paralysis that can eventually progress into forearm paralysis. it is induced upon immunization with restricted cns peptides, such as myelin oligodendrocyte glycoprotein, myelin basic protein or proteolipid protein (plp), into susceptible mice. this injection results in the activation of myelin - specific cd4 t cells in naive animals where in the cns inflammatory cells are recruited that secrete interferon (ifn)-, tnf- and il-1, resulting in perpetuation of inflammation along with tissue damage, including axonal damage, demyelination and perivascular inflammatory lesions. due to demyelination, new epitopes become exposed, and exposure of these neoags acts as an immunization process, thereby causing further epitope spreading. studies have shown that the proinflammatory - promoting cytokine, il-23, is primarily responsible for encephalitogenic t - cell development in eae. il-17 is the principal mediator of the inflammation observed in eae and in large part induced by il-23. il-17 is cross - regulated by both il-4 and ifn-. neutralization of il-17 has been shown to be protective, and protection can also be mediated via regulatory t (treg) cells. protection to eae correlates with th2/treg cell dependence as il-4, il-10 and transforming growth factor (tgf)- can reverse or prevent eae. as for many autoimmune diseases, patients have lost the capacity to be tolerized to self, and consequently, the patient begins to mount an immune response to self much like recognition of foreign ags. this t - cell dysfunction exhibited in these patients results in chronic activation of inflammatory th1 and th17 cells. often the course of treatment involves anti - inflammatory drugs and does not address the cause of the disease. tolerance is the inability to recognize self or to defined ags (reviewed in faria and weiner, mueller and bilate and lafaille) and past efforts to induce tolerance in humans by delivering ags have proven successful for treating allergies. the major obstacle in human tolerance is in part attributed to the requirement for large doses of ag or repeated administrations of therapeutics. although feeding auto - ags is effective in treating experimental autoimmune diseases, when applied to patients, oral feeding with auto - ags has been deemed unsuccessful. as noted, the salmonella - cfa / i vaccine elicited th2-type responses to the fimbriae much like an effect of soluble ag with adjuvant. the observed th2 cell bias was directed to the fimbriae but not as much as to the salmonella vector, which still retained the capacity to stimulate th1-type responses against salmonella ags. with this backdrop, subsequent studies began to analyze the potential of salmonella - cfa / i to augment disease, first with plp139 - 151-induced eae. as salmonella - cfa / i elicits a biphasic th cell response, groups of mice were orally vaccinated 1 week or 4 weeks before eae challenge to coincide with a more th2 cell- or th1 cell - prone environment, respectively. in either case, salmonella - cfa / i still conferred protection recovering completely from disease unlike those mice vaccinated with an isogenic salmonella vaccine lacking cfa / i fimbriae or those mice treated with phosphate - buffered saline (pbs). however, mice vaccinated with the isogenic salmonella vector did show reduced disease relative to pbs - treated mice but still bore greater disease than those mice vaccinated with salmonella - cfa / i. in addition to the clinical scores, increased disease pathology of the cns was evident from the enhanced demyelination and inflammatory cell infiltration relative to salmonella - cfa / i - vaccinated mice. this protection was supported by increased production of il-4, il-10 and il-13 and diminished production of ifn- by plp139 - 151- or cfa / i fimbriae - restimulated cd4 t cells. in contrast, cd4 t cells isolated from unprotected or salmonella vector - immunized mice displayed elevated ifn- and minimal - to - no th2-type cytokines. thus, salmonella - cfa / i was successful in reducing eae severity in a bystander fashion when administered before disease induction. although these prophylactic results were clearly promising, often with human autoimmune diseases, it is unknown which patients will develop disease and at what time point. therefore, to address the therapeutic potential of oral salmonella - cfa / i, additional studies were conducted to determine whether it could impact ongoing disease. adapting the same plp139 - 151 challenge model, mice were subjected to intervention with salmonella - cfa / i, salmonella vector or pbs 6 days post - eae induction. as per the prophylactic studies, both the salmonella - cfa / i and salmonella vector were able to subdue disease to different degrees, but only salmonella - cfa / i was able to inhibit cns inflammation unlike the salmonella vector - treated mice, which showed extensive neutrophil, macrophage and t - cell infiltration into the cns. / i was attributed to the stimulation of anti - inflammatory cytokines, il-4, il-10 and il-13 with concomitant reductions in ifn- and il-17. because of the observed anti - inflammatory cytokines, we queried whether these were generated by treg cells, possibly induced by salmonella - cfa / i. treg cells were originally delineated in thymectomized neonatal mice that showed increased manifestations of autoimmune disorders. as a result, treg cells have been shown to maintain peripheral tolerance and are responsible for protection against a variety of autoimmune diseases, including colitis, arthritis and eae. treg - cell subsets are varied in their expression of phenotypic markers, but natural treg cells are identified by the expression of il-2 receptor -chain. these are also transcriptionally regulated by forkhead box transcription factor (foxp3), and when foxp3 function is ablated, cd4cd25 treg cells are abrogated producing a wasting disease and inflammatory bowel disease in mice. co - inhibitory molecules, activation - induced cytotoxic t lymphocyte associated protein-4 and glucocorticoid - induced tnf receptor may also be expressed and contribute in mediating teff cell suppression. in lieu of the phenotypic markers, earlier studies relied on functional characterization of these treg cells, and these were distinguished by the cell surface expression or secretion of tgf- referred to as th3 cells or production of il-10 referred to as tregulatory 1 cells. tgf- production by cd25cd4 treg cells has been shown to be responsible for recovery from eae, and the presence of tgf- has been shown to be necessary for conversion of cd4cd25 t cells into cd4cd25foxp3 treg cells. more recently, il-35, a member of the il-12 family and produced by treg cells, was found to have inhibitory activity capable of potently suppressing arthritis, colitis and eae. il-35 can mediate its effects via the stimulation of il-10. to examine the possible role for induction of treg cells by salmonella - cfa / i, a kinetic analysis was done. it was discovered that both the salmonella vector and salmonella - cfa / i could stimulate the induction of cd25cd4 t cells, but the percentage of foxp3 treg cells was particularly augmented in mice treated with salmonella - cfa / i. to assess their relative contribution, in vivo cd25 neutralization was performed resulting in the diminution of salmonella - cfa / i 's protective response demonstrating the importance of these treg cells to abate autoimmune disease. to assess their relative potency, adoptive transfer of treg cells from each of the treatment groups (salmonella - cfa / i treg cells derived from mice vaccinated with salmonella - cfa / i showed the greatest potency in plp139 - 151-challenged mice exhibiting nearly complete protection. conversely, although treg cells obtained from salmonella vector - vaccinated mice did confer protection, some disease was still evident that was subsequently protracted. recipients adoptively transferred with naive treg cells only showed a delayed onset of disease, and all mice developed eae. interestingly, partial protection could be achieved with cd25cd4 t cells adoptively transferred from salmonella - cfa / i - vaccinated mice unlike those same cells from salmonella vector - immunized mice that were unable to confer protection. the adoptively transferred treg cells from salmonella - cfa / i - vaccinated mice produced both tgf- and il-10, but the majority of the il-10 was derived from cd25cd4 t cells. moreover, these cd25cd4 t cells produced il-4 and il-13, suggesting these are potentially th2 cells. treg cells from salmonella vector - vaccinated mice produced little tgf- and il-10, and their cd25cd4 t cells did not produce il-4, il-10 or il-13, which accounts for the lesser potency in reducing eae. as tgf-1 mice succumb to death in utero and those surviving succumb early in life, additional adoptive transfer studies were performed to test the dependence on tgf- for protection to eae. upon adoptive transfer of treg or cd25cd4 t cells from salmonella - cfa / i - vaccinated mice, recipients induced with eae were neutralized of their tgf- using a monoclonal ab (mab), and this abrogated much of the protective effect by salmonella - cfa / i 's treg cells. complete abrogation was observed upon treating recipients with salmonella - cfa / i 's cd25cd4 t cells. as with this latter finding, tgf- neutralization resulted in the complete loss of any partial protection conferred by salmonella vector treg cells, and no protection was evident in recipients given cd25cd4 t cells from salmonella vector - immunized mice. tgf- neutralization also impacted the expression of foxp3 by the treg cells enabling il-17 to be augmented, which would account for the loss of function and ultimately protection. thus, tgf- is an essential regulatory element induced by salmonella - cfa / i therapeutic. in an attempt to disrupt the protective capacity of cfa / i fimbriae, a mutant was developed to alter the cell surface expression of the fimbriae. this mutant bears only the cfaab portion of the operon and lacks the genes for the outer membrane usher protein cfac, and minor fimbrial subunit cfae, and is referred to as salmonella - cfa / i(intracellular) (salmonella - cfa / iic). upon oral vaccination, mice showed reduced fecal siga and reduced serum igg abs to the fimbriae but remained as effective in protecting mice against eae as did adoptive transfer of their treg cells into eae recipients. what was particularly interesting of this finding was the difference in cytokine profiles from salmonella - cfa / i - vaccinated mice. examination of cytokine production by treg cells from salmonella - cfa / iic - treated eae mice revealed no change in tgf- production but considerably augmented ifn- and il-13 production relative to similarly treated mice with salmonella - cfa / i. the percentage of foxp3 treg cells was similar. to test the relevance of the observed ifn- and il-13, in vivo ab adoptive transfer of salmonella - cfa / iic 's treg cells into eae recipients neutralized of their ifn- using a mab resulted in no differences in susceptibility to eae, and both groups of mice given treg cells with normal rat igg or rat anti - mouse ifn- mab showed protection against disease. in contrast, eae recipients neutralized of their il-13 using a polyclonal anti - il-13 ab and adoptively transferred with salmonella - cfa / iic 's treg cells lost their protection further showing the importance of il-13 in defense against eae. this further implicated the ability of il-13 to directly affect treg cell function or enhance the action of treg cells. thus, these collective studies show the effectiveness of salmonella - cfa / i and salmonella - cfa / iic as therapeutics to defend against eae. rheumatoid arthritis (ra) is an autoimmune disorder and chronic inflammatory disease of the joints impacting 1% of the population in north america and the united kingdom, with women being three times more likely to be afflicted than men. although the etiology of this disease remains to be discerned, it is manifested as a chronic synovitis and progressive destruction of the joints, leukocyte infiltrates and cartilage destruction and bone erosion. past studies have indeed shown that proinflammatory cytokines are overexpressed in ra joints (reviewed in feldmann. to understand how such cytokines are regulated, a rodent model sharing many of the same features for human disease (reviewed in kannan.) this autoimmune disease, collagen - induced arthritis (cia), is induced by immunizing rodents, typically with heterologous (bovine or chick) type ii collagen in combination with adjuvant, to elicit immune attack of the host 's native collagen. emphasis on regulating proinflammatory cytokines, particularly tnf-, is key to minimizing disease as it can be detected in joints of ra patients. such treatment is also believed to inhibit other inflammatory cytokines, including il-1, il-6, il-8 and granulocyte macrophages colony - stimulating factor. components of both the adaptive and innate immune systems contribute as a source for tnf- and other proinflammatory cytokines. th17 cells, which can regulate both th1 and th2 cells, may be important for mediating ra disease as icos dba/1 mice showed depressed il-17 production, but not tnf- or ifn-, and still conferred complete resistance to cia. il-17 is also expressed by the human synovium and is particularly elevated in patients with ra and is il-23 dependent. in vivo neutralization of il-17 results in significantly reduced cia and given the results from the eae studies, we queried whether salmonella - cfa / i would be effective in treating cia, a rodent model for ra. dba / i mice are susceptible to chick or bovine collagen ii (cii) challenge, and develop a progressive disease affecting multiple joints. as such, dba/1 mice were orally dosed with salmonella - cfa / i, salmonella vector or pbs 7 days before cii challenge. mice were followed for a course of 42 days, and salmonella - cfa / i protected against cia as evidenced by minimal clinical disease and significantly reduced incidence unlike mice treated with the salmonella vector or pbs. the observed reduction in disease was supported by the production of the cytokines il-4, il-10 and tgf- by cd4 t cells. in addition, mononuclear cells from salmonella - cfa / i - treated animals had decreased levels of tnf-, il-1, il-6 and il-27. to distill which cd4 t cells were responsible for the regulatory and anti - inflammatory cytokines in dba/1 mice void of disease, mice were orally vaccinated with salmonella - cfa / i, and cytokine profiles from cd25cd4 and cd25cd4 t cells were assessed. the cd25cd4 t cells produced significantly more il-4, il-10 and tgf- than the cd25 t cells. interestingly, ifn- and il-17 were significantly elevated relative to cd25cd4 t cells but less than cd25cd4 t cells from salmonella vector - immunized mice. as the cd25cd4 t cells from similarly vaccinated mice were highly protective against eae, adoptive transfer studies were performed to measure the potency of these treg cells in conferring protection against cia. surprisingly, neither the individual cd25cd4 nor cd25cd4 t - cell subset was adequate in treating cia relative to whole cd4 t - cell isolates with respect to disease onset and mice with reduced clinical disease. thus, it appeared that both cd25cd4 and cd25cd4 t cells were required for protection against cia. subsequently, adoptive transfer studies using total cd4 t cells in combination with anti - il-4 mab or anti - tgf- mab were performed and revealed that inhibition of either cytokine resulted in disease and loss of the protective response. collectively, these data showed that salmonella - cfa / i could treat cia via the induction of diverse populations of treg cells. as neither cd25 nor cd25cd4 t cells could completely protect following adoptive transfer into dba/1 mice, our data suggested that perhaps a different treg - cell subset was being induced. to investigate such a possibility, the salmonella - cfa / i - induced cd4 t cells were screened for expression of alternative treg - cell markers other than cd25. these cd39 treg cells are also able to suppress th17 cells, and their absence has been linked to ms. specifically, cd39 is an ectonuleoside triphosphate diphosphohydrolase, and it is expressed on the cell surface of foxp3 treg cells, dampening proinflammatory cells by ultimately converting proinflammatory extracellular atp to anti - inflammatory adenosine. subsequent evaluation of cd39 expression was conducted in c57bl/6 male mice, which also are susceptible to arthritis. thus, cia mice were orally dosed with salmonella - cfa / i, and it was revealed that only half of the cd39cd4 t cells was foxp3cd25cd4, although cd39 was also expressed on the cd25cd4 t cells. to determine whether these cd39 t cells were protective against disease, c57bl/6 mice were adoptively transferred with cd39cd4 or cd39cd4 t cells from salmonella - cfa / i- or salmonella vector - dosed mice into recipients challenged 14 days earlier with cia. only mice receiving cd39cd4 t cells from salmonella - cfa / i - dosed mice were protected against cia, indicating that again the cfa / i fimbriae are essential in stimulating this therapeutic subset of treg cells. as these cd39cd4 t cells were composed of both foxp3 and foxp3 cells, further analysis was performed to determine whether foxp3cd39cd4 t cells were protective against cia. notably, cia recipients given either foxp3cd39cd4 or foxp3cd39cd4 t cells protected equally to disease but not as effectively as total cd39cd4 t cells. cytokine analysis revealed that il-10 and tgf- segregated with foxp3cd39cd4 and foxp3 cd39cd4 t cells, respectively. neutralization of tgf- reduced the percentage of cd39 expression, implicating the importance of tgf- for induction of cd39. outside of our studies, there have only been a few reports where bacterial infections have been used to subdue eae, and even less for cia. however, it is important to emphasize that the induction of treg cells is mediated not so much by the attenuated salmonella vaccine strain as these cells are induced by the fimbriae or the combination of bacteria with fimbriae. nonetheless, our studies demonstrate the feasibility of a simple oral treatment with salmonella - cfa / i to render protection against eae and cia without having previous knowledge of the auto - ag. consequently, in a bystander fashion, both fimbriae- and plp139 - 151-specific, tgf--producing, foxp3cd25cd4 t cells were induced for eae and cii - specific, il-10-producing foxp3cd39 and tgf--producing foxp3cd39cd4 t cells. for the protective treg cells in cia, co - expression of cd25 did not specifically segregate with either subset. the advantage of using salmonella - cfa / i is that intervention of autoimmunity can be achieved upon vaccination with an innocuous ag, and in this case the side - effect would be the additional protection against the diarrheal diseases, etec and salmonellosis. additionally, this approach does not polyclonally activate treg cells, which have been shown to have a cataclysmic outcome. | to date, efforts to treat autoimmune diseases have primarily focused on the disease symptoms rather than on the cause of the disease. in large part, this is attributed to not knowing the responsible auto - antigens (auto - ags) for driving the self - reactivity coupled with the poor success of treating autoimmune diseases using oral tolerance methods. nonetheless, if tolerogenic approaches or methods that stimulate regulatory t (treg) cells can be devised, these could subdue autoimmune diseases. to forward such efforts, our approach with colonization factor antigen i (cfa / i) fimbriae is to establish bystander immunity to ultimately drive the development of auto - ag - specific treg cells. using an attenuated salmonella vaccine expressing cfa / i fimbriae, fimbriae - specific treg cells were induced without compromising the vaccine 's capacity to protect against travelers ' diarrhea or salmonellosis. by adapting the vaccine 's anti - inflammatory properties, it was found that it could also dampen experimental inflammatory diseases resembling multiple sclerosis (ms) and rheumatoid arthritis. because of this bystander effect, disease - specific treg cells are eventually induced to resolve disease. interestingly, this same vaccine could elicit the required treg cell subset for each disease. for ms - like disease, conventional cd25 + treg cells are stimulated, but for arthritis cd39 + treg cells are induced instead. this review article will examine the potential of treating autoimmune diseases without having previous knowledge of the auto - ag using an innocuous antigen to stimulate treg cells via the production of transforming growth factor- and interleukin-10. |
the type 1 boston keratoprosthesis (kpro) is a poly (methyl methacrylate) device that has gained acceptance in many types of end - stage corneal diseases as a viable surgical option.13 the kpro is assembled using a carrier donor tissue, and its optics afford excellent visual acuity and field of vision4 assuming that the alignment of the kpro is optimized. centration of the kpro is determined during preparation of the donor carrier tissue and host trephination. the manufacturer s recommended steps for kpro preparation involve punching the donor with an 8.5 mm or greater diameter followed by a 3-mm central punch. we have found that centration of the kpro in the carrier tissue can be difficult using this procedure, and we present a modification for minimizing centration error. the center of the donor carrier tissue is marked using a surgical marker, and a 3-mm central punch is performed using the centration mark (figure 1a).. the 3-mm - diameter punched tissue is removed, and the edge is inspected. an appropriate outer diameter punch size is selected, which should be at least 8.5 mm diameter if possible, and a disposable barron corneal punch (katena eye instruments, denville, nj) is typically used. the donor carrier tissue is placed on the punch block and the 3-mm hole is centered between the vacuum holes of the punch block (figure 1b), and the vacuum is engaged. the punch is then carefully performed, and the kpro is assembled and sutured to the host rim (figure 1c). the type 1 boston kpro is a viable therapeutic option for many end - stage corneal diseases that are poor candidates for traditional penetrating keratoplasty, and the reported visual results of the kpro have been good.2,3 the assembly of the kpro involves preparation of a carrier tissue with two punches that are ideally concentric. we have found difficulty in creating concentric punches using this technique (figure 2), and we believe that punching the central 3-mm hole first and then using this hole to center within the barron corneal punch s four vacuum ports affords much better control. if the manufacturer s recommendations are followed and the outer punch is performed first, then the free - hand 3-mm dermatologic punch must be placed perfectly for a concentric result. the optical performance of the kpro on an optical bench using a 3-mm pupil and precise alignment was evaluated and found to produce a sharp, crisp image with a tight point - spread function.4 the optical cylinder, under these optimized alignment conditions, produced scattered ghost images when the 3-mm pupil was widened to 10 mm. if the alignment of the kpro is suboptimal with the cylinder off - axis from the fovea, then the projected image will most likely be further degraded. we believe the centration of the kpro in the donor carrier and host cornea is integral for optimal alignment of the cylinder and minimization of scatter and other optical phenomena. our technique of punching the 3-mm inner hole first and then centering the outer punch on this hole relieves much centration uncertainty in kpro preparation. in addition to the optical advantages of optimizing centration, suturing to the host rim is much easier with better distribution of tension when the kpro is centered. we have not found any limitations or problems from this simple modification of kpro assembly. | the type 1 boston keratoprosthesis preparation requires a 3-mm central punch and an 8.5 mm or larger punch in the carrier tissue. these punches are ideally concentric, but we have found difficulty in achieving concentric punches when the larger punch is performed first. we present a modification in the preparation procedure to help minimize centration error. |
values of (kcat / km)gap for triosephosphate isomerase - catalyzed reactions of (r)-glyceraldehyde 3-phosphate and kcat / khpikga for reactions of the substrate pieces glycolaldehyde and hpo32 have been determined for wild - type and the following tim mutants : i172v, i172a, l232a, and p168a (tim from trypanosoma brucei brucei) ; a 208-tgag for 208-yggs loop 7 replacement mutant (l7rm, tim from chicken muscle) ; and, y208 t, y208s, y208a, y208f and s211a (yeast tim). a superb linear logarithmic correlation, with slope of 1.04 0.03, is observed between the kinetic parameters for wild - type and most mutant enzymes, with positive deviations for l232a and l7rm. the unit slope shows that most mutations result in an identical change in the activation barriers for the catalyzed reactions of whole substrate and substrate pieces, so that the two transition states are stabilized by similar interactions with the protein catalyst. this is consistent with a role for dianions as active spectators, which hold tim in a catalytically active caged form. |
|
the rate of end - stage failure of several vital organs (e.g., kidneys, liver, heart, and lungs) is increasing expeditiously due to scientific advancements and the ability to sustain brain dead patients over a long period of time (1). organ transplantation is known as the treatment of choice for patients with advanced organ failure (2). annually, more than 100,000 solid organ transplantations are performed worldwide, more than 50% of which are renal transplantation (3). statistical analyses showed that the rate of organ failure is increasing faster than the sources for organ donation, and the imbalance between supply and demand has resulted in long transplant waiting lists (1). depending on the types of required organ, given the medical and legal barriers to living donors, the use of cadaveric organ donation (brain dead patients) as a treatment method is on the rise across the world ; however, this growing trend is not in proportion with organ demand (5, 6). nowadays, the rate of cadaveric organ donation is 19.4%, 69.5%, 63.1%, 16.6%, and 60.9% in the middle east, europe, america, east asia, and australia, respectively (7). as previously mentioned, the highest rate of cadaveric organ donation belongs to european countries, among which croatia, with over 53.8 per million populations (pmp), spain (47.5 pmp), and estonia (43.9 pmp) are ranked first to third regarding the use of cadaveric organ donation (8). iran is one of the industrious countries regarding organ transplantation ; in addition, it is one of the 30 high - demand countries with high rates of renal transplantation (9). currently, the rate of renal transplantation is 12 pmp in iran, and it is ranked 36 in the world, after turkey, saudi arabia, bahrain, and qatar (8). in iran, due to the high rate of organ transplantation and ranking first in the region regarding cadaveric organ donation, living donor transplantation is tried to be replaced with cadaveric organ donation. for this purpose, this study aimed to identify the barriers to organ donation in brain dead patients, referred to organ procurement organizations (opo) of mashhad university of medical sciences, mashhad, iran. in this cross - sectional study, data were gathered from medical records of patients who were referred to opos of five hospitals affiliated with the mashhad university of medical sciences, mashhad, iran, during 20062013. approximately, 8.6% of the brain dead patients were referred to private hospitals, and the rest were referred to governmental hospitals. demographic information such as name, age, gender, time interval between admission and brain death, place of residence, religion, admission date, reason for family s refusal to organ donation, and cause of brain death were recorded. the causes of brain death were categorized as follows : motor vehicle traumas, cerebral hemorrhages (nontraumatic cases), brain tumors, and others (including drug poisoning, except for drugs affecting the central nervous system, convulsion, and anoxia). the patients were divided into three groups as follows : 1) brain dead patients not eligible for organ donation due to medical reasons such as age above 65 years, sepsis, and chronic infectious diseases (e.g., hepatitis b or c, and human immunodeficiency virus) ; 2) brain dead patients who were medically eligible for donation, but organ donation was prohibited due to legal reasons such as medical malpractice, lack of access to legal heirs, or private prosecution ; 3) potential donors without legal prohibition and with at least one organ appropriate for transplantation. if they consented to organ donation, the brain dead patient was placed under conservative treatment. if the patient survived until completing consultation with patient s family and obtaining consent to organ donation, organs were harvested. based on interviews with experts, reasons for declining organ donation were identified and evaluated separately, and the data were analyzed using chi - square test by spss version 13 (spss inc. in this cross - sectional study, data were gathered from medical records of patients who were referred to opos of five hospitals affiliated with the mashhad university of medical sciences, mashhad, iran, during 20062013. approximately, 8.6% of the brain dead patients were referred to private hospitals, and the rest were referred to governmental hospitals. demographic information such as name, age, gender, time interval between admission and brain death, place of residence, religion, admission date, reason for family s refusal to organ donation, and cause of brain death were recorded. the causes of brain death were categorized as follows : motor vehicle traumas, cerebral hemorrhages (nontraumatic cases), brain tumors, and others (including drug poisoning, except for drugs affecting the central nervous system, convulsion, and anoxia). the patients were divided into three groups as follows : 1) brain dead patients not eligible for organ donation due to medical reasons such as age above 65 years, sepsis, and chronic infectious diseases (e.g., hepatitis b or c, and human immunodeficiency virus) ; 2) brain dead patients who were medically eligible for donation, but organ donation was prohibited due to legal reasons such as medical malpractice, lack of access to legal heirs, or private prosecution ; 3) potential donors without legal prohibition and with at least one organ appropriate for transplantation. if they consented to organ donation, the brain dead patient was placed under conservative treatment. if the patient survived until completing consultation with patient s family and obtaining consent to organ donation, organs were harvested. based on interviews with experts, reasons for declining organ donation were identified and evaluated separately, and the data were analyzed using chi - square test by spss version 13 (spss inc. all the studied patients were muslims ; the mean age of the patients was 30.2516.52 years. the occurrence of brain death in the age group of 18 years decreased from 14% (39 people) in 2006 to 11.2% (30 people) in 2013. the cardinal causes of brain death were head trauma (667 patients [65.2% ]), ischemic cerebrovascular accident (cva) (174 patients [17% ]), anoxia (91 patients [8.8% ]), brain tumor (67 patients [6.6% ]) and other cause (25 patients [2.4% ]). the majority (69.8%) of the brain dead patients was male, and sex ratio did not change significantly during the study. during 20062013, brain death was not confirmed in eight patients among 1042 declared cases of brain death, who were excluded from the study ; finally, in 1034 patients, brain death was confirmed. the number of brain dead patients, referred to opos, increased from 129 patients in 2006 to 135 in 2013. in 2009, only 104 brain dead patients were referred to opos, which was the lowest number of annual brain death during the study. the mean interval between admission and brain death was 4.25.06 days during the current study. the majority (69.8%) of the brain dead patients was male, and sex ratio did not change significantly during the study. in total, the rate of brain death due to trauma decreased from 62% in 2006 to 57% in 2013 (table 1). of the confirmed cases of brain death, 212 (20.5%) were medically ineligible for donation, and 86 (40.6%) and 28 (13.2%) of whom had uncorrectable hypotension and infection, respectively. the other medical reason for declining organ donation was multi - organ failure, which was observed in 59 (29.8%) patients. during the study, the number of patients who were not medically approved for donation diminished from 43 in 2006 to 17 patients in 2013. organ donation was not performed in 89 (8.4%) patients due to legal reasons. more specifically, the organs of 38 (42.7%), 28 (32.2%), 19 (21.3%), and 4 (4.6%) of the patients were not donated because of unavailability of legal heirs, having nationality of other countries, private prosecution, and medical malpractice, respectively. in these cases, the initial interview was performed with families of 733 patients with legal heirs in the third group. during the interview, 82 (11.2%) organ donation was carried out in 344 (52.8%) patients, while organ donation was not authorized for the rest of the cases. the rate of organ donation increased during the study ; that is, the rate of organ donation was 119 and 225 cases before and after 2008, respectively. the most important reasons for families refusal were not accepting the brain death (20.1%), fear of organ donation to non - coreligionists (8.1%), fear of organ trafficking (5.5%), belief in miracles (12%), fear of corpse mutilation or deformation (4%), adverse reaction of others (2%), asking for money (3%), and view of clergies (3%) ; no reason was spelt out by 42.2% of the families. the cardinal reasons for declining organ donation in the studied cases were fear of organ donation to non - coreligionists and not accepting brain death, respectively. in case of declining organ donation, it was refused by all heirs in 81.3% (253 families) of the cases. among the legal heirs, the strongest opposition to organ donation was observed in the patients mothers ; mothers were the only persons who refused organ donation in 45 cases (14%), which reduced from 10% to 1% by the end of the study. during the past half - century, organ transplantation has been considered as an effective treatment for end - organ damage. such procedures have resulted in higher quality of life and longevity of tens of thousands of patients with end - organ damage, and demand for organ transplantation has been on the rise ever since. however, the number of available transplanted organs does not correspond with the demand, and an organ shortage crisis has been a major concern worldwide. this problem is more prevalent in developing countries where patients with end - organ damage are in more critical condition (11, 12). cadaveric organ donation in the eastern mediterranean region is less common compared with european countries, the united states, and the western pacific (13). factors such as unbalanced distribution of healthcare facilities, lack of priority of prevention over treatment, poor governmental support of organ transplantation, inadequate knowledge of the medical community and public awareness regarding organ donation, and lack of medical team cooperation are among the shared features of the countries located in the eastern mediterranean (14, 15). countries such as iran, turkey, saudi arabia, kuwait, tunisia, jordan, and lebanon have consistent, active medical programs in the field of cadaveric donation of different organs, including the liver, heart, pancreas, and lungs. higher per capita income in these developing countries is the main reason for the rising trend of organ donation and transplantation. however, most of these countries are faced with the disproportionate rate of available donor organs to the current demand (10, 15, 16). according to our findings, the number of cases referred to organ transplant centers (i.e., patients with brain death per year) was not significantly different during the course of the study. due to the lack of reliable statistics regarding the total number of diagnosed brain deaths during our research, the percentage of referred cases to organ procurement units could not be determined. similar studies performed in iran, philippines, germany, and singapore have reported no significant changes in the number of referrals to organ procurement units with diagnosed brain death (1721). in this regard, the rate of referred cases with brain death to organ procurement units has been reported to range between 63.8%93.6% in european countries. for instance, this rate has been reported to be 90% in belgium and 63.8% in sweden. in belgium, the total number of potential organ donors increased from 289 cases in 1990 to 640 cases in 2013 (22). considering the development of organ procurement and transplant networks in the region, the number of brain death diagnoses was expected to increase during the course of the current study. lack of development in this regard could be attributed to the inadequate knowledge of nurses, physicians, and healthcare personnel about brain death and organ donation (2224). during the course of the present study, the number of suitable organ donors was observed to increase due to the older age and use of marginal donors. use of marginal donors for organ transplantation in our study was similar to that of other countries in the world. according to our findings, although the number of cases against organ donation was relatively unchanged, rate of consent to organ donation increased from 34.8% in 2006 to 69.2% in 2013. according to similar studies in iran, rate of organ donation furthermore, higher satisfaction with organ donation in iran could be attributed to the rising number of organ procurement units and enhanced public knowledge about this medical procedure (8). in the current research, mean age of the patients with brain death was 30.1516.504 years, which increased from 17.3529.42 years in 2006 to 17.1432.30 years in 2013. this is consistent with the findings of similar studies in the world, which have highlighted the increasing mean age of organ donors (20, 25, 27, 3033). increased age of patients with brain death could be attributed to the variable causes of this condition (8, 28, 29), the most important of which are severe head trauma (65.5%), cerebrovascular accident, brain tumors, and anoxia. this is in line with the results of similar studies in this regard (19, 25, 33). according to statistics, rate of brain deaths due to head trauma has declined from 70% in 2006 to 57% in 2013. this could be due to several factors, such as the reduced rate of road traffic accidents, enhancement of immediate medical care, and higher awareness of drivers, which have resulted in the lower rate of traumatic brain injury leading to brain death (34). this finding has been confirmed in previous studies (25, 27, 33). in the present study, 56.1% of the patients with consent to organ donation were shia (official state religion in iran), while 10.6% were non - shia. on the other hand, the main reason for refusal of organ donation in non - shia individuals was disagreement for donating organs to individuals of other religious backgrounds. this finding could be explained through considering the effect of ethnicity on the intention for organ donation (35). in the current study, we also investigated the causes of disagreement with organ donation in the families of patients with brain death. in most of the cases, families were reluctant to mention their reasons for disagreement (42.2%), which could be due to the inadequate knowledge or unsettling mental state of the family at the time of the survey. the most common reason for the refusal of organ donation was the denial of brain damage as the actual death of the patient. moreover, believing in miracles was reported as another cause of disagreement with harvesting the organs of brain dead patients. in general, the families of patients with brain death believed that the condition could be reversed either through medical interventions or by a miracle. previous studies have investigated the causes of agreement or refusal of organ donation reporting similar results (denial of the death of patient and believing in miracles in families) (19). in the present study, we evaluated the reasons for the disagreement of the relatives of brain dead patients with organ donation. according to our findings, most of the disagreements came from the mother of the patient (15% of all the cases), which denotes the significance of emotional factors in the process of organ donation. analysis of the collected data indicated that rate of maternal opposition decreased during the course of our study (from 15.6% in 2006 to 3.1% in 2013). this finding is indicative of the improved performance of coordinating teams in dealing with the families of patients with brain death in healthcare facilities. according to the results of the current research, denial of brain death was the most important cause of disagreement with organ donation, the rate of which had no significant difference during the course of the study. uniformity of the attitudes of society members toward organ donation could be a sign of the inefficacy of the mass media, as the most essential sources of information, in raising social awareness about organ donation. it is recommended that diagnosis rate of brain death and medical criteria for organ donation had no significant difference during the course of the present study. however, compared with the first year of the research, the number of donor organs increased more than twofold at the end of the experiment. considering the mortality patterns in developing countries, such as iran and other mediterranean regions, enhancement of medical services and accurate identification of cases with brain death could eliminate the need for organ donation from living donors or after cardiac death. | introductionorgan transplantation is the treatment of choice for some diseases. however, the need for cadaveric organ donation has either plateaued or is on a decreasing trend in some countries, especially in developed ones. in this study, we aimed to identify the barriers to organ donation in brain dead patients, who were referred to the organ procurement organizations (opo) in northeast iran.methodsin this cross - sectional study during 2006 to 2013, data were collected from medical records of brain dead patients. demographic information, cause of brain death, the process of obtaining informed consent, and the reasons for declining organ donation were obtained from the opo records. the data were analyzed using chi - square test by spss 13 software.resultsof 1034 brain dead patients, 751 cases (72.6%) were eligible for organ donation, and, ultimately, 344 cases underwent organ donation. the rate of organ donation increased during the course of the study ; medical and legal reasons as well as family refusal to authorize donation were the main barriers to the process.conclusionbased on the pattern of mortality, the need for living donors in developing countries, such as iran and other countries in the mediterranean region, can be reduced by improving the quality of healthcare, efficient identification of brain death, and obtaining consent with appropriate strategies. |
kimura disease (kd) presents as a subcutaneous mass, most frequently occurring in the head and neck regions. the histological characteristics of the disease are hyperplastic lymphoid tissue that contains well - developed lymphoid follicles, marked infiltration of eosinophils, vascular proliferation, and fibrosis. however, treatments with steroid and immunosuppressive agents were also reported to produce beneficial effects, although discontinuation of steroid often results in recurrence of the masses. in patients with renal manifestations we herein report the case of secondary membranous nephropathy (mn) associated with kd which recovered after surgical resection of the mass. a 33-year - old woman presented with a soft - tissue mass in her left axillary area. a percutaneous biopsy was performed, and histological findings showed atypical lymphoid hyperplasia with many eosinophilic infiltrations, which are consistent with kd (fig. one year after the diagnosis of kd, a 6-cm, left scapulo - anterior pseudoaneurysm was noted (fig. 1), which required a stent - graft insertion. following the graft insertion, the size of pseudoaneurysm decreased. treatment with prednisolone was continued for 1 year, and eosinophilia gradually improved to<500/mm within this period. one and half year after the diagnosis of kd, the patient presented with a month - long history of foamy urine and a weight gain of 5 kg ; pitting edema of both lower extremities was also observed. upon admission, the patient s blood pressure was 98/61 mmhg, white blood cell (wbc) count was 7,200/mm (with 33.8% eosinophils), and hemoglobin and platelet levels were 14.5 g / dl and 287,000/mm, respectively. serum blood urea nitrogen and creatinine levels were within the normal range, with a creatinine clearance rate of 120 ml / min/1.73 m. other laboratory assessments showed normal electrolyte, low serum albumin (1.3 g / dl), and high cholesterol (521 mg / dl) levels ; complement proteins (c3 and c4) and immunoglobulins (ig) a, g, and m were within normal limits. the patient s virology profile was negative for hepatitis b and c, and her immunologic status was negative for anti - double - stranded dna, antistreptococcal antibodies, cryoglobulins, and rheumatoid factor. urinalysis was 4 + positive for protein, with five to six red blood cells and five to nine wbcs per high - power field. the random, spot urinary protein - to - creatinine ratio (upcr) was 16.6 g / g, and urine protein electrophoresis showed nonspecific proteinuria. a light microscopic examination of renal biopsy specimens showed diffuse thickening of the capillary walls, focal, mild hypercellular mesangial cells, and normal - sized glomeruli. an electron microscopic examination revealed electron - dense deposits in some subepithelial areas and diffuse foot process effacement. an immunofluorescence microscopic examination revealed granular deposits of igm, igg, c3, and c1q in the mesangium (fig. angiotensin receptor blocker or angiotensin - converting enzyme inhibitor was considered the first - choice treatment. however, the patient s blood pressure was too low to add antihypertensive drugs to the treatment protocol. g / g / d to 2.0 g / g / d) over a 6-month period upon treatment with cyclosporine (3.5 mg / kg / d) and prednisolone (dose tapered from 0.5 mg / kg / d to 0.17 mg / kg / d within 6 months). however, 1.5 years from the onset of nephrotic syndrome, the patient s random upcr and serum creatinine level increased to 31.0 g / g and 2.11 mg / dl, respectively. fractional sodium excretion was calculated to be 1.23%. moreover, at the same time, the left subclavian mass had enlarged from an initial 5.8 cm3.6 cm to 7.2 cm7.2 cm, causing occlusion of the left axillary artery. therefore, surgical resection was necessary, and pathological reports of the excised specimen were consistent with kd. fortunately, after the mass excision, the azotemia normalized from a serum creatinine level of 2.11 mg / dl to 1.11 mg / dl, and proteinuria resolved from a random upcr of 31.0 g / g to 6.9 g / g within 1 month. after 3 months of follow up, the patient s serum creatinine level was 0.68 mg / dl, and the random upcr was 2.78 g / g (fig. kd often follows a benign, chronic course but does not generally resolve spontaneously and shows frequent relapses. although most patients do not have systemic symptoms, 1216% of these patients have nephropathy that often presents as nephrotic syndrome. although the pathogenesis of renal involvement and vasculitis in kd is unclear, several immunopathogenetic features have been suggested. katagiri showed that elevated tumor necrosis factor-, interleukin (il)-4, il-5, and il-13 are found in the peripheral blood cells of kd patients, as well as in the lesion tissue. this observation supports the fact that t - helper 2 (th2) cytokines play a part in the development of kd. in addition, lu reported a case of kd secondary to chronic renal graft failure. because chronic graft rejection is considered to be induced by th2 cell - produced ils, th2 cytokines and overgrowth of the cd4 th2 may play an important role in kd. many treatment methods were proposed for kd, including corticosteroid, cyclosporine, surgical excision, and radiotherapy (rt). this implies that t - cell- mediated pathogenesis maybe involved in kd since corticosteroids are known to regulate t - cell proliferation and lymphokine production. however, recurrence upon termination of steroid therapy was reported in 1540% of the patients. katagiri reported on the effectiveness of cyclosporine (4 mg / kg / d for 3 months followed by 3.5 mg / kg / d for 6 months) in treating kd. a previous study showed that rt is more effective than local excision and steroid therapy for the treatment of kd. with the 65-month median follow - up duration, local control was achieved in nine (64.3%) of the 14 patients in the rt group and in two (22.2%) of the nine patients in the non - rt group. for local mass control, however, the role of surgical resection in controlling renal manifestations in patients with kd has not yet been clarified. this case showed that surgical resection resulted in reversal of not only azotemia but also proteinuria. a similar reversal case was reported previously with regard to castleman s disease. a patient with a mixed type of localized castleman s disease complicated with nephrotic syndrome underwent removal of two mesenteric lymphoid masses. after the surgical resection, the proteinuria gradually decreased and disappeared. in patients with castleman s disease having renal complications, immunosuppressants such as prednisolone and azathioprine are often used, similar to the treatment for kd. however, surgical resection is helpful to reverse the renal function. both kd and castleman s disease cases imply that some unknown circulating mediators secreted by the primary tumor may cause renal dysfunction. it has long been postulated that some circulating humoral factors might cause proteinuria in minimal change nephrotic syndrome (mcns) and focal segmental glomerulosclerosis (fsgs). a t - cell - derived humoral factor might induce damages to the glomerular permeability barrier in mcns. hemopexin is one of the proposed molecules, which can cause proteinuria and glomerular alterations characteristic of mcns. in cases with fsgs, post - transplant recurrence of proteinuria and its response to plasmapheresis suggest the role of some plasma factors. soluble urokinase receptor is detected in the plasma of patients with recurrent fsgs, and this can induce foot process effacement, proteinuria, and fsgs - like glomerulopathy. in our patient, surgical mass reduction induced reversal of not only proteinuria but also the serum creatinine level. although the patient s serum creatinine level gradually increased over a 2-year period, the estimated glomerular filtration rate was fully normalized after surgical mass reduction. this suggests that renal dysfunction in this patient is possibly caused by a reversible mechanism. we can postulate that unknown circulating factors secreted by the angiolymphoid hyperplastic mass persistently restrict glomerular filtration possibly without evident chronic damage. because proteinuria slowly improved compared with the serum creatinine level, some humoral factors might have induced structural change to the glomerular permeability barrier so that it took more time to recover. we described the first official case of secondary mn in a kd patient in korea. this suggests that surgical resection could be preferentially be considered prior to medical treatment in kd patients with renal complications. | kimura disease (kd) is an eosinophilic, granulomatous, benign, chronic inflammatory disease with an unknown etiology. a 33-year - old woman visited our hospital because of a palpable, left subclavian mass, a left scapulo - anterior pseudoaneurysm, and nephrotic syndrome. her subclavian lymph node biopsy examination result was consistent with kd, and results of a renal biopsy indicated secondary membranous nephropathy. after renal histological examination confirmed nephropathy, treatment with prednisolone and cyclosporine was initiated, which was maintained for over 1 year. however, this therapy only provided a transient improvement in proteinuria. one year after commencing the treatment, both proteinuria and azotemia aggravated as the left axillary mass doubled in size. finally, the mass was surgically excised, following which the azotemia rapidly normalized and proteinuria resolved within 1 month. this case shows that tumor resection in a patient with kd with secondary nephropathy may resolve secondary renal manifestations. furthermore, reversible renal dysfunction may be caused by unknown secreted molecules. |
the use of the waterpipe, or shisha, for smoking tobacco is an old tradition in the eastern mediterranean region that goes back centuries. this habit is relatively rare in singapore, a country with a predominantly chinese population. carbon monoxide (co) poisoning can be notoriously deceptive and non - specific in its initial presentation to the emergency department (ed). its correct diagnosis and eventual management require a high level of suspicion on the part of the emergency physician (ep). our patient was a 19-year - old gentleman of saudi descent who was a student in singapore and had no past medical history of note. he had been having dinner with a friend at a restaurant 4 h prior to presentation and had been smoking shisha at that time. collateral information from his friend revealed that he had been smoking shisha with three other friends and had hit his occiput after a fall. his vital signs revealed a temperature of 36.7c, blood pressure of 108/61, pulse rate of 99/min and pulse oximetry reading of 99% on room air. physical examination revealed that he was alert and orientated to time, place and person. bedside capillary blood sugar was 5.1 mmol / l, and the baseline electrocardiogram was normal. the initial working diagnosis was that of stable head injury and a few other possible explanations for the dizziness, including cardiac arrhythmias, transient hypoglycemic episode, viral illness and substance overdose. he was scheduled for computed tomography (ct) of the brain. however, a carboxyhemoglobin (cohb) level was taken in view of the shisha smoking. he was immediately transferred to the critical monitoring area and put on 100% oxygen via a non - rebreather mask. a bedside arterial blood gas on high flow oxygen revealed respiratory alkalosis with ph of 7.441, pco2 of 37.3 mmhg and po2 of 501 mmhg. he was admitted to the medical high dependency unit (mdu) for further monitoring and management. he was placed on 100% oxygen for the next 46 h while he was in the mdu, and his dizziness resolved. he was discharged 2 days post - admission with a follow - up date for psychometric testing and neurological review at the outpatient clinic. this case highlights the challenge to emergency physicians regarding the timely diagnosis of co poisoning, a highly treatable condition. the non - specific neurological complaints can mimic many illnesses, such as viral illness or stable head injury. it binds to hemoglobin 200300 times more tightly than oxygen, forming cohb. as such, it inhibits the release of oxygen from hemoglobin to peripheral tissues, causing tissue hypoxia. the half life of cohb is 4 to 5 h in a person breathing room air and changes to 60 min in the presence of 100% oxygen at sea level. as such, our index patient would have been symptomatic for a prolonged period of time if the initial suspicion of co poisoning had not been made and he had been managed as a person with stable head injury. shisha smoking is one form of waterpipe smoking among others, including hookah, nargileh and arguileh. shisha smoking is relatively rare in singapore, but is common in the mediterranean regions, according to a who report. the report stated that the overall prevalence of shisha smoking in egypt was estimated at 10% from a national survey in 2002 focusing on hypertension, obesity and diabetes in such smokers. it has been estimated that smoke exposure could be as much as 100200 cigarettes per session. co poisoning is difficult to diagnose in the ed as its presenting symptoms are usually non - specific. undoubtedly, a history of potential co exposure is the most reliable indicator of poisoning. eps should have a high index of suspicion, even though the exposure can be exotic, as in this case. it is important to realize that when dizziness occurs in co poisoning, it usually corresponds to a caboxyhemoglobin level of 20% and above, a level considered to be at least moderately severe. making a diagnosis in a timely fashion can expedite the management of such patients. | carbon monoxide poisoning has been reported as a result of exposure to various sources of smoke, such as car exhaust fumes, home water heaters and tobacco smoke. we describe a case of symptomatic, moderately severe carbon monoxide (co) poisoning in a young mediterranean man after smoking a waterpipe, or shisha. this case highlights the importance of considering carbon monoxide exposure in patients presenting with non - specific neurological symptoms to the emergency department (ed). |
lichen planus pigmentosus (lpp), an uncommon variant of lp, is characterized by mottled or reticulated hyperpigmented, dark brown macules in sun - exposed areas and flexural folds. the histopathologic findings of lpp consist of hyperkeratosis, atrophic epidermis with vacuolar alteration of the basal cell layer, and scarce lymphohistiocyte or lichenoid infiltrates in the dermis with pigmentary incontinence and the presence of melanophages (1). although there have been a few reports of linear lichen planus, there has been no report of lpp with a linear pattern (2, 3). we describe two patients with lpp who had skin lesions in a linear distribution related to blaschko 's lines on their extremities. a 23-yr - old korean woman presented with asymptomatic dark brown macules on the left leg for 2 yr. one or two dark brown macules first appeared and spreaded gradually without any preceding erythematous or scaly skin eruption. there was no history of prolonged sun exposure or trauma on the lesion site. on examination, she had linear streaks of dark brown macules from the left ankle, across the calf and to the thigh, consistent with the pattern of blaschko 's lines (fig. skin biopsy showed atrophic epidermis, basal hydropic degeneration with sparse perivascular lymphohistiocytic infiltrates, and numerous melanophages (fig. these findings were consistent with lpp. a 16-yr - old korean woman presented with linear dark brown pigmentation on the left arm for one year. she stated that recurrent asymptomatic erythematous papules first appeared and then the lesion had developed into dark brown macules during 1 - 2 weeks. examination showed two linear streaks of dark brown macules from the left dorsum of hand to the upper arm probably related to blaschko 's lines (fig. skin biopsy showed orthokeratosis, focal basal liquefaction, a sparse perivascular inflammatory infiltrate, and pigmentary incontinence, confirming the diagnosis of lpp (fig. a 23-yr - old korean woman presented with asymptomatic dark brown macules on the left leg for 2 yr. one or two dark brown macules first appeared and spreaded gradually without any preceding erythematous or scaly skin eruption. there was no history of prolonged sun exposure or trauma on the lesion site. on examination, she had linear streaks of dark brown macules from the left ankle, across the calf and to the thigh, consistent with the pattern of blaschko 's lines (fig. skin biopsy showed atrophic epidermis, basal hydropic degeneration with sparse perivascular lymphohistiocytic infiltrates, and numerous melanophages (fig. a 16-yr - old korean woman presented with linear dark brown pigmentation on the left arm for one year. she stated that recurrent asymptomatic erythematous papules first appeared and then the lesion had developed into dark brown macules during 1 - 2 weeks. examination showed two linear streaks of dark brown macules from the left dorsum of hand to the upper arm probably related to blaschko 's lines (fig. skin biopsy showed orthokeratosis, focal basal liquefaction, a sparse perivascular inflammatory infiltrate, and pigmentary incontinence, confirming the diagnosis of lpp (fig. lpp has been described as a condition of unknown etiology which clinically differs from the classical lichen planus by exhibiting dark brown macules and/or papules and a longer clinical course without pruritus or scalp, nail, or mucosal involvement. the lpp is most common on sun - exposed areas such as the face, neck, and flexural folds including the axilla, inguinal, and submammary regions (1). some authors observed a striking predominance of lesions in an intertriginous location, with most of them in the axillae, thus they proposed the designation lpp - inversus (4). less common presentations include zosteriform pattern on the trunk (5) and involvement of non sun - exposed areas such as thigh (6). the linearity of the lesions is probably related to blaschko 's lines, which suggests that the predisposition to develop lpp might be determined during embryogenesis. the differential diagnoses of our cases include lichen striatus (7), linear and whorled nevoid melanosis and incontinentia pigmenti. in particular, because lichen striatus may have post - inflammatory hyperpigmentation (8) and lacks a well - defined histopathological picture (9), it should be differentiated in our patients. lichen striatus almost always have preceding inflammatory papules or scaly eruption, which last for 4 months to 4 yr (8). there was no previous papule in patient 1 and the short duration of preceding papules (1 - 2 weeks) favor the lpp in patient 2. there were no epidermal changes consisting of spongiosis and exocytosis, and a deeper dermal inflammatory infiltrate around adnexal structures which are features frequently seen in lichen striatus (9). in summary, lpp can present with a linear pattern and thus should be considered in the differential diagnosis of linear hyperpigmented skin lesions. | we report two cases of lichen planus pigmentosus (lpp) that developed in a unilateral linear pattern. the patients presented with unilateral linear brown macules on the extremities. skin biopsy showed orthokeratosis, basal hydropic degeneration with scarce lymphohistiocytic infiltrates, and numerous melanophages in both patients. these patients, to the best of our knowledge, are the first cases of lpp presenting with a linear pattern. lpp should be considered in the differential diagnosis of linear hyperpigmented skin lesions. |
crimean congo hemorrhagic fever (cchf) is a viral disease with approximate mortality rate of 30% in humans (ergonul 2006). the disease can be transmitted via contact with blood or secretions of infected animals and tick bite or manipulation and squishing of cchf infected ticks. human to human transmission i.e. nosocomial infection is another main way for the disease transmission (hoogstraal 1979, charrel 2004, appannanavar and mishra 2011). cchf disease has a worldwide dissemination and is considered to be an endemic disease in many countries in asia, africa and europe continents (charrel 2004, appannanavar and mishra 2011). until now cchf virus has been detected in 31 species of several species of hard and soft ticks (hoogstraal 1979, linthicum and bailey 1994, papa. the disease was first reported in iran during 1970 (chumakov 1972), and now is considered as an endemic disease in many parts of the world. previous studies confirmed cchf cases. in iran, many studies were conducted on disease carriers ; however in 1978, the virus was separated from soft tick larvae, ornithodoros lahorensis (sureau 1980) for the first time. since then, many studies were conducted in different regions of iran to find the cchf infection in ticks. based on previous studies, cchf infection was detected in 5 genera of soft and hard ticks including hyalomma, rhipicephalus, dermacentor, haemaphysalis and ornithodoros (shirani. a diverse range of infection rates has been reported in these ticks from 0.2 to 33.3% (shirani. kermanshah province contains a big population of nomads in west of the country, so it is an important region for the legal and illegal import / export of domestic animals from iraq, the neighbor country at the borderline of sarpole - zahab city. crimean - congo hemorrhagic fever is reported from some parts of iraq and seems to be an endemic disease there, where during 19791981, 63 cases of the disease were reported within number of 48 mortalities. studies over 50% of iraqi goat, sheep, and horse sera were positive for the presence of antibodies, in another sero - survey 29% of all animal breeders tested in iraq were also reported to be positive for those antibodies (defens pest managment information analysis center armed forces glen section walter reed army medical center washington 1999). according to the national monitory system of iraq, 06 of cchf cases were annually reported during 19982009, and in 2010, 11 confirmed cases of the disease with 36% mortality and 28 suspected cases with 4% mortality were reported (majeed. 2012). presence of more than 140,000 livestock in the county makes it as a major area of animal husbandry in kermanshah province. adjacent plains and mountainous areas are the major locations for nomad migration, which have large herds of livestock. sarpole - zahab has a long borderline with iraq ; make it a suitable area for legal / illegal livestock export / import trades between two countries. so risk of the disease transmission exists in both sides of the borderlines of the two neighboring countries where it can be passed from one side to another side of the border, periodically. this study was aimed to investigate cchf virus infection rate in ticks of domestic animals, as the main vectors of the disease. sarpole - zahab county located at the western margin of the province, in coordinates of 342740 n and 45 5146 e, with an area of about 1.271 square kilometers. sarpole - zahab has a relatively warm and semi - arid climate with the mild winters and hot summers., eight villages of sarzal, ghalee vari, mela kabob, salman tape, berimov and, anzal, dare balut and sare baghe golin located in different geographical locations of the county were selected randomly (table 1). tick specimen collection from the livestock was conducted as described below during the years 20122013 (fig. 131 tick specimens were selected to determine the cchf infection rate in ticks of the area study. map of the study area in kermanshah province, iran details of the tick species were collected and examined for the presence of cchf virus genome, sarpole - zahab county, western iran sz : sarzal, gv : ghaleevari, mk : mela kabob, st : salman tape, bv : berimovand, an : anzal, db : darebalut, sbg : sarebaghegolin. tick specimens were collected seasonally based on the species diversity, type of host animals and geographic location of the area study. samples were maintained individually in labeled tubes and transferred to the laboratory of school of public health, tehran university of medical sciences in cool boxes. the specimens were identified to species level using the known morphologically keys (hoogstraal 1979, walker. 128 specimens of the identified ticks were selected in random and transferred in cold chain to the arbovirus and viral hemorrhagic fevers laboratory (national ref. lab) at pasture institute of iran for molecular detection of cchf virus. for rna extraction, each tick was washed twice with pbs 1x and then crushed by a mortar and pestle in 300 l of pbs buffer. rna extraction was performed using rna easy mini kit (qiagen, germany) based on the protocol recommended by the manufacturer. the extracted rna was dissolved in rnase - free water and kept at 70 c until use. rt - pcr reaction was performed using one - step rt - pcr kit (qiagen, germany) based on the protocol. in each pcr reaction, 5l of the extracted rna and 1l of each specific primer (forward : 5-tggacacc ttcacaaactc-3 and reverse : 5-gac aattccctacacc-3) were added to amplify the small segment (s - segment) of the virus (chinikar. 2004). at next step, 5 l of rt - pcr products were mixed with 1 of loading buffer and the mixture was loaded on 1.5% agarose gel for electrophoresis. dna bands were stained with ethidiumbromide and were visualized under uv trans illuminator (chinikar. rt - pcr products were sequenced by abi genetic analyzer 3130 machine using big dye terminator v3.1 cycle sequencing kit and specific primers (chinikar, shah - hosseini. 2013). the partial sequences around 500 bp of the s - segment were used for phylogenetic analysis (table 2). the multiple alignments were performed using clustal w, for seven sequences of current study and some sequences from gen bank. phylogenetic tree was drawn by maximum - likelihood method with kimura 2-parameter model using mega 5.2 software. bootstrap method with replications of 1000 was used for assessing confidence in phylogenetic tree results. sarpole - zahab county located at the western margin of the province, in coordinates of 342740 n and 45 5146 e, with an area of about 1.271 square kilometers. sarpole - zahab has a relatively warm and semi - arid climate with the mild winters and hot summers., eight villages of sarzal, ghalee vari, mela kabob, salman tape, berimov and, anzal, dare balut and sare baghe golin located in different geographical locations of the county were selected randomly (table 1). tick specimen collection from the livestock was conducted as described below during the years 20122013 (fig. 131 tick specimens were selected to determine the cchf infection rate in ticks of the area study. map of the study area in kermanshah province, iran details of the tick species were collected and examined for the presence of cchf virus genome, sarpole - zahab county, western iran sz : sarzal, gv : ghaleevari, mk : mela kabob, st : salman tape, bv : berimovand, an : anzal, db : darebalut, sbg : sarebaghegolin. tick specimens were collected seasonally based on the species diversity, type of host animals and geographic location of the area study. samples were maintained individually in labeled tubes and transferred to the laboratory of school of public health, tehran university of medical sciences in cool boxes. the specimens were identified to species level using the known morphologically keys (hoogstraal 1979, walker. 128 specimens of the identified ticks were selected in random and transferred in cold chain to the arbovirus and viral hemorrhagic fevers laboratory (national ref. lab) at pasture institute of iran for molecular detection of cchf virus. for rna extraction, each tick was washed twice with pbs 1x and then crushed by a mortar and pestle in 300 l of pbs buffer. rna extraction was performed using rna easy mini kit (qiagen, germany) based on the protocol recommended by the manufacturer. the extracted rna was dissolved in rnase - free water and kept at 70 c until use. rt - pcr reaction was performed using one - step rt - pcr kit (qiagen, germany) based on the protocol. in each pcr reaction, 5l of the extracted rna and 1l of each specific primer (forward : 5-tggacacc ttcacaaactc-3 and reverse : 5-gac aattccctacacc-3) were added to amplify the small segment (s - segment) of the virus (chinikar. 2004). at next step, 5 l of rt - pcr products were mixed with 1 of loading buffer and the mixture was loaded on 1.5% agarose gel for electrophoresis. dna bands were stained with ethidiumbromide and were visualized under uv trans illuminator (chinikar. rt - pcr products were sequenced by abi genetic analyzer 3130 machine using big dye terminator v3.1 cycle sequencing kit and specific primers (chinikar, shah - hosseini. 2013). the partial sequences around 500 bp of the s - segment were used for phylogenetic analysis (table 2). the multiple alignments were performed using clustal w, for seven sequences of current study and some sequences from gen bank. phylogenetic tree was drawn by maximum - likelihood method with kimura 2-parameter model using mega 5.2 software. bootstrap method with replications of 1000 was used for assessing confidence in phylogenetic tree results. tick infestation rate was accounted as much as 84.2%, 10.53% and 5.27%, in sheep, cows and goats respectively. a subsetof 131 ticks (15.4%) out of 851 ticks was examined to detect cchf virus transcripts (fig. rt - pcr amplification of s - segment of cchf virus produced a pcr band of 536bp (table 1). the results of rtpcr showed an infection rate of 3.8% (n=5) among the tested specimens. molecular results showed cchf virus genome in 6.38% (3/47) and 2.85% (2/70) of ticks from cowand sheep, respectively, while all ticks collected from goat were negative (fig. rt - pcr products of cchf s - segment (536 bp band) found in tick specimens collected in sarpole - zahab county, kermanshah province. lad : 100 bp ladder, pc : positive control, nc : negative control, s1, s2, s3, s4, s5, s6, s7 and s9 : negative samples ; s8 and s10 : positive samples. details of cchf infected ticks and their animal hosts in sarpole - zahab county, kermanshah, western iran the phylogenetic relationship of the isolated cchf sequences from ticks of sarpole - zahab with genbank available sequences was drawn using maximum likelihood method and kimura2 parameter (fig. all the isolates were clustered in asia i clade, closely to matin and sr3 strains of pakistan and newly released strain from afghanistan (lschlger. maximum likelihood phylogenetic tree retrieved from 500bp of cchfv partial s - segment sequences obtained in this study (cchfm14, cchfm16, cchfm18, cchfm22 and cchfm24) and the available data from genbank. the phylogenetic relationship of the isolated cchf sequences from ticks of sarpole - zahab with genbank available sequences was drawn using maximum likelihood method and kimura2 parameter (fig. all the isolates were clustered in asia i clade, closely to matin and sr3 strains of pakistan and newly released strain from afghanistan (lschlger. maximum likelihood phylogenetic tree retrieved from 500bp of cchfv partial s - segment sequences obtained in this study (cchfm14, cchfm16, cchfm18, cchfm22 and cchfm24) and the available data from genbank. our results in this study showed the presence of cchf virus in different regions of sarpol - e - zahab city, kermanshah province. findings of this study are consistent with the results obtained other groups in different regions of the country (tahmasebi. 2010). although hyalomma ticks are the main carriers of the virus in africa, asia, europe and the middle east (swanepoel. 1987, whitehouse 2004, ergnl 2006) the virus was also detected in other genera of both soft and hard ticks (whitehouse 2004) as we found in r. sanguineus. in other studies conducted in western part of iran, cchf virus infection was reported in hy. 2012, nasiri unpublished data). according to our previous study conducted in ardabil province, northwest of iran, studies conducted in west part of iran showed that the genome of cchf virus exists in different species of three genera of hard ticks including hyalomma, rhipicephalus and haemaphysalis. this rate has been reported from 0.2 to 33.3% in previous studies in iran (shirani. 2004, telmadarraiy. 2006, 2007, 2010, 2014, moradi. ticks of hyalomma genus showed an infection rate of 3.36%, while the species of this genus were found to be infected 1.57% to 20% to cchf virus in other studies 2004, telmadarraiy. 2006, 2007, 2010, 2014, moradi. 2012, sarifinia 2012, karimi 2013, mehravaran. 2013, champour. 2014). although 9.09% of rhipicephalus ticks were infected in this study, other groups reported the infection rate between 1.8% to 55% (telmadarraiy. 2010, karimi 2013), therefore it can be concluded that although the hyalomma ticks are usually introduced as the vectors of cchf, this potential exists in other genera as well. comparison of results obtained from different regions of the county showed that ticks collected from central regions were more infected than southern and northern regions. the reason of such infection may be due to the condensation of livestock and the quality of breeding management including poor hygienic conditions of livestock breeding sites. people of sarpol - e - zahab area work in high risk professions in close contact with ticks and animals tissue and blood. therefore, it is instructed to prevent these people from being subjected to different ticks infected with the virus and or infected animals blood or tissue. this study indicates that cchf must be considered as a critical health problem in health centers of sarpole - zahab as well as kermanshah and other neighboring provinces, and appropriate strategies must be used for controlling carrier ticks. future research should be focused on the population of carriers and their infection rate, presence of the virus in domestic animal populations and also humans in other regions of the province in order to present a better picture of the dissemination and epidemiology of the virus in the province. the prevalence of infected to cchf was higher in plain region of the county rather than mountain region. teaching and prevention programs are recommended to people who are in close contact with ticks and animals tissue and blood to prevent from infection. this study indicates that cchf must be considered as a critical health problem in health centers of sarpole - zahab and other neighbouring county, and appropriate strategies must be used for controlling carrier ticks. | background : crimean - congo hemorrhagic fever (cchf) is a feverous and hemorrhagic disease endemic in some parts of iran and caused by an arbovirus related to bunyaviridae family and nairovirusgenus. the main virus reservoir in the nature is ticks, however small vertebrates and a wide range of domestic and wild animals are regarded as reservoir hosts. this study was conducted to determine the infection rate of cchf virus in hard ticks of sarpole - zahab county, kermanshah province, west of iran.methods:from total number of 851 collected ticks from 8 villages, 131 ticks were selected randomlyand investigated for detection of cchf virus using rt-pcr.results:the virus was found in 3.8% of the tested ticks. hyalommaanatolicum, h. asiaticum and rhipicephalus sanguineus species were found to have viral infection, with the highest infection rate (11.11%) in rh. sanguineus.conclusion:these findings provide epidemiological evidence for planning control strategies of the disease in the study area. |
futsal has been growing as a relatively new sport since fifa standardised the regulations and international competitions (i.e., the first world championship was played in 1989, rotterdam, the netherlands). however, from a scientific perspective, there is a lack of research in futsal, in particular when comparing the available research with soccer. previous research carried out in this sport has mainly focused on physiological (lvarez., 2009), injury - related (junge and dvorak, 2010), and psychological aspects (geisler and kerr, 2007). from a performance analysis perspective the available research is limited and the studies have mainly analysed a variety of tactics and match situations. on the one hand, the researchers have studied tactical approaches in futsal (lapresa., 2013). these studies highlighted the importance of tactical systems and space as key indicators when finalising ball possession in futsal. on the other hand, futsal has been studied from tactical modelling and dynamic perspectives (fonseca., 2013 ; according to the futsal laws of the game (fdration internationale de football association, law 3), any player may change places with the goalkeeper without informing the referees or waiting for a stoppage in a match. they may be substituted by a regular field player if their team elects to use this scheme in order to outnumber the defending players, that is, 5 vs. 4. this field player becomes the designated goalkeeper on the court ; and must wear some vest or bib to be identified as such. despite this tactical possibility, up to now there is lack of research concerning the impact of playing 4 vs. 4 or 5 vs. 4 on ball possession effectiveness in futsal. in a recent study, correa. (2014) examined how the goalkeeper as an outfield player affected player s behaviour in futsal. they found that the goalkeeper acting as an outfield player was an effective strategy for attacking in terms of increasing shots at the goal and that each team reduced its defensive area as well as its variability in situations where the goalkeeper acted as an outfield player. however, the available literature exploring team - tactical structures and effectiveness regarding space and task related indicators and situational variables in futsal is limited when all these factors are addressed simultaneously (moore., 2014), probably due to the fact that performance analysis in futsal gathering these variables is complex and nonlinear. therefore multivariate technique is a useful tool when describing the normative profiles of ball possession effectiveness and their association with space and task related indicators and the situational variables. moreover, none of the aforementioned studies have examined the influence of the goalkeeper on ball possession effectiveness. therefore, the aim of the present study was to identify the impact of playing 4 vs. 4 or 5 vs. 4 on ball possession effectiveness in futsal and to determine the best predictors (i.e., space and task related indicators and situational variables) of success in futsal ball possession using the binomial logistic regression. it was hypothesized that ball possession effectiveness in futsal was dependent on space and task performance indicators as well as situational variables and that teams using the 5 vs. 4 pattern would obtain better results than those using 4 vs. 4. the sample consisted of 326 situations of ball possession corresponding to 31 matches played by a team from the spanish futsal league during the 20102011, 20112012 and 20122013 seasons where the goalkeeper played as a regular field player (5 vs. 4, 163 situations) or not (4 vs. 4, 163 situations). they may be substituted by a regular field player if their team elects to use this scheme in order to outnumber the defending players. this field player becomes the designated goalkeeper on the court and must wear some vest or bib to be identified as such. the matches analysed (7 playoff and 24 regular season matches) resulted in 6 wins, 7 draws, and 18 losses. teams play each other twice a season, once during rounds 115 and once during rounds 1630 when the status of home and visiting team is reversed. the playoff league stage is played by the 8 teams classified best during the regular season (played in a balanced schedule of 15 teams), then the playoff includes quarter - final, semi - final and final rounds in a best - of - three - series with a home court advantage predetermined by the regular season results, the best classified team guarantees the home court advantage. it was established into a dichotomous dependent variable successful ball possession (when the offensive team scored a goal) and unsuccessful ball possessions (when the offensive team did not score a goal). variables studied in elite futsal the independent variables were related to space and task related variables and situational variables. the space was studied by the possession ending areas (see figure 1) of the court (7 zones were used according to lvarez., 2004). futsal court zones used in relation to playing tactics (adapted from alvarez., 2004). the task related variables included : (i) participation of the goalkeeper as a regular field player or not (5 vs. 4 or 4 vs. 4) ; (ii) ball possession duration (from 0 to 10 s and more than 10 s) ; (iii) the number of passes (from 0 to 2 passes, 3 to 5 passes and more than 5 passes) ; (iv) the number of players involved (0 2 players, 3 4 players and > 4 players) ; (v) existence of defensive pressure by the opponent (shooting player under pressure and shooting player under no pressure) and (vi) the number of defending players into the offensive influence zone (0 defenders, 1 defender and more than 1 defender). in order to control for situational variables effect, match location (playing at home or away) and match status (1 goal up, 1 goal down, 2 or more goals up, 2 or more goals down, level score) were included as independent variables. the observational analysis was developed by one experienced observer (graduated in sports sciences with ten years of experience as a coach) trained for this task during two months. in order to asses intra - observer reliability (weighted kappa correlations coefficients) 33 randomly ball possession situations were observed again after a 4 week period (odonoghue and holmes, 2015). the intra - observer reliability results were very with good kappa values (0.98) (altman, 1991). firstly, a binary logistic regression model was used to assess the relationship between offensive, defensive and situational variables according to ball possession offensive effectiveness. the dependent variable used in the model was y { 0,1 }, with 0 (1) values for unsuccessful (successful) ball possession (willoghby, 2002). the binomial logistic regression model was expressed as follow : 0 is the constant of the equation and the independent variables were gp = goalkeeper participation, d = duration, l = length, npi = number of players involved, defp = defensive pressure, defd = defensive density, sz = shot zone, s = score and ml = match location ; i was the disturbance term. this non - linear regression model estimates the regression coefficients that represent the estimated change in the log - odds, corresponding to a unit change in the corresponding explanatory variable conditional on the other explanatory variables remaining constant (landau and everitt, 2004). the odds ratios (or) and their 95% confidence intervals (ci) were also determined. secondly, the chisquare test was used to identify the influence of the independent variables on ball possession effectiveness. both statistical analyses were performed using ibm spss statistics for windows version 20.0 (armonk, ny ; ibm corp.). the sample consisted of 326 situations of ball possession corresponding to 31 matches played by a team from the spanish futsal league during the 20102011, 20112012 and 20122013 seasons where the goalkeeper played as a regular field player (5 vs. 4, 163 situations) or not (4 vs. 4, 163 situations). they may be substituted by a regular field player if their team elects to use this scheme in order to outnumber the defending players. this field player becomes the designated goalkeeper on the court and must wear some vest or bib to be identified as such. the matches analysed (7 playoff and 24 regular season matches) resulted in 6 wins, 7 draws, and 18 losses. teams play each other twice a season, once during rounds 115 and once during rounds 1630 when the status of home and visiting team is reversed. the playoff league stage is played by the 8 teams classified best during the regular season (played in a balanced schedule of 15 teams), then the playoff includes quarter - final, semi - final and final rounds in a best - of - three - series with a home court advantage predetermined by the regular season results, the best classified team guarantees the home court advantage. all the variables included are defined in table 1. the dependent variable was ball possession offensive effectiveness. it was established into a dichotomous dependent variable successful ball possession (when the offensive team scored a goal) and unsuccessful ball possessions (when the offensive team did not score a goal). variables studied in elite futsal the independent variables were related to space and task related variables and situational variables. the space was studied by the possession ending areas (see figure 1) of the court (7 zones were used according to lvarez., 2004). futsal court zones used in relation to playing tactics (adapted from alvarez., 2004). the task related variables included : (i) participation of the goalkeeper as a regular field player or not (5 vs. 4 or 4 vs. 4) ; (ii) ball possession duration (from 0 to 10 s and more than 10 s) ; (iii) the number of passes (from 0 to 2 passes, 3 to 5 passes and more than 5 passes) ; (iv) the number of players involved (0 2 players, 3 4 players and > 4 players) ; (v) existence of defensive pressure by the opponent (shooting player under pressure and shooting player under no pressure) and (vi) the number of defending players into the offensive influence zone (0 defenders, 1 defender and more than 1 defender). in order to control for situational variables effect, match location (playing at home or away) and match status (1 goal up, 1 goal down, 2 or more goals up, 2 or more goals down, level score) were included as independent variables. the observational analysis was developed by one experienced observer (graduated in sports sciences with ten years of experience as a coach) trained for this task during two months. in order to asses intra - observer reliability (weighted kappa correlations coefficients) 33 randomly ball possession situations were observed again after a 4 week period (odonoghue and holmes, 2015). the intra - observer reliability results were very with good kappa values (0.98) (altman, 1991). firstly, a binary logistic regression model was used to assess the relationship between offensive, defensive and situational variables according to ball possession offensive effectiveness. the dependent variable used in the model was y { 0,1 }, with 0 (1) values for unsuccessful (successful) ball possession (willoghby, 2002). the binomial logistic regression model was expressed as follow : 0 is the constant of the equation and the independent variables were gp = goalkeeper participation, d = duration, l = length, npi = number of players involved, defp = defensive pressure, defd = defensive density, sz = shot zone, s = score and ml = match location ; i was the disturbance term. this non - linear regression model estimates the regression coefficients that represent the estimated change in the log - odds, corresponding to a unit change in the corresponding explanatory variable conditional on the other explanatory variables remaining constant (landau and everitt, 2004). the odds ratios (or) and their 95% confidence intervals (ci) were also determined. secondly, the chisquare test was used to identify the influence of the independent variables on ball possession effectiveness. both statistical analyses were performed using ibm spss statistics for windows version 20.0 (armonk, ny ; ibm corp.). the level of significance was set at p 0.05. distribution of relative frequencies from the studied variables results from the binary logistic regression analysis (table 3) showed that there were significant relationships between ball possession effectiveness and the participation of the goalkeeper as a regular field player (5 vs. 4) or not (4 vs. 4) (p<0.01), possession duration (p<01), passes used (p<.05), shot zone (p<.01) and defensive density in the offensive influence zone (p<.01). results of success in ball possession as a function of performance indicators in a futsal team. results from the pearson s chi - squared test indicated significant relationships between ball possession effectiveness and goalkeeper participation, defensive pressure, duration time, defensive pressure, defensive density and the shot zone (table 4). model and fit information for the frequency of performance indicators according to ball possession offensive effectiveness. the highest ball possession effectiveness was achieved by the team when the goalkeeper participated as a regular field player (5 vs. 4 ; p<0.05), the duration of the ball possession was less than 10 s (p<0.05), ball possession ended in the penalty area (p<0.01) and the defensive pressure was low (p<0.05). the aim of this study was to identify which variables were the best predictors of success in futsal ball possession when controlling for space and task related indicators and situational variables. firstly, up to now this is one of the first studies that have analyze the participation of the goalkeeper as a regular field player on success in futsal. moreover, we used logistic regression, an appropriate statistical method for comparisons of categorical differences associated with binary response variables (nevill., 2002). for the main variable i.e. goalkeeper participation, results from logistic regression analyses showed that success in ball possession was higher when the goalkeeper participated as a regular field player (5 vs. 4) than when the team played 4 vs. 4. (2014) who found that the goalkeeper acting as an outfield player was an effective strategy for attacking in terms of increasing the number of shots at the goal. results from the current study showed that the probability for scoring a goal was 3.6 times higher when the team attacked with the goalkeeper as a regular field player (5 vs. 4). the assessment of opponent interactions revealed that playing against low defensive pressure increased offensive effectiveness. the differences in the study design and variable types as well as their definitions make a direct comparison between studies that had assessed opponent interactions and situational variables difficult. harris and reilly (1988) showed that defence against attacks with a shot on target, compared with those without a shot, tended to involve higher attacker to defender ratios and greater average distances between the attacker in possession and the nearest defender throughout the attack. according to grehaigne (1991), the overall attacking configuration with adequate space and time and the opponent s defence with its centre of gravity out of the position had a positive effect on the scoring of 10 of 33 goals. again in soccer, seabra and dantas (2006) reported a higher proportion of successful shooting attempts for ball receptions and shots originating from zones of low defensive confrontation than of high defensive confrontation. (1997) showed more scoring opportunities and goals from breakdown attacks (counterattacks) started when the opposition defence was imbalanced rather than balanced. (2010), the tactics of balanced defence (tight pressure, present backup and present cover) are more effective in preventing score - box possession than the opposite tactics of imbalanced defence (loose pressure, absent backup and absent cover). for the duration variable, results showed that short possession was more effective than long possession. to our knowledge, no studies had examined this variable before. the current finding is in accordance with some previous studies in soccer (bate, 1988 ; reep and benjamin, 1968), but different from those of tenga. data from the study of reep and benjamin (1968) and hughes and franks (2005) demonstrated that more shots were indeed produced from shorter passing sequences. significant differences were found when analysing success in ball possession and the area in which the possession ended. the highest ball possession effectiveness was achieved when the teams ended ball possession in the penalty area (zone 1) and they were the ones which had the highest rate of occurrence (47.2%). (2004) who found that approximately 80% of the shots that achieved a goal came from within 10 m of the goal. the unexpected non - significant independent influence of the match location and match status on success in ball possession probability could be explained by the fact that situational variables would have unique effects on individual players, teams and playing styles (barnett and hilditch, 1993 ; bloomfield., 2005 ; clarke and norman, 1995 ; lago, 2009). in terms of the limitations of the present study, the attacking performance of a single elite soccer team was analysed and consequently the results obtained could be a reflection of the playing standard or style of this particular team, so care should be taken when extrapolating these results to other teams. | abstractthe aim of this study was to identify which variables were the best predictors of success in futsal ball possession when controlling for space and task related indicators, situational variables and the participation of the goalkeeper as a regular field player or not (5 vs. 4 or 4 vs. 4). the sample consisted of 326 situations of ball possession corresponding to 31 matches played by a team from the spanish futsal league during the 20102011, 20112012 and 20122013 seasons. multidimensional qualitative data obtained from 10 ordered categorical variables were used. data were analysed using chi - square analysis and multiple logistic regression analysis. overall, the highest ball possession effectiveness was achieved when the goalkeeper participated as a regular field player (p<0.01), the duration of the ball possession was less than 10 s (p<0.01), the ball possession ended in the penalty area (p<0.01) and the defensive pressure was low (p<0.01). the information obtained on the relative effectiveness of offensive playing tactics can be used to improve team s goal - scoring and goal preventing abilities. |
this paper focuses on estimates of the australian population 's (including women of child bearing age, the target group for folic acid fortification) intake of folic acid from voluntary and mandatory fortified foods, and not their intake of total dietary folate from all foods consumed. folic acid as used in this paper refers to added folic acid in the fortified foods reported as consumed by the respondents of the two national food consumption datasets used for the dietary modelling. folic acid is the chemical form of folate normally used by the food industry as a fortificant. fsanz is able to estimate the target population 's intake of folic acid because the australia new zealand food standards code (the code) clearly specifies foods that can be fortified under the voluntary and mandatory fortification permissions. before implementation of the mandatory folic acid fortification standard, specific foods in the australian market could be fortified under the voluntary folic acid permission outlined in standard 1.3.2 of the code. it was therefore possible to identify these foods that individuals reported as consumed and apply a factor accounting for the relevant market share of fortified to unfortified product in the dietary modelling, using data obtained from the food industry for each food category. where permissions for foods or food groups to be voluntarily fortified with folic acid had not been taken up by industry, these foods or food groups were not included in the model. in addition, because the mandatory folic acid fortification standard relates only to wheat flour for baking bread, it was possible to identify foods consumed that have been fortified with folic acid under the mandatory standard. the estimates did not take into account naturally occurring folates in the foods consumed by the respondents, or folic acid from the use of folic acid supplements or multivitamin supplements containing folic acid. in developing the folic acid fortification standard, estimates of natural folate and total dietary folate equivalent intakes for the australian population were previously presented by fsanz and are not further discussed here. although the total folate contents of the bread samples were also determined, they are not presented in this paper but were used to validate our folic acid content results and for updating the national food composition database, which fsanz maintains. australia implemented mandatory folic acid fortification of wheat flour for making bread in september 2009. the purpose was to reduce the incidence of neural tube defects (ntds) by increasing the intake of dietary folic acid among women of child - bearing age (1644 years), the target population. it had been estimated that between 300 and 350 pregnancies were affected by ntds each year in australia and that the numbers were higher in indigenous communities. the total dietary folate intake of the target population had remained well below recommended levels despite the various health programs that had been initiated since 1993 to encourage women of child - bearing age to increase their intake of foods high in natural folates and/or folic acid supplements. in australia, the exemption allows the organic wheat flour milling industry and bread manufacturers to comply with the fair trading legislation (australia, trades practices act 1974), which takes precedence over the code. wheat flour for making bread was selected as the food vehicle for fortification because bread is widely consumed by the population, including the target group. in proposing the mandatory folic acid fortification level for wheat flour, fsanz considered a number of national scenarios, available scientific evidence, and the experiences of other developed countries that had instituted mandatory folic acid fortification of flour. the fortification level was set as a range of 200300 g folic acid per 100 g wheat flour. the australian level has been set as a range to reduce industry overages, taking into account that a degree of uncertainty exists with regard to the effects of long - term increased folic acid intake by the nontarget population, especially children. countries such as the united states of america (usa) and canada that have mandated folic acid fortification of wheat flour have not prescribed a fortification range. for example, the usa food standard requires each pound of enriched flour (fortified flour) to contain 0.7 milligrams of folic acid. this translates to approximately 154 g folic acid per 100 g of flour. in canada flour, white flour, enriched flour, or enriched white flour are required to contain 150 g folic acid per 100 g of flour. in australia, the mandated level of folic acid in wheat flour for making bread was expected to increase the average intake of folic acid among the target group by 100 g / day. this would be above the levels already achieved through use of foods voluntarily fortified with folic acid and use of dietary supplements. it had been estimated that the target population 's intake of folic acid from voluntarily fortified foods (including breakfast cereals and yeast - based spreads) was about 108 g folic acid per day. the estimated additional 100 g folic acid from mandatory fortification of bread was expected to increase total folic acid intake (from voluntary and mandatory fortified foods) and bring about the reduction in number of ntd - affected pregnancies by up to 14%. fsanz 's role in determining the postfortification levels of folic acid in bread and assessing the population 's (including the target group) intake of dietary folic acid is part of the national activities to monitor the mandatory folic acid fortification standard, which includes monitoring of ntd affected pregnancies. the monitoring activities for australia and new zealand are described in two recent reports published by the australian institute of health and welfare (aihw), with pre - fortification data for the prevalence of ntds in australia also recently published by the aihw. to measure the amounts of folic acid in breads sold in the country, a survey of breads was undertaken in june / july 2010, nine to ten months after implementation of the mandatory fortification standard. one hundred samples from seven bread categories were purchased from grocery shops and bakeries in the capital cities of all states and territories. the bread types were selected based on both their market share and on the need to capture the types generally consumed nationwide. samples were transported under refrigeration to the national measurement institute 's analytical laboratories in melbourne, australia. at the laboratory, each individual loaf was weighed (all slices plus the two crusts) and divided into two halves. one half was left to dry at ambient temperature and the other labelled and frozen. following the drying, all the samples were individually reweighed, homogenised thoroughly and stored in labelled air - tight containers to be used for the required chemical analyses. a portion of the homogenised material for each bread sample was then taken and prepared for folic acid and total folate analyses. the amount of folic acid in the samples was determined using a modified form of the triple enzyme microbiological method aoac 2004.5 that is accredited by the national accreditation association of testing authorities, australia (nata). the method eliminated the protease and conjugase digestion steps from the tri - enzyme digestion for measuring total folate using lactobacillus casei (spp rhamnosus) atcc 7469. the limit of detection for folic acid was 3 g/100 g. the results obtained provided information on the amount of folic acid present in each of the 100 individual bread samples purchased. the folic acid analytical results from the bread survey were used for the intake assessment. to determine folic acid intake before mandatory fortification, the nutrient data released in ausnut 2007 were used to estimate folic acid intakes from voluntarily fortified foods such as breakfast cereals, juices, and yeast - based spreads. most of the folic acid values in ausnut for fortified foods were determined using the same triple enzyme microbiological method, although some were developed using imputation and recipe calculations. food consumption data from 24-hour recalls of the 1995 australian national nutrition survey (1995 nns) and the 2007 australian national children 's nutrition and physical activity survey (2007 ancnpas) were used in estimating the dietary intake of folic acid by the target group and other sub - groups of the population. the 1995 nns sampled approximately 13,858 respondents aged two years and above from urban and rural areas in all states / territories, from february 1995 to march 1996. approximately 10% of the nns participants provided a second 24-hour period food recall on a nonconsecutive day. the 2007 ancnpas collected data on food and nutrient intake, physical activity levels, and physical measurements from 4,487 children aged 216 years across australia. participants were asked to recall all food, drink, and dietary supplements they had consumed in the previous 24 hours. in a follow - up telephone interview held one to three weeks later, participants were again asked to recall food, drink, and supplements consumed the previous day. the survey used stratified sampling with nonproportional samples, and was conducted between february and august 2007. in both surveys, each food and beverage consumed was described in sufficient detail to allow its nutrient composition to be determined. for this investigation, only data for those aged 17 years and above was used from the 1995 nns because of the newer food consumption data from the 2007 ancnpas for 2 to 16 year olds. fsanz 's custom - built dietary modelling program (diamond) was used to estimate folic acid intakes. usual intake due to the nonnormality of the distribution of folic acid intakes. because the 1995 nns data captured two days of food consumption for only 10% of respondents, the data used to estimate the two - day average folic acid intakes were for only those respondents with both day 1 and day 2 food recalls. this restricted the number of respondents available for analysis, and the estimates produced may not be fully representative of the total population of women of child - bearing age. for example, while there were 3,178 female respondents aged 1644 years in the 1995 nns data, the number of consumers in the age group was reduced to 328 when food consumption data for only those with both day 1 and day 2 recalls were compiled. similarly, although there were 10,851 consumers in the 19 + age group for day 1 consumption data, the number was reduced to 1,163 when data were compiled for those with both day 1 and day 2 food recalls. the estimated dietary folic acid intakes were based on the amounts of folic acid in the fortified foods consumed by the respondents in the 1995 and 2007 surveys. data were available for the folic acid content of breads that had been mandatorily fortified, foods that had been voluntarily fortified, and mixed foods containing bread or other folic - acid - fortified foods as ingredients. for each individual included in the dietary modelling, daily intake of folic acid (g / day) was estimated by multiplying the concentration of folic acid (g/100 g) in each fortified food by the amount of that food consumed (g / day), and summing this across all the fortified foods consumed. intake estimates were generated for two scenarios, before (voluntary fortification only) and after mandatory fortification of wheat flour for making bread. data were not available for the 1995 nns and although data on supplement consumption were available from the ancnpas, few children consumed supplements containing folic acid. the mean amount of folic acid in the five main bread categories (white sandwich bread, wholemeal breads, multigrain and seeds bread, english muffins and flat breads / wraps) was 185 g per 100 g bread (range 165 to 200 g/100 g). the lowest levels were found in gluten - free and organic breads which are not required to be made from folic - acid - fortified wheat flour (see table 1). factors that are likely to have influenced the measured levels of added folic acid include : the proportion of folic - acid - fortified flour used in the bread recipe, which is higher in white breads than in grain and seed breads, and in flat breads compared to sandwich loaf breads;flour production practices in australia, where wholemeal flour is produced from fortified white flour to which unfortified grain constituents are returned ; folic acid degradation during production, baking, and storage ; water loss from the dough during baking, which is higher in flat breads than in loaf breads;presence of naturally occurring free folic acid (if any). the proportion of folic - acid - fortified flour used in the bread recipe, which is higher in white breads than in grain and seed breads, and in flat breads compared to sandwich loaf breads ; flour production practices in australia, where wholemeal flour is produced from fortified white flour to which unfortified grain constituents are returned ; folic acid degradation during production, baking, and storage ; water loss from the dough during baking, which is higher in flat breads than in loaf breads ; presence of naturally occurring free folic acid (if any). mean daily folic acid intake of the target population and of other sub - groups of the population increased after the introduction of mandatory folic acid fortification of wheat flour for making bread. the postfortification dietary folic acid intake of the target group was estimated to have increased by 159 g / day. the increase in intake was around 20% higher among the nontarget adult population because of the higher consumption of bread by men than women. for both adult groups, the estimated increases in mean folic acid intake for the target group and other age groups of the australian population, following mandatory folic acid fortification of wheat flour, are shown in table 2 and figure 1. the tenth and ninetieth (90th) percentiles were selected to represent a usual low daily intake and a usual high daily intake of folic acid, respectively. the tenth and ninetieth (90th) percentile folic acid intakes for the target group and other population sub - groups, before and after mandatory folic acid fortification of bread, are given in table 3. the estimated dietary folic acid intakes were compared to the upper level of intake (ul the highest average daily nutrient intake level likely to pose no adverse health effects to almost all individuals in the general population.) for folic acid for the target group and other age groups. table 4 shows the proportion of the target and the nontarget population groups with daily folic acid intakes above the ul for their age group. only 1% or less of the target group and of all adults exceeded the folic acid ul before and after fortification. a higher proportion of children in the 2 to 16 years age group exceeded the ul after fortification than before fortification. the presence of measurable levels of folic acid in all the breads that are required to be made with fortified wheat flour indicates that this requirement has been implemented by bread manufacturers. the low levels of added folic acid in some gluten - free and organic breads indicate that there is some voluntary use of folic acid in these breads, which are not required to be made with folic - acid - fortified flour. the short sample collection period may generate some inaccuracies when used to estimate folic acid intakes, because the samples may not reflect longer - term fortification levels. there is also measurement uncertainty associated with folic acid analysis in this bread survey and in earlier surveys of voluntarily fortified foods. the levels of folic acid measured in the breads surveyed were higher than what was predicted before the implementation of the standard. there may be several reasons for this, including flour fortification occurring at the upper end of the permitted fortification range rather than the midpoint, and the loss of folic acid on baking and storage being less than predicted. additional sampling and analysis of breads at subsequent time points would be helpful for future monitoring. the same finding was observed in the us after the introduction of mandatory folic acid fortification in that country. using food consumption data from the 1995 nns to estimate the folic acid intake in the target group introduces some additional uncertainty into the analysis, because consumption patterns may have changed since 1995. the true impact of mandatory fortification may therefore be different to what has been estimated here. the notably higher intakes seen in teenagers, estimated using 2007 consumption data, compared to adults estimated using 1995 data, suggest that current adult folic acid intakes may actually be higher than the estimated postfortification intakes. the differences may be due to an increased number of voluntarily fortified foods or to changes in the amounts of bread consumed between 1995 and 2007. the assumptions about market share and product formulation used to assign folic acid levels to voluntarily fortified foods and to mixed dishes in some of the data preparation could also introduce other inaccuracies. to address some of these limitations estimates based on current australian population food consumption data need to be undertaken in the future. the nutrition and physical activity component of the 201113 australian health survey being conducted by the australian bureau of statistics, will provide new and more appropriate population data on the amounts of food consumed and proportion of the population consuming breads and other fortified foods for future estimates. however, inaccuracies due to the use of a 24-hour recall method, such as over or under estimation of food consumption amounts, potentially affect all intake estimates provided. mandatory folic acid fortification of bread has resulted in women of child - bearing age having higher estimated intakes of folic acid and bringing their daily intake closer to 400 g / day, the amount recommended for a reduced incidence of ntds. the estimated mean total daily intake was more than one - half of the recommended level when intakes of folic acid from mandatory and voluntarily fortified foods were taken into account. among women whose usual intakes were low (represented by the tenth percentile of intake), mandatory fortification has had a particularly marked effect, increasing their estimated intake from less than 5% of that recommended to a quarter of the recommended amount. however, for the majority of the target group, dietary supplements would be required to achieve the recommended daily intake of folic acid. the proportion of children aged 28 years that potentially exceed the ul for folic acid after mandatory fortification, was predicted in the pre - fortification estimates. this prediction was a constraint on the level of folic acid that was mandated to be added to wheaten bread flour. although the proportion of children who potentially exceed the relevant ul steadily decreases with age, the possible health risks of high folic acid intake require scrutiny particularly because the requirements for children are based on extrapolations from studies conducted with adults. fsanz is keeping a watching brief on research in this area, including the aihw reports of all monitoring activities and the review process for the national health and medical research council nutrient reference values for australia and new zealand, which the australian commonwealth department of health and ageing has commenced. in addition, fsanz will reassess folic acid and iodine intake levels for the australian population (target and nontarget groups) when more up - to - date food consumption data from the 20112013 australian health survey become available in late 2013. based on the recent survey of breads in the food supply, mandatory folic acid fortification of wheaten bread flour in australia has increased the estimated dietary folic acid intake in women of child - bearing age (the target population). it has also brought about an increase in the estimated dietary intake of folic acid for nontarget population groups, irrespective of age. the estimated increases in mean dietary folic acid intakes after fortification exceed the estimates made during development of the mandatory folic acid fortification standard. as predicted, the estimated increase in intakes in women of child - bearing age falls short of the recommended folic acid intake of 400 g folic acid per day, without additional use of dietary supplements. | mandatory folic acid fortification of wheat flour for making bread was implemented in australia in september 2009, to improve the dietary folate status of women of child - bearing age, and help reduce the incidence of neural tube defects in the population. this paper presents estimates of folic acid intake in the target population and other subgroups of the australian population following implementation of the mandatory folic acid fortification standard. in june / july 2010 one hundred samples from seven bread categories were purchased from around the country and individually analysed for the amount of folic acid they contained. a modification to the triple enzyme microbiological method was used to measure folic acid in the individual bread samples. the folic acid analytical values together with national food consumption data were used to generate estimates of the population 's folic acid intake from fortified foods. food standards australia new zealand 's (fsanz) custom - built dietary modelling program (diamond) was used for the estimates. the mean amount of folic acid found in white bread was 200 g/100 g which demonstrated that folic - acid - fortified wheat flour was used to bake the bread. the intake estimates indicated an increase in mean folic acid intake of 159 g per day for the target group. other sub - groups of the population also showed increases in estimated mean daily intake of folic acid. |
micro- and nanoscale photonic devices require miniaturized glass - based photonic components. in this context, silica nanofibers have a great potential as low - loss waveguides for nano - optics and microphotonics applications. the large tensile strength of these fibers allows for the development of micro- and nanomechanical springs and levers. various techniques have been proposed for the fabrication of nanofibers, such as high - temperature taper - drawing and electrospinning. this is due to the fact that femtosecond laser pulses do not interact with the ejected particles, thus avoiding complicated secondary laser - material interactions. further, the material reaches extreme temperature and pressure and cools down in a very short time. this leads to material states which can not be produced using longer pulses of comparable energy. although previous investigations on femtosecond laser nanostructuring of materials showed the formation of silicon nanotips, nanobumps in thin gold films, thin rims in borosilicate glass and nanofibers in chalcogenide glass using femtosecond laser radiation with khz repetition rate, the growth of glass nanofibers at mhz repetition rate under ambient condition has not been reported. in a previous study, we report the synthesis of weblike nanoparticles aggregate of silicon and metallic materials using mhz frequency femtosecond laser radiation under ambient condition and is explained by the theory of vapor condensation. in the present work, we aim to study the unique growth of nanofibers of silica and borosilicate glass using femtosecond laser radiation at mhz repetition rate under ambient condition, which is defined by rather a different mechanism. a direct - diode pumped yb - doped fiber amplified ultrafast laser system (= 1,030 nm) capable of delivering a maximum output power of 15 w average power at a pulse repletion rate ranging from 200 khz to 26 mhz is employed in this experiment. in the present case, arrays of microvias were drilled on silica and borosilicate glass specimens using laser radiation with a repetition of 8 mhz and pulse width 214 fs. the laser beam is focused on the substrate surface and scanned using a computer controlled galvanometer system. sem micrographs of nanofibers generated in borosilicate and silica glass materials using femtosecond laser radiation at a pulse frequency of 8 mhz and pulse width 214 fs are presented in figs. it appeared from sem observations that nanofibers are grown both parallel and perpendicular to the substrate surface from the molten material in laser drilled microvias. fibers grown perpendicular to the substrate are intertwined and bundle up above the surface (figs. 2b, c,3a c), while fibers grown parallel to the surface are attached to the substrate (fig. sem images of laser - processed borosilicate glass sem images of laser - processed silica glass processing of dielectric materials for example glass using femtosecond laser radiation involves steps such as nonlinear absorption, plasma formation, shock wave propagation, melt propagation, and resolidification. laser radiation energy is absorbed by the electrons in materials through multiphoton and avalanche ionization and then transferred to the lattice within few picoseconds, after which heat diffusion into material begins. at the same time, the ionized material is removed from the surface through ablation in the form of an expanding high pressure plasma. a smaller portion of the absorbed energy from laser radiation remains in the material as thermal energy. since glass does not have a latent heat of melting, all of this energy is used for melting. the melt time and the pulse repetition rate the lifetime of the molten material is determined by the time in which the energy diffuses into the substrate. the estimated melt time based on one - dimensional heat conduction model for glass varies between 0.4 and 0.8 s, which is longer than the pulse separation time of 0.125 s used in the present experiment. as a result, resolidification of molten material throughout the irradiation process is avoided. furthermore at 2 mhz, the pulse separation time is 0.5 s, which is longer than the melt time, only resolidified particles are observed on the irradiated surface. the forces acting on the molten material are interacting capillary forces coupled with thermal processes (marangoni force) and hydrodynamic forces exerted by the plasma above the surface. the temperature gradient on the molten surface, which follows the gaussian intensity profile of the laser beam induces the thermocapillary flow. the temperature gradient in turn creates surface tension gradient that drives material from the hot center to the cold periphery. this behavior is expected in most materials where the surface tension decreases as the fluid gets hotter in the center. however, with glass the surface tension gradient is positive, and as a result the thermocapillary flow would actually drive fluid from the cold periphery to the hot center. this is in contrast to the one observed in our experiments where the nanofibers are grown along and perpendicular to the substrate surface. by taking into account of the pressure gradient created by ablation plume, the strong temperature gradients produced by the tightly focused femtosecond laser pulses generate acceleration of the molten liquid at the melt / air interface. this acceleration as well as the plasma plume induces a pressure gradient from the center toward the periphery in the molten liquid of the laser - drilled microvias. the highly energetic droplets that are formed inside the molten material are moved to the exterior of the laser - drilled microvias due to pressure gradient in the molten liquid and provide the heads of nanojets which eventually draws the fiber from the melt and because of shorter duration of the laser pulse the fibers drawn are immediately solidified. further, subsequent laser pulses are not interacting with the nanofibers that are grown perpendicular to the surface. this argument is supported by the calculated timescale for marangoni flow in glass which is three orders of magnitude longer than the pressure driven flow. therefore, marangoni effect is not playing a significant role in the formation of these nanofibers for the conditions used in the experiment. hence, the large plasma pressure above the molten surface acts to move the fluid more quickly than do the surface tension gradients. further, it is observed that the use of nitrogen background gas at atmospheric pressure suppresses the fiber growth. with nitrogen background gas the plume expansion will be slowed down due to collisions between vapor species and the gas atoms. since the repetition rate is in mhz range, laser dwell time (interaction time) also plays a role in nanofiber growth. for a dwell time of 0.1 ms, the laser radiation is not making any change in the surface. for 0.5 ms, the melting threshold reached within few microseconds of irradiation and thereafter the melt is maintained by the subsequent laser pulses. edx analysis of the nanofibers shows that there is no significant change in composition when compared to the untreated glass surfaces. microraman spectra of the unprocessed substrate and processed nanofibers of silica glass are presented in fig. the intensity of the spectrum of nanofibers in laser - irradiated surfaces is much higher than the untreated surface. moreover, a slight increase in intensity at 603 cm peak is observed in the spectrum of nanofibers. the raman peaks at 487 and 603 cm are due to breathing modes from 4- to 3-membered ring structures in the silica network. the increase in intensity corresponds to an increase in relative number of these ring structures in the glass network. in summary, we report a characteristic growth of nanofibers of silica and borosilicate glass using femtosecond laser radiation at 8 mhz repetition rate and a pulse width of 214 fs under atmospheric pressure. the fibers are grown perpendicular to the substrate, intertwined and stands above the surface. the nanofiber growth is explained by the formation of nanojets in the molten material and drawn into fibers by high plasma pressure. further studies are required to find the suitability of these nanofibers as waveguides for nanophotonic applications. | we report the unique growth of nanofibers in silica and borosilicate glass using femtosecond laser radiation at 8 mhz repetition rate and a pulse width of 214 fs in air at atmospheric pressure. the nanofibers are grown perpendicular to the substrate surface from the molten material in laser - drilled microvias where they intertwine and bundle up above the surface. the fibers are few tens of nanometers in thickness and up to several millimeters in length. further, it is found that at some places nanoparticles are attached to the fiber surface along its length. nanofiber growth is explained by the process of nanojets formed in the molten liquid due to pressure gradient induced from the laser pulses and subsequently drawn into fibers by the intense plasma pressure. the attachment of nanoparticles is due to the condensation of vapor in the plasma. |
increasing longevity is one of the great achievements of our civilization, but it has also given rise to discussion about good and successful aging. the concept of successful aging has attracted much debate, but there is still no universally accepted definition or standard measurement tool for it. the encyclopedia of aging defines successful aging as survival (longevity), health (lack of disabilities), and life satisfaction (happiness). it appears that the main sources of difficulty lay in the ambiguity of the meaning of success, in the complexity of the aging process, the rapid changes taking place in society, and the changing characteristics of the older population. discussions on successful aging have taken two main perspectives : one defines successful aging as a state of being, while the other understands it as a process of adaptation, described as doing the best with what one has. studies taking the adaptation approach have often found that older people themselves feel they are aging successfully, even though traditional quantitative models say otherwise [3, 4 ]. successful aging as a state of being, then, is an objective measurable condition at a certain point in time, demonstrating the positive extreme of normal aging. the most influential model of successful aging as a state of being was introduced by rowe and kahn [58 ], who characterize success as absence of disease and disability, maintained physical and mental functioning, and active engagement with life. many studies and definitions take the view that successful aging is possible only among individuals without disease and impairment. obviously such categorizations are likely to exclude most older people, typically the oldest - old, from the possibility of successful aging. still, according to bowling, longevity is only rarely mentioned in lay or biomedical definitions. in studies using quantitative measures, younger age is one of the most regular predictors of successful aging [10, 11 ], and the rate of success drops dramatically in very old age. indeed, several researchers have emphasized the need to use multidimensional models and to adopt different conceptual approaches to studying different age groups [3, 12 ]. recently, young. suggested that successful aging may coexist with diseases and functional limitations if compensatory psychological and social mechanisms are used. their model considers three important principles : the heterogeneity of aging, multiple pathways to successful aging, and individual compensation mechanisms to adjust for age - related changes. the oldest - old group of nonagenarians meets the key biomedical criterion of successful aging that is longevity. they are also a rapidly growing age group that is heterogeneous in terms of health and functioning : a large majority have some health problems but are independent in basic everyday activities. in this study, we investigate successful aging in an unselected population of nonagenarians, applying several different models that include physical, social, and psychological dimensions. the models differ with respect to the threshold for success on the physical, social, and psychological dimensions. our aim is not to introduce an ideal or universal model, but rather to demonstrate the variation in the prevalence of successful aging by applying different criteria. the first objective of this study was to construct six different models of successful aging and to use these models to estimate the prevalence of successful aging among nonagenarians. the second objective was to investigate whether successful aging in nonagenarians, defined in several different ways, is associated with sociodemographic factors. the vitality 90 + study is a population - based multidisciplinary research program on nonagenarians in the city of tampere, finland. in the context of this program, mailed surveys were conducted with all community - dwelling people in 1996 and 1998, and with both community - dwelling and institutionalized people four times since 2001. a questionnaire was sent to all individuals aged 90 or over in tampere (n = 1630). proxy responses were obtained from 22% of the subjects who were themselves unable to answer the questions. for additional 20%, the respondent chose the answers but someone else helped in reading the questions or writing down the answers. we explored the associations of five sociodemographic factors with successful aging : age, sex, marital status, level of education, and place of living. age was categorized into three groups : 90 - 91, 92 - 93, and 94107. marital status was classified as currently married and currently unmarried, including never married, divorced, and widowed. education was categorized into four groups as low (no more than elementary schooling), middle (lower secondary school), high (vocational school, folk high school, or upper secondary school), and highest (college and academic education). place of living was dichotomized as community (private and service housing) and institution (residential care, service housing with 24-hour assistance, and hospitals). it was described by six different models that were constructed using psychical, social, and psychological indicators. the participants were asked whether they had been told by a doctor that they had (1) a heart problem, (2) stroke, (3) circulatory problems in the brain, (4) diabetes, (5) arthritis, (6) parkinson 's diseases, (7) hip fracture, or (8) dementia or memory problems. for the measurement of functional ability, the participants were asked whether they were able to perform independently (a) three mobility activities : moving about indoors, walking 400 meters, using stairs and (b) two adl activities : getting in and out of bed and dressing and undressing. the response options, (1) yes, without difficulty ; (2) yes, with difficulty ; (3) only with help ; (4) not at all, were categorized as independent (1 + 2) and dependent (3 + 4). the participants were also asked whether they were able to read the newspaper, with glasses if they used glasses (vision), and to hear what another person was saying when they were alone with them, with hearing aid if they used a hearing aid (hearing). the participants were asked whether they suffered from depression or had depressive feelings (yes, no). present self - rated health was categorized as average or good (very good, fairly good, and average) and poor (fairly poor and poor). self - rated health was included in the psychological components because it is a subjective measure with no predetermined criteria : it reflects not only the more objective components of health, but also and importantly the age - related way in which the individual adjusts and adapts to different health problems. the participants were also asked whether they thought it was good for people to live to be 100 years (yes, no). the social component was measured by two questions : the frequency of meetings with children (six categories from today or yesterday to several years ago) and the frequency of talking on the phone with family members or friends (six categories from today or yesterday to several years ago). if these participants had had telephone contacts during the past two weeks, they were categorized as having had contact with children. part of the reason for this was that these questions were not asked of proxy respondents. to avoid reducing the number of participants in the analyses, we categorized both proxy responses and other missing values in these two variables at the negative extreme (poor self - rated health and thinking that it is not good to live to be 100). this imputation was done to avoid overestimation of the prevalence of successful aging, which would happen if the frailest participants were lost from the analyses. following rowe and kahn and young., we defined successful aging as consisting of three components as shown in figure 1. the main differences between the models are in the physical component, where we defined four alternative criteria for success, ranging from most to least demanding as follows : criterion 1 : absence of disease + good vision and hearing + independence in all five activities. criterion 2 : less than three diseases, no dementia, good vision and hearing, and independence in adl and moving about indoors (independent in 3 easier activities). criterion 3 : no dementia, good vision and hearing, and independence in all five activities. criterion 1 : absence of disease + good vision and hearing + independence in all five activities. criterion 2 : less than three diseases, no dementia, good vision and hearing, and independence in adl and moving about indoors (independent in 3 easier activities). criterion 3 : no dementia, good vision and hearing, and independence in all five activities. criterion 4 : good vision and hearing, and independence in all five activities. in the psychological component, success was defined as absence of depressiveness, average or good self - rated health, and agreement with the view that it is good to live to be 100. in the social component, success was defined as having met one 's children and having talked on the phone with family members or friends during the past two weeks. the six models of successful aging were constructed as follows : model 1 : physical component criterion 1 and psychological component & social component. model 4 : physical component criterion 4 and psychological component & social component. model 5 : physical component criterion 3 and psychological component. the prevalence of successful aging in different sociodemographic categories was compared by cross tabulation using the chi - square test. logistic regression models were used to assess the independent associations of different models of successful aging with sociodemographic factors. odds ratios (ors) and 95% confidence intervals (95% ci) were calculated. most of the participants (85.9%) were under 95 years of age, and more than 80% were women. heart problems, arthritis, and dementia were the most frequent diseases, and only 14.7% of men and 10.2% of women did not have any of the eight conditions listed in the questionnaire. four in ten respondents were independent in all five activities, and seven in ten were independent in adl and moving about indoors. according to different criteria, 5.3 to 25.2% were aging successfully if only the physical component was considered. in the psychological component, the prevalence of successful aging was 20%, in the social component the figure was markedly higher at 75%. men had better scores than women in both the physical component (most criteria) and the psychological component (table 2). it was lowest (1.6%) for model 1, which required absence of all diseases, independence in all five activities, and good vision and hearing, in addition to the psychological and social components, and highest (18.3%) for model 6, which differed from model 1 in that diseases other than dementia were allowed, and the psychological component was not included. successful aging was significantly more prevalent in men than women and among community - living than institutionalized individuals, regardless of the model. according to most models, successful aging was more frequent among those aged 9093 than those aged 94 +, among married people, and among those with a higher education. finally, logistic regression models were calculated to examine the independent association of different sociodemographic indicators with the six models of successful aging (table 4). in four models, higher age gender was another predictive variable, and in all models except model 6, men were significantly more successful in aging than women. higher education was a significant predictor in two models, and in model 6 both those with a high and the highest educational level differed significantly from those with the lowest level of education. marital status did not play an independent role, but place of living was a significant determinant of successful aging in all but model 1. this paper examined one the most prominent concepts in aging research, successful aging, by constructing six different models to measure it among nonagenarians. the models were based on work by rowe and kahn, rowe, and young. [68, 13, 16 ], although not the exact same indicators were used. rowe and khan, successful aging is typically understood as comprising three main domains : physical (in young. : the results showed that the prevalence of successful aging varies markedly from one model to another, standing at 1.6% for model 1 that required the absence of any disease, independence in functioning, and the ability to hear and read, as well as meeting the psychological and social criteria, and at 18.3% for model 6, which required the absence of dementia, independence in functioning, the ability to hear and read, and meeting the social criteria. it is obvious that the absence of disease is the most demanding criterion for measuring successful aging. only 11% of the nonagenarians in our study had no major disease, and only 5.3% were both free of disease, able to hear and see, and independent in five daily activities (physical dimension criterion 1). very few earlier studies have attempted to estimate the prevalence of successful aging in nonagenarians or in very old age in general. von faber. classified only 10% of community - dwelling and 1.9% of institutionalized participants aged 85 or over as successful agers. in the nonasantfeliu study by formiga. these studies emphasized the role of health and physical functioning, but also included some social or quality - of - life measures. it is clear that especially when the focus is on the physical dimension, successful aging will be very rare among people experiencing longevity. rowe and kahn included productive activities in their model of successful aging but these can hardly be expected from nonagenarians.. showed that the daily activities of individuals aged 90 or over differed from other age groups, and in all categories this age group was engaged in significantly less activity than others. this implies that the social dimension of successful aging among the oldest old should be measured using different criteria and against different activities than in the case of the younger old and should be seen in relation to the situation of the best performers in the same age group. in cross - sectional analysis, we limited our examination to socioeconomic predictors that at least potentially have played a role in the lives of the individuals for a longer time, and, with the exception of place of living, are not supposed to be influenced by factors that were thought to be components of successful aging. in most studies age has emerged as one of the strongest predictors of successful aging. in our study, persons aged 94 or over were less likely to meet the successful aging criteria than the younger age groups. the difference between the age groups was significant for all except model 1, and it was greatest in model 6 where the overall prevalence of successful aging was highest. after adjusting for other sociodemographic variables, a significant age difference still persisted in four models. in our study, the prevalence of successful aging was consistently higher for men, and in all except the last model the differences were also significant after the adjustments. earlier studies show no consistent patterns of gender differences, but the results seem to be dependent on the model used. mclaughlin. found no gender difference in prevalence, but higher odds of successful aging in women after controlling for sociodemographic variables. our findings among nonagenarians are only partly explained by the high prevalence of disabilities and disease in women, as men had clearly better scores in the psychological component as well. these disparities are likely to reflect differential survival, lifelong differences in biological, health, and social conditions. marital status was associated with successful aging in unadjusted analysis but not in the adjusted models, where the uneven age and gender distribution of the variable was controlled for. education is known to have an impact on health and life style, and it reflects socioeconomic status ; therefore, it can also be considered a potential predictor of successful aging. most of the studies reviewed by depp and jeste found no differences according to educational level, but the analysis by mclaughlin. in the health and retirement study showed that the prevalence of successful aging was higher in groups with a higher education and household income. the study of pruchno. revealed that a higher level of formal education is associated with successful aging. our findings with an older group than in these studies showed a graded increase in the prevalence of successful aging with higher education, although the difference was not significant for all models. in several studies institutionalized people and those of lower social position were less likely to participate, while our study represents the whole age group in the region. place of living is not usually considered a predictor of successful aging and in many (but not all, see e.g., von faber.) studies samples only include community - dwelling individuals. in our study, we wanted to take account of the possibility of successful aging even in an institution. however, the results showed that the prevalence of successful aging was clearly lower for those living in institutions, and this was also true for the adjusted models. our earlier analyses (not shown here) indicated that disease, disability, and problems with hearing and seeing are more prevalent in institutions, as is self - rated health, which partly explains this finding. the major strength of this study is that it covers the whole population aged 90 or over in the area concerned, including institutionalized people as well as proxy responses. our earlier and ongoing analyses suggest that the information on health and functioning collected by mailed questionnaires among nonagenarians is sufficiently valid and reliable [20, 21 ] ; particularly as for a majority for those suffering from dementia, the answers were given by a proxy respondent. in order to gain a broad and thorough understanding of successful aging unlike most other studies, we also included the ability to see and hear as an important contributing factor to independence and quality of life. the main limitations of our study have to do with the measures used to assess the social and psychological components. our only information about meeting with other people concerned meetings with children ; no data were available about other family members or friends. one fifth of the respondents had no children, and we decided to give them a positive score for social contacts if they had made or received any telephone calls during the past two weeks. one - fifth of our responses were from proxies, who were not asked about self - rated health or living to be 100. therefore, we had a high percentage of missing or proxy answers to two questions regarding the psychological dimension of successful aging. in order not to overestimate the prevalence of successful aging, we scored this missing data and proxy answers as negative. these kinds of problems are unavoidable in unselected samples of very old people, but they nonetheless add some uncertainty to our findings. another obvious limitation of our study is that we had no direct questions designed to capture our respondents ' self - evaluations of their life. our study in a nonselected population of persons aged 90 or over supports earlier findings that the prevalence of successful aging is highly dependent on the model applied, but in every case successful aging is associated with age, gender, and socioeconomic status. however, it is apparent that with any model that defines successful aging as a state of being and that uses criteria commonly used for younger age groups, successful aging remains a rare situation among the oldest old. an increased likelihood of health and functional problems, often followed by reduced opportunities for active social engagement, is normative consequences of biological aging and typical of extreme longevity. therefore, in very old age, rather than models emphasizing the absence of disease and activity, emphasis should be given to approaches focusing on autonomy, adaptation, and sense of purpose [3, 22, 23 ]. these age - sensitive approaches would help us better understand the potential of successful aging among those individuals who have already had success in longevity. | objectives. this study was designed (1) to estimate the prevalence of successful aging among nonagenarians based on six different models and (2) to investigate whether successful aging is associated with socio - demographic factors. methods. a mailed survey was conducted with people aged 90 + in tampere in 2010. responses were received from 1283 people. the prevalence of successful aging was measured by six multidimensional models including physical, social, and psychological components. age, sex, marital status, level of education, and place of living were studied as factors associated with successful aging. results. the prevalence of successful aging varied from 1.6% to 18.3% depending on the model applied. successful aging was more prevalent in men, and also more prevalent among community - living people. in most models, successful aging was also associated with younger age, being married, and a higher level of education. discussion. models which emphasize the absence of disease and activity as criteria for successful aging may not be the most relevant and applicable in oldest old. instead, preference should be given to models that focus more on autonomy, adaptation and sense of purpose. age - sensitive approaches would help us better understand the potential of successful aging among individuals who already have success in longevity. |
the ncic clinical trials group ma.17 study was a prospective, randomized, double - blind, placebo - controlled, phase iii trial of letrozole as extended adjuvant therapy for 5 years in postmenopausal breast cancer patients who remained disease - free after having completed approximately 5 years of standard adjuvant tamoxifen treatment (figure 1a). a total of 5157 eligible postmenopausal women with hormone receptor positive (er+ and/or pr+) tumors were randomly assigned to receive either letrozole or placebo after completing approximately 5 years of standard adjuvant tamoxifen therapy. in accordance with trial protocol, the ma.17 trial was unblinded in 2003 after the first interim analysis (median follow - up of 30 months) demonstrated a statistically significant disease - free survival benefit and a trend toward survival advantage in patients who received letrozole. patients on the placebo arm were offered letrozole for a planned period of 5 years. the overall ma.17 trial design (a), and the sample consort of the ma.17 biomarker study (b). because of the practical obstacles to retrospectively obtain primary tumor blocks from ma.17 participants, a nested case - control design using all available recurrent case subjects with a planned ratio of 1:2 was used to study the ability of h / i to predict late recurrence and the benefit from extended therapy with letrozole. case subjects included patients with local, regional, or distant recurrence for which primary tumor tissue blocks were available. for each case subject, two matched control subjects were selected in which the control subject had been recurrence - free for a period of time longer than the case subject. all patients with disease recurrence and with available formalin - fixed paraffin - embedded (ffpe) tumor tissue blocks were included in this study. detailed methods for case - control selection are described in supplementary methods (available online). the prespecified objectives of this study were to determine whether h / i groups [based on a prespecified and validated cut point (1113) ] would predict late disease recurrence and responsiveness / benefit from extended letrozole therapy after 5 years tamoxifen treatment. the primary endpoint was any breast cancer recurrence, including breast, chest wall, nodal, or metastatic site. informed consent for the use of tumor specimens for correlative science studies were obtained from each subject. the massachusetts general hospital institutional review board approved the use of the ma.17 tumor samples for this study. tumor size and grade, lymph node status, and er and pr status were assessed using local institutional pathology laboratory criteria. central tumor grade was assessed using the elston and ellis modified version of the bloom and richardson method by a single subspecialty - trained breast pathologist (d.c. central review for er, pr, and her-2 expression by immunohistochemistry (ihc) and her gene amplification by fluorescence in situ hybridization was scored by two pathologists (d.c. sgroi and a.k. bhan) using two 1.0-mm tissue microarray cores using previously described methods summarized in the supplementary material (available online) (15,16). gene expression analysis of formalin - fixed paraffin - embedded specimens was performed blinded to clinical outcome by biotheranostics inc, as previously described (1113). briefly, hematoxylin and eosin stained slides were reviewed to guide manual microdissection for tumor enrichment if necessary. after rna extraction from three to six 8-m unstained tissue sections and dnase treatment, total rna content was measured and the absence of dna contamination verified as previously described (11,13). total rna was reverse transcribed, and the resulting cdna was preamplified by performing eight rounds of pcr using the preamp master mix kit (applied biosystems, foster city, ca) before being analyzed by taqman rt - pcr. high and low h / i groups were determined using a prespecified cutpoint (0.06) that was determined and validated in our previous studies (1113). reportable results were generated using rna derived from all 249 formalin - fixed paraffin - embedded tumor samples submitted for testing. because of the nature of matched case - control study, unadjusted conditional logistic regression that takes matching set into consideration was used to examine whether h / i was prognostic of late disease recurrence and whether h / i predicts benefit from extended letrozole therapy by including an interaction term between the treatment and predefined h / i groups in the model and testing with statistical contrasts (17). conditional logistic regression was also performed in an adjusted analysis that also included the following prespecified covariates : age, tumor size, tumor grade, lymph node status, and er, pr, and her2 status. similarly, the predictive analyses in clinically relevant patient subgroups was performed by conditional logistic regressions with a three - way interaction term that included the clinical variable of interest in addition to the treatment and h / i groups. odds ratios (ors) and the 95% confidence intervals (cis) were estimated from conditional logistic regressions. the absolute recurrence - free survival (rfs) at 5 years and the corresponding 95% ci were estimated using methods developed by langholz and borgan (18) for nested case - control study by taking into consideration the number of patients at risk from the entire ma.17 trial at the time of each recurrence in the case - control study. statistical significance of the interaction between extended letrozole treatment and h / i index as a continuous variable was assessed by a likelihood ratio test that compared a reduced model without h / i index by treatment interaction with the competing full model, which included the interaction. linearity of h / i index was tested by a likelihood ratio test that compared a model including the h / i index transformed by restricted cubic spline (19) with a model including only the linear h / i index. if a significant nonlinearity existed, then all analyses involving continuous h / i were based on h / i index transformed by restricted cubic spline. all p values were two - sided, and a p value less than.05 was considered statistically significant. all analyses were performed using r statistical package (version 2.12.2, http://www.r-project.org), except for absolute risk estimation for which sas software (sas institute inc, cary, nc) was used. the ncic clinical trials group ma.17 study was a prospective, randomized, double - blind, placebo - controlled, phase iii trial of letrozole as extended adjuvant therapy for 5 years in postmenopausal breast cancer patients who remained disease - free after having completed approximately 5 years of standard adjuvant tamoxifen treatment (figure 1a). a total of 5157 eligible postmenopausal women with hormone receptor positive (er+ and/or pr+) tumors were randomly assigned to receive either letrozole or placebo after completing approximately 5 years of standard adjuvant tamoxifen therapy. in accordance with trial protocol, the ma.17 trial was unblinded in 2003 after the first interim analysis (median follow - up of 30 months) demonstrated a statistically significant disease - free survival benefit and a trend toward survival advantage in patients who received letrozole. patients on the placebo arm were offered letrozole for a planned period of 5 years. the overall ma.17 trial design (a), and the sample consort of the ma.17 biomarker study (b). because of the practical obstacles to retrospectively obtain primary tumor blocks from ma.17 participants, a nested case - control design using all available recurrent case subjects with a planned ratio of 1:2 was used to study the ability of h / i to predict late recurrence and the benefit from extended therapy with letrozole. case subjects included patients with local, regional, or distant recurrence for which primary tumor tissue blocks were available. for each case subject, two matched control subjects were selected in which the control subject had been recurrence - free for a period of time longer than the case subject. all patients with disease recurrence and with available formalin - fixed paraffin - embedded (ffpe) tumor tissue blocks were included in this study. detailed methods for case - control selection are described in supplementary methods (available online). the prespecified objectives of this study were to determine whether h / i groups [based on a prespecified and validated cut point (1113) ] would predict late disease recurrence and responsiveness / benefit from extended letrozole therapy after 5 years tamoxifen treatment. the primary endpoint was any breast cancer recurrence, including breast, chest wall, nodal, or metastatic site. informed consent for the use of tumor specimens for correlative science studies were obtained from each subject. the massachusetts general hospital institutional review board approved the use of the ma.17 tumor samples for this study. tumor size and grade, lymph node status, and er and pr status were assessed using local institutional pathology laboratory criteria. central tumor grade was assessed using the elston and ellis modified version of the bloom and richardson method by a single subspecialty - trained breast pathologist (d.c. central review for er, pr, and her-2 expression by immunohistochemistry (ihc) and her gene amplification by fluorescence in situ hybridization was scored by two pathologists (d.c. sgroi and a.k. bhan) using two 1.0-mm tissue microarray cores using previously described methods summarized in the supplementary material (available online) (15,16). gene expression analysis of formalin - fixed paraffin - embedded specimens was performed blinded to clinical outcome by biotheranostics inc, as previously described (1113). briefly, hematoxylin and eosin stained slides were reviewed to guide manual microdissection for tumor enrichment if necessary. after rna extraction from three to six 8-m unstained tissue sections and dnase treatment, total rna content was measured and the absence of dna contamination verified as previously described (11,13). total rna was reverse transcribed, and the resulting cdna was preamplified by performing eight rounds of pcr using the preamp master mix kit (applied biosystems, foster city, ca) before being analyzed by taqman rt - pcr. high and low h / i groups were determined using a prespecified cutpoint (0.06) that was determined and validated in our previous studies (1113). reportable results were generated using rna derived from all 249 formalin - fixed paraffin - embedded tumor samples submitted for testing. because of the nature of matched case - control study, unadjusted conditional logistic regression that takes matching set into consideration was used to examine whether h / i was prognostic of late disease recurrence and whether h / i predicts benefit from extended letrozole therapy by including an interaction term between the treatment and predefined h / i groups in the model and testing with statistical contrasts (17). conditional logistic regression was also performed in an adjusted analysis that also included the following prespecified covariates : age, tumor size, tumor grade, lymph node status, and er, pr, and her2 status. similarly, the predictive analyses in clinically relevant patient subgroups was performed by conditional logistic regressions with a three - way interaction term that included the clinical variable of interest in addition to the treatment and h / i groups. odds ratios (ors) and the 95% confidence intervals (cis) were estimated from conditional logistic regressions. the absolute recurrence - free survival (rfs) at 5 years and the corresponding 95% ci were estimated using methods developed by langholz and borgan (18) for nested case - control study by taking into consideration the number of patients at risk from the entire ma.17 trial at the time of each recurrence in the case - control study. statistical significance of the interaction between extended letrozole treatment and h / i index as a continuous variable was assessed by a likelihood ratio test that compared a reduced model without h / i index by treatment interaction with the competing full model, which included the interaction. linearity of h / i index was tested by a likelihood ratio test that compared a model including the h / i index transformed by restricted cubic spline (19) with a model including only the linear h / i index. if a significant nonlinearity existed, then all analyses involving continuous h / i were based on h / i index transformed by restricted cubic spline. all p values were two - sided, and a p value less than.05 was considered statistically significant. all analyses were performed using r statistical package (version 2.12.2, http://www.r-project.org), except for absolute risk estimation for which sas software (sas institute inc, cary, nc) was used. tumor samples from 100 patients with disease recurrence were obtained retrospectively and matched to 200 patients without disease recurrence. because the predefined cutpoint of h / i was previously tested with samples associated with patient outcome defined as local, regional, or distant metastasis (1113), patients with contralateral and unknown recurrences were removed. therefore our final cohort consisted of 83 patients with local, regional, or distant recurrence matched with 166 patients without recurrence (figure 1b). a post hoc power analysis indicated that with this sample size, the power to detect an odds ratio of 3 for comparing risk of late recurrence without extended letrozole vs that with letrozole in the h / i - high group was 82% at a 5% significance level. the majority of patients was aged greater than 50 years with t1/t2 stage disease, and a larger proportion was node - positive and did not receive adjuvant chemotherapy. within unmatched variables, there was a statistically significant difference between the number of case subjects and control subjects for letrozole vs placebo and high vs low h / i groups (table 1). case subjects and control subjects are similar to the overall ma.17 study population with respect to key clinical parameters with the exception of nodal status and radiation therapy (supplementary table 1, available online). er = estrogen receptor ; h / i = hoxb13/il17br ; pr = progesterone receptor. p values were calculated using the fisher exact test, except for type of surgery, for which binomial proportional test was used. high and low h / i groups were determined using a prespecified cutpoint (0.06) that was determined and validated in our previous studies (1113). the observed clinical benefit from letrozole within different patient subgroups was similar between the case - control study and the entire study population reported in the ma.17 trial (table 2). the benefit was statistically significant in both studies in all subgroups except within the lymph node positive subgroup for the case - control, which may be because of small sample size for the relatively smaller size of the benefit (vs lymph node negative) (table 2). for example, the odds ratio estimated by conditional logistic regression with an interaction between clinical factors and the treatment in this case - control study and the hazard ratio estimated from the overall ma.17 trial as in published literature (6,20) were as follows : 0.20 and 0.45 for node negative, 0.63 and 0.61 for node positive, 0.44 and 0.73 for aged greater or equal to 50 years, 0.42 and 0.58 for hormone receptor positive, and 0.45 and 0.49 for er+/pr+ (table 2). comparison of clinical benefit from extended letrozole therapy in patient subgroups of the nested case - control study and the overall ma.17 trial odds ratio (or) and 95% confidence interval (ci) were calculated from conditional logistic regression. er = estrogen receptor ; hr = hazard ratio ; pr = progesterone receptor. in the placebo arm, h / i status was statistically significantly associated with prognosis in the unadjusted model, as women in the high h / i group experienced substantially worse prognosis than those in the low h / i group (or = 2.24 ; 95% ci = 1.09 to 4.61 ; p =.03). h / i status remained marginally statistically significant in the adjusted model (or = 2.15 ; 95% ci = 1.00 to 4.64 ; p =.05) after adjusting for all clinicopathological factors examined (age, tumor size, tumor grade, nodal status, er, pr, her2) (supplementary table 2). in the letrozole arm, however, h / i was not prognostic for late recurrence in neither the unadjusted nor the adjusted models (p =.72 and.63, respectively). in the unadjusted analysis, high h / i group was statistically significantly associated with patient benefit from letrozole (or = 0.35 ; 95% ci = 0.16 to 0.75 ; p =.007) (table 3). in the adjusted model, which included all clinicopathological factors as covariates, high h / i remained statistically significantly associated with patient benefit from letrozole (or = 0.33 ; 95% ci = 0.15 to 0.73 ; p =.006) (table 3 ; figure 2), which represented a 67% reduction in the risk of recurrence with extended letrozole treatment as compared with placebo. unadjusted and adjusted analyses of treatment benefit by hoxb13/il17br (h / i) groups odds ratio (or), 95% confidence interval (ci), and p values were calculated from conditional logistic regression. er = estrogen receptor ; pr = progesterone receptor. forest plots showing odds ratio (or) for recurrence associated with clinico - pathological factors and treatment effect for each of the hoxb13/il17br (h / i) groups. red color indicates h / i - high patients ; black color indicates h / i - low patients. the absolute rfs at 4 years estimated from this case - control study was 86.6% (95% ci = 80.6% to 90.9%) and 93.4% (95% ci = 90.2% to 95.6%) for patients receiving placebo and letrozole, respectively. this is consistent with the 4-year disease - free survival (87% and 93% for placebo and letrozole, respectively) estimated from the parental ma.17 trial (2) for low h / i patients, the 5-year rfs was 87% (95% ci = 76.8% to 92.9%) and 91% (95% ci = 83.1% to 95.3%) in the placebo and letrozole group, respectively, showing a non - statistically significant reduction in the risk of recurrence of 4% (p =.35). however, for high h / i patients, the 5-year rfs was 73% (95% ci = 56.6% to 84.1%) and 89.5% (95% ci = 80.3% to 94.5%) in the placebo and letrozole group, demonstrating a 16.5% reduction in the absolute risk of recurrence at 5 years (p =.007) (table 4). estimates of recurrence - free survival (rfs) at 5 years in patients who were treated with placebo or extended letrozole rfss and 95% confidence intervals (cis) were calculated from conditional logistic regression using the method developed by langholz and borgan for nested case - control study. h / i = hoxb13/il17br. to examine whether continuous er and pr measurements would affect the predictive performance of h / i, gene expression values of er and pr by rt - pcr were used in the adjusted model instead of binary immunohistochemistry er and pr values. high h / i remained statistically significant with extended letrozole benefit (or = 0.32 ; 95% ci = 0.14 to 0.72 ; p =.006), whereas low h / i still showed no statistically significant benefit (or = 0.59 ; 95% ci = 0.25 to 1.39 ; p =.23). linearity testing with a conditional logistic regression model indicated that there was a significant nonlinear relationship of h / i index as a continuous variable with recurrence (p =.02) ; therefore h / i index was transformed by restricted cubic spline when assessing the statistical significance of the interaction between the treatment and continuous h / i index. likelihood ratio test showed that the interaction between h / i and letrozole therapy was statistically significant (p = 0.03), adjusting for clinicopathological factors. unplanned analyses were conducted to determine whether patient subgroups were differentially associated with the predictive performance of h / i by including a conditional logistic regression three - way interaction term between the clinical variable of interest, treatment, and h / i groups. high h / i was statistically significantly predictive of letrozole benefit in our overall study population. analyses of subsets including nodal, her2, er, and pr status are shown in supplementary table 3 and supplementary figure 1 (available online). tumor samples from 100 patients with disease recurrence were obtained retrospectively and matched to 200 patients without disease recurrence. because the predefined cutpoint of h / i was previously tested with samples associated with patient outcome defined as local, regional, or distant metastasis (1113), patients with contralateral and unknown recurrences were removed. therefore our final cohort consisted of 83 patients with local, regional, or distant recurrence matched with 166 patients without recurrence (figure 1b). a post hoc power analysis indicated that with this sample size, the power to detect an odds ratio of 3 for comparing risk of late recurrence without extended letrozole vs that with letrozole in the h / i - high group was 82% at a 5% significance level. the majority of patients was aged greater than 50 years with t1/t2 stage disease, and a larger proportion was node - positive and did not receive adjuvant chemotherapy. within unmatched variables, there was a statistically significant difference between the number of case subjects and control subjects for letrozole vs placebo and high vs low h / i groups (table 1). case subjects and control subjects are similar to the overall ma.17 study population with respect to key clinical parameters with the exception of nodal status and radiation therapy (supplementary table 1, available online). er = estrogen receptor ; h / i = hoxb13/il17br ; pr = progesterone receptor. p values were calculated using the fisher exact test, except for type of surgery, for which binomial proportional test was used. high and low h / i groups were determined using a prespecified cutpoint (0.06) that was determined and validated in our previous studies (1113). the observed clinical benefit from letrozole within different patient subgroups was similar between the case - control study and the entire study population reported in the ma.17 trial (table 2). the benefit was statistically significant in both studies in all subgroups except within the lymph node positive subgroup for the case - control, which may be because of small sample size for the relatively smaller size of the benefit (vs lymph node negative) (table 2). for example, the odds ratio estimated by conditional logistic regression with an interaction between clinical factors and the treatment in this case - control study and the hazard ratio estimated from the overall ma.17 trial as in published literature (6,20) were as follows : 0.20 and 0.45 for node negative, 0.63 and 0.61 for node positive, 0.44 and 0.73 for aged greater or equal to 50 years, 0.42 and 0.58 for hormone receptor positive, and 0.45 and 0.49 for er+/pr+ (table 2). comparison of clinical benefit from extended letrozole therapy in patient subgroups of the nested case - control study and the overall ma.17 trial odds ratio (or) and 95% confidence interval (ci) were calculated from conditional logistic regression. in the placebo arm, h / i status was statistically significantly associated with prognosis in the unadjusted model, as women in the high h / i group experienced substantially worse prognosis than those in the low h / i group (or = 2.24 ; 95% ci = 1.09 to 4.61 ; p =.03). h / i status remained marginally statistically significant in the adjusted model (or = 2.15 ; 95% ci = 1.00 to 4.64 ; p =.05) after adjusting for all clinicopathological factors examined (age, tumor size, tumor grade, nodal status, er, pr, her2) (supplementary table 2). in the letrozole arm, however, h / i was not prognostic for late recurrence in neither the unadjusted nor the adjusted models (p =.72 and.63, respectively). in the unadjusted analysis, high h / i group was statistically significantly associated with patient benefit from letrozole (or = 0.35 ; 95% ci = 0.16 to 0.75 ; p =.007) (table 3). in the adjusted model, which included all clinicopathological factors as covariates, high h / i remained statistically significantly associated with patient benefit from letrozole (or = 0.33 ; 95% ci = 0.15 to 0.73 ; p =.006) (table 3 ; figure 2), which represented a 67% reduction in the risk of recurrence with extended letrozole treatment as compared with placebo. unadjusted and adjusted analyses of treatment benefit by hoxb13/il17br (h / i) groups odds ratio (or), 95% confidence interval (ci), and p values were calculated from conditional logistic regression. er = estrogen receptor ; pr = progesterone receptor. forest plots showing odds ratio (or) for recurrence associated with clinico - pathological factors and treatment effect for each of the hoxb13/il17br (h / i) groups. red color indicates h / i - high patients ; black color indicates h / i - low patients. the absolute rfs at 4 years estimated from this case - control study was 86.6% (95% ci = 80.6% to 90.9%) and 93.4% (95% ci = 90.2% to 95.6%) for patients receiving placebo and letrozole, respectively. this is consistent with the 4-year disease - free survival (87% and 93% for placebo and letrozole, respectively) estimated from the parental ma.17 trial (2) for low h / i patients, the 5-year rfs was 87% (95% ci = 76.8% to 92.9%) and 91% (95% ci = 83.1% to 95.3%) in the placebo and letrozole group, respectively, showing a non - statistically significant reduction in the risk of recurrence of 4% (p =.35). however, for high h / i patients, the 5-year rfs was 73% (95% ci = 56.6% to 84.1%) and 89.5% (95% ci = 80.3% to 94.5%) in the placebo and letrozole group, demonstrating a 16.5% reduction in the absolute risk of recurrence at 5 years (p =.007) (table 4). estimates of recurrence - free survival (rfs) at 5 years in patients who were treated with placebo or extended letrozole rfss and 95% confidence intervals (cis) were calculated from conditional logistic regression using the method developed by langholz and borgan for nested case - control study. to examine whether continuous er and pr measurements would affect the predictive performance of h / i, gene expression values of er and pr by rt - pcr were used in the adjusted model instead of binary immunohistochemistry er and pr values. high h / i remained statistically significant with extended letrozole benefit (or = 0.32 ; 95% ci = 0.14 to 0.72 ; p =.006), whereas low h / i still showed no statistically significant benefit (or = 0.59 ; 95% ci = 0.25 to 1.39 ; p =.23). linearity testing with a conditional logistic regression model indicated that there was a significant nonlinear relationship of h / i index as a continuous variable with recurrence (p =.02) ; therefore h / i index was transformed by restricted cubic spline when assessing the statistical significance of the interaction between the treatment and continuous h / i index. likelihood ratio test showed that the interaction between h / i and letrozole therapy was statistically significant (p = 0.03), adjusting for clinicopathological factors. unplanned analyses were conducted to determine whether patient subgroups were differentially associated with the predictive performance of h / i by including a conditional logistic regression three - way interaction term between the clinical variable of interest, treatment, and h / i groups. high h / i was statistically significantly predictive of letrozole benefit in our overall study population. analyses of subsets including nodal, her2, er, and pr status are shown in supplementary table 3 and supplementary figure 1 (available online). currently, for er - positive breast cancer patients, there are no established tests that predict treatment benefit from extended adjuvant endocrine therapy (15). in this prospectively defined, retrospective analysis of a nested case - controlled study of ma.17, patients with high h / i expressing tumors had a 67% reduction in relative risk of recurrence and 16.5% reduction in the absolute risk of recurrence at 5 years when taking letrozole, as compared with placebo. notably, the strong consistency in the estimates of 4-year rfs in both treatment groups calculated from this case - control study vs those from the parental ma.17 study population contends that the case - control samples are representative of the entire ma.17 study population. in addition, there was a statistically significant interaction between h / i as a continuous index and extended aromatase inhibitor (ai) treatment. as a comparison, continuous er and pr values measured by rt - pcr had no statistically significant interaction with extended ai treatment (p =.11 and.24, respectively). the prognostic performance of high h / i for late recurrence within the placebo group was offset by the benefit from letrozole therapy for patients with tumors expressing high h / i. these data suggest that high h / i within the primary tumor stratified a group of patients that had a greater likelihood for benefit from extended adjuvant letrozole above the known residual benefit from 5 years of adjuvant tamoxifen therapy. in addition, patients with high h / i in their primary tumor have a greater likelihood of experiencing a recurrence beyond 5 years of tamoxifen treatment if their adjuvant therapy is not extended with letrozole. although mechanistically unclear, h / i has both prognostic and predictive performance similar to her2 in that higher expression of the biomarker suggests a worse prognosis for breast cancer patients yet indicates a favorable response to a given therapy. as our retrospective case subject selection was based on available tissue blocks, the size of our case - control cohort is substantially smaller than the overall ma.17 trial, and this selection could have introduced bias. despite this, apart from fewer patients treated with adjuvant radiation therapy and a greater proportion with lymph node positive disease, our cohort was similar to the overall ma.17 study population with respect to key clinical parameters (supplementary table 1, available online). moreover, we showed similar benefit from letrozole treatment in our overall case - control cohort and within important subgroups in our study as compared with the overall ma.17 patient population. the clinical applications of our findings apply to many women with er+ early breast cancer. first, 5 years of adjuvant tamoxifen remains the standard adjuvant therapy for premenopausal women most of whom are menopausal after chemotherapy and 5 years of tamoxifen and are therefore potential candidates for extended ai therapy. second, although upfront ai adjuvant therapy has become more common, 5 years of tamoxifen remains a common adjuvant therapy among postmenopausal women globally. identifying which patients are vulnerable to a late recurrence and who among them will benefit from extended therapy is of substantial clinical value. our biomarker should allow many women to avoid unnecessary treatment and for the focus to center on those in most need of therapy. this, in turn, could improve compliance with medication and further improve outcomes (2124). in conclusion, we have demonstrated in a prospective retrospective analysis of the ma.17 trial that patients with primary tumors with a high h / i index who are disease - free after 4.5 to 6 years of adjuvant tamoxifen therapy receive benefit from extended adjuvant letrozole therapy. performance of h / i in predicting treatment benefit from extended ai therapy for women who have used tamoxifen for less than 5 years and those who have taken upfront ai without any tamoxifen for 5 years awaits prospective retrospective analyses of currently ongoing trials such as ma.17r, nsabp42, and others (25,26). this work was supported by grants from the avon foundation (to d.c.s. and p.e.g.) ; the national institute of health (r01ca112021 to d.c.s.) ; the breast cancer foundation (to d.c.s. and ; the department of defense breast cancer research program (w81xwh-04 - 1 - 0606 to d.c.s.) ; the nci spore in breast cancer at massachusetts general hospital (to p.e.g. and d.c.s.) ; and novartis. | backgroundbiomarkers to optimize extended adjuvant endocrine therapy for women with estrogen receptor (er)positive breast cancer are limited. the hoxb13/il17br (h / i) biomarker predicts recurrence risk in er - positive, lymph node negative breast cancer patients. h / i was evaluated in ma.17 trial for prognostic performance for late recurrence and treatment benefit from extended adjuvant letrozole.methodsa prospective retrospective, nested case - control design of 83 recurrences matched to 166 nonrecurrences from letrozole- and placebo - treated patients within ma.17 was conducted. expression of h / i within primary tumors was determined by reverse - transcription polymerase chain reaction with a prespecified cutpoint. the predictive ability of h / i for ascertaining benefit from letrozole was determined using multivariable conditional logistic regression including standard clinicopathological factors as covariates. all statistical tests were two-sided.resultshigh h / i was statistically significantly associated with a decrease in late recurrence in patients receiving extended letrozole therapy (odds ratio [or ] = 0.35 ; 95% confidence interval [ci ] = 0.16 to 0.75 ; p =.007). in an adjusted model with standard clinicopathological factors, high h / i remained statistically significantly associated with patient benefit from letrozole (or = 0.33 ; 95% ci = 0.15 to 0.73 ; p =.006). reduction in the absolute risk of recurrence at 5 years was 16.5% for patients with high h / i (p =.007). the interaction between h / i and letrozole treatment was statistically significant (p =.03).conclusionsin the absence of extended letrozole therapy, high h / i identifies a subgroup of er - positive patients disease - free after 5 years of tamoxifen who are at risk for late recurrence. when extended endocrine therapy with letrozole is prescribed, high h / i predicts benefit from therapy and a decreased probability of late disease recurrence. |
the essential features of the olmsted county, minnesota, usa, impaired glycemia (oc ig) survey were identification of persons with ig and non - ig in local population - based medical and laboratory registries, obtaining consent by letter, assessing their glycemia status (non - ig, ig, and new diabetes) at study (fig. 1) and then evaluating their microvessel complications (typ and atyp dpn, retinopathy, and nephropathy) by masked and objective examination criteria (supplementary fig. the survey was made possible by the unique nature of the medical practice in this community, which facilitates population - based epidemiologic surveys and therapeutic trials of prospectively defined groups of patient cohorts using masked, objective, and quantitative assessment of complications previously described (33). shown is the algorithm used to identify ig and non - ig patients from mayo clinic rochester (mcr) and olmsted medical center (omc) disease and laboratory registries. at study (usually delayed by months), volunteers were classified by their ig status and microvessel complications (e.g., no dpn, dspn, or atyp dpn) in non - ig, ig, and new diabetes (dm) groups. eval., evaluation ; dx, diagnosis ; neuro, neuropathy ; tx, treated as dm. the oc ig survey (ns36797) was initiated on 1 april 2004 (22). following approval by the respective institutional review boards, the medical and laboratory data of the mayo clinic and the olmsted medical center were used to identify the olmsted county residents with ig (i.e., fasting plasma glucose [fpg ] values 6.1 to < 7.0 mmol / l from blood taken between 5:00 and 9:30 a.m.) between the years 2000 and 2005. the slightly higher, lower limit of abnormality of fpg was deliberately set to avoid inclusion of borderline ig patients. a matched (by age and sex) list of local residents without ig (fpg < 5.6 specifically, nerve, eye, or kidney complications, as recorded in an index of medical diagnoses (33), were not used as exclusion criteria. institutional review board approved letters inviting ig and non - ig people to participate in the restudy of their ig status, as well as complications of typ and atyp polyneuropathy, retinopathy, and nephropathy, were sent. at restudy, which was sometimes delayed for months or even a year or two, the ig status was reassessed and clinical microvessel complications and tests were assessed independently of each other. at restudy, patients were defined as having ig when their fpg was 5.6 mmol / l, their 2-h 75-g oral glucose tolerance test (ogtt) plasma glucose values were 7.8 mmol / l, and they did not have new diabetes as judged by one or more of the following : fpg value 7 mmol / l, a 2-h ogtt plasma glucose value 11.1 mmol / l, or an a1c value 6.5% (fig. an a1c value was not used as a lower limit for ig (because the lower limit [6.0% ] was later changed to 5.7%). also, if patients revealed at restudy that they had previously been diagnosed or treated as having diabetes, they were included in the new diabetes group. power for a comparative study of 300 ig and 300 non - ig patients was determined to be 84% (= 0.05 one - sided) for detecting a relative risk for dpn (typ and atyp varieties combined) of 5.0 (frequencies of dpn were assumed to be 1% and 5% for non - ig and ig, respectively) (22). the distribution of non - ig and ig patients and the total sample size, however, had to be modified because of budgetary considerations and a greater than expected number of people whose status had changed from ig to new diabetes. data were analyzed according to the ig status at the time of study evaluation using standard measures of association and tests for proportions. to recognize a subtle functional neurophysiologic change of nerves in ig, we compared composite scores of nerve conduction (nc) (2 nc nds, 4 nc nds, 5 nc nds, and 6 nc nds) spanning normal and abnormal values among the three study groups. assessed were summated normal deviate scores (from percentiles corrected for age, sex, and physical characteristics, with all abnormalities expressed in the lower tail of the normal distribution, obtained from the study of a healthy subject cohort). the minimal criterion for dspn was nc abnormality (2 nc nds 2.5th percentile, i.e., stage 1a) with increased severity staged by additional neuropathic signs and symptoms (supplementary fig. all neurologic assessments were performed (by p.j.d.) by entering neurologic signs in the neuropathy impairment score and symptoms in the neuropathy symptoms and change into paper and electronic form (clinical neuropathy assessment) (35). a distinction of typ from atyp dpn was made using the criteria recently described (20). patients classified as typ or atyp dpn were further classified by narrow and broad criteria. the latter patients were those in whom another diagnosis other than diabetes was considered, e.g., lumbosacral disk disease, spinal stenosis, a family history suggestive of inherited neuropathy, and others. retinopathy was staged as r0 (no retinopathy), r1 (mild preproliferative), r2 (severe preproliferative), and r3 (proliferative) from 7 stereoscopic photographs of each eye and as read in the department of ophthalmology and visual sciences, university of wisconsin madison (r.k.). nephropathy was judged as being present if the 24-h urinary albumin excretion was 30 mg. of 558 volunteers recruited to be studied, 542 (150 non - ig, 174 ig, and 218 new diabetes) completed the studies. in the ig group, 31 of 174 (17.8%) chose not to have the 2-h 75-g ogtt. the diagnosis of ig was based on abnormality of only ifg (60/174, 34.5%) ; ifg and a1c (58/174, 33.3%) ; ifg, igt, and a1c (28/174, 16.1%) ; igt and a1c (10/174, 5.7%) ; ifg and igt (9/174, 5.2%) ; and igt only (9/174, 5.2%). small differences in age, sex, and physical features among study groups (supplementary table a) should not have influenced the results since neurophysiologic end points (e.g., attributes of nc) were corrected for applicable variables affecting the frequency and severity of dpns (34,36). significant differences among studied groups were observed for pulse, blood pressure, and some lipid and lipoprotein classes (supplementary table a). the primary outcome measure, the prevalence of dpn (typ or atyp or combined), was not significantly different between ig and non - ig, whether defined narrowly or broadly (fig. by contrast, the frequency of typ dpn only was significantly increased in new diabetes. typical dpn was significantly more frequent in new diabetes (dm) (6.0%) than in ig (0.6%, p < 0.01) and more frequent than in non - ig (2.0%), although this latter difference was almost significant (p = 0.07). atypical dpn was more frequent in dm (1.8%) than in non - ig (0.0%) or ig (1.%), but these differences were not significant. typical dpn was more frequent in dm (8.3%) than in non - ig (5.3%) or ig (4.6%), but these differences were not significant. atypical dpn was more frequent in dm (9.2%) than in non - ig (7.3%) or ig (8.1%), but these differences were not significant. in secondary analysis using ifg only, igt only, or ifg and igt combined as the criterion for ig, no significant increase in typ, atyp, or typ and atyp dpn was found whether narrowly or broadly defined. none of the four composite nc scores assessed showed a significant difference in mean values between ig and non - ig (fig. the 25th, 50th, 75th percentiles and range values were essentially overlapping between ig and non - ig. by comparison, a definite and significant downward shift toward abnormality was shown for new diabetes. as a further test of the validity of these composite nc scores, we compared them with those of an earlier healthy subjects cohort (the rochester diabetic neuropathy study of healthy subjects [rdns - hs ]) and to a previously studied prevalence diabetes cohort (the rochester diabetic neuropathy study [rdns ]) (fig. the composite scores of the non - ig and ig groups did not differ significantly from the scores in the previously studied rdns - hs (34). in rdns (25,27), the scores were significantly worse than in the presently studied non - ig, ig, and new diabetes groups (fig. 2 nc nds is the sum of peroneal mncv and sural snap nds ; 5 nc nds is the sum of peroneal cmap, mncv, and mndl, tibial mndl, and sural snap nds ; 4 nc nds is the sum of peroneal, tibial, and ulnar cmap and sural snap nds ; 6 nc nds is the sum of peroneal, tibial, and ulnar mncv and f - wave latency nds (all percentiles expressed in the lower tail of the distribution). two - sample t tests : 2 nc nds 1 vs. 3 0.002, 1 vs. 5 < 0.001, 2 vs. 3 < 0.001, 2 vs. 5 < 0.001, 3 vs. 4 < 0.001, 3 vs. 5 < 0.001, 4 vs. 5 < 0.001 ; 5 nc nds 1 vs. 3 0.033, 1 vs. 5 < 0.001, 2 vs. 3 0.044, 2 vs. 5 < 0.001, 3 vs. 4 0.002, 3 vs. 5 < 0.001, 4 vs. 5 < 0.001 ; 4 nc nds 1 vs. 3 0.008, 1 vs. 5 < 0.001, 2 vs. 3 < 0.001, 2 vs. 5 < 0.001, 3 vs. 4 0.002, 3 vs. 5 < 0.001, 4 vs. 5 < 0.001 ; 6 nc nds 1 vs. 3 0.006, 2 vs. 3 < 0.001, 3 vs. 4 0.002. among 1, 2, and 4, there were no significant differences for any composite score. cmap, compound muscle action potential ; mncv, motor nerve conduction velocity ; mndl, motor nerve distal latency ; snap, sensory nerve action potential. quantitative sensation test (qst) results were confirmatory of the clinical and nc observations reported above (i.e., increased prevalence of typ dpn and composite nc abnormality only in new diabetes). no significant difference in quantitative sensation scores was found between the non - ig and ig groups, but scores were significantly worse in the new diabetes group than in the other two tested groups (table 1). qst and hrdb test results in the oc ig trial in contrast to the qst results, a decrease in heart rate response to deep breathing (hrdb) was found in ig as compared with non - ig, but a further significant decrease was not found in new diabetes. in secondary analysis, a similar result was found when ifg only was used as the indication of ig. when igt was the indicator of ig, no significant decrease of hrdb was observed. the frequency of diabetic retinopathy was 3.4, 4.7, and 9.4%, respectively, for non - ig, ig, and new diabetes (fig. the difference was not significant between the non - ig and ig groups (p = 0.57) but was significantly increased for new diabetes versus non - ig (p = 0.03) and borderline significant for ig versus new diabetes (p = 0.08). in secondary analysis and using ifg only as the ig criterion, retinopathy was found in 5.2, 4.3, and 10.2%significantly increased in new diabetes versus ig. using igt only, retinopathy was found in 3.4, 9.9, and 12.1%significantly increased in ig versus non - ig and new diabetes versus non - ig. using combined ifg and igt abnormality, retinopathy was found in 4.4, 8.7, and 10.9%significantly increased only in new diabetes versus non - ig. in primary analysis, nephropathy was recorded in 4.1, 4.7, and 10.7% of patients with non - ig, ig, and new diabetes (fig. 2). the difference was significant for non - ig versus new diabetes (p = 0.02), as well as for ig versus new diabetes (p = 0.03). in secondary analysis of nephropathy, nephropathy occurred in 3.5, 7.2, and 10.9% in non - ig, ig, and new diabetes being significantly more frequent only in new diabetes. using igt, only nephropathy was found in 3.8, 10.0, and 9.3%significant for ig versus non - ig (p = 0.03), diabetes versus non - ig (p = 0.03), but not significant for new diabetes versus ig (p = 0.87). when both ifg and igt were used, frequency was 3.6, 13.3, and 9.4%significant increase of ig versus non - ig (p < 0.01), diabetes versus non - ig (p = 0.02), but not significantly different for new diabetes versus ig. of 558 volunteers recruited to be studied, 542 (150 non - ig, 174 ig, and 218 new diabetes) completed the studies. in the ig group, 31 of 174 (17.8%) chose not to have the 2-h 75-g ogtt. the diagnosis of ig was based on abnormality of only ifg (60/174, 34.5%) ; ifg and a1c (58/174, 33.3%) ; ifg, igt, and a1c (28/174, 16.1%) ; igt and a1c (10/174, 5.7%) ; ifg and igt (9/174, 5.2%) ; and igt only (9/174, 5.2%). small differences in age, sex, and physical features among study groups (supplementary table a) should not have influenced the results since neurophysiologic end points (e.g., attributes of nc) were corrected for applicable variables affecting the frequency and severity of dpns (34,36). significant differences among studied groups were observed for pulse, blood pressure, and some lipid and lipoprotein classes (supplementary table a). the primary outcome measure, the prevalence of dpn (typ or atyp or combined), was not significantly different between ig and non - ig, whether defined narrowly or broadly (fig. by contrast, the frequency of typ dpn only was significantly increased in new diabetes. typical dpn was significantly more frequent in new diabetes (dm) (6.0%) than in ig (0.6%, p < 0.01) and more frequent than in non - ig (2.0%), although this latter difference was almost significant (p = 0.07). atypical dpn was more frequent in dm (1.8%) than in non - ig (0.0%) or ig (1.%), but these differences were not significant. typical dpn was more frequent in dm (8.3%) than in non - ig (5.3%) or ig (4.6%), but these differences were not significant. atypical dpn was more frequent in dm (9.2%) than in non - ig (7.3%) or ig (8.1%), but these differences were not significant. in secondary analysis using ifg only, igt only, or ifg and igt combined as the criterion for ig, no significant increase in typ, atyp, or typ and atyp dpn was found whether narrowly or broadly defined. none of the four composite nc scores assessed showed a significant difference in mean values between ig and non - ig (fig. 3). the 25th, 50th, 75th percentiles and range values were essentially overlapping between ig and non - ig. by comparison, a definite and significant downward shift toward abnormality was shown for new diabetes. as a further test of the validity of these composite nc scores, we compared them with those of an earlier healthy subjects cohort (the rochester diabetic neuropathy study of healthy subjects [rdns - hs ]) and to a previously studied prevalence diabetes cohort (the rochester diabetic neuropathy study [rdns ]) (fig. the composite scores of the non - ig and ig groups did not differ significantly from the scores in the previously studied rdns - hs (34). in rdns (25,27), the scores were significantly worse than in the presently studied non - ig, ig, and new diabetes groups (fig. 2 nc nds is the sum of peroneal mncv and sural snap nds ; 5 nc nds is the sum of peroneal cmap, mncv, and mndl, tibial mndl, and sural snap nds ; 4 nc nds is the sum of peroneal, tibial, and ulnar cmap and sural snap nds ; 6 nc nds is the sum of peroneal, tibial, and ulnar mncv and f - wave latency nds (all percentiles expressed in the lower tail of the distribution). two - sample t tests : 2 nc nds 1 vs. 3 0.002, 1 vs. 5 < 0.001, 2 vs. 3 < 0.001, 2 vs. 5 < 0.001, 3 vs. 4 < 0.001, 3 vs. 5 < 0.001, 4 vs. 5 < 0.001 ; 5 nc nds 1 vs. 3 0.033, 1 vs. 5 < 0.001, 2 vs. 3 0.044, 2 vs. 5 < 0.001, 3 vs. 4 0.002, 3 vs. 5 < 0.001, 4 vs. 5 < 0.001 ; 4 nc nds 1 vs. 3 0.008, 1 vs. 5 < 0.001, 2 vs. 3 < 0.001, 2 vs. 5 < 0.001, 3 vs. 4 0.002, 3 vs. 5 < 0.001, 4 vs. 5 < 0.001 ; 6 nc nds 1 vs. 3 0.006, 2 vs. 3 < 0.001, 3 vs. 4 0.002. among 1, 2, and 4, there were no significant differences for any composite score. cmap, compound muscle action potential ; mncv, motor nerve conduction velocity ; mndl, motor nerve distal latency ; snap, sensory nerve action potential. quantitative sensation test (qst) results were confirmatory of the clinical and nc observations reported above (i.e., increased prevalence of typ dpn and composite nc abnormality only in new diabetes). no significant difference in quantitative sensation scores was found between the non - ig and ig groups, but scores were significantly worse in the new diabetes group than in the other two tested groups (table 1). qst and hrdb test results in the oc ig trial in contrast to the qst results, a decrease in heart rate response to deep breathing (hrdb) was found in ig as compared with non - ig, but a further significant decrease was not found in new diabetes. in secondary analysis, a similar result was found when ifg only was used as the indication of ig. when igt was the indicator of ig, no significant decrease of hrdb was observed. the frequency of diabetic retinopathy was 3.4, 4.7, and 9.4%, respectively, for non - ig, ig, and new diabetes (fig. the difference was not significant between the non - ig and ig groups (p = 0.57) but was significantly increased for new diabetes versus non - ig (p = 0.03) and borderline significant for ig versus new diabetes (p = 0.08). in secondary analysis and using ifg only as the ig criterion, retinopathy was found in 5.2, 4.3, and 10.2%significantly increased in new diabetes versus ig. using igt only, retinopathy was found in 3.4, 9.9, and 12.1%significantly increased in ig versus non - ig and new diabetes versus non - ig. using combined ifg and igt abnormality, retinopathy was found in 4.4, 8.7, and 10.9%significantly increased only in new diabetes versus non - ig. in primary analysis, nephropathy was recorded in 4.1, 4.7, and 10.7% of patients with non - ig, ig, and new diabetes (fig. the difference was significant for non - ig versus new diabetes (p = 0.02), as well as for ig versus new diabetes (p = 0.03). in secondary analysis of nephropathy, nephropathy occurred in 3.5, 7.2, and 10.9% in non - ig, ig, and new diabetes being significantly more frequent only in new diabetes. using igt, only nephropathy was found in 3.8, 10.0, and 9.3%significant for ig versus non - ig (p = 0.03), diabetes versus non - ig (p = 0.03), but not significant for new diabetes versus ig (p = 0.87). when both ifg and igt were used, frequency was 3.6, 13.3, and 9.4%significant increase of ig versus non - ig (p < 0.01), diabetes versus non - ig (p = 0.02), but not significantly different for new diabetes versus ig. our prospective, population - based survey using masked and quantitative assessment for the prevalence of polyneuropathy, retinopathy, and nephropathy did not find an increased prevalence of any of them in ig, defined as any abnormality of ifg, igt, or ia1c (the latter used only to recognize new diabetes). using the criterion of igt for the diagnosis of ig, 31% had new diabetes by ifg or ia1c criteria. in a secondary analysis when ig was defined by ifg only, igt only, or ifg and igt combined criteria, no significant increase in typ, atyp, or combined typ and atyp dpn was observed whether narrowly or broadly defined ; however, small but significant increases of retinopathy and nephropathy were observed. since other risk covariates than chronic hyperglycemia (e.g., microalbuminuria or hypertension) might be implicated in early retinopathy or nephropathy, it is unclear whether this low level of increase can be attributed to impaired glycemia (37). to relate our results to those of earlier studies, we make a distinction between typ and atyp dpn as agreed to at a recent consensus meeting (20). typ dpn was defined as a length - dependent dpn, usually developing on a background of chronic hyperglycemia and secondary metabolic derangement (polyol shunting, accumulation of advanced glycation end products, oxidative stress, altered lipid metabolism, or other). typical early manifestations of typ dpn are abnormalities of nc and associated with it or developing later signs and symptoms of a distal sensorimotor polyneuropathy. both large and small sensory fibers and motor and autonomic fibers may be affected. by contrast, atyp dpn (ciap) is manifested by intercurrent development of pain and autonomic symptoms and more selective involvement of small sensory and autonomic nerve fibers. nc abnormality is not a necessary feature. to ensure that clinical evaluations of complications were standard, detailed, and comprehensive, we used the neuropathy symptoms and change score, a broad survey of muscle weakness and sensory and autonomic symptoms. to guard against biased exclusion of patients with atyp dpn, we included all patients with the symptoms and findings (into the broad category of ciap) even when we thought they might have another cause than ig or diabetes for their neuropathy. to avoid overdiagnosis of typ dpn considering typ dpn, our data do not support the hypothesis that ig causes it. while the power of our study is insufficient to rule out a small increase, a substantial increase appears unlikely for the following reasons : 1) we were able to demonstrate an unequivocal increase of this polyneuropathy in a new diabetes cohort that was not much larger than the ig cohort ; 2) average values of composite nc scores spanning normal and abnormal values showed no significant abnormality in ig, whereas they were significantly shifted in new diabetes ; 3) similar results to those recorded in reason 2 were found for quantitative sensation test values ; and 4) occurrence of the complications of retinopathy and nephropathy known to be correlated with typ dpn also were not significantly increased in ig but were unequivocally increased in new diabetes. the small but significant increase of retinopathy and nephropathy found only in secondary analysis may relate to a greater degree of chronic hyperglycemia with use of the igt, and igt and ifg combined criteria than we used or any abnormality of the three criteria. our lack of finding an increased prevalence of typ dpn in ig agrees with the results of fujimoto. (5) and isak. (23), who used nc as a primary indication of polyneuropathy, but not with that of franklin. (6) based on clinical examination by trained nurses. use of clinical neurologic examination only may overestimate the frequency, especially signs of dspn (38), emphasizing the need for use of objective minimal criteria for the diagnosis. as we have recently shown, composite scores of nc, such as 2 nc nds or 5 nc nds, perform very well because they define the neurophysiologic test exactly by avoiding type 1 error, and they are representative, sensitive, and specific for the diagnosis and therefore are useful for epidemiologic survey and conduct of controlled trials (38). our finding that atyp dpn was not significantly increased in ig fits the conclusions of hughes. whose results differ strikingly from that of several earlier studies using historic control subjects (915,17,19). our studies focusing mostly on symptomatic painful and autonomic polyneuropathies did not address the related question of whether counts of epidermal nerve fibers were decreased in ig. however, the tests we used (qsts and hrdb, presumably less sensitive or specific) did not detect abnormality in ig or new diabetes. thus, the inferences that ig is a common or the usual underlying cause of symptomatic atyp dpn (or ciap) are not supported by our data nor that of hughes. or ziegler. the likely explanation for the difference in the results of the studies of hughes. (21), ziegler. (31,32), and our present study finding no or only small increases of atyp dpn as compared with other studies reviewed in the beginning of this article is difficult to reconcile but can be attributable, at least in part, to selection bias in the earlier studies (selectively recruiting patients with ig to study), to inappropriate use of historic control subjects, or to use of only clinical criteria used for diagnosis. in this study, we may have more rigorously defined ig using any one of three criteria, i.e., ifg, igt, or ia1c. to avoid the first two pitfalls, we recruited patients from a population - based disease and laboratory database (39), selected patients by their non - ig or ig status to avoid referral bias, and made judgments about the presence of atyp dpn by masked evaluation using both narrow and broad criteria. a priori power was not obtained in the study because of a decrease in the overall sample size and the realization of a third patient classification (new diabetes), which further limited the sample size for each classification group. nonetheless, adequate power and precision (ci width) remained for between classification comparisons and the description of the prevalence of dpn. the realized sample sizes in each classification (i.e., 150, 174, and 218 for non - ig, ig, and new diabetes, respectively) helped maintain precision by providing large sample sizes where higher prevalence of dpn could be anticipated (note, precision decreases as prevalence approaches 0.5). for a range of hypothesized prevalences, say 110%, sample sizes ranging from 150 to 218 would be expected to have precision of approximately plus or minus 4 percentage points as measured by the width of a 95% score ci. what are the implications of our studies ? by showing that ig alone does not cause diabetic microvessel complications, our results support present ada criteria for the diagnosis of diabetes, based on the idea that the lowest level of chronic hyperglycemia that induces microvessel complications should be the minimal criteria for the diagnosis of diabetes. also, our results have important implications for the diagnosis and management of polyneuropathy in ig or diabetes. our studies may also have implications for the degree of hyperglycemia control that is desirable for management of diabetes. our observations might be taken as a further argument not to overdo rigorous control of hyperglycemia in ig (40). our findings, however, should not allay concerns about ig as a risk covariate for macro- and microvessel complications since ig usually leads to t2 dm, which is known to cause such complications. finally, our study sheds doubt on the common assumption that ig is the proximate and usual cause of chronic idiopathic painful and autonomic polyneuropathy (atyp dpn or ciap) since ig does not appear to be an adequate explanation of their cause. | objectiveto test whether diabetic polyneuropathies (dpns), retinopathy, or nephropathy is more prevalent in subjects with impaired glycemia (ig) (abnormality of impaired fasting glucose [ifg ], impaired glucose tolerance [igt ], or impaired hba1c [ia1c ]) than in healthy subjects (non - ig).research design and methodsmatched ig and non - ig volunteers were randomly identified from population - based diagnostic and laboratory registries, restudied, and reclassified as non - ig (n = 150), ig (n = 174), or new diabetes (n = 218).resultsfrequency (%) of dpn in non - ig, ig, and new diabetes was 3 (2.0%), 3 (1.7%), and 17 (7.8%) narrowly defined (no other cause for polyneuropathy) and 19 (12.7%), 22 (12.6%), and 38 (17.4%) broadly defined. mean and frequency distribution of composite scores of nerve conduction and quantitative sensation tests were not significantly different between ig and non - ig but were worse in new diabetes. frequency of retinopathy and nephropathy was significantly increased only in new diabetes. in secondary analysis, small but significant increases in retinopathy and nephropathy were found in igt, ifg, and igt combined groups.conclusionsin population studies of olmsted county, minnesota, inhabitants, prevalence of typical dpn, retinopathy, and nephropathy was significantly increased only in subjects with new diabetes not in subjects with ig as defined by american diabetes association (ada) criteria of abnormality of ifg, igt, or ia1c. for atypical dpn, such an increase was not observed even in subjects with new diabetes. in medical practice, explanations other than ig should be sought for patients with atypical dpn (chronic idiopathic axonal polyneuropathy) who have ig. |
according to ims institute for healthcare informatics estimates, health care costs caused by improper and unnecessary use of medicines exceeded $ 200 billion in 2012 (ims institute for healthcare informatics, 2013). in 2013, the estimated health care expenditures related to potentially inappropriate medications (pims) was $ 1.3 billion, with a range of $ 900 million to $ 1.7 billion (ims institute for healthcare informatics, 2013). pims are medications with risks that outweigh their therapeutic benefit and should be avoided in people aged 65 or older (campanelli, 2012 ; oconnor, gallagher, & omahony, 2012). the prevalence of pim reported in the literature ranges from 35% to 47% (gallagher., 2011 ; gallagher & omahony, 2008) in hospitalized older adult patients and up to 73% in nursing homes (byrne. 2013). a similar study in ireland attributed 9% of the overall expenditure on pharmaceuticals to pims (cahir., 2010). pims such as nonsteroidal anti - inflammatory drugs (nsaids) are the most common cause of gastropathy among geriatrics, with an average admission cost of over $ 14,000 (fick., 2003). these numbers are expected to only increase with rising health care costs and the use of multiple specialty physicians that increases the likelihood of polypharmacy and the prescribing of pims (takane, balignasay, & nigg, 2013). inappropriate prescribing is associated with negative outcomes including adverse drug events, readmission rates, higher mortality rates, medication nonadherence, increased risk of falls, and increased health care costs (oconnor., 2012). a 2005 study estimated that more than 4.3 million health care visits were attributed to an adverse drug event as a result of polypharmacy (maher, hanlon, & hajjar, 2014). furthermore, polypharmacy and pims are estimated to cause adverse drug events in up to 35% of outpatients and 40% of inpatient older adults (maher., 2014). there are no clear guidelines for prescribers to determine what type of pim should be used ; clinicians must therefore consider multiple factors when choosing such agents for geriatric use (campanelli, 2012). efficient use of medication among older military beneficiaries represents a significant challenge for the department of defense (dod). many older dod beneficiaries use both tricare (military health care service) and medicare for their medical needs. tricare is the health maintenance organization (hmo) equivalent for military service members, including retirees and their qualified dependents. as civilian and government hospitals do not have combined medical records, it is difficult for the dod to properly manage medications. in one study of 123,682 tricare beneficiaries 65 years and older, 50% obtained six or more medications, and 3% obtained 16 or more medications from the pharmacy during a 90-day period (linton, garber, fagan, & peterson, 2007). the beers criteria for potentially inappropriate medications use in older adults (the beers criteria), devised by beers and his colleagues in 1991 for use in nursing homes, was subsequently expanded and revised in 1997, 2003, and 2012, and consists of 53 medications or classes of medications that are divided into three groups : pims to avoid in older adults, pims to avoid in older adults with diseases and syndromes that the drugs can exacerbate, and medications to be used with caution (campanelli, 2012). the beers criteria (mainly designed for use in the united states) is a well - validated tool that allows easy comparison with other studies (fick., 2003). it is a well - known, comprehensive list endorsed by the american geriatrics society, creating a standard list of medications that may be deemed potentially inappropriate. among community - dwelling older adults, a systemic review identified an association between medications listed on the beers criteria and hospitalizations (jano & aparasu, 2007). the beers criteria is currently being updated and is set for release in 2015 (the john a. hartford foundation, 2015). the aim of this study is to determine the prevalence and types of pims at admission and upon discharge, and to compare these findings with the national average. in addition, the factors that affect the number of pims at admission and discharge were also evaluated using the 2012 beers criteria. a retrospective study was conducted by a clinical pharmacist and a member of the study team. three electronic record systems were used : the composite health care system (chcs), the armed forces health longitudinal technology application (ahlta), and essentris (an inpatient system). all admission and discharge medications were assessed for pim using the 2012 beers criteria. in this study, medications in the patient s record that were listed on the beers criteria were considered pims. inclusion criteria included patients 65 years and older who had been discharged from the internal medicine unit, patients with at least one medication prescribed at time of admission, patients with medications who had been in active status with or without multiple refills within 180 days of admission, patients with medications of sufficient quantity to warrant chronic use (at least a 30-day supply), patients who received medical care for chronic disease management, and patients with available medication records. all readmissions within 30 days of initial discharge from the internal medicine unit were also examined. all patient medications were evaluated and verified 6 months prior to admission and at discharge. patients who died during hospitalization and/or left against medical advice were excluded from the study ; patients admitted and discharged from other clinics such as family medicine, step down, intensive care, surgery, and psychiatry units were also excluded. patients were also excluded if they had no medication history prior to admission and had expired or discontinued medications. a total of 285 charts were linked to the internal medicine unit for the study period ; after exclusion criteria were assessed, a random sample of 60 patients was included in the study due to time limitations and a stringent inclusion criterion. the pim prevalence was determined by dividing the total number of patients with at least one pim by the total number of patients. only medications listed in the hospital electronic medical record that were covered by tricare were reviewed. over - the - counter (otc) medications were not reviewed because they are not kept in the electronic medical record. contraindicated diseases / conditions at admission were identified to determine both acute and chronic disease state, and compared with the 2012 beers criteria for potential drug disease interactions. factors affecting number of pims at admission and discharge were determined by fitting regression using two models. the first model was fitted for number of pims at admission, with gender, age, and total number of medications used by the patient at admission as independent variables. the second model fitted a global model with number of pims at discharge, with gender, age, length of stay at hospital, total number of medications used by the patient at admission, total number of medications used by the patient at discharge, and number of pims at admission as independent variables. table 1 provides an overview of population characteristics including age, gender, and length of hospital stay. an examination of polypharmacy found that 93% of patients at admission and 90% of patients at discharge had at least five medications. among the 60 patients evaluated, 44 (73%) were on at least one pim at admission ; the prevalence at discharge was 50% (p overall, 11% (77/722) of medications at admission and 7.1% (46/647) of discharge medications were found to be potentially inappropriate (table 2). the top three classes of pim at admission were antihistamines (15.3%), nsaids (13.9%), and benzodiazepines (8.3%) ; whereas antihistamines (18.6%), central alpha blockers (11.6%), and antiarrhythmics (9.6%) were the most frequently prescribed pims at discharge. several other drugs and drug classes accounted for the remaining pim at admission and include calcium channel blockers (8.3%), central alpha blockers (6.9%), opioids (5.6%), antidepressants (5.6%), antiarrhythmics (5.6%), hypnotic (4.2%), alpha blockers (4.2%), skeletal muscle relaxants (4.2%), antimuscarinic (4.2%), and medications less frequently prescribed (tricyclic antidepressants, antispasmodics, antiparkinson, sulfonylurea, thiazolidinedione, mirtazapine, and megestrol ; table 3). common pim identified at admission and discharge based on the 2012 beers criteria. source. gender did not make a statistically significant difference in number of pims at either admission or discharge (table 4). age was negatively related to number of pims at admission meaning older patients were likely to have smaller number of pims. however, this relationship was not found between number of pims at discharge and total number of medications at discharge. number of pims at both admission and discharge were positively related with total number of medications at admissions and discharge, respectively. at admission, each increase in number of medications was associated with.1 pims. at discharge, each increase in number of medications was associated with.07 pims. according to the global model, number of pims at discharge was positively associated with the number of pims at admission as well as the total number of medications used at discharge. however, somewhat surprisingly, number of pims at discharge was negatively associated with the total number of medications used at admission. the reason for this may be that those who are known to use a larger number of medications at admission are assumed to be more likely users of pims and as such may be given more intensive scrutiny and care in reducing the number of pims. three patients were readmitted within 30 days of discharge ; only one had a pim (meclizine), but the pim was unrelated to the readmission diagnosis (pleural effusion). the frequencies based on this group classification at admission were as follows : medications to avoid (61%), medications that cause disease interaction (20.3%), and medications to be used with caution (2.7%). pim with potential drug disease interaction identified at admission include zolpidem (hypnotic), verapamil and diltiazem (calcium channel blockers), terazosin (alpha blocker), and pseudoephedrine and theophylline (central nervous system [cns ] stimulants). two antipsychotics, risperidone and paliperidone, were identified at both admission and discharge as medications to use with caution. this study found a high prevalence of pim use at both admission and discharge among older adult patients in a u.s. military hospital. among the 60 patients evaluated, 44 (73%) were on at least one pim at admission, whereas the prevalence of pim at discharge (30 patients) was 50% (p the top three classes of pim at admission were antihistamines (11, 15.3%), nsaids (10, 13.9%), and benzodiazepines (6, 8.3%). patients on > 10 medications at admission (37, 62%) were 4 times more likely to have a pim (p 15 drugs (figure 1). patients taking > 10 medications at admission were 4 times more likely to have a pim (p 60 years old were seen at the hospital annually. the small sample size is attributed to a stringent inclusion criterion and time limitations that did not evaluate all patients receiving regular medical care for managing chronic disease states at other clinics, hence limiting the generalizability of this study. data were obtained from only one department in the hospital, thus introducing selection bias. the prevalence and types of pims found in our results are most likely lower than the actual amount due to only including medications covered by tricare. for example, an otc antihistamine taken by a patient would not have been evaluated. this is significantly lower than the national average of 56% of the population > 65 years old who are women. the period from which data for the study were compiled (december 2012-september 2013) may have been too close to the introduction of the revised beers criteria (april 2012), thus not providing health professionals sufficient time to adapt and incorporate the new evidence into their practice. we also recognize that there are other reasons for admission other than pim and polypharmacy. finally, the list and number of medications captured were those paid for by tricare ; filled at womack army medical center, other military hospitals, and non - network pharmacies ; and documented in various hospital record systems. any medication purchased out of pocket and not provided by the patient at admission was not evaluated and could be a limitation to this study. our study shows a high prevalence of pim among older adult patients who receive care at a u.s. military hospital. health care providers should screen medications to minimize polypharmacy, a major risk factor for pim, and address pims and justification for their use at each hospital visit. furthermore, health care managers must also look at ways to incorporate the beers list into electronic prescribing systems to alert providers. providers must be aware of the beers criteria and minimize pim use except where clinically warranted to help mitigate potential harms that may be associated with using these types of medications. the results of this study may help create awareness, and provide knowledge and understanding of the importance of the application of the beers criteria and pim prevalence in the military health system. future studies should involve larger sample size, investigate justification for pim use, analyze any association between pim and readmission, and address comorbidity and pim association if any. | objective : this study aims to examine potentially inappropriate medication (pim) prevalence and factors that affect the use of pims in a military treatment facility. method : admission and discharge medication lists of 60 patients aged 65 years were retrospectively reviewed by a clinical pharmacist and a member of the study team for the presence of pim using the 2012 beers criteria. patients included were those discharged between december 2012 and september 2013 from the womack army medical center, internal medicine unit. results : among the 60 patients evaluated, 44 (73%) were on at least one pim at admission, whereas the prevalence of pim at discharge (30 patients) was 50% (p 10 medications at admission (37, 62%) were 4 times more likely to have a pim (p <.001). conclusion : data showed a high and a previously unknown pim prevalence among older adults in a u.s. military treatment facility. |
a 31-year - old female patient consulted to our outpatient clinic because of a mass protruding from her right nipple. on her breast examination, an 8 mm prolapsed mass was seen on the right breast areola (figure 1). during physical examination any abnormality was not detected on other parts of the breast, and her left breast. from her personal and family medical history her breast ultrasonographic (us) examination demonstrated an avascular, hypoechoic prolapsed solid mass measuring 8x5 mm which filled the areolar region completely. based on physical, and us examination findings surgery was planned with the initial diagnosis of intraductal papilloma. the prolapsed mass, minimal portion of the overlying areolar skin and communicating ductus were totally excised under local anesthesia. histopathological examination of the specimen revealed intraductal papilloma without atypical dysplasia (figure 2). any postoperative complication did not develop, and any recurrence was not seen during 2 years of follow - up. intraductal papillomas (ip) are benign tumours which develop as a result of papillary proliferation of the ductal epithelium. its incidence is 2 - 3%, and it is seen between 30, and 77 years of age. central type is a solitary ip which settles in the subareaolar region, and it is observed in perimenauposal women. peripheral type is situated on the proximal parts of the laciferous ducts of young female patients and tends to be multiple. however, the patient consulted to the physician at an earlier stage because of the protruding characteristics of the mass. although it is generally localized in the breast tissue, and subareolar region, in our case, it protruded from the nipple of the patient. intramammary masses are detected by us, and the diagnosis is conclusively confirmed by biopsy. radiological imaging techniques are helpful in establishing the diagnosis, however for the discrimination between benign, and malign lesions core needle biopsy should be performed. treatment of intraductal papillomas consists of total excision. since the mass lesion of our patient was protruding, total excision was performed both for diagnosis, and treatment. if intramammary ip lesion can be located using radiological techniques, then excision, without needle biopsy is recommended. core biopsy is recommended for cases with radiologically suspect malignancy or in the presence of microcalcification, and distorted tissue ultrastructure. if small papillary lesions can be totally excised, and histopathologic examination does not reveal any evidence of atypia, then the patient can be followed up with us, and mammographic monitorization. in the differential diagnosis, nipple adenoma, and papillary lesion, paget s disease, eczematous dermatitis, and pyogenic granuloma histopathological differentiaton of the excised mass can be achieved. if untreated, papillary lesion of the nipple also protrudes. paget s disease, and eczema can be discriminated from other lesions with their characteristic cutaneous incrustrations. ip prolapsed from the nipple is a rarely seen abnormality. for its diagnosis, and treatment, | intraductal papillomas (ip) are benign papillary lesions caused by proliferation of mammary ductal epithelium. ip occurs in the breast tissue. prolapse of ip from nipple can be rarely seen. ips are generally treated with total excision. a 31-year - old female patient was admitted to our clinic because of a protruded lesion from the nipple of her right breast. on her breast examination, an 8 mm- prolapsed mass was seen on the areola of her right breast. breast ultrasonography showed no other lesions in the breast. the patient was operated with initial diagnosis of ip. the prolapsed mass, the overlying nipple skin and related ductus were totally excised under local anesthesia. histopathological examination of the specimen revealed intraductal papilloma without atypical dysplasia. herein, we are presenting a rarely encountered case of ip prolapsed from the nipple of a female patient. |
malignancies of the thyroid gland are relatively rare worldwide, but incidence has steadily increased over the last few decades. the majority of thyroid cancers are differentiated carcinomas of the papillary or of follicular type, which typically have a good prognosis and highest cure rate. here, we report a case of an 18-year - old boy with a huge multinodular goiter, noted swelling first at 5 years of age, which compromised the airway with retro - sternal extension and tracheal compression. he was operated twice and found to be irresectable, further line of management from palliative care point highlighted in this text. this case also draws our attention towards those factors which prevent the early diagnosis and treatment of these types of malignancies in which early diagnosis and treatment implications can change the whole prognostic scenario of the patient. an 18-year - old male presented with multiple swellings [first swelling appeared at the age of 5 years ] involving the entire neck [figure 1 ] with history of dyspnea, change in voice, and 4 episodes of hemoptysis. the amount of blood was around 10 - 15 ml, and color was bright red. from the past 1 year, he had the complain of dyspnea on moderate exertion, which aggravated on neck flexion and also developed change in the voice. patient with a large goiter in propped up position on examination, he looked well, not in distress or sweating. his body weight 35 kg, heart rate was 92 beats/ min, and blood pressure 100/70 mmhg. local neck examination showed multiple nodular swellings with enlarged thyroid more on the right side moving with swallowing, firm in consistency, nodular surface, not tender with normal overlying skin, swelling seen extending from 1 cm above thyroid notch up to suprasternal notch, lower margin of the swelling could not be make out, swelling on right side extends 2 cm beyond posterior border of sternocleidomastoid muscle [figure 2 ]. larynx and trachea displaced towards left side, right carotid vessel displaced anteriorly, bruit heard and thrill felt, left carotid thrill also felt ; engorged right external jugular vein was seen. patient with a large goiter in sitting position with neck extended cardiovascular and abdominal system examination was normal. chest x - ray showed thin miliary nodules in both lung fields with basal predominance, suggestive of metastasis [figure 3 ]. chest x - ray shows multiple miliary mottling x - ray soft tissue neck - ap and lateral view [figure 4 ] showed calcified mass lesion in neck compressing trachea with retrosternal extension into superior mediastinum. lateral neck x - ray shows goiter extension to pretracheal and paratracheal area laboratory investigations were within normal range. the patient was scheduled to undergo total thyroidectomy under general anesthesia. during surgery, it was found that tumor was unresectable due to an extensive involvement of major blood vessels of the neck, therefore, case was closed. we shifted the patient to icu, ventilated him overnight and successfully extubated him on next day. thyroid cancer which involves the laryngotracheal airway is an uncommon but serious clinical problem, its incidence has been reported to be 0.5 to 2.2% among all thyroid cancers. from the anesthetic point of view, intubation and extubation however in this case, we did not face any problem during intubation and extubation but since the tumor was non - resectable, the main concern was to extend the life and to palliate the distressing symptoms due to progressive disease. various distressing symptoms patient can develop due to local structure invasion such as pain, hoarseness of voice, dyspnea, dysphonia, hemoptysis, and dysphagia. the most commonly invaded organs in wdtc [well - differentiated thyroid cancer ] are the larynx and trachea, and their involvement causes death from asphyxia. thyroid cancer metastasizes to distant sites such as lung, bone, and liver can cause pain and other dysfunction. these symptoms are often a source of great discomfort and distress for the patient and for his family and raise a challenge for the treating doctor. challenging issues are : physical problems faced by patient, which carry a poor prognosis.end of life care and psychosocial issues. physical problems faced by patient, which carry a poor prognosis. pain - it is quite disappointing for the patient and should be treated as early as possible. find out the cause and prescription of appropriate analgesics [opoids or non - opoids ] and adjuvant drugs, with addition of drug to control the intolerant adverse effects of analgesic, is the mainstay of treatment. sometimes patient may respond with palliative chemotherapy, radiotherapy, or specific intervention [nerve block, neurolysis, trigger point injection etc.].excess oral secretion and salivary drooling - treat with pharmacologic inhibition [hyoscine hydrobromine transdermal patch or 150 300 g sl or glycopyrronium 200 400 g sc or 400 1200 g by continues sc infusion or hyoscine butyl bromide 20 mg orally or sc and 40 180 mg by csci ] or radiation, or surgery.breathlessness due to tracheal invasion or compression, patient may develop breathlessness. this should be managed by explaining the cause and the treatment plan to patient with involvement of physiotherapist to teach breathing techniques and use of relaxation and cognitive behavioral therapy techniques. oxygen, heliox, inhaled furesemide, anti - depressant, facial cooling by fan, opoids for reduction of sensation of breathlessness and benzodiazepines for panic and anxiety attack and sometimes non - invasive ventilation can be used.dry cough if there is no underlying reversible cause, it can be suppressed by oral antitusive or use inhaled or nebulized steroids or inhaled cromolyn sodium or lidocaine, nebulized morphine, paroxetine, benzodiazepines, etc.fear and panic- occurs due to compressive symptoms and impending death, should find out the underlying cause and seek help with clinical psychologist for patients with complex problem or start benzodiazepine.management of bleeding identify and treat underlying cause, if appropriate consider hemostatic agents and dressings, anti - fibrinolytic agent, vit. k, vasopressin / desmopressin, octreotide / somatostatin, blood product transfusion, radiotherapy, endoscopic ligation and coagulation, and transcutaneous arterial embolization and for patient at risk of major bleed in the terminal phase, use of sedative medications like midazolam buccal /iv / im / sc or diazepam per rectum and green towels or surgical clothes to minimize the visual impact of blood loss. if major bleed occurs, stay with and reassure the patient and family.lymphedema manage with good skin care, regular exercise of effected limb, manual lymph drainage, massage therapy, compressive therapy or some patients require radiotherapy or chemotherapy or dexamethasone 16 mg daily for 1 week for acute lymphatic obstruction. pain - it is quite disappointing for the patient and should be treated as early as possible. find out the cause and prescription of appropriate analgesics [opoids or non - opoids ] and adjuvant drugs, with addition of drug to control the intolerant adverse effects of analgesic, is the mainstay of treatment. sometimes patient may respond with palliative chemotherapy, radiotherapy, or specific intervention [nerve block, neurolysis, trigger point injection etc. ]. excess oral secretion and salivary drooling - treat with pharmacologic inhibition [hyoscine hydrobromine transdermal patch or 150 300 g sl or glycopyrronium 200 400 g sc or 400 1200 g by continues sc infusion or hyoscine butyl bromide 20 mg orally or sc and 40 180 mg by csci ] or radiation, or surgery. this should be managed by explaining the cause and the treatment plan to patient with involvement of physiotherapist to teach breathing techniques and use of relaxation and cognitive behavioral therapy techniques. oxygen, heliox, inhaled furesemide, anti - depressant, facial cooling by fan, opoids for reduction of sensation of breathlessness and benzodiazepines for panic and anxiety attack and sometimes non - invasive ventilation can be used. if there is no underlying reversible cause, it can be suppressed by oral antitusive or use inhaled or nebulized steroids or inhaled cromolyn sodium or lidocaine, nebulized morphine, paroxetine, benzodiazepines, etc. fear and panic- occurs due to compressive symptoms and impending death, should find out the underlying cause and seek help with clinical psychologist for patients with complex problem or start benzodiazepine. identify and treat underlying cause, if appropriate consider hemostatic agents and dressings, anti - fibrinolytic agent, vit. k, vasopressin / desmopressin, octreotide / somatostatin, blood product transfusion, radiotherapy, endoscopic ligation and coagulation, and transcutaneous arterial embolization and for patient at risk of major bleed in the terminal phase, use of sedative medications like midazolam buccal /iv / im / sc or diazepam per rectum and green towels or surgical clothes to minimize the visual impact of blood loss. manage with good skin care, regular exercise of effected limb, manual lymph drainage, massage therapy, compressive therapy or some patients require radiotherapy or chemotherapy or dexamethasone 16 mg daily for 1 week for acute lymphatic obstruction. the majorities of thyroid cancers are slow growing and have an excellent prognosis after surgical and medical therapy, therefore, the early diagnosis and institution of treatment is necessary. the major challenges for early diagnosis and treatment are negligence or lack of knowledge[1619 ] - unawareness, lack of education, social and domestic responsibilities are the causes attributes delay from patient side.paucity of approach - lack of approach or accessibility to health care services causes delay.financial constraints in our country, one of the very important factors leading to delay in seeking medical advice.quacks and alternative treatment modalities an improper guidance may lead to aggravation of disease and delay in the diagnosis and hence for treatment.non-uniformity of medical advice due to unconsensus opinion regarding the treatment modalities, patient gets confused and leads to delay in seeking the proper treatment.fear of surgery many patients have various fears regarding surgery ; therefore, the proper counseling is necessary. negligence or lack of knowledge[1619 ] - unawareness, lack of education, social and domestic responsibilities are the causes attributes delay from patient side. paucity of approach - lack of approach or accessibility to health care services causes delay. financial constraints in our country, one of the very important factors leading to delay in seeking medical advice. quacks and alternative treatment modalities an improper guidance may lead to aggravation of disease and delay in the diagnosis and hence for treatment. non - uniformity of medical advice due to unconsensus opinion regarding the treatment modalities, patient gets confused and leads to delay in seeking the proper treatment. fear of surgery many patients have various fears regarding surgery ; therefore, the proper counseling is necessary. palliative care should not only include physical symptoms management but also cover psychological, spiritual, and social aspect of care. integrated care pathway should be opted, especially for the patients who are at the last stage. pain - it is quite disappointing for the patient and should be treated as early as possible. find out the cause and prescription of appropriate analgesics [opoids or non - opoids ] and adjuvant drugs, with addition of drug to control the intolerant adverse effects of analgesic, is the mainstay of treatment. sometimes patient may respond with palliative chemotherapy, radiotherapy, or specific intervention [nerve block, neurolysis, trigger point injection etc.].excess oral secretion and salivary drooling - treat with pharmacologic inhibition [hyoscine hydrobromine transdermal patch or 150 300 g sl or glycopyrronium 200 400 g sc or 400 1200 g by continues sc infusion or hyoscine butyl bromide 20 mg orally or sc and 40 180 mg by csci ] or radiation, or surgery.breathlessness due to tracheal invasion or compression, patient may develop breathlessness. this should be managed by explaining the cause and the treatment plan to patient with involvement of physiotherapist to teach breathing techniques and use of relaxation and cognitive behavioral therapy techniques. oxygen, heliox, inhaled furesemide, anti - depressant, facial cooling by fan, opoids for reduction of sensation of breathlessness and benzodiazepines for panic and anxiety attack and sometimes non - invasive ventilation can be used.dry cough if there is no underlying reversible cause, it can be suppressed by oral antitusive or use inhaled or nebulized steroids or inhaled cromolyn sodium or lidocaine, nebulized morphine, paroxetine, benzodiazepines, etc.fear and panic- occurs due to compressive symptoms and impending death, should find out the underlying cause and seek help with clinical psychologist for patients with complex problem or start benzodiazepine.management of bleeding identify and treat underlying cause, if appropriate consider hemostatic agents and dressings, anti - fibrinolytic agent, vit. k, vasopressin / desmopressin, octreotide / somatostatin, blood product transfusion, radiotherapy, endoscopic ligation and coagulation, and transcutaneous arterial embolization and for patient at risk of major bleed in the terminal phase, use of sedative medications like midazolam buccal /iv / im / sc or diazepam per rectum and green towels or surgical clothes to minimize the visual impact of blood loss. if major bleed occurs, stay with and reassure the patient and family.lymphedema manage with good skin care, regular exercise of effected limb, manual lymph drainage, massage therapy, compressive therapy or some patients require radiotherapy or chemotherapy or dexamethasone 16 mg daily for 1 week for acute lymphatic obstruction. pain - it is quite disappointing for the patient and should be treated as early as possible. find out the cause and prescription of appropriate analgesics [opoids or non - opoids ] and adjuvant drugs, with addition of drug to control the intolerant adverse effects of analgesic, is the mainstay of treatment. sometimes patient may respond with palliative chemotherapy, radiotherapy, or specific intervention [nerve block, neurolysis, trigger point injection etc. ]. excess oral secretion and salivary drooling - treat with pharmacologic inhibition [hyoscine hydrobromine transdermal patch or 150 300 g sl or glycopyrronium 200 400 g sc or 400 1200 g by continues sc infusion or hyoscine butyl bromide 20 mg orally or sc and 40 180 mg by csci ] or radiation, or surgery. this should be managed by explaining the cause and the treatment plan to patient with involvement of physiotherapist to teach breathing techniques and use of relaxation and cognitive behavioral therapy techniques. oxygen, heliox, inhaled furesemide, anti - depressant, facial cooling by fan, opoids for reduction of sensation of breathlessness and benzodiazepines for panic and anxiety attack and sometimes non - invasive ventilation can be used. dry cough if there is no underlying reversible cause, it can be suppressed by oral antitusive or use inhaled or nebulized steroids or inhaled cromolyn sodium or lidocaine, nebulized morphine, paroxetine, benzodiazepines, etc. fear and panic- occurs due to compressive symptoms and impending death, should find out the underlying cause and seek help with clinical psychologist for patients with complex problem or start benzodiazepine. identify and treat underlying cause, if appropriate consider hemostatic agents and dressings, anti - fibrinolytic agent, vit. k, vasopressin / desmopressin, octreotide / somatostatin, blood product transfusion, radiotherapy, endoscopic ligation and coagulation, and transcutaneous arterial embolization and for patient at risk of major bleed in the terminal phase, use of sedative medications like midazolam buccal /iv / im / sc or diazepam per rectum and green towels or surgical clothes to minimize the visual impact of blood loss. manage with good skin care, regular exercise of effected limb, manual lymph drainage, massage therapy, compressive therapy or some patients require radiotherapy or chemotherapy or dexamethasone 16 mg daily for 1 week for acute lymphatic obstruction. the majorities of thyroid cancers are slow growing and have an excellent prognosis after surgical and medical therapy, therefore, the early diagnosis and institution of treatment is necessary. the major challenges for early diagnosis and treatment are negligence or lack of knowledge[1619 ] - unawareness, lack of education, social and domestic responsibilities are the causes attributes delay from patient side.paucity of approach - lack of approach or accessibility to health care services causes delay.financial constraints in our country, one of the very important factors leading to delay in seeking medical advice.quacks and alternative treatment modalities an improper guidance may lead to aggravation of disease and delay in the diagnosis and hence for treatment.non-uniformity of medical advice due to unconsensus opinion regarding the treatment modalities, patient gets confused and leads to delay in seeking the proper treatment.fear of surgery many patients have various fears regarding surgery ; therefore, the proper counseling is necessary. negligence or lack of knowledge[1619 ] - unawareness, lack of education, social and domestic responsibilities are the causes attributes delay from patient side. paucity of approach - lack of approach or accessibility to health care services causes delay. financial constraints in our country, one of the very important factors leading to delay in seeking medical advice. quacks and alternative treatment modalities an improper guidance may lead to aggravation of disease and delay in the diagnosis and hence for treatment. due to unconsensus opinion regarding the treatment modalities, patient gets confused and leads to delay in seeking the proper treatment. fear of surgery many patients have various fears regarding surgery ; therefore, the proper counseling is necessary. palliative care should not only include physical symptoms management but also cover psychological, spiritual, and social aspect of care. integrated care pathway should be opted, especially for the patients who are at the last stage. a patient of advance thyroid malignancy should receive palliative support in the form of disease management, symptom control, and psychosocial care. in the above - discussed case, patient has reached a point of no return due to delayed diagnosis, therefore, for the prevention of such type of incidences in future, the government, health care professionals and ngo 's should work at the grass root level to develop health care awareness in uneducated, poor, rural - based peoples, and there should be an easy accessibility and proper guidance by primary health service centers. involvement of the local self governments [panchayat ] in the provision of care in the locality will be essential for ensuring sustainability of the projects at the primary health care system level. legislation introduced and funds allotted by the government are important for establishing a stable system that can achieve a meaningful coverage, should reach to all and provide continued care of patients discharged from referral or specialist centres. | malignancies of the thyroid gland has steadily increased over the last few decades, out of which mostly are differentiated carcinomas of the papillary or of follicular type, have a good prognosis and highest cure rate if treatment commences early. here, we report a case of an 18-years - old boy with a huge multinodular goiter, which compromised the airway and lung metastasis, presented at advance stage of disease in tertiary care center. factors prevent early diagnosis and treatment, distressing symptoms patient can develop, palliation of those symptoms, and effort to be made to prevent the delay are highlighted. |
in companion animals, the healing of large skin defects resulted from traumatic accidents can be challenging to treat since they need a complex management consisting of accurate debridement of damaged and necrotic tissues, local and/or systemic infection control, protection of the underlying tissues and induction of cutaneous tissue regeneration 1,2. to this aim, surgical tissue reconstruction (i.e., skin graft) and medical treatments are often associated to reach complete anatomical and functional recovery of the damaged area, reducing debilitating side effects, and pain. the present work describes a successful therapeutic approach based on the synergic application of platelet - rich plasma (prp) and autologous mesenchymal stem cells (mscs) in an adult labrador male dog. the patient was involved in a traumatic accident that caused a very large tissue defect (approximately 30 35 cm, width length) of the superior area of the left thigh, that could not be resolved by surgery. a 1-year -old labrador male dog, weight 33 kg, was referred about 812 h after being struck by a train. the dog was conscious, well oriented in space and cooperating, but presented an extensive loss of skin tissues of the superior area of the left thigh (approximately 30 35 cm, width length) (fig.1). the lesion was classified as a class 2 avulsion injury, 612 h old, with large loss of integumentary structures 1. furthermore, the dog presented fractures of the coccygeal vertebra with partial avulsion of the tail, bilateral lesions of the achilles tendons, a fracture of the left calcaneal bone, and several cutaneous wounds. the animal did not show neurological deficits, but exhibited orthopedic deficits associated to the bilateral tendon injuries. in particular, the first orthopedic evaluation showed the presence of lameness (grade 3) of the hind limbs. edema of both achilles tendons was present at the insertion to os calcaneus, where a 2 cm linear skin wound was present bilaterally. a faster tissue growth was observed where wound margins strongly adhered to the underlying tissue. at day 90 the first day a lavage of the joints with physiological saline was performed, the left calcaneal bone fragment was removed, and the skin wounds were closed. both lesions of the achilles tendons were 1 cm in length and 0.5 cm in depth, parallel to the tendon fibers. we decided not to close the tendon lesions, to avoid fibrotic scar formation, but instead to proceed with a regenerative therapy (see below). no bandage, casting or external fixation was performed. with regard to the main lesion of the left hind limb, after the evaluation of the elasticity of the safe surrounding skin, we decided to perform a two - step surgery. we first opted to close the wound with the surrounding skin, to reduce as much as possible the tissue exposition, thus creating a suitable environment for second intention healing of the residual exposed part of the wound. a second surgery to perform a rotational flap or, alternatively, a skin graft to completely close the wound was scheduled 2030 days later 3,4. moreover, it was decided to proceed with the amputation of the tail. the fifth day after surgery, diffused necrosis of the edge of the skin, and the presence of purulent material were observed, thus we decided to remove the necrotic and contaminated tissue. although the patient was a large size breed, he weighed only 33 kg and there was not enough skin available to perform a free skin graft. in particular, we opted for a biologic and cellular therapy, to promote second intention healing with open wound management, based on the application of platelet - rich plasma (prp) and adipose tissue - derived mesenchymal stem cell (mscs). we reasoned that the association between mscs and prp could provide an appropriate set of biological mechanisms to speed up tissue growth, improve the quality of tissue regeneration, and control infection. materials and methods used for the preparation of mscs and prp are described in appendix. prp was applied either by dripping or spraying over the wound surface (every 4872 h), as well as by injecting the platelet concentrate along the attached wound edge (every 46 days). mscs were applied by spraying the cells over the wound surface (five applications at day 11, 17, 23, 31, 41). for each cell application, an aliquot of the cells was sprayed on a culture dish and growth in dmem to confirm their vitality (fig.2). the lesions of the achilles tendons were treated by injecting under ultrasonographic guidance a single dose of 2 10 mscs resuspended in 1 ml of prp inside the lesions 5,6. since the cutaneous defect was extremely extended, a wound managing strategy and planning was decided based on the time system 7. the medication of the wound was performed daily, starting with the removal of old bandage, followed by the irrigation with lactated ringer s solution, debridement of the necrotic tissue, and application of prp and/or cell therapy. the hydration of the wound was ensured by means of connettivina (fidia farmaceutici, padova, italy) or hypermix bandage (ri.mos. when prp or cells were not employed, hypermix oil and hypermix dressing were applied, to protect the tissue. no antibiotic or disinfectant was applied locally. to prevent the movement of the bandage, a variation of tie - over dressing / bandage technique was applied 8. sprayed mscs culture. to assess mscs viability and replication after spraying, an aliquot of cells was cultured in dmem for 72 h. prp induced a partial gelation of the culture medium, therefore cells distributed and grew on different focal planes. systemic antibiotic therapy was administered as follow : cefazolin (cefazolina teva, milano, italy) 30 mg / kg intravenous every 8 h from day 1 to 15 ; cefadroxil monohydrate (cefa cure tabs, intervet italia, milano, italy) p / o 20 mg / kg from day 16 to 30 ; marbofloxacin (marbocyl vetoquinol, forl, italy) 2 mg / kg from day 31 to 60 and amoxycillin and clavulanic acid (synulox pfizer, roma, italy) p / o from day 61 to 80. the huge area of the wound and rare episodes of fever in the first weeks suggested the use of the antibiotic therapy. anyway, no signs of bacterial infection were observed after the onset of regenerative therapy. analgesic therapy was administered with tramadol (altadol formevet, milano, italy) 2 mg / kg, every 8 h for the first 15 days. anti - inflammatory therapy was given with carprofen (rimadyl pfizer, roma, italy) 2 mg / kg p / o, for 30 days, while gastric protection was provided with omeprazolum (omeprazolo laboratori alter, milano, italy) 10 mg p / o. before the daily care, for the first 20 days, the animal was sedated with butorphanol (butorphanol nargesic acme, reggio emila, italy) 0.2 mg / kg and dexmedetomidine (dexdomior orion pharma, milano, italy) 5 microgr / kg ; afterwards, since the dog did not exhibit pain sensitivity, the sedation was suspended. a granulation tissue was visible after 4 days following the first prp application. for a better perception of the speed of new tissue growth, as well as of the reduction in the exposed area, we measured every day the amplitude of the wound, in the same position. interestingly, the curve depicted in fig.3 fits a hyperbolic curve as described by cukjati. the ratio tissue growth / time reduced gradually during the period, with a fast growth during the first period (about 2.5 cm / day in the first month) and then a gradual fall during the remnant days. a complete closure of the wound occurred 3 months after the start of the regenerative therapy (fig.3). the wound never presented signs of infection or necrosis during and following the regenerative therapy. the lameness of the hind limbs and the edema of the achilles s tendon disappeared 20 days after intra - lesional application of mscs and prp. advancement of the wound margins, identified by the ls (lesion size) line, as a function of time. the graph fits with a hyperbolic curve with a faster healing rate during the first weeks. light blue rectangle indicates the duration of prp treatment ; red arrows indicate the msc treatments. in recent years, mscs and platelet - derived products have gained a strong attention in veterinary medicine since they are supposed to enhance tissue regeneration and wound healing 10. although a definitive knowledge about the molecular and cellular mechanisms through which prp and mcs exert their effects is still lacking, several clinical and experimental reports confirm their efficacy for the treatments of patients both in veterinary and human medicine 1114. recently, a positive effect of the application of mscs in healing of experimentally induced skin wounds has been reported in the dog 15. mscs respond to wound healing cytokines and migrate to region of inflammation creating a favorable immune environment 16. mscs secrete a plethora of effector molecules and produce microvesicles containing signaling proteins, mrnas, mirnas 17,18. by means of these mechanisms, they reprogram resident immune cells, control inflammation, activate tissue progenitors cells, promote angiogenesis. mscs also regulate leukocytes (t and b cells, natural killer cells) function and activate resident macrophages to produce anti - inflammatory cytokines.. in particular, cox2 and pge2 upregulation are probably key elements of immunomodulatory mechanisms of the mscs as well as of their antiscarring effects 16. large cutaneous lesions, where poor blood supply, tissue necrosis, excessive scarring, inflammation, and bacterial contamination are possible complications, would take significant advantages from the application of regenerative therapies based on the synergic action of prp and mcs 16,1922. here, we report the case of a particularly large cutaneous lesion in a dog hit by a train. the area involved in the lesion after the failure of the first surgery aimed to close the wound with the surrounding skin, the physical conditions of the patient were serious, although not critical. furthermore, although the patient was a labrador, he weighed only 33 kg and there was not enough skin to perform a free skin graft. since the main lesion was particularly extended to reach a homogeneous distribution of the therapeutics, we sprayed the whole injured area with both prp and mcs. parallel in vitro cell cultures showed that sprayed mscs could survive and growth inside a prp - derived gel (fig.2), thus supporting this route of therapy administration. connettivina and hypermix dressing were used to improve tissue hydration when prp and mscs were not applied. the application of prp and autologous adipose tissue - derived mscs probably contributed to the positive outcome, inducing a prompt formation of granulation tissue, a strong adhesion of the wound edges to the underlying tissue and a rapid tissue growth, starting from wound margin. furthermore, no sign of excessive scarring, tissue contraction, and fragile re - epithelialization, sometimes associated to second intention healing, was observed. in addition to the amelioration of the tissue growth, prp and mscs probably contributed to a faster wound healing providing an antibacterial and anti - inflammatory environment 23,24. antimicrobial properties are probably do to their capacity to reduce inflammatory response and to increase macrophages and monocytes phagocytosis 27,28. furthermore, mscs secrete gm - csf, a cytokine that exert significant antimicrobial activity 27. as a matter of fact, following the regenerative therapy, no sign of bacterial contamination was evidenced, even though the exposed area was vast and extended to the perianal region (fig.1). these results suggest that mscs and prp are indeed an effective therapeutic option to manage soft tissue wounds where a large amount of tissue is destroyed, especially when surgery alone can not guarantee satisfactory results. regenerative therapy can be considered by surgeon both to improve the quality of tissue regeneration and to speed up the wound healing process. finally, this report outlines that in clinical veterinary medicine, effective collaboration of the owner, and a highly collaborative approach between clinical and biomedical staffs, are essential to lead to a successful healing of complicated wounds and ensure the return of the patients to an excellent quality of life. mesenchymal stem cells preparation : for the preparation of mscs, three grams of healthy subcutaneous adipose tissue were collected along the edge of the wound, minced into small pieces under sterile conditions, and washed several times with phosphate buffer saline solution (pbs) containing penicillin (1000 iu / ml) and streptomycin (100 mg / ml) (sigma - aldrich corp., st. the sample was then digested in 15 ml of a 0.75 mg / ml solution of type i collagenase (sigma - aldrich corp.) dissolved in dulbecco s modified eagle s low glucose medium (dmem) (lonza, inc. after digestion, the remaining tissue fragments were removed, while the cell suspension was filtered through a 50 m nylon mesh and then centrifuged at 250 g for 10 min. the supernatant was removed and the cell pellet resuspended in dmem containing 10% v / v fetal bovine serum (fbs) (lonza, inc.), 1000 iu / ml penicillin and 100 mg / ml streptomycin. finally, the cells were seeded in 25 cm tissue culture flasks at the concentration of 5.0 10 cells / cm, and incubated at 37c in 5% co2. cell viability was always > 90%. to assess mscs viability and replication after spraying, an aliquot of the cells used for the therapy was sprayed on a cell culture dish and was cultured in dmem containing 10% v / v fetal bovine serum (fbs) and antibiotics for 72 h. the expression of cell surface markers cd13, cd34, cd44, cd45, cd90, cd105 has been assessed by rt - pcr (data not shown). cell cultures were positive to cd44, cd90, and cd105, and negative to cd45 and cd13 expression. cells were also positive to cd34 expression, as often reported for adipose tissue - derived mscs 29. furthermore, cells were positive to adipogenic, osteogenic, and chondrogenic differentiation (appendix fig.1). platelet - rich plasma preparation : platelet - rich plasma (prp) was obtained from autologous venous blood collected with citrate - phosphate - dextrose. fresh blood samples (about 2530 ml) were centrifuged at 150 g for 30 min at 4c in a 50 ml tube. the erythrocyte fraction was discarded, while the plasma, enriched with platelets, was further centrifuged at 800 g for 15 min. the platelet pellet was collected and the platelets were counted (cell - dyn 3500r haematology analyser, abbott, roma, italy) and diluted at a final concentration of 1.0 10 cell / ml. platelet - rich plasma was applied soon after preparation (prp), or as platelet - rich plasma lysate (prplys). in this case | key clinical messageextensive full - thickness skin wounds are quite common in domestic animals. in these report, following the failure of reconstructive surgery, adipose tissue - derived mesenchymal stem cells, and platelet - rich plasma were successfully used in a dog to improve speed and quality of skin tissue healing, avoiding suffering, and debilitating effects. |
the papillomaviruses (pvs) are viruses that require the environment of a differentiating epithelium for their replication cycle. pvs infect mammals, including man, and are related to development of benign lesions that can progress to cancer. uterine cervical cancer, the second most frequently occurring cancer in women worldwide, is causal related to human papillomavirus infection (hpv) [3, 4 ]. responsible for genome transcription control, l region, encoding the capsid major and minor proteins (l1 and l2, resp.), presenting late transcription in virus replication cycle, and e region, with early transcription in virus cycle, which codifies the proteins related to carcinogenic action [5, 6 ]. the virus transmission is recognized as occurring through direct contact : the abrasion of the skin or sexual intercourse leads to pv infection. pv oncoproteins are the source for the alterations related to carcinogenesis : they interfere with the host cell cycle control, through interactions with specific proteins, as p53, p rb, p21, and p27. as examples of viral oncoprotein actions, e6 induces accelerated degradation of p53. papillomaviruses maintain their genomes in episomal condition, linked to host cell chromosomes during cell division and being distributed in dividing cells. the papillomavirus e2 protein simultaneously associates the host chromatin and the viral genome during mitosis. the virus in its episomal form is found in benign lesions and e2 also acts in the integration of virus sequences in host chromatin of neoplasic cells. these cells are tightly associated with the expression of high - risk human papillomavirus (hpv) oncogenes e6 and e7 and exhibit chromosomal instability. the virus is specific to epithelium, but, recently, many reports have described virus dna sequences in blood stream [1421 ]. the exact source of these sequences is not clear : circulating virus dna has been discussed as product of lyses of circulating cancer cells or micrometastasis from the tumor. bovine papillomavirus (bpv) dna was simultaneously detected in different tissues of the same animals, including blood, thus suggesting a blood stream virus spread [17, 2224 ]. it has been speculated that blood mononuclear cells, that migrate to sites of tissue inflammation could act as a source of virus (bpv, e.g.,) in the infection of epithelial cells and could become involved in tumor development independently or jointly with several biological and/or chemical cofactors [14, 20 ]. the seminar questions are as follows : could these sequences represent virus replicate status in the bloodstream, in particular in the lymphocytes, acting as a reservoir of viral infection ? can the viruses present oncogene expression in other tissues ? papillomavirus dna sequences have been identified in blood stream of specifically bovines in recent reports [1619, 25, 26 ]. the studies analyzed whole blood, plasma, isolated lymphocytes, and short - term peripheral lymphocyte cultures : the bpv dna was detected in all systems [15, 17, 18, 22, 23 ]. besides, bpv dna was detected also in semen, uterus, urine, milk, and seminal fluid. furthermore, the cytogenetic analysis performed in short - term peripheral lymphocyte cultures revealed significant increase of chromosome aberrations in samples from infected animals [1518 ]. the mechanisms of virus action on host chromatin became important issue of study. in this study, we analyzed the levels and the types of chromosome aberrations verified in cultured cells obtained in samples collected from peripheral blood, cutaneous papilloma, esophagus papilloma, and urinary bladder cells of animal presenting enzootic hematuria. short - term lymphocyte cultures were performed with the blood samples and the lesion fragments were used to obtain primary cell cultures. the protocols used in this study were approved by the ethical committee in research of the universidade federal de so paulo (number 0835.07) assigned by the president of this committee. nine animals (bos taurus) were selected for this study : 2 males and 7 females, comparable age. the animal group included 2 animals clinically normal, 3 presented severe cutaneous papillomatosis, 2 had esophagus papillomas, and 2 were affected by enzootic hematuria, presenting papilloma like lesion in the bladder. blood samples were collected in two sterile syringes with heparin or edta, respectively, for cultures and dna extraction. tissue fragments were obtained by surgical procedures performed by a veterinary with local anesthesia. for histological analysis, fragments of the samples obtained from the solid lesions were fixed in 10% neutral buffered formalin and embedded in paraffin wax : 5 m ticked sections were stained with hematoxylin / eosin. eighteen drops of blood were incubated in rpmi medium supplied with 10% fetal serum and 2% phytohemagglutinin during 72 hours at 37c. the tissue fragments were washed in pbs, submitted to collagenase 0.01%, 30 minutes, 37c, and incubated in dulbecco mem supplied with 10% fetal serum in co2 atmosphere at 37c. colchicine 16 g / ml, 0.1 ml was added to culture cells for 1 hour at 37c. the cells were submitted to hypotonic solution, kcl 0.075 m, at 37c, 10 minutes. after that, the cells were fixed in three baths with 3 : 1, methanol : acetic acid. the slides were stained in giemsa 3%, 5 minutes. each type of chromosome aberration was recorded, according to melo.. the dna extraction was performed using the cell & tissue kit illustra genomicprep mini spin (ge healthcare, buckinghamshire, uk), and the extracted dna was kept at 20c. the quality of obtained dna samples was verified using the polymerase chain reaction (pcr) technique, by means of the amplification of a bovine -globin gene fragment, (450 bp), with specific primers (f : 5-aacctctttgttcacaac cag-3 and r : 5-cag atgcttaacccactgagc-3), according to yaguiu.. viral molecular identification was performed using the degenerate primers fap59 (forward, 5-taacwgtiggicayccwtatt-3) and fap64 (reverse, 5-ccwatatcwvhcatitciccatc-3), which promote l1 gene amplification, resulting in a fragment of 478 bp, ogawa., 2004. in detail, the amplification reactions were performed in a ptc-100tm (mj research, inc.) thermo cycler, with pcr master mix (promega, madison, usa), under the following conditions : 10 min at 94c, followed by 45 cycles of 1 min and 30 s at 94c, 2 min at 52c and 1 min and 30 s at 72c, and a final extension step of 5 min at 72c, for primer fap59/fap64. for specific bpv1, 2, and 4 : bpv-1 (5-ggagcgcctgctaac tat agg a-3/5-atctgttgtttgggtggtgac-3), bpv-2 (5-gttatacca ccc aaagaagaccct-3/5-ctggttgcaacagctctctttctc-3), and bpv-4 (5-gctgaccttccagtctta at3/5-cag tttcaatctcctcttca-3), in detail, thermo cycler, with pcr master mix (promega, madison, usa), under the following conditions : 3 min at 94c, followed by 35 cycles of 50 s at 94c, 1 min at 60c and 1 min at 72c, and a final extension step of 5 min at 72c. the pcr products were analyzed in 2% agarose gel electrophoresis stained with gelred in tae buffer, visualized under uv light. the histological analysis confirmed the identification of the fragments collected for the studies (figure 1). specifically, a segment of a normal skin obtained by surgical procedure from a normal bovine was selected as control. by similar procedures, biopsies were obtained from cutaneous papilloma, esophagus papilloma, and papilloma from urinary bladder of an animal affected with enzootic hematuria. the pcr technique using primers fap 59/64 amplified a dna fragment 474 bp long indicating virus sequence presence in the biopsies collected from papilloma lesions. the specific primers allowed the identification of bpv1 (301 bp) and bpv2 (164 bp) (figure 2). also, the same virus sequences were detected in the obtained primary cell cultures and in their first five passages (figures 2 and 3). the same pcr procedures with the same primers were used to investigate the presence of virus sequences in blood samples, but it was not possible to detect any virus sequence in any of the blood samples, normal or affected animals., four groups of animals were fixed according to the clinical features : c : control (not affected and without detection of virus dna in culture cells), group 1 : cutaneous papilloma ; group 2 : esophagus papilloma ; group 3 : enzootic hematuria. a total of 1068 cells were evaluated : 501 derived from short - term lymphocyte cultures and 567 obtained from biopsy primary cell cultures (tables 1 and 2). the results observed in culture blood cells make it possible to verify that the affected animals showed higher levels of chromosome aberrations compared to not affected animals. as the pcr procedures were unable to detect bpv sequences in blood cells, the data were analyzed as not affected animals compared to affected bovines. however, the pcr technique showed bpv dna sequences in the biopsies collected from the affected animals such as the fragments from not affected animals that were negative for bpv in pcr procedures. so, the data were analyzed comparing bpv positive and bpv negative biopsies and respective primary culture cells. it is important to emphasize that the bpv negative biopsies were obtained from the not affected animals and so these animals were our controls. a specific analysis was performed considering the different chromosome aberration types comparing the previous groups (c, 1, 2, and 3). in blood cells, comparing to control, the aberration types presenting significant higher levels in cells from affected animals were addition / deletion, chromatid breaks, acentric fragments, and centromere associations (table 2). considering the primary culture cells, the more frequent chromosome aberrations were addition / deletion, chromatid break, chromosome breaks, acentric fragments, centromere association, and association of telomeres (table 2 and figure 4). it was possible to verify that the cells obtained from the bpv infected animals presented significant higher levels of chromosome aberrations. as far it was possible to verify, this is the first report describing chromosome aberrations in cells derived from bovine papillomavirus lesions. as we have previously described in peripheral lymphocytes, the chromosome aberrations occur in significant increased levels in short - term lymphocyte cultures and in primary cell cultures, established from samples obtained from bpv affected animals. a very important point has to be discussed : the fact that it was not possible to detect virus dna sequences in peripheral blood of affected or not affected animals. despite this fact, the level of chromosome aberrations was verified higher in the affected animal samples. as it was not possible to identify virus dna in blood either in control or affected animals, it could be discussed that the chromosome aberrations were not caused by virus action. however, the same types of aberrations were detected in cells derived from lesions, positive for virus presence. furthermore, there was a significant difference between the chromosome aberration levels, comparing affected and not affected animals. in matter of fact, considering the similarity of the detected chromosome aberrations, the virus action on host chromatin was verified as effective either in blood cells or in cells derived from lesions. we could argue that the virus load in the peripheral blood of the affected animals was too low to be detected in conventional pcr. the same argument could be used for the not affected animals, leading to the need to compare affected to nonaffected animals and emphasizing the differences observed in the levels of chromosomal aberrations. this fact indicates that the virus acts in different ways in its interaction with host chromatin. besides, the virus acts on mitotic spindle, changing the chromosome set and rising aneuploidy. although bpv is described as nonintegrated in host cell, its action produces different types of chromosome alterations suggesting a large interaction with the chromatin and also with dna repair mechanisms. we have already described the presence of virus sequences in primary culture cells, in different passages, but now we demonstrate that these sequences are active leading to chromosome alterations. we compare for the first time the action of bovine papillomavirus on host cell chromatin in cultured lymphocytes and primary culture cells, describing the increase of chromosomal aberrations in both cell types. the primary cells cultures not only presented bpv dna sequences but also keep these sequences throughout different passages. these data plus recent reports emphasize possible active bpv infection in blood as well as in in vitro cultured cells. | the majority of malignant cells present genetic instability with chromosome number changes plus segmental defects : these changes involve intact chromosomes and breakage - induced alterations. some pathways of chromosomal instability have been proposed as random breakage, telomere fusion, and centromere fission. chromosome alterations in tumor cells have been described in animal models and in vitro experiments. one important question is about possible discrepancies between animal models, in vitro studies, and the real events in cancer cells in vivo. papillomaviruses are relevant agents in oncogenic processes related to action on host genome. recently, many reports have discussed the presence of virus dna in peripheral blood, in humans and in animals infected by papillomaviruses. the meaning of this event is of controversy : possible product of apoptosis occurring in cancer cells, metastasized cancer cells, or active dna sequences circulating in bloodstream. this study compares chromosome aberrations detected in bovine cells, in peripheral blood cells, and in bpv lesion cells : the literature is poor in this type of study. comparing chromosome aberrations described in the different cells, a common mechanism in their origin, can be suggested. furthermore blood cells can be evaluated as an effective way of virus transmission. |
the complications related to drug abuse such as myocardial insufficiency, myocardial infarction, endocarditis, myocarditis, aortic dissection, neurologic damage, ischemic colitis and renal failure are known, but have been reported very rarely. amongst the illicit drugs, cocaine, amphetamines and cannabis have been studied and documented well to cause myocardial infarction by different mechanisms. there is very sparse data available on myocardial involvement after heroin abuse.[13 ] here, we report a young male who suffered from acute myocardial injury after heroin inhalation. a 28-year - old young male shopkeeper was brought to the emergency with complaints of chest discomfort, cold sweating and severe generalized weakness. there was no history of fever, headache, any flu - like symptoms, systemic illness or drug allergy. his parents were alive and there was no history of diabetes mellitus, coronary artery disease, hypertension or cerebrovascular disease in first degree relatives. he was not a cigarette smoker but his parents and patient himself gave history of heroin inhalation (smack) for last five years. as per history last heroin inhalation was done approximately 12 h before admission along with alcohol binge drinking. on general physical examination he was thin built, looked drowsy but arousable. his vital signs were pulse 64/min, blood pressure 70/50 mmhg, respiratory rate 24/min and temperature was 98.6f along with cold extremities. laboratory data showed mild leukocytosis with total leukocyte count of 14,200/ cmm, hemoglobin 14.6 gm%, platelet count 2.6 lacs / cmm. biochemical investigations including urea, creatinine, total protein, albumin, liver transaminases, glucose and fasting lipid profile were within normal limits. value<20u / l) total cpk was 456 u / l(normal being < 200) and toponin - i was 3.02 ng / ml (normal value < 0.01 ng / ml). in 2-d echocardiography hypo kinesis of left ventricular anterior wall was noticed while left ventricular systolic function and ejection fraction was within normal limits (64%).on the basis of history, clinical examination and investigations, diagnosis of acute coronary ischemic event involving left ventricular wall was made. since the patient had hypotension at presentation, he was treated with aspirin 325 mg and clopidogrel 300 mg and vasopressors, but nitroglycerine could not be given to him. the patient did not receive thrombolytic therapy, because of the pattern of electrocardiographic changes and time interval between the onset of chest tightness and hospitalization was more than 12 h. therefore, he was administered only subcutaneous low molecular weight heparin enoxaparin. he responded to treatment, got relief in the chest discomfort and was discharged after seven days. at the time of discharge, minimal st elevation persisted in electrocardiogram which became normal after a week during follow up along with the echocardiography. coronary angiography which was done one month later did not reveal any significant luminal stenosis. the patient was diagnosed to have acute myocardial involvement on the basis of symptoms of chest tightness, cold sweating and hypotension. his investigations that included electrocardiogram, echocardiography, cpk - mb and troponin - i and also favored the diagnosis of acute myocardial injury. he had bilateral constricted pupils with excessive salivation, basal crepitations in the chest and relative bradycardia despite hypotension. there was a definite history of heroin inhalation and binge drinking in the night prior to admission. no family history of premature heart disease or any conventional risk factors of cardiovascular disease were present in the patient. our patient presented with symptom of chest tightness, which was not localized, had no postural variation or relation with respiration. he possibly had acute myocardial ischemia which is being supported by elevated cardiac biomarkers, electrocardiographic changes and echocardiography. myocarditis can also masquerade as myocardial ischemia sometimes because of st - t changes, cardiac enzyme elevation and wall motion abnormalities which can be observed with myocarditis. myocarditis was a possibility in our patient that could not be excluded. during the hospitalization we could not subject the patient for either coronary angiography or myocardial scintigraphy to confirm the infarct or any occlusive lesion in the coronaries. heroin (diacetylmorphine) is rapidly hydrolyzed to 6-monoacetylmorphine which in turn is hydrolyzed to morphine. though heroin - induced myocardial infarction has been seldom reported, the underlying mechanisms have been still unclear. reported a case of heroin intoxication followed by rhabdomyolysis associated with myocardial injury, with symptoms, laboratory findings, ecg and echocardiography features of non - q wave infarction. however, a 201 thalium myocardial scintigraphy, performed after patient was discharged, did not show any abnormality. this shows that heroin probably has a direct myotoxic effect on both myocardium and skeletal muscle. there is a possibility that hypoxia, acidosis, vasoconstrictive substances released by muscle necrosis, or hypersensitivity reactions associated with heroin or some of its adulterants are involved in myocardial injury. reported a young woman with acute myocardial infarction after heroin abuse ; they had claimed that heroin might have a direct toxic effect on the coronary arteries and can cause coronary occlusion by provoking vasospasm or inflammation. there has been suggestion that heroin acts directly on vasomotor centre to increase parasympathetic activity and reduces sympathetic tone, which leads to vasodilatation and stimulates histamine release from mast cells.. there was history of binge drinking present in our patient which has been associated with development of acute myocardial infarction. men who consume five drinks (50 g) or more and women who consume four drinks (40 g) or more in single sitting are known as binge drinkers. it is well known that ethanol induces concentration dependent vasospasm in coronary arteries and coronary vasoconstriction may itself damage the endothelium thereby increasing the likelihood of platelet adhesion and thrombus formation. in conclusion, a 28-year - old young male developed acute myocardial injury after heroin inhalation and binge drinking while he had no other conventional cardiovascular risk factors. the cause might be heroin - induced cardio toxic effect or vasospasm compounded by the presence of binge drinking. | amongst the illicit drugs cocaine, amphetamines and cannabis have been studied and documented well to cause myocardial infarction by different mechanisms but there is very sparse data available on myocardial involvement after heroin abuse. we report a young man who developed acute myocardial injury after heroin inhalation and alcohol binge drinking. heroin induced cardio toxic effect and vasospasm compounded by alcohol were suspected to be the cause of this. |
hypothyroidism is a complex disorder characterized by an increase in body weight. about 1530% of hypothyroid patients are reported to be overweight and sufficient replacement therapy generally induces significant weight loss. however, 7% of the patients were observed to preserve their original weight in spite of the successful treatment. in hypothyroid patients, body fat content this effect is attributed to the reduction of lipid metabolism in hypothyroidism [3, 4 ]. nevertheless, the expected decrease in body fat content is not observed with replacement therapy in a few studies [5, 6 ]. in a recent study, it was reported that l - thyroxine therapy resulted in an increase in body mass index (bmi) independently from thyroid - stimulating hormone (tsh) levels. in another study, the decrease in body weight of hypothyroid patients treated with l - thyroxine was found to be related with the excretion of excess body water associated with the improvement of myxedema state instead of the change in body adiposity. all these data caused requery of the effects of l - thyroxine replacement therapy on body adiposity in hypothyroid patients. although there are many methods to determine body fat content, bmi and waist circumference are widely used due to their easiness and low cost [1012 ]. measurement of skin fold thickness (sft) is another simple method used for this purpose [13, 14 ]. bioelectrical impedance analysis system (bia) is an easy and a cheap method which helps to identify different body compartments : body lipid percentage, fat - free body mass, and total body fluid. in this study, we aimed to observe the effects of midterm thyroid replacement therapy on body fat content determined with various anthropometric methods and a bioelectrical impedance method. this study was performed in a university hospital 's endocrinology and metabolism diseases outpatient clinic and it was designed as a prospective and controlled study. as body fat content is known to be different within the two genders, only females were asked to participate. subjects with hypothyroidism due to autoimmune thyroiditis who did not administer l - thyroxine replacement therapy before, with tsh levels greater than 10 miu / l and aged between 18 and 50 years, were enrolled to the study. for the chronic autoimmune thyroiditis diagnosis, the criteria used were elevation of at least one of the antithyroglobulin or antithyroid peroxidase autoantibodies and/or shown ultrasonographic changes due to thyroiditis. exclusion criteria for the study were (1) postmenopausal women, (2) smoking, (3) patients using drugs which may affect thyroid functions like lithium, amiodarone, steroids, beta blockers, or interferon, (4) patients using drugs which may affect body water - lipid homeostasis like diuretics or oral contraceptives, (5) patients with chronic renal failure, hepatic failure, congestive heart diseases, malnutrition, or malignant diseases, (6) pregnant women, and (7) patients with other known endocrine disorders. a control group with similarly aged healthy women volunteers this study was approved by bakent university institutional review board and ethics committee (project no. patients who did not come to control visits, did not reach target tsh levels (0.454.12 miu / l), became pregnant, or used drugs which might affect the results during follow - ups were excluded from the study. after 12 hours of fasting, weight and height of the patients and controls were measured with a standard steelyard at the first visit. waist circumference was measured at the midpoint between the iliac crest and lower rib margin. subscapular, suprailiac, femur, biceps, and triceps skin fold thicknesses (sft) were measured by a caliper. body fat percentage (bfp) was calculated with the data obtained via using the methods suggested by deurenberg, lean, and durnins for female gender [1719 ] : bfp : 1.2 bmi + 0.23 age (year) 5.4 (by deurenberg for bmi), bfp : 0.439 waist circumference (cm) + 0.221 age (year) 9.4 (by lean for waist circumference), bfp : 1.33 (triceps sft + subrascapular sft) 0.013 (triceps sft + subscapular sft) 2.5 (by deurenberg for bmi), bfp : 0.439 waist circumference (cm) + 0.221 age (year) 9.4 (by lean for waist circumference), bfp : 1.33 (triceps sft + subrascapular sft) 0.013 (triceps sft + subscapular sft) 2.5 body fat measurements were performed by using a foot - to - foot pressure electrode bioelectrical impedance analysis contact system (bia) (tanita tbf-105, tanita corp., tokyo, japan). before testing, subjects were required to adhere to the bia testing guidelines : (1) not to eat or drink (especially caffeinated products) within 4 hours of the test, (2) not to consume alcohol within 48 h of the test, (3) to avoid intense exercise within 12 hours of the test, (4) not to take diuretics within 7 days of the test, and (5) to empty bladder within 30 minutes of the test. the procedure was performed while the subject was standing erect barefoot on the device 's footpads and wearing light clothes. thyroid - stimulating hormone and free thyroxine (ft4) levels were obtained from the venous blood sample of the forearm brachial veins and were studied with electrochemiluminescence immunoassay by using abbott - artitect analyzer (chicago, il, usa). anti - thyroid peroxidase levels were studied with electrochemiluminesans immunoassay by using modular e170 analyzer (roche diagnostic, mannheim, germany). then, each patient was given 1.6 mcg / kg / day l - thyroxine in order to reach the target tsh level ; the dosage was increased when indicated. the subjects were advised not to change their dietary and exercise habits and all were called for regular control every six weeks. at the 6th and 18th months of follow - up, body fat percentages were recalculated and tsh measurements were reperformed by the same researcher using the methods mentioned above. body fat percentages of the patients and the control group calculated by the mentioned formulas and bia during the initial 6- and 18- month visits were compared. comparisons between continuous variables were applied with student 's t - test or one - way anova for normally distributed data and mann - whitney u test or kruscal wallis test for the data not - normally distributed. prepost measures data were analyzed by paired t - test, wilcoxon tests or repeated measure analyses. correlation coefficients were interpreted as either excellent relationship r 0.91 ; good 0.90 r 0.71 ; fair 0.70 r 0.51 ; weak 0.50 r 0.31 ; little or none r 0.3 (ref). forty - two patients as study group and 40 subjects as a control group were enrolled to the study. thirty - one patients as a study group and 34 subjects as control group completed the study because of the exclusion criteria mentioned in section 2. the characteristics of the patients and control subjects at inclusion, at the 6th month, and at the 18th month of the study are shown in tables 1 and 2. mean tsh level at inclusion was 57.49 36.46 miu / l (minimum : 10.12, maximum : 100), at the 6th month 1.26 1.35 miu / l, and at the 18th month, 1.38 1.09 final mean l - thyroxine dose was 1.54 0.76 cg / kg / day there was no significant difference between the patient group and the control group when mean ages were compared (p = 0.63). mean tsh level at inclusion was 1.94 1,12 miu / l (minimum : 0.52 and maximum : 4.1), at the 6th month 1.76 1.01 miu / l, and at the 18th month 1.49 0.8 miu / l. there was evident difference between initial mean tsh levels of the study group and control group (p = 0.001), while there was no statistically significant difference at the 6th and the 18th months (p = 0.28 and 0.31, resp.). the comparisons of hypothyroid- and control - group characteristics during follow - up were given in table 3. the female gender is classified into the following groups regarding body fat measurements performed with tanita : the ones with bfp(%) below 15 are regarded as thin, those between 15 and 22 as normal, those between 23 and 26 as overweight, those between 27 and 32 as obese, and the ones over 32 as morbid obese. considering this information, our hypothyroid - cases are grouped as obese throughout the follow - up, with bfp values 32.09 2.81 at initiation, 31.11 2.56 at the 6th month, and 31.02 2.77 at the 18th month. in hypothyroid group, the mean body weight showed a slight decrease which did not exhibit statistical significance (p = 0.36 at the 6th month and p = 0.34 at the 18th month). using the above - mentioned four methods, the bfp of each case at inclusion was compared with the value at the 6th and the 18th months. in the hypothyroid group, a slight decrease was observed but it was not significant (table 1). during follow - up, sft measured from all sites were observed to decline but only those obtained from femur and biceps showed a statistically significant decrease (p = 0.03 and p = 0.01, resp.) the decrease in thermogenesis and fat tissue metabolism and fluid retention are considered to be responsible for this situation. in this study, in spite of the fact that the participants achieved euthyroidism with adequate l - thyroxine replacement, we did not observe a significant decrease in body weight and body fat percentages. our findings are compatible with the animal studies and human studies reporting statistically insignificant change in bfp following the treatment of hypothyroidism [2022 ]. the expected decrease in weight and body fat percentage was not observed in our study. this issue may resulted from a few reasons ; one of them may be the increase in orexigenic response which can be triggered by increased thermogenesis. the persistence of hypothyroid milieu in the tissues in spite of normalized tsh levels may well be another explanation. although there was no difference by means of body weight, waist circumference, and bfp, there was a significant decrease in sft measured with a caliper. this finding might be attributed to the decrease in subcutaneous mucopolysaccharides accumulation resulting from hypothyroidism. this study has a few limitations. our inability to determine the fat percentages with the gold standard methods, computerized tomography or magnetic resonance imaging, was one of them. but every patient being the control of his own and that all measurements being performed by the same researcher, we hope it may be appreciated. however, our study results support current medical literature, and bigger studies with larger study groups are required to clarify these findings. due to the classification regarding body fat measurements performed with tanita, our subjects are grouped as obese, although they are considered to be overweight for bmi. this finding may be attributed to the increase in body fat resulting from hypothyroidism. in conclusion, in spite of the correction of hypothyroidism, at the 6th and 18th months of follow - up, our cases did not exhibit significant changes in terms of body weight, waist circumference, and bfp determined via the methods mentioned above. this condition might be explained by the reduction of subcutaneous mucopolysaccharides which were deposited during the hypothyroid state. | aim. we aimed to observe the effects of l - thyroxine replacement therapy on body fat content determined with various anthropometric methods and a bioelectrical impedance analysis method in patients with hypothyroidism. methods. forty - two women with naive autoimmune hypothyroidism were included. also, 40 healthy participants were enrolled as a control group. weight, body mass index, waist circumference, and subscapulary, suprailiac, femur, biceps, and triceps skin fold thicknesses were measured. body fat percentages were calculated and body fat measurements were performed. euthyroidism was maintained with l - thyroxine. at the 6th and 18th month, of therapy, measurements were reperformed. results. mean tsh levels were 57.49 36.46 miu / l in hypothyroid group and 1.94 1.12 miu / l in control subjects at admission. in hypothyroid patients, calculated body fat percentages were greater than those of the control subjects during follow - up. body fat percentage of each hypothyroid case decreased at 6- and 18-month controls, but the decrements were statistically insignificant. although skin fold thicknesses measured from all sites were observed to decline, only those obtained from femur and biceps showed a significant decrease (p = 0.03 and p = 0.01, resp.). discussion. correction of hypothyroidism did not cause any improvement in body weight and body fat percentage. the decrease in skin fold thicknesses might probably result from the reduction in subcutaneous mucopolysaccharide deposits. |
diabetes especially diabetes mellitus (dm) has become a disease of concern for both developed and developing countries [1, 2 ]. in adults, the prevalence of dm worldwide was estimated to be 8.3% in 2011 and is expected to rise to 9.9% by the year 2030 largely due to the global obesity epidemic and other factors. a dm prevalence of 8% has been reported in europe and the us [5, 6 ]. in sub - saharan africa reported prevalence varies widely (benin 3% ; mauritania 6% ; cameroon 6.1% ; congo 7.1% ; zimbabwe 10.2% ; democratic republic of congo 14.5%). type 2 diabetes mellitus (type 2 dm) has been shown to be the most common form of diabetes in sub - saharan africa [9, 10 ] constituting 9095%. type 2 dm has been shown to be associated with obesity. abdominal obesity / central obesity measured by either waist circumference (wc) or waist - to - hip ratio (whr) has been shown to be strongly associated with diabetes and other chronic diseases than general obesity measured by bmi [1315 ]. it is established that abdominal obesity is associated with decreased glucose tolerance, alterations in glucose insulin homeostasis, reduced metabolic clearance of insulin, and decreased insulin - stimulated glucose disposal. some 31% of adults in tamale, ghana, are centrally obese and this has been related to advanced age, low physical activity, female gender, urban environment, high income, distorted perception of weight status, and tertiary education [12, 1621 ]. with contrasting prevalence, severe complications, and public health significance, a study on the prevalence of abdominal obesity and its predictors in type 2 dm patients are remarkably scarce. understanding the burden of abdominal obesity and its associated factors is pertinent in guiding diagnosis, management, and prevention of dm in sub - saharan africa. the objective of this study was to determine the prevalence of abdominal obesity (measured by wc) in a sample of type 2 dm patients. furthermore, we examined the demographic, clinical, and anthropometric determinants of increasing waist circumference in this same sample. three hundred (300) previously diagnosed diabetes patients attending the diabetes clinic of the tamale teaching hospital in tamale, ghana, were recruited for this cross - sectional study in 2013. as described elsewhere, all previously diagnosed diabetes patients that sought for care from the hospital 's diabetes clinic, during the study period, were eligible to participate in the study. three hundred and twenty - one participants were approached ; 300 of them consented to the study, yielding a response rate of 93.5%. the study was approved by the ethics committee of the university for development studies, school of medicine and health sciences, ghana. participants aged 30 years, who have clinical determined type 2 dm based on the who criteria, and who have duration of diabetes of at least 1 year were qualified to participate in the study. participants aged 102 cm in men and > 88 cm in women according to the world health organization cut - off points and risk of metabolic complications for waist circumference. clinical variables such as systolic blood pressure (sbp) and diastolic blood pressure (dbp) and fasting plasma glucose (fpg) values were taken from the personal health record files of the diabetic patients. elevated blood pressure denoted a mean bp 140/90 mmhg and/or documented antihypertensive treatment. impaired fasting glycaemia (ifg) was defined as fpg 6.1 mmol l. sociodemographic data such as gender, age, and duration of diabetes were also obtained from the patients. all data were entered into microsoft excel 2007 and analysed using graphpad prism version 5 (graphpad software, san diego, california, usa, http://www.graphpad.com) and the pasw statistics 18 for windows. continuous data were analyzed using student 's t - test whilst categorical variables were analyzed using fisher 's exact test using graphpad prism version 5. a forward : lr method of multiple linear regression models was used to determine the predictors of wc. all correlation and multiple linear regression analyses were done using pasw statistics 18 for windows. in all statistical tests, mean waist circumference was found to be 95.99 cm and significantly higher in women than in men. the prevalence of abdominal obesity was found to be 77.0% and significantly higher in women than in men (p < 0.001). average systolic blood pressure (sbp) and diastolic blood pressure (dbp) of the participants were 122.8 16.16 mmhg and 84.5 13.83 mmhg. men had higher mean sbp (p = 0.015) and dbp (p = 0.001) than women. over 70% of both men and women were found to have uncontrolled diabetes. among the participants with uncontrolled diabetes, 29.9% (n = 69) had impaired fasting glycaemia and 70.1% (n = 162) had hyperglycaemia. significantly (p = 0.008), the mean age of the women (57.22 12.32 years) in this study was higher than men (52.83 10.85 years). the mean duration of diabetes among the participants was found to be 5.23 5.00 years in which men had a higher mean duration than women. as seen in table 2, significantly, wc correlated positively with whr (r = 0.56, p < 0.01), age (r = 0.50, p < 0.01), and gender (r = 0.36, p < 0.01). the multiple linear regression models in table 3 show the relative contribution of predictor variables of wc. explaining 14% of the variance in wc in step 1, gender was a significant predictor of wc. in step 2, gender was no longer a significant predictor of wc, but whr (b = 0.43, p < 0.01), age (b = 0.40, p < 0.01), and fpgl (b = 0.14, p < 0.01) were significant predictors of wc. this cross - sectional study from tamale, ghana, among type 2 dm patients attending an outpatient clinic shows a high prevalence of central obesity and a relatively low prevalence of elevated blood pressure. parameters that significantly predicted increasing waist circumference were gender, age, fpg, whr, and wc. this is higher than the central obesity prevalence of 31.2% reported among an apparently healthy population of civil servants in tamale, ghana. our findings however concur with the central obesity prevalence of 75% in a hospital - based study of diabetes patients in kumasi, ghana, and 68.1% among diabetes patients in southern india. this is not surprising since obesity has been shown to be a significant risk factor for diabetes especially in type 2 dm [13, 14 ]. this is lower than the 63.0% reported among diabetes patients in kumasi, ghana, 54.2% among diabetes patients in benin city, nigeria, 66.4% in a cameroonian type 2 diabetic population, and 50% of the diabetes patients in kenya. the differences could be due to variations in definitions of hypertension, population characteristics, and ethnic variations. in a univariate analysis this was confirmed by our correlation and multiple linear regression models in which the female gender strongly predicted whr and wc in a positive direction. several studies have reported findings that are in agreement with the association between the female gender and obesity among diabetics [3033 ]. a similar relationship has also been reported in cross - sectional studies among apparently healthy populations [18, 3436 ]. in identifying factors that influenced wc, our correlation and multiple linear regression models revealed whr, age, and fpg as independent predictors of wc in a positive direction. as reported in several studies, a positive relationship was found between age and wc making age a strong predictor of wc (= 0.40, 95% ci = 0.400.64, p < 0.01) [12, 3739 ]. in agreement with our findings, wc significantly predicted the levels of blood glucose in a cross - sectional study in a sample of 5,882 adults from the us 19992004 national health and nutrition examination survey. in a population - based survey of the prevalence of diabetes and correlates in an urban slum in a community in nairobi, kenya, ayah. found that persons with diabetes were twice as likely to have an elevated wc (or 2.3 ; 95% ci 1.24.6%) and whr (or 2.1 ; 95% 1.13.9%). increased intra - abdominal adipose tissue is the most clinically relevant type of body fat that is associated with metabolic complications and adverse health effects including hyperinsulinemia and type 2 dm [4244 ]. this indicates the negative influence of increasing wc on blood glucose levels. in the management of diabetes to maintain blood glucose levels, emphasis should be placed on regularly measuring and monitoring abdominal and central adiposity using a simple and inexpensive measure like wc. fpg and blood pressure values were obtained secondarily from the personal health files of the diabetes patients. although all care was taken to record the values to minimize errors, misreporting might have occurred. predictors of increasing whr and wc were the female gender, age, and fpg. a relatively low prevalence of elevated blood pressure was found. | type 2 diabetes mellitus (type 2 dm) has become a disease of public health concern worldwide. obesity and elevated blood pressure have been shown to be comorbidities of type 2 dm. in this cross - sectional study in tamale, ghana, we determined the prevalence of abdominal obesity among type 2 dm patients. furthermore, we examined the demographic, clinical, and anthropometric predictors of increasing waist circumference in this population. three hundred type 2 dm patients attending the outpatient diabetes clinic of the tamale teaching hospital, ghana, were recruited for the study. waist circumference (wc) and hip circumferences were measured appropriately. systolic blood pressure (sbp) and diastolic blood pressure (dbp) and fasting plasma glucose (fpg) were taken from the personal health record files of patients. demographic data were obtained. pearson correlation and multiple linear regression models were employed to identify predictors of increasing wc. the prevalence of abdominal obesity was 77.0% and was significantly higher in women than in men. a positive correlation was observed between waist - to - hip ratio (whr) and wc (r = 0.56, p < 0.001), female gender (r = 0.73, p < 0.001), and age (r = 0.20, p < 0.001). a high prevalence of abdominal obesity was observed. predictors of increasing wc were gender, age, fpg, and whr. |
patient 1 was a 60-year - old man who was hospitalized on 5 august 2013, because of two weeks of fever, arthralgias and malaise. furthermore, no plasmodium parasite was observed on the giemsa stained blood smears obtained on the first day of hospitalization. the patient had a temperature of 38.5c, low platelet count (6.910/l) and hematocrit (39.0 %), but other routine blood examinations were normal. he also had increased levels of direct bilirubin (6.10 mol / l) and alanine aminotransferase (100 u / l). the patient recalled that he had travelled to myanmar and back to china frequently, but had never received any blood transfusions or blood products. he also recalled multiple tick bites about 2 months prior to diagnosis, particularly after outdoor activities in the jungle along border areas of china myanmar. patient 2 was a 30-year - old man who was hospitalized on 9 april 2013, because of two days of fever, diaphoresis, myalgias, progressive dyspnea and fatigue. the patient had a temperature of 38.4c, a slightly elevated leukocyte count (1.1110/l), but normal levels of other routine blood parameters. originally from tengchong village, he had travelled to myanmar 2 months ago, returning home at the beginning of april. he recalled multiple tick bites in the recent past and had also received blood transfusion and blood products for the treatment of renal - malaria caused by infection with plasmodium falciparum during the summer of 2012. a nested polymerase chain reaction (pcr) with two sets of babesia microti specific primers for the small subunit ribosomal rna (ssu rrna) was conducted on blood samples. positive samples were tested using another set of nested pcr primers to detect the beta - tubulin gene of b. microti. to identify the clades to which the isolates belong, a more accurate analysis of the sequence encoding the 18s rrna gene of the babesia parasite from the patients was applied with the nested pcr primers piro1f second round pcr products that were full - length cdnas for the 18s rrna gene (1700 bp) and the beta - tubulin gene (590 bp) were sequenced. the blood smears showed intraerythrocytic ring form and tetrad typical of small babesia parasites (figure 1). sequences from ssu rrna and beta - tubulin gene obtained by direct sequencing of pcr products from the two patients were aligned by using the clustalw method (embl - ebi, hixton, cambridge, uk). those sequences were deposited in genbank with accession nos kf410825, kj128385 and kj128387, respectively. the sequences of our two isolates and other sequences were clustered following the pattern described by hunfeld. to identify the group of our isolates. phylogenetic trees were produced by using the neighbor joining method in mega version 5.1 (http://mega.software.informer.com/5.1b/). the case samples (denoted as yunnan china) clustered with other b. microti isolates. infection of human babesiosis has only been reported as a few sporadic cases in china. because malaria rdt was negative for each case, and the blood smears failed to find any protozoan parasites, neither patient was treated with any anti - protozoa drugs. atovaquone, the drug of first choice for treatment of babesiosis is not available in china. however, a combination of penicilin, quinolone and other symptomatic treatments, such as oral paracetamol tablets for the high temperature and supplemental vitamin c and vitamin b1, were administered to these two patients. both patients had no significant immune deficiency ; babebsia infections were relatively benign since fever and other symptoms resolved within 1 month of therapy. the severity of human babesiosis depends on the immune status of the host and on the babesia species causing the infection, ranging from an asymptomatic infection to a severe life threatening disease. in some areas, b. microti is known to elicit no symptoms in about half of children and a quarter of adults. most cases reported on b. divergens infection are severe and most of these severe babesiosis cases occurred in people who lack a spleen. babesiosis is now classified as a notifiable disease in the united states and is recognized as an emerging health risk in other parts of the world. in asia, b. microti - like organisms have caused illness in japan, taiwan and zhejiang province of china. importantly, human babesiosis has sometimes been diagnosed initially as malaria because of the similarity between the two diseases or the two parasites, but little is known about the prevalence of babesia spp. infections in malaria - endemic areas, where misidentification as plasmodium infection is most probable. myanmar border areas of yunnan, china, where is endemic area for malaria, suggesting that babesiosis and malaria co - exist in this region. both cases presented with malaria - like symptoms ; babesia infections were confirmed by blood smears, pcr amplification and amplicon sequencing., their blood smears showed intraerythrocytic ring forms and tetrads, the latter forms being an uncommon finding that is considered pathognomonic of small babesia spp. these two cases reveal that human babesiosis caused by b. microti occurs in areas along the china the lessons learnt from this finding are two - fold : first, diagnosis of babesiasis is usually detected by blood smear, but the ring forms of both p. falciparum and babesia spp. previous study showed that at least 300 microscopical fields need to be reviewed to detect low level parasitemia. the confirmation of two cases by pcr indicated that human babesiosis can be distinguished from malaria with the assistance of pcr - based diagnostics. b. microti was regarded as a single species before, but then regarded as a genetically diverse species complex. clade 1 of b. microti contained mostly rodent parasites and also the majority of strains thought to be zoonotic. clade 2 contained carnivore parasites, and clade 3 contained rodent parasites that are probably not zoonotic. as expected, the b. microti isolates reported herein belong to the clade that contains the majority of zoonotic strains. second, babesiosis does not respond to chloroquine which might cause its misidentification as drug - resistant malaria, especially in syndemic areas. both cases were treated with penicillin and quinolone, although these drugs have not been shown to be effective against babesiosis. it must also be noted that most antimalarial drugs, such as chloroquine and mefloquine have no effect on babesiosis. the first regimen effective against babesiosis consists of atovaquone and azithromycin whereas the second consists of clindamycin and quinine. from the treatment standpoint, particularly, artemisinin - resistant p. falciparum malaria has emerged in cambodia and thailand myanmar border. b. microti appears to be responsive to artemisinin derivatives, as per the study on a mouse model. but there is still not enough data or studies to confirm that artemisinin derivatives are effective to eliminate babesia infection in humans. in conclusion, babesiosis and malaria are caused by pathogens with their similar morphology and overlapping symptoms, but require different treatments. | babesiosis is a tick - borne, zoonotic disease caused by babesia spp. two cases of babesiosis were detected by nested polymerase chain reaction (pcr) in yunnan province, china, and further confirmed by molecular assay. the blood smears showed intraerythrocytic ring form and tetrads typical of small b. microti. in both cases, the rapid diagnostic test (rdt) ruled out the possibility of co - infections with malaria. neither case was initially diagnosed because of the low babesia parasitemia. these two cases of babesiosis in areas along the myanmar china border pose the question of the emergence of this under recognized infection in countries or areas where malaria is endemic. |
diabetes mellitus is one of the chronic metabolic diseases characterized by high blood glucose level, due to the absence of insulin and/or defect in insulin action. the chronic elevation of blood glucose level in diabetic patient leads to complications and failure of many organs in the body such as heart, kidney, and blood vessels. according to the who assessments, diabetes mellitus considered the seven cause of death in the next 20 years in the world. it is well - known that patients with diabetes are more prone to develop ischemic heart disease due to metabolic derangement that leads to accelerated atherosclerosis. there are numerous molecules produced from an adipose tissue called adipocytokines can estimate metabolic disturbances. omentin is an as of late recognized novel adipocytokine secreted by visceral adipose tissue, and it falls under the classification of being a benefit adipokine. in which diminished in patients with obesity, insulin resistance (ir), and diabetes that assist in development of the metabolic disorder and other illness conditions such as atherosclerosis and immune system disorders. omentin is determined by two isoforms omentin-1 and omentin-2 that predominantly found in visceral omental fat tissue. the reduction in plasma omentin levels encourages the pathogenesis of ir, type 2 diabetes mellitus (t2 dm), and cardiovascular disorders in individuals with overweight. omentin-1 strengthens the role of insulin in the stimulus of akt - phosphorylation, glucose uptake, while suppress the cytokine as tumor necrosis factor that provoked inflammation so this shows that omentin-1 has a protective role as adiponectin. omentin-1 levels in plasma and epicardial adipose tissue are diminished in patients with t2 dm. omentin act as multi - events as anti - inflammatory, anti - atherogenic, anti - cardiovascular disease, and anti - diabetic properties in addition to its action on vascular by inducing vasodilatation of veins and lessens c - receptive protein provoked angiogenesis. this study aimed to evaluate the influence of treatment for 12 weeks with 1000 mg metformin drug (insulin sensitizer) in group 1 or in combination with 80 mg gliclazide drug (insulin secreting agent) in group 2 on serum omentin-1 level and others biomarkers represented by blood pressure, pulse rate, body mass index, lipid profile, fasting serum glucose (fsg), postprandial blood glucose (ppg), hba1c, fasting serum insulin, and ir index in patients with newly diagnosed t2 dm. a total of 70 newly diagnosed patients with t2 dm who visited (the specialized center for endocrinology and diabetes, al - mustansiriya university two patients (1 from each group) did not complete the course of the treatment for unknown reasons and considered as default. sixty - eight patients completed the 12 weeks course of treatment ; patients were divided equally into two groups ; group 1 (20 males and 14 females) with mean age 51.35 11.70 years, treated with 1000 mg metformin tablet, and group 2 (19 males and 15 females) with mean age 51.21 9.63 years, treated with 1000 mg metformin plus 80 mg gliclazide. the patients were considered excluded if they have type 1 diabetes or others conditions that linked with hyperglycemia such as (polycystic ovary syndrome and gestational diabetes), having any persistent diseases of the heart, kidney, thyroid, lung, and liver and taking corticosteroids. the blood samples were taken from fasting volunteers (for 812 h) through vein puncture technique by sterile (10 ml) syringe, at the beginning of the study (before starting metformin for the group 1 and before starting metformin plus gliclazide for the group 2) to measure specific parameters included in this study and after 12 weeks of taking the drugs to see the effect of the drugs on these parameters (fsg, ppg, hba1c, fasting serum insulin, and serum omentin-1 levels). serum omentin-1 was determined by utilization of an instant serum omentin-1 eliza kit (biovendor laboratorn medicna a.s., czech republic) and fasting serum insulin was determined by utilization of an instant insulin eliza kit (accubind elisa microwells, monobind inc., usa) (humareader hs, human, germany), in addition to determination of hba1c concentrations by utilizing an instant kit (clover a1c analyzer, infopia inc. ir determined from the homeostasis model assessment of ir (homa - ir) = insulin concentration (iu / ml) fasting glucose concentration (mg / dl)/405. continuous variables were summarized as mean standard deviation. on the other hand, the significance of difference of different means (quantitative data) was tested using student 's t - test for difference between two independent means. both of treated groups showed significant reductions in the levels of fsg, ppg, and hba1c after 12 weeks of treatment regimen, while there were variable influences of treatment regimen on serum insulin levels over 12 weeks of treatment among study groups [table 1 ]. it has been found that treatment with metformin alone result in reduction in serum insulin level in comparison to pretreatment values but not reached to the significant levels, whereas using of both of metformin and gliclazide in combination resulted in an increment (but not significant) in this parameter in comparison to their pretreatment levels. regarding ir index represented by homa - ir showed that there was significantly decreased in ir index respect to their pretreatment values after 12 weeks treatment with metformin used in combination with gliclazide among group 2, while the extent of reduction in ir among group 1 treated with metformin alone not reached to the significant levels over 12 weeks of treatment. it is nice to mention that there is a significant decreased in ir index (p = 0.043) in group 2 when it compared to group 1 values after 12 weeks of treatment. the effects of 12 weeks treatment with metformin alone (group 1), or metformin plus gliclazide (group 2) on glycemic indices and omentin-1 regarding omentin-1 levels, it has been found that treatment with metformin alone result in clearly increment in omentin-1 level in comparison to pretreatment values among group 1 but not reached to the significant levels, whereas using of both of metformin and gliclazide in combination for 12 weeks resulted in significant decrement in omentin-1 level in comparison to their pretreatment levels among group 2. it 's nice to mention that there was a significant reduction in this parameter after treatment regimens among patients of group 2 compared to group 1 (p = 0.004). this study revealed that use of gliclazide as an add - on therapy to metformin in patients with the t2 dm result in better glycemic control and much more improvement in insulin sensitivity, whereas it has an adverse impact on serum omentin-1 levels. in this study, there were significant reduction and improvement in fsg, ppg, and hba1c levels following treatment with metformin alone or metformin plus gliclazide for 12 weeks among type 2 diabetic patients (group 1 and group 2) in which the greatest reduction in these parameters were achieve by metformin plus gliclazide and these results consistent with other previous study. in type 2 diabetic patients metformin considered the first choice treatment unless there is a contraindication, in which it acts through inhibition of hepatic gluconeogenesis, lower down intestinal absorption of glucose and fasting glycemia and improvement in insulin sensitivity. combination of metformin with sulpfonylureas acts with different mechanisms considered the most common one among combination therapy in treatment of persistent hyperglycemia in type 2 diabetic patients by increasing insulin secretion and insulin sensitivity so more intensive glycemic controls. concerning the influences of treatment regimen on fasting serum insulin the results of current study were showed that serum insulin level changed in a different way when gliclazide was combined to metformin in treatment of patients with dm. hence, treatment with metformin alone leads to nonsignificant reduction in serum insulin levels whereas adding gliclazide to metformin result in nonsignificant elevation in its. the trend of insulin changing with treatment regimen in this study (although it not reached significance level) is consistent with other previous study. metformin treatment acts mainly through inhibition of hepatic glucose production, decrease workload on beta - cells and improved insulin sensitivity as a result in reduction in serum insulin levels, while during treatment with sulfonylurea as a single agent or combined with metformin result in an elevation of serum insulin levels in which gliclazide and metformin acts through different mechanisms as increase insulin secretion through blocked of atp - sensitive k channels on pancreatic beta - cell and improve insulin sensitivity, respectively resulting an additive effect on glycemic control. this reduction of ir was further lowered and reached the degree of significance when both of gliclazide and metformin used together. result of this study document the previous reports regarding beneficial influence of gliclazide on ir. the interesting finding in the present study is the synergistic improvement in insulin sensitivity when gliclazide used in combination with metformin in treatment of diabetic patients. it is important to mention that not all members of sulfonylureas have this helpful impact on ir. gliclazide in contrast to other sulfonylureas drug has the ability to counteract the deteriorating effects of free radicals on insulin sensitivity of peripheral tissue by its anti - oxidant ability. hence, the combinations of metformin with gliclazide showed this clear improvement in insulin sensitivity by reduce ir by more than one mechanism. the present study revealed that metformin alone behave positively in regard serum omentin-1 levels whereas combination therapy of metformin plus gliclazide are adversely affects omentin-1 level (p < 0.05). the influence of metformin toward omentin in the present study approves the finding of many previous studies which stated that treatment with metformin result in an increment in serum omentin levels. it is nice to mention that to the best of our knowledge there are no published reports describing the combined effects of both of metformin and gliclazide (or any other sulfonylureas) on serum omentin-1 level. the current study highlights an important impact of adding gliclazide on cardioprotective action of metformin. it showed that adding of gliclazide might at least attenuate cardioprotective effects of metformin in term of reversing the positive influence of metformin on serum omentin-1 levels. in this study, the changing trend of serum omentin-1 in response to treatment course can be attributed to different influence of both treatment regimens on serum insulin levels. it is well - known that serum insulin has negative impact on serum omentin-1 levels. hence, in the case of treatment with metformin alone, plasma insulin is decreased due to the action of metformin as an insulin sensitizer. whereas adding of gliclazide, although it enhances insulin sensitivity to a certain extent, is associated with an increment of plasma insulin levels. adding of gliclazide to metformin in treatment of patients with t2 dm might extend the therapeutic action of metformin in regarding much better controlling of glycemic indices, insulin sensitivity, and lipid profile. however, at the same time, it might attenuate the cardioprotective effects of metformin by its adverse influence on body weight and serum omentin-1 levels | background : omentin is a newly identified adipokine that has beneficial influence against cardiovascular disorders. hence, considering the impact of anti - diabetic drug on omentin levels may provide an adjuvant strategy to protect diabetic patients against valuable clinical hazards.aim of the study : to investigate the influence of metformin alone or in combination with gliclazide on the level of serum omentin among patients with type 2 diabetes mellitus (t2dm).patients and methods : a total of 70 newly diagnosed patients with t2 dm were enrolled in this randomized, double - blind prospective study, and divided into two equal groups based on treatment regimen in which group 1 treated with metformin (1000 mg) and group 2 treated with metformin (1000 mg) plus gliclazide (80 mg). blood glucose levels, hba1c, insulin levels, and serum omentin-1 were measured at baseline and after 12 weeks of treatment.result:use of gliclazide as an add - on therapy to metformin in patients with t2 dm result in better glycemic control evidenced by significant reductions in the levels of blood glucose levels and hba1c and much more improvement in insulin sensitivity evidenced by significant decreased in insulin resistance index, whereas it has adverse impact on serum omentin-1 levels evidenced by significant decrement in omentin-1 level in comparison to their pretreatment levels among group 2 patients.conclusions:adding of gliclazide to metformin in treatment of patients with t2 dm might extend the therapeutic action of metformin in regarding much better controlling of glycemic indices, but, at the same time, it might attenuate the cardioprotective effects of metformin by its adverse influence on serum omentin-1 levels. |
the total contamination of fukushima - daiichi nuclear power plant (f1npp) accident was about a tenth comparing to that of the chernobyl accident, and a hundred times to that of the windscale accident [1, 2 ]. most of the radioactive materials dispersed to the pacific ocean by the dominant westerly wind occurring at the time of the explosions and release (vent). the rest was deposited mainly towards the northwest terrestrial area of about 1,000 km from the f1npp, on the highland of high biodiversity [2, 3 ] (fig. 1). ground contamination has been detected as far as 250 km southwest of the chichibu mountain range. vegetation, land use by man, terrain, distance and decontamination activities, are all factors related to the f1npp accident that are expected to affect free - living wildlife such as aphids, butterflies, birds, and trees. exposure to free - living wildlife species is likely to be highly variable, depending on their ecology, behavior and by chance. japanese bush warblers (cettia diphone) found in the highest contamination district (akaugi) had strong contamination on their feathers in 2011. we have been monitoring the radioactivity level of the environment and of japanese bush warblers in the region. 1.location of f1npp, several cities, towns, and the main survey locations in fukushima and chichibu, japan. the small map indicates the outline of detected radioactively contaminated areas resulting from the f1npp accident. the bottom figure shows the topology profile from f1npp on the pacific coast (right) to the west for 55 km, close to abukuma river (left). location of f1npp, several cities, towns, and the main survey locations in fukushima and chichibu, japan. the small map indicates the outline of detected radioactively contaminated areas resulting from the f1npp accident. the bottom figure shows the topology profile from f1npp on the pacific coast (right) to the west for 55 km, close to abukuma river (left). the altitude is magnified about five - fold on a relative scale. the most contaminated area, with total radioactive cesium fallout of > 3000 kbq / m, expands 30 km to the northwest from the f1npp through the northern part of the abukuma mountains (fig. 1). the landscape consists of a mix of various types of forest, agricultural fields and small residential lands. there are various species of wildlife in the area, including japanese monkey (macaque fuscata), boar (sus scrofa), copper pheasant (syrmaticus soemmerringii), among many other species. forest covers 70% (9750 km) of fukushima prefecture, and is thus the most dominant habitat within the area contaminated by the f1npp accident. the forest and soil have been proved to steadily fix the radioactive cesium and cesium [2, 10 ]. the most contaminated area, with total radioactive cesium fallout of > 3000 kbq / m, expands 30 km to the northwest from the f1npp through the northern part of the abukuma mountains (fig. 1). the landscape consists of a mix of various types of forest, agricultural fields and small residential lands. there are various species of wildlife in the area, including japanese monkey (macaque fuscata), boar (sus scrofa), copper pheasant (syrmaticus soemmerringii), among many other species. forest covers 70% (9750 km) of fukushima prefecture, and is thus the most dominant habitat within the area contaminated by the f1npp accident. the forest and soil have been proved to steadily fix the radioactive cesium and cesium [2, 10 ]. japanese bush - warblers were captured with a mist net in mid august 2011, and mid july and mid august 20122014. the net sites were prepared (by removal of dense bush and grasses) at akaugi (29.631.7 km northwest from f1npp), hiruzone (20.3 km nw), and omaru (11.2 km nw), namie town, fukushima prefecture, japan. two or more rectrices (tail feathers) were removed from each individual for measurement of radioactive contaminants on the feathers. the feathers were placed in contact on a radio - autograph imaging plate (ms2025 fuji film) for three (2011) to seven (2013) days (72168 h) in a 5c room. the imaging plate was subsequently read using fla5000 (fuji film) at a resolution of 100 m. the feather sample dose rates were measured with a germanium semiconductor detector (gem type, seiko eg&g). the air dose rate at breast height around the netting sites was temporally measured with a portable survey meter (hitachi - aloka ics-311), which indicates the value in sv / h. ten ic recorders (olympus, ds-750) were placed around the area (the most western point is 20.6 km and the most northwestern point is 32.5 km from f1npp, during late february or early march through september in 20122014. natural sound was recorded with this equipment early every morning (starting at around sunrise) for 23 h. the recorded audio files were manually monitored with headphones, and recording dates and the period of the japanese bush warbler songs and calls were determined.. ltd, es system : providing values in millisievert) were placed in various microhabitats, including > 15 cm below the ground, on the ground, and at different heights ranging up to 12 m from the ground, at a number of locations (kamitashiro, yamakiya, kawamata town and tecchiro, akaugi, namie town) during a period extending from december 2012 to february 2013 (12001350 h). the geography was a significant factor affecting the habitat and microhabitat contamination, and exposure of wildlife to radiation. overall, the side of mountain peaks and ridges closest to the f1npp received greater fall - out. even structures like a hill or a rock affected the dose rates as measured in situ. for example, the ground measurement at the foot of a small hill facing away from the f1npp, averaged 0.3 sv / h, whereas the ground measurement at the hilltop, facing the f1npp, averaged 4.0 sv / h, in two - month continuous dose - rate observations using glass dosimeter badges in the yamakiya district in 2013 (fig. 2). the equivalent measurements varied from 12.4 to 30.1 sv / h in the tecchiro district. fig. 2.landscape and representative microhabitat dose rates at kamitashiro, yamakiya, kawamata town, 29 km northwest of the f1npp. the aerial dose rates were measured with glass dosimeter badges (type es, chiyoda technol. this photo was taken using a motor paraglider, at several hundred meters above the ground (bizworks corp. typical dose measurement results and microhabitats are indicated in the picture : for example, the minimum and maximum values on the ground, and those close to the average value in air and in several types of forest, agricultural and water environments. landscape and representative microhabitat dose rates at kamitashiro, yamakiya, kawamata town, 29 km northwest of the f1npp. the aerial dose rates were measured with glass dosimeter badges (type es, chiyoda technol. this photo was taken using a motor paraglider, at several hundred meters above the ground (bizworks corp. typical dose measurement results and microhabitats are indicated in the picture : for example, the minimum and maximum values on the ground, and those close to the average value in air and in several types of forest, agricultural and water environments. in mid august 2011, an adult male japanese bush warbler was captured at tsushima district, where the air dose rate measured directly at breast height was 510 sv / h. three other adult males were captured in the akaugi district, where the air dose rates were 2030 sv / h (fig. the radioactivity of cs and cs was estimated to be above 3000 kbq / m at akaugi and above 1000 kbq / m at tsuhima (where the birds were captured). the contamination of tail feathers (rectrices) collected from the three warblers from akaugi were rated as high (fig. 4, bird 1, 1.2 bq of cs and 1.8 bq of cs for 0.015 g feathers ; bird 2, 2.5 bq of cs and 3.6 bq of cs for 0.026 g feathers ; bird 3, 12.5 bq of cs, 17.3 bq of cs and 1.4 bq of ag for 0.056 g feathers) ; these measurements were determined with a germanium semiconductor detector at the university of tokyo. the total feather dose rates were calculated as 117557 bq / g for the three birds. the radioactive material on the feather was strongly fixed, and most of it could not be removed by washing with ethanol or soapy water in the ultrasonic cleaner. feather contamination rates had decreased by 80% (to about a fifth) in august 2012, with further decreases in frequency (some individuals had no detectable radiocontamination by 2013) compared with those collected in 2011. japanese bush warblers immigrate to this district in late march, as determined by automatic sound recording using ic recorders in 20122014. usually a male stays in its territory at one location till late summer, and continues to sing and call for the entire day. the feathers collected, which grew the year before, were expected to have remained in a highly contaminated condition for five months. the total external dose for humans was roughly estimated as 50 msv in the akaugi district (= 20 sv / h 24 150 h). we need to determine the conversion rate for small birds based on this value to estimate the radiation effects on the birds. one of the three birds captured in akaugi in 2011 had a conspicuous lesion (that looked like an avian poxvirus lesion) near its cloaca ; it was not likely to have been a tumor, but more likely was an abscess or a dilatation of cutaneous glands ; histological examination was not performed. similar lesions had been observed on two males of the same bird species at wakayama prefecture, western japan, in summer 2006 (kumashiro., unpublished data). this kind of observation is rare in wild birds in japan, and the probability is currently under research. the observation rate in fukushima (1 in 3) is significantly higher than that in chichibu mountains during 19892013 (0 in 224 adult japanese bush warblers captured by the first author, z = 8.64, p = 0.013, exact test mann it will be necessary to accumulate further comparable data related to this type of lesion. 3.a male japanese bush warbler (left) and the lesion observed around the upper tail coverts on a male captured at akaugi on 11 august 2011. 4.radio images of contaminated rectrices of two male japanese bush warblers captured at akaugi on 11 and 12 august 2011. strong spots indicate higher contamination on the feathers. a male japanese bush warbler (left) and the lesion observed around the upper tail coverts on a male captured at akaugi on 11 august 2011. radio images of contaminated rectrices of two male japanese bush warblers captured at akaugi on 11 and 12 august 2011. monitoring of free - living wildlife in their natural habitat in the highly contaminated area of the f1npp accident may have three benefits. first, this may provide helpful information about the real consequences of radioactive contamination in the environment. we assume that the effects of radiation do not independently affect an organism in the contaminated area of the f1npp accident. the behavior of each individual could also change its exposure rate, often by chance, because dose rates vary greatly among the microhabitats. second, the results from studies of wildlife populations may play a role in influencing when and where people decide to return to the homes from which they evacuated immediately following the f1npp accident. wild animals are exposed directly to the environment and may not have any speculation to avoid the radioactive contamination and its influences. we can assume that better conditions for the wildlife, especially vertebrates, should indicate better conditions for human beings, with safety redundancy. a number of species of wildlife, such as warblers, can be indicator species for such speculations. third, there is huge variety among wildlife and in life histories in relation to the environment, intra- and interspecific interactions, etc. we can learn about the various characteristics of radioactivity affecting the organisms in the natural environment. this information has the potential to provide better understanding for future generation of people about ways to deal with radioactivity in the world, which we can not afford to miss. this also means we should study radiation activities, the process and pattern of radiation through organisms in the ecosystem, and how to preserve the biodiversity and the ecosystem services. however, we do not yet know very well enough which wildlife species and how to observe the free - livings. we can search many kinds, according to our own experiences and skills at f1npp accident. the icrp has listed several wild organisms as candidate reference animals, such as deer, rats, ducks, frogs, bees and earthworms. they also described their standards as provisional ones, and stated that it will be valuable to select other organisms for our references, as the nature of each individual place is unique. the geography was a significant factor affecting the habitat and microhabitat contamination, and exposure of wildlife to radiation. overall, the side of mountain peaks and ridges closest to the f1npp received greater fall - out. even structures like a hill or a rock affected the dose rates as measured in situ. for example, the ground measurement at the foot of a small hill facing away from the f1npp, averaged 0.3 sv / h, whereas the ground measurement at the hilltop, facing the f1npp, averaged 4.0 sv / h, in two - month continuous dose - rate observations using glass dosimeter badges in the yamakiya district in 2013 (fig. 2). the equivalent measurements varied from 12.4 to 30.1 sv / h in the tecchiro district. fig. 2.landscape and representative microhabitat dose rates at kamitashiro, yamakiya, kawamata town, 29 km northwest of the f1npp. the aerial dose rates were measured with glass dosimeter badges (type es, chiyoda technol. this photo was taken using a motor paraglider, at several hundred meters above the ground (bizworks corp. typical dose measurement results and microhabitats are indicated in the picture : for example, the minimum and maximum values on the ground, and those close to the average value in air and in several types of forest, agricultural and water environments. landscape and representative microhabitat dose rates at kamitashiro, yamakiya, kawamata town, 29 km northwest of the f1npp. the aerial dose rates were measured with glass dosimeter badges (type es, chiyoda technol. this photo was taken using a motor paraglider, at several hundred meters above the ground (bizworks corp. typical dose measurement results and microhabitats are indicated in the picture : for example, the minimum and maximum values on the ground, and those close to the average value in air and in several types of forest, agricultural and water environments. in mid august 2011, an adult male japanese bush warbler was captured at tsushima district, where the air dose rate measured directly at breast height was 510 sv / h. three other adult males were captured in the akaugi district, where the air dose rates were 2030 sv / h (fig. the radioactivity of cs and cs was estimated to be above 3000 kbq / m at akaugi and above 1000 kbq / m at tsuhima (where the birds were captured). the contamination of tail feathers (rectrices) collected from the three warblers from akaugi were rated as high (fig. 4, bird 1, 1.2 bq of cs and 1.8 bq of cs for 0.015 g feathers ; bird 2, 2.5 bq of cs and 3.6 bq of cs for 0.026 g feathers ; bird 3, 12.5 bq of cs, 17.3 bq of cs and 1.4 bq of ag for 0.056 g feathers) ; these measurements were determined with a germanium semiconductor detector at the university of tokyo. the total feather dose rates were calculated as 117557 bq / g for the three birds. the radioactive material on the feather was strongly fixed, and most of it could not be removed by washing with ethanol or soapy water in the ultrasonic cleaner. feather contamination rates had decreased by 80% (to about a fifth) in august 2012, with further decreases in frequency (some individuals had no detectable radiocontamination by 2013) compared with those collected in 2011. japanese bush warblers immigrate to this district in late march, as determined by automatic sound recording using ic recorders in 20122014. usually a male stays in its territory at one location till late summer, and continues to sing and call for the entire day. the feathers collected, which grew the year before, were expected to have remained in a highly contaminated condition for five months. the total external dose for humans was roughly estimated as 50 msv in the akaugi district (= 20 sv / h 24 150 h). we need to determine the conversion rate for small birds based on this value to estimate the radiation effects on the birds. one of the three birds captured in akaugi in 2011 had a conspicuous lesion (that looked like an avian poxvirus lesion) near its cloaca ; it was not likely to have been a tumor, but more likely was an abscess or a dilatation of cutaneous glands ; histological examination was not performed. similar lesions had been observed on two males of the same bird species at wakayama prefecture, western japan, in summer 2006 (kumashiro., unpublished data). this kind of observation is rare in wild birds in japan, and the probability is currently under research. the observation rate in fukushima (1 in 3) is significantly higher than that in chichibu mountains during 19892013 (0 in 224 adult japanese bush warblers captured by the first author, z = 8.64, p = 0.013, exact test mann whitney u test). it will be necessary to accumulate further comparable data related to this type of lesion. 3.a male japanese bush warbler (left) and the lesion observed around the upper tail coverts on a male captured at akaugi on 11 august 2011. 4.radio images of contaminated rectrices of two male japanese bush warblers captured at akaugi on 11 and 12 august 2011. strong spots indicate higher contamination on the feathers. a male japanese bush warbler (left) and the lesion observed around the upper tail coverts on a male captured at akaugi on 11 august 2011. radio images of contaminated rectrices of two male japanese bush warblers captured at akaugi on 11 and 12 august 2011. monitoring of free - living wildlife in their natural habitat in the highly contaminated area of the f1npp accident may have three benefits. first, this may provide helpful information about the real consequences of radioactive contamination in the environment. we assume that the effects of radiation do not independently affect an organism in the contaminated area of the f1npp accident. the behavior of each individual could also change its exposure rate, often by chance, because dose rates vary greatly among the microhabitats. second, the results from studies of wildlife populations may play a role in influencing when and where people decide to return to the homes from which they evacuated immediately following the f1npp accident. wild animals are exposed directly to the environment and may not have any speculation to avoid the radioactive contamination and its influences. we can assume that better conditions for the wildlife, especially vertebrates, should indicate better conditions for human beings, with safety redundancy. a number of species of wildlife, such as warblers, can be indicator species for such speculations. third, there is huge variety among wildlife and in life histories in relation to the environment, intra- and interspecific interactions, etc. we can learn about the various characteristics of radioactivity affecting the organisms in the natural environment. this information has the potential to provide better understanding for future generation of people about ways to deal with radioactivity in the world, which we can not afford to miss. this also means we should study radiation activities, the process and pattern of radiation through organisms in the ecosystem, and how to preserve the biodiversity and the ecosystem services. however, we do not yet know very well enough which wildlife species and how to observe the free - livings. we can search many kinds, according to our own experiences and skills at f1npp accident. the icrp has listed several wild organisms as candidate reference animals, such as deer, rats, ducks, frogs, bees and earthworms. they also described their standards as provisional ones, and stated that it will be valuable to select other organisms for our references, as the nature of each individual place is unique. this study was supported in part by a general grant for an agricultural field study by the graduate school of agricultural and life sciences (gsals), the university of tokyo, a 2012 wildlife fund grant provided by wildlife research centre of kyoto university, and a 2013 grant for new technology studies by watanabe memorial foundation for the advancement of new technology. funding to pay the open access publication charges for this special issue was provided by the grant - in - aid from the japan society for the promotion of science (jsps) [kakenhi grant no. | the fukushima daiichi nuclear power plant (f1npp) accident is an iaea level 7 event, the same as that of chernobyl, while the amount of radionuclides released is not comparable. radioactivity attributed to the f1npp accident was detected 250 km away from the f1npp. although we have not yet systematically studied the effect of radionuclides on the environment and wildlife, one of three japanese bush warblers (cettia diphone), captured in akaugi district in august 2011, was observed to have a conspicuous lesion near the cloaca, which is rare in japan. all of the birds ' feathers were strongly contaminated. further study is needed to determine the significance of this result. we emphasize the importance of continuing assessment of the effects of the f1npp accident on wildlife. |
microorganisms such as fungi, viruses and bacteria are recognized as biocontrol agents (1). nematodes are a large group of parasites which cause serious economic and hygienic problems in plants, animals and humans. several programs are developed to minimize the unfavorable effects of gastrointestinal parasites (3). some of the programs attempted to reduce the infective larvae with antihelminthic compounds to reduce nematode infections in adult animals. even though using the antihelminthic compounds are the major tools to treat gastrointestinal parasites, there are limitations regarding their usage in drug residual in animal products such as milk and meat (4). these compounds can be also toxic for non - target organisms (5) and helminthes because of resistance to the antihelminthics (6). biological control seems to be a safe and efficient idea to decrease the population of infective nematodes larvae in gastrointestinal tract and pastures. de souza maia filho. (8) evaluated ovicidal effect on toxacara canis ova by using several species of fungi including acremonium, aspergillus, bipolaris, fusarium, gliocladium, mucor and trichoderma isolated from local soil. the results showed that trichoderma, fusarium solani complex and acremonium have more ovicidal effect on t. canis ova (8). agriculture nematodes were controlled by nematocidal activity of fusarium and paecilomyces species isolated in india. mishra and dwivedi indicated a reduction in the number of nematode farms such as root - knot meloidogyne incognita and m. javanica, and reniform rotylenchulus reniformiss using fusarium and paecilomyces isolates (9). showed that aspergillus alliaceus can be used as a potential biological controlling agent on root parasitic weed orobanche population (10). various types of fungi, mostly belonging to ascomycota, demonstrate antagonistic effects on eggs and parasitic nematodes in animal or human. the secretion of nematode - antagonistic compounds in f. equiseti isolated from soybean cyst is recognized (11). these metabolites can influence the creation of nematicidal agents and promote the nematocidal activity of some bacteria in plant (12). showed that trichoderma harzianum enhanced the production of nematicidal compounds in laboratory and developed biocontrol of meloidogyne javanica with pseudomonas fluorescens in tomato (13). the current study mainly aimed to evaluate the in vitro activities of various saprophyte soil - fungi to reduce the infective larvae stage of parasitic nematode trichostrongylidae family. two - hundred grams of feces from each sheep was incubated in room temperature for 10 days. the third stage infective larvae of trichostrongylidae family containing ostertagia circumcincta, marshalgia marshali and haemonchos contortus, were collected by berman apparatus. to obtain larvae without fecal fungi and bacteria, they were washed 10 times in normal saline by centrifugation for two minutes at 500 rpm. the larvae were kept at 4c in a solution including antibiotics penicillin - streptomycin (sigma, germany) and amphotericin b (fungizone / brstol - myers squibb, paris) to prevent bacteria and fungi growth. fifteen isolates of filamentous fungi including penicillium sp., a. flavus, cladosporium sp., trichoderma sp., f. equisetti, paecilomyces sp., a. niger, fusarium sp., acremonium sp., alternaria sp., derecselera sp., trichotecium sp. and the collected fungi were identified by a mycologist using special media and according to colony morphology characters and light microscope. the fungi were cultured on sabouraud dextrose agar (merck, germany) at room temperature for 3 days. the grown fungi were transferred on potato dextrose agar (pda) (merck, germany) for three days at room temperature. after grow of fungi on pda, 7 mm diameter mycelium culture discs were cut and transferred to plates containing 2% water - agar medium with 1% gentamycin (sigma, germany). the larvae were washed 10 times with normal saline to remove antibiotics. on the 4th day, 1 ml of larvae culture suspension containing 200 third stage nematode larvae from trichostrongylidae family l3 was separately added to the fungal cultures in 2% water - agar medium petri - dishes. every day the live larvae were counted by light microscope (10x) and the number of captured larvae was recorded in different days. the control groups were use in each isolated fungi to compare data with the test groups. the data were analyzed by chi - square test (= 5% confidence index) and descriptive analysis by spss software version 16 (spss, inc, chicago, il, usa). two - hundred grams of feces from each sheep was incubated in room temperature for 10 days. the third stage infective larvae of trichostrongylidae family containing ostertagia circumcincta, marshalgia marshali and haemonchos contortus, were collected by berman apparatus. to obtain larvae without fecal fungi and bacteria, they were washed 10 times in normal saline by centrifugation for two minutes at 500 rpm. the larvae were kept at 4c in a solution including antibiotics penicillin - streptomycin (sigma, germany) and amphotericin b (fungizone / brstol - myers squibb, paris) to prevent bacteria and fungi growth. fifteen isolates of filamentous fungi including penicillium sp., a. flavus, cladosporium sp., trichoderma sp., f. equisetti, paecilomyces sp., a. niger, fusarium sp., acremonium sp., alternaria sp., derecselera sp., trichotecium sp. and the collected fungi were identified by a mycologist using special media and according to colony morphology characters and light microscope. the fungi were cultured on sabouraud dextrose agar (merck, germany) at room temperature for 3 days. the grown fungi were transferred on potato dextrose agar (pda) (merck, germany) for three days at room temperature. after grow of fungi on pda, 7 mm diameter mycelium culture discs were cut and transferred to plates containing 2% water - agar medium with 1% gentamycin (sigma, germany). the larvae were washed 10 times with normal saline to remove antibiotics. on the 4th day, 1 ml of larvae culture suspension containing 200 third stage nematode larvae from trichostrongylidae family l3 was separately added to the fungal cultures in 2% water - agar medium petri - dishes. every day the live larvae were counted by light microscope (10x) and the number of captured larvae the control groups were use in each isolated fungi to compare data with the test groups. the data were analyzed by chi - square test (= 5% confidence index) and descriptive analysis by spss software version 16 (spss, inc, chicago, il, usa). the table 1 shows the results of 15 isolates from 13 different tested fungi in this study. these results indicated the highest level of efficiency among the isolates after seven days co - culture of nematodes larvae and fungi., trichothecium sp. and curvularia sp. had no significant effect on the reduction of live larvae population, compared with the control group, after seven days incubation (p > 0.05)., a. flavus, paecilomyces sp., a. niger, acremonium sp., alternaria sp. and fusarium sp. the killed larvae were introduced by being immobilized, elongation and appearance of several vacouele in body and cuticule of the larvae. controlling nematodes in agriculture, livestock industries and human community is an important program in many countries. currently, chemical agents and anti - nematode drugs are utilized to control and treat nematode diseases. the resistance of nematodes against anti - nematode drugs has increased since many years ago. it seems that chemical control is not completely effective for this purpose. in recent years, biologic control of nematodes is dramatically considered by many investigators (14 - 16). the current study results demonstrated that some saprophytic fungi spread in the environment can be effective in reducing the number of third stage larvae of trichostrongylidae family. these results indicated great potential of using appropriate saprophyte fungi for biological control of trichostrongylidae family larvae in sheep. two factors including adaptability to the environment and ability to produce extracellular enzymes which contribute in the process of infection are the major characteristics of selecting potentially suitable fungus to be employed as an agent for biocontrol (18, 19). in the current research, three fungi derecselera, trichothecium, curvularia species did not show nematophagous activity against trichostrongylidae family larvae in sheep. to employ fungi isolates as biological control, the in vitro efficacy of predacious fungal isolates on parasitic nematodes of cattle, cooperia punctata and haemonchus placei has been indicated by a previous study (20). in addition, the in vivo biological control of parasites is shown in bovine by nematode - trapping fungi (21). other researchers reported the capability of a. robusta isolates in the biological control of nematode parasites in bovine gastrointestinal. it seems that d. flagrans has nematocidal activity ; hence, it is used to control ostertagia sp., cooperia sp. this fungus consists of one to three cells covered with adhesive material. in spite of the kind of trap, the entrapped nematode ineffectively struggle for relieve themselves (25). free - living nematodes of panagrellus sp. are used in many laboratories across the world. this nematode is used as bait for the isolation and predation experiments of nematophagous fungi. in trapping tests by gomes.. showed high susceptibility to predation by the entire genus monacrosporium isolates (26). also, duddingtonia flagrans can be as potential tool for biological controlling of nematodes by nematode - destroying ability. the fungus creates sticky traps and seizes developing larval stages of parasitic nematodes in the feces of animals (27). after feeding the grazing sheep with the spores of d. flagrans, biological control has become an important tool in maintaining an appropriate system of sheep products. regarding the time of infection, the fungus has various effects including decrease in the population of mature females, fecundity, and eggs parasitism (23). in conclusion, the studied fungal isolates could be applied as a suitable alternative to resolve the problems related to nematode infection. compared with the chemical compounds, biological control agents need longer time and have lower ability to rapidly control of the nematodes infection. in addition, more in vivo surveys are required to choose isolates which affect nematodes larvae in the environment. | background : biological control of parasitic nematodes by microorganisms is a promising approach to control such parasites. microorganisms such as fungi, viruses and bacteria are recognized as biocontrol agents of nematodes.objectives:the current study mainly aimed to evaluate the in vitro potential of various saprophyte soil - fungi in reducing the infective larvae stage of parasitic nematode trichostrongylidae family.materials and methods : sheep feces were employed to provide the required third stage larvae source for the experiments. the nematode infective larvae of trichostrongylidae family including three species of ostertagia circumcincta, marshalgia marshali and heamonchos contortus were collected by berman apparatus. fifteen isolates of filamentous fungi were tested in the current study. one milliliter suspension containing 200 third stage larvae of trichostrongylidae family was separately added to the fungal cultures in 2% water - agar medium petri - dishes. every day the live larvae were counted with light microscope (10x) and the number of captured larvae was recorded on different days.results:significant differences were observed in the results of co - culture of nematodes larva and fungi after seven days. the most effective fungi against the nematodes larvae were cladosporium sp., trichoderma sp., fusarium equisetti, after seven days of incubation.conclusions:the studies on fungi could be applied as suitable tools in biocontrol of nematode infections. however, additional surveys are required to select efficient with the ability to reduce the nematode larvae in the environment. |
all videos were viewed and included in subsequent analyses if tcg was discussed or shown. most of the search terms used in the current study were obtained from the orlando sentinel and additional terms commonly used in tcg research, including the following : the choking game ; space cowboy ; space monkey ; funky chicken ; pass - out game ; american dream ; blackout ; tingling ; breath play ; choke - out ; dream game ; fainting game ; suffocation ; roulette ; flatliner ; california high ; airplaning ; gasp ; faint challenge ; faint game ; knockout challenge ; choking game instructions ; pass - out ; pass - out challenge ; and knockout game. each term was searched on march 13, 2015, using the standard search parameters for youtube. up to the first 100 videos for each term were recorded (2058 in total) and then analyzed between march 26 and april 8, 2015. at the time of this analysis, some video links were no longer valid, leaving 1857 videos. the remaining videos were then sorted into those relevant to tcg (419) and irrelevant to the choking game (1438). a data collection form was used to record information about each video, such as number of views, upload date, whether the video was related to tcg, number of thumbs up ratings, number of thumbs down ratings, and the number of comments. additionally, a number of qualitative aspects of tcg videos were coded to 100% agreement by 3 research assistants. videos were coded as for prevention purposes if there was any mention of reasons for not engaging in tcg or if they encouraged people to resist participating in tcg. gender was coded when unambiguous ; if there was any uncertainty, gender was coded as other gender codes for participants, spectators, or assistants included female, male, or mixed when multiple people of either gender were present. seizures were endorsed if the choking game participant began to visibly convulse, shake, or twitch after passing out. the presence of other injury was coded if the participant hit their head on losing consciousness. the number of observers were coded based on who could be seen on the video or if it was clear there was a person holding the camera (eg, the image was mobile or someone was talking who was out of sight). additionally, videos were coded based on whether someone was actually participating in tcg and, if so, what techniques were shown in the video (sudden standing, use of a ligature, pressure on the neck, pressure on the chest, use of the sleeper hold, hyperventilation, and breath - holding). coding of asphyxiation techniques was based on the techniques identified by a recent qualitative review of self - asphyxial behaviors. on occasion, multiple techniques were used in the video and in these cases all techniques observed were coded. a one - way anova was used to compare the number of views, ratings, and comments between tcg - related and other videos. chi - square tests were used to identify significant differences in the frequency of individual techniques, gender of participants, spectators, and assistants, as well as the occurrence of physical injuries. furthermore, gender differences based on tcg context and techniques used for asphyxiation were analyzed in a final set of analyses. an a priori power analysis for a sample size of 500 videos, a moderate effect size (f =.30), and =.05 identified the power as 0.98, which was adequate for the current analyses. all videos were viewed and included in subsequent analyses if tcg was discussed or shown. most of the search terms used in the current study were obtained from the orlando sentinel and additional terms commonly used in tcg research, including the following : the choking game ; space cowboy ; space monkey ; funky chicken ; pass - out game ; american dream ; blackout ; tingling ; breath play ; choke - out ; dream game ; fainting game ; suffocation ; roulette ; flatliner ; california high ; airplaning ; gasp ; faint challenge ; faint game ; knockout challenge ; choking game instructions ; pass - out ; pass - out challenge ; and knockout game. each term was searched on march 13, 2015, using the standard search parameters for youtube. up to the first 100 videos for each term were recorded (2058 in total) and then analyzed between march 26 and april 8, 2015. at the time of this analysis, some video links were no longer valid, leaving 1857 videos. the remaining videos were then sorted into those relevant to tcg (419) and irrelevant to the choking game (1438). a data collection form was used to record information about each video, such as number of views, upload date, whether the video was related to tcg, number of thumbs up ratings, number of thumbs down ratings, and the number of comments. additionally, a number of qualitative aspects of tcg videos were coded to 100% agreement by 3 research assistants. videos were coded as for prevention purposes if there was any mention of reasons for not engaging in tcg or if they encouraged people to resist participating in tcg. gender was coded when unambiguous ; if there was any uncertainty, gender was coded as unclear. other gender codes for participants, spectators, or assistants included female, male, or mixed when multiple people of either gender were present. seizures were endorsed if the choking game participant began to visibly convulse, shake, or twitch after passing out. the presence of other injury was coded if the participant hit their head on losing consciousness. the number of observers were coded based on who could be seen on the video or if it was clear there was a person holding the camera (eg, the image was mobile or someone was talking who was out of sight). additionally, videos were coded based on whether someone was actually participating in tcg and, if so, what techniques were shown in the video (sudden standing, use of a ligature, pressure on the neck, pressure on the chest, use of the sleeper hold, hyperventilation, and breath - holding). coding of asphyxiation techniques was based on the techniques identified by a recent qualitative review of self - asphyxial behaviors. on occasion, multiple techniques were used in the video and in these cases all techniques observed were coded. a one - way anova was used to compare the number of views, ratings, and comments between tcg - related and other videos. chi - square tests were used to identify significant differences in the frequency of individual techniques, gender of participants, spectators, and assistants, as well as the occurrence of physical injuries. furthermore, gender differences based on tcg context and techniques used for asphyxiation were analyzed in a final set of analyses. an a priori power analysis for a sample size of 500 videos, a moderate effect size (f =.30), and =.05 identified the power as 0.98, which was adequate for the current analyses. using the full list of terms identified by the popular press, as well as several additional terms commonly used in academic work, 419 choking game related videos were identified and characterized. see table 1 for full anova results comparing tcg videos to non - tcg videos. when compared to videos that did not depict tcg tcg videos were also less likely to be commented on, f(1, 1855) = 5.138, p =.024. no significant difference was found between tcg and unrelated videos with regard to the mean number of views or anovas comparing the chocking game (tcg) videos to unrelated videos and prevention - oriented videos. of the videos related to tcg, only 25% appeared to be intended to prevent future participation. see table 1 for full results of an anova comparing prevention - oriented to nonprevention - oriented videos. notably, prevention videos had a higher mean number of views relative to nonprevention videos, f(1, 405) = 33.99, p <.001. prevention videos did, however, receive more thumbs down ratings than nonprevention videos, f(1, 405) = 14.07, p <.001. prevention videos on average also had more comments than nonprevention tcg videos, f(1, 405) = 5.995, p =.003. no significant difference was found between the number of thumbs up ratings of nonprevention videos compared to prevention videos (see table 1). such results indicate that, while prevention - oriented tcg videos are viewed more often, they are not reviewed as positively as noncautionary tcg videos. largely, the videos were filmed by groups of adolescents in private locations, depicting tcg as a group recreational activity. nearly 80% of the videos, including those intended to be cautionary, included footage of adolescents participating in tcg. the most common asphyxiation techniques shown included moving quickly from a seated or pronate position to standing in combination with hyperventilation and breath holding. nearly half of the participants shown in the videos whose gender could be clearly identified were male (57%) compared to 34% female. additionally, 62% of those assisting with inducing asphyxiation whose gender could be clearly identified were male. the gender of spectators was more diverse, with 29% being exclusively male groups, 14% exclusively female, and 12% mixed gender. of note, males were significantly more likely to use a sleeper hold than females (= 14.72, p =.005). just over half of the videos showed tcg participants in a private location (ie, a private residence). one fourth of the videos did, however, show tcg occurring in a public location, such as school property or public sidewalks (table 2). a minority of videos showed injury to the participants, including possible seizures demonstrated by convulsions. one third of the videos showed spectators making an attempt to catch the participant as they lost consciousness. several significant differences between prevention and nonprevention videos emerged on further analysis. specifically, prevention videos were significantly less likely to depict adolescents actually participating in tcg than nonprevention videos (= 195.61, p <.001). namely, prevention videos were less likely to show participants moving quickly from a seated or squatting position to standing (= 14.42, p <.001) or pressing on their chest (= 27.80, p <.001) and more likely to show hyperventilation (= 11.45, p =.002) and breath holding (= 7.05, p =.010). the representation of the gender of participants in prevention videos also did not represent the gender observed in nonprevention videos, with prevention videos showing significantly more females than nonprevention videos (= 62.02, p <.001). prevention videos also showed tcg occurring in a public location far more often than nonprevention videos (= 22.77, p <.001). overall, while prevention videos had a higher mean number of views, they were rated less positively than nonprevention tcg videos and showed tcg occurring in a significantly different social contexts. overall, 419 videos pertaining to tcg were found from over 1800 videos that were also identified using common tcg - related keywords. videos about tcg were less likely to be rated positively and less likely to be commented on than non - tcg videos. these prevention videos had a higher mean number of views, but also received more prevention videos also differed from other tcg videos in their portrayal of the social context of tcg as well as the methods of asphyxiation depicted. only one prior such study characterized the portrayal of tcg on youtube reviewing only a fraction of the amount of videos examined in the present study. specifically, based on the videos reviewed by linkletter and colleagues, the number of youtube videos available about tcg has increased by 400% in just 5 years. furthermore, choking game related videos were viewed over 22 million times, which is a stark increase from the 200 000 views reported by linkletter and colleagues. while this increase in availability and rate of viewing may seem alarming, it is consistent with the rapid growth of social media. to extend linkletter and colleagues work, this study reviewed videos that both depicted and discussed tcg, and subsequently coded the videos as either prevention - related or not. using this method, a quarter of the videos from this study these prevention videos were viewed more often than nonprevention videos, potentially suggesting significant public concern about tcg. prevention videos were also rated more unfavorably than nonprevention videos, as indicated by youtube s thumbs down feature. furthermore, the differences in prevention video methods and participant gender indicates that there is significant room for growth in future prevention efforts. notably, many of the prevention videos were home videos recorded using cell - phones and were overwhelmingly not professional or factual. it is currently understood that relatively few parents speak with their children about the risks of tcg, but parents who do speak with their children about tcg often report using third - party resources. this observation and the rate at which prevention videos were viewed supports previous claims that a reasonable starting point in tcg prevention may be producing higher quality and more accurate prevention videos that can be accessed through social media in addition to removing existing nonprevention videos. improved prevention interventions can be designed using the descriptive data from this study regarding those persons present, assisting, and participating. ideally, using these data will help tailor interventions to those adolescents most at risk of participation. based on the videos reviewed in the current study and consistent with a recent review when there were groups of spectators, these groups were more often all male than mixed - gender or all female, suggesting that prevention efforts should especially target adolescent male social groups. males were also more likely to induce asphyxiation using a chokehold, which linkletter and colleagues indicated was associated with a higher risk of serious neurological side effects. furthermore, most videos were filmed in private locations suggesting a possibility that prevention techniques aimed at informing parents or caregivers about tcg, and assisting in methods of increasing adolescent supervision, may be most effective in decreasing choking game participation. using existing videos as prevention materials may not be adequate, as many of these videos did not show any kind of injury occurring to the participants and thus may minimize the consequences of participation. the observed rate of injury is likely low given the estimated rates of serious neurological and other physical side effects associated with tcg. additionally, it is concerning that though most of the videos showed multiple persons present during asphyxiation, few videos showed any attempt at catching the participant as they lost consciousness. the apparent lack of safety precautions in the videos reviewed may be due to a lack of concern of the risks of tcg or it may be that adolescents found videos of participants falling more amusing and were more likely to post these online. as a descriptive study designed to highlight the availability and content of choking game related videos, this study only searched for videos using 25 known terms associated with tcg ; however, this list may not be inclusive of all possible common terms for tcg. furthermore, viewing only the first 100 entries of each youtube search could have eliminated a significant portion of the total overall choking game related videos available on the internet. additionally, limiting the videos viewed to those that appeared related to our keywords in an initial search may not represent the ways that adolescents identify tcg - related videos in natural circumstances. based on these limitations, the current study likely significantly underestimates the availability and accessibility of tcg content on youtube. despite this limitation, the nature of the videos coded in this study can provide insight into how people engage in the tcg in a naturalistic setting, such as location, gender of persons involved, and methods of asphyxiation, as well as how much the availability and viewing of this content has changed in the last five years. given the wealth of information gathered from youtube about how tcg occurs in a naturalistic setting, future research should move toward developing socially valid and empirically sound prevention materials for adolescents and their parents. it is clear that since the last methodical analysis of tcg youtube videos in 2010, the availability of tcg - related materials has increased markedly. while one quarter of tcg videos available are prevention - oriented, these videos do not reflect naturally occurring tcg nor are they particularly well received. given the significant health risks associated with participation in tcg, the drastic increase in choking game related videos on youtube within the last five years, and the variety of asphyxial methods in use, can be used to design socially valid and scientifically based prevention materials targeted toward those adolescents most at risk for participating in the choking game. | the choking game (tcg) is an adolescent activity in which asphyxiation is used to obtain a high, occasionally resulting in seizures or death. a plethora of tcg information is available through youtube, though this content has not been evaluated recently. the current study described tcg as portrayed in youtube videos and compared views and ratings of tcg videos to unrelated videos. the tcg videos demonstrated diverse methods of asphyxiation, with a minority showing injury to the participants. tcg videos were less likely to be commented on or rated positively than non choking game videos. tcg prevention videos differed significantly from actual tcg videos in the way they depicted the social context of tcg. thus, tcg videos are accessible through youtube, but the prevention materials available on youtube are not accurate or representative. accurate and educational online prevention materials should be created to decrease the occurrence of tcg. |
due to ageing populations and increased survival rates from myocardial infarction, heart failure (hf) is now at epidemic levels in high - income countries [1, 2 ]. as a result, the costs of caring for people with hf are very high and rising. over past decades, a primary strategy in reducing the personal and cost - related hf burden has been to promote the use of evidence - based medication prescribing [35 ]. however, over the last 5 years, there has been a growing recognition that to reduce the hf burden, it is vital to also address hf self - care [615 ] ; that is, the decisions and strategies undertaken by the individual in order to maintain life, healthy functioning and wellbeing. after being comparatively neglected for many years, self - care is now recognized as a effective hf self - care improves the performance of the heart, reduces the demands of the body on the heart, and promotes general wellbeing. evidence to support the importance of self - care in each of these areas has improved vastly over recent decades. there is now strong evidence from large randomized trials and cohort studies that mortality, morbidity, and symptoms can be improved in key self - care domains through consumption of key medications [17, 18 ], behavioural / lifestyle management (including smoking cessation, and salt, fluid and weight management) [1, 15, 19 ], timely use of health services, regular physical activity and good social relationships [1, 15 ]. self - care of hf is important because the vast majority of ongoing care is undertaken by the person with hf and their caregiver(s) in the home outside of the direct presence, supervision, or support of the health professional in a healthcare setting [9, 11 ]. recognition of the importance of self - care has been made in recent clinical guidelines [1, 15, 1922 ]. although recent research on self - care and its determinants has recognized a number of influential factors (including age, knowledge, coping skills, confidence, cognition), the influence of sex and gender on hf self - care is not well understood. to increase our understanding of the influence of sex and gender on hf self - care, we reviewed existing qualitative studies of self - care in hf patients. these studies specifically contained data on the influence of sex and gender on self - care practices. with the definition of hf self - care guiding the paper and the perception of hf self - care as a complex process, qualitative research studies were selected for inclusion. qualitative studies have been used extensively in health research to understand user approaches and behaviours. qualitative approaches do not presuppose the topics or factors that will be identified in a research study as influencing self - care. as such, qualitative methods are used to inform the understanding of complex phenomena prior to quantitative research. a qualitative systematic paper is used to synthesize findings from similar qualitative studies [25, 26 ]. sex was defined in the review as the classification of living things, generally as male or female according to their reproductive organs and functions assigned by the chromosomal complement. gender was defined as the, distinct and individual properties of men and women that are expressed through the values they hold, their psychosocial characteristics, and ultimately their behaviours gender also has interactive or contingent dimensions of social identity ; individual properties of masculinity or femininity are elicited from men and women in some social contexts, but not others [30, 31 ]. the search strategy involved general and specific terms in relation to hf. to be included in the review, studies had to include, adults over 18 years of age, be in english, men only, women only or mixed - sex studies that specifically explored the influence of gender or sex using qualitative or mixed (qualitative and quantitative) methods. the search included studies using different qualitative methodologies (including grounded theory, interpretive descriptive, and ethnography) and various techniques for data collection (including interviews and focus groups). studies that contained data for people with coronary heart disease were excluded because these populations have different self - care needs compared to hf patients. surveys were also excluded as these studies do not constitute qualitative research as conventionally defined. a search was done for studies published from 1995 to 2010 that were indexed in ovid medline, ovid medline, ovid embase, ovid psycinfo, csa sociological abstracts, ovid aarp ageline, ebsco academic search complete, ebsco cinahl, ebsco socindex, isi web of science : social sciences citation index and science citation index expanded and scopus. over 110 keywords were used around heart failure and self - care (e.g., heart, self - manage) and relevant research methods (e.g., semistructured, interview, narrative methods). quality of the studies meeting the inclusion criteria was independently assessed using the critical appraisal skills programme (casp) tool for qualitative research a valid tool for the assessment of quality in qualitative research. data extraction was undertaken by the primary author for each paper and checked by the second author. data were extracted on the focus of the study, the population (i.e., patients, family / caregivers, health professionals), sample (i.e., men only, women only, mixed), type of sampling (i.e., convenience, purposive, theoretical, other), number and age of the sample, sample setting (i.e., country) and the method / approach of the study (i.e., grounded theory, interpretive, mixed methods, ethnography, critical theory phenomenology, etc.) and data collection methods (i.e., face to face / telephone interviews). quality was assessed independently using the casp tool with disagreements resolved by consensus. this involved the primary author reading each study to identify, based on the team 's approach to self - care, the main self - care needs of patients / lay caregivers and links between different needs and age. these represent the main findings of each study as presented by the participants in the studies [33, 36 ]. the details of each study in terms of setting and quality were also extracted and taken into account at this stage. stage two (second - order coding) involved the researchers examining the relationships between concepts identified in the findings from the matrices. second - order interpretations of common or reoccurring concepts were sought and interpreted in the context of study quality and setting. for the third stage (synthesis), the main concepts identified during the second stage (second order interpretations) were used to reinterpret each paper and reconsider the relationships between the papers. after initial screening of 537 studies, 78 papers were retrieved, and reviewed in full. from these studies, six studies were identified that used qualitative methods containing or examined themes related to gender differences in hf patient 's perceptions and experiences (table 1). these studies recruited patients with a wide range of ages (35 to 95 years). sample sizes ranged from 4 to 32 with a total of 61 women and 31 men. phenomenographic approach [38, 39 ], two studies from the united states of america (usa) used a phenomenology approach [40, 41 ], and two studies (usa and australia) used all the included studies used semistructured interviews as a method of data collection, and recruited patients 18 years of age with nyha classifications of class ii or iii. the six qualitative studies varied in methodological quality (2 high quality, 1 medium quality, and 2 low quality papers). the qualitative studies chosen were systematically evaluated to comprehend the influence of gender on hf patients ' willingness and capacity for effective self - care. the stated foci of studies were illness experiences [3841 ] or barriers and facilitators of hf self - care [42, 43 ]. however, each used gender as a means to interpret data that resulted in similar categories / themes. these similarities not only identify relevant issues, they also support the value of each study and their findings. the data from all these studies, having been organized into various themes / categories, gave adequate illustration of the different aspects of the self - care experience of men and women with hf. the qualitative research objectives covered several aspects about living with hf, including : (1) new self concept, (2) physical limitations, (3) negative emotions / losses, (4) support / deepening relationships, (5) rejuvenate / rest, (6) hope, (7) uniqueness of gender. participants were recruited from outpatient clinics [38, 39 ] ; professional referrals, unspecified healthcare settings, and from a previously hospitalized sample of hf patients. the most overarching theme identified across the sexes in relation to hf was the overwhelming physical limitations experienced by men and women their loss of energy, high fatigue and shortness of breath / breathlessness affected all aspects of life, including occupation, social, and recreational roles [3843 ]. this occurred even when participants were not clear what was causing their symptoms, for example, some women reported difficulty in differentiating hf symptoms from their wider emotions. reductions in physical activity in the form of sitting or sleeping were used to prevent and/or alleviate symptoms in all the studies. taking time to try and complete the activities of daily living, while accepting the fact they may not complete the task was common across sexes [3843 ]. life after a diagnosis of hf, compared to past functioning, and social roles, was seen in negative terms by both sexes. however, women viewed themselves in a range of more negative ways, including : being handicapped, sick, burdensome or worthless [39, 41, 42 ]. fears of death, isolation, of being a burden, and struggles with depression and unhappiness over their physical limitations were common across the sexes [3942 ]. however, again women experienced more negative feelings of anger and hate towards their hf [40, 41 ] and reported greater loss of hope [41, 43 ]. the women worried over a lack of money, not being able to care for others or of being dependent on others [39, 40, 42 ]. some women increased coping by consciously refocusing their mental energy in ways more productive for dealing with their hf or placed great hope in maintaining their present level of functioning [39, 42 ]. conversely, men reported a wider range of positive and negative emotions compared to women. age appeared to moderate men 's emotions with younger men being more negative about hf and the negative effects on life. while women saw supportive relationships as being based on having someone to talk to [3943 ], women in all the studies frequently reported that they did not have another close person they could rely on to even help with activities of daily living [39, 40, 42, 43 ]. conversely, men reported having more tangible support with family members being involved in supporting their hf self - care [38, 43 ]. with the assistance of family, men had more confidence in interpreting symptoms of hf and self - care [38, 43 ]. this paper identified that though hf has severe effects on the physical and psychosocial wellbeing of both sexes, women frequently experience more negative emotions in relation to the hf, tend to have lower confidence, poorer social and family support, and see the future as more bleak. age and culture did appear to influence the experiences and reactions to hf in conjunction with gender and sex. these patterns in women are a cause for concern because achieving effective hf self - care is difficult for both sexes. this process is complex as it requires a range of activities, skills, confidence and sustained efforts. as hf is associated with older age, women comprise more than half of the already large population with hf [44, 45 ]. achieving optimal conditions for effective self - care in the large female hf population is therefore of high clinical significance. though people with hf tend to be at risk for poor psychosocial health with 40% having depression or depressive symptoms, women are particularly vulnerable to adverse psychosocial health and support. this may be because women with hf tend to have more symptoms than men [47, 48 ]. however, it may also be related to the lower psychosocial and family support identified in the studies in this review or to a reluctance of men to voice being isolated or fearful. that said, there is wider evidence from observational studies that psychosocial factors are more adverse in women with hf and that these psychosocial factors not only affect wellbeing but also hf self - care [4951 ]. the large size and distinctive self - care needs of the population of women with hf suggest that more gender - sensitive approaches are needed for care and disease management. while supporting self - care is now recognized to be a vital part of effective disease management, there is as yet little appreciation or acknowledgement in clinical guidelines that women have distinct or greater needs for psychosocial support than men with hf. this paper and other evidence [4951 ] indicate that women need additional support around psychosocial factors and self - care that is sensitive to elements of gender and sex. health professionals providing care to people with hf during the self - care management phase should be aware of the vulnerability that women can experience around psychosocial health and support. where possible, families, partners and other lay caregivers should be mobilized to provide effective support to the women with hf not only around self - care but also in relation to more general psychosocial wellbeing. in addition to increasing psychosocial support, antidepressant medications should be considered for women who are suitable candidates. as with most systematic reviews, this review was confined to studies that had been published. while there is a sizable body of qualitative research into hf, relatively few studies included or incorporated gender into analyses. the data in the studies contain only preliminary insights into how gender influences hf patients ' willingness and capacity for effective self - care. further research is needed into understanding the nature and influences on psychosocial factors in women with hf. the effects of contextual factors such as being married, widowed, ethnicity, living alone, years of hf experience, education, income and age on women need further exploration., women with hf tend to have considerably more negative views of the future, themselves and their ability to fulfill social self - care roles. women also report having less support for psychosocial wellbeing and self - care. as a highly vulnerable population, women need more and better support from health professionals, families and caregivers for psychosocial wellbeing and self - care. | to improve patient support, it is important to understand how people view and experience heart failure (hf) self - care. this systematic review of qualitative studies included all published studies that examine the influence of sex and gender on hf self - care. a systematic search was done for papers (19952010) indexed in ovid medline, ovid medline, ovid embase, ovid psycinfo, csa sociological abstracts, ovid aarp ageline, ebsco academic search complete, ebsco cinahl, ebsco socindex, isi web of science : social sciences citation index and science citation index expanded, and scopus. after screening of 537 citations, six qualitative studies identified that differences existed in perceptions of symptoms with women having less family involvement and psychosocial support around self - care. moreover, women had considerably more negative views of the future, themselves and their ability to fulfill social self - care roles. women with hf represent a highly vulnerable population and need more support for psychosocial wellbeing and self - care. |
all tissues were obtained from north carolina eye bank donors without a clinical history of glaucoma or glaucoma - associated conditions, elevated iop, or the use of glaucoma medications or steroids. the ocular tissues were dissected out by the surgeon (rra) and immersed in rnalater (ambion, waltham, ma, usa), to preserve the rna at 4c overnight, and then stored at 80c until rna extraction. total rna was extracted using the mirvana mirna isolation kit from thermofisher scientific, inc. the quantity of rna yield was determined with nanodrop from thermofisher scientific, inc., and the quality was assessed using the rna 6000 nano kit with bioanalyzer 2100 from agilent technologies (santa clara, ca, usa). a total of 21 samples was used in this study, including 7 cb, 7 cornea, and 7 tm samples. the truseq small rna sample prep kit from illumina (san diego, ca, usa) was used to generate the small rna sequencing library, as previously described. briefly, 1 g total rna was ligated using the manufacturer - supplied rna 3 and rna 5 adapters. to produce cdna constructs, the ligated small rna was subjected to rt - pcr with a sample - specific index sequence followed by gel purification. amplified mirnas were enriched and validated with the agilent (santa clara, ca, usa) bioanalyzer 2100 using high - sensitivity dna chips. using a miseq reagent kit v2 with 50 cycles (illumina, inc., san diego, ca, usa), the validated small rna sequencing libraries were normalized, denatured, and loaded to the illumina miseq sequencer. sequencing data were trimmed to remove adapter sequences and aligned against human reference database using bowtie software (http://bowtie-bio.sourceforge.net/index.shtml ; in the public domain). only exact matches to known mature mirna sequences in mirbase were counted. the original sequencing data, as well as the normalized data, have been deposited into the ncbi gene expression omnibus and are accessible through geo series accession number gse81254 (http://www.ncbi.nlm.nih.gov/geo/ ; in the public domain). although no standard method for normalizing mirna - seq data exists, we chose to normalize our data using the trimmed mean of m (tmm) method because of its high performance with spiked mirna samples. comparing tmm normalization with normalizing with the counts - per - million technique and the raw data, the tmm method produced the lowest variation between the biological replicates in our data set. all analysis was done using microsoft excel 2013 (microsoft corp., seattle, wa, usa) and the r language and environment for statistical computing (https://www.r-project.org/ ; in the public domain). the edger package in r was used to normalize the data, trimming the data using an m value of 30% and an a value of 5%. only mirnas with a mean number of normalized reads greater than 1 and with expression in 3 or more samples of each tissue type were included in the analysis. to identify mirnas shared between or uniquely expressed in the various tissues, the resulting mean number of normalized reads per mirna was compared based on relative expression levels within the cb, cornea, and tm. for the mirnas uniquely expressed, we compared experimentally validated gene targets in mirtarbase, an online database containing experimentally validated mirna targets and the corresponding experimental documentation. gene targets experimentally validated using reporter assays, western blot, qpcr, microarrays, or psilac (pulsed stable isotope labeling by / with amino acids in cell culture) were classified as high - confidence experimentally validated targets. the classification of low - confidence targets included targets experimentally validated using next generation sequencing techniques. we also used mirtarbase to analyze mirnas that possibly target genes associated with glaucoma and keratoconus. heat maps were created using the r language and environment for statistical computing. the color palette used in the heat maps was made with the heatplus package (http://bioconductor.org/packages/release/bioc/html/heatplus.html ; in the public domain), and the gplots package (http://ggplot2.org/ ; in the public domain) was used to create the heat maps. to validate the mirna expression data obtained from sequencing, we measured the expression of five mirnas (mir-141 - 3p, mir-184, mir-186 - 5p, mir-200b-3p, and mir-429) in 11 of the human ocular samples from the three different tissues (4 cb, 4 cornea, and 3 tm samples) using ddpcr. these mirnas were chosen for validation based on their relative expression patterns and potential relevance to tissue function or disease, representing mirnas uniquely expressed (mir-141 - 3p, mir-200b-3p, and mir-429), mirnas with approximately equivalent expression (mir-186 - 5p), and mirnas highly expressed (mir-184). the ddpcr assays were performed using the qx200 ddpcr system from bio - rad (hercules, ca, usa) as described previously. to perform the ddpcr, rna from each sample was reverse transcribed to cdna using taqman microrna reverse transcriptase kit from applied biosystems (grand island, ny, usa) according to the manufacturer 's instructions. the generated cdna samples were further diluted 5-fold using ultrapure dnase and rnase free water, and 2 l diluted cdna was used for each ddpcr reaction. taqman mirna assays (cat # 4427975) from applied biosystems were used to validate the expressions. the reaction mix was prepared using qx200 ddpcr supermix for probes (no dutp) from bio - rad, and a bio - rad qx200 droplet generator was used to partition each pcr reaction into up to 20,000 nano - sized droplets. the amplified pcr products were quantified using bio - rad qx200 droplet reader and analyzed by its associated quantasoft software. for quality control, all samples were run in duplicate, and negative controls containing water instead of cdna were included to ensure no contamination in all reagents. all tissues were obtained from north carolina eye bank donors without a clinical history of glaucoma or glaucoma - associated conditions, elevated iop, or the use of glaucoma medications or steroids. the ocular tissues were dissected out by the surgeon (rra) and immersed in rnalater (ambion, waltham, ma, usa), to preserve the rna at 4c overnight, and then stored at 80c until rna extraction. total rna was extracted using the mirvana mirna isolation kit from thermofisher scientific, inc. the quantity of rna yield was determined with nanodrop from thermofisher scientific, inc., and the quality was assessed using the rna 6000 nano kit with bioanalyzer 2100 from agilent technologies (santa clara, ca, usa). a total of 21 samples was used in this study, including 7 cb, 7 cornea, and 7 tm samples. the truseq small rna sample prep kit from illumina (san diego, ca, usa) was used to generate the small rna sequencing library, as previously described. briefly, 1 g total rna was ligated using the manufacturer - supplied rna 3 and rna 5 adapters. to produce cdna constructs, the ligated small rna was subjected to rt - pcr with a sample - specific index sequence followed by gel purification. amplified mirnas were enriched and validated with the agilent (santa clara, ca, usa) bioanalyzer 2100 using high - sensitivity dna chips. using a miseq reagent kit v2 with 50 cycles (illumina, inc., san diego, ca, usa), the validated small rna sequencing libraries were normalized, denatured, and loaded to the illumina miseq sequencer. sequencing data were trimmed to remove adapter sequences and aligned against human reference database using bowtie software (http://bowtie-bio.sourceforge.net/index.shtml ; in the public domain). only exact matches to known mature mirna sequences in mirbase were counted. the original sequencing data, as well as the normalized data, have been deposited into the ncbi gene expression omnibus and are accessible through geo series accession number gse81254 (http://www.ncbi.nlm.nih.gov/geo/ ; in the public domain). although no standard method for normalizing mirna - seq data exists, we chose to normalize our data using the trimmed mean of m (tmm) method because of its high performance with spiked mirna samples. comparing tmm normalization with normalizing with the counts - per - million technique and the raw data, the tmm method produced the lowest variation between the biological replicates in our data set. all analysis was done using microsoft excel 2013 (microsoft corp., seattle, wa, usa) and the r language and environment for statistical computing (https://www.r-project.org/ ; in the public domain). the edger package in r was used to normalize the data, trimming the data using an m value of 30% and an a value of 5%. only mirnas with a mean number of normalized reads greater than 1 and with expression in 3 or more samples of each tissue type were included in the analysis. to identify mirnas shared between or uniquely expressed in the various tissues, the resulting mean number of normalized reads per mirna was compared based on relative expression levels within the cb, cornea, and tm. for the mirnas uniquely expressed, we compared experimentally validated gene targets in mirtarbase, an online database containing experimentally validated mirna targets and the corresponding experimental documentation. gene targets experimentally validated using reporter assays, western blot, qpcr, microarrays, or psilac (pulsed stable isotope labeling by / with amino acids in cell culture) were classified as high - confidence experimentally validated targets. the classification of low - confidence targets included targets experimentally validated using next generation sequencing techniques. we also used mirtarbase to analyze mirnas that possibly target genes associated with glaucoma and keratoconus. the color palette used in the heat maps was made with the heatplus package (http://bioconductor.org/packages/release/bioc/html/heatplus.html ; in the public domain), and the gplots package (http://ggplot2.org/ ; in the public domain) was used to create the heat maps. to validate the mirna expression data obtained from sequencing, we measured the expression of five mirnas (mir-141 - 3p, mir-184, mir-186 - 5p, mir-200b-3p, and mir-429) in 11 of the human ocular samples from the three different tissues (4 cb, 4 cornea, and 3 tm samples) using ddpcr. these mirnas were chosen for validation based on their relative expression patterns and potential relevance to tissue function or disease, representing mirnas uniquely expressed (mir-141 - 3p, mir-200b-3p, and mir-429), mirnas with approximately equivalent expression (mir-186 - 5p), and mirnas highly expressed (mir-184). the ddpcr assays were performed using the qx200 ddpcr system from bio - rad (hercules, ca, usa) as described previously. to perform the ddpcr, rna from each sample was reverse transcribed to cdna using taqman microrna reverse transcriptase kit from applied biosystems (grand island, ny, usa) according to the manufacturer 's instructions. the generated cdna samples were further diluted 5-fold using ultrapure dnase and rnase free water, and 2 l diluted cdna was used for each ddpcr reaction. taqman mirna assays (cat # 4427975) from applied biosystems were used to validate the expressions. the reaction mix was prepared using qx200 ddpcr supermix for probes (no dutp) from bio - rad, and a bio - rad qx200 droplet generator was used to partition each pcr reaction into up to 20,000 nano - sized droplets. the amplified pcr products were quantified using bio - rad qx200 droplet reader and analyzed by its associated quantasoft software. for quality control, all samples were run in duplicate, and negative controls containing water instead of cdna were included to ensure no contamination in all reagents. to determine the expression of mirnas in nondiseased human eye tissues, we studied human tissue samples of cb, cornea, and tm from 14 donor eyes, using seven samples of each tissue type. the phenotypes for these tissue samples are supplied in table 1, with samples from the same patient denoted with similar superscripts. clinical phenotypes of human donors in this study using mirna - seq, the average sequence reads for the cb, cornea, and tm samples were 540202, 531607, and 447289, with an sd of 94213, 86239, and 232677, respectively. after normalization a complete list of these mirnas with their normalized number of sequencing reads per each tissue sample can be found in supplementary table s1. the most abundant mirnas found from the collective tissue were mir-143 - 3p, mir-184, mir-26a-5p, and mir-204 - 5p. these mirnas were the only ones from the collective tissue to express an average of 10,000 normalized reads or more, comprising 54% of the average total number of normalized reads in the combined tissues. figure 1 depicts these mirnas as well as the other seven most abundant mirnas, all of which were found to be expressed with more than 3000 mean number of normalized reads in the collective tissues and constitute 80% of the total number of normalized reads. as shown in figure 2, the expression between the different tissues was approximately equivalent, with the exception of mir-143 - 3p and mir-184. within the individual tissue types, the most abundant mirnas were mir-204 - 5p, mir-184, and mir-143 - 3p for the cb, cornea, and tm, respectively. expression of the top 11 most abundant mirnas in all human ocular tissues. using the mean value of the normalized number of reads for all samples, we were able to determine which mirnas were most abundantly expressed in our combined ocular tissue samples. included in this figure are only the mirnas with more than 3000 mean number of normalized reads in the collective tissues. distribution of top 11 most abundant mirnas across all human ocular tissues. within the specific tissues, the expression was relatively consistent in the top 11 most abundant mirnas, with an exception of mir-143 - 3p and mir-184. the mirna expressions in this figure are represented as the mean log10 of the normalized number of reads, with the error bars signifying the sem. overall, the cb expressed 320 mirnas, the cornea 297 mirnas, and the tm 310 mirnas. the relative expression of these mirnas across the different tissues is illustrated as a heat map in supplementary figure s1. we further compared the ocular mirna expression within and across the different tissue types using a venn diagram (fig. 3). this venn diagram indicates how many mirnas were expressed only in the specific tissues types, showing that although 243 mirnas were found in all of the tissues studied, 36% of the mirnas were observed in only one or two of the tissue types. venn diagram of expressed mirnas in postmortem human cb, cornea, and tm. to examine the mirna content of the specific tissue types, the numbers in the figure indicate how many mirnas were expressed only by the tissues indicated by the circles. for the mirnas found in only one or two of the tissues, most expressed fewer than 10 mean normalized reads, with an exception of 11 mirnas. these 11 mirnas were uniquely expressed in either the cb only, the cb and tm only, or the cornea and tm only. a number of other mirnas exhibited significantly higher expression in one or two of the tissue types, although they were present in all the tissues. the relative expressions of these uniquely expressed mirnas are depicted in the heat map of figure 4. this heat map has been clustered to group mirnas with similar expression patterns between the various tissues. heat map of the expression of mirnas uniquely expressed in one or two of the specific ocular tissues. the expression of these mirnas is illustrated in this heat map as the mean normalized number of reads, with green representing a relatively low number of reads and red as a relatively high number of reads. of the 34 uniquely expressed mirnas, 18 of them were highly expressed in the cornea and tm with no or low expression in the cb. because of the possible tissue specificity of these mirnas, we used mirtarbase to analyze their gene targets. using the targets that we classified as having been experimentally validated with high confidence, we found that 28 gene targets were shared between 11 of the 18 mirnas. of the remaining seven mirnas, four had no high confidence targets, and three shared no gene targets with the other uniquely expressed mirnas. of the 28 shared gene targets, 10 of them are regulated primarily by our uniquely expressed mirnas : bap1 (100%), dlx4 (100%), il24 (100%), inppl1 (100%), rere (100%), sip1 (100%), wasf3 (75%), zeb1 (88%), zeb2 (88%), and zfpm2 (100%). of the uniquely expressed mirnas, mir-141 - 3p, mir-200a-3p, mir-200b-3p, mir-200c-3p, and mir-429 appear to be the most similar with respect to shared gene targets, sharing 47%, 77%, 80%, 50%, and 88% of their gene targets, respectively, with the other uniquely expressed mirnas. overall, 12 high - confidence gene targets are shared between at least 2 of these 5 mirnas (table 2), and of all validated gene targets in mirtarbase, they have 220 shared gene targets. of the 12 high - confidence gene targets, these five mirnas all target 3 genes : zeb1, zeb2, and zfpm2. uniquely expressed mirnas in the cornea and tm and their validated gene targets using mirtarbase, we analyzed mirnas known to target genes associated with two relevant ocular diseases : glaucoma and keratoconus. for genes associated with glaucoma, we studied the mirnas that possibly target abca1, adamts10, afap1, arhgef12, asb10, atoh7, atxn2, c12orf23, cav1, cav2, cdkn2b - as1, cyp1b1, fndc3b, foxc1, galc, gas7, gmds, lrp12, myoc, optn, pmm2, six6, srbd1, tbk1, tgfbr3, wdr36, and zfpm2. we also analyzed the mirnas predicted to target dock9, fndc3b, foxo1, and rab3gap1, which are all associated with keratoconus. all the mirnas that target these disease - associated genes and their relative expression are illustrated in figure 5 and supplementary table s2. only 8 of the 29 glaucoma - associated genes and 2 of the 4 keratoconus - associated genes have mirna target interactions experimentally validated with high confidence, so we included targets with both high and low confidence in our profile. of the 58 mirnas found to target genes associated with glaucoma, 17 mirnas had no or relatively low expression in all the tissue types, with relatively low expression being classified as less than or equal to 10 mean number of normalized reads. for keratoconus, 8 of the 27 mirnas had no or low expression in all the tissues. several of the mirna regulators for both the glaucoma- and keratoconus - associated genes were highly expressed, having greater than or equal to 1000 mean normalized reads, in at least one of the tissue types. for glaucoma, these mirnas include mir-143 - 3p, mir-204 - 5p, mir-26a-5p, mir-181 - 5p, mir-21 - 5p, mir-27b-3p, and mir-92a-3p, and for keratoconus, the highly expressed regulators are mir-143 - 3p, mir-182 - 5p, and mir-92a-3p. all of these highly expressed disease - associated mirnas are included in the top 18 most abundant mirnas in the collective ocular tissues. many of our mirnas were found to target genes associated with glaucoma (a) and keratoconus (b). the values in the heat map are expressed as the mean number of normalized reads, with green for a relatively low number of reads and red for a relatively high number of reads. in an attempt to validate the expression data produced from mirna - seq, we measured the expression of mir-141 - 3p, mir-184, mir-186 - 5p, mir-220b-3p, and mir-429 in 11 samples from the cb, cornea, and tm using ddpcr. expression measurements from these ddpcr assays indicate a similar expression pattern to that from sequencing, as seen in figure 6, although while sequencing showed no mir-141 - 3p, mir-200b-3p, and mir-429 present in the cb samples, low levels of these mirnas were detected with ddpcr. droplet digital pcr was performed to analyze the expression of mir-141 - 3p, mir-184, mir-186 - 5p, mir-200b-3p, and mir-429 in cb (n = 4), cornea (n = 4), and tm (n = 3) tissues. the relative expression patterns among the three tissues were compared with the expression obtained from mirna sequencing. in this figure, the ddpcr expression is depicted as the log10 concentration (copies/l), and sequencing data expressed as the mean log10 normalized number of reads. sequencing showed no expression of mir-141 - 3p, mir-200b-3p, and mir-429 in the cb, so bar graphs are not available for the cb for these tissues. previously only a few studies have profiled the mirna expression in normal cb and cornea tissues, with no published study, to our knowledge, analyzing the overall expression of mirnas in tm tissues. many of the mirnas from our ocular expression profiles had not been previously reported in these ocular tissues, with approximately 76% of the cb, 30% of the cornea, and 92% of the tm mirnas being unique to our study. a list of the previously reported mirnas that have been identified in our study and the corresponding sample and technique used is documented in supplementary table s3. to determine the expression of mirnas in nondiseased human eye tissues, we studied human tissue samples of cb, cornea, and tm from 14 donor eyes, using seven samples of each tissue type. the phenotypes for these tissue samples are supplied in table 1, with samples from the same patient denoted with similar superscripts. using mirna - seq, the average sequence reads for the cb, cornea, and tm samples were 540202, 531607, and 447289, with an sd of 94213, 86239, and 232677, respectively. a complete list of these mirnas with their normalized number of sequencing reads per each tissue sample can be found in supplementary table s1. the most abundant mirnas found from the collective tissue were mir-143 - 3p, mir-184, mir-26a-5p, and mir-204 - 5p. these mirnas were the only ones from the collective tissue to express an average of 10,000 normalized reads or more, comprising 54% of the average total number of normalized reads in the combined tissues. figure 1 depicts these mirnas as well as the other seven most abundant mirnas, all of which were found to be expressed with more than 3000 mean number of normalized reads in the collective tissues and constitute 80% of the total number of normalized reads. as shown in figure 2, the expression between the different tissues was approximately equivalent, with the exception of mir-143 - 3p and mir-184. within the individual tissue types, the most abundant mirnas were mir-204 - 5p, mir-184, and mir-143 - 3p for the cb, cornea, and tm, respectively. expression of the top 11 most abundant mirnas in all human ocular tissues. using the mean value of the normalized number of reads for all samples, we were able to determine which mirnas were most abundantly expressed in our combined ocular tissue samples. included in this figure are only the mirnas with more than 3000 mean number of normalized reads in the collective tissues. distribution of top 11 most abundant mirnas across all human ocular tissues. within the specific tissues, the expression was relatively consistent in the top 11 most abundant mirnas, with an exception of mir-143 - 3p and mir-184. the mirna expressions in this figure are represented as the mean log10 of the normalized number of reads, with the error bars signifying the sem. overall, the cb expressed 320 mirnas, the cornea 297 mirnas, and the tm 310 mirnas. the relative expression of these mirnas across the different tissues is illustrated as a heat map in supplementary figure s1. we further compared the ocular mirna expression within and across the different tissue types using a venn diagram (fig. 3). this venn diagram indicates how many mirnas were expressed only in the specific tissues types, showing that although 243 mirnas were found in all of the tissues studied, 36% of the mirnas were observed in only one or two of the tissue types. venn diagram of expressed mirnas in postmortem human cb, cornea, and tm. to examine the mirna content of the specific tissue types, the numbers in the figure indicate how many mirnas were expressed only by the tissues indicated by the circles. for the mirnas found in only one or two of the tissues, most expressed fewer than 10 mean normalized reads, with an exception of 11 mirnas. these 11 mirnas were uniquely expressed in either the cb only, the cb and tm only, or the cornea and tm only. a number of other mirnas exhibited significantly higher expression in one or two of the tissue types, although they were present in all the tissues. the relative expressions of these uniquely expressed mirnas are depicted in the heat map of figure 4. this heat map has been clustered to group mirnas with similar expression patterns between the various tissues. heat map of the expression of mirnas uniquely expressed in one or two of the specific ocular tissues. the expression of these mirnas is illustrated in this heat map as the mean normalized number of reads, with green representing a relatively low number of reads and red as a relatively high number of reads. the mirnas in the heat map are clustered based on the relative expression patterns. of the 34 uniquely expressed mirnas, 18 of them were highly expressed in the cornea and tm with no or low expression in the cb. because of the possible tissue specificity of these mirnas, we used mirtarbase to analyze their gene targets. using the targets that we classified as having been experimentally validated with high confidence, we found that 28 gene targets were shared between 11 of the 18 mirnas. of the remaining seven mirnas, four had no high confidence targets, and three shared no gene targets with the other uniquely expressed mirnas. of the 28 shared gene targets, 10 of them are regulated primarily by our uniquely expressed mirnas : bap1 (100%), dlx4 (100%), il24 (100%), inppl1 (100%), rere (100%), sip1 (100%), wasf3 (75%), zeb1 (88%), zeb2 (88%), and zfpm2 (100%). of the uniquely expressed mirnas, mir-141 - 3p, mir-200a-3p, mir-200b-3p, mir-200c-3p, and mir-429 appear to be the most similar with respect to shared gene targets, sharing 47%, 77%, 80%, 50%, and 88% of their gene targets, respectively, with the other uniquely expressed mirnas. overall, 12 high - confidence gene targets are shared between at least 2 of these 5 mirnas (table 2), and of all validated gene targets in mirtarbase, they have 220 shared gene targets. of the 12 high - confidence gene targets, these five mirnas all target 3 genes : zeb1, zeb2, and zfpm2. using mirtarbase, we analyzed mirnas known to target genes associated with two relevant ocular diseases : glaucoma and keratoconus. for genes associated with glaucoma, we studied the mirnas that possibly target abca1, adamts10, afap1, arhgef12, asb10, atoh7, atxn2, c12orf23, cav1, cav2, cdkn2b - as1, cyp1b1, fndc3b, foxc1, galc, gas7, gmds, lrp12, myoc, optn, pmm2, six6, srbd1, tbk1, tgfbr3, wdr36, and zfpm2. we also analyzed the mirnas predicted to target dock9, fndc3b, foxo1, and rab3gap1, which are all associated with keratoconus. all the mirnas that target these disease - associated genes and their relative expression are illustrated in figure 5 and supplementary table s2. only 8 of the 29 glaucoma - associated genes and 2 of the 4 keratoconus - associated genes have mirna target interactions experimentally validated with high confidence, so we included targets with both high and low confidence in our profile. of the 58 mirnas found to target genes associated with glaucoma, 17 mirnas had no or relatively low expression in all the tissue types, with relatively low expression being classified as less than or equal to 10 mean number of normalized reads. for keratoconus, 8 of the 27 mirnas had no or low expression in all the tissues. several of the mirna regulators for both the glaucoma- and keratoconus - associated genes were highly expressed, having greater than or equal to 1000 mean normalized reads, in at least one of the tissue types. for glaucoma, these mirnas include mir-143 - 3p, mir-204 - 5p, mir-26a-5p, mir-181 - 5p, mir-21 - 5p, mir-27b-3p, and mir-92a-3p, and for keratoconus, the highly expressed regulators are mir-143 - 3p, mir-182 - 5p, and mir-92a-3p. all of these highly expressed disease - associated mirnas are included in the top 18 most abundant mirnas in the collective ocular tissues. many of our mirnas were found to target genes associated with glaucoma (a) and keratoconus (b). the values in the heat map are expressed as the mean number of normalized reads, with green for a relatively low number of reads and red for a relatively high number of reads. in an attempt to validate the expression data produced from mirna - seq, we measured the expression of mir-141 - 3p, mir-184, mir-186 - 5p, mir-220b-3p, and mir-429 in 11 samples from the cb, cornea, and tm using ddpcr. expression measurements from these ddpcr assays indicate a similar expression pattern to that from sequencing, as seen in figure 6, although while sequencing showed no mir-141 - 3p, mir-200b-3p, and mir-429 present in the cb samples, low levels of these mirnas were detected with ddpcr. droplet digital pcr was performed to analyze the expression of mir-141 - 3p, mir-184, mir-186 - 5p, mir-200b-3p, and mir-429 in cb (n = 4), cornea (n = 4), and tm (n = 3) tissues. the relative expression patterns among the three tissues were compared with the expression obtained from mirna sequencing. in this figure, the ddpcr expression is depicted as the log10 concentration (copies/l), and sequencing data expressed as the mean log10 normalized number of reads. sequencing showed no expression of mir-141 - 3p, mir-200b-3p, and mir-429 in the cb, so bar graphs are not available for the cb for these tissues. previously only a few studies have profiled the mirna expression in normal cb and cornea tissues, with no published study, to our knowledge, analyzing the overall expression of mirnas in tm tissues. many of the mirnas from our ocular expression profiles had not been previously reported in these ocular tissues, with approximately 76% of the cb, 30% of the cornea, and 92% of the tm mirnas being unique to our study. a list of the previously reported mirnas that have been identified in our study and the corresponding sample and technique used is documented in supplementary table s3. for the first time, we have performed mirna profiling in nondiseased human cb, cornea, and tm using mirna - seq, followed by ddpcr validation. mirna - seq enabled us to identify all known mirnas with high accuracy and sensitivity while detecting highly similar mirnas with small sequence variations, which are difficult to discern using techniques that rely on hybridization. collectively we identified 378 individual mirnas : 320 in the cb, 297 in the cornea, and 310 in the tm. many of the mirnas were uniquely expressed in only one or two of the ocular tissues studied, and most of these unique mirnas were highly expressed in the cornea and tm with low or no expression in the cb. we also created an expression profile of mirnas that target genes associated with either keratoconus or glaucoma. to support the reliability of our findings, we successfully used ddpcr to validate the expression pattern of five mirnas in the cb, cornea, and tm. although the ocular tissues studied expressed a large number of mirnas, we found that only a few mirnas comprised most of the total mirnas present in a specific cell type. although 378 mirnas were found in the collective ocular tissues, only 11 highly expressed mirnas represented 80% of the total number of mean normalized reads. with an exception for mir-184, in which mutations in the seed region cause keratoconus with cataracts, none of these most abundant mirnas have been implicated for their role in function or disease in these tissues, to our knowledge. the large representation of these mirnas most likely indicates that they are important to the functions of these particular ocular tissues, especially because it has been found that only mirnas present in a sufficient concentration have an impact on regulation within the cell. of the mirnas expressed in only one or two tissues, only a few had an expression level greater than 10 mean normalized reads, many of which being highly expressed in the tm and cornea. the fact that the cornea and tm would share a large number of mirnas is understandable considering that a transitionary region has previously been proven to exist between the cornea and tm. using the online database mirtarbase, we analyzed the target genes that these uniquely expressed cornea and tm mirnas have been experimentally validated with high confidence to regulate. of these mirnas, five of them (mir-141 - 3p, mir-200a-3p, mir-200b-3p, mir-200c-3p, and mir-429) were found to commonly target a large set of genes, leading us to believe that these mirnas most likely act in a cooperative fashion. mir-200a, mir-200b, and mir-429 are all located on chromosome 1 and are known clustered mirnas, whereas mir-141 - 3p and mir-200c-3p are known clustered mirnas located on chromosome 12. to our knowledge, no previous studies have been conducted to determine the role of these mirnas in the cornea and tm function. because these five mirnas are the only ones known with high confidence to regulate zfpm2, a gene that resides in a chromosome locus (chr8q22) that has been previously associated with normal - tension glaucoma, the necessity of future study of these mirnas is evident. our expression analysis has also generated a number of mirna candidates that may be involved in glaucoma and keratoconus. using mirtarbase, we were able to determine the mirnas predicted to target these genes associated with glaucoma and keratoconus. because only a small number of glaucoma and keratoconus genes had highly validated mirna target interactions, we chose to include both targets verified with high and low confidence in our disease expression profile. the lack of mirna target interaction data for these genes could be attributed to many of them being primarily associated with ocular diseases, which are not as well studied as genes involved in diseases with higher prevalence, like cancer or diabetes. previous studies have shown, however, that mir-106b, mir-16, mir-26a, mir-27a, mir-27b, and mir-7 are upregulated in tm cells during mechanical stress and that mir-155, mir-200c, and mir-204 regulate contractibility in tm cells. both the effect of mechanical stress on and the contractibility of tm cells have been theorized to play a role in glaucoma, further emphasizing the potential involvement of these mirnas in these diseases. the expression profile in this study can be used to compare normal mirna expression with that of diseased tissue using low - cost targeted experimental approaches such as ddpcr and qrt - pcr. previous studies have shown that there are substantial differences between the outputs of different mirna profiling techniques, so validating expression data with a different technique is essential. although mirna - seq is beneficial in providing quality expression data with high specificity and reproducibility, qpcr and ddpcr have been shown to have better sensitivity, so we chose to validate our sequencing data using ddpcr. the benefit of selecting ddpcr over qrt - pcr is that ddpcr allows absolute quantification without the use of references, while also being more tolerant of sample quality and variations in pcr efficiency. to validate our mirna - seq data, we performed ddpcr with five different mirnas in cb, cornea, and tm tissues. we chose these specific mirnas because they represented mirnas uniquely expressed (mir-141 - 3p, mir-200b-3p, and mir-429), mirnas with approximately equivalent expression (mir-186 - 5p), and mirnas highly expressed (mir-184). the results from our validation confirmed the relative expression patterns we observed in our sequencing data. the differences in sensitivity between ddpcr and sequencing were emphasized, however, through our attempts at validation. although sequencing showed mir-141 - 3p, mir-200b-3p, and mir-429 to be absent in the cb samples, ddpcr indicated a low expression of these mirnas in the cb. second, our sequencing experiments were performed in two batches, which could explain some of the variation within specific tissue types, although normalizing should have minimized any batch effects. because all of our ocular samples were from nondiseased donors, future studies can be conducted to focus on a specific disease, such as glaucoma or keratoconus. in summary, we have profiled mirna expression in 21 nondiseased human cb, cornea, and tm samples using mirna - seq for the first time. through our expression profile, we have identified mirnas abundantly or uniquely expressed and created a list of mirnas that potentially target genes associated with glaucoma or keratoconus. this comparative analysis could potentially enhance our knowledge and understanding of these ocular tissues and related diseases. | purposebecause micrornas (mirnas) have been associated with eye diseases, our study aims to profile ocular mirna expression in normal human ciliary body (cb), cornea, and trabecular meshwork (tm) using mirna - seq to provide a foundation for better understanding of mirna function and disease involvement in these tissues.methodstotal rnas were extracted from seven normal human cb, seven cornea, and seven tm samples using mirvana total rna isolation kit. mirna - seq was done with illumina miseq. bowtie software was used to trim and align generated sequence reads, and only exact matches to mature mirnas from mirbase were included. the mirtarbase database was used to analyze mirna target interactions, and the expression of five selected mirnas was validated using droplet digital pcr (ddpcr).resultsusing the mirna extracted from 21 human samples, we found 378 mirnas collectively expressed, of which the 11 most abundant mirnas represented 80% of the total normalized reads. we also identified uniquely expressed mirnas, of which five share 18 highly validated gene targets, and created a profile of mirnas known to target genes associated with keratoconus and glaucoma. using ddpcr, we validated the expression profile of five mirnas from mirna-seq.conclusionsfor the first time, we profiled mirna expression in three human ocular tissues using mirna - seq, identifying many mirnas that had not been previously reported in ocular tissue. defining the relative expression of mirnas in nondiseased eye tissues could help uncover changes in mirna expression that accompany diseases such as glaucoma and keratoconus. |
pregnancy is a transient condition, but when it is complicated by preeclampsia it has lasting effects on both the mother and the child. this paper describes the short- and long - term consequences of preeclampsia to both the mother and the child, with an emphasis on the children 's vulnerability to vascular disease and cognitive impairment, and summarizes the potential pathophysiologic mechanisms at play. it also aims to expose the need to more easily identify individuals whose mothers were preeclamptic so that prevention measures can be instituted to avoid the vascular disease complications. the paper is the result of multiple literature searches through pubmed and other search engines spanning the period from 2000 to 2012. the articles referenced in this paper were selected because they contributed to understanding the broader picture emerging on the importance of preeclampsia as a long - term threat to the health of the mother and the child. the american college of obstetricians and gynecologists defines preeclampsia as hypertension with a systolic blood pressure of 140 mm / hg or higher or a diastolic blood pressure of 90 mm / hg or higher that occurs after 20 weeks of gestation in a woman with previously normal blood pressure. the hypertension must be combined with proteinuria, defined as urinary excretion of 0.3 g protein or higher in a 24 h urine collection. increasingly, however, it is appreciated that preeclampsia is a systemic disease that has both short- and - long term consequences to both mother and offspring. as well, there is concern that the incidence and prevalence of preeclampsia are rising in society with the increase in some of the known risk factors for this condition. the prevalence, however, appears to vary by location and by ethnic background. in a large study of almost a million women from new york city, the prevalence of preeclampsia was 3.2%. linking this event with ethnicity showed that east indian women had the lowest risk of preeclampsia (1.4%) and mexican women had the highest risk (5.0%). the eclaxir study in france showed that african origin was a risk factor for preeclampsia. women of advanced maternal age exhibit more preeclampsia than younger women. a registry - based study from finland showed that under the age of 35 the rate of preeclampsia was 6.4%, but in women older than 35 the rate climbed to 9.4%. this study additionally identified other associations with preeclampsia, such as a body mass index (bmi) of more than 25 and a higher incidence of maternal diabetes and chronic hypertension. this was confirmed by two recent studies, one that included 220 patients from saudi arabia and showed that patients with gestational diabetes mellitus had a significantly higher incidence of preeclampsia as well as preterm delivery and a study of 2,056 pregnancies from qatar which revealed that the incidence of preeclampsia was 7.3% in women with, and 3.8% in women without, gestational diabetes. in contrast, a large norwegian study that included more than 200 women giving birth from 1967 to 2008 showed that the rates of preeclampsia increased more over time among younger than older women. another study from usa showed that gestational hypertension, preeclampsia in a prior pregnancy, a bmi of more than 30, and african american race were all predictive of late postpartum preeclampsia, and a study from taiwan confirmed that elevated bmi increased the risks of gestational diabetes mellitus, preeclampsia, and preterm labour. in teenage deliveries, defined as mothers 18 years of age, 8.9% developed preeclampsia, and the strongest associations were with bmi of more than 40 and elevated gestational weight gain. thus, elevated bmi and gestational diabetes consistently appear as risk factors for preeclampsia in the mother. although preeclampsia is a transient phenomenon, there are both acute and long - term significant consequences to the mother affected by this condition. the condition is associated with significant mortality, and black women were 3.1 times more likely to die with this condition than white women. in mothers who survive, women who have had a pregnancy complicated by preeclampsia have an increased risk of antenatal stroke [13, 14 ]. this serious complication of pregnancy was associated with a previous history of migraine and gestational diabetes. some insight into the pathophysiology for increased stroke risk was derived from a study of 40 women with untreated preeclampsia who were compared to 40 matched healthy pregnant women. those with untreated preeclampsia demonstrated increased cardiac output and cardiac stroke volume as well as increased systemic vascular resistance, which led the authors to conclude that the hypertension associated with untreated preeclampsia is due to increased cardiac output and mild vasoconstriction with reduced diastolic function. khalil and colleagues, in a screening study, showed that women who develop preeclampsia had higher aortic systolic blood pressure and arterial stiffness, which are apparent from the first trimester of pregnancy. in addition, stroke risk is greater when the pregnancy is associated with acute microalbuminuria in the absence of preexisting kidney disease, and the association persists even after adjustment for established cardiovascular risk factors. a number of additional clinically relevant nonvascular consequences to the mother may be noted during the preeclampsia phase, confirming that preeclampsia is a syndrome with multiorgan impact. there is a deterioration of maternal renal function with the possibility of a rise in serum creatinine to more than 0.9 g / l, liver involvement with elevated liver enzymes, pulmonary edema (particularly in cases of severe preeclampsia), hematological disorders including thrombocytopenia, hemolysis and disseminated intravascular coagulation, neurological involvement with visual disturbances, severe headaches and hyperreflexia, and intrauterine growth restriction [19, 20 ]. as well, women with preeclampsia in the 3rd trimester showed significantly higher levels of serum procalcitonin, c - reactive protein (crp), and plasma d - dimer levels, and these hematological indices were significantly higher in patients with severe as compared to mild preeclampsia. the rate of very early preterm delivery (less than 32 weeks of pregnancy) was 21.2% in uncomplicated preeclampsia compared with 37.2% in preeclampsia complicated by prior chronic hypertension. a recent paper by smith and colleagues estimated the 10-year, 30-year, and lifetime cardiovascular disease (cvd) risk following a pregnancy complicated by preeclampsia by comparing cvd events in 118 control women and 99 preeclamptic women. a total of 18.2% of preeclamptic women and 1.7% of control women had a high 10-year risk (or 13.08 ; 95% confidence interval (cl) 3.38 to 85.5), 31.3% of preeclamptic women and 5.1% of control women had a high 30-year risk (or 8.43 ; 95% cl 3.48 to 23.23), and 41.4% of preeclamptic women and 17.8% of control women had a high lifetime risk for cvd (or 3.25 ; 95% cl 1.76 to 6.11). davis and colleagues state that women who have had a pregnancy complicated by preeclampsia have a 4-fold increased risk of later cardiovascular disease. when 73 formerly preeclamptic women were matched for age and time since pregnancy with control women, mri scans in the formerly preeclamptic women showed significantly more frequent and more severe white matter brain lesions. this increased cerebrovascular risk was measured 18 years after pregnancy in a prospective cohort study of more than 3,000 women. it showed that the calculated 10-year cerebrovascular disease risk in preeclampsia had an odds ratio of 1.31 (95% ci : 1.11, 1.53) compared to women without preeclampsia. the authors suggested that preeclampsia may be a better predictor of future cerebrovascular disease than other pregnancy - associated abnormalities. this is confirmed by a nationwide study from sweden which reviewed almost one million women. the study showed that the risk of maternal cerebrovascular disease increased with decreasing gestational age. the hazard ratio of cerebrovascular disease ranged from 1.39 (95% ci 1.221.53) to 2.57 (95% ci 1.973.34) for mothers with small - for - gestational age births. five- to 8-years postpartum, kvehaugen and colleagues in norway compared 26 mother and child pairs from pregnancies complicated by preeclampsia with pairs from uncomplicated pregnancies and showed that endothelial function was significantly reduced in both mothers and children after preeclampsia, especially when combined with small - for - gestational age infants. this included measurements of fms - like tyrosine kinase and crp which were elevated in the preeclampsia group compared with controls. crp has been correlated with vascular complications and is now accepted and used as a marker for vascular vulnerability. these studies show conclusively that mothers who were exposed to preeclamptic pregnancies have a higher incidence of cerebrovascular and cardiovascular disease. although there have been no studies on possible cognitive impairment in women who gave birth associated with preeclampsia, the increased cerebrovascular risk and the presence of white matter lesions on mri scans have been associated with this outcome in several other studies [31, 32 ]. a number of cardiovascular and other complications have been reported in children born to preeclamptic mothers. a systematic review and meta - analysis on studies reporting traditional cardiovascular risk factors in children exposed to preeclampsia compared to controls showed a 2.39 mm / hg (95% ci : 1.743.05 ; p < 0.0001) higher systolic and a 1.35 mm / hg higher diastolic blood pressure (95% ci : 0.901.80 ; p < 0.0001) during childhood and young adulthood. as well, the bmi of these children was significantly higher, but there was insufficient evidence to identify consistent variation in lipid profile or glucose metabolism. an australian study, on the other hand, showed that offspring of women who experienced hypertensive disorders of pregnancy had 3.46 mm / hg greater systolic blood pressure and 3.02 mm / hg greater diastolic blood pressure at age 21 years. in a large uk cohort, assessed at age 912 years after pregnancy, including maternal - offspring pairs, lawlor and colleagues reported that offspring of women with preeclampsia had higher systolic blood pressure by 2.04 mm / hg even when the analyses were adjusted for maternal and offspring bmi, sodium intake, and other potential confounders. although these blood pressure elevations appear modest, it is important to bear in mind that hypertension in children, regardless of etiology, can result in significant end - organ damage [35, 36 ]. knowing that hypertension increases the risk for stroke, it is perhaps not surprising that kajantie and colleagues have reported that preeclampsia is associated with increased risk of stroke in the adult offspring. the crude hazard ratio for all forms of stroke among individuals whose mothers had preeclampsia was 1.9 (1.2 to 3.0 ; p = 0.01), and among people whose mothers had gestational hypertension, it was 1.4 (1.0 to 1.8 : p = 0.03). fugelseth. reported that 45 children delivered from pregnancies complicated by preeclampsia had significantly smaller hearts, increased heart rate, and increased late diastolic velocity (a - wave, at mitral valve attachments), supporting the conclusion that the cardiovascular phenotype of offspring of preeclampsia mothers is altered. age - related change in cognitive ability in the offspring of mothers who were hypertensive during pregnancy was studied by a group in finland. they showed that men born after pregnancies complicated by hypertensive disorder scored 4.36 points lower on total cognitive ability at 68.5 years (95% ci, 1.177.55). they also displayed a greater decline in total cognitive ability. because this was a study of military forces, recently, a study from australia confirmed this association. verbal ability at age 10 years was assessed with the peabody picture vocabulary test - revised (ppvt - r) and nonverbal ability with raven 's coloured progressive matrices (cpm). offspring of pregnancies complicated by maternal hypertension or preeclampsia had a mean ppvt - r score that was 1.83 (p = 0.03) point slower than children from normotensive pregnancies, and there was no significant association between offspring gender and ppvt - r or cpm scores. the authors conclude that maternal hypertensive diseases of pregnancy are a risk factor for a small reduction in offspring verbal ability. another study by tuovinen and colleagues in finland showed that female offspring born to pregnancies complicated by hypertension without proteinuria were at 1.19-fold higher risk of mental disorders (ci : 1.011.41, p = 0.04) and similarly showed significant increases in the risk of mood and anxiety disorders (ci : 1.111.88, p < 0.01). in contrast, preeclampsia was associated with a lower risk of any mental disorder in the male offspring. the same group had reported earlier that primiparous pregnancies complicated by preeclampsia were associated with later depressive symptoms in the progeny, regardless of the children 's gender. ozkan and colleagues have reported that the incidence of bronchopulmonary dysplasia in preterm infants born to a group of preeclamptic mothers was 38.5%, and was significantly higher than that in those born to normotensive mothers, reported at 19.5%. there is also some evidence to suggest that if the pregnancy is associated with prior chronic hypertension in the mother, then a number of additional structural birth defects may occur. thus, preeclampsia may have significantly more consequences to children born of mothers with prior cardiovascular disease. interestingly, wikstrm and colleagues revealed that there is an intergenerational recurrence of placental dysfunction disorders, such that mothers who were born small - for - gestational age (sga) suffered disproportionately and significantly from preeclampsia, placental abruption, spontaneous preterm birth and still birth. compared with parents who had not been born sga, the risk of preeclampsia was more than 3-fold increased if both parents had been born sga, whereas if only the mother had been born sga the corresponding risk was increased by 50%. the rate of small for gestational age infants increased to 50.7% in preeclampsia versus 5% in the controls. the main pathways by which preeclampsia serves to modify vascular risk would appear to be hypoxia, antiangiogenesis, endothelial dysfunction and immune modifications. these pathways individually, synergistically, or cumulatively appear to alter the epigenetic potential of offspring exposed to a preeclampsia environment in utero leading to altered vascular phenotype after birth. a key feature of the in utero preeclamptic environment is reduced uterine perfusion of the fetus - placental unit leading to hypoxia and placental release of reactive oxygen species (ros) and cytokines. the progression to a systemic oxidative and inflammatory state arises from the placenta overexpressing antiangiogenic factors which inhibit the normal pregnancy - related angiogenesis and contribute to systemic endothelial dysfunction. thus, offspring of preeclamptic mothers develop in an environment of placental insufficiency and hypoxia with exposure to circulating inflammatory and antiangiogenic factors. these alter long - term risk for vascular disease, likely by activating mechanisms that decrease transcriptional activity in the endothelium or alter vascular gene expression. thus, abnormal placentation in early pregnancy is considered the key pathological insult leading to subsequent development of the preeclampsia syndrome. in animal studies, mechanical reduction in uterine artery perfusion pressure (rupp) and blood flow in rats between 14 and 19 days of gestation induces a full preeclampsia like phenotype, including elevation in blood pressure, changes in renal artery flow, and dysfunction of endothelium - dependent relaxation. as well, there is subsequent release of endothelial microparticles resulting in the binding of the proangiogenic factors, placental growth factor (pigf) and vascular endothelial growth factor (vegf). variations in the timing of rupp (early versus late gestation) have shown that early exposure to perfusion abnormalities appears critical for altering blood pressure programming in the offspring. the early placental insufficiency that persists in preeclampsia leads to an environment of significant hypoxia. lai and colleagues have shown that mice with normal placentation that are exposed to significant hypoxia, coupled with the deficiency of the interleukin il-10 from early pregnancy, will develop preeclampsia like symptoms including hypertension, proteinuria, renal pathology, and intrauterine growth restriction. because the offspring of these pregnancies, complicated by preeclampsia - like symptoms, did not show elevations in blood pressure, it is thought that hypoxia alone may be insufficient to cause offspring alterations in blood pressure but can act as a trigger to what is now referred to as the preeclampsia cascade. along with early placental insufficiency and hypoxia, endothelial dysfunction is a significant pathophysiologic mechanism leading to the development of the preeclampsia syndrome. as well, once established, endothelial function remains impaired in women with previous preeclampsia. the impact of systemic endothelial dysfunction on in utero development can be shown in mouse models genetically manipulated to develop systemic inhibition of endothelial nitric oxide synthase (enos). when these mice are bred with wild - type males to produce enos - heterozygous offspring, these offspring have higher bp during adulthood than genetically similar offspring from wild - type mothers and enos - knockout fathers. this distinction serves to highlight the impact of maternal endothelial dysfunction on in utero development of subsequent blood pressure irregularities in the offspring. directly related to reduced nitric oxide availability and its subsequent endothelial dysfunction are alterations in angiogenic factors. elevations in circulating antiangiogenic factors are viewed as a key step in the progression to preeclampsia from the initiating event of placental insufficiency. persistence of angiogenic abnormalities in the offspring are also thought to lead to persistent endothelial dysfunction later in life. in animal models maynard and colleagues developed a sprague - dawley rat model of preeclampsia based on adenovirus vector administration of sflt-1, a competitive binder of placental growth factor, at days 8 - 9 of pregnancy. lu and colleagues also showed that male offspring of mice transfected with sflt-1 showed a sustained increase in blood pressure from day 1 of life. petrozella and colleagues implicate sflt-1 as well as soluble endoglin (seng) proteins in human preeclampsia. released from the placenta in response to diffuse endothelial injury, these factors have significant effects on maternal vasculature. though the placenta normally produces sflt-1 and seng, these factors are produced in higher amounts from hypoxic placentae in pregnancies affected by preeclampsia and interact with pigf and vegf in women destined to develop preeclampsia. the authors suggest that the antiangiogenic environment is best reflected by the sflt1 : pigf ratio which they feel provides a snapshot of antiangiogenic imbalance. lamarca and colleagues have recently reported that rupp is a stimulus for angiotensin ii type i receptor during pregnancy and emphasized the important role that stimulating this receptor plays in preeclampsia. to directly assess the level of endothelial damage, quantification of endothelial microparticles (emps) these are submicroscopic membranous particles shed from the endothelial cell wall upon disturbance which can be identified in the plasma by fluorescent antibody labelling and quantified with flow cytometry. a higher total number of microparticles were observed in women with severe preeclampsia compared with normotensive pregnant women and nonpregnant women. the endothelial microparticles cd31+/42, cd105 +, and cd62e+ are all elevated in women with preeclampsia, and the first two are associated with cell apoptosis. they have also been shown to have a positive correlation with the sflt1 : pigf ratio, suggesting that the antiangiogenesis is related to apoptosis of the endothelial cells. functionally, gonzlez - quintero and colleagues have shown in women with preeclampsia that levels of cd31+/42 and cd62e+ emp were significantly correlated with mean arterial pressure and worsening levels of proteinuria. others have reported delayed clearance of these emps up to 1 week afterartum, supporting the theory that endothelial damage persists in women with preeclampsia and may be related to its long - term sequelae. though the exact components which elicit the release of microparticles in response to endothelial injury in a preeclamptic woman are unknown, some have implicated proinflammatory cytokines, since these are known to be endothelial activators. cytokines, such as tumor necrosis factor- (tnf-) and il-1, have been shown to be elevated in preeclampsia. the role of tnf- in mediating the increase in sflt-1 in response to placental ischemia was recently discussed. freeman and colleagues have recently confirmed these observations and additionally reported the significant elevation of il-6/il-10 ratio in women who had had preeclampsia twenty years earlier, showing the persistence of the inflammation changes. in comparing the gene expression in placental tissue from preeclamptic women with tissue from those with a strong family history of heart disease, genes relevant to immune function and inflammatory responses have been shown to be similarly expressed in these 2 conditions. because of these findings, preeclampsia has been characterized as an intense systemic inflammatory environment. since women suffering from autoimmune conditions are known to have an increased risk of developing the syndrome, one of the triggers to widespread endothelial dysfunction may indeed be the immune and inflammatory modulations that occur in preeclampsia. interestingly, neonates born following preeclamptic pregnancies also show elevated levels of il-8 and natural killer (nk) cells with reduced t cell function [6770 ]. our understanding of how reduced uterine perfusion and hypoxia promote the release of inflammatory cytokines and derange antiangiogenic factors leading to systemic endothelial and vascular dysfunction is still limited. a proposed hypothesis supporting the inheritability of these vascular changes involves epigenetic programming, whereby the polymorphisms for certain genes, such as those encoding enos or inflammatory modulators, are activated by adverse exposures including early placental insufficiency or hypoxia. this activation may then lead to changes in transcriptional function of downstream cytokines or antiangiogenic proteins. the level of endothelial damage can now be quantified through emps which may serve as a biomarker for both present and future cardiovascular risks [45, 61 ]. the health consequences of preeclampsia to the mother are so clear that a recent review has suggested that this condition may be a better predictor of future vascular risk in the mother than pregnancy - associated hypertension or diabetes. this review additionally emphasizes that significant health consequences occur in those born to preeclamptic mothers. fortunately, there are now significant measures that can be taken to reduce the risk of vascular events if an individual of any age is known to be at increased risk for vascular disease in organs such as the brain and the heart. these measures may include proactive observation of blood pressure, and if needed treatment of hypertension, and lifestyle changes that may mitigate this and other complications. for example, the recent literature shows that a higher level of total daily physical activity protects against cognitive decline and brain atrophy. we are unaware, however, of any systematic effort aimed at informing the progeny of preeclamptic mothers that they have increased risk for vascular complications and proactively offering them close follow - up. it is our observation that patients with vascular disease are usually unaware of the health status of their mothers during the pregnancy and at the time of their delivery. this information should be made available to them, but this must be done within accepted ethical boundaries, including the prior consent of the mother to make this information available. this also assumes that the individual whose mother was preeclamptic wishes to know this information. once these boundaries are respected and verified, the advent of electronic medical records may facilitate this task, although this is not universally available. in the meantime, it is our recommendation that pediatricians, family physicians, and other health practitioners should suggest to those in their care to seek out this information and make it part of their permanent health record. once known as a product of a preeclamptic pregnancy, the individual should be advised to monitor vascular risk factors and to remain in contact with the health care providers to benefit from preventive measures. | this paper reviews the literature pertaining to the impact of preeclampsia not only on the mother but particularly on the children. the review points to the higher blood pressure in children born to preeclamptic mothers compared to controls, their increased tendency to suffer strokes, the reduction in their cognitive ability, and their vulnerability to depression. mechanisms that may induce these changes are emphasized, particularly the placental vascular insufficiency and the resulting hypoxic and proinflammatory environments in which the fetus develops. the hypothesis proposed is that these changes in the fetal - placental environment result in epigenetic programming of the child towards a higher propensity for vascular disease. the review 's main recommendation is that, within ethical boundaries, the medical records of individuals born to preeclamptic mothers should clearly indicate this event and should be made available to the affected individuals so that preventive measures against vascular complications and lifestyle changes that may mitigate the latter can be instituted. |
professor marthanda varma sankaran valiathan is currently chairman of the task force in ayurvedic biology of the department of science and technology and an honorary advisor, manipal university. earlier, he was professor of cardiac surgery and director of the sree chitra tirunal institute for medical sciences and technology, thiruvananthapuram, for two decades. he has been honored with many awards, fellowships, and honorary doctorates in india and abroad for his contributions to medical science and technology. he was awarded with the padma vibhushan in 2005. as part of a team on the project even a short time with him would instill in us, immense positive energy to pursue intriguing work in ayurvedic biology. thanks to journal of ayurvedic and integrative medicine (jaim), i got the rare opportunity to interview prof. valiathan and get a peek into his 78-year long journey as an accomplished surgeon, biomedical scientist, and a profound scholar of ayurveda, who is the pioneer of the idea that unique scientific opportunities can arise from viewing ayurveda from the perspective of contemporary science. professor valiathan agreed to meet me in manipal and meeting him in his office was sheer sattvic happiness. his simple, unassuming personality and assuring words valiathan giving interview at manipal kj : it has indeed been a long 78-year fruitful journey. how was your childhood and what were the important transitions in your life ? my early education was in the government school at mavelikara and then at university college, trivandrum. my parents instilled in me a love for languages (sanskrit, malayalam, and english), music, and ethical conduct. there was tradition of doctors in our family and one of my maternal uncles, dr. the first phase of my professional life began with postgraduate training in surgery in the uk, leading to fellowship at the royal colleges of surgeons of edinburgh and england in 1960 and a masters degree in surgery from liverpool university. after a brief stint as a faculty member at the post graduate institute of medical education and research, chandigarh, i underwent further training in cardiac surgery at the johns hopkins, george washington, and georgetown university hospitals, usa, and became a fellow of the royal college of physicians and surgeons, canada, in cardiac surgery. gott had developed the first thrombo - resistant surface by ionic bonding of heparin for cardiovascular applications ; hufnagel made history by implanting a ball valve into the descending aorta to treat aortic regurgitation in 1952, even before the advent of heart lung bypass. it was a heady experience to work with pioneers in biomaterials and cardiac devices, and follow their lead. msv : when i returned to india in 1972, my major problem was getting a job. at safdarjung hospital in new delhi then i moved to iit, chennai, where i spent most of my time teaching and doing no research. hufnagel, believed that i had made a foolish mistake in opting to leave the united states. the chief minister of kerala, achutha menon, asked me to set up a hospital for specialities in the new, unoccupied building of sree chitra tirunal center, trivandrum, and offered me the freedom and authority to develop it. within 2 years, patients were admitted for treatment of cardiovascular and neurologic diseases at the center, and development of cardiovascular devices followed. as sree chitra grew, it received support from the prime minister, morarji desai, and the institute was notified as an institute of national importance by an act of parliament, within 5 years of my joining its helm. msv : in 1975, the demand for prosthetic valves was high in the hospital but import was expensive. the state of kerala had but one licensed unit, which slaughtered less than 200 pigs per month, which made porcine valve development unviable. my team then decided to develop a mechanical valve with a tilting - disc design. a mechanical valve has three parts : a metallic cage, a ball or disc as an occluder, and a sewing ring of plastic fabric. our first model failed because the metallic cage fractured ; the second failed because of cage - disc mismatch in hardness and excessive wear of the cage ; the third was on the verge of success, but failed because the disc fractured in the animal model and set us back seriously. more than 75,000 valves have been implanted in patients (till 2012) and over 1200 are being produced monthly by ttk industries. our multidisciplinary team developed a series of disposable devices such as blood bags, oxygenator, cardiotomy reservoir, and a vascular graft, which are in commercial production in several industrial units in kerala and tamil nadu. during this period, my other team of surgical and scientific colleagues in the hospital built a large surgical series for treatment of a serious heart muscle disease in the tropics endomyocardial fibrosis and did in - depth studies, which suggested its causation to be geochemical. the chitra chapter fulfilled my dream of combining cardiac surgery, scientific research, and technology development in a seamless manner. after two decades at chitra, i moved to manipal as the first vice chancellor of manipal university, which was a refreshing change. kj : after a long and successful career as a cardiac surgeon, assuming the high post of vice chancellor in the field of education and several honors as a biomedical scientist, why did you study ayurveda ? msv : the predisposing factor was my upbringing in an ayurveda - friendly environment. for any ailment, except obviously surgical, such as a fracture or a tumor, our family consulted a reputed ayurvedic physician once i joined the medical college and throughout my surgical career of three decades, ayurveda vanished from my view. it reappeared in the 1990s, when i began to feel that nothing in my cardiac surgical practice, or indeed in the modern medicine, had been contributed by an indian. it disturbed me that since the advent of modern medicine in india over 200 years ago, there had been no contribution by an indian in the causation of a disease, a drug, a surgical technique, a technology, a prophylactic regime in medicine which had been adopted globally. i refused to accept shockley 's view that originality in science was exclusive to white people ! msv : i started my study of the charaka samhita with a saintly ayurvedic physician and profound scholar, sri raghavan thirumulpad in kerala. he was in his 80s but was gracious to me and generous with his time. i would inform him in advance that i would be coming with notes on my understanding of three to five chapters of the samhita i would discuss what i had understood ; he would point out my mistakes, the need for greater clarity, for abridgment, or expansion, etc. he would also share with me related ideas and his own experience, which was invaluable. i used to go to him once in two months and the studies went on for 2 years. i was honored when he told me that i would not need similar help in the study of susruta and vagbhata ! kj : please share with us your views on charaka, susruta, and vagbhata. msv : volumes have been written on the great trinity. what could i possibly add to what has been said ? while excelling as a general physician with an encyclopedic mind, he formulated the mula sankhya doctrine with 24 tathwas before iswarakrishna, and modified the gunas of vaiseshika to suit ayurveda. his claim that what is found here, you may find elsewhere ; but what you do n't find here, you will find nowhere was justified. susruta 's text was revised by nagarjuna a few centuries after charaka and was better structured, more compact, and conspicuous by emphasis on surgery. but i felt that several important sections on cadaveric dissection, plastic reconstruction of nose, lips, etc., which won global recognition had perhaps been unduly shortened during the revision of the text ! unlike charaka and susruta who cared little for literary style, vagbhata was a master poet and physician who composed ashtanga hridaya in memorable verse for students and practitioners. he drew his inspiration from charaka and susruta, and made them more accessible to ordinary people like us. msv : learning of ayurveda was not easy because the basic concepts, the role of causation, pathogenesis, diagnosis, the rationale for doing procedures, the basis for prognosis, and most of all, the preparation of medicinal formulations, were vastly different from what i had learnt and practiced in a lifetime. language was a barrier, but not insurmountable. without an inspiring teacher like sri thirumulpad kj : how can we use newer information (generated through reductionist approach) for understanding ayurveda (holistic science) ? msv : new science (reductionist) can not help in understanding all aspects of ayurveda. by definition, even after the ultimate reduction, there will be a part that would defy understanding. but what is revealed by the reductionist approach even at this early stage in studies on prakritis, rasayana, etc is important and exciting. msv : yes, it would be desirable to introduce a short, familiarization course of 2 or 3 weeks in ayurveda for medical students. msv : the projects in the first round were concerned with studies on dosha prakritis, panchakarma, rasayna, dosha - neutralizing plants, and rasa - sindur. the studies have been completed and two important papers have been published, with several more on the way. equally importantly, they have built a bridge between ayurvedic physicians and basic scientists for joint research, and led to the establishment of a task force in ayurvedic biology at the department of science and technology. kj : you have introduced innovative ideas like textual epidemiology in your book legacy of charaka. msv : it would seem that my novel exercise in archeo - epidemiology based on a digitized text of the charaka samhita had escaped the serious notice of reviewers except an american scholar ! as a matter of fact, textual studies can be as exciting as biological studies. for example, digitized texts could enable one to make probable estimates of common and uncommon diseases, commonly and uncommonly used procedures, evolution of the treatment of a disease from charaka to vagbhata, etc., during the period of brihatrayee ; computational linguistics could dissect the different layers of composition and revision of the charaka and susruta samhitas, and so on. some work on these lines on the charaka samhita is being done in vienna, but none in india. msv : i am at a stage when future comes to me in the disguise of today ! every morning brings a noble chance and something of interest to do. research in ayurveda has so far been mainly focused on the utilitarian aspect of drug development. however, ayurveda offers much more for a student of science. apart from its central claim to be a holistic system, which prizes wellness, professor valiathan believes that unique scientific opportunities would arise from investigating ayurveda through the perspective of contemporary science. when i asked him how ayurvedic biology would help ayurveda or biology, his answer was, i can not claim that ayurvedic biology helps, or will help ayurveda or biology. however, when new science, new techniques are applied to old science, new sprouts of knowledge would appear. the conversation with professor valiathan awakened the scientist as well as philosopher in me. here i wish to quote charaka 's words from his book : the legacy of charaka. ayurveda owes its call not to selfish goals or worldly pleasure, but to compassion for fellow beings. in seeking to know my legacy, you have but seen the leaves of a universal tree, too vast for your eyes. kj : it has indeed been a long 78-year fruitful journey. how was your childhood and what were the important transitions in your life ? my early education was in the government school at mavelikara and then at university college, trivandrum. my parents instilled in me a love for languages (sanskrit, malayalam, and english), music, and ethical conduct. there was tradition of doctors in our family and one of my maternal uncles, dr. v.s. the first phase of my professional life began with postgraduate training in surgery in the uk, leading to fellowship at the royal colleges of surgeons of edinburgh and england in 1960 and a masters degree in surgery from liverpool university. after a brief stint as a faculty member at the post graduate institute of medical education and research, chandigarh, i underwent further training in cardiac surgery at the johns hopkins, george washington, and georgetown university hospitals, usa, and became a fellow of the royal college of physicians and surgeons, canada, in cardiac surgery. gott had developed the first thrombo - resistant surface by ionic bonding of heparin for cardiovascular applications ; hufnagel made history by implanting a ball valve into the descending aorta to treat aortic regurgitation in 1952, even before the advent of heart lung bypass. it was a heady experience to work with pioneers in biomaterials and cardiac devices, and follow their lead. msv : when i returned to india in 1972, my major problem was getting a job. at safdarjung hospital in new delhi then i moved to iit, chennai, where i spent most of my time teaching and doing no research. hufnagel, believed that i had made a foolish mistake in opting to leave the united states. the chief minister of kerala, achutha menon, asked me to set up a hospital for specialities in the new, unoccupied building of sree chitra tirunal center, trivandrum, and offered me the freedom and authority to develop it. within 2 years, patients were admitted for treatment of cardiovascular and neurologic diseases at the center, and development of cardiovascular devices followed. as sree chitra grew, it received support from the prime minister, morarji desai, and the institute was notified as an institute of national importance by an act of parliament, within 5 years of my joining its helm. msv : in 1975, the demand for prosthetic valves was high in the hospital but import was expensive. the state of kerala had but one licensed unit, which slaughtered less than 200 pigs per month, which made porcine valve development unviable. my team then decided to develop a mechanical valve with a tilting - disc design. a mechanical valve has three parts : a metallic cage, a ball or disc as an occluder, and a sewing ring of plastic fabric. our first model failed because the metallic cage fractured ; the second failed because of cage - disc mismatch in hardness and excessive wear of the cage ; the third was on the verge of success, but failed because the disc fractured in the animal model and set us back seriously. more than 75,000 valves have been implanted in patients (till 2012) and over 1200 are being produced monthly by ttk industries. our multidisciplinary team developed a series of disposable devices such as blood bags, oxygenator, cardiotomy reservoir, and a vascular graft, which are in commercial production in several industrial units in kerala and tamil nadu. during this period, my other team of surgical and scientific colleagues in the hospital built a large surgical series for treatment of a serious heart muscle disease in the tropics endomyocardial fibrosis and did in - depth studies, which suggested its causation to be geochemical. the chitra chapter fulfilled my dream of combining cardiac surgery, scientific research, and technology development in a seamless manner. after two decades at chitra, i moved to manipal as the first vice chancellor of manipal university, which was a refreshing change. kj : after a long and successful career as a cardiac surgeon, assuming the high post of vice chancellor in the field of education and several honors as a biomedical scientist, why did you study ayurveda ? msv : the predisposing factor was my upbringing in an ayurveda - friendly environment. for any ailment, except obviously surgical, such as a fracture or a tumor, our family consulted a reputed ayurvedic physician once i joined the medical college and throughout my surgical career of three decades, ayurveda vanished from my view. it reappeared in the 1990s, when i began to feel that nothing in my cardiac surgical practice, or indeed in the modern medicine, had been contributed by an indian. it disturbed me that since the advent of modern medicine in india over 200 years ago, there had been no contribution by an indian in the causation of a disease, a drug, a surgical technique, a technology, a prophylactic regime in medicine which had been adopted globally. i refused to accept shockley 's view that originality in science was exclusive to white people ! msv : i started my study of the charaka samhita with a saintly ayurvedic physician and profound scholar, sri raghavan thirumulpad in kerala. he was in his 80s but was gracious to me and generous with his time. i would inform him in advance that i would be coming with notes on my understanding of three to five chapters of the samhita i would discuss what i had understood ; he would point out my mistakes, the need for greater clarity, for abridgment, or expansion, etc. he would also share with me related ideas and his own experience, which was invaluable. i used to go to him once in two months and the studies went on for 2 years. i was honored when he told me that i would not need similar help in the study of susruta and vagbhata ! kj : please share with us your views on charaka, susruta, and vagbhata. while excelling as a general physician with an encyclopedic mind, he formulated the mula sankhya doctrine with 24 tathwas before iswarakrishna, and modified the gunas of vaiseshika to suit ayurveda. his claim that what is found here, you may find elsewhere ; but what you do n't find here, you will find nowhere was justified. susruta 's text was revised by nagarjuna a few centuries after charaka and was better structured, more compact, and conspicuous by emphasis on surgery. but i felt that several important sections on cadaveric dissection, plastic reconstruction of nose, lips, etc., which won global recognition had perhaps been unduly shortened during the revision of the text ! unlike charaka and susruta who cared little for literary style, vagbhata was a master poet and physician who composed ashtanga hridaya in memorable verse for students and practitioners. he drew his inspiration from charaka and susruta, and made them more accessible to ordinary people like us. msv : learning of ayurveda was not easy because the basic concepts, the role of causation, pathogenesis, diagnosis, the rationale for doing procedures, the basis for prognosis, and most of all, the preparation of medicinal formulations, were vastly different from what i had learnt and practiced in a lifetime. language was a barrier, but not insurmountable. without an inspiring teacher like sri thirumulpad kj : how can we use newer information (generated through reductionist approach) for understanding ayurveda (holistic science) ? msv : new science (reductionist) can not help in understanding all aspects of ayurveda. by definition, but what is revealed by the reductionist approach even at this early stage in studies on prakritis, rasayana, etc is important and exciting. that opens a new frontier in knowledge. msv : yes, it would be desirable to introduce a short, familiarization course of 2 or 3 weeks in ayurveda for medical students. msv : the projects in the first round were concerned with studies on dosha prakritis, panchakarma, rasayna, dosha - neutralizing plants, and rasa - sindur. the studies have been completed and two important papers have been published, with several more on the way. equally importantly, they have built a bridge between ayurvedic physicians and basic scientists for joint research, and led to the establishment of a task force in ayurvedic biology at the department of science and technology. kj : you have introduced innovative ideas like textual epidemiology in your book legacy of charaka. msv : it would seem that my novel exercise in archeo - epidemiology based on a digitized text of the charaka samhita had escaped the serious notice of reviewers except an american scholar ! as a matter of fact for example, digitized texts could enable one to make probable estimates of common and uncommon diseases, commonly and uncommonly used procedures, evolution of the treatment of a disease from charaka to vagbhata, etc., during the period of brihatrayee ; computational linguistics could dissect the different layers of composition and revision of the charaka and susruta samhitas, and so on. some work on these lines on the charaka samhita is being done in vienna, but none in india. msv : i am at a stage when future comes to me in the disguise of today ! every morning brings a noble chance and something of interest to do. research in ayurveda has so far been mainly focused on the utilitarian aspect of drug development. however, ayurveda offers much more for a student of science. apart from its central claim to be a holistic system, which prizes wellness, professor valiathan believes that unique scientific opportunities would arise from investigating ayurveda through the perspective of contemporary science. when i asked him how ayurvedic biology would help ayurveda or biology, his answer was, i can not claim that ayurvedic biology helps, or will help ayurveda or biology. however, when new science, new techniques are applied to old science, new sprouts of knowledge would appear. the conversation with professor valiathan awakened the scientist as well as philosopher in me. here i wish to quote charaka 's words from his book : the legacy of charaka. ayurveda owes its call not to selfish goals or worldly pleasure, but to compassion for fellow beings. in seeking to know my legacy, you have but seen the leaves of a universal tree, too vast for your eyes. | professor marthanda varma sankaran valiathan, fellow of the royal college of surgeons, ex president of the indian national science academy, is a reputed cardiac surgeon who made original contributions to cardiology and the development of medical technology. he is widely recognized for his role in pioneering the joint culture of medicine and technology, and laying the foundations for the medical devices industry in india. he has pioneered several scientific studies in the field of ayurveda and authored several books on the subject. in this free and frank interview he discusses three important phases in his life, and his passion for the convergence of modern biology and ayurveda as a new discipline of science ayurvedic biology. |
lung carcinoma is the mostly frequently diagnosed cancer in the world and is also the most common cause of cancer deaths in males and females all over the world. female lung cancer, with mortality higher than that of the combined mortality from breast and colon / rectum cancer, accounted for 26% of the estimated cancer deaths in 2012. a recently study, in which never smokers with lung cancer were frequently women, demonstrated an increased prevalence of egfr mutations in never - smoking lung cancer patients with familial cancer history. hsieh. also reported a much higher mutation of loci related to nsclc in females than in males, as detected by sequencing. this trend of rapidly increasing incidence of lung carcinoma in females has recently drawn much attention. lung cancer is broadly classified as small cell lung cancer originating from neuroendocrine cells versus non - small cell lung cancer (nsclc) originating from bronchial epithelial cell precursors. nsclc can be divided into 3 types : squamous cell carcinoma, adenocarcinoma, and large cell carcinoma. among all types of lung carcinoma, non - small cell lung cancer (nsclc) accounts for approximately 85% of cases. the 5-year survival rate is still about 17%, despite improvements in cancer therapies over the past few decades. although many indicators of lung carcinoma have been found, there has been limited work in developing indicators from the perspective of potentially unique or vulnerable subpopulations, such as females. as the understanding of lung carcinoma evolves, researchers found that a kinase, epidermal growth factor receptor (egfr), is overexpressed in 4080% of nsclc patients, and is therefore an important target of interest for therapy in this disease. egfr is the expression product of the proto - oncogene c - erbb-1 and possesses tyrosine kinase (tk) activity. in general, reported that the expression rate of egfr was 50% in female nsclc cases, which revealed the indicator potential of egfr with the increasing incidence of female nsclc. recent studies have shown that the egfr receptor is overexpressed in nsclc and several other types of cancers. clinical research has demonstrated that egfr inhibitors have a relatively good therapeutic effect on female lung carcinoma, particularly adenocarcinoma. according to a report, use of egfr mutations - specific tyrosine kinase inhibitors (tki), such as erlotinib, gefitinib, or afatinib, is the most effective treatment strategy of nsclc that is targeted to egfr. gefitinib and erlotinib significantly increased overall survival (os) and progression - free survival (pfs) compared with placebo or best support care (bsc). in this study, we investigated the expression of egfr in chinese female nsclc patients, trying to explore the relationship between egfr expression and the clinical and pathological characteristics in prognosis of female nsclc patients. our results showed that high expression of egfr was observed in female nsclc and its expression was closely related to pathology of the tumor type, tnm staging, and lnm. our study shows that egfr is an important indicator of disease progression and prognosis in female nsclc, and that it can be used to investigate the target therapy in female nsclc. we enrolled 62 female patients diagnosed with pathologic stages i to iv nsclc from january 2000 to june 2002 at the archives of the changzheng hospital. of the 62 specimens from patients aged 3275 years (mean, 56 years), none had received chemotherapy, radiotherapy, or any other anticancer therapies ; 46 had adenocarcinoma, 15 had bronchioloalveolar carcinoma (bac), and 16 had squamous cell carcinoma (scc). poorly - differentiated, moderately - differentiated, and well - differentiated carcinoma was observed in 22, 25, and 15 cases, respectively. lymph node metastasis was observed in 37 cases and non - lymph node metastasis was observed in 25 cases. stage i, stage ii, stage iii, and stage iv were observed in 7, 25, 28, and 2 cases, respectively. the survival period was expressed in months until death or the last recorded follow - up ; this period was determined through telephone or mail inquiries until oct 31, 2005. thirty - four patients survived less than or equal to 3 years and 28 patients survived more than 3 years. ten control samples were randomly selected from the nonmalignant lung tissue of female patients during the study period. this investigation was approved by the research ethics committee and the written informed consent was obtained from all individuals. according to personal medical records and individual interviews from research group and control group, a uniform epidemiology questionnaire was designed to obtain patients information, including sex, age, smoking, and alcohol consumption. a biotin - free immunohistochemical staining technique was used for detecting egfr expression according to the manufacturer s instructions (dako). serial sections were placed on l - lysine coated slides, deparaffinized in xylene, and rehydrated through an ethanol gradient. antigen retrieval was achieved by slide immersion in pepsin solution for 15 min at 37c. endogenous peroxidase activity was blocked by incubating the sections in 3% hydrogen peroxide for 15 min, and nonspecific binding was blocked with 10% goat serum for 15 min. the sections were then incubated with anti - egfr monoclonal antibody (1:1000) at 4c overnight in a humid chamber. subsequently, the sections were incubated with envision reagent for 30 min at room temperature. the sections were visualized with the application of diaminobenzidine substrate chromogen solution and hematoxylin counterstain. the positive cell percentage was scored as follows : 05% (score 1), 5%25% (score 2), 5175% (score 3), and > the staining intensity was scored as follows : no staining (score 1), brown - yellow (score 2), and chocolate brown (score 3). the si score was the sum of the positive cell percentage and staining intensity scores. an si score of 0 to 2 indicated negative expression, and a score of 3 to 7 indicated positive expression. we looked for associations between egfr expression and various patient characteristics, including age, smoking history, pathology of the tumor type, tnm staging, and lnm. for statistical analysis, the chi - square test was conducted to analyze associations between egfr expression and the different variables. the cumulative survival rate was determined by the kaplan - meier product - limit method. the prognosis of female patients with nsclc was examined by using a multivariate cox proportional hazard regression model. statistical analysis was carried out using a commercially available computer program (spss version 10.0 ; spss ; chicago, il). we enrolled 62 female patients diagnosed with pathologic stages i to iv nsclc from january 2000 to june 2002 at the archives of the changzheng hospital. of the 62 specimens from patients aged 3275 years (mean, 56 years), none had received chemotherapy, radiotherapy, or any other anticancer therapies ; 46 had adenocarcinoma, 15 had bronchioloalveolar carcinoma (bac), and 16 had squamous cell carcinoma (scc). poorly - differentiated, moderately - differentiated, and well - differentiated carcinoma was observed in 22, 25, and 15 cases, respectively. lymph node metastasis was observed in 37 cases and non - lymph node metastasis was observed in 25 cases. stage i, stage ii, stage iii, and stage iv were observed in 7, 25, 28, and 2 cases, respectively. the survival period was expressed in months until death or the last recorded follow - up ; this period was determined through telephone or mail inquiries until oct 31, 2005. thirty - four patients survived less than or equal to 3 years and 28 patients survived more than 3 years. ten control samples were randomly selected from the nonmalignant lung tissue of female patients during the study period. this investigation was approved by the research ethics committee and the written informed consent was obtained from all individuals. according to personal medical records and individual interviews from research group and control group, a uniform epidemiology questionnaire was designed to obtain patients information, including sex, age, smoking, and alcohol consumption. a biotin - free immunohistochemical staining technique was used for detecting egfr expression according to the manufacturer s instructions (dako). serial sections were placed on l - lysine coated slides, deparaffinized in xylene, and rehydrated through an ethanol gradient. antigen retrieval was achieved by slide immersion in pepsin solution for 15 min at 37c. endogenous peroxidase activity was blocked by incubating the sections in 3% hydrogen peroxide for 15 min, and nonspecific binding was blocked with 10% goat serum for 15 min. the sections were then incubated with anti - egfr monoclonal antibody (1:1000) at 4c overnight in a humid chamber. subsequently, the sections were incubated with envision reagent for 30 min at room temperature. the sections were visualized with the application of diaminobenzidine substrate chromogen solution and hematoxylin counterstain. the positive cell percentage was scored as follows : 05% (score 1), 5%25% (score 2), 5175% (score 3), and > the staining intensity was scored as follows : no staining (score 1), brown - yellow (score 2), and chocolate brown (score 3). the si score was the sum of the positive cell percentage and staining intensity scores. an si score of 0 to 2 indicated negative expression, and a score of 3 to 7 indicated positive expression. we looked for associations between egfr expression and various patient characteristics, including age, smoking history, pathology of the tumor type, tnm staging, and lnm. for statistical analysis, the chi - square test was conducted to analyze associations between egfr expression and the different variables. the cumulative survival rate was determined by the kaplan - meier product - limit method. the prognosis of female patients with nsclc was examined by using a multivariate cox proportional hazard regression model. statistical analysis was carried out using a commercially available computer program (spss version 10.0 ; spss ; chicago, il). positive staining of egfr was observed in the cytoplasm and cytomembrane of tumor cells, which was characterized by brownish - yellow particles. staining efficacy varied among different tissues, as indicated by the pathological images (figure 1). egfr expression was positive in 70.97% (44/62) of female nsclc cases, while it was significantly negative in the control group with nonmalignant lung tissues (p=0.000014). the expression of egfr in female nsclc showed dramatic differences in different pathology of the tumor type, with or without lnm, and various tnm staging (p0.05). of the 44 cases with positive egfr expression, survival time was less than or equal to 3 years in 28 cases and greater than 3 years in 16 cases. in the 18 cases with negative egfr expression, the survival time was less than or equal to 3 years in 6 cases and greater than 3 years in 12 cases. the 3-year survival rate of the group with positive egfr expression was significantly lower than that of the group with negative egfr expression (p 0.0295). the kaplan - meier survival curve based on the relationship between the different levels of expression of egfr and survival time is shown in figure 2. a cox proportional risk regression model was constructed according to patient s age, pathology of the tumor type, tumor size, tumor site, lnm, surgical method, egfr expression, and survival time. the analysis of the cox proportional risk model indicated that the postoperative survival time was significantly associated with pathology of the tumor type and lnm (p0.05). of the 44 cases with positive egfr expression, survival time was less than or equal to 3 years in 28 cases and greater than 3 years in 16 cases. in the 18 cases with negative egfr expression, the survival time was less than or equal to 3 years in 6 cases and greater than 3 years in 12 cases. the 3-year survival rate of the group with positive egfr expression was significantly lower than that of the group with negative egfr expression (p 0.0295). the kaplan - meier survival curve based on the relationship between the different levels of expression of egfr and survival time is shown in figure 2. a cox proportional risk regression model was constructed according to patient s age, pathology of the tumor type, tumor size, tumor site, lnm, surgical method, egfr expression, and survival time. the analysis of the cox proportional risk model indicated that the postoperative survival time was significantly associated with pathology of the tumor type and lnm (p<0.05). adenocarcinoma with lnm was an independent poor prognostic factor (i.e., positive cox proportional risk regression model) (table 3) ; however, patient age, tumor size, tumor site, surgical method, and egfr expression were not independent prognostic factors. the expression of egfr in tumor tissues is closely related to pathology of the tumor types, differentiation degree, lnm, and tumor invasion ; moreover, a correlation has been observed between egfr expression and patient prognosis. in this study, we recruited chinese female nsclc patients as subjects to explore the expression of egfr in female nsclc. the expression rate of egfr was 70.97% in chinese female nsclc cases, which was higher than that reported in previous studies. with more detail classification of pathology in our research, we found that the expression of egfr in female adenocarcinoma was higher than that in scc and even higher than that in female bac ; the expression of egfr was positively correlated with lnm and tnm staging, and it was not associated with patient age, smoking history, tumor size, tumor site, differentiation degree, and distal metastases. some studies confirmed that female adenocarcinoma and bac were also associated with egfr gene mutations ; therefore, the high level of expression of egfr in female nsclc might be related to female egfr gene mutation [1618 ], which corresponded with our immunohistochemical results. some studies have indicated that the expression of egfr is associated with a reduction in disease - free survival time and total survival time, poor prognosis, easy recurrence, late staging, and high metastasis rate, but other studies have reported contradictory findings. our study showed that the 3-year survival rate of female nsclc patients with positive egfr expression was clearly lower than that of patients with negative egfr expression. the cox proportional risk model analysis demonstrated that the postoperative survival time of the patients was significantly associated with pathology of the tumor type and lnm (p<0.05), and that adenocarcinoma with lnm was the independent poor prognostic factor. currently, in the treatment of tumors, target therapy of lung cancer has drawn much attention. egfr is an important target for tumor inhibition, which affects the signal transduction system of tumor cells and suppresses tumor proliferation, invasion, metastases, and angiogenesis. clinical research has validated the therapeutic effects of the egfr - tk inhibitor in female patients with adenocarcinoma. therefore, the study of egfr expression in chinese female nsclc can predict the pathogenesis, development, and prognosis of the disease in chinese female nsclc patients and can also be a good choice for the target therapy of female nsclc. the expression of egfr is high (70.97%) in female nsclc and the positive egfr expression exhibited a reduction in 3-year survival rate compared with those of the negative egfr expression. our results also showed that egfr expression was closely related to pathology of the tumor type, tumor - node metastasis staging, and lymph node metastasis, which could be used as a promising indicator of nsclc in chinese female patients. a more comprehensive study that includes male patients and different races is needed to determine if our results have universal applicability. | backgroundnon - small cell lung cancer (nsclc) accounts for approximately 80% of lung carcinoma cases, which becomes more and more important in the field of lung carcinoma as well as primary lung carcinoma in females.material/methodswe analyzed the medical history of 62 female nsclc patients. immunohistochemistry was used to observe and compare the expression of egfr. the chi - square test was conducted to analyze associations between egfr expression and the different variables. the cumulative survival rate was determined by the kaplan - meier product - limit method. the prognosis of female patients with nsclc was examined by using a multivariate cox proportional hazard regression model.resultsthe expression proportion of egfr in chinese female nsclc patients was 70.97%, and it was remarkably higher in adenocarcinoma than in squamous cell carcinoma and bronchioloalveolar carcinoma. a positive correlation was observed between egfr expression and tumor - node metastasis staging or lymph node metastasis. the cox proportional risk model analysis showed a correlation between postoperative survival time of the patients and pathology of the tumor type and lymph node metastasis.conclusionsexpression of egfr was closely related to pathology of the tumor type, tumor - node metastasis staging, and lymph node metastasis, which could be used as a promising indicator of nsclc in chinese female patients. |
glucocorticoid (gc) excess, including cushing 's syndrome, is a common cause of secondary osteoporosis. several reports have confirmed the high prevalence of various degrees of osteopenia / osteoporosis in patients with hypercortisolism. the prevalence of osteopenia and osteoporosis in cushing 's syndrome is diverse among studies, with approximate ranges from 60 - 80% and 30 - 65%, respectively. also, 30 - 50% of patients with cushing 's syndrome experience non - traumatic fractures, which can be the presenting manifestation of cushing 's syndrome. approximately one third of patients develop vertebral fractures, especially at the level of the thoracic and lumbar vertebral bodies. spontaneous fractures may also occur in the ribs and pelvis, and less commonly in the long bones. however, there are rare cases diagnosed as cushing 's syndrome based solely on bony manifestations. in korea, only two cases have been reported in which cushing 's syndrome was diagnosed after pathologic vertebral fractures occurred in young females. we described a case where cushing 's syndrome was diagnosed in a 44-year - old woman who visited our hospital due to multiple non - traumatic rib fractures. a 44-year - old woman was referred to our hospital on may 2009 due to an abnormal chest x - ray finding. she had a chest x - ray before a gastrofibroscopy at a local hospital., she had a chest computed tomography (ct) scan done before visiting our hospital. the chest ct revealed multiple sclerotic masses with bone destruction in both hemithoraxes (right 2nd, 4th, 5th, 6th, 7th, and 10th ribs, left 2nd, 4th, 7th, 8th, and 9th ribs) of variable size (fig. initially she was admitted to the pulmonology department to rule out bony metastases from a cancer of unknown origin. she had taken the bone densitometry of the l1-l4 lumbar spine by dual energy x - ray absorptiometry (dxa), at the local department of gynecology 1.5 years ago. the result of bone mineral density (bmd) was 0.726 g / cm and the average t - score of the l1-l4 lumbar spine was -2.6. therefore, she was taking calcium, vitamin d supplements and hormone replacement therapy for osteoporosis. she also had a conization in 2002 due to squamous cell carcinoma in situ at the uterine cervix and thereafter received a total hysterectomy in 2005 due to uterine leiomyoma. there were no abnormal findings in her family history. also, she had no trauma history. she did n't have any pain on her ribs. on the physical examination, there was n't tenderness around fracture sites. her height and weight were 153 cm and 53 kg, respectively, with a body mass index (bmi) of 22 kg / m. her waist measurement was 83 cm, and she had experienced no recent weight changes. her blood pressure was 140/80 mmhg with a pulse of 96 beats / min, a respiratory rate of 20 breaths / min, and a body temperature of 36.8. on the blood test, the leukocyte, hemoglobin, and platelet counts were 8,900/mm (neutrophils 85.9%, lymphocyte 8.4%, monocyte 5.7%), 14.9 g / dl, and 184,000/l, respectively. fasting glucose, albumin, aspartate aminotransferase, alanine aminotransferase, alkaline phosphatase, and creatinine were 93 mg / dl, 4.0 g / dl, 45 iu / l, 81 iu / l, 49 iu / l, and 0.56 mg / dl, respectively. total calcium and phosphate were 10.5 mg / dl and 3.5 mg / dl, respectively. in addition, serum intact parathyroid hormone (pth) was 35.6 pg / ml (normal range, 13 - 54 pg / ml). to evaluate the patient for metastatic cancer, a bone biopsy was performed at the right 6th rib posterior arc in the pulmonology department. also a bone scan and the bone densitometry of the l1-l4 lumbar spine and an abdominal ct were performed. fragmented bony particles with small amounts of marrow tissue were observed in the biopsy tissue. there were no cancer cells nor cytokeratin (ck)-positive epithelial cells on immunohistochemical staining. there was no cancerous lesion in abdomen ct, except a left adrenal incidentaloma, a well - marginated soft tissue mass 25 mm in diameter, was found (fig., multi - focal increased uptake was observed in both ribs, suggesting non - traumatic micro - fractures caused by osteoporosis (fig. 4a). the average bmd, t - score and z - score of the l1-l4 lumbar spine was 0.761 g / cm, -2.1 and -1.7, respectively. therefore, an endocrine cause of osteoporotic fracture was suspected, and a hormonal study for adrenal incidentaloma was performed. free cortisol in the urine and 17-hydroxycorticosteroid were 580.4 g / day (normal range, 20 - 90 g / day) and 12.93 mg / day (normal range, 3 - 15 mg / day), respectively. a low - dose dexamethasone suppression test showed that the serum adrenocorticotrophic hormone level was 1.4 pg / ml (normal < 130 pg / ml), the basal cortisol was 26.3 g / dl and the cortisol on the 3rd day was 35.4 g / dl (normal, 3 - 6 g / dl). finally, she was diagnosed with cushing 's syndrome due to the left adrenocortical adenoma. a month after the laparoscopic left adrenalectomy, 24-hr urine free cortisol was checked, and was below 1.8 g / day. a bone scan taken 1 year after the operation showed decreased multifocal uptake in the bilateral ribs (fig. 4b) and the patient 's bmd improved gradually, reaching 0.822 g / cm in 2012 (fig. 5). also, the average t - score and z - score of the l1-l4 lumbar spine improved, reaching -1.6 and -1.0, respectively. currently, she is being regularly followed - up and taking calcium and vitamin d for osteopenia. cushing 's syndrome encompasses a variety of clinical features that result from chronic exposure to excess gcs of any etiology. cushing 's syndrome occurs with an incidence of 1 - 2 per 100,000 persons per year. the clinical manifestations of cushing 's syndrome are central obesity with supraclavicular fat accumulation, a cervical fat pad, thinned skin, purple striae, proximal muscle weakness, fatigue, hypertension, glucose intolerance, acne, hirsutism, menstrual irregularity, and osteoporotic vertebral fractures. however, the clinical manifestations of cushing 's syndrome are not always definite so that sometimes clinical suspicion should arise preferentially by the physician. furthermore, because of its variable pattern of the biochemical parameters, diagnosis of cushing 's syndrome is often difficult for clinicians. the prevalence of osteoporosis due to endogenous gc excess has been reported to be present in 50 - 59% of cases, and approximately 30 - 50% of patients with the condition experience non - traumatic fractures. secondary osteoporosis is defined as bone loss, microarchitectural alterations, and fragility fractures due to an underlying disease or concurrent medication. clinicians should be suspicious and evaluate for secondary osteoporosis in male or premenopausal female patients with unexplained bone loss, a history of fragility fractures or very low bmd values and fractures despite anti - osteoporotic therapy, as in this case. moreover, because osteoporotic fractures can be the only presenting manifestation of cushing 's syndrome, secondary osteoporosis caused by cushing 's syndrome should be considered in patients with unclear causes of osteoporotic fractures. although the patient in this case was a relatively young female who had already taken calcium, vitamin d supplements and hormonal replacement therapy for osteoporosis, asymptomatic multiple pathologic rib fractures were incidentally discovered in a routine chest x - ray. because she exhibited no typical signs of cushing 's syndrome such as moon face, truncal obesity, thinned skin or purple striae and showed no associated features of cushing 's syndrome, such as diabetes mellitus or hypertension, she was not initially suspected of cushing 's syndrome. at first however, they did not find any evidence of metastatic cancer, and incidentally found the left adrenal adenoma on abdominal ct. then, we suspected cushing 's syndrome and performed endocrine function tests, which confirmed the diagnosis. there have only been two korean cases of cushing 's syndrome previously diagnosed after recurrent non - traumatic fractures occurring in young females. however, both of these cases were accompanied by vertebral fractures, not rib fractures. our case is the first report that diagnosed cushing 's syndrome by multiple ribfractures without vertebral fractures, which are the most affected fracture site in cushing 's syndrome. they act in two phases : a rapid, early phase in which bmd falls by excessive bone resorption, and a slower, more progressive phase in which bmd declines as a result of impaired bone formation. an early phase of excessive bone resorption is due to the action of gcs on calcium metabolism by inhibition of calcium absorption from the gut through a mechanism independent of vitamin d, increasing the urinary excretion of calcium and increasing osteoclast activity.. however, most studies have found differences between gc - induced osteoporosis (gio) and the hyperparathyroid state. in gio, preferential bone loss tends to occur in cancellous bone, in contrast to primary hyperparathyroidism where preferential bone loss occurs in cortical skeletal bone. as a result, greater bone mineral loss in the vertebral spine is commonly observed in patients with cushing 's syndrome. moreover, gio shows reduced bone turnover, whereas bone turnover is enhanced in primary hyperparathyroidism. also, the slower phase of impaired bone formation is due to a decrease in osteoblast number and function. hypercortisolism inhibits replication of cells of osteoblastic lineage and osteoblastogenic differentiation, decreases osteoblast function and increases apoptosis of osteoblasts and osteocytes. in addition, gcs inhibit alkaline phosphatase activity, production of type i collagen and synthesis of non - collagenous bone protein like osteocalcin. many studies that evaluated bone formation with serum osteocalcin levels found that it was greatly suppressed in endogenous gio. an important feature of gio is that it is reversible. after cure of hypercortisolism by both an adrenalectomy or pituitary adenomectomy, an increase in bmd, which can even reach normal levels, has been described and a time - dependent rise was observed. manning. reported that the bmd of 17 adult cushing 's syndrome patients, who had been cured, recovered to normal values and there was a positive relationship between bone density and the time since cure by a unilateral adrenalectomy, which requires approximately 10 years for complete recovery. they also observed a time - dependent rise in bmd, which was paralleled by increased osteocalcin. one of the two korean cases did not report progress in the bony manifestations of cushing 's syndrome after treatment, while the other case showed a slight improvement in bmd, but new compression fractures developed during the course of treatment. interestingly, we showed that multifocal increased uptake of the ribs on bone scan completely disappeared one year after left adrenalectomy. furthermore, bmd significantly increased after 2 years with no additional fractures. in conclusion, although a patient may not exhibit typical features of cushing 's syndrome, this disease should be considered in young adults with multifocal non - traumatic rib fractures, as they could be bony manifestations that can be completely eliminated by treatment. | glucocorticoid (gc) excess, including cushing 's syndrome, is a common cause of secondary osteoporosis. thirty to fifty percent of cushing 's syndrome patients experience non - traumatic fractures, which is often the presenting manifestation of cushing 's syndrome. however, there have been rare cases of cushing 's syndrome diagnosed only based upon bone manifestations. we describe a case of cushing 's syndrome that was diagnosed in a 44-year - old woman who initially visited our hospital due to multiple non - traumatic rib fractures. she did not exhibit any other manifestations of cushing 's syndrome such as moon face, buffalo hump or abdominal striae. initially, we evaluated her for bone metastases from a cancer of unknown origin, but there was no evidence of metastatic cancer. instead, we found a left adrenal incidentaloma. as a result of the hormone study, she was diagnosed as having cushing 's syndrome. interestingly, her bony manifestation of cushing 's syndrome, which was evident in the bone scan and bone mineral densitometry, completely recovered after a left adrenalectomy. therefore, the possibility of cushing 's syndrome as a cause of secondary osteoporosis should be considered in young patients with non - traumatic multiple fractures, with or without any other typical features of cushing 's syndrome. |
diabetes mellitus is an important public health issue due to its high prevalence and increased morbidity and mortality. cardiac injury is caused by coronary atherosclerosis and diabetes - related cardiomyopathy. as first reported by rubler., diabetic cardiomyopathy is a single form of heart disease characterized by left ventricular systolic and diastolic dysfunction in the absence of underlying coronary artery disease and/or hypertension. diabetic cardiomyopathy is a common cardiac condition affecting both type 1 and type 2 diabetes patients. the pathophysiology of diabetic cardiomyopathy is not completely understood as several mechanisms can be involved ; these include myocyte hypertrophy, myocardial fibrosis, contractile dysfunction, calcium handling and mitochondrial function changes, and nitric oxide signaling impairment [38 ]. hyperglycemia - induced oxidative stress is an important factor involved in diabetic cardiomyopathy [912 ]. regular physical exercise is an established nonpharmacological strategy used as an adjuvant therapy in heart failure from different etiologies [13, 14 ]. clinical studies in stable chronic heart failure have shown that long - term moderate physical training attenuates abnormal cardiac remodeling and improves functional capacity, exercise duration, and quality of life [1518 ]. in different cardiac injury models, exercise has been shown to attenuate left ventricular dilatation, myocyte hypertrophy, myocardial fibrosis, mitochondrial dysfunction, myocyte calcium handling changes, sympathoexcitation alterations, cardiac dysfunction, and inflammatory activation [1925 ]. in diabetes, physical exercise reduces cardiovascular risk factors and improves glycemic control, functional capacity, and muscle strength [2629 ]. however, most clinical studies in diabetes have been performed on type 2 diabetes patients [28, 30 ]. in experimental studies on rats with streptozotocin - induced diabetes, regular physical exercise has been shown to improve myocardial glucose homeostasis, endogenous antioxidant defenses, cardiac function, heart tolerance to ischemia, and ultrastructural extracellular matrix and mitochondrial changes [3133 ]. in vivo evaluation of cardiac function is subjected to myocardial function modulation by hemodynamic and systemic metabolic abnormalities. left ventricular isolated papillary muscle preparations allow us to properly control preload and afterload and analyze intrinsic myocardial function without the effects of systemic metabolic changes [3436 ]. furthermore, by using positive inotropic stimulation, it is also possible to evaluate myocardial contractile reserve in papillary muscle preparations [37, 38 ]. therefore, in this study we evaluated the influence of a low intensity aerobic exercise protocol on in vivo cardiac remodeling and in vitro myocardial function in rats with streptozotocin - induced diabetes mellitus. as oxidative stress is associated with diabetes cardiomyopathy and can be influenced by physical exercise, we also analyzed myocardial oxidative stress in diabetic rats. male wistar rats were purchased from the central animal house at botucatu medical school, unesp. all animals were housed in a room under temperature control at 23c and kept on a 12-hour light / dark cycle. all experiments and procedures were approved by botucatu medical school ethics committee, unesp, botucatu, sp, brazil. the rats were assigned into four groups : sedentary control (c - sed, n = 14) ; exercised control (c - ex, n = 15) ; sedentary diabetes (dm - sed, n = 25) ; and exercised diabetes (dm - ex, n = 25). louis, mo, usa) at the dose of 50 mg / kg diluted in 0.01 m citrate buffer ph 4.5 [9, 3941 ]. seven days after streptozotocin administration, blood glucose was measured by glucometer (advantage) ; only rats with glycemia > 220 mg / dl were considered diabetic and included in the study. after diabetes confirmation, exercise protocol was started in a treadmill (avs projects, so paulo, brazil) as previously described. the protocol was applied once a day, five days a week, for nine weeks. after the first week of animals adaptation (8 min, 8 m / min), exercise duration and speed were increased gradually up to 18 min / day at 11 m / min. in the first two weeks of training, the animals were subjected to low - voltage electrical stimulation to start the exercise. systolic blood pressure was measured at the end of experiment by the tail - cuff method using an electrosphygmomanometer (narco bio - system, model 709 - 0610, international biomedical inc. echocardiographic evaluation was performed using a commercially available echocardiograph (general electric medical systems, vivid s6, tirat carmel, israel) equipped with a 511.5 mhz multifrequency probe. rats were anesthetized by intraperitoneal injection of a mixture of ketamine (50 mg / kg) and xylazine (0.5 mg / kg). a two - dimensional parasternal short - axis view of the left ventricle (lv) was obtained at the level of the papillary muscles. m - mode tracings were obtained from short - axis views of the lv at or just below the tip of the mitral - valve leaflets and at the level of the aortic valve and left atrium [4346 ]. m - mode lv images were printed on a black - and - white printer at a sweep speed of 200 mm / s. all lv structures were manually measured by the same observer (ko) according to the leading - edge method of the american society of echocardiography. the measurements obtained were the mean of at least five cardiac cycles on the m - mode tracings. the following structural variables were measured : left atrium (la) diameter, lv diastolic and systolic diameters (lvdd and lvsd, resp.), lv diastolic posterior wall thickness (pwt), and aortic diameter (ao). lv relative wall thickness (rwt) was calculated by the following formula : 2 pwt / lvdd. left ventricular mass (lvm) was calculated using the following formula : [(lvdd + pwt + swt) (lvdd) ] 1.04. left ventricular function was assessed by the following parameters : endocardial fractional shortening (efs), ejection fraction (ef), posterior wall shortening velocity (pwsv), early - to - late diastolic mitral inflow velocities ratio (e / a ratio), and e wave deceleration time (edt). a joint assessment of diastolic and systolic lv function was performed by the myocardial performance index (tei index). two days after the echocardiographic study, intrinsic myocardial contractile performance was evaluated in isolated lv papillary muscle preparation as previously described [4750 ]. rats were anesthetized (sodium pentobarbital intraperitoneally, 50 mg / kg) and decapitated. lv anterior or posterior papillary muscle was dissected free, mounted between two spring clips, and placed vertically in a chamber containing krebs - henseleit solution at 28c and oxygenated with a mixture of 95% o2 and 5% co2 (ph 7.38). the composition of the krebs - henseleit solution in mm was as follows : 118.5 nacl, 4.69 kcl, 1.25 cacl2, 1.16 mgso4, 1.18 kh2po4, 5.50 glucose, and 25.88 nahco3. the spring clips were attached to a kyowa model 120t-20b force transducer and a lever system which allowed for muscle length adjustment. after a 60-minute period, during which the preparations were permitted to shorten whilst carrying light loads, muscles were loaded to contract isometrically and stretched to the apices of their length - tension curves (lmax). after a 5-minute period, during which preparations performed isotonic contractions, muscles were again placed under isometric conditions and length - tension curve apex was determined. the following parameters were measured from isometric contraction : peak of developed tension (dt, g / mm), resting tension (rt, g / mm), time to peak of tension (tpt, ms), maximum rate of tension development (+ dt / dt, g / mm / s), and maximum rate of tension decline (dt / dt, g / mm / s). to evaluate contractile reserve, mechanical papillary muscle performance was evaluated at basal condition and after the following inotropic stimulation : postrest contraction, extracellular ca concentration increase, and beta - adrenergic agonist isoproterenol addition to the nutrient solution. papillary muscle cross - sectional area (csa) was calculated from muscle weight and length by assuming cylindrical uniformity and a specific gravity of 1.0. papillary muscles with csa > 1.7 mm were excluded from analysis as muscles with csa > 1.7 mm can present central core hypoxia and impaired functional performance. after dissecting papillary muscle, atria and ventricles were separated and weighed. fragments of lung and left and right ventricles were weighed before and after drying sessions (65c for 72 h) to evaluate the wet - to - dry weight ratio. five - micrometer - thick sections were stained with hematoxylin and eosin. from each lv, the smallest transverse diameter was measured in at least 50 myocytes, in which the nucleus could be clearly identified. measurements were performed using a leica microscope (magnification 40x) attached to a video camera and connected to a computer equipped with image analysis software (image - pro plus 3.0, media cybernetics, silver spring, md, usa). to estimate myocardial collagen content, hydroxyproline concentration was measured in lv tissue as previously described [51, 52 ]. briefly, the tissue was dried using a speedvac concentrator sc 100 attached to a refrigerated condensation trap (trl 100) and vacuum pump (vp 100, savant instruments, inc., farmingdale, ny, usa). tissue dry weight was measured and the samples were hydrolyzed overnight at 100c with 6 n hcl (1 ml/10 mg dry tissue). a 50 l aliquot of the hydrolysate was dried in the speedvac concentrator ; 1 l of deionized water was added ; and the sample transferred to a teflon tube. one milliliter of potassium borate buffer (ph 8.7) was added to maintain constant ph and the sample was oxidized with 0.3 ml of chloramine t solution at room temperature for 20 min. the addition of 1 ml of 3.6 m sodium thiosulfate and thorough mixing for 10 s stopped the oxidative process. the tubes were capped and heated in boiling water for 20 min. after cooling to room temperature, the aqueous layer was extracted with 2.5 ml of toluene ; 1.5 ml of toluene extract was transferred to a tube ; and 0.6 ml of ehrlich 's reagent was added. deionized water and 20 g / ml hop were used as the blank and standard, respectively. biochemical parameters were measured in serum using a spectrophotometer from pharmacia biotech (ultrospec 2000, cambridge, england). analyses were performed with a celm kit (modern laboratory equipment company, so paulo, brazil). high - density lipoprotein (hdl) concentration was measured after precipitation of vldl and ldl by the sodium phosphotungstate / mg method using an enzymatic colorimetric method that incorporates polyethylene glycol - modified cholesterol ester oxidase. myocardial lipid hydroperoxide concentration was measured in medium containing methanol 90% (v / v), 250 m ammonium ferrous sulfate, 100 m xylenol orange, 25 mm sulfuric acid, and 4 mm butylated hydroxytoluene. the solution was incubated for 30 min at room temperature and measured at 560 nm. glutathione peroxidase was assayed in 15 l using 0.15 m phosphate buffer, ph 7.0, containing 5 mm edta, 0.1 ml of 0.0084 m nadph, 4 g of glutathione - reductase, 1.125 m sodium azide, and 0.15 m glutathione reduced form (gsh) in a total volume of 0.3 ml. superoxide dismutase (sod) activity was determined using its ability to inhibit reduction of nitroblue tetrazolium, in medium containing 50 mm phosphate buffer ph 7.4, 0.1 mm edta, 50 m nbt, 78 m nadh, and 3.3 m phenazine methosulfate. one unit of sod was defined as the amount of protein needed to decrease the reference rate to 50% of maximum inhibition. enzyme activities were analyzed at 25c using a microplate reader system (quant - mqx 200 with kc junior software, bio - tek instruments, winooski, vt, usa). catalase activity was determined in a mixture containing 10 mm hydrogen peroxide and sodium phosphate buffer 50 mm, ph 7.0, in a final volume of 0.3 ml. catalase unit was defined as the amount of enzyme related to mol h2o2 decomposition in a first order rate constant during 15 s, at 240 nm. all reagents were purchased from sigma (st. louis, mo, usa). values were expressed as mean standard deviation or median and 25th and 75th percentiles, according to normal or nonnormal distribution, respectively. parameters with normal distribution were compared by one way anova followed by the bonferroni post hoc test and nonnormal parameters were compared by kruskal - wallis and the dunn post hoc test (comparisons of interest : c - ex versus c - sed, dm - sed versus c - sed, and dm - ex versus dm - sed). the final number of animals in each experimental group was 14 in c - sed, 13 in c - ex, 19 in dm - sed, and 18 in dm - ex. fifteen rats were excluded from the study due to nonadaptation to treadmill exercise or failure to increase glycemia after streptozotocin administration. initial body weight (c - sed : 327 23 ; c - ex : 331 13 ; dm - sed : 336 20 ; dm - ex : 340 20 g ; p > 0.05), glycemia (c - sed : 109 11 ; c - ex : 108 14 ; dm - sed : 103 12 ; dm - ex : 102 12 mg / dl ; p > 0.05), and final systolic blood pressure (c - sed : 131 18 ; c - ex : 126 13 ; dm - sed : 135 18 ; dm - ex 140 22 mmhg ; p > 0.05) did not differ between groups. final glycemia was higher in diabetic groups than controls and slightly lower in dm - ex than dm - sed (figure 1). final body weight was lower in diabetic groups than controls and in exercised versus sedentary groups. however, lv - to - body weight ratio was higher in dm than control groups. atria weight was lower in dm - ex than c - ex and dm - sed. c - ex presented lower lv diastolic diameter and higher relative wall thickness than c - sed. diabetic groups had higher lv diastolic diameter - to - body ratio, left atrial diameter - to - aorta diameter, and lv mass index and lower posterior wall shortening velocity than control groups. left atrium diameter, in absolute or normalized to aorta diameter values, was lower in dm - ex than in dm - sed. table 3 shows lv papillary muscle functional data. in basal condition, + dt / dt was lower in c - ex than c - sed. after postrest contraction, + dt / dt was lower in c - ex and dm - sed than c - sed ; dt and dt / dt were lower in dm - sed than c - sed. after extracellular calcium concentration increase to 2.5 mm, tpt was greater in dm - sed than c - sed. after isoproterenol addition, dm - sed presented increased tpt and reduced + dt / dt and dt / dt compared to c - sed ; dm - ex had lower dt / dt than c - ex. myocardial hydroxyproline concentration (c - sed : 2.06 0.50 ; c - ex : 1.96 0.09 ; dm - sed : 2.19 0.40 ; dm - ex : 2.29 0.36 mg / g ; p > 0.05) and lv myocyte diameter (c - sed : 12.7 0.90 ; c - ex : 13.8 1.62 ; dm - sed : 13.1 1.08 ; dm - ex : 13.7 0.69 m ; p > 0.05) did not differ between groups. total cholesterol concentration was higher in both dm groups than controls and lower in dm - ex than dm - sed (c - sed : 90.5 (86.5100) ; c - ex : 98 (86.5121) ; dm - sed : 188 (182198) ; dm - ex : 148 (136165) mg / dl ; p < 0.05). hdl - cholesterol was lower in dm - sed than c - sed and dm - ex (c - sed : 41.6 (37.849.0) ; c - ex : 38.6 (37.145.3) ; dm - sed : 21.5 (20.824.5) ; dm - ex : 40.8 (30.443.8) mg / dl ; p < 0.05). lipid hydroperoxide concentration was higher in c - ex and dm - sed than c - sed and lower in dm - ex than dm - sed. catalase and superoxide dismutase activity was lower in dm groups than their respective controls and higher in dm - ex than dm - sed. glutathione peroxidase activity was lower in c - ex and dm - sed than c - sed and higher in dm - ex than dm - sed. in this study, we evaluated the effects of a low intensity physical exercise protocol on cardiac remodeling and myocardial oxidative stress and function in type 1 diabetic rats. we used a low intensity exercise protocol for nine weeks including one week of adaptation. low intensity exercise protocols have been used in diabetic rats as they may not tolerate more extensive or intense periods of exercise [42, 54, 55 ]. low intensity appeared more effective than high intensity exercise training to reduce diabetes - related inflammation in serum and skeletal muscles. in our study, the low intensity exercise protocol was sufficient to reduce myocardial oxidative stress and to improve cardiac remodeling and myocardial function. as expected, diabetic animals presented heightened glycemia increase and reduced body weight and physical exercise slightly attenuated serum glucose increase in dm - ex group. as blood pressure did not differ between groups, we can discard the influence of hemodynamic changes on exercise - induced cardiac changes. transthoracic echocardiogram was performed to analyze in vivo cardiac structures and left ventricular function. in the c - ex group, physical exercise induced a slight reduction in absolute lv diastolic diameter values and an increase in lv relative wall thickness with unchanged systolic or diastolic function. dm - sed presented lv hypertrophy with dilated left cardiac chambers, characterized by increased lv mass index, lv diastolic diameter - to - body weight ratio, and left atrial diameter, with reduced systolic function, characterized by decreased lv posterior wall shortening velocity, compared to c - sed. a similar echocardiographic pattern of dilated cardiomyopathy has often been observed in experimental diabetes mellitus [5761 ]. the fact that posterior wall shortening velocity was the only changed functional variable suggests that cardiac function was evaluated early during diabetes cardiomyopathy development. the higher lung wet - to - dry weight ratio in dm - sed suggests the presence of pulmonary congestion and reinforces the lv dysfunction in dm - sed. myocardial function analysis in lv papillary muscle preparations showed lower developed tension in postrest contraction ; lower + dt / dt in basal condition, postrest contraction, and after isoproterenol stimulation ; lower dt / dt in postrest contraction and after isoproterenol stimulation ; and higher time to peak tension after calcium and isoproterenol stimulation in dm - sed compared to c - sed. these results allow us to conclude that diabetes - induced systolic and diastolic myocardial dysfunction is responsible for the echocardiographic pattern of dilated cardiomyopathy observed in the in vivo evaluation. the echocardiographic study revealed that left atrium diameter was lower in dm - ex than dm - sed. left atrium dilation is often caused by an increase in lv diastolic pressure, which may result from alterations in lv diastolic and/or systolic function. in clinical studies, in fact, an increase in left atrium diameter can be considered an early indicator of diastolic dysfunction. physical exercise attenuated myocardial dysfunction as dm - ex had papillary muscle parameter values between those of dm - sed and c - ex but not significantly different from either group, except for lower dt / dt after isoproterenol stimulation than c - ex. in dm - ex, the pulmonary congestion marker (wet / dry lung weight ratio) also presented values between those of dm - sed and c - ex. we can therefore conclude that exercise attenuated lung congestion, left atrium dilation, and systolic and diastolic myocardial dysfunction in diabetic rats. physical exercise has been previously shown to improve cardiac function in diabetic rats and attenuate diabetes - induced impaired fractional shortening, contraction velocity, and relaxation time in isolated cardiomyocytes [55, 63 ]. in diabetes, several myocardial changes can be involved in myocardial dysfunction. in this study, we evaluated myocyte hypertrophy, myocardial fibrosis, and oxidative stress as mechanisms potentially involved in the benefits of physical exercise. myocardial fibrosis was assessed by measuring myocardial concentration of hydroxyproline, an amino acid, and the main component of the collagen molecule which can only be found in small concentrations in a limited number of other proteins. myocyte hypertrophy, assessed by measuring the lower transverse diameter, also did not differ between groups. we can therefore conclude that myocardial fibrosis and myocyte hypertrophy are not involved in the cardiac effects of physical exercise. some authors have previously observed increased myocardial interstitial collagen in streptozotocin - induced diabetes rats [33, 64, 65 ] and attenuation by physical exercise [33, 65 ]. different data can result from the different methods used to evaluate myocardial fibrosis such as ultrastructural analysis, protein expression measurement by western blot technique, or morphometric analysis using sirius - red staining. diabetes increased oxidative stress as lipid hydroperoxide concentration was higher and the activity of antioxidant enzymes superoxide dismutase, catalase, and glutathione peroxidase was lower in dm - sed than c - sed. increased myocardial oxidative stress has previously been reported in diabetic rats [59, 66 ]. we have previously shown that myocardial oxidative stress in aged diabetic spontaneously hypertensive rats was associated with impaired myocardial and ventricular function. oxidative stress is a state of imbalance between reactive oxygen species production and endogenous antioxidant capacity. our data showed that diabetes induced both increased reactive oxygen species production and decreased antioxidant capacity due to reduced antioxidant enzymes activity. current knowledge indicates that oxidative stress plays a role as a major determinant of the onset and progression of diabetes - associated cardiovascular alterations [3, 8, 10 ]. although it has been established that oxidative stress plays a major role in the development of cardiovascular diseases, clinical studies have failed to show improved outcomes after antioxidant supplementation in preventing or treating cardiovascular diseases [67, 68 ]. while the mechanisms responsible for these poor results are not clear, researchers have directed their attention towards nonpharmacological therapy to reduce oxidative stress, with physical exercise attracting great interest. recent experimental studies have shown that chronic moderate exercise can decrease oxidative stress in skeletal muscles [69, 70 ]. in this study, we observed that physical exercise prevented an increase in myocardial lipid peroxidation and attenuated a decrease in antioxidant enzymes activity. additional studies are needed to elucidate the mechanisms involved in exercise - induced decrease in myocardial oxidative stress during diabetes mellitus. studies have shown that increased oxidative stress jeopardizes myocardial function through mechanisms such as microvascular damage, abnormalities in calcium homeostasis, and endothelial dysfunction. although a causative role could not be demonstrated in this study, myocardial oxidative stress may have been involved in the exercise - induced improvement in myocardial function and cardiac remodeling in diabetes rats. our data therefore support the idea of the beneficial role of low intensity exercise in myocardial function and cardiac remodeling in rats with unmanaged type 1 diabetes mellitus. in conclusion, low intensity physical exercise attenuates myocardial oxidative stress, lung congestion, left atrium dilation, and myocardial dysfunction in type 1 diabetic rats. | we evaluated the effects of a low intensity aerobic exercise protocol on cardiac remodeling and myocardial function in diabetic rats. wistar rats were assigned into four groups : sedentary control (c - sed), exercised control (c - ex), sedentary diabetes (dm - sed), and exercised diabetes (dm - ex). diabetes was induced by intraperitoneal injection of streptozotocin. rats exercised for 9 weeks in treadmill at 11 m / min, 18 min / day. myocardial function was evaluated in left ventricular (lv) papillary muscles and oxidative stress in lv tissue. statistical analysis was given by anova or kruskal - wallis. echocardiogram showed diabetic groups with higher lv diastolic diameter - to - body weight ratio and lower posterior wall shortening velocity than controls. left atrium diameter was lower in dm - ex than dm - sed (c - sed : 5.73 0.49 ; c - ex : 5.67 0.53 ; dm - sed : 6.41 0.54 ; dm - ex : 5.81 0.50 mm ; p < 0.05 dm - sed vs c - sed and dm - ex). papillary muscle function was depressed in dm - sed compared to c - sed. exercise attenuated this change in dm - ex. lipid hydroperoxide concentration was higher in dm - sed than c - sed and dm - ex. catalase and superoxide dismutase activities were lower in diabetics than controls and higher in dm - ex than dm - sed. glutathione peroxidase activity was lower in dm - sed than c - sed and dm - ex. conclusion. low intensity exercise attenuates left atrium dilation and myocardial oxidative stress and dysfunction in type 1 diabetic rats. |
intravenous (iv) induction during general anesthesia (ga) is common practice in modern anesthesia. avoidance of neuromuscular blocking (nmb) drugs is an unusual requirement, in surgical procedures that mandates no paralysis (e.g., selective nerve stimulation to aid in dissection), anticipated difficult airway, or in children with difficult iv access. in an earlier study by van twest. a target bispectral index (bis) value of 25 provided good to excellent intubating conditions over target bis of 40 with sevoflurane induction of anesthesia without the use of nmb drugs. studies are needed to evaluate the time required to achieve target bis value of 25 versus 40 and tracheal intubation with sevoflurane inhalational induction as the primary outcome. hence we planned this study to compare the total time taken from inhalation induction to tracheal intubation at a bis value of 25 or 40. after approval of the institutional ethics committee and written informed consent, we enrolled 80 patients of american society of anesthesiologists physical status i and ii, 20 - 60 years, of either sex scheduled for elective surgical procedures requiring ga with tracheal intubation. exclusion criteria were ; history of significant systemic dysfunction, gastro - oesophageal reflux or a hiatus hernia, alcohol or substance abuse, previous or predicted difficult intubation, body mass index (bmi) > 30 kg / m, and pregnancy. all the patients received alprazolam 0.25 mg and ranitidine 150 mg per oral at night and 2 h before surgery as premedication. using computer generated random number table, an anesthesiologist not part of the clinical trial allocated the patients to either of the following two groups. group bis40 (n = 40) - intubation with oral cuffed tracheal tube (portex, uk) after induction with sevoflurane to reach a target bis value of 40 5 ; group bis25 (n = 40) - intubation with oral cuffed tracheal tube (portex, uk) after induction with sevoflurane to reach a target bis value of 25 5. on arrival of the patient in the operating room, iv access, and standard anesthesia monitoring (aestiva s/5 critical care monitor, datex ohmeda, helsinki, finland) was started. skin of the forehead was cleaned with an alcohol swab and dried with gauze before application of a disposable bis - quatro sensor strip (aspect medical systems inc., norwood, ma, usa) on the forehead in accordance to manufacturer 's instructions. bis was monitored and recorded using m - bis module (aestiva s/5 critical care monitor, datex ohmeda, helsinki, finland). iv midazolam 20 g / kg, fentanyl 0.5 g / kg, and glycopyrrolate 0.1 mg were given to all patients 5 min prior to induction of anesthesia. the intubating anesthetist (p.k) started the induction of anesthesia using semi - closed bain coaxial circuit at an oxygen gas flow rate of 6 l / min. the supervising anesthetist (k.k.g) increased sevoflurane (drager vapor 2000, abbott lab., germany) in increments of 1 - 2% up to a maximum of 6 - 8% to achieve the target bis value as per group allocation. the patient and intubating anesthetist were blinded to sevoflurane dial setting and the target bis value that was concealed as the supervising anesthetist (k.k.g) managed the sevoflurane dial settings and bis as per group allocation. the end - tidal sevoflurane concentration (etsevo) was measured using module m - caiov (s/5 critical care monitor, datex ohmeda, helsinki, finland). once the target bis value was reached, the supervising anesthetist maintained the target bis value for 2 min and the intubating anesthetist performed tracheal intubation. if the time to achieve target bis value was more than 10 min or a second attempt for tracheal intubation was required, then the intubating anesthetist was allowed to proceed with technique as appropriate for the procedure. an independent observer used a stopwatch to observe and record the time to reach the target bis value and tracheal intubation confirmed on capnography. the intubating conditions were graded according to the intubating conditions scoring table ; 3 - 4 = excellent, 5 - 6 = good, and 8 - 12 = poor / impossible. hemodynamic parameters were measured every one minute during preoxygenation, intubation, and up to 5 min following intubation. the patients were postoperatively followed for 24 h to observe any complications such as nausea, vomiting, awareness, sore throat, or any other adverse effect. the sample size was calculated based on an earlier study in which mean total time to achieve bis 25, and tracheal intubation were 8.6 2.4, and 7.1 1.6 min for bis 40. considering error of 0.05 and power of 90%, the sample size required was estimated to be 38 patients per group. to compensate for possible dropouts 40 patients data were analyzed using statistical package for the social sciences (spss) version 15.0 for windows. statistical analysis was performed using two - tailed sample t - test and chi - square test. mann - whitney u - test was used to compare intubation score between both the groups. the sample size was calculated based on an earlier study in which mean total time to achieve bis 25, and tracheal intubation were 8.6 2.4, and 7.1 1.6 min for bis 40. considering error of 0.05 and power of 90%, the sample size required was estimated to be 38 patients per group. to compensate for possible dropouts 40 patients data were analyzed using statistical package for the social sciences (spss) version 15.0 for windows. statistical analysis was performed using two - tailed sample t - test and chi - square test. mann - whitney u - test was used to compare intubation score between both the groups. eighty - five patients were enrolled for the study and of these five patients were excluded due to non - fulfilment of inclusion criteria ; rest 80 patients completed the study. the total time required from induction to tracheal intubation and mean values of etsevo (%) was lower in group bis40 as compared to bis25 (p = 0.001) [table 2 ]. the mean intubation score was superior in group bis25 as compared to group bis40 (p = 0.001) [table 3 ]. on post - hoc analysis, it was found that patients with lower bmi (< 20 kg / m) exhibited better intubation scores and required lower etsevo to achieve target bis value (p = 0.001) [table 3 ]. patient characteristics induction and intubation parameters in patients intubation score, etsevo with different bmi all the patients completed the study, and none of the patients in either group had a failure to achieve the target bis or required alternative means for tracheal intubation. a target bis of 40 was considered an adequate depth of anesthesia and hence one group was bis40. we planned tracheal intubation without the use of nmb drugs so a lower bis value of 25 was selected assuming that this may benefit in terms of tracheal intubation score. kimura. used etsevo concentration of 4.5 % and achieved a desirable intubating condition in 20 min without the use of bis. so far, a study by van twest. was the only study available to address the issue of bis guided intubation without the use of neuromuscular agents and there is no such study in the indian population. van twest. concluded that no difference existed in the time taken from induction to intubation with a target bis 25 or 40. in this study, patient 's in - group bis25 required greater time for induction to tracheal intubation possibly due to the greater time required for alveolar and the cerebral concentrations equilibration. the longer induction time in group bis25 and greater etsevo (%) allowed for greater absorption of sevoflurane into the effect site tissues (brain, spinal cord) and provided greater relaxation of jaw muscles and obtunded airway reflexes to a greater degree. the triad of anesthesia is sedation, analgesia, and muscle relaxation and omission one of these are likely to effect the time to achieve target bis and tracheal intubation, which is a clinical outcome. the present study proved that greater time required for induction to tracheal intubation in patients of group bis25 relates to adequate intubating conditions to allow successful intubation without increasing the incidence of hemodynamic instability or side effects as compared to group bis40. fentanyl when used in higher doses of 2 - 4 g / kg reduces the required etsevo and intubation response. in this study, patients had lower mean bmi 22.4 2.2 kg / m as compared to 26.2 2.9 kg / m in the study conducted by van twest. patients with bmi (< 20 kg / m) exhibited excellent intubation scores and needed lower values of etsevo to achieve the target bis (p = 0.001). the explanation in this regard is better jaw relaxation and lesser response to intubation in our patients due to lesser muscle mass. therefore, bis guided tracheal intubation during inhalational induction may be especially useful in patients with lower bmi, as it is a more accurate measurement of the depth of anesthesia and overcomes the physiological variability in these patients, which may not be alone possible with etsevo. the effect of bis on tracheal intubation in patients with bmi < 20 kg / m was underpowered and requires further randomized clinical trials. we used a low dose of fentanyl during the induction period, and the results may differ with a higher dosage of fentanyl. the total time from induction to tracheal intubation was greater with sevoflurane induction at a target bis value of 25 as compared to 40 but with better intubation score. | background and aims : a target bispectral index (bis) value of 40 is considered adequate for depth of anesthesia, but no consensus exists regarding bis value for tracheal intubation without neuromuscular blocking drugs. the aim of this randomized, double - blinded study was to compare the total duration from sevoflurane induction to tracheal intubation at a bis value of 25 or 40.material and methods : this study was a prospective, randomized and observer - blinded clinical trial. after approval of the institutional ethics committee and written informed consent, 80 patients of american society of anesthesiologists physical status i - ii, aged 20 - 60 years, of either sex, requiring general anesthesia with tracheal intubation were enrolled. the patients were randomized to either group bis40-intubation at a target bis value of 40 5 or group bis25-intubation at a target bis value of 25 5. the intubating conditions, hemodynamic, and adverse effects were observed in both the groups.results:this study showed that the total time required from induction to tracheal intubation was 4.9 0.9 min in group bis40 as compared to 6.3 0.5 min in group bis25 (p = 0.001) using two - tailed sample t - test. the mean intubation score was 6.5 0.9 in group bis40, and 5.1 0.7 in group bis25 (p = 0.001) using mann - whitney u-test.conclusion:the time to achieve target bis value of 25 was greater as compared to target bis value of 40 during sevoflurane induction but provided better intubating conditions in the absence of neuromuscular agents. |
eight male new zealand white rabbits, weighing approximately 3 kilograms each, were included in this study. these rabbits were anesthetized with an intravenous injection of ketamin (40 mg / kg) and xylazine (5 mg / kg), and placed in the right decubitus position ; thus, allowing a retroperitoneal approach to the left renal hilum. the left flank was incised, the retroperitoneal space dissected, and the left renal hilum exposed through the posteromedial aspect of the kidney. the segmental left renal artery supplying the lower pole was isolated and ligated with surgical silk. the incised flank was immediately closed in four rabbits following the surgical procedure in order to cause a permanent segmental infarction. in the remaining four rabbits, the segmental arterial obstruction was released 60 minutes later after ligation, to cause transient renal ischemia and reperfusion, and then the incised flank closed. gray - scale and contrast - enhanced color doppler us imaging were performed using a sequoia 512 system (siemens medical solution, mountain view, ca, usa), equipped with a linear array transducer of 8 - 15 mhz. the doppler us gain was gradually increased until background noise was observed, which was then reduced just enough to remove the noise from the appearance of the kidney. intravenous anesthesia was performed with ketamin (40 mg / kg) and xylazine (5 mg / kg) prior to the us scan. sh u 508a (levovist ; schering ag, berlin, germany) was used as the us contrast agent, which consisted of galactose microparticles (99.9%) and palmitic acid (0.1%). a total of 300 mg of the us contrast agent (100 mg per kilogram) was intravenously administered as a manual bolus injection. us images were obtained on preoperative day one, immediate after wound repair, and when scheduled on postoperative days (pod) one, three, seven, 14 and 28. immediately after the final us imaging on pod 28, all rabbits were sacrificed with an overdose of intravenous thiopental sodium, and the left kidneys harvested for histological examination, which were fixed in formalin and stained with hematoxylin and eosin. the imaging features of the involved renal parenchyma were compared between the renal ischemia and infarction groups, on gray - scale us images, for the presence or absence of parenchymal swelling, echogenicity changes and tissue loss. parenchymal swelling was graded as follows : mild (mildly swollen with no obliteration of renal sinus), moderate (moderately swollen enough to compress the renal sinus by less than half of the normal sinus thickness) and severe (severely swollen enough to compress the renal sinus by more than half of normal sinus thickness). echogenicity changes or tissue loss were graded as follows : mild (echogenicity change or tissue loss of less than one third of the lower polar parenchyma), moderate (echogenicity change or tissue loss between one third and two thirds of the lower polar parenchyma) and severe (echogenicity change or tissue loss of more than two thirds of the lower polar parenchyma). on contrast - enhanced color doppler us images, the perfusion defects of the involved renal parenchyma were compared between the ischemia and infarction groups, and graded as follows : mild (perfusion defect of less than one third of the lower polar parenchyma), moderate (perfusion defect between one third and two thirds of the lower polar parenchyma) and severe (perfusion defect of more than two thirds of the lower polar parenchyma). eight male new zealand white rabbits, weighing approximately 3 kilograms each, were included in this study. these rabbits were anesthetized with an intravenous injection of ketamin (40 mg / kg) and xylazine (5 mg / kg), and placed in the right decubitus position ; thus, allowing a retroperitoneal approach to the left renal hilum. the left flank was incised, the retroperitoneal space dissected, and the left renal hilum exposed through the posteromedial aspect of the kidney. the segmental left renal artery supplying the lower pole was isolated and ligated with surgical silk. the incised flank was immediately closed in four rabbits following the surgical procedure in order to cause a permanent segmental infarction. in the remaining four rabbits, the segmental arterial obstruction was released 60 minutes later after ligation, to cause transient renal ischemia and reperfusion, and then the incised flank closed. gray - scale and contrast - enhanced color doppler us imaging were performed using a sequoia 512 system (siemens medical solution, mountain view, ca, usa), equipped with a linear array transducer of 8 - 15 mhz. the doppler us gain was gradually increased until background noise was observed, which was then reduced just enough to remove the noise from the appearance of the kidney. intravenous anesthesia was performed with ketamin (40 mg / kg) and xylazine (5 mg / kg) prior to the us scan. sh u 508a (levovist ; schering ag, berlin, germany) was used as the us contrast agent, which consisted of galactose microparticles (99.9%) and palmitic acid (0.1%). a total of 300 mg of the us contrast agent (100 mg per kilogram) was intravenously administered as a manual bolus injection. us images were obtained on preoperative day one, immediate after wound repair, and when scheduled on postoperative days (pod) one, three, seven, 14 and 28. immediately after the final us imaging on pod 28, all rabbits were sacrificed with an overdose of intravenous thiopental sodium, and the left kidneys harvested for histological examination, which were fixed in formalin and stained with hematoxylin and eosin. the imaging features of the involved renal parenchyma were compared between the renal ischemia and infarction groups, on gray - scale us images, for the presence or absence of parenchymal swelling, echogenicity changes and tissue loss. parenchymal swelling was graded as follows : mild (mildly swollen with no obliteration of renal sinus), moderate (moderately swollen enough to compress the renal sinus by less than half of the normal sinus thickness) and severe (severely swollen enough to compress the renal sinus by more than half of normal sinus thickness). echogenicity changes or tissue loss were graded as follows : mild (echogenicity change or tissue loss of less than one third of the lower polar parenchyma), moderate (echogenicity change or tissue loss between one third and two thirds of the lower polar parenchyma) and severe (echogenicity change or tissue loss of more than two thirds of the lower polar parenchyma). on contrast - enhanced color doppler us images, the perfusion defects of the involved renal parenchyma were compared between the ischemia and infarction groups, and graded as follows : mild (perfusion defect of less than one third of the lower polar parenchyma), moderate (perfusion defect between one third and two thirds of the lower polar parenchyma) and severe (perfusion defect of more than two thirds of the lower polar parenchyma). all rabbits, with the exception of one, survived until pod 28, the last day of us imaging. various abscesses occurred in the perirenal area or in the left flank wall, but these responded to antibiotics. table 1 summarizes the imaging features of the gray - scale us in the ischemic and infarction groups. parenchymal swellings in the ischemic and infarction groups peaked on pod three and seven, respectively, by normalized by pod 14. renal ischemic and infarction areas showed hypoechoic parenchyma before pod seven, which were then replaced with a hyperechoic area. the hyperechoic area in the renal ischemic group was greatest at pod seven, and then gradually reduced until pod 28. a hyperechoic area in the infarction group was observed at pod seven, which did not alter until pod 28. parenchymal tissue loss was observed in both groups at pod 14, with the infarction group showing more tissue loss than the ischemia group. table 2 summarizes the perfusion defect changes in the two groups according to the postoperative day. the ischemic group showed the most extensive perfusion defect area on pod one. this imaging feature improved from pod three, and appeared as a mild perfusion defect on pod 28. normal renal perfusion of the lower polar parenchyma did not fully recover in the ischemic group. however, the hyperechoic areas that showed blood flow recovery after reperfusion regained normal echogenicity and perfusion, but the hyperechoic areas that were not reperfused became infarcted. the rabbits that underwent renal infarction showed complete perfusion defect of the lower polar parenchyma and no recovery of renal perfusion at pod 28. the pathological specimens obtained from the ischemic group showed minimal tissue loss of the lower polar parenchyma, as a result of coagulation necrosis of the renal tubules and glomeruli. however, those obtained from the infarction group showed severe tissue loss and hemorrhage, as a result of extensive necrosis of the lower polar parenchyma. table 1 summarizes the imaging features of the gray - scale us in the ischemic and infarction groups. parenchymal swellings in the ischemic and infarction groups peaked on pod three and seven, respectively, by normalized by pod 14. renal ischemic and infarction areas showed hypoechoic parenchyma before pod seven, which were then replaced with a hyperechoic area. the hyperechoic area in the renal ischemic group was greatest at pod seven, and then gradually reduced until pod 28. a hyperechoic area in the infarction group was observed at pod seven, which did not alter until pod 28. parenchymal tissue loss was observed in both groups at pod 14, with the infarction group showing more tissue loss than the ischemia group. table 2 summarizes the perfusion defect changes in the two groups according to the postoperative day. the ischemic group showed the most extensive perfusion defect area on pod one. this imaging feature improved from pod three, and appeared as a mild perfusion defect on pod 28. normal renal perfusion of the lower polar parenchyma did not fully recover in the ischemic group. however, the hyperechoic areas that showed blood flow recovery after reperfusion regained normal echogenicity and perfusion, but the hyperechoic areas that were not reperfused became infarcted. the rabbits that underwent renal infarction showed complete perfusion defect of the lower polar parenchyma and no recovery of renal perfusion at pod 28. the pathological specimens obtained from the ischemic group showed minimal tissue loss of the lower polar parenchyma, as a result of coagulation necrosis of the renal tubules and glomeruli. however, those obtained from the infarction group showed severe tissue loss and hemorrhage, as a result of extensive necrosis of the lower polar parenchyma. many clinical and experimental studies have described the findings of renal infarction with the use of us, ct or mri (1 - 10). renal infarction is usually diagnosed based on the ct findings, including a sharply demarcated area of poor contrast enhancement, a hyperdense cortical rim and subcapsular fluid collection (3, 4, 10). mri can also be useful for the detection of renal infarction, and in this case usually appears as areas of low signal intensity on both t1- and t2-weighted mr images, and as a region of poor contrast enhancement on contrast - enhanced mr images (1, 2, 6, 7). doppler us has the ability to depict focal perfusion defects by clearly visualizing fine small vessels in the renal parenchyma (5, 9). moreover, gray - scale us can show echogenicity changes in the infarction areas, including hypoechoic and hyperechoic involved parenchyma in the early and late stages of the infarction, respectively (8). however, previous studies have primarily focused on the renal infarction, so have not addressed the transient renal ischemic changes. moreover, these must be differentiated from renal infarction, as renal ischemia is theoretically reversible ; whereas, renal infarction is not. therefore, it is of some great importance to obtain imaging features that are able to differentiate renal ischemia from renal infarction during evaluation of the management and prognosis of patients with a renal vascular impairment. in the present study, gray - scale us and contrast - enhanced color doppler us were able to depict potentially differentiating features of renal ischemia and renal infarction. during the early pod, parenchymal swelling, hypoechogenicity and reduced renal perfusion were common us imaging features in both the ischemic and renal infarction groups. however, the reperfused hyperechoic areas, unlike the infarct areas, returned to being normal parenchyma. this imaging feature should be considered a differential us imaging feature of renal ischemia and renal infarction. on the contrary, hyperechoic areas without reperfusion proved irreversible, and became infarcted. reported that renal parenchymal hyperechogenicity followed hypoechogenicity after arterial occlusion, and these regions corresponded pathologically to infarction (8). however, our study demonstrated that reperfused hyperechoic renal parenchyma was able to recover normal echogenicity and perfusion. the hyperechoic area corresponded pathologically to an ischemic penumbra area, which does not determined whether this lesion returned to normal or became infarcted. this should depend on the presence or absence of arterial reperfusion to the renal ischemic area. (11), who reported that renal infarction occurs when renal artery was occluded for more than 90 minutes. in our pilot study, 60 minutes was found to be the optimal ischemic duration for depiction of renal ischemia and infarction on us. 30 minute duration failed to visualize the ischemic or infarction area on us because the involved area was too small ; whereas, 90 minute duration made it impossible to differentiate renal ischemia from infarction as all involved area had become totally infarcted. our study had several limitations ; first, a relatively small number of cases were included. second, us imaging features at the early stage of renal ischemia and infarction did not correlate with those of the pathological examination. third, subcapsular rim enhancement was not observed on the contrast - enhanced color doppler us. this was why the subcapsular arteries might have been injured when the left kidneys were isolated from the perirenal space. in conclusion, gray - scale and contrast - enhanced color doppler us were found to have the potential to depict various imaging features as a result of renal ischemia and renal infarction. a hyperechoic region, with normal blood flow, may be a reversible us feature to provide a clue to the differentiation of renal ischemia from renal infarction. | objectiveto characterize the imaging features on gray - scale and contrast - enhanced color doppler us images which differentiate renal ischemia from renal infarction.materials and methodsthe segmental renal arteries of eight healthy rabbits were surgically ligated. in four of these rabbits, the ligated renal artery was released 60 minutes after arterial occlusion to cause transient ischemia. in the remaining four rabbits, the arterial ligation was retained to cause a permanent infarction. the gray - scale and contrast - enhanced color doppler us imaging features of the involved renal parenchyma of both ischemia and infarction groups were compared with respect to the presence or absence of parenchymal swelling, echogenicity changes, tissue loss and perfusion defects.resultsparenchyma swelling, echogenic changes, tissue loss and perfusion defects were found to be more extensive in the infarction than the ischemia group. the hyperechoic areas reperfused with blood flow recovered normal echogenicity and perfusion, whereas the hyperechoic areas without reperfusion became renal infarcts.conclusiongray-scale and contrast - enhanced color doppler us showed that the hyperechoic areas with reperfusion may reverse to normal parenchyma and allow the differentiation of renal ischemia from renal infarction. |
the seronegative spondyloarthopathies (spa) that include ankylosing spondylitis (as), reactive arthritis, and arthritis associated with psoriasis or inflammatory bowel disease, and juvenile onset spondyloarthropathy, share certain common articular and peri - articular features that differ from rheumatoid arthritis (ra) and other forms of inflammatory arthritis. these differences include the tendency of the spas to involve the axial skeleton in addition to the diarthrodial joints [1, 2 ], and the prominent involvement of the extra - articular entheses (sites of ligamentous and tendon insertion), which are not common sites of primary pathology in ra and other inflammatory arthropathies. the differential anatomic sites of the articular and peri - articular bone pathology in the spas in comparison to the other forms of arthritis suggests that the underlying pathogenic processes that account for the peri - articular inflammation involve different underlying disease mechanisms. analysis of the inflamed tissues at sites of skeletal pathology support this hypothesis, in that the cell types and profiles of inflammatory mediators differ in the spas in comparison to ra and other forms of inflammatory arthritis. many of the mediators involved in the de - regulation of bone cell activity in the spas and ra also function as potent regulators of the immune system. this observation has led to the development of a specialized field of investigation that is generally identified as osteoimmunology. this review will highlight the molecular and cellular processes that are involved in the pathogenesis of the skeletal pathology in the spas, and provide evidence that many of the factors involved in regulation of bone cell function exhibit potent immune - regulatory activity, providing support for the general concept of osteoimmunology. peri - articular bone is organized into distinct structural entities that include the subchondral bone plate, which is comprised of compact cortical bone, and a deeper zone of contiguous trabecular bone that is encased within the bone marrow. the bone that forms the joint margins and extends distally from the joint surface is also comprised of compact bone that is lined by the periosteum. the peri - articular bone at all of these sites undergoes marked changes in response to biological and biomechanical signals produced by the local inflammatory processes associated with the spas. these bone changes are mediated by bone cells that modify the architecture and properties of the bone through active cellular processes of modeling and remodeling. modeling is a process that involves direct osteoblast - mediated apposition of bone to existing bone surfaces without a resorptive phase. remodeling involves the recruitment of monocytic osteoclast precursors to the bone surface followed by differentiation of these cells into osteoclasts that are uniquely adapted to removal of the mineralized bone matrix. multiple lines of evidence have established that the osteoclast is required for resorption of bone under physiologic conditions of bone remodeling [4, 5 ]. the role of the osteoclast in pathologic states associated with spa and other forms of inflammatory arthritis the phase of osteoclast - mediated bone resorption is followed by a so - called reversal phase after which the resorbed bone surface is populated by precursors of the osteoblast, which are of mesenchymal origin. the osteoblast lineage cells then undergo differentiation into mature bone - forming osteoblasts that replace the resorbed bone. remodeling occurs during embryonic development and throughout post - natal life, and provides a cellular system for adapting bone to biomechanical influences, repairing damage to the bone matrix and, under certain conditions, releasing calcium for maintenance of mineral ion homeostasis. importantly, under physiological conditions, the amount of bone that is removed during the phase of bone resorption is exactly matched by the amount of bone that is added during the phase of bone formation, such that bone mass is preserved during the remodeling cycle. the mechanisms that are involved in the coupling of the bone resorption and formation are not fully understood. both transforming factor- (tgf-) and bone morphogenic proteins (bmp) are growth factors that are sequestered within the bone matrix during osteoblast - mediated bone formation, and their release during the phase of osteoclast - mediated bone resorption represents a potential mechanism for linking the resorptive process to bone formation [6, 7 ]. there is also evidence that osteoclasts may themselves be the source of factors that can function either as inhibitors or activators of osteoblast differentiation and activity [8, 9 ]. in the spas, the so - called coupling of bone formation and resorption is de - regulated such that there is localized loss of bone in the entheseal insertion sites and excessive bone formation in periosteal sites adjacent to the sites of bone erosion. etheseal inflammation is a unique feature of the spas that results in characteristic skeletal pathological changes. at these sites, the new bone is added by a process of endochondral ossification that recapitulates the cellular mechanisms of bone growth that occur during skeletal growth and development in which new bone is formed by replacement of a cartilaginous matrix. syndesmophytes, which are one of the radiographic hallmarks of the spas, represent examples of ossification at the margins of vertebral bodies that are formed via the process of endochondral ossification. local production of bone growth factors, including tgf- and bmps, which play a role in endochonral bone formation during development and post - natally in fracture repair, have been implicated in this process [1014 ]. recent studies have identified the role of the osteocyte in contributing to the regulation of bone remodeling [15, 16 ]. they are embedded within the bone matrix where they form an interconnected network with each other and with the cells on the bone surface. in response to mechanical signals, local soluble mediators and systemic hormones release products that control the activities of the osteoclasts and osteoblasts involved in the remodeling process. two of these osteocyte - derived products, receptor activator of nf-b ligand (rankl) and sclerostin, play essential roles in regulating bone remodeling. rankl was originally identified as tnf - related activation - induced cytokine (trance) that regulated dendritic cell activity and played a role in development of the immune system [17, 18 ]. subsequently, rankl was shown to be a master regulator of osteoclast differentiation that was required for formation of osteoclasts and bone resorption [19, 20 ]. production of rankl by osteocytes enhances osteoclast - mediated bone resorption in response to mechanical stimuli and hormones such as parathyroid hormone [15, 16 ]. sclerostin is a product of the sost gene, which is a potent inhibitor of the wnt/catenin signaling pathway that contributes to the regulation of bone formation. the expression of this gene is regulated in part by mechanical factors and soluble mediators such as prostaglandins [22, 23, 24 ]. the dickkopf (dkk) family of proteins, which are produced by a variety of cell types, also inhibit bone formation by interfering with signaling by the wnt/catenin pathway [21, 25 ]. both dkk-1 and sclerostin, as well as soluble frizzled related protein (sfrp), which binds wnt ligands involved in activation of the wnt/catenin pathway, are implicated in the suppression of bone repair in ra. as will be discussed in the following section, the reduced production of these inhibitors of bone formation likely contributes to the excessive bone formation that characterizes the skeletal pathology in the spas. investigators have utilized mri and anatomic and histopathological analysis to examine the pathological changes at the entheses, which are primary sites of inflammation in the spas [12, 26, 27, 28 ]. the inflammatory tissue often extends to the synovial lining, which exhibits synovial hyperplasia, lymphocytic infiltration, and pannus formation. the development of synovial pannus and entheseal inflammation is also accompanied by inflammatory cell infiltration in the subchondral bone marrow. cells with morphological features of osteoclasts can be identified at the interface between the bone surface and the inflammatory tissue associated with bone erosions, providing evidence that, similar to ra, osteoclasts are the cell type responsible for the pathological bone resorption. studies employing animal models of inflammatory arthritis in which osteoclast formation is defective have helped to provide strong evidence that osteoclasts are the principal cell type responsible for the pathological bone resorption in inflammatory arthropathies. they showed that the rankl knock - out mice, which lacked the capacity to form osteoclasts, were protected from the development of bone erosions despite a level of synovial inflammation comparable to the wild - type mice. subsequently, other investigators [31, 32 ] provided further evidence demonstrating the requirement for osteoclasts in the pathogenesis of bone erosions utilizing additional murine models of inflammatory arthritis. as described in the preceding discussion, a striking feature of the skeletal pathology in the spas is the presence of enhanced bone formation associated with the entheseal and synovial pathology. braun analyzed tissues from inflamed sacroiliac joints obtained from patients with as, and noted the presence of dense infiltrates of cd14 positive macrophages and cd4 and cd8 t lymphocytes. analysis, using in situ hybridization, revealed that many of the inflammatory cells expressed abundant messenger rna for tumor necrosis factor- (tnf-), but not interleukin il-1 (il-1). of interest, tgf-2 message was noted in close proximity to the regions of new bone formation.. examined synovial biopsies from patients with as and ra and detected high levels of bmp-2 and -6 expression in synovial fibroblasts and macrophages. they also showed that treatment of synovial fibroblasts with tnf- or il-1 increased bmp-2 and bmp-6 expression, providing a potential mechanism for the enhanced production of these bone growth factors in the inflamed synovial tissues. the detection of the bone growth factors in the ra synovium was surprising in light of the absence of new bone formation at sites of synovial pathology in ra, and they speculated that the suppression of bone repair could be related to the production in the ra synovium of potent factors that inhibit osteoblast - mediated bone formation. diarra and co - workers have provided insights into the mechanism responsible for the suppressed bone formation and repair associated with the synovial lesion in ra using animal models of ra. analysis of inflamed synovial tissues in animals with arthritis revealed high levels of expression of dkk-1, the potent inhibitor of the wnt/catenin pathway. they also analyzed synovial tissue from ra patients and found that dkk-1 was expressed in synovial fibroblasts, endothelial cells, and in chondrocytes located in cartilage immediately adjacent to sites of pannus invasion. using in vitro cell cultures they showed that tnf- markedly increased the production of dkk-1 in cultured synovial fibroblasts. analysis of the serum levels of dkk-1 in ra patients revealed that dkk-1 levels were elevated in ra patients compared to healthy controls, and that dkk-1 levels correlated with measures of clinical disease activity. in contrast, in patients with as, the serum dkk-1 levels were below the levels in the healthy control population. in studies by diarra treatment of animals with arthritis with an antibody to dkk-1 resulted in increased bone repair, but in addition they unexpectedly observed a marked inhibition in focal articular bone resorption. the effect on bone resorption was attributed to an increase in the production of osteoprotegerin (opg), the potent inhibitor of rankl. they speculated that the increase in opg was related to inhibition of dkk-1 and resultant up - regulation of the wnt pathway that led to activation of catenin, which transcriptionally enhances opg gene expression [33, 34 ]. quantitative polymerase chain reaction was used to evaluate the expression levels of a spectrum of wnt pathway inhibitors in retrieved synovial specimens from arthritic and wild type animals. they showed that the levels of several members of the dkk-1 family, as well as the soluble frizzled related protein (sfrp), were elevated in the synovial tissues from animals with arthritis compared to the controls, and employing immunostaining confirmed the local expression of dkk-1 and sfrp1 in synovial tissue at sites of erosions., appel and co - workers found that serum levels of dkk-1 were reduced in patients with as compared to healthy controls. in addition, using serial samples, they showed serum sclerostin levels correlated with the propensity to form syndesmophytes and noted that low serum sclerostin levels were associated with the formation of new syndesmophytes. they also analyzed bone tissue from joints from patients with as and noted the virtual absence of sclerostin expression in osteocytes at sites of new bone formation, providing further evidence that the lack of suppression of the wnt/catenin signaling contributed to the enhanced bone formation. [28 ] provides further evidence of the unique interplay between the bone and immune systems. employing a murine model of as, the authors identified the presence of t cells that were responsive to il-23 in the entheses. il-23 is a cytokine that previously had been linked to the pathogenesis of both articular and extra - articular inflammation in the spas [36, 37 ]. importantly, they showed that overexpression of il-23 was sufficient to induce a destructive enthesitis with histopathologic and bone remodeling features that pheno - copied the features of as. they found that both il-17 and il-22 contributed to the pathology, and that il-22 was the predominant effector molecule. they further showed that il-22 could induce osteoblast differentiation via effects on the wnt and bmp pathways, providing a link between the proinflammatory and immunomodulatory activities of this cytokine and its capacity to modulate bone remodeling and enhance bone formation at sites of inflammation. the bone anabolic effects of il-22 are not unique to this cytokine, and other proinflammatory cytokines also have been shown to have pro - osteogenic effects. these include, il-1, il-17, il-18, il-33 and oncostatin m, which under certain conditions can enhance osteoblast differentiation [3841 ]. although the specific mediators have not been rigorously defined, t cells and monocyte macrophage lineage cells have also been shown to exert pro - osteogenic effects on osteoblast precursors, providing additional evidence that under certain conditions immune cells and their products may contribute not only to catabolic processes but also participate in anabolic tissue responses, at least with respect to bone [4245 ]. mri imaging has been extensively utilized to study the inflammatory bone pathology associated with the spas. in these studies, so - called osteitis is manifest by the presence of an increased signal on stir sequences. the altered signals have been identified in multiple skeletal sites, including the sacroiliac and zygapophyseal joints and the vertebral bodies, where they are most often localized to the endplates or corners of the vertebral bodies. histopathological examination of tissues from these sites has confirmed the presence of inflammatory cell infiltration with monocyte macrophages and t and b cells accompanied by variable degrees of edema [4749 ]. multiple previously published studies in patients with as have observed that, although anti - tnf- therapy effectively suppresses entheseal and synovial inflammation, the treatment does not prevent progression of syndesmophyte formation [5053 ]. some authors have interpreted these findings to suggest that the formation of syndesmophytes following resolution of inflammation after anti - tnf therapy supports the theory that tnf- acts as a brake on bone formation, and that blockade of its activity releases this constraint and allows new bone formation [5456 ]. an alternate explanation is that inflammation and new bone formation may be independent of each other, and that the pathogenic processes responsible for the enhanced bone formation may escape control by the therapies such as anti - tnf- that suppresses the inflammatory process. a recent publication by baraliakos. [57 ] has provided data on the long - term follow - up of patients with as treated successfully with anti - tnf therapy. they compared the radiographic progression of syndesmophytes in as patients treated with infliximab versus historical controls who had not received tnf - blockers over 8 years. although there were limitations in the study design, their data indicated that there was less new bone formation in patients treated with anti - tnf therapy, and they suggested that the processes of inflammation and new bone formation were in fact linked. they speculated that this argued against the hypothesis of a mechanism for the development of excessive new bone formation that was independent of inflammation. paradoxically, although individuals with spa exhibit localized regions of enhanced bone formation at sites of spinal inflammation, many patients have evidence of marked osteopenia of the spinal column. studies indicate that disease burden correlates with the osteoporosis and osteopenia and importantly the presence of decreased bone mass is associated with an increased risk of fracture [58, 59 ]. the bone loss has been ascribed to spinal immobility. however, other studies [61, 62 ] have demonstrated that osteopenia may occur, even in the absence of bony ankylosis, and the authors speculated that the osteopenia was attributable to local effects of inflammatory mediators released from the sites of joint pathology, rather than immobilization. of interest, marzo - ortega. demonstrated that bmd improves in patients with spa who show clinical responses to the tnf- blocker, etanercept. in summary, under physiological conditions, bone remodeling is initiated by activation of osteoclast - mediated bone resorption followed by a phase of osteoblast - mediated bone formation. these cellular processes are tightly coupled such that bone structure and mass are preserved during the remodeling cycle. in the spas, the cellular machinery of the remodeling unit is co - opted by inflammatory cells and their products, resulting in de - regulation of the remodeling process and uncoupling of bone resorption and formation. a unique feature of the spas in comparison to ra is the presence of enhanced bone formation at sites of inflammation. in part, this may be related to the localization of the inflammatory process to the entheses, but, in addition, there is evidence that the cytokine profiles and regulation of the wnt/catenin pathways in the spas may differ from the regulatory pathways in ra and other forms of inflammatory arthritis. many studies have observed that, although inhibition of inflammation with anti - tnf therapy reduces progression of bone erosions at sites of inflammation, enhanced bone formation may persist. the mechanisms involved in this apparent dissociation of inflammation and bone formation have not been fully elucidated. further studies are needed to confirm these observations and to integrate the findings into improving the treatment protocols for management of the spas. | the seronegative spondyloarthopathies (spa) share certain common articular and peri - articular features that differ from rheumatoid arthritis (ra) and other forms of inflammatory arthritis. these include the tendency of the spas to involve the axial skeleton in addition to the diarthrodial joints, and the prominent involvement of the extra - articular entheses (sites of ligamentous and tendon insertion), which are not common sites of primary pathology in ra and other inflammatory arthropathies. the differential anatomic sites of bone pathology in the spas in comparison to the other forms of arthritis suggest that the underlying pathogenic processes and cellular and molecular mechanisms that account for the peri - articular bone pathology involve different underlying disease mechanisms. this review will highlight the molecular and cellular processes that are involved in the pathogenesis of the skeletal pathology in the spas, and provide evidence that many of the factors involved in regulation of bone cell function exhibit potent immune - regulatory activity, providing support for the general concept of osteoimmunology. |
given the 1:500 prevalence of hypertrophic obstructive cardiomyopathy (hocm) in the general population, it may present to the anaesthesiologist more often than anticipated. we hereby describe how our anaesthetic technique (general anaesthesia with peripheral nerve blocks) for bilateral knee arthroplasty was well chosen for the perioperative management of such a patient. a 69-year - old female weighing 78 kg, a medically managed (atenolol 25 mg and amlodipine 10 mg once daily) case of hocm was scheduled for bilateral knee arthroplasty. there was no history of angina, syncopal attacks, or any sudden death in her family. systemic examination revealed a regular pulse rate of 68 beats / min, and a grade 3/6 crescendo - decrescendo systolic murmur was heard between the left sternal border and apical area, not radiating to the carotids. electrocardiography (ecg) showed normal sinus rhythm with nonspecific t wave changes in leads ii, iii, and avf with left ventricular hypertrophy and left axis deviation. echocardiography showed asymmetrical septal hypertrophy, left ventricular outflow tract obstruction (lvot) with peak systolic gradient (psg) of 56 mmhg, moderate mitral regurgitation and moderate diastolic dysfunction with ejection fraction of 56%. both cardiac drugs were continued till the morning of surgery along with a premedication of oral ranitidine 150 mg and alprazolam 0.25 mg. in the operating room, baseline blood pressure (bp), heart rate (hr) and respiratory rate (rr) were 160/90 mmhg, 68/minute and 14/minute, respectively. the patient was given injection metoprolol 2 mg, 80 mcg fentanyl and midazolam 2 mg intravenously, before establishing invasive monitoring (left radial blood pressure and right jugular venous pressure), opening central venous pressure (cvp) was 8 mmhg. a bolus of 8 ml of 2% lignocaine with 8 ml of 0.2% ropivacaine was injected in each femoral catheter before the incision of each side, followed by a continuous infusion of ropivacaine 0.2% 8 ml / hour intra and postoperatively. half an hour later, induction and intubation were accomplished using propofol 100 mg, morphine 8 mg, midazolam 1 mg and vecuronium 8 mg. mild hypotension occurred with bp falling to 100/50 mmhg, which was managed with a bolus of 200 ml crystalloid and injection phenylephrine 50 g. to prevent intubation stress, esmolol anaesthesia was maintained with 66% nitrous oxide in oxygen and isoflurane 0.2 - 0.4% (because of its myocardial depressive properties, halothane is an ideal agent in such patients but due to its nonavailability in our institute, isoflurane was used without any adverse haemodynamic changes) ; the average duration of both tourniquets was 35 to 40 minutes. at the time of both tourniquet deflations, systolic pressures dropped by more than 20% each time which responded to a judicious administration of crystalloid and phenylephrine 100 mcg. cvp remained between 8 and 10 mmhg and urine output was 500 ml with an input of 2.5 l of crystalloids. the surgery lasted for four hours ; neuromuscular blockade reversed with neostigmine 3.5 mg and glycopyrrolate 0.6 mg and esmolol 30 mg was given again to prevent exaggerated haemodynamic response at extubation. post extubation, the patient was haemodynamically stable (bp : 124/62 mmhg, hr : 74/minute) with saturation of 100% on oxygen of 2 l / minute. postoperatively, the patient was transferred to a special intensive care unit (icu) for further management. four hours later, we noted increase in heart rate upto 94 - 96 beats/ min ; bp was 110/75 mmhg, cvp and rr were10 mmhg and 33/ min respectively and desaturation up to 90% on room air, with bilateral drain loss of about 100 ml each. her pain assessment on a verbal analogue score was 6 (on a scale of 0 - 10). immediately, the oxygen was increased from 2 to 5 l / minute. for pain and tachycardia, a bolus of ropivacaine 0.2%, 8 ml was given through each femoral catheter along with metoprolol 2 mg intravenously, and liberal fluids continued. also, other parenteral analgesics like diclofenac, paracetamol and tramadol were started on a regular basis, as per our icu protocol. six hours postoperatively, dyspnoea persisted with the occurrence of bilateral fine crepts in chest now and cvp increased to 12 mmhg with heart rate and bp being 88 - 90 beats / min and 108/70 mmhg, respectively. so, furosemide 20 mg and another dose of metoprolol 2 mg were given intravenously. the patient passed about 1200 ml urine over the next three hours ; her tachycardia and tachypnoea both settled with an hr of 78/minute and rr of 20/minute and blood pressure increased to 136/67 mmhg. her daily dose of atenolol was increased from 25 mg once a day to 50 mg orally twice a day. forty - eight hours later, the patient was shifted from the icu after removing femoral catheters. hocm is marked by asymmetric hypertrophy of the left ventricle (left ventricular wall thickness > 15 mm), dynamic lvot obstruction due to systolic anterior motion of anterior valve leaflet of mitral valve and diastolic dysfunction caused due to impaired relaxation of noncompliant left ventricle.the patient may present from infancy to older than 90 years. although adverse clinical consequences of the disease, particularly sudden cardiac death, are well documented, a more balanced perspective regarding prognosis has recently evolved in which normal longevity is seen with relatively mild disability. a symptomatic patient may experience progressive heart failure with exertional dyspnoea, fatigue and chest pain, evolution to end - stage phase and atrial fibrillation (af). goals of anaesthetic management should aim at avoiding exacerbation of outflow tract obstruction (due to sympathetic stimulation), maintaining diastolic filling by maintenance of sinus rhythm and preventing fall in preload and afterload. centroneuraxial blocks, though not absolutely contraindicated, are still best avoided, because of the risk of profound bilateral sympathectomy and hypotension. though isolated measurements of cvp do not provide an accurate guide to left ventricular filling because of poor left ventricular compliance, serial recordings provide a useful trend. whenever sympathetic shootups were anticipated establishment of femoral nerve catheter and invasive lines, intubation and extubation good sedoanalgesia and adequate anaesthetic depth was provided with the beta blocker, esmolol. vasopressor phenylephrine was used as it increases systemic vascular resistance without ionotropy or chronotropy. for postoperative analgesia, our choice of continuous femoral nerve blocks (cfnbs) has many advantages over epidural analgesia like lack of hypotension and epidural haematoma associated with the use of anticoagulants, effective pain relief and improved functional recovery. till date, we have not found much literature on bilateral safe infusion doses of ropivacaine in peripheral nerve block for prolonged durations. our limitation is that we did not do serum values of ropivacaine because of lack of this facility in our institute. however, no signs or symptoms of toxicity were seen with our doses and patient satisfaction was good. according to standard teaching, sudden cardiac death is the most feared complication in perioperative setup, but maron. proposed two forms of disease, early onset and late onset. hocm in the elderly is less severe and has a more benign course, unlike the early onset of the disease in young adults, where more lethal complications like sudden cardiac death is seen. found congestive heart failure (chf) to be the predominant complication in elderly patients in the perioperative setup. this is related to diastolic dysfunction in hocm which causes increased diastolic filling pressures, pulmonary congestion and dyspnoea which is seen in 90% of the patients of hocm. the chief complaint of our patient, who was elderly, was also dyspnoea. focusing only on the lvot gradient and providing fluids aggressively may very well surpass the limits of cardiac compensation and precipitate chf. in our patient also, initial attempts to decrease ventricular gradient were fruitful to some extent by using beta blockers and local anaesthetic boluses for pain, but liberal fluids and diastolic dysfunction tipped the balance towards failure (desaturation and tachypnoea), which finally responded to the diuretic. at this stage, if epidural boluses had been given instead of femoral, the resulting hypotension and tachycardia would have complicated the picture. hence, our choice of postoperative analgesia was well chosen. in conclusion, we do need to understand hocm pathophysiology and prevent exacerbation of lvot obstruction, but recent literature shifts our focus from catastrophic obstructive complications like perioperative sudden cardiac death in young hocm to more benign anaesthetic course in elderly hocm. | this case report exemplifies how the anaesthetic technique of general anesthesia with continuous bilateral femoral nerve block for bilateral knee arthroplasty was well chosen for the management of perioperative complications in an elderly patient with hypertrophic obstructive cardiomyopathy (hocm). a 69-year - old female patient of hocm was scheduled for bilateral total knee replacement. echocardiography revealed severe left ventricular outflow tract obstruction with peak systolic gradient of 56 mmhg. the surgery was conducted under general anaesthesia with invasive monitoring and bilateral continuous femoral nerve blocks for postoperative analgesia. postoperatively, she developed pulmonary oedema due to the liberal administration of fluids. this complication was successfully managed without interrupting the management of pain. management of patients with hocm for noncardiac surgery requires knowledge of variable presentation of two forms of disease. also, this case report highlights the practical advantage of continuous femoral nerve block (cfnb)s over epidural anaesthesia. |
bladder cancer is the fifth most common malignancy in europe with more than 151,000 new cases diagnosed annually, accounting for 4.4% of all cancers excluding non - melanoma skin cancer. 70 to 80% of bladder tumors are classified as non - muscle invasive bladder cancer (nmibc). it was repeatedly demonstrated that, despite relatively high survival rates, up to 70% of these tumors recur and 20 - 30% progress into muscle - invasive cancer after local curative therapy. the standard treatment of nmibc is a complete transurethral resection of the bladder tumor (turbt), followed by intravesical instillation therapy in the presence of risk factors for recurrence or progression. while there has been a large number of studies demonstrating the ability to reduce the risk of recurrence of nmibc with different types of the intravesical therapy, less attention was paid to the quality of turbt in improving long - term treatment results. however, besides the standard risk factors for recurrence and progression of nmibc including clinical (frequency of recurrence, multifocality) and pathological (category pt, tumor grade) characteristics of the disease, the quality of turbt, which may vary depending on the experience and style of surgery, can also significantly influence the risk of tumor recurrence. a number of studies have shown that limited surgical experience, which is generally defined as being a resident, is associated with an increased risk of disease recurrence as compared to the staff members [4, 5 ]. however, even amongst experienced surgeons, there might be a considerable variability in the quality of turbt that could affect long - term outcomes, and this variability has not been sufficiently studied to date. the aim of this study was to evaluate the influence of the individual surgeon on the recurrence - free survival rate after the curative treatment of patients with nmibc. a retrospective analysis of the data was done by searching the institutional database for patients with histologically confirmed primary or recurrent nmibc, treated with visually complete turbt with or without intravesical therapy between 2004 and 2013. a total of 1,550 consecutive cases were identified. cases without follow - up data (n = 471) and operated by surgeons with fewer than 70 operations performed (n = 130) were excluded from the analysis. a total of 949 cases of organ preservation therapy in 784 patients (174 women and 610 men), with the age range from 23 to 93 years (median 67 years) remained in the study. in recurrent tumors, the inclusion of several cases per patient was allowed if the treatment fell within the period of the study and the case did not meet the exclusion criteria. in total, there were 284 such cases in 119 patients with the number of turbts ranging from 2 to 5 (median 2) per patient. the surgeons were coded from 1 to 5 according to an increase in the hazard ratio (hr) of recurrence. as a result, five surgical groups were created that included 225 (23.7%), 324 (34.1%), 78 (8.2%), 115 (12.1%) and 207 (21.8%) cases, respectively. homogeneity of the groups by the main prognostic factors was assessed with the test for categorical variables and one - way anova for continuous ones. recurrence - free survival was defined as the time from the turbt until the histologically confirmed recurrence or the last follow - up date. the data on follow - up were obtained from outpatient medical records and the national cancer registry. the rates of the recurrence - free survival by surgical group were calculated using the kaplan - meier method, a stratified analysis by recurrence risk group was also done. the log - rank test was used to assess the differences. to mitigate the imbalance in prognostic variables or adjuvant therapy use between surgical groups, the uni- and multivariate cox regression analyses were performed with adjustment to all potential prognostic factors. an explanatory analysis of the benefit of performing the surgical intervention by the two most successful surgeons as compared to the two least successful ones in various subgroups of patients was also conducted. the surgical groups were comparable with respect to age, gender, recurrence rate, t - stage, carcinoma in situ (cis) rate, eortc risk groups, and frequency of restaging turbts (table 1). however, there were statistically significant differences between the surgical groups in the period of therapy (p 3 cm, solid, t1, with high - risk of recurrence and without subsequent use of intravesical therapy). the distribution of early recurrence frequencies by the most and least successful surgeons stratified by the modified recurrence risk group (table 3) showed that the most divergent figures without overlapping cis were at 12 months after turbt. subgroup analysis of recurrence hazard ratio (hr) after transurethral resection (tur) performed by the two most successful (12) surgeons as compared to the two least successful (45). recurrence rate in the first 3, 6, and 12 months after turb performed by the two most and two least successful surgeons within different prognostic groups ci confidence interval, n number of patients with recurrences, n number of patients in the subgroup for many years, the cornerstone of recurrence prevention strategy in nmibc patients was the use of intravesical instillation therapy. the quality of the surgical part of the treatment has come to the attention of the urological community after the publication by brausi., who assessed the variability in the early recurrence rate (i.e. identified at the first follow - up cystoscopy 3 months after the turbt) between different urological clinics in the seven eortc phase iii trials including 2,410 patients with nmibc. as a result, a significant variability was detected in the early recurrence rate which ranged from 3% to 21% for patients with a single tumor and from 7% to 46% for multiple tumors. it was stated that those differences could only be explained by the variability in the quality of the turbt performed by individual surgeons, and a high rate of residual tumor after poor quality turbt is responsible for high early recurrence rates. subsequent studies were focused on establishing the causes of this variability, identifying the criteria for the quality of turbt, and finding ways to improve the thoroughness of the surgery. later in the eortc quality control study on turbt, brausi. showed that after adjustment for prognostic factors the reduction in the recurrence rate was associated with the use of a bladder diagram and being a staff urologist rather than a resident or a chief [6, 7 ]. in a retrospective study, jacke. evaluated the impact of surgical experience on the recurrence and progression rates in 768 patients with primary nmibc. they found a substantial decrease in the risk of recurrence after turbts performed by specialized urologists as compared to residents (op = 0.68, 95% ci 0.530.87), but the risk of progression was basically the same (op = 0.76, 95% ci 0.371.56). surgical volume had no significant impact on the recurrence or progression rates. in a similar study by di zingaro., which included 209 patients with intermediate and high risk nmibc, found high surgical volume (defined as experience in more than 100 turbts) to be predictive for recurrence and progression. in contrast to these studies, in our series, all the surgeons had a status of specialist and their experience in performing turbt significantly exceeded 100 surgical interventions. therefore, the differences in the long - term outcomes in our study can not entirely be explained by the poor basic technique associated with the initial training period. for example, the risk of recurrence did not differ significantly based on the year of a surgery in the multivariate analysis. furthermore, the analysis of the recurrence - free survival by experience in turbts, categorized as < 10 and 10 years, showed worse results with increased experience both among the most and least successful surgeons (figure 4), which might reflect a relative increase in more advanced cases over time. recurrence - free survival by length of turbt experience (< 10 vs. 10 years) among the most (a) and least successful (b) surgeons. there are several possible explanations for these observations : despite the fact that the turbt is considered a simple surgical intervention, the learning curve for providing the best results with this operation may significantly exceed 100 cases or 45 years of residency. another explanation could be that some of the surgeons successes in achieving better results may be associated with certain inborn professional qualities (e.g. alertness, scrupulousness, etc.) and does not change substantially over time. meanwhile, these findings raise an important question on defining the quality of turbt. in this regard, the mainstream idea was to consider the presence of muscle tissue in the specimen after turbt as a key quality indicator of surgical completeness. as early as in 1999, herr showed that this parameter predicted the rate of muscle - invasive disease after restaging turbt in patients initially staged as t1. however, there is some controversy in the current literature on the true significance of this criterion. assessed the prognostic value of the presence of muscle tissue in the specimen after turbt as a surrogate marker for the quality of the turbt in a prospective database including 356 patients with nmibc. in the multivariate analysis, this parameter was associated with the resection of large, low - differentiated tumors and a senior surgeon that was defined as having 5 or more years of training. the early recurrence rate correlated with the absence of muscle in the specimen and a junior surgeon (odds ratio 2.9 ; 95% ci 1.65.4 ; p = 0.0002). in a similar study, huang. found that the absence of muscle in the specimen after turbt was more often observed with large tumors, tumors with difficult location and " young " surgeons (10 years of training). these factors, together with the absence of muscle in the specimen and t1 staging, were associated with the presence of residual tumor on repeat turbt. evaluated the results of 340 turbts for pt1 nmibc and found significant differences in the rate of muscle tissue detection in the specimen between junior and senior surgeons (61.3% vs. 73.8% ; p = 0.02). however, in the multivariate analysis, only a junior surgeon as an operator, regardless of the presence or absence of the muscle tissue in the specimen, was predictive of recurrence (hr 2.33 ; 95% ci 1.45 - 3.74 ; p = 0.01). and finally, shoshani., in the analysis of the data from 332 patients with nmibc, found the association between the presence of muscle tissue in the specimen and high tumor grade, large size, multifocality and nonpapillary morphology, but not with the surgical experience. moreover, the lack of muscle tissue in the specimen had no effect on the long - term recurrence and progression rate in the overall patients cohort. therefore, the authors concluded that the presence of muscle in the specimen was determined more by the tumor extent than by the surgeon 's experience, and the presence of muscle in the specimen can be a criterion of turbt quality only in the t1 tumor subgroup. unfortunately, we were unable to evaluate the presence of the muscle tissue in the turbt specimen in our cohort as this criterion has not been systematically assessed in a significant number of patients. however, we would like to focus the attention on a more relevant and direct measurement of the turbt quality by evaluating the 12-month recurrence rate, which we found to be the most discriminative between more and less successful surgeons. a single institution study and a low number of surgeons could not allow us to provide firm recommendations on optimal cut - off values of these parameters. we suggest conducting a multi - institution prospective study for assessing the early recurrence rate as a surrogate marker for the quality of turbt in patients with nmibc. finally, we have to underscore a wide variation of recurrence risk between different surgeons in our study reaching up to 1.71, which is more than hr for multiple or large tumors in a pivotal eortc prognostic study. whereas any comparative trial exploring new therapies in nmibc used to be balanced for basic prognostic factors of the tumor, it is unusual to ensure balance of the study arms by the operating surgeon. however, this may introduce a significant bias in the results of the comparative trials in which one group may be operated on by better surgeons than the other with fewer recurrences mimicking an effect of additional interventions. a surgeon has a significant impact on the risk of recurrence after curative treatment of patients with nmibc, which should be taken into account while performing and evaluating the results of comparative studies in this field. in our study, a significant difference between the surgeons was observed despite relatively similar and extensive experience in bladder endoscopic surgery and practicing in a setting of one specialized center. early recurrence rate may be used as a criterion of the quality of the turbt. | introductionone of the factors responsible for the risk of recurrence after complete transurethral resection of the bladder tumor (turbt) in patients with non - muscle invasive bladder cancer (nmibc) is the quality of surgery that may vary between individual surgeons. the aim of the study was to evaluate the impact of the surgeon on recurrence - free survival in patients with nmibc.material and methodsthe long - term results of a series of consecutive turbts performed by five staff urologists at a single institution were retrospectively analyzed. a total of 949 cases of organ - preserving treatment in 784 patients with nmibc were included in the analysis.resultswith the median follow - up of 64.3 months (3124 months), the 5-year recurrence - free survival rates according to the surgeon were 62.9% (95% ci 56.269.7%), 53.6% (95% ci 47.459.9%), 51.0% (95% ci 39.662.4%), 46.2% (95% ci 36.456.0%), and 44.2% (95% ci 36.851.7%), respectively (p < 0.0001). in the multivariate analysis including all potential risk factors, the individual surgeon was associated with a risk of recurrence with a high degree of statistical significance (p = 0.0013). the between - surgeon differences in the recurrence risk were not that pronounced in less extensive tumors.conclusionsa surgeon has a significant impact on the risk of recurrence after curative treatment of patients with nmibc. this effect was observed despite the relatively extensive experience in bladder endoscopic surgery of all of the surgeons and practicing in a setting of one specialized center. these findings should be taken into account while performing and evaluating the results of comparative studies. |
studies suggest that localized renal cell carcinoma (t12n0m0) is best treated by nephron - sparing surgery (nss) rather than by radical nephrectomy irrespective of the surgical approach. although the ideal outcome remains partial nephrectomy (pn), patient characteristics, tumor radiologic features, surgeon experience, and the availability of technology must be taken into consideration when determining the surgical approach. the morphometric characteristics of renal tumors are likely the most surgically relevant factors for the technical approach of pn. customarily, surgeons have subjectively evaluated cross - sectional imaging to gain a sense for how to achieve an ideal pn. more recently, new measurements have been developed to systematically and quantitatively assess the most surgically relevant anatomical features of kidney tumors, namely the r.e.n.a.l. (radius, exophytic property, nearness to the collecting system or sinus, anterior / posterior location, location relative to the polar lines), padua (preoperative aspects and dimensions used for anatomical classification), and centrality (c)-index systems. as a result, multiple studies have been published, and the results have extended the utility of these nephrometry systems to the prediction of surgical outcomes following pn. however, the measurement variability and complicated methodology of the above nephrometry systems make the translation of this information into practice difficult. in 2012, a study by simmons described a novel system that integrates the optimized attributes of the r.e.n.a.l. and c - index systems, diameter - axial - polar (dap) nephrometry. dap nephrometry exhibits a simplified methodology, decreased measurement variability, and a much stronger correlation with clinical outcomes. however, the association of this novel nephrometry system with clinical outcomes requires external validation. thus, we assessed the validity of the dap scoring system to predict pn outcomes in an independent external cohort. on approval from the institutional review board (irb) of the second military medical university, we identified 285 consecutive patients undergoing pn via open, conventional laparoscopic, laparoendoscopic single - site, or robotic approaches between 2009 and 2013 at a tertiary referral center (kidney cancer center of second military medical university). patient information was anonymized and deidentified prior to analysis. the surgical technique and approach (open versus minimally invasive and transperitoneal versus retroperitoneal) were determined at the discretion of the primary urologist on a case - by - case basis. the electronic radiologic database was queried to identify those who had preoperative cross - sectional imaging (computerized tomography or magnetic resonance imaging) for dap scoring assessment. digital radiological data were available for 238 (83.5%) subjects, one of whom exhibited multiple ipsilateral tumors and was excluded from the final analysis. the assignment of a dap score for all identified lesions was made by a radiologist (mml) and an urologist (zjw) according to the established protocol described by simmons. for all of the included patients, the clinical records were retrospectively reviewed, and the following data were extracted : patient age, sex, body mass index (bmi), american society of anesthesiologists classification, age - weighted charlson comorbidity index (cci) score, operative time (ot), estimated blood loss (ebl), ischemia time, length of hospital stay (los), pathological outcomes, intraoperative and postoperative complications, and the perioperative serum creatinine (scr) levels. the estimated glomerular filtration rate (egfr) was calculated using the modification of diet in renal disease 2 equation. for baseline egfr, the scr level preceding surgery (generally within one week before surgery) the follow - up egfr was estimated based on the most recent available scr level measured during the clinic oncological visits or the scr value prior to discharge. the percentage decline in egfr was calculated as follows:(postoperative egfr- preoperative egfr)/preoperative egfr patient demographics and surgical outcomes were presented as frequencies (percentages) for categorical variables and as the median and interquartile range (iqr) for continuous variables. associations between the dap sum score as well as its individual categories and the main surgical outcomes were evaluated using spearman correlation analysis. a logistic regression model was used for both univariable and multivariable analysis to identify predictors of ischemia time > 20 minutes in cases where hilar clamping was used or the percent decline in egfr > 10%. analyzed variables included patient age (50 years vs > 50), sex, bmi (25 kg / m vs > 25), american society of anesthesiologists score (02 vs > 2), age - adjusted cci (02 vs > 2), clinical tumor size, surgical approach (open vs conventional laparoscopy and laparo - endoscopic single - site [cl&less ] vs robotic), dap score, ot (3 hours vs > 3), and ebl (250 ml vs > 250). the covariates tested were different according to the outcomes analyzed, and factors at p 20 minutes in cases where hilar clamping was used or the percent decline in egfr > 10%. analyzed variables included patient age (50 years vs > 50), sex, bmi (25 kg / m vs > 25), american society of anesthesiologists score (02 vs > 2), age - adjusted cci (02 vs > 2), clinical tumor size, surgical approach (open vs conventional laparoscopy and laparo - endoscopic single - site [cl&less ] vs robotic), dap score, ot (3 hours vs > 3), and ebl (250 ml vs > 250). the covariates tested were different according to the outcomes analyzed, and factors at p 20 minutes, whereas patient age, sex, bmi, tumor side, and robotic versus open surgical approach were not statistically significant (table 3). on multivariable logistic regression, only the dap sum score (or : 1.749 ; 95%ci : 1.3792.220 ; p 20 minutes (table 4, model 1). moreover, the dap size - adjusted score (or : 1.481 ; 95%ci : 1.0652.058 ; p = 0.020) was able to predict ischemia time > 20 minutes irrespective of clinical tumor size (or : 1.506 ; 95%ci : 1.1411.990 ; p = 0.004) and surgical approach (cl&less vs open, or : 5.404 ; 95%ci : 2.39112.213 ; p 20 min (n = 230) multivariate models predicting ischemia time > 20 minutes (n = 230) with respect to postoperative renal functional impairment, a decrease in egfr greater than 10% was observed in 116 (50.7%) patients. univariable analysis revealed that tumor size (p = 0.002), the dap sum score (p = 0.001), the dap size - adjusted score (p = 0.002), ischemia time (p 10% (table 5). in multivariable analysis, the dap sum score (or : 1.297 ; 95%ci : 1.0511.602 ; p = 0.016) was an independent predictor of egfr decline > 10% as well as cci (or : 4.730 ; 95%ci : 1.46315.291 ; p = 0.009), ebl (or : 2.433 ; 95%ci : 1.0955.407 ; p = 0.029), and ischemia time (or : 3.332 ; 95%ci : 1.7776.249 ; p 10% after adjustment for the effects of cci (or : 5.635 ; 95%ci : 1.7303.193 ; p = 0.004), ebl (or : 2.309 ; 95%ci : 1.0385.136 ; p = 0.040), and ischemia time (or : 3.348 ; 95%ci : 1.7836.286 ; p 10% in percentage (n = 229) multivariate models predicting egfr decline > 10% in percentage (n = 223) our data confirmed the correlations of the dap nephrometry score with clinical outcomes and demonstrated that the dap nephrometry score is an independent predictor of both ischemia time and renal function decrease in patients who undergo pn with 2 models. furthermore, our results provide additional insights into the different effects of individual dap nephrometry component scores on pn patient outcomes. using linear regression analysis, simmons reported strong associations between all dap scoring parameters and clinical outcomes, including warm ischemia time, ebl, and percent functional volume preservation (each p 20 minutes regardless of the tumor size and surgical approach. this result implies that the anatomical characteristics of kidney tumors, apart from size, can be incorporated into the dap nephrometry system to impart information that could be translated into patient benefit. in a multicenter, international series of robot - assisted pn conducted by ficarra, the padua size - adjusted score was found to be an independent predictor of ischemia time longer than 20 min. the median decrease in renal function in pn patients with a normal contralateral kidney ranges from 0% to 19% in literature reports. some authors have reported that the preoperative anatomic characteristics of treated tumors are predictive of the postprocedure renal function damage. specifically, cha reported a median 12% decrease in egfr at a median follow - up of 38 months, and higher r.e.n.a.l. similarly, simmons reported that r.e.n.a.l., c - index, and the optimized combination form of dap were consistently and strongly correlated with functional preservation. conversely, bylund failed to confirm a relationship between any of the r.e.n.a.l., c - index or padua scoring systems, and postoperative functional outcomes. in the current study, we confirmed that the dap sum score and ischemia time were able to predict renal function decline. however, multiple studies have demonstrated, in addition to the present analysis, that the anatomic complexity of renal tumors has a strong correlation with ischemia time. thus, we further studied the interactions between the dap score and tumor size and ischemia time. with respect to the functional outcome, the effect of the dap score at least partially depends on that of ischemia time. however, we do not deny the possibility that the effect of the dap score can be interpreted alone because its association with the percent functional volume preservation is nearly linear (r = 0.97). indeed, the collinearity and interactions between strongly correlated predictors should be evaluated, which may help explain the discrepancy in the effectiveness of nephrometry systems and ischemia time on renal function impairment after pn in the literature. the main limitations of this study are that it represents a retrospective analysis collected from a single surgeon 's series with a limited number of patients and potential effects of measurement variability. moreover, patients with a solitary kidney were enrolled (n = 6, 2.5%). finally, the percent egfr decrease was not adjusted according to the preserved kidney volume, and the percent functional volume preservation was not captured. the predictive value of the dap nephrometry score on ischemia time and renal function decline was confirmed in an independent external cohort of patients undergoing pn, and the individual component dap scores may have different effects on these outcomes. however, our findings need to be further confirmed in a well - designed prospective global multi - institutional study. | abstractthis study sought to evaluate the predictive value of the dap (diameter - axial - polar) nephrometry system on surgical outcomes following partial nephrectomy (pn).this was a retrospective study of 237 patients who underwent open or minimally invasive pn for renal tumors at a single tertiary care center between 2009 and 2013. the primary outcomes included ischemia time > 20 minutes and percentage of estimated glomerular filtration rate (egfr) decline > 10%. statistical analysis was performed to study associations and predictions.the dap sum score exhibited a statistically significant correlation with ischemia time, operative time (ot), estimated blood loss (ebl), length of hospital stay (los), and percent change in egfr. the dap sum score (odds ratio [or ] : 1.749 ; 95% confidence interval [ci ] 1.3792.220 ; p 20 minutes. similarly, the dap sum score (or : 1.297 ; 95% ci 1.0511.602 ; p = 0.016), age - weighted charlson comorbidity index (cci) (or : 4.730 ; 95% ci 1.46315.291 ; p = 0.009), ebl (or 2.433 ; 95% ci 1.0955.407 ; p = 0.029), and ischemia time (or 3.332 ; 95% ci 1.7776.249 ; p 10%. furthermore, the dap score ischemia time interactions were statistically significant (p < 0.001).we confirmed the predictive value of the dap nephrometry score with respect to ischemia time and renal functional decline in an independent external cohort of patients undergoing pn. the effect of the dap score on renal functional decline partially depends on that of ischemia time, and the individual component dap scores may have different effects on clinical outcomes. |
tooth carving is an important practical preclinical exercise in the curriculum in indian dental education setup. it forms the basis of introduction to tooth anatomy, morphology and occlusion of primary and permanent teeth through practical approach. it requires enormous time and manpower to master the skill. therefore, there is an imminent necessity to incorporate computer - based learning of the art of tooth carving for effective teaching and efficient student learning. this will ensure quality time to be spent on other academic and research activities by students and faculty in addition to adding value as a teaching aid. |
|
traumatic crown fractures, which are caused from dental injuries, are a serious dental public health problem.1 a majority of the crown fractures involve the maxillary incisors.2 today s dental patients are demanding a youthful, attractive smile.3 single - appointment direct restorations should ideally be restricted to small to medium - sized intracoronal lesion.4 alternatively, large multisurface defects can best be restored with indirect laboratory - processed restorations.5 however, the higher cost of indirect restorations, patients desire to maintain remaining sound tooth structure, and unfavorable anatomical conditions may render the direct restoration the first choice in many clinical situations.6,7 restoring a number of missing teeth is usually a difficult problem for the clinician.8 the reattachment of the crown fragment to a fractured tooth is the best method to reinstate the natural shape, contour, surface texture, occlusal alignment and color of the fragment, which offers excellent esthetic and functional results and less chair time.7 recent developments in restorative materials and techniques facilitate restoration of fractured teeth. endodontically treated teeth often have extensive loss of coronal tooth structure as a result of endodontic treatment procedures, carries or previous restorations. besides, the success of root canal treatment of teeth, a successful final restoration is also important for long - term clinical success. spear9 reported that the endodontically treated teeth must have 3 mm healthy tissue complex to maintain functional longevity. resin based restorative materials are frequently used in restoration of the fractured teeth. because of the poor mechanical resistance of these materials, different approaches developed to strengthening resistance of composite resin,10 such as fiber posts. tooth - colored fiber posts were introduced in the 1990 s and have several advantages, such as esthetic, bond to tooth structure, have a modulus of elasticity similar to that of dentin, but still require dentin preparation to fit into the canal.6,11 the purpose of this report is to describe the re - attachment of a crown fragment of anterior tooth after trauma with utilizing clinical approach and present the 1 year follow - up. a 29-year - old man referred to our clinic, because of fracture of the crown in the left maxillary lateral incisor. there was no apparent trauma to the soft tissues in the extra oral and intraoral examination. clinical and radiographic examination revealed that there was a horizontal fracture in the cervical region of the left maxillary incisor. it was tender to percussion, and there was a temporary restoration of the palatal region of the tooth. dental history of the patient revealed that an endodontic treatment was started nine months ago, but incompleted because of the patient s anxiety from dentists. the crown was mobile but attached to the gingiva. in radiographic examination, the fracture line was below the cement - enamel junction (figure 1). it was explained to the patient that the placement of a dental implant could be indicated if an unfavorable crown - to - root ratio would result after completing crown reattachment. the patient expressed the desire to maintain tooth and restore it with a direct resin based composite restoration, due to the lower cost compared to an indirect restoration. a detailed explanation about the treatment plan was given to the patient, which included completion of the endodontic treatment, then reattachment of the tooth crown with using a fiber post. local anesthetic was administered and the segment was removed (figures 2a and 2b) with minimal force from its soft tissue attachment and recovered and stored in sterile distilled water to prevent discoloration and dehydratation. the working length was determined with an electronic apex locater (root zx, j.marita corp., the gates glidden drills (mani inc, japan) were used for coronal segment of the root canal. the root canal was dried with paper points (spident, hand rolled, korea) and obturated using endodontic sealer (sealapex, kerr, usa) and laterally condensed with gutta perca technique (spident, hand rolled, korea) (figure 3). the coronal portion of the root canal obturation was removed with a heat carried instrument for the placement post - system. the root canal was obturated with a temporary restoration (cavit g, 3m - espe, germany). the day after completion of the endodontic treatment, the root were prepared for the post placement by removing the sealing material with gates glidden burs and manual files. the parallel sided glass - fiber post system (cytec blanco, hahnenkraat, germany) was placed into the root canal (figure 4). glass ionomer luting system (vitremer, 3m - espe, usa) was used for cementation. decayed portion of the fractured crown s internal dentin surface was removed with a tungsten carbide bur, with care taken to preserve peripheral margin (figure 5). the fragment and tooth were subsequently cleaned with a 2% chlorhexidine solution, rinsed and lightly air dried. two steps etch & rinse system (vococid, voco - germany, single bond, 3m - espe, usa) was utilized for the bonding of tooth structure. a flowable composite (filtek flow, 3m - espe, usa). then composite resin (valux plus, 3m - espe, usa) was placed incrementally and cured for 40 seconds using soft - start technique (elipar freelight ii, 3m - espe, usa). the residual excess at the restorative margin was finished with a series of finishing burs. then polished to a high luster using aluminum oxide discs (sof - lex, 3m - espe, usa) (figure 6). following restoration, any necessary occlusal equilibration was accomplished with an egg shaped bur and the final polishing was repeated, no prescription was given to the patient. at the 1-year follow - up, there was a little marginal discoloration, but no recurrent decay or periapical or gingival abscess were detected (figures 7 and 8). reattachment of the crown fragment to a fractured tooth influences esthetic by retaining natural translucency and surface texture and is first choice for crown fractures of anterior teeth. also, this procedure is relatively simple, atraumatic and inexpensive.12 today, we have a lot of different approaches in treatment of fractured teeth depending on the location of the fracture.13 the fractured teeth, especially where fracture line extends below the marginal bone level, exists various problems in restoration.14 orthodontic extrusion or surgical extrusion has been recommended before the treatment of such fractured teeth.15,16 orthodontic extrusion is more closely to natural way of tooth eruption, than surgical extrusion. however, orthodontic extrusions required longer time than surgical extrusion.14,17 in the present case the fracture line was below the gingival contour, however above the marginal alveolar bone crest. hayashi indicated that, the best restorative methods needed to be identified for teeth with extensive loss of structure, and reinforcing pulpless teeth. however, when a tooth has more than 50% of its coronal structure missing, the use of a post - and - core foundation is recommended prior to restoration.19 in recent literature reviews, it has become clear that posts do not strengthen endodontically treated teeth, and their use is justified only for retention of the coronal restoration.2,20 the most common complication in post and core system is debonding.21 root fracture is another reason for failure of the post - and core system.22 restoration with cast metal posts can cause wedging forces coronally that may result in irreversible failure because of fracture of an already weakened root.23 fiber - reinforced composite resin post has demonstrated negligible root fracture. studies have indicated that dentin - bonded resin post - core restorations provide significantly less resistance to failure than cemented custom cast posts and cores.24,25 in addition, the fiber - reinforced posts can be used with minimal preparation because it uses the undercuts and surface irregularities to increase the surface area for bonding. fiber reinforced resins allow not only creation esthetic restoration but also for the preservation and reinforcement to tooth structure. at the 1-year follow - up, however, before recommending a similar treatment on a regular basis, a longer follow - up period is required. | coronal fractures of permanent dentition are the most frequent type of dental injury. if the original tooth fragment is retained following fracture, the natural tooth structures can be reattached using adhesive protocols. the development and use of fiber - reinforced composite root canal posts make possible of the reattachment of the crown esthetically. this case report presents a clinical technique to reattachment maxillary lateral incisor tooth after trauma using direct fiber - reinforced post systems. at the 1-year follow - up, a slightly marginal discoloration, but no recurrent decay or composite clefts were detected and the resultant appearance was acceptable to the patient. |
every year between the 1200 to 1400 persons per million develop urinary calculosis with a male to female ratio of 3:1 (1). urology is probably the oldest branch of surgery, knowing that one of the first operations was safe and resolve stone jammed on the outer opening of the urethra (2). creation of stones in the urinary organs (urolithiasis) is a very common disease (3). epidemiological data suggest an increased prevalence of upper urinary tract calculi in developed countries (4). various authors suggest that urinary calculi constitute 1 - 3 per thousand total hospitalized patients which makes 15 - 24% of patients in the urology departments (5). this disease have several names : nephrolithiasis meaning kidney stone, nephrolithiasis and the word is derived from the greek word nephros (kidney) and lithos (stone). word of urolithiasis urinary (urine) stone is derived from the french word urine and greek ouron meaning urine. it is also used as renal calculus from the latin word calculus (plural calculi), which means gravel. urolithiasis also affects animals : the stones were found in dogs, cats, rabbits, minks, etc., and the components are the same as in humans (1). urolithiasis occurs during the most productive human age from 30 to 50 years of age, but has been described in all age groups (6). it is believed that 12% of men and 4% of women in developed countries suffer from urinary stones. in case of a positive family history, this number doubles (2). one of the reasons for its frequent occurrence in men is explained by the increased endogenous production of oxalate in the liver under the influence of testosterone, while in the urine of women is on average higher concentration of citrate, otherwise, increase the solubility of calcium. calculosa with women predominantly induced urinary infections and metabolic disorders, while in men predominate idiopathic lithiasis or calcium lithiasis and uric acid (5). percentage of recurrent calculosis is 50% within 5 years and 70% over 10 years (8). one of the most common pathological conditions in human medicine is the presence of a stone in the urinary tract, characterized more often as urolithiasis. in countries with developed industry the disease usually affects people in the fourth and fifth decade of life who are working, and their absence from work due to healing has significant social and economic implications on the society. localization of the stone is determined by several factors, including even the demographic characteristics. in developed countries, 97% of the stones are localized in the kidney and ureter where in 59% of cases in the ureter. urethral stone is in 75% of cases located in the iliac and pelvic part of the ureter (1, 3). if the calculi in their characteristics are not spontaneously eliminated, taken are further steps and therapeutic protocols to solve this problem. asperitan stone and stone larger than 7 mm in diameter, which practically can not be spontaneously eliminated, threatening development of kidney urostasis and infection (2). indications for an active therapeutic approach to ureter stones is stone diameter over 7 mm with low (below 20%) probability of spontaneous elimination or absence of spontaneous stone elimination of any size for a period longer than 30 days from the first renal colic, urinary infection develop, sepsis, calculous anuria, as well as the request of patients. treatment of urolithiasis includes conservative, surgical treatment, and treatment with extracorporeal shock wave lithotripsy (eswl) depending on the evaluation. recently, endoscopic procedures, such as eretheroscopy (urs) and percutaneous lithotripsy (pcnl), together with the aforementioned eswl, have been almost entirely replaced open surgery, so in just 30 years, radically changed the approach and functional outcome of this disease (1, 2). eswl treatment is the first - line treatment of urinary tract stones, but there are still no clearly defined limits and recommendations for its use in the treatment of urinary calculi, depending on its location, size and morphological structure. this raises the question of efficiency of eswl depending on the characteristics of urinary calculi. determine characteristics of the patients with calculi in the urinary system, possibilities of disintegration of stones and its spontaneous elimination dependent on morphological structure of stones, their size and location in the urinary tract. it was conducted at the urology clinic clinical center of sarajevo university in the period from 2007 to 2013. all patients prior to initiation of therapy eswl treatments were subjected to the following diagnostic procedures : anamnesis, clinical examination of patients, laboratory tests, ultrasound examination of the urinary tract and urinary tract x - ray, from which was derived chemical qualitative analysis of morphological stone composition. diagnostics are used in the detection of complications such as obstruction with dilatation of the renal colorectal system, reduction of the renal parenchyma and in monitoring of renal obstruction during treatment. this type of diagnosis is not suitable for stones in the ureter and can make the difference between calcified and radiolucent concrement. eswl treatment is performed on the machine siemens model lithostar multiline, which has a combined ultrasonographic and fluoroscopic display, large energy density in order to obtain optimum focus (without damaging surrounding tissue) and minimal pain that on rare occasions requires for mild sedation - sedation. for nominal and ordinal variables chi - square test was used. in cases when the frequency was lower than expected statistical analysis was performed using spss computer software for statistical analysis (spss statistical package for the social sciences) version 13.0. from a total of 404 patients included in the study there were 234 (57.92%) male and 170 (42.08%) female patients. the most common age group in the sample was at age from 35 to 45 years and consisted of 110 respondents (27.09%). the minimum number of respondents had the age over 65 years 19 respondents (4.67%). the most common type of stone both in female and male patients was calcium type. from a total of 262 calcium stones, 105 of them (40.07%) was present in female patients and 157 (59.92%) in male. share of infectious type of stone in female patients was 63 (49.60%) and 64 among males (50.39%). other stones were less abundant in both the gender groups and their total number was only 17. in women their frequency was 2 (13.33%) and 13 among males (86.67%). there was a significant difference in the frequency of different types of stones by gender (2 = 11.47, p = 0.009). due to the very low prevalence of other types of stones and inability to perform the chi - square test to a group of other stones are grouped stones which, by virtue were cystine, xanthine stones and uric acid stones. the incidence of cystine calculi was 4 (0.9%), frequency of xanthine stones 3 (0.7%) and uric acid 8 (1.9%). in the group of female respondents 74 (40.88%) had calculus size up to 10 mm, while in the group of male patients stone size up to 10 mm had 107 (59.12%). in the group of female respondents 96 of them (43.05%) had a size of stone exceeding 10 mm, while in the group of male patients stone size over 10 mm had 127 (56.95%). there was no statistically significant difference in the incidence of stones with sizes up to 10 and over 10 mm by gender (2 = 0.192, p = 0.661) number of stones localized in the upper pole of the kidney in women was 43 (48.86%), and among men was slightly lower and amounted to 45 (51.13%). number localized in the lower pole of the kidney in women was 22 (61.11%), and among men was slightly lower and amounted to 14 (38.88%). number of stones localized medially among women was 38 (45.78%), and among men was slightly lower and amounted to 45 (54.21%). number of localized in the renal pyelon in females was 27 (40.39%), and among men was slightly lower and amounted to 40 (59.70%). there was no statistically significant difference in the frequency of localization of stones by gender. the incidence of urolithiasis at the site of physiological narrowing of the ureter in female subjects was 22 (27.5%) and 58 in males (72.5%). the incidence of urolithiasis at the site of the physiological enlargement of the ureter in female subjects was 8 (50%), and the same among men 8 (50%). there was no statistically significant difference in the frequency of localization of calculi to physiological narrowing and widening of the ureter in relation to gender differences (p = 0.086). the second most common size of the calculi in the sample was 9 mm, which had 14.6% of respondents, followed by the size of 20 mm, which had 14.38% of the respondents. the least frequent size calculi were 17 mm, which was only 0.25% of the respondents. size of the calculi in women was 12 (8 - 15 mm), while in men it was 12 (8 - 15 mm). there was no statistically significant difference in the size of calculi between males and females (p = 0.557). there was a significant mild positive correlation between age and size of the stone in the total sample (rho = 0.240, p < 0.01), i.e. increase with age slightly increases the size calculi. in the group of patients who had a negative family history of calculus size to 10 mm were present in 108 (59.67%), while in the group of subjects who had a family history size of stones up to 10 mm had 73 (40.33%). in the group of patients who had a negative family history of calculus size over 10 mm was registered in 160 (71.75%), while in the group of subjects who had a positive family history of calculus size over 10 mm was registered in 63 (28.25%). there was a statistically significant correlation between the size of stones and positive / negative family history (2 = 6.529, p = 0.011), respectively, in patients with a positive family history more often were present small stones (to 10 mm). size of the calculi in patients who had a positive family history was 12 (9 - 15 mm), while the size of stones in patients who had a positive family history was 10 (8 - 15 cm). there was no statistically significant difference in the size of the stones between the groups of patients (p = 0.013). size of calculus in patients without recurrent urolithiasis was 11 (9 - 15 mm), while the size of the calculus in patients who have had recurrent urolithiasis was 12 (8 - 15 mm). there was no statistically significant difference in the size of calculi between groups of patients (p = ns). frequency of localization in the upper pole of kidney which have the size of 10 mm was 30 (34.09%), while the frequency of localization in the top half of kidney s which had more than 10 mm in size was 58 (65.91%) (table 1). fisher exact test ; p=0.003 frequency of localization in the lower pole of the calculi that had the size of 10 mm was in 3 cases (8.33%), while the frequency of localization in the lower pole of the calculi that had the size over 10 mm was present in 33 cases (91.67%). there was a significant dependence between the size of the stone and the same localization in renal pole (fisher 's exact test, p = 0.003). looking at the frequency of stones it is a lot bigger on the top half, but looking at their size, larger stones (over 10 mm) were significantly more often present in the lower half. size of calculi localized medially was 14 (10 - 15 mm), while the localization pyelon was 15 (12 - 18 mm). there was a significant difference in size between the mentioned calculus localization (p = 0.022). stones that occur in the renal pyelon are higher than the stones that are found in our study, in medial position. frequency medial localization of calculi which size was less than 10 mm was 33 (39.75%), and frequency of 50 (60.25%) for stones ranging in size over 10 mm. pyelon localization of calculi which size was less than 10 mm was 5 (7.46%), and frequency of 62 (92.53%) for stones ranging in size over 10 mm. there was a significant correlation between the size of the stone and localization of stones (medial / pyelon) (2 = 20.443, p < 0.001). frequency of calculi localization at sites of physiological stricture site that had the size of 10 mm was 68 (85%), while the frequency of localization at sites of calculi physiological stricture site which had the size over 10 mm was 12 (15%). frequency of localization at sites of calculi enlargement physiological ureter which had the size of 10 mm was 15 (93.75%), while the frequency of localization at sites of calculi enlargement physiological ureter which had the size over 10 mm, was 1 (6.25%). there was no statistically significant dependence between the size of tartar and calculus localization to physiological constriction and expansion of the ureter (p = 0.688) (table 2). e1- physiological narrowing of the ureter, e2 physiological enlargement of the ureter in the group of patients under 35 years the incidence of calcium stones was 88 (33.58%), while in the age group of 35 - 55 years the incidence of calcium type of calculi was 135 (51.52%). the frequency of this type of calculi in subjects older than 55 years was 39 (14.88%). in the group of patients under 35 years the incidence of infectious stones was 26 (20.47%), and at the age of 35 to 55 years the incidence of infectious types of calculi was 63 (49.60%). the frequency of this type of calculi in subjects older than 55 years was 38 (29.92%). in the group of patients under 35 years the incidence of other types of stones was 4 (26.66%), while in the age group of 35 - 55 years the incidence of other types of calculi was 7 (46.66%). the incidence of other types of calculi in subjects older than 55 years was 4 (26.66%). statistically significant dependence between age and type of calculi (2 = 15.170, p = 0.004) (table 3). renal lithiasis is a disease in which the stones were formed in the collecting tubules, cups and pyelon. the incidence was similar in both kidneys, and about 40% of patients had bilateral stones. there is a wide range of risk factors that may be associated with the disease, including local and general factors. of local risk factors that favor the emergence of this disease are : trail of urine, disorders of innervation, anomalies of drainage pathways, anatomical abnormalities (sponge kidney, horseshoe kidney), and recurrent infection. general risk factors are categorized as : metabolic (calciuria, cystinuria), hormonal (primary hyperparathyroidism, hyperthereodosis and hypovitaminosis) and other factors such as climatic conditions of life, feeding, ph of urine excretion of concentrated urine, prolonged immobilization, etc.. formation of kidney stones attempted to explain many theories but none fully explains the mechanism of occurrence. urine is in the usual conditions supersaturated solution in which the particles are held in solution influence crystallization inhibitor and colloids. if these factors are disrupted leads to precipitation and aggregation of crystals. the organic matrix, which consists of cellular detritus, blood and bacteria may be the main factor that leads to nucleation and crystal growth. there is a theory which states that the formation of stones occurs when the crystals, which are constantly being created in the urine oversaturated with salts, are not washed away in the urine. this may occur due to damage to the epithelial duct to which it adheres crystal (11). changes in the socio - economic conditions have influenced the changes in the frequency and type of urolithiasis in terms of localization and physico - chemical properties of stones. major variations on the occurrence of urolithiasis in the world are presented to the public in terms of geographical areas. annual incidence in england is 22 cases per 100,000 inhabitants, in kuwait 23.9 per 100,000 population. however, in some countries there are significant differences in the incidence, such as sweden, where the incidence of 140 per 100,000 inhabitants, italy 168 per 100,000 inhabitants and united states with high prevalence of 277 per 100,000 population. in europe, urinary stones are found mainly in the upper urinary tract, while the proportion of stones in the bladder does not exceed 10.0%. it is shown that the urinary bladder calculi more common in the elderly (12). the disease is more common in men and usually occurs after the third decade of life. it is shown that caucasians are more likely to develop kidney stones than african americans, and men more often than women patients. a possible explanation why men are more frequent in patients than in females lies in the fact that men in performing physical activities much sweat and lose a lot of fluid, which is also the main reason for the formation of a kidney stone or a stone in the bladder (1). some new studies are mostly directed of change in the relationship of occurrence calculi in men and women. in the united states and the data showed that the overall incidence of urolithiasis 10.6% for men and 7.1% for women. this is explained by balancing risks for both men and women today, compared to the past when they were significantly different (13). results of this study showed that the total number of subjects included higher percentage occupied by male respondents and 57.92%, while the remaining 42.08% are occupied by the respondents are female. the results are consistent with published data showing a higher incidence of this disease in male patients compared to female respondents. greater tendency of men to concentrate urine compared to the opposite sex, may be the reason for higher incidence of this disease in men. it is shown that the higher the osmolality in men also work super saturation which is responsible for the crystallization of poorly soluble compounds. even if the concentration of poorly soluble compounds reaches the threshold of saturation of the total 24-h urine, then it can exceed during transient episodes, the way to increase the intake of foods rich in protein, at night, or during intense exercise, especially in the summer months, or season in which men showed a significant decrease in urine volume. although urolithiasis 2 - 3 times more common in men, there are no studies that clearly define the reasons for variations incidence of this disease (1,3). daudon and colleagues (14) show that men older than 80 years constitute 40.0% of the analyzed patients with urinary bladder calculi. prostatic hyperplasia is more common in the elderly and causes an obstruction in the urinary tract. this may be a possible explanation for the high incidence of stones in the bladder in the elderly. women are also at risk calculus appears in the lower parts of the urinary tract. this suggests the existence of other risk factors, such as changes in bladder function associated with relaxation of smooth muscle tone in the elderly, with an efficiency reduction bladder emptying favoring stagnation of urine and the occurrence of tartar. when it comes to the size calculi, the results of our study showed a statistically significant positive correlation between age and size of the stone in the total sample (rho = 0.240, p < 0.01). classifying respondents into three age groups, our results showed that the highest incidence of stones measuring greater than 10 mm was represented at the age between 35 and 55 years. chi - square test showed a statistically significant correlation between age and size of the stone (2 = 40.287, p < 0.00005). the study by alaya and associates (12), who analyzed the sample of 1301 urinary tract stones, it has been proven that the highest percentage share of 58.6% occupied stones of calcium type, that type of calcium oxalate, but they also recorded an increase in the incidence and types of stones uric acid. the authors believe that in the last 50 years there has been a change in eating habits associated with an increase in foods rich in purines (animal proteins projections and seafood), which correlates the increase in uric acid in the urine, and increasing incidence of this type of calculi. the results of our study showed that the group of patients under 35 years the incidence of calcium stones was 33.58%, the incidence of infectious stones 20.47%, while the incidence of other types of stones was 26.66%. at the age of 35 to 55 years the incidence of a calcium type of calculi was 51.52%, the frequency of the infectious type of calculi was 49.60%, and the prevalence of other types of stones was 46.66%. the frequency of this type of calcium calculi in subjects older than 55 years was 14.88%, infectious stones were 29.92%, while the incidence of other types of calculi in subjects older than 55 years was 26.66%. there was a statistically significant correlation between age and type of calculi (2 = 15.170, p = 0.004), i.e. among younger patients are the most common types of calcium stones, while the incidence of infectious types of stones rarer. increasing age leads to equalization of the frequency of calcium and infectious stones. differences in the incidence of age and stones were analyzed through a large number of epidemiological studies. baker (15) reported that in australia peak incidence of urolithiasis calcium oxalate sampled observed in individuals between 50 and 60 years of age. in europe, research shows that the stones which are chemically calcium oxalate more common in people between 40 and 50 years of age. in asia, the highest prevalence of calcium oxalate stone formation occurs at an earlier age range 30 to 50 years (1). certain hereditary disorders that run in the family increases the risk of recurrent kidney stones. a rare hereditary disease, renal tubular acidosis, increases the acidity of urine, which is favorable for the occurrence of kidney stones. cystinuria is a hereditary disorder of the metabolism of amino acids, which results in high levels of cystine in the urine and blood, leading to frequent formation of cystine kidney stones. second, a hereditary disorder of metabolism, hyperoxaluria, is resulting in high levels of oxalate salt in the body, which is combined with calcium in the form of kidney stones. hypercalciuria causes high accumulation of calcium in the body, which increases the incidence of kidney stones. hiperuricosuria increased level of uric acid in the urine, which leads to the formation of uric acid stones (1,3). diet, in terms of animal protein (52 g / day), sodium (50 mg / day) and the oxalate (200 mg / day) with a normal intake of calcium (1,200 mg / day), reduced recurrent stones for almost 50% and more, within five years, compared to a diet low in calcium (400 mg / day) and oxalate (16). our results show that the proportion of respondents who did not have positive personal and family history of urolithiasis was 44.94%, and patients who had a positive family history of urolithiasis, but he had a personal history was 50.05%. the share of respondents, who had a family history, and negative personal history of urolithiasis, was 42 (30.88%), while the number of respondents who had a positive to families and personal history was 136 (33.74%). there was a significant frequency dependence of family and personal history (2 = 7.41, p = 0.006), i.e. higher incidence of recurrence in patients who have a positive family history of urolithiasis. similar results were presented by the study koyuncu and associates (17,1), which showed a significant correlation recurring calculi and positive family history. the authors also found that the time interval between the onset of recurrence was significantly shorter in patients who had a positive family history of urolithiasis. by analyzing the patients according to sex, the authors noted that the incidence of recurrence was more frequent in males than females respondents. the authors believe that the information positivity family history is very important and can provide valuable information about the possibility of future attacks as well as the severity of the disease. epidemiological and randomized studies have shown greater security eswl treatment methods in breaking stones when it starts with applying lower energy sequences of the same, with a gradual increase energy sequences, resulting in a vasoconstriction which prevents renal damage and the difference in the fragmentation is not significant despite the fact that whether amplification is carried out or not (1). previous clinical and epidemiological studies have shown that as an indication of eswl treatment of urolythiasis depends on several factors, including the size, localization, consistency and other histological characteristics of calculi (1,2). pregnancy and specific internship and urological diseases, with an emphasis on acute urinary infection, contraindications to perform of eswl (4). from a total of 404 patients included in the study there was 57.92% male and 42.8% female respondents, or male : female ration of 1.2 : 1, while the most common age group in a sample of patients with urolithiasis was between 35 and 45 years(27%). most frequent type of calculi both in female and male subjects was of calcium type. in younger patients the most common are calcium stones, with increase in respondents age calcium and infectious stones frequencies there was a significant correlation between the size of the stone and its localization in renal pole. the incidence of stones was significantly greater in the top half, but the size of large stones (over 10 mm) were significantly more present in the lower kidney pole. there was no statistically significant relationship between the size of stones and personal history, but statistically significant correlation is determined between the size of the stone and family history of urolithiasis. also there was significant correlation between the size of the stone and its localization (medial / pyelon). stones up to 10 mm are more frequently localized medially, and those larger than 10 mm are somewhat more common in the pyelon. | introduction : elimination of stone is determined by size and its localization. stone from the ureter in 80% of cases can be eliminated spontaneously. if the stone by its characteristics is not spontaneously eliminated, taken are further steps and therapeutic protocols to solve this problem.material and methods : the study was prospective, open and comparative. it was conducted at the urology clinic clinical center of sarajevo university in the period from 2007 to 2013. the study included 404 patients with urinary tract lithiasis treated by eswl. eswl treatment is performed on the machine siemens model lithostar multiline, which has a combined ultrasonographic and fluoroscopic display, large energy density in order to obtain optimum focus (without damaging surrounding tissue) and minimal pain that on rare occasions requires for mild sedation-sedation.results:from a total of 404 patients included in the study there were 234 (57.92%) male and 170 (42.08%) female patients. the most common type of stone both in female and male patients was calcium type. from a total of 262 calcium stones, 105 of them (40.07%) was present in female patients and 157 (59.92%) in male. share of infectious type of stone in female patients was 63 (49.60%) and 64 among males (50.39%). other stones were less abundant in both the gender groups and their total number was only 17. in women their frequency was 2 (13.33%) and 13 among males (86.67%). there was a significant difference in the frequency of different types of stones by gender (2 = 11.47, p = 0.009).conclusion : there was no statistically significant correlation between the number of treatments and localization of stones in the ureter, as well as a statistically significant correlation between the size of the stone and the localization of calculus in the ureter. |
atherosclerosis is a common degenerative disorder, which is closely related to the aging process. because of the aging of the general population, atherosclerotic renal artery stenosis (aras) is anticipated to become increasingly prevalent over the coming decades. aras is a common cause of hypertension and chronic renal failure, particularly in middle - aged and elderly patients. ischemic nephropathy caused by aras has been reported to be a leading cause of end - stage renal disease (esrd) in the elderly. revascularization of arterial critical stenosis through percutaneous trans - luminal renal angioplasty or stent placement can overcome renal vascular hypertension and halt the disease progression of ischemic nephropathy in patients with aras. this treatment is now extensively used in patients with aras and may be of benefit under some conditions ; however, the renal disease may progresses in aras patients after revascularization. previous studies indicated that the severity of stenosis and renal outcome in patients with aras is not always parallel, and that improvements in renal function after revascularization may only develop in some conditions. instead, chronic renal parenchymal disease caused by atherosclerotic factors or coexisting detrimental factors has been suggested to be more closely related to the condition of the kidney in patients with aras, and that the development of significant stenosis in renal arteries could be assumed to be a harbinger of the coexisting atherosclerotic renal parenchymal disease in aras. to date, the data to elucidate the impact of these coexisting risk factors in aras patients with or without renal arterial revascularization (rar) are lacking. this study aimed to investigate the effect of coexisting risk factors on long - term renal outcomes in patients with aras. the taiwan bureau of national health insurance consolidated 13 insurance programs into a single - payer national health insurance program in march 1995, and this program now covers over 99% of the population of 23.74 million people in taiwan. the claims database from all health providers and all medical registries is managed and maintained by the national health research institutes (nhri). the nhri created a scrambled, anonymous identification number to insure privacy when combining each person 's information, including sex, birth date, and registry of medical services. the disease diagnoses were based on the international classification of diseases, ninth revision, clinical modification (icd-9-cm). this study was approved by the ethics review committee of the china medical university and hospital (cmu - rec-101012). we identified patients with a diagnosis of renal artery stenosis (ras) (icd-9 code 440.1) from claims data for inpatients from 1999 to 2011. patients aged 18 years or older with newly diagnosed esrd (icd-9-op code 585) were selected for the esrd case group. esrd was identified from the hospitalization records and registry for catastrophic illness patient database in taiwan. the registration of catastrophic illness for esrd requires lifelong dialysis ; these documents are formally reviewed by the taiwan bureau of national health insurance. the control group consisted of subjects randomly selected from among the other ras patients who were not esrd. in the present study, patients with the diagnosis of ras were according to the abdominal image examinations such as computed tomography angiography (cta), magnetic resonance angiography (mra), or aortic angiography and those who were subjected to revascularization should have had critical stenosis of more than 70% in the arterial lumen or an arterial pressure gap > 15 mm hg. the esrd and control groups were selected with an approximately 1:2 ratio in order to enhance the power of any statistical tests. information extracted from the claims data included sex and age, charlson comorbidity index (cci) and baseline comorbidities. we categorized cci into 4 levels 0, 1, 2, and 3 or more. cci was determined for each subject from claims data for outpatient visits or hospitalizations at baseline. the cci is a scoring system that includes weighting factors on important concomitant diseases ; it has been validated for the use with icd-9-cm coded administrative database. the pre - existing comorbidities and surgery included diabetes (icd-9 code 250), hypertension (icd-9 codes 401405), hyperlipidemia (icd-9 code 272), stroke (icd-9 codes 430438), congestive heart failure (chf) (icd-9 code 428), vascular disease(icd-9 codes 410 - 414, 443.89, 444) rar (icd-9-op code 39.50 or 39.90), and nonalcoholic fatty liver disease (icd-9-cm 571.8). distributions of categorical demographic factors and comorbidities, including sex, age, cci, diabetes, hypertension, hyperlipidemia, stroke, chf, vascular disease, and rar, were compared between the esrd and control groups. differences were examined using the chi - square test for categorical variables and the t test for continuous variables. the odds ratio (or) and 95% confidence intervals (cis) were determined by univariable and multivariable logistics regression models. the data analysis also evaluated the joint effect among diabetes, hypertension, chf, and rar. all data analyses were performed using the sas statistical package (version 9.2 ; sas institute inc., the taiwan bureau of national health insurance consolidated 13 insurance programs into a single - payer national health insurance program in march 1995, and this program now covers over 99% of the population of 23.74 million people in taiwan. the claims database from all health providers and all medical registries is managed and maintained by the national health research institutes (nhri). the nhri created a scrambled, anonymous identification number to insure privacy when combining each person 's information, including sex, birth date, and registry of medical services. the disease diagnoses were based on the international classification of diseases, ninth revision, clinical modification (icd-9-cm). this study was approved by the ethics review committee of the china medical university and hospital (cmu - rec-101012). we identified patients with a diagnosis of renal artery stenosis (ras) (icd-9 code 440.1) from claims data for inpatients from 1999 to 2011. patients aged 18 years or older with newly diagnosed esrd (icd-9-op code 585) were selected for the esrd case group. esrd was identified from the hospitalization records and registry for catastrophic illness patient database in taiwan. the registration of catastrophic illness for esrd requires lifelong dialysis ; these documents are formally reviewed by the taiwan bureau of national health insurance. the control group consisted of subjects randomly selected from among the other ras patients who were not esrd. in the present study, patients with the diagnosis of ras were according to the abdominal image examinations such as computed tomography angiography (cta), magnetic resonance angiography (mra), or aortic angiography and those who were subjected to revascularization should have had critical stenosis of more than 70% in the arterial lumen or an arterial pressure gap > 15 mm hg. the esrd and control groups were selected with an approximately 1:2 ratio in order to enhance the power of any statistical tests. information extracted from the claims data included sex and age, charlson comorbidity index (cci) and baseline comorbidities. we categorized cci into 4 levels 0, 1, 2, and 3 or more. cci was determined for each subject from claims data for outpatient visits or hospitalizations at baseline. the cci is a scoring system that includes weighting factors on important concomitant diseases ; it has been validated for the use with icd-9-cm coded administrative database. the pre - existing comorbidities and surgery included diabetes (icd-9 code 250), hypertension (icd-9 codes 401405), hyperlipidemia (icd-9 code 272), stroke (icd-9 codes 430438), congestive heart failure (chf) (icd-9 code 428), vascular disease(icd-9 codes 410 - 414, 443.89, 444) rar (icd-9-op code 39.50 or 39.90), and nonalcoholic fatty liver disease (icd-9-cm 571.8). distributions of categorical demographic factors and comorbidities, including sex, age, cci, diabetes, hypertension, hyperlipidemia, stroke, chf, vascular disease, and rar, were compared between the esrd and control groups. differences were examined using the chi - square test for categorical variables and the t test for continuous variables. the odds ratio (or) and 95% confidence intervals (cis) were determined by univariable and multivariable logistics regression models. the data analysis also evaluated the joint effect among diabetes, hypertension, chf, and rar. all data analyses were performed using the sas statistical package (version 9.2 ; sas institute inc., during the 13-year observational period, 840 patients with esrd were enrolled in the case group, and 1344 patients without esrd were included in the control group. of the 840 esrd patients, 51.7% were male, and 59.1% were aged more than 65 years. the mean age of the group with esrd and the control group was 65.2 (sd = 13.4) and 66.7 (sd = 13.0) years, respectively. as compared with the control group, patients with esrd were more likely to have comorbidities including diabetes (59.6% vs 33.3%, p 15 mm hg. second, serial renal changes could not be analyzed in this study ; however, we selected a solid end - point of renal outcomes in the present study. third, details on blood pressure, smoking, body mass index (bmi), and medication regimens could not be determined. | abstractthe aim of this study was to investigate the risk factors associated with end - stage renal disease (esrd) in patients with atherosclerotic renal artery stenosis (aras).information about the study participants was extracted from the national health insurance research database of taiwan for the years 1999 through 2011. we conducted this retrospective cohort study of patients with aras to identify the potential risk factors associated with long - term renal outcomes.a total of 2184 patients with aras were enrolled, of whom 840 had esrd and were classified as the study group, and 1344 patients who were without esrd were included in the comparison cohort. after adjusting for related variables, univariable, and multivariable logistic regression analysis showed that esrd was associated with higher charlson - comorbidity index (cci) score (adjusted odds ratio [or ] = 6.78, 95% ci = 4.5910.0 for cci = 2 ; adjusted or = 20.0, 95% ci = 13.729.2 for cci 3), diabetes (adjusted or = 1.55, 95% ci = 1.241.93), hypertension (adjusted or = 3.66, 95% ci = 2.365.66), and age 20 to 49-years old (adjusted or = 2.14, 95% ci = 1.513.03). moreover, our data showed that renal artery revascularization (rar) was significantly associated with a lower risk of esrd in aras patients (crude or = 0.64, 95% ci = 0.500.84).our study is the first to disclose that cci score was significantly associated with the risk of esrd in aras patients, and comorbid diseases including diabetes mellitus and hypertension significantly affect renal outcomes in patients with aras. of note, our data showed that renal artery revascularization was associated with a lower risk of esrd in aras patients in long - term follow - up. |
these extrahepatic lesions are most commonly found in the lungs, lymph nodes, and bones. there have been reports of extrahepatic lesions found in urogenital sites, such as the kidneys, testes, and bladder [24 ]. we encountered a patient with a metastatic hcc lesion presenting as a tender right inguinal mass. to the best of our knowledge, this case represents the first such report in the english language literature. a 57-year - old man was referred to our urology out - patient department from a gastrointestinal doctor because of a tender inguinal mass that had become progressively larger over the previous one and half months. the patient had a past history of hcc (underwent radiofrequency ablation in july 2004 and transcatheter arterial chemoembolization in november 2004), hepatitis b virus infection, rightside inguinal hernia (status postherniorrhaphy in 2007), a cholecystectomy in 2000, and a vasectomy in the 1990s. he noticed a painful hard mass in the right inguinal area one and half months prior to visiting our department. physical examination revealed a 2 2 centimeter hard, movable, tender mass in the right inguinal area. an excision biopsy was performed, and the pathological report revealed tumor cells with abundant amphophilic to pale eosinophilic cytoplasm, round nuclei, mitosis, and focal necrosis, and the cells were hep par 1 positive as determined by immunohistochemical staining (figure 1). due to a persistent, painful sensation in the right inguinal area, removal of the right inguinal metastatic mass was arranged. during inguinal exploration a right radical orchiectomy was performed because the tumor could not be freed from the spermatic cord. the pathological report showed multiple metastatic hcc tumor nodules and tumor emboli in the lymphatic and blood vessels of the spermatic cord and peritesticular soft tissue (figure 2). hcc is commonly seen in taiwanese hospitals due to high incidence of hepatitis b and c in taiwan. most documented extrahepatic metastatic lesions have been found in the lungs followed by the lymph nodes, bones, and adrenal glands, but there are cases of distal metastasis to the genitourinary system, such as the kidneys and bladder [1, 3, 4 ]. similar to other metastatic lesions, the clinical presentation of extrahepatic metastatic lesions depends on their location and the affected areas. presentations include hematuria, flank pain, and testicular pain ; these signs and symptoms are very similar to those of other common genitourinary diseases [14 ]. in our case, this patient presented with a painful inguinal mass. when patients present with an inguinal mass, we need to take into consideration several differential diagnoses ranging from benign to malignant lesions. malignant tumors, including primary tumors and metastases, are extremely rare [68 ]. painless scrotal or lower inguinal mass was the most common clinical presentation in the metastatic spermatic cord tumors. the metastatic spermatic cord tumors could be misdiagnosed as hydrocele, hernia, and testis tumor. when a tumor is found in the inguinal area in patients with a history of malignancy or peritoneal carcinomatosis, retrograde extension through the vas deference and transperitoneal seeding had been reported. in this case a metastatic tumor originating from hcc was confirmed after excision biopsy. according to the national comprehensive cancer network clinical practice guideline for metastatic hcc, only sorafenib (for child - pugh class a or b), supportive care, or clinical trials because of persistent pain in the inguinal area and progressive enlargement of the tumor, a radical orchiectomy was performed. what kind of treatment is suitable for tumor emboli in the surgical margin of the spermatic cord ? according to previous reports, palliative radiation therapy has been used to treat hcc with brain and bone metastasis with successful symptom control. hawkins and dawson showed that radiation therapy can prolong survival for hcc patients with portal vein thrombus. because of the lack of a standard treatment for metastatic lesions of hcc, we used radiation therapy for local control, and no recurrence was found after 6 months. in conclusion, we report the first case of metastatic hcc in the spermatic cord, which presented as a painful inguinal mass. palliative radiation therapy is a choice for the treatment of metastatic hcc with tumor emboli in the surgical margin. | most spermatic cord masses are benign, and malignant spermatic cord tumors are uncommon. spermatic cord metastases originating from hepatocellular carcinoma (hcc) have not been previously reported in the english language literature as determined by a pubmed search. we report a male patient who presented with a painful palpable mass in the right inguinal area. the patient was diagnosed with hcc in 2004 and undertook a nonsurgical approach to control the cancer. a radical orchiectomy was performed, and the pathological report showed metastatic hcc in the spermatic cord. the patient received palliative radiation therapy because of a positive surgical margin. no recurrence was noted after 6 months of followup. |
severe growth hormone deficiency (ghd) in adults can give rise to several abnormalities. a growing recognition of this clinical syndrome in the last 20 years has led to the therapeutic use of growth hormone (gh) replacement in adults with severe ghd. this treatment is now available in approximately 80 countries worldwide and has been shown to improve many abnormal parameters [25 ]. ghd is established on both clinical and biochemical criteria, but despite significant advances in our understanding of adult ghd, accurate diagnosis remains challenging. selecting the appropriate patient, performing a reliable diagnostic test, and understanding the clinical caveats as well as the analytical limitations are the crucial steps. consensus guidelines for the diagnosis of adult ghd have been published by professional societies [69 ]. while helpful, recommended diagnostic criteria are not necessarily universally applicable. problems exist with the performance of some diagnostic tests in terms of accuracy, reproducibility, and resources required. the interpretation of test results may pose further challenges due the variability of current biological assays. this paper will summarise the current evidence for the appropriate selection of adult patients at risk of ghd, the strengths and limitations of available diagnostic tests, and the characteristics of currently available assays for gh and igf-1. adults with ghd comprise two distinct groups those with a prior diagnosis of ghd in childhood and those who acquire ghd in adulthood due to hypothalamic - pituitary disease. international guidelines consistently advocate that patients with idiopathic childhood - onset ghd should undergo repeat assessment once final adult height is achieved following gh withdrawal for a few months. many such children will have normal adult gh reserve when retested in adulthood and ongoing gh replacement is not necessary. children with severe ghd and additional pituitary hormone deficiencies secondary to organic pituitary disease such as craniopharyngioma do not require retesting in adult life [10, 11 ]. adult - onset ghd is an uncommon disorder, but the symptoms are subtle and common - place, including fatigue, poor exercise capacity, abdominal obesity, and impaired psychosocial function. this contrasts with childhood - onset ghd where growth failure acts as a useful biological marker of ghd. in addition, the majority of adults with ghd have deficiencies of other pituitary hormones, further complicating the clinical picture. we can not therefore rely on symptoms alone for case detection. identifying patients at risk of ghd such as those with hypothalamic pituitary disease, cranial radiotherapy, head injury, other clinically or biochemically detectable pituitary hormone abnormalities is crucial. replacement of gh in deficient adults improves body composition, exercise capacity, cardio - metabolic parameters, bone health and quality of life. multiple tests are available for the diagnosis of ghd in adulthood and debate still exists about the most appropriate test. the availability of multiple testing modalities emphasises the complexities involved in making an accurate diagnosis and the need to individualise testing for each patient 's clinical circumstances. the ideal test will provide clear separation between normal and ghd patients even allowing for factors than may attenuate gh secretion such as age and obesity (see the following). in adults, the 24-hour integrated gh profile shows considerable overlap between healthy and gh deficient subjects when using a polyclonal radioimmunoassay to measure gh. better separation of ghd and normal subjects can be achieved by using a highly sensitive assay for gh. however, this testing method requires frequent sampling over a 24-hour period, which is highly time and resource consuming. twenty - four - hour urinary gh excretion lacks adequate specificity in separating patients with ghd from normal controls particularly over the age of 40 years. the test yields a sensitivity of 90% but the specificity ranges from 79% for patients under 40 years to 36% for those over 60 years. igf-1 is a peptide hormone that mediates most of the biological actions of growth hormone. circulating igf-1 is principally composed of endocrine igf-1 produced in the liver under gh stimulation. a small amount of autocrine igf-1 is also produced in peripheral tissues such as bone and can be controlled by other factors released from surrounding cells. igf-1 has a very high affinity for binding proteins (igfbps) and circulates in a ternary complex, bound to igfbp-3 and the acid - labile subunit. it exerts its effect by activation of the igf-1 receptor which is widely distributed in many tissues. the value of serum igf-1 and igf binding protein-3 (igfbp-3) in the diagnosis of gh deficiency is a matter of contention among endocrinologists. while serum igf-1 levels less than 2 standard deviation (sd) below the age - matched mean, in a well - nourished adult with pituitary disease, is highly suggestive of ghd, it is clear that serum igf-1 and or igfbp-3 can be normal in patients with undisputed ghd. various investigators have reported normal igf-1 values in 3770% of gh deficient adults [12, 14, 17, 18 ]. further studies, however, showed that age, the time of onset of ghd, and the degree of hypopituitarism, all had a significant influence on serum igf-1 levels sometimes expressed as standard deviation scores (igf-1 sds) or z scores. in the study by aimaretti., 70% of ghd adults under the age of 40 years had a serum igf-1 level below the age - related 3rd centile, but the corresponding percentage for those over the age of 40 was only 35%. in a large retrospective analysis of patients with ghd from the kims database, lissett. found that 86% of patients with childhood - onset ghd compared to 52% with adult - onset ghd had serum igf-1 sds less than 2. the latter study also identified gender, bmi, and number of additional pituitary hormone deficiencies as factors which influence serum igf-1 sds. while recognising the above - mentioned caveats, it is now generally accepted that, in well - nourished patients without liver disease, a low igf-1 in the presence of 3 or more anterior pituitary hormone deficiencies provides very strong evidence of ghd. however, for many patients with suspected ghd, a provocative test of growth hormone reserve is required. in addition, since the presence of other pituitary hormone deficiencies is the strongest predictor of ghd and no provocative test has 100% specificity, it is recommended that adults patients who appear to have isolated ghd undergo two provocative tests to confirm the diagnosis, particularly if the serum igf-1 is not low. international consensus guidelines have converged around the insulin tolerance test and the growth - hormone releasing hormone (ghrh) + arginine test (combined test) as the best available test of ghd in adults, providing sufficient sensitivity and specificity to establish a reliable diagnosis when appropriate cutoffs are used. the glucagon stimulation test is a second - line test but is nonetheless well validated for assessing gh secretory capacity when first line tests are unavailable or contra - indicated. this test measures gh reserve by inducing hypoglycaemia with a bolus of intravenous insulin (0.15 units / kg). gh levels are measured every 1530 minutes for two hours. following an adequate venous blood glucose nadir of 2.2 mmol / l, a peak gh response of less than 5 ng / ml using a polyclonal radioimmunoassay suggests ghd while a peak of less than 3 ng / ml indicates severe ghd [6, 7, 12 ]. the latter cutoff provides sufficient separation of normal and hypopituitary subjects even allowing for conditions that result in reduced gh secretion such as age and obesity and is the indication for considering gh replacement in adults. patients should be adequately replaced with the other hormones before the test is performed. while the insulin tolerance test is considered the gold - standard, it is not a perfect test. it can be safely conducted in experienced centres but is contraindicated in patients with a history of seizures or heart disease. also, it is unpleasant for the patient who requires hospital admission and close medical supervision, and adequate hypoglycaemia is not always achieved. this consumes considerable healthcare resources and reduces its appeal among some endocrinologists, as illustrated in a recent us study which found that only 11.4% of patients evaluated for ghd underwent an insulin tolerance test. the glucagon stimulation test (gst) is a reliable, safe alternative to the itt in the diagnosis of ghd [2529 ]. glucagon (11.5 mg) is administered intramuscularly and serum samples are taken for gh between 90 and 240 minutes. the mechanism of glucagon stimulated gh release is not fully understood, although several mechanisms have been proposed. it has been suggested that gh release may result from the drop in plasma glucose later during the test (following its initial rise), but this mechanism is disputed, as the drop in plasma glucose rarely reaches the hypoglycaemic level. another possible mechanism is by stimulating noradrenaline release, which may stimulate gh secretion via the -receptor ; a suggestion that is, supported by the finding that the administration of -blockers enhances glucagon - stimulated gh release. found the gst to be at least as good as the itt in provoking gh secretion, based on the comparison of overall responses to the two tests. reported, in a large cohort of lean healthy subjects, the third and first centiles normative limits for peak gh response to the gst to be 7.6 ng / ml and 7.1 ng / ml, respectively, compared to 5.3 ng / ml and 3.8 ng / ml, respectively, for the itt, although the overall response was similar between the two tests. found the itt to be a more exuberant stimulant of gh than glucagon in healthy subjects [28, 33 ] ; the study by rahim. reported the minimum response to the gst in their healthy subjects to be 11.8 mu / l (comparable to 4 ng / ml). the cut - off limit for the diagnosis of severe ghd using the gst is less well established than that for the itt, although two studies showed that a cutoff of 3 ng / ml using polyclonal radioimmunoassay to provide reasonable sensitivity and specificity [27, 28 ]. berg. reported a slightly lower optimal cutoff of 2.5 ng / ml using a modern ultrasensitive chemiluminescent gh assay. the gh response to glucagon may be more likely to be attenuated by age and obesity compared with the itt. although the gst is safe, with almost no contraindications, it causes nausea and sometimes vomiting in 1520% of subjects [25, 26 ]. in addition it is resource intensive test lasting for three - four hours due to the delayed action of glucagon. the co - administration of arginine and ghrh (the combined test) is a powerful stimulus for gh production and has gained increasing acceptance as a useful method of diagnosing ghd. this test has been advocated as a suitable alternative to itt [6, 3537 ]. as the amino acid arginine inhibits somatostatin tone, the ghrh - induced gh release is significantly potentiated. an intravenous infusion of arginine (0.5 g / kg body weight) together with an intravenous bolus of ghrh (1 mcg / kg body weight) is administered. the ghrh + arginine test allows good separation between healthy subjects and those with gh deficiency. however, the cutoff limit for the diagnosis of severe ghd is controversial, with one study suggesting a cutoff of 9 ng / ml, while another reporting an optimal cut - off of 4.1 ng / ml. the latter result is supported by a recent study that reported a cut - point of 3.7 ng / ml with an ultrasensitive chemiluminescence - based immunometric assay which conforms to international gh assay guidelines. the difference between these studies may be due to different gh assays used and different characteristics of the control groups particularly body mass index (bmi). the gh response to the combined test seems to be particularly influenced by bmi, and this is discussed in a later section. this test is safe, and, while half of patients experience flushing, more serious side effects are rare. this test should be avoided in patients with chronic renal failure due the risk of severe hyperkalaemia with arginine infusion. the ghrh + arginine test may give false normal results in patients with ghd secondary to hypothalamic damage, such as those with radiation induced hypopituitarism [4043 ]. hypothalamic injury is apparent earlier than pituitary damage, and therefore direct stimulation of the pituitary by ghrh may give a falsely normal result when compared with itt. once 10 years have elapsed following radiotherapy, the two tests appear to perform similarly well. in addition, combining ghrh with growth hormone releasing peptides (ghrp-6, ghrp-2, hexarelin) provides a strong stimulus for gh secretion. ghrh + ghrp-6 is now a well - validated test of gh reserve with a cut - off gh concentration of 15.0 ng / ml separating normal from hypopituitary subjects. mahajan and lightman demonstrated ghrh + ghrp-2 to be a reliable test for ghd despite only measuring a single gh value after 30 minutes. the restricted number of gh measurements makes this an attractive option but the low specificity of 78.6% will temper enthusiasm for this approach. ghrelin is the natural ligand of the gh secretagogue receptor and may have a role in the diagnosis of ghd in the future. arginine alone (the arginine test) is also used in the assessment of gh reserve. it has been shown to be a less exuberant stimulant for gh secretion than the itt or the gst [33, 37 ]. data on normal gh responses to the arginine test are not very robust ; while one study suggested that the third and first centile normative limits to be 2.9 ng / ml and 2.7 ng / ml, respectively, another study found a considerable overlap in gh response to arginine between ghd patients and normal controls ; 59% of healthy controls had a peak gh response to arginine 65 years) compared with middle - aged adults after stimulation with ghrh + arginine. obesity, particularly marked obesity, is associated with blunted gh secretion in response to provocative stimuli, and weight loss is associated with the restoration of normal gh production. kg / m) can result in diminished stimulated gh production in 13% of healthy subjects. in obesity, serum igf-1 concentrations are usually normal but some authors reported reduced, or even elevated levels in obese children. the pathogenesis of reduced gh secretion in obesity is unknown, but suggested mechanisms include increased hypothalamic somatostatinergic tone or ghrh hypoactivity, hyperinsulinaemia, or elevated circulating free fatty acids. currently, separate reference data for gh response to most provocative stimuli in obesity are not available. however, corneli. have defined bmi - specific cut - off points for diagnosing adult - onset ghd using ghrh + arginine11.5 ng / ml for those with bmi 30 kg / m. additionally, stimulated gh values are affected by oestrogen exposure and phase of the menstrual cycle. gh levels are higher during the luteal phase in comparison with the follicular phase of the cycle. oral, in contrast to transdermal oestrogen, lowers igf-1 levels and is associated with increased gh levels [61, 62 ]. therefore, one can not rely on a low igf-1 to diagnose ghd in women taking oral oestrogen preparations. while the measurement of serum gh and igf-1 concentrations is the cornerstone of the diagnosis of ghd, there are significant analytical problems with the currently available commercial immunoassays. despite attempts at assay standardisation and the recent increasing use of a highly - sensitive chemiluminescent method for the measurement of gh an assay method specific for the 22 kda isoform of gh is recommended, yet many assays still contain antibodies that detect other circulating forms of gh. additionally, not all methods have been calibrated with the international reference preparation (is : 98/574) leading to further interlaboratory discrepancy. nevertheless the increasing use of monoclonal assays (specific for the 22 kda isoform of gh) and recalibration with the international standard will overall lead to lower reported gh levels. this has implications for peak gh cut - off levels in provocative testing for ghd and older cut - offs should be adjusted depending on assay performance. gh results are reported in mass units or in international units although the former are now the recommended format. the international reference standard has recently changed (is : 02/254) but is not universally adopted. also, accurate measurement of igf-1 is subject to interference by binding proteins (igfbps), and a variety of methods with differing efficacy are used to separate ifg-1 from igfbps. more robust normative data with stratification for age groups and gender are required. despite the limitations mentioned above, the integrity of gh and igf-1 measurement can be improved at a local level by defining normal cut - off levels using healthy control subjects from the hospital 's catchment population. adult - onset ghd is now a well - recognised clinical syndrome and multiple benefits can be accrued from gh replacement. investigating patients within the appropriate clinical context is important to identify those who may be eligible for treatment. while it is widely accepted that a low igf-1 value in the presence of multiple pituitary hormone deficiencies provides strong evidence of ghd in adults, most patients will require provocative testing to confirm the diagnosis. numerous gh secretagogues are available with the insulin tolerance test being the gold standard and the glucagon stimulation test or the ghrh + arginine as acceptable alternatives. gh response to stimulation is both stimulus and assay dependent and can be influenced by factors such as age and bmi. all these variables should be considered when defining severe gh deficiency as an indication for gh replacement. | adult growth hormone (gh) deficiency is a recognised syndrome associated with adverse phenotypic, metabolic, and quality - of - life features which improve in many patients when gh is substituted. the appropriate selection of patients at risk of growth hormone deficiency (ghd) is the crucial first step in arriving at a correct diagnosis. although multiple diagnostic modalities are available including a 24-hour serum gh profile, stimulated gh levels, and insulin - like growth factor-1 (igf-1) levels, the use of dynamic tests for gh reserves is required in most cases. this paper discusses the utility and drawbacks of the various testing modalities with reference to international guidelines. regardless of the test chosen, clinical pitfalls including age and obesity must be taken into account. in addition, there is considerable analytical variation in the biochemical measurements of gh and igf-1 which must be considered before making a diagnosis of ghd in adulthood. |
to detect bim deletion polymorphism, we performed two types of polymerase chain reaction (pcr) analysis, according to the method of ng. in brief, we used a single primer set that contains the deletion area in intron 2 and two separate primer sets designed for wild - type and deletion alleles. the dna was subjected to pcr amplification using primers designed to detect deletion site (2903 bp) in intron 2 of the bcl2l11 gene. the resulting pcr products from the deletion (1285 bp) and wild - type (4188 bp) alleles were analyzed on agarose gels. in addition, the pcr products for the deletion (177 bp) and wild - type (174 bp) alleles were analyzed on agarose gel. we analyzed 20 cell lines, including the kcl-22 cell (which was reported to have the bim deletion), and 30 dna samples from healthy japanese volunteers. we studied 70 patients with egfr mutation - positive nsclc who were treated with egfr - tki during the period from january 2008 to january 2013. bim deletion polymorphism was analyzed by pcr in 58 samples of peripheral blood (cell - free dna in 34, leukocyte dna in 35) and on 24 formalin - fixed paraffin - embedded (ffpe) slides of surgical specimens (20 specimens of lung tissue and four of brain tissue) ; both blood and tissue specimens were available for 12 patients. to confirm the validity of pcr analysis of two types of samples, we compared the results for bim deletion polymorphism identified in lung tissue on ffpe slides with those from peripheral blood (cell - free dna or leukocyte dna) from the same patients (n = 12). dna was extracted from ffpe slides using the qiaamp ffpe tissue kit (qiagen kk, tokyo, japan). dna extraction blood samples were diluted in lysis solution to lyse the red cells and the white cell fraction was pelleted and washed once in phosphate - buffered saline. dna was extracted from the white cell pellets using the qiaamp dna mini kit (qiagen kk, tokyo, japan). we retrospectively analyzed the clinical characteristics, response rate (rr), disease control rate (dcr), and toxicity of egfr - tki in patients with and without bim deletion polymorphism. toxicity was assessed according to national cancer institute common terminology criteria for adverse events, version 3. we estimated pfs and overall survival (os) in patients with and without bim deletion polymorphism. the pfs of patients treated with egfr - tki was assessed from the date egfr - tki therapy was started to the earliest sign of disease progression as determined by findings from computed tomography or magnetic resonance imaging, according to the response evaluation criteria in solid tumors. os was defined as the period from the date of diagnosis until death from any cause. statistical analyses were conducted using spss software for windows, version 12.0 (spss, tokyo, japan). differences in clinical characteristics, rr, dcr, and adverse events between patients with and without bim deletion polymorphism were compared using fisher s exact test. survival curves were drawn by the kaplan - meier method, and statistical analysis was performed using the log - rank test. we used univariate analysis and multivariate cox regression analysis to identify factors associated with shorter pfs. the investigated prognostic factors were age, sex (male versus female), performance status (2 versus 1 versus 0), brain metastasis (yes versus no), bone metastasis (yes versus no), pulmonary metastasis (yes versus no), liver metastasis (yes versus no), lymph node metastasis (yes versus no), egfr mutation (major mutations [l858r and exon 19 deletion ] versus minor mutations [other mutations ]), egfr - tki response (partial response versus stable disease), smoking history (pack - years), and bim deletion (yes versus no). this single - center study was conducted at toho university omori medical center (tokyo, japan) and was approved by its human genome / gene analysis research ethical committee (authorization number ; 24 - 1). to detect bim deletion polymorphism, we performed two types of polymerase chain reaction (pcr) analysis, according to the method of ng. in brief, we used a single primer set that contains the deletion area in intron 2 and two separate primer sets designed for wild - type and deletion alleles. the dna was subjected to pcr amplification using primers designed to detect deletion site (2903 bp) in intron 2 of the bcl2l11 gene. the resulting pcr products from the deletion (1285 bp) and wild - type (4188 bp) alleles were analyzed on agarose gels. in addition, the pcr products for the deletion (177 bp) and wild - type (174 bp) alleles were analyzed on agarose gel. we analyzed 20 cell lines, including the kcl-22 cell (which was reported to have the bim deletion), and 30 dna samples from healthy japanese volunteers. we studied 70 patients with egfr mutation - positive nsclc who were treated with egfr - tki during the period from january 2008 to january 2013. bim deletion polymorphism was analyzed by pcr in 58 samples of peripheral blood (cell - free dna in 34, leukocyte dna in 35) and on 24 formalin - fixed paraffin - embedded (ffpe) slides of surgical specimens (20 specimens of lung tissue and four of brain tissue) ; both blood and tissue specimens were available for 12 patients. to confirm the validity of pcr analysis of two types of samples, we compared the results for bim deletion polymorphism identified in lung tissue on ffpe slides with those from peripheral blood (cell - free dna or leukocyte dna) from the same patients (n = 12). dna was extracted from ffpe slides using the qiaamp ffpe tissue kit (qiagen kk, tokyo, japan). dna extraction blood samples were diluted in lysis solution to lyse the red cells and the white cell fraction was pelleted and washed once in phosphate - buffered saline. dna was extracted from the white cell pellets using the qiaamp dna mini kit (qiagen kk, tokyo, japan). we retrospectively analyzed the clinical characteristics, response rate (rr), disease control rate (dcr), and toxicity of egfr - tki in patients with and without bim deletion polymorphism. toxicity was assessed according to national cancer institute common terminology criteria for adverse events, version 3. we estimated pfs and overall survival (os) in patients with and without bim deletion polymorphism. the pfs of patients treated with egfr - tki was assessed from the date egfr - tki therapy was started to the earliest sign of disease progression as determined by findings from computed tomography or magnetic resonance imaging, according to the response evaluation criteria in solid tumors. os was defined as the period from the date of diagnosis until death from any cause. statistical analyses were conducted using spss software for windows, version 12.0 (spss, tokyo, japan). differences in clinical characteristics, rr, dcr, and adverse events between patients with and without bim deletion polymorphism were compared using fisher s exact test. survival curves were drawn by the kaplan - meier method, and statistical analysis was performed using the log - rank test. we used univariate analysis and multivariate cox regression analysis to identify factors associated with shorter pfs. the investigated prognostic factors were age, sex (male versus female), performance status (2 versus 1 versus 0), brain metastasis (yes versus no), bone metastasis (yes versus no), pulmonary metastasis (yes versus no), liver metastasis (yes versus no), lymph node metastasis (yes versus no), egfr mutation (major mutations [l858r and exon 19 deletion ] versus minor mutations [other mutations ]), egfr - tki response (partial response versus stable disease), smoking history (pack - years), and bim deletion (yes versus no). this single - center study was conducted at toho university omori medical center (tokyo, japan) and was approved by its human genome / gene analysis research ethical committee (authorization number ; 24 - 1). using the two types of pcr analysis, we analyzed 20 cell lines and 30 dna samples from healthy japanese volunteers. among the 20 cell lines, only kcl-22 showed bim deletion. as for dna samples, bim deletion polymorphism was present in six of the 30 (20%) healthy volunteers. we confirmed the validity between blood samples (leukocyte dna in 12 and cell - free dna in four) and ffpe slides of surgical specimens (lung tissue in 12) : bim deletion was detected in three of 12 patients (25%). we analyzed bim deletion polymorphism in 70 patients with egfr mutation - positive nsclc who were treated with egfr - tki. bim deletion polymorphism was present in 13 of the 70 patients (18.6%) ; homozygous deletion was noted in one and heterozygous deletion in 12. for the one case of homozygous deletion, pcr analysis using the primer set for the wild - type allele showed no amplification (table 1). presence of bim deletion in patients with egfr mutation - positive nsclc (n = 70) there were no significant differences in the clinical characteristics, rr, dcr, or incidence of adverse events between patients with (n = 13) and without (n = 57) bim deletion polymorphism (tables 2 and 3). patient characteristics (n = 70) comparison of clinical response and adverse events after egfr - tki therapy we estimated pfs and os in patients with and without bim deletion polymorphism. the patients with bim deletion polymorphism had significantly shorter pfs than did those without bim deletion polymorphism (median, 227 versus 533 days ; p < 0.001 ; fig. 1). there was no significant difference in os (median, 1176 versus 1363 days ; p = 0.27 ; fig. 2). multivariate cox regression analysis showed that bim deletion polymorphism was the strongest independent indicator of shorter pfs (hazard ratio [hr ], 3.99 ; 95% confidence interval [ci ], 1.8648.547 ; p < 0.001 ; table 4). indicators of shorter pfs after egfr - tki treatment patients with bim deletion polymorphism had significantly shorter progression - free survival than did those without bim deletion polymorphism (median, 227 versus 533 days ; p < 0.001). there was no significant difference in overall survival between patients with and without bim deletion polymorphism (median, 1176 versus 1363 days ; p = 0.27). using the two types of pcr analysis, we analyzed 20 cell lines and 30 dna samples from healthy japanese volunteers. among the 20 cell lines, only kcl-22 showed bim deletion. as for dna samples, bim deletion polymorphism was present in six of the 30 (20%) healthy volunteers. we confirmed the validity between blood samples (leukocyte dna in 12 and cell - free dna in four) and ffpe slides of surgical specimens (lung tissue in 12) : bim deletion was detected in three of 12 patients (25%). we analyzed bim deletion polymorphism in 70 patients with egfr mutation - positive nsclc who were treated with egfr - tki. bim deletion polymorphism was present in 13 of the 70 patients (18.6%) ; homozygous deletion was noted in one and heterozygous deletion in 12. for the one case of homozygous deletion, pcr analysis using the primer set for the wild - type allele showed no amplification (table 1). presence of bim deletion in patients with egfr mutation - positive nsclc (n = 70) there were no significant differences in the clinical characteristics, rr, dcr, or incidence of adverse events between patients with (n = 13) and without (n = 57) bim deletion polymorphism (tables 2 and 3). patient characteristics (n = 70) comparison of clinical response and adverse events after egfr - tki therapy the patients with bim deletion polymorphism had significantly shorter pfs than did those without bim deletion polymorphism (median, 227 versus 533 days ; p < 0.001 ; fig. 1). there was no significant difference in os (median, 1176 versus 1363 days ; p = 0.27 ; fig. 2). multivariate cox regression analysis showed that bim deletion polymorphism was the strongest independent indicator of shorter pfs (hazard ratio [hr ], 3.99 ; 95% confidence interval [ci ], 1.8648.547 ; p < 0.001 ; table 4). indicators of shorter pfs after egfr - tki treatment patients with bim deletion polymorphism had significantly shorter progression - free survival than did those without bim deletion polymorphism (median, 227 versus 533 days ; p < 0.001). there was no significant difference in overall survival between patients with and without bim deletion polymorphism (median, 1176 versus 1363 days ; p = 0.27). bim deletion polymorphism is a germline alteration that affects egfr - tki related apoptosis. in a study that screened 2597 healthy individuals, bim deletion polymorphism was present in 12.3% of east asians but absent in africans and europeans. in the present study, bim deletion polymorphism was present in 13 of 70 japanese patients (18.6%) with egfr mutation - positive nsclc and in six of 30 healthy japanese volunteers (20%), a statistically insignificant difference. the overall frequency of bim deletion polymorphism in our study (19%, n = 100) was higher than that noted in a previous report. reported homozygous bim deletions in patients with mantle - cell lymphoma, and homozygous bim deletion was found in 0.5% of east asians. among the present 70 japanese patients with nsclc, one (1.4%) had homozygous deletion and 12 had heterozygous deletion. future studies should investigate the characteristics of patients with homozygous bim deletion polymorphism to determine if this genotype results in worse clinical outcomes when compared with heterozygous bim deletion. there were no significant differences between clinical characteristics, response to egfr - tki, or incidences of adverse events due to egfr - tki among patients with and without bim deletion polymorphism. thus, it is difficult to distinguish between patients with and without bim deletion polymorphism on the basis of clinical characteristics alone. bim knockdown was reported to prevent foxo3 (i.e., fkhrl1, a member of the forkhead transcription factor subfamily)-mediated overproduction of reactive oxygen species and apoptosis. bim deletion polymorphism might affect egfr - tki related lung injury by preventing overproduction of reactive oxygen species. further studies are needed to clarify the relationship between egfr - tki related pneumonitis and bim. bim deletion polymorphism, a germline alteration, is thought to be associated with intrinsic resistance to egfr - tki and would likely result in primary resistance and no response to treatment. however, the present clinical outcomes were probably due to acquired resistance : when compared with patients without bim polymorphism, those with bim deletion polymorphism had similar rrs and dcrs but shorter pfs. the reasons for these findings remain to be investigated. it has been hypothesized that egfr - tki induced apoptosis does not completely depend on the bim pathway and that tumor response to egfr - tki in patients with bim deletion might depend on other proapoptotic regulators, which could have less - prolonged clinical activity than those of the bim pathway. a second hypothesis is that bim deletion polymorphism itself results in relative resistance to egfr - tki. kuroda. showed that cancer cells were sensitive to small changes in bim protein concentrations and that bim protein concentration exerted a dose - dependent effect on apoptosis and the degree of tki resistance. in a report by faber., pfs was shorter (4.7 versus 13.7 mo, p = 0.007) among patients with low bim rna expression, which appeared to correlate with high bim protein expression on immunohistochemistry. the rr after egfr - tki was worse among patients with low bim rna expression (44%) than among those with high bim rna expression (77%), although the difference was not statistically significant. carriers that have varied bim expression and clinical responses that are modulated by genetic or epigenetic interactions, a possibility that warrants further study. although cells with bim deletion polymorphism show decreased induction of exon-4containing transcripts after tki exposure, the response after prolonged tki exposure should be investigated. ng. reported that patients with bim deletion polymorphism had significantly shorter pfs than did patients without bim deletion polymorphism after egfr - tki treatment (6.6 versus 11.9 mo, p = 0.0027), but they did not report rr or os. our present study in a japanese population yielded similar results : bim deletion polymorphism was an independent indicator of shorter pfs. however, there was no significant difference in os among patients with and without bim deletion polymorphism. multivariate cox regression analysis showed that indicators of shorter os were egfr - tki related pneumonitis (hr, 3.52 ; 95% ci, 1.1903.860 ; p = 0.023), brain metastasis (hr, 2.14 ; 95% ci, 1.0994.165 ; p = 0.025), and smoking history (hr, 1.001 ; 95% ci, 1.0001.001 ; p = 0.026). egfr - tki related pneumonitis developed only in patients without bim deletion polymorphism (n = 8, 14%) but has a detrimental effect on chemotherapy given after pneumonitis. thus, egfr - tki related pneumonitis might have reduced os among the present patients without bim deletion, which possibly explains the lack of a significant difference in os between patients with and without bim deletion polymorphism in the present study. bh3-mimetic drugs and histone deacetylase inhibitors may be able to surmount bim - associated resistance to egfr - tki. our findings suggest that although there was no significant difference in rr or os among patients with and without bim deletion polymorphism, the addition of these drugs might prolong pfs. however, this study was a retrospective study at a single center. a prospective multicenter study should be conducted to investigate the clinical significance of bim deletion polymorphism on egfr - tki therapy. in addition, egfr - tki related pneumonitis should be considered in any randomized prospective study of the clinical benefit of bh3-mimetic drugs or histone deacetylase inhibitors for patients with bim deletion polymorphism. in conclusion, bim deletion polymorphism, a germline alteration, was successfully detected by pcr analysis of samples of peripheral blood and ffpe slides of surgical specimens, thus providing a minimally invasive and convenient detection method. bim deletion polymorphism was the strongest indicator of shorter pfs among patients with egfr mutation - positive nsclc treated with egfr - tki. our results indicate that new treatment strategies should be established for patients with bim deletion polymorphism. we thank atsushi kakimoto, hiroki todoroki, and satoshi natsume of srl (tokyo, japan) and hiroyuki mano and manabu soda of jichi medical university (tochigi, japan) for their help. we are also grateful to r. j. turner of toho university and david kipler for their review of the language of this article. | background : germline alterations in the proapoptotic protein bcl-2like 11 (bim) can have a crucial role in tumor response to treatment. to determine the clinical utility of detecting bim deletion polymorphism in non small - cell lung cancer positive for epidermal growth factor receptor (egfr) mutation, we examined outcomes of patients with and without bim alterations.methods:we studied 70 patients with egfr mutation - positive non small - cell lung cancer who were treated with an egfr tyrosine kinase inhibitor between january 2008 and january 2013. bim deletion was analyzed by polymerase chain reaction in 58 samples of peripheral blood and 24 formalin - fixed paraffin - embedded slides of surgical specimens (20 of lung tissue and four of brain tissue) ; both blood and tissue specimens were available for 12 patients. we retrospectively analyzed clinical characteristics, response rate, toxicity, and outcomes among patients with and without bim deletion.results:bim deletion was present in 13 of 70 patients (18.6%). there were no significant differences between patients with and without bim deletion in clinical characteristics, rate of response to egfr tyrosine kinase inhibitor, or incidence of adverse events. patients with bim deletion had significantly shorter progression - free survival (pfs) than those without bim deletion (median, 227 versus 533 days ; p < 0.001). multivariate cox regression analysis showed that bim deletion was an independent indicator of shorter pfs (hazard ratio, 3.99 ; 95% confidence interval, 1.8648.547 ; p < 0.001).conclusions : polymerase chain reaction successfully detected bim deletion in samples of peripheral blood and formalin - fixed paraffin - embedded slides of surgical specimens. bim deletion was the most important independent prognostic factor in shorter pfs. |
contrast - enhanced computed tomography colonography (ce - ctc) is the best technique for colorectal cancer sites and staging (12), as well as to diagnose synchronous colonic lesions (3) in patients with obstructing cancers. ce - ctc is also useful to preoperatively evaluate others colorectal diseases, such as diverticular disease and inflammatory bowel disease (45). the laparoscopic approach for colonic surgery has become common and widely used because of the multiple advantages compared to conventional laparotomy. laparoscopic surgery produces smaller surgical incisions, less intraoperative blood loss, faster recovery of normal bowel function, and shorter hospitalization (67). nevertheless, the disadvantages to this approach include lack of a panoramic view of the operative field and tactile sensation, leading to potential inaccurate localization of a colonic lesion and difficulties with vessel ligation and lymph node dissection (8). only a few studies have analysed the vascular anatomy of the colon using multidetector ct (91011) and only one used ct colonography (12). bowel preparation consisted of a low - fiber diet and a mild laxative (macrogol solution) the day before ct. faeces were tagged by administering 60 - 90 ml amidotrizoate meglumine and 500 ml water at least 3 hours before the examination. the colon was distended by insufflating at least 3 l of carbon dioxide using an automatic insufflator. we performed a pre - contrast scan with the patient in the prone position using low mas and different post - contrast scans in the supine position after injecting 500 - 600 mgi / kg / body weight. post - contrast scans may have included arterial (obtained using bolus - tracking monitoring technique), portal venous, and delayed phases depending on the disease. comprehending the complex three - dimensional (3d) anatomy of the colon and branching vessels is difficult on axial images, particularly for inexperienced readers. 3d imaging provides surgeons with a precise and immediate understanding of the patient 's anatomy, including colonic loop shapes, colonic lesion sites, and the courses and relationships of the branching vessels. we obtained 3d fused images using a dedicated workstation (advantage workstation 4, general electric healthcare, waukesha, wi, usa) by processing the ct dataset from the arterial and portal - venous phases. three reformations with different settings (3d colon map and two different 3d vascular presets) were prepared separately and fused together into a single volume, which included the 3d colon map, a 3d arteriogram, and a 3d venogram, with the mesenteric arteries colored in red and relevant venous branches colored in blue. this resulted in a colon map that overlapped with the vascular map and showed the mesenteric branching pattern and the relationships between the colonic lesions, arteries and veins. the 3d images could be tilted and rotated to obtain the view that best simulates the intraoperative field of view. ct colonography allows for an accurate pre - operative assessment of colonic anatomy, and the locations of the colonic lesions and lymph nodes. post - contrast acquisition and the vascular map allow for a precise evaluation of mesenteric artery branching patterns and the relationships between arterial and venous vessels. although the laparoscopic approach has many obvious benefits compared to laparotomy, it suffers from a restricted operative field of view and an inability to manipulate tissues, which can result in time - consuming dissections when searching for anatomical landmarks, lymph nodes, or vessels. intraoperative conversion rates to laparotomy from laparoscopic colectomy are 10 - 20% (713) and is often due to difficulties identifying mesenteric vessels, synchronous tumors, intraoperative bleeding or procedure length (7). complications, such as bleeding and bowel ischemia, can occur because of vascular injury while dissecting nodes or ligating a vessel. previous knowledge of the patient 's mesenteric vascular anatomy, including arterial branching variants and relationships with adjacent veins, reduces operative time and the incidence of intraoperative complications (11). the branching pattern of the superior mesenteric artery (sma) must be assessed before a right hemicolectomy and right transverse colon surgery. the middle colic artery (mca) and the ileocolic artery (ica) are present in almost all patients, whereas the right colic artery (rca) is present in about 50% of cases (figs. 1, 2). the inconsistency in the presence of the accessory left colic artery (alca), known as the artery of riolan, originates from the sma or mca and anastomoses with the left colic artery (lca), feeding the transverse colon (figs. 3, 4). the common origin of the mca, rca, and ica (fig. the most significant variant to be considered during laparoscopic right hemicolectomy is the relationship between the colic arteries and the superior mesenteric vein (smv) ; arteries cross anterior to the smv in most patients, but a posterior crossing pattern of the ica, mca, or rca is also common (figs. 5, 6). it is important to locate the alca and the branching pattern of the inferior mesenteric artery (i m a) when planning left transverse colon surgery and left hemicolectomy. moreover, pre - operative planning for sigmoidectomy should include an evaluation of the sigmoid artery (sa) branching pattern because the i m a can be preserved if the sas are selectively ligated. the number of sas varies and they can either originate from the i m a or lca (figs. 2, 4, 7) (15). the relationship between arteries and the inferior mesenteric vein (imv) can also vary : lca and sas can either cross anteriorly or posteriorly to the imv (figs. 8, 9). because of their close proximity, the relationships between the lca, sas, and the left gonadic vein and ureter must be assessed. the origins of other splanchnic arteries from the sma or i m a must also be considered be. 7) (15). variants in mesenteric vein drainage should also be evaluated (fig. 8). vascular maps from a ce - ctc examination are easily obtained by modifying the standard protocol and are easy to interpret. the laparoscopic surgeon, regardless of the disease, can benefit from vascular maps, as they limit risks concerning vessel ligation and/or lymph node dissection. | contrast - enhanced computed tomography colonography (ce - ctc) is a useful guide for the laparoscopic surgeon to avoid incorrectly removing the colonic segment and the failure to diagnose of synchronous colonic and extra - colonic lesions. lymph node dissection and vessel ligation under a laparoscopic approach can be time - consuming and can damage vessels and organs. moreover, mesenteric vessels have extreme variations in terms of their courses and numbers. we describe the benefit of using an abdominal vascular map created by ce - ctc in laparoscopic colorectal surgery candidates. we describe patients with different diseases (colorectal cancer, diverticular disease, and inflammatory bowel disease) who underwent ce - ctc just prior to laparoscopic surgery. |
primary hyperparathyroidism (php) is a rare life - threatening condition that can present during the pregnancy. most of the cases are due to parathyroid adenoma, but rarely parathyroid carcinoma may be the cause of php. diagnosis can be difficult to establish during the pregnancy, given the non - specific symptoms related to hypercalcemia. here, we present a case of parathyroid carcinoma diagnosed during the pregnancy. a 10-week - pregnant female patient had presented with nausea and vomiting in antenatal clinic. she was diagnosed as having morning sickness and prescribed multivitamins and symptomatic treatment to which she did not respond. there was no history of calcium disorders, kidney stones, fractures, osteoporosis or any drug ingestion, which could lead to hypercalcemia. on examination initial laboratory evaluation revealed severe hypercalcemia with a corrected calcium level 14.9 mg / dl (reference range 8.5 - 10.3 mg / dl) and a phosphorous level of 1.9 mg / dl (2.4 - 4.1) with a normal renal function. her 25-hydroxy vitamin d levels were 27.6 ng / ml. her parathyroid hormone (pth) level was 768 pg / ml (10 - 60 pg / ml) and a urinary calcium level of 879 mg/24 h (reference range : 100 - 300 mg/24 h). laboratory work - up was inconsistent with vitamin d intoxication, milk alkali syndrome, sarcoidosis, hyperthyroidism or malignancy. ultrasound of the neck was carried out, which showed a 4.05 cm 3.39 cm 2.5 cm sized left inferior parathyroid adenoma as shown in figure 1. magnetic resonance imaging of neck confirmed a mass of the same size arising from the parathyroid gland as shown in figures 2 and 3. ultrasound image of parathyroid adenoma coronal magnetic resonance imaging image showing large parathyroid adenoma axial section of magnetic resonance imaging neck showing parathyroid adenoma an elective minimally invasive parathyroidectomy of the enlarged parathyroid gland was planned at 14 weeks of pregnancy. during the surgery, an enlarged parathyroid gland was located behind the left lobe of thyroid gland and was well - encapsulated and easily separated from thyroid. there was a remarkable drop in the pth levels from 768 pg / ml to 25 pg / ml at 10 min after the removal of the enlarged parathyroid gland as measured intraoperatively. post - operatively, calcium and pth level was 9.4 mg / dl and 38.5 pg / ml respectively. transient drop in the serum calcium during the post - operative period was managed with oral and intravenous calcium supplementation. the patient 's calcium stabilized after 4 days and was discharged and counseled for regular and frequent endocrine and antenatal follow - up. pathological evaluation of the resected mass demonstrated parathyroid carcinoma with vascular and capsular invasion as shown in the figures 4 and 5. however, on follow - up there is no recurrence of hypercalcemia and repeat ultrasound is not suggestive of any lymph node enlargement or any other evidence of malignancy. diagnosis of php in pregnancy becomes difficult due to two reasons ; firstly, 80% are asymptomatic and secondly the clinical features of hypercalcemia can be easily confused with non - specific symptoms in pregnancy unless more specific symptoms like pathological fracture or renal stones manifest, which themselves are rare nowadays. biochemically, pregnancy makes the diagnosis of hypercalcemia challenging due to factors such as physiological hemodilution, hypoalbuminemia and maternal hypercalciuria due to an increase in glomerular filtration rate. diagnosis of php in pregnancy applies the same criteria as in non - pregnant adults namely, an elevated total corrected calcium level (> 9.5 mg / dl) or ionized calcium level, hypophosphatemia (< 2.5 mg / dl) and an elevated serum pth level in the absence of other causes of hypercalcemia. ultrasonography of the neck is the investigation of choice during pregnancy for localization of parathyroid adenomas with a sensitivity of 69% and specificity 94%. php also poses a grave danger to fetus if untreated hence necessitating an immediate and complete expert management by a multidisciplinary approach. php leads to maternal complications in 2/3 of cases with nephrolithiasis, bone disease and pancreatitis being most common. other less frequent maternal complications include hyperemesis gravidarum, preeclampsia, tremors, constipation, depression, blurred vision, uremia, seizures and coma. however, the gravest of all complications are hypercalcemic crises in antenatal and hypocalcemic tetany and seizures in immediate postnatal period. due to the paucity of specific guidelines, management of hyperparathyroidism during pregnancy needs to be individualized considering clinic - biochemical issues and fetal well - being. a minimally invasive parathyroidectomy in the second trimester is the gold standard in managing php during pregnancy. parathyroid carcinoma is one of the rarest of endocrine cancers with higher prevalence in patients with the chronic kidney disease and neck irradiation. they are slow growing tumors presenting with hypercalcemia and having a tendency to recur locally in 40 - 60% of cases. they occur with equal propensity in males and females and at a younger age, are larger in size and associated with profound renal, metabolic, neuromuscular, rheumatologic, gastrointestinal and cardiovascular manifestations. microscopically, the cells resemble watermelon seeds and show vascular and capsular invasion in most of the cases, but these features are not absolutely conclusive. our case highlights the significance of timely recognition and effective management of php in pregnancy, leading to optimization of both maternal and fetal outcomes. | incidence of primary hyperparathyroidism (php) in pregnancy is 8/100,000 population / year with less than 200 cases reported. physiological changes associated with pregnancy make a diagnosis of php difficult and 80% are asymptomatic. high index of suspicion is required as physiological hypocalcemia related to hemodilution, increased glomerular filtration rate resulting in maternal hypercalciuria and gestational hypoalbuminemia can mask hypercalcemia of php. maternal and fetal complication rates are high. early recognition followed by appropriate management and treatment significantly reduces complications. here, we present a rare case of parathyroid carcinoma in pregnancy and highlight the difficulties in diagnosis given the non - specific symptoms related to hypercalcemia. we have also discussed the management of php during the pregnancy. php is a preventable cause of fetal and maternal morbidity and mortality. |
unilocular adipocytes are the principal component of white adipose tissue and have a classical role in the regulation of triglycerides and fatty acid accumulation during energy expenditure and deprivation 1 - 2. the regulation of adipocyte differentiation is controlled by several factors, including hormones and their receptors that activate proteins and transcription factors such as cebp/, ppar-, cebp/, ap2 and others 3 - 4. besides unilocular adipocytes, mesenchymal stem cells and differentiating adipocytes have been described in the adipose tissue making it appear that mesenchymal stem cells under specific stimuli become committed to the adipocyte lineage and able to accumulating lipids thus forming adipocytic multilocular cells, preadipocytes, and ultimately, unilocular adipocytes 1 - 4. more recently, several groups have demonstrated that adipose tissue is able to produce proinflammatory cytokines and fat - derived peptides termed adipokines (including ligands such as adiponectin, leptin, resistin, tnf-, il-6), which act in a paracrine, autocrine and/or endocrine manner 4 - 5. the accumulation of adipocytic cells and an increased percentage of fat in several ectopic regions of the body with aging have been well - described 6. this increase also appears to correlate with observed increases in circulating levels of proinflammatory cytokines during aging 7. this is of great interest from an immunological perspective, as the thymus is one of the organs known to accumulate fat during aging and has been shown to be sensitive to inflammatory changes 8 - 10. the thymus is a primary lymphoid organ responsible for the differentiation and maturation of t lymphocytes 10 - 12. anatomically, it is a bi - lobed organ subdivided in lobules by septa that emerge from the capsule. blood vessels and nerves are able to reach the thymic parenchyma by the septa region. in the young thymus, each lobule contains two very well defined regions : the cortex, enriched in immature t cells ; and the medulla, where mainly mature immunocompetent thymocytes can be found, before exiting the organ to populate the periphery. the process of t cell maturation initiates during fetal development. in post - natal life, progenitors that originated in the bone marrow enter into the thymus and interact with several different thymic stromal cell types, including epithelial cells, macrophages, dendritic cells and fibroblasts, which participate of the t cell differentiation process 10 - 12. with age, the thymus gradually decreases its capacity to generate immunocompetent t cells and becomes minimally functional, as it undergoes dramatic changes in its size, morphology and cell composition, a process termed age - associated thymic involution 8 - 10, 13 - 16. decreased thymopoiesis, loss of cortical and medullary boundaries, deposition of unilocular adipocytes and changes in the expression of various thymic factors have been shown to occur during this process. this is associated with the increased susceptibility of aged individuals to infectious diseases 10, 17. thus, investigating the mechanisms that regulate thymic involution and identifying the cells that participate in this process might contribute to the development of strategic therapies for immunodeficiency conditions, as in the case of aging. in the current studies, we have investigated the distribution of fat - storing cells in the aging thymus and we found not only an increase of unilocular adipocytes but also an increase of adipocytic - like multilocular mesenchymal cells in the septa and parenchymal regions of the organ. these findings suggest that adipocyte precursors or fat - storing cells may be migrating into and/or differentiating actively within the aging thymic microenvironment. furthermore, we found that the adipocyte - like cells accumulating in the thymus with age express the chemokine receptor, ccr5. using the well - characterized adipocytic mesenchymal cell line, 3t3-l1, we found that ccr5 ligands are capable of regulating the migration and differentiation of these cells and suggest a potential role for these chemokines in adipocyte biology. balb / c mice bred in the national institute on aging rodent colony (bethesda, md) were utilized at 2, 4, 6, 9, 12, 18, 21 and 24 month - old. mice were housed in environmentally controlled rooms with a 12h light - dark cycle according to the procedures outlined in the " guide for the care and use of laboratory animals " [nih publication no. 86 - 23, 1985 ]. ccr5-deficient mice (b6;129p2-ccr5/j) originally obtained from jackson laboratories (bar harbor, me) were aged in the animal house of the niaid and kindly donated by dr. 1,152 cdna clones were selected from a verified sequence master set containing 15,000 human t1 phage - negative image consortium clones commercially obtained from research genetics, inc. nylon membranes were used as substrate for denatured cdna clone printing in duplicates, using a gms417 microarrayer (affymetrix, santa clara, ca). before the addition of the cdna probe, the thymi of 2-, 4-, 6-, 12- and 18-month - old balb / c mice were placed into multiple pools by age for total rna extraction using rnazol b (tel - test, friendswood, tx) and cdna probes were prepared using reverse transcriptase. cdna microarray membranes were loaded into conical tubes containing mycrohyb hybridization buffer (research genetics) in presence of 0.6g/l of cot1 dna (life technologies) and 0.5g/l of poly a primers (sigma) blocking agents. after prehybridization, p - labeled cdna probes (at the concentration of 1x10 counts / ml hybridization buffer) were added to the tubes with cdna microarray membranes and hybridized overnight at 42c. hybridized membranes were washed twice with 15 ml of wash solution (0.1%sds and 2x ssc) for 15 min at 55c and at room temperature, respectively. the radioactive cdna microarray membranes were examined on a phosphorimager (molecular dynamics storm, sunnyvale, ca) at a resolution of 50 m. grid overlays were utilized to identify cdna targets on the arrays and signal intensity for each cdna was examined using the array pro software (media cybernetics, silver spring, md). background correction for each cdna microarray hybridization assay was assessed via the subtraction of single spot intensities by the median of the background signal intensity from the array. the background - subtracted spot intensities were subsequently transformed to loge scale and ratio comparisons were done using the group of 2 month - old as control. 1g of total rna isolated from the thymi of 2-, 12- or 18-month - old balb / c mice was utilized to generate cdna probes using taqman reverse transcription reagents (pe applied biosystems, foster city, ca). the sybr green i assay and the geneamp 5700 sequence detection system (pe applied biosystems) were utilized for the detection of real - time pcr products as previously described 18. primers were designed for ccr5, ccl3, ccl4 and ccl5 based on their sequence in genbank (www.ncbi.nlm.nih.gov/genbank) as well as for glyceraldehyde-3-phosphate dehydrogenase (gapdh), which was utilized as control. for each of the age groups, pcr reactions were performed in duplicate in a 96-well plate for each gene - specific primer pair tested. the comparative threshold cycle (ct) method (pe applied biosystems) was utilized to determine relative quantity of gene expression for each gene compared with the gapdh control. briefly, ct values from gapdh reactions were averaged for each duplicate and the relative difference between gapdh and each duplicate was calculated (2 ct gapdh - ct experimental). this value was then averaged for each duplicate set and divided by the value of the 2 month - old thymus samples to determine the relative fold induction for each sample. differences regarding fold change values observed between the cdna microarray and real - time pcr results might be due to experimental variability in the two distinct assays. thymi (n=4) of 2, 9, 12, 18 and 21 months of age were mounted in a tissue array as previously described 19. for hematoxylin and eosin staining, sections were deparaffinized in xylene, re - hydrated in graded alcohols and placed at high temperature in solution of 0.01 m sodium citrate buffer (ph 6.0) for 40 min. sections were then stained with hematoxylin (lerner laboratories), rinsed and differentiated with 1% acidic alcohol before eosin (lerner laboratories, pittsburgh, pa) staining, dehydrated in graded alcohol and then mounted in organic media. for peroxidase immunohistochemistry, a standard two - step dako autostainer (dako corporation, carpenteria, ca) was utilized to examine the thymic sections. primary purified rabbit anti - mouse ccr5 (bd pharmingen, ca), rabbit anti - ccl3, -ccl4 (r&d systems, mn) or -ccl5 (chemicon, ca) igg antibodies were applied on thymic sections at 10g / ml for 60 min at room temperature in moist humidified chamber. after extensive washing, tissue sections were incubated with peroxidase - conjugated donkey anti - goat, goat anti - rabbit or rabbit anti - rat (santa cruz biotechnologies) antibody, for 30 min, after which the sections were extensively washed and then immersed in a freshly prepared chromogen / substrate reagent (diaminobenzidine, dab/ hydrogen peroxide, h2o2). slides were mounted using an organic media (cytoseal60, stephens scientific, riverdale, nj). pbs, ph 7.4, was used for all intermediate wash steps. for immunofluorescence, rat anti - mouse fibroblast/ mesenchymal cells (er - tr7) (novus biologicals, littleton, co) igg antibody was used at 10g / ml for 60 min. after pbs washing, slides were incubated with anti - rat igg antibody conjugated to alexa-594 (molecular probes, eugene, or). subsequently, slides were washed, incubated with the dna dye dapi (4',6-diamidino-2-phenylindole) and mounted using glycerol 50% aqueous mounting media. oil red o (fischer scientific, hanover park, il) was diluted in 50% propylene glycol, and filtered. thymic tissue sections were incubated with oil red o solution for 4h at room temperature and then rinsed with 50% isopropyl alcohol and in distilled water before hematoxylin staining, for 2 min. slides were then rinsed with ammonia 5% in water, blot dried and mounted with glycerol 50% aqueous mounting media. cells were cultured in dulbecco 's minimal essential medium (dmem) supplemented with 10% calf serum until confluence (6 - 7 days). then, confluent 3t3-l1 preadipocytes were treated for 9 or 12 days with 100 ng of ccl3, ccl4 or ccl5 (chemicon, ca). subsequently, differentiation of 3t3-l1 cells was analyzed by lipid accumulation under light microscope and by western blot analysis for adipocyte differentiation markers. 3t3-l1 cells were lysed in 1.5x laemlli sample buffer and proteins were quantitated by bradford reagent (bio - rad, hercules, ca). after heating for 5 min at 95c, proteins were separated by sds - page on 12% polyacrylamide gel and transferred onto 0.22m polyvinylidine (difluoride) membranes (invitrogen). membranes were probed with rabbit anti - ppar2 (affinity bioreagents, co) or rabbit - anti - ap2 (genetex, tx) antibodies. signal detection was performed by chemiluminescence (ecl) using hyperfilm (amersham biosciences). 3t3-l1 preadipocytes were placed in fibronectin - coated plates (bd biosciences, ca) in dmem medium. after two days post - confluence, cells were treated in the absence or in the presence of ccl3, ccl4 or ccl5 (100 ng / ml) for 16h. a wound was inflicted with a sterile plastic tip by scratching the confluent monolayer. cells moving into the scratch were observed over several time points using light microscopy. tissue arrays were used to characterize the phenotype of adipocytic cells within the thymus of aging mice. histological and morphological analyses indicated an age - dependent increase in adipose tissue deposition, including unilocular adipocytes and multilocular cells. upper panels of figure 1 represent the thymus of 2, 12 and 21 month - old mice stained for hematoxylin and eosin. in the thymus of 2 month - old mice the cortical and medullary regions were well - defined and very few or no adipocytes were observed in the septa region or inside the organ (figure 1a). a progressive deposition of unilocular adipocytes was mainly seen in the thymic perivascular space (pvs), as shown in the representative photomicrography of 12 month - old murine thymus (figure 1b). interestingly, in some thymic tissue sections of 18 month - old animals, isolated adipocytes were observed in the subcapsulary region of the organ (not shown) and fibroblastoid cells were visualized inside the thymic parenchyma. these fibroblastoid cells were observed connected to the capsule, thus creating a boundary - like structure in the subcapsulary region of the organ (figure 3h). as expected, as thymus aged, a decrease in the number of thymocytes was seen in the cortex and loss of cortical and medullary boundaries were observed in the thymic lobules (figure 1). to further investigate the presence of fat - storing cells in the aging thymus, we performed oil red o staining in frozen mouse thymic tissues. increased number of multilocular oil red o cells while the thymi of 2 month - old mice showed few, if any, oil red o multilocular cells, mice at 4 and 6 months of age presented fat - storing cells mainly in the septa region of the organ (not shown). moreover, oil red o+ multilocular cells were observed in the thymic septa and in the thymic capsular regions of 12 month - old mice. finally, a higher number of oil red o multilocular cells were visualized in the septa region and inside the thymic parenchyma of 12 and 24 month - old thymi (figure 1). these data lead us to propose that adipocytic / mesenchymal cells may be migrating to the aging thymus and behaving as a thymic stromal cell component able to interact closely with differentiating thymocytes and other microenvironmental cells in the aging thymus. age - dependent thymic expression of ccr5 chemokine receptor. based on the possibility that adipocytic / mesenchymal cells could be immigrating into the thymus, we looked for genes that significantly changed with age and are known to be involved in cell migration. using cdna microarray technology, changes in thymic gene expression profiles were analyzed as a feature of aging. one of the genes identified was ccr5, a chemokine receptor known to bind to the proinflammatory chemokines ccl3, ccl4 and ccl5. previous data have demonstrated that ccr5 participates in t cell migration and activation 20. in addition, ccr5 has been shown to be expressed in t cells, macrophages and, interestingly, human adipocytes and 3t3l1 preadipocyte cell line 21 - 23. we analyzed the expression of ccr5 mrna and found that it was increased in the aging thymus, as detected by cdna microarray and confirmed by real time rt / pcr (figure 2). flow cytometric analyses revealed that only 1 to 2% of total mouse thymocytes express ccr5, independently of age (data not shown), indicating that this increase may be attributable to ccr5 production by thymic stromal cells. ccr5 expression in the aging thymus is mainly detected in fat - storing multilocular cells. to substantiate the above observations, we performed immunohistochemical analysis of our thymic tissue array and demonstrated an increase of ccr5 expression in the aging thymus (figure 3). although some thymocytes stained positive for ccr5 were observed, the main thymic cell type expressing ccr5 resembled adipocytic - like multilocular cells or fat - storing cells. these cells were mainly found in the septa region, adjacent to adipocytes, and also in the thymic parenchyma, interacting with thymocytes and thymic microenvironmental cells (figure 3). morphologically, ccr5 multilocular cells and fibroblastoid cells were present in the perithymic adipose tissue as well as in the perivascular space in the septa and capsule. additionally, these cells were visualized in the subcapsulary region of aged thymi and inside the thymic aged parenchyma in contact with thymocytes (figures 3). serial sections of thymic tissue arrays showed that these multilocular cells stained positively for er - tr7, a known marker for murine mesenchymal cells (figure 4). to further investigate a possible role for ccr5 on immigration of fat - storing cells, we examined the expression of ccr5 ligands in the aging thymus. real time - rt - pcr analysis showed that the expression of ccl3, ccl4 and ccl5 mrna increased in thymus and total thymocytes with age (figure 5). using immunohistochemical method, thymocytes and thymic stromal cells stained positively for ccl4 and ccl5 (figure 6). interestingly, in the septa region of the thymus of 2 month - old mice, ccl4 expression was detected in cells resembling pericytes and myofibroblasts, mesenchymal cell types (figure 6). in the thymus of 12 months of age, ccl4 expression was observed in thymocytes and in multilocular cells in the septa and inside the thymic parenchyma. these data reinforced the hypothesis that adipocytic mesenchymal cells could be possibly immigrating and/or differentiating in the aging thymus by an active process regulated by ccr5 ligands. the possibility that ccr5 ligands could be influencing immigration of adipocytic mesenchymal cells into the aging thymus lead us to investigate whether oil red o cells could be visualized in thymi of 10 - 11 month - old ccr5-deficient mice. both aged ccr5-deficient mice and wild type control group presented oil red o multilocular cells in the septa and in the cortical region of the thymus (figure 7). although the number of oil red o cells in ccr5-deficient mice was lower than in control group, this difference was not statistically significant. moreover, there was no significant histological change between ccr5-deficient and control thymi stained for hematoxylin and eosin (data not shown). ccr5 ligands regulate differentiation and migration of 3t3-l1 adipocytic multilocular mesenchymal cells in vitro. due to the lack of specific surface markers for adipocytic multilocular mesenchymal cells and technical difficulties to isolate them, we chose to analyze the effects of ccr5 ligands in murine 3t3-l1 cells, a well - characterized embryonic mesenchymal cell line known to differentiate into adipocytes in vitro 24,25. to investigate the role of ccr5 ligands in 3t3-l1 cells, immunocytochemistry was used to verify the expression of er - tr7 and ccr5. in addition, 3t3-l1 cells in differentiation also expressed ccl3, ccl4 and ccl5, thus suggesting that these chemokines could possibly act in an autocrine and paracrine manner (figure 8a). the differentiation of 3t3-l1 cells is routinely carried out by the addition of dexamethasone, insulin and isobutyl - methyl - xanthine to the culture medium 24,25. however, in the absence of these specific factors, 3t3-l1 cells are able to differentiate spontaneously although to a much slower rate. to analyze if ccr5 ligands would be able to stimulate differentiation of 3t3-l1 cells to adipocytes, ccl3, ccl4 or ccl5 was added to the culture medium of confluent cells for nine or twelve days. these chemokines were found to stimulate the differentiation of 3t3-l1 cells, as evidenced by the increase expression of the adipocyte differentiation markers, ppar2 and ap2 (figure 8b). by the ninth day of culture, the number of refringent multilocular cells accumulating lipids was higher in ccr5 ligand - treated cells when compared to untreated cells. this observation was even more evident at twelve days of culture (figure 8c). we also investigated the influence of ccl3, ccl4 and ccl5 on the migration of multilocular mesenchymal cells in vitro. 3t3-l1 cells were cultured in fibronectin coated - plates and two days post - confluence, cells were treated with ccl3, ccl4 or ccl5 for 20h, followed by scratching of the plate. as indicated in figure 9a, after 20h, higher cell motility was observed in the plates treated with all three ccr5 ligands, as compared to untreated cells, and the treatment of ccl5 elicited the strongest effect. taken together, these results show that ccr5 ligands are able to modulate adipocyte differentiation as well as the migration of 3t3-l1 adipocytes. within the young thymus, several cell types have been described as playing a role in thymic physiology including thymocytes, thymic epithelial cells, dendritic cells, fibroblasts, mesenchymal cells and a variety of hematopoietic cells, such as macrophages, nk and b cells 25, 26. however, alterations in numbers, distribution and function of these thymic cellular components during the aging process are poorly known. in this work, we suggest that adipocytes and fat - storing cells may be an active component during thymic atrophy associated with age. in this context, unilocular adipocytic cells have been described to fill the space left by the receding lymphoid thymic compartment as thymus age 9, 27, 28. it is known that adipocyte deposition occurs in the aging thymus possibly due to the loss of thymopoiesis and increase of thymic interlobular spaces, characteristics of thymic involution 10, 27, 28. in agreement, our histological analysis show progressive age - dependent alterations in the thymic organ, with unilocular adipocytes accumulation in the mouse thymic perivascular space 9, 27 - 29. in addition, our data also show interaction between unilocular adipocytes with thymocytes and thymic stromal cells inside the thymic parenchyma. these observations suggest a possible functionality to adipocytic cells in the thymus which conflicts with the general belief that during aging, adipocytic unilocular cells simply fill a space left by the thymic lymphoid compartment or replace the lymphocytic perivascular space. in the present study, we defined not only thymic unilocular adipocytes in the thymus but also fat - storing multilocular mesenchymal cells, based on their morphology, oil red o and ertr7 staining. we found that the presence of fat - storing cells inside the murine thymic parenchyma and septa region with age is in accordance with a previous study showing the ultrastructure of adipocytic multilocular cells in the thymus of rats and mouse 30. interestingly, oil red o cells were shown within the perivascular space of human thymus 31. however, these authors failed to comment on the presence of adipogenic multilocular cells within the aged human thymus. an increased number of fat - storing multilocular cells within the aging thymus were also observed in our study. however, how these cells appear in the thymus and their function is unknown. one hypothesis is that adipogenic multilocular cells could be differentiating from mesenchymal cells known to be present in the thymic parenchyma since fetal life 32. it is also possible that fat - storing multilocular cells could be differentiating from pericytes associated with endothelial cells in blood capillaries of the thymus. in this context, pericytes have the potential to differentiate to distinct mesenchymal cell lineages, including the adipocytic one 33, 34. third, the immigration of adipocytic precursors from the perithymic adipose tissue or circulation may result in adipocytic multilocular cell accumulation in the aging thymus. recently, bone marrow mesenchymal stem cells were found to migrate from the circulation to several tissues, including the thymus 35, 36. finally, the possibility that all these events are happening conjointly during the process of aging can not be ruled out. our results show an age - associated increase in ccr5 mrna expression in the thymus that correlates with an increased number of ccr5 multilocular cells within the thymic capsule, septa and in the parenchyma of the organ. in this context, ccr5 expression has been previously found in human adipocytes in vitro and in human adipose tissue in situ as well as in 3t3l1 preadipocyte line in culture 25, 37. thus, the possibility that the chemokine receptor ccr5 could be regulating adipocyte migration was investigated. toward this end, the ccr5 ligands, ccl4 and ccl5, increase in the thymic parenchyma as revealed by the age - associated increases in the staining of thymocytes and microenvironmental cells, including the multilocular fat - storing cells. these data suggest that chemokines may influence the migration and possibly the differentiation of adipogenic or fat - storing cells within the aging thymus. however, our observations showing no significant differences in the number of fat - storing multilocular cells using 11 month old ccr5-deficient versus wild type mice (although a trend of lower adipocyte numbers was observed) failed to support a role for ccr5 in adipocyte development in the aging thymus. however, these data also raised two possibilities. first, the progenitors of these adipocyte - like cells could be thymic mesenchymal cells that are known to be present in the thymus parenchyma 31 and whose phenotype may be modified during the aging process. second, other chemokine receptors could be acting in the migration of adipocytic mesenchymal cells to the aging thymus of ccr5-deficient mice. however, it should be noted that we were quite limited with the number of aged ccr5 deficient mice available to us to examine here and additional studies may provide more conclusive data regarding the role of distinct chemokine receptors in adipogenic mesenchymal cell immigration and/or differentiation within the aging thymus. interestingly, we have found that the ccr5 ligands, ccl3, ccl4 and ccl5, without any other stimuli, were able to induce adipogenesis using the 3t3-l1 mesenchymal cell line, as evaluated by the increased expression of ppar2 and ap2 38, 39. to our knowledge, this is the first time ccr5 ligands are described to stimulate adipocyte differentiation. while these data do not directly demonstrate the ability of chemokine ligands to facilitate primary mesenchymal cell differentiation to the adipocyte lineage, these experiments support the idea that chemokines may be possibly acting as chemoattractants for adipogenic mesenchymal and/or fat - storing cells, facilitating their immigration and possibly their subsequent differentiation within the aging thymic microenvironment. although additional work will be needed to establish a role for adipogenic cells in the thymus, several groups have shown thymic atrophy in transgenic mice harboring defects in adipocyte physiology, such as ob / ob (leptin), db / db (leptin receptor) and corticotropin - releasing factor overexpressing mice 40, 41. in this context, reducing proadipogenic signaling in caloric restriction model leads to a reduction in age - associated thymic involution 42. obviously, much more work is needed to understand the crosstalk and interregulatory relationships between chemokines and cytokines, mesenchymal cells and adipocytes during the aging process, in particular during the thymic involution process. adipocytes and preadipocytes secrete a number of inflammatory cytokines including lif, il-1, il-6, tnf- among others 43, 44. in the thymus, we have observed an increased level of lif, il-6, tnf- and other pro - inflammatory cytokines in the supernatant of thymus explants of 10 month - old mice as compared to the thymus explants of 2 month - old animals (our unpublished data). in addition, the expression of lif, oncostatin m and il-6 increases in the thymus with age 8, 45. thus, it is quite reasonable to hypothesize that the production of proinflammatory cytokines by adipocytic cells could actually contribute to oxidative stress in the thymus and, consequently, to the age - associated thymic involution process, killing thymocytes and/or thymic epithelial cells and favoring the lipid accumulation in adipocytic cells. our observations associating the increased presence of adipocytic / fat - storing mesenchymal cells and loss of thymocytes with advancing age lead to a novel conceptual point of view concerning the understanding of the process of thymic physiology in aging, where the increase in adipocytes an fat - bearing cells may play and active role in thymic tissue loss rather than simply increasing as a consequence of thymic loss by some other as - of - yet undescribed mechanism. based on these findings, studies are underway to investigate the role of adipocytes and adipogenic precursors in the aging thymus physiology as well as their possible contribution to age - associated thymic involution. these studies may eventually lead to the development of strategic therapies to improve thymic integrity and thymopoiesis during aging. | age - associated thymic involution is characterized by decreased thymopoiesis, adipocyte deposition and changes in the expression of various thymic microenvironmental factors. in this work, we characterized the distribution of fat - storing cells within the aging thymus. we found an increase of unilocular adipocytes, ertr7 + and ccr5 + fat - storing multilocular cells in the thymic septa and parenchymal regions, thus suggesting that mesenchymal cells could be immigrating and differentiating in the aging thymus. we verified that the expression of ccr5 and its ligands, ccl3, ccl4 and ccl5, were increased in the thymus with age. hypothesizing that the increased expression of chemokines and the ccr5 receptor may play a role in adipocyte recruitment and/or differentiation within the aging thymus, we examined the potential role for ccr5 signaling on adipocyte physiology using 3t3-l1 pre - adipocyte cell line. increased expression of the adipocyte differentiation markers, ppar2 and ap2 in 3t3-l1 cells was observed under treatment with ccr5 ligands. moreover, 3t3-l1 cells demonstrated an ability to migrate in vitro in response to ccr5 ligands. we believe that the increased presence of fat - storing cells expressing ccr5 within the aging thymus strongly suggests that these cells may be an active component of the thymic stromal cell compartment in the physiology of thymic aging. moreover, we found that adipocyte differentiation appear to be influenced by the proinflammatory chemokines, ccl3, ccl4 and ccl5. |
a 24-year - old woman with mild pre - eclampsia was admitted for induction of labor under normal - term labor after 40 weeks gestation. ten days before her admission she was admitted for 6 days for mild hypertension and moderate edema of her legs. her blood pressure at the time of admission was 152/82 mm hg and her heart rate was 86 and regular. the patient requested epidural analgesia, and an epidural catheter was inserted successfully at the l3 - 4 interspace through an 18-gauge tuohy needle. sensory anesthesia was established with 8 ml of 0.25% bupivacaine and 0.1 ml of fentanyl. the patient underwent vaginal delivery of a 3365 g female infant with an apgar score of 9. after delivery, the epidural anesthesia was stopped by the anesthesiologist, who removed the epidural catheter from the patient s back. one day after the delivery the patient developed a postdural puncture headache (pdph), which was managed by conservative measures : bed rest (patient s position of choice), increased hydration (normal saline 3 l per day intravenously), and metamizole sodium (dipyrone ; garan s.k. ltd, ramat gan, israel) 500 mg three times per day, which is commonly used in many countries as a powerful analgesic and antipyretic. despite the conservative treatment her headache worsened when she was in an upright position and was relieved when she was lying flat. on the fifth postpartum day, an epidural blood patch (ebp) this was performed at one level above the epidural anesthesia, with 18 ml of autologous blood taken from the antecubbital vein. sixteen hours later she developed paralysis of lower motor neuron type of her right facial nerve, which was treated with prednisone at a dosage of 50 mg daily for 5 days, tapering off by 10 mg / day for an additional 5 days. resolution of the patient s symptoms and complete recovery of the seventh nerve was observed after 9 days. six days after application of the ebp, a nerve conduction study (ncs) of the seventh cranial nerve and blink reflexes was performed ; these tests showed normal findings. seven days after the application of the ebp, the patient suffered pain in the posterior shoulder and in the left arm mainly posteriorly, which was mildly burning and increased gradually over several days. three weeks after the ebp she was admitted to the neurological department after complaining of continuous pain. her neurological examination revealed a severe weakness with moderate atrophy of the left infraspinatous muscle (figure 1). one day after admission (22 days after application of the ebp), a magnetic resonance imaging (mri) scan of the brain and cervical spine region showed normal findings of the brain but a spread of the ebp (trace amounts of blood) in the cervical spine region. an electromyography performed 23 days after showed spontaneous activity (positive sharp waves) and active denervation in the left infraspinatus, and a mild neurogenic pattern in the supraspinatus on the same side (figure 2 and figure 3). ncs of the suprascapular nerve, which arises from the trunk and is formed by the union of the fifth and sixth cervical nerves and innervates the supraspinatus and infraspinatus muscles, revealed no response in the infraspinatus division (figure 4). an ncs of the bilateral median and ulnar nerves as well as the right peroneal, right tibial, and right surral nerves was normal. physiotherapy of the affected muscle was recommended, and this resulted in mild improvement over 3 months. dural puncture is a commonly performed invasive procedure for various medical indications like diagnostic lumbar puncture, spinal anesthesia, myelography, and intrathecal chemotherapy. however, in anesthesiology, apart from intentional dural puncture as in spinal anesthesia, unintentional dural puncture can also occur while performing epidural anesthesia or analgesia for various indications, including postoperative and labor pain relief. ebp is a treatment procedure for pdph and refers to the injection of 1520 ml of a patient s autologous blood into the epidural space of the vertebral column at or near the location of a dural puncture. the first report of blood patch1 used only 23 ml. using this small volume, had the blood clot formed in a position that did not seal the dural tear, the benefits of blood patching may not have been evident. since that time, the need for adequate volumes of blood has been emphasized. crawford2 recommended the injection of 20 ml of blood (but less if there is discomfort). ostheimer and abouleish,4 however, found that volumes of less than 10 ml were associated with higher initial failure or recurrence of pdph after initial apparent success. the volume injected displaces cerebrospinal fluid (csf) from the lumbar csf space into the area surrounding the brain, often yielding immediate headache relief. when the blood clots it seals the dural puncture, prohibiting further leakage of csf from the subarachnoid space. when headache appears in the postoperative or postpartum period after regional anesthesia, it can have many causes, apart from a complication of dural puncture during regional anesthesia. historically, pdph was described firstly by karl august bier in 1899,5 when he gave the first spinal anesthetic, injecting 1015 mg of cocaine to seven patients, himself, and his assistant.5 dr bier described the headache as a feeling of very high pressure in the head, accompanied by light dizziness when rising quickly from the chair. he also described the most important sign of pdph as follows : all symptoms disappeared immediately when i laid horizontally but came back when i got upright.5 dr biers suggested that csf loss caused the symptoms he experienced, and he recommended preventing the loss of csf as much as possible. he lost excessive csf while receiving the experimental spinal block from his assistant, who was unable to fit the syringe to the needle during the procedure.5 indeed, pdph typically occurs hours to days after puncture and presents with symptoms such as headache and nausea that typically worsen when the patient assumes an upright posture. it is thought to result from a loss of csf into the epidural space.69 decreased hydrostatic pressure in the subarachnoid space then leads to traction to the meninges with associated symptoms. diagnosis of pdph depends on its association with body position ; the pain is aggravated by sitting or standing and relieved or decreased by lying down flat.10,11 headache after dural puncture is a complication of spinal anesthesia and is believed to result from leakage of csf at the time of dural puncture and, probably more importantly, continued leaking afterwards.12,13 criteria of pdph14 are summarized by the following characteristics : occurred after mobilization ; aggravated by an erect or a sitting position and coughing, sneezing, or straining ; and relieved by lying flat. the highest incidence of 36% was reported after ambulatory diagnostic lumbar puncture using a 20- or 22-gauge standard quincke spinal needle.15,16 unintentional dural puncture with a large tuohy needle (16 and 18 gauge) is associated with a high incidence of 70%80% pdph. in an obstetric population, unintentional dural puncture is one of the most common major complications. indeed, there is considerable variability in the incidence of pdph, which is affected by many factors, including age, gender, needle size, and needle type. a prospective review of 100 parturients from australia who experienced accidental dural puncture with a tuohy needle had a pdph rate of 81%.17 the diagnosis of dural puncture was delayed until presentation of headache in 27% of these cases. a similar incidence of pdph has been found by other investigators,1820 but choi performed a meta - analysis of obstetrical studies and reported that the pooled risk for accidental dural puncture for all epidural needles was 1.5%. the risk of pdph varied amongst spinal needles and ranged from 1.5% to 11.2%.10 the effectiveness and early reports of the ebp procedure demonstrated that immediate and permanent cure rates approached 100%. in this study, we describe an unfamiliar neurological complication of epidural analgesia during labor, the development of facial nerve palsy and partial brachial plexopathy, which, to our knowledge, has not been previously reported. this case report is a distinctive neurological complication of epidural analgesia during labor. we could not find a similar case of brachial plexopathy reported in the literature as a complication of ebp here, we report a unique case of facial paralysis and neuralgic amyotrophy of the suprascapular nerve suspected to be secondary to the ebp. various neurological consequences following dural puncture are well recognized.5 the most serious rare complication is the occurrence of transient cranial nerves palsy, and almost all cranial nerves have been implicated.20 usually, single nerve palsy has been reported, with the nerves affected being the third, fourth, sixth, seventh, and eighth.20 a reported incidence of cranial nerve palsies is 1:100,000 to 3.7:100,000.20 the sixth nerve is said to be most susceptible, but length alone is not the sole factor, as the fourth cranial nerve is longer than the sixth cranial nerve but is rarely affected.1 the abducent nerve is suggested to be vulnerable because it is relatively fixed at its entry into the cavernous sinus and at its attachment to the pons. this nerve is most likely to be stretched due to sagging of the brain because of a csf leak.1 facial nerve palsy associated with ebp was first reported by abouleish in 1975.4 the paralysis in their patient occurred 4 days after ebp was performed and was considered a coincidence.2,21 fang,22 in 2010, presented a case of a 29-year - old woman who underwent an emergency cesarean section due to a prolonged second stage of labor and suffered trigeminal nerve and facial nerve palsy after combined spinal epidural anesthesia.22 population - based epidemiologic studies have demonstrated an increased incidence more than three - fold that of of bell s palsy during pregnancy, especially in the third trimester and the early postpartum period.4,2325 the etiology of bell s palsy is unknown,13,24 although two theories exist. the speculated causes are either edema or viral manifestation.25,26 the edema hypothesis postulates that fluid retention and generalized edema of pregnancy result in a compression of the facial nerve with resulting facial paralysis.13,26 this view is supported by the high incidence of bell s palsy during the time of maximal fluid retention in the third trimester. there seems to be an association between bell s palsy and hypertensive disorders during pregnancy that often leads to increased fluid retention and the higher frequency of other nerve compression manifestations such as carpel tunnel syndrome.15 support for the viral causation includes the fact that patients with bell s palsy have evidence of previous herpes virus infection ; the presence of pregnancy - induced immunosuppressant, which may predispose to reactivation of a latent herpes virus within the nerve ganglia ; the fact that bell s palsy syndrome is sometimes part of a complex cranial polyneuritis,16 with the presence of lymphocytosis and increased protein in the csf of the affected patients ; and occurrence of clusters or epidemics of bell s palsy. there is controversy concerning the relationship between bell s palsy and pre - eclampsia.17 notwithstanding the different neurological complications known in the pre - eclampsia period as pdph and cranial subdural haematoma associated with dural puncture in labor, peripartum cardiomyopathy, anesthesia after cesarean delivery, and seizures, our patient did not demonstrate any facial weakness after the pdph period. in addition, blood injected into the epidural space ascends in the spinal column, and trace amounts get to the cervical spine region, as shown by mri scans post - ebp. certainly, some inflammation often occurs in the epidural space, but typically this is manifested in lumbar / sacral symptoms and not cervical, although horner s syndrome does occasionally occur with large epidural top - ups.27 this suggests a pathophysiological cause different from the loss of csf, inflammation, or horner s syndrome. previous reports have postulated that a sudden increase in intracranial pressure caused by a blood patch may compromise the blood supply to the seventh nerve within the facial canal.21,22 an increase in the epidural and subarachnoid pressure secondary to injection of blood volume in the epidural space has been described.18 in a recent study, boezaart28 proposed that pdph is probably a vascular - type headache and that an ebp relieves the headache by its vasoconstrictive action.29 this cerebral vasoconstriction may be caused by subarachnoid spread of the injected blood. indeed, low csf pressure results in cerebrovascular vasodilatation and headache that is similar in mechanism to other vascular headaches such as migraine.30 in addition, the possible role that the rich innervations of the dura matter with adrenergic, cholinergic, and peptidergic fibers may play in pdph and its management with an ebp require further research to know the exact mechanism of pdph. other hypotheses include the delay in ebp performance that may have led to the patient s symptoms. in other words, rather than the ebp causing the facial and brachial symptoms, perhaps an earlier ebp may have prevented its occurrence.31 the possibility of accidental epidural injection of anesthetic should be considered. accidental production of spinal anesthesia has been reported as a complication of attempted brachial plexus blockade using the posterior approach of brachial plexus blockade, which may indicate that there is a possible pathway that fluid (either blood or local anesthetic) can traverse between the epidural space and the brachial plexus roots or trunks. in fact, the tip of the block needle may have entered a dural cuff that can run with a nerve root for some distance from the intervertebral foramen, in the end causing brachial plexus palsy.3234 the course and succession of events in our case study have special characteristics, such as the rapid resolution of the patient s symptoms and the complete recovery of the seventh nerve, which was observed after only 9 days. this speedy recovery has not been encountered among patients suffering from bell s palsy, where improvement is gradual and recovery times vary. with or without treatment, most individuals begin to get better within 2 weeks after the initial onset of symptoms and most recover completely, returning to normal function within 36 months. also, we do not exclude the hypothesis of irritation of the nerve roots due to the spread of blood as an etiology of our case. the suprascapular nerve derived from the upper trunk of the brachial plexus, typically receiving fibers from c5 and c6, contains both motor and sensory components and sends sensory branches to both the glenohumeral and acromioclavicular joints but does not innervate the skin. it passes downward laterally (deeply to the omohyoid and trapezius and then posteriorly to run under cover of trapezius) along with the suprascapular vein and artery. it reaches the suprascapular notch, then the nerve travels beneath the suprascapular notch, whereas the vessels travel above the notch ; after giving off two branches to supraspinatus, it passes around the lateral border of the scapular spine (spinoglenoid notch) and ends in the infraspinatus fossa to supply infraspinatus.. both of these mechanisms result in nerve ischemia, edema, microenvironmental changes, and conduction impairment. these changes are proportional to the magnitude and duration of the insult and eventually lead to irreversible damage.35,36 indeed, the suprascapular nerve may be injured as a result of trauma, repetitive overuse, a mass lesion, or iatrogenic causes. traumatic causes of suprascapular nerve injury include scapular fractures,37 clavicular fractures,38 shoulder dislocations,39 and penetrating trauma.40 also, iatrogenic injury to the suprascapular nerve may occur during operative procedures.41,42 a common location for injury to the suprascapular nerve is the suprascapular notch. the mechanism by which injury occurs at the suprascapular notch has been termed the sling effect by rengachary.43 they evaluated the motion of the suprascapular nerve relative to the suprascapular notch with various movements of the arm and shoulder. they noted that the nerve was often opposed to the sharp inferior margin of the superior transverse scapular ligament and that the contact was accentuated with depression and retraction, or hyperabduction, of the shoulder. the spinoglenoid notch is another site where the suprascapular nerve is frequently injured.44 several hypotheses have been proposed regarding the etiology of this injury. one theory is that the nerve is compressed in the fibro - osseous tunnel formed by the spine of the scapula and a hypertrophied spinoglenoid ligament. other hypotheses have expressed the belief that the nerve is injured as a result of the anatomy of the spinoglenoid notch and stress that is placed on the nerve by repetitive overhead activities. this theory is supported by clinical data that show that the majority of these injuries occur in athletes who repetitively stress their shoulder. a large percentage of the cases that have been reported were in professional volleyball players.45 another hypothesis is that the nerve is compressed between the spine of the scapula and the medial tendinous margin of the infraspinatus and supraspinatus muscles during extreme abduction of the shoulder with full external rotation.46,47 it has been proposed that stretching of the suprascapular artery during pitching results in intimal damage to the suprascapular artery. microthrombi form and embolize to the vasa nervorum of the suprascapular nerve with resultant ischemic damage. another mechanism by which the suprascapular nerve may be injured is compression by a mass, most commonly a ganglion cyst. other masses that have been described include synovial sarcoma, ewing s sarcoma, chondrosarcoma, metastatic renal cell carcinoma, and a bone cyst.48 | we report a complication related to epidural analgesia for delivery in a 24- year - old woman who was admitted with mild pre - eclampsia and for induction of labor. at the first postpartum day she developed a postdural puncture headache, which was unresponsive to conservative measures. on the fifth day an epidural blood patch was done, and her headache subsided. sixteen hours later she developed paralysis of the right facial nerve, which was treated with prednisone. seven days later she complained of pain in the left arm and the posterior region of the shoulder. she was later admitted and diagnosed with partial brachial plexopathy. |
resin - bonded fixed partial dentures (fpds) are inexpensive and there are more conservative treatment options for replacing missing teeth [1, 2 ]. metal resin - bonded fpds continue to decrease demand because of the existing several disadvantages. while metal substrate is durable and stiff, it has considerable esthetic problems such as discoloration of the gingiva and abutment tooth graying. the other drawbacks may occur with these prostheses ; namely, the potential for alloy hypersensitivity, retainer fracture, and loss of attachment from bridge abutments, corrosion and health risks to laboratory staff [35 ]. given thes problems, composite materials have been a subject to attention for metal - free fpds after the advent of using fibers as frameworks to reinforce them. in addition, these economically feasible restorations have proper esthetics, low weight and favorable elastic modulus [2, 4, 6 ]. conversely, color stability and wear resistance are remarkable potentials of ceramics, but these materials have some liabilities such as brittleness, disability of adhesion to tooth structure and having the potential to damage the unrestored opposing teeth [3, 7 ]. based on these backgrounds, currently frc are not only used for crowns and inlays, but also for a variety of esthetic restorations in clinics, for example the suprastructure of implants and fpds. different kinds of fiber materials exist in the market, but at present polyethylene and glass fibers are the most popular. to date, several studies have evaluated the mechanical properties (flexural strength and fracture strength) of frc [4, 6, 8, 10 ], but a few studies have been conducted to find out and understand the color properties of frc [1114 ].. stated significant color change between non - frc and frc restorations with a decrease in lightness. tuncdemir and aykent measured the effect of fiber reinforcement on the color stability of composite resin. they concluded that an everstick net fiber - reinforced anterior composite combination exhibits trace color change, but the other frc groups reveal slight color change without accelerated aging. after accelerated aging, they found no significant color difference between frc and non - frc restorations. these studies analyze different types of composites with varying types of fibers and the results are different [1114 ]. so, this study investigated the influence of glass and polyethylene fibers and veneering composites (direct and indirect) in the frc system on color differences. the null hypothesis assumed in this study was that the fibers and veneering composites did not influence the color differences of fiber - reinforced composites and non - fiber - reinforced composites. two types of fiber - reinforced system and veneering composite were investigated in the present study (table 1). specimen preparation : using two stainless steel molds, 13 mm in diameter and 1 mm or 3 mm height, 40 cylindrical specimens were prepared (fig 1). composite resin veneers were packed into a mold on a glass plate. after packing, a second glass plate was placed over the mold, followed by compression to run off the excess composite resin into the escape area. the z250 cylinders were light - cured using the light curing unit (bluephase ivoclar vivadent, austria) for 20s with an output of 1,000 mw / cm2 light intensity. the output of the curing light was checked with a radiometer (1,000 mw / cm2). but the initial curing of gradia specimens was done according to the recommendations by gc steplight sl - i for 10s. after light - curing, the top glass plate was removed and the specimens were then removed from the mold. twenty (1 mm height) cylinders of each base composite were prepared according to the manufacturer`s recommendations (1618). a 20-second duration cure and handling of glass slab was similar to the veneering composite. these cylinders were entered in the thicker mold. in the cylinders of nulite f base composites, polyethylene fibers were cut in 10 mm size, impregnated in resist resin and embedded on thin layers of nulite f composites and post - cured 20 seconds after, then a small layer of nulite f composite covered the fiber. subsequently, the cylinders of each veneering composite material were carried to a thicker mold and pressed with a glass slab to remove the excess composite. in z250 veneering composite, the specimens were light cured using the blue phase (ivoclar vivadent, austria) visible - light - curing unit for 20s with 1000mw / cm2 light intensity (g1) and gradia indirect completion of curing was done in gc labolight lv-, cure unit (g3). in adhesive c cylinders, the proper pieces (10 mm) of glass fibers were cut, placed on a thin layer of adhesive c composite and cured for 20 seconds. veneering composites in (g5) and (g7) were used in a similar manner as explained above for (g1) and (g3), respectively. in g2 and g6, z250 cylinders were placed in thicker molds and the remaining spaces in the molds were packed with nulite f and adhesive c, respectively. for g4 and g8, gradia indirect cylinders were placed in thicker molds and the remaining spaces in the molds were packed with nulite f and adhesive c, respectively. the color parameters of the disks were measured over a white background using a reflection spectrophotometer (color - eye 7000a, gretagmacbeth, new windsor, ny, usa), according to cie l a b color system relative to the standard illumination tungsten d65 lamp. prior to each of the color measurement series, a calibration was done based on the manufacturers instruction. here, a, b represented the colors on the green - red and blue - yellow axes, respectively and l represented lightness scale. the color differences (e) between the groups were calculated by equation : e = [(l)2 + (a)2 + (b)2 ] 1/2. the extent of significant color difference was evaluated by two - way analysis of variance (anova) combined with tukey s hsd at the 0.05 level of significance. the color parameters of the disks were measured over a white background using a reflection spectrophotometer (color - eye 7000a, gretagmacbeth, new windsor, ny, usa), according to cie l a b color system relative to the standard illumination tungsten d65 lamp. prior to each of the color measurement series, here, a, b represented the colors on the green - red and blue - yellow axes, respectively and l represented lightness scale. the color differences (e) between the groups were calculated by equation : e = [(l)2 + (a)2 + (b)2 ] 1/2. the extent of significant color difference was evaluated by two - way analysis of variance (anova) combined with tukey s hsd at the 0.05 level of significance. the values of l, a, b, and the differences in color (e) are indicated in table 3. application of two - way anova revealed that l, a and b were significantly affected by the veneering composites (p 3.5=mismatch). according to these classifications, clinical color match in g3 and these results were in disagreement with the findings of a previous study, whereby incorporation of fibers in the composite caused color mismatches that were not clinically acceptable (5.29 < e < 8.19). they only investigated the incorporation of glass - fiber in single - layer and double - layer in direct dpi curex microhybrid composite (shade a1) and the overall thickness of all specimens were 2 mm. one possible explanation about the different results is that the greater amount of veneering composite for covering specimens may reduce the effect of fibers. since the type of fibers and veneering composites were clearly different from the current study, direct comparison was impossible. tuncdemir and aykent demonstrated that the types of composite and fiber materials used explained the color difference between frc and non - frc restorations without aging. they have reported less color differences (0.32<e<1.03) between groups than those observed (1.91<e<2.32) in the present study. differences in the range of e in our study and the previous study may be due to the use of these base composites.. showed that reproduction of the similar color to the veneering composite was possible in all experimental groups (except in the case of fibrekor). as indicated in earlier studies, the key factors affecting the optical properties (color change) in composites are as follows : (i) size, shape and filler content, (ii) type of polymerization, (iii) organic matrix, and (iv) thickness of composite. z250 is a microhybrid composite that contains bis - gma, udma and bisema monomers and zirconium / silicon fillers (60% volume, 0.01 to 3.5 micrometers). gradia is a micro - filled udma - based composite that is mixed with a fine particle glass filler, silica nanofiller and prepolymerized filler (75 wt %). although compositions and the method of polymerization of the studied composites varied, these differences had no significant effect on color changes. these results could be linked to the interaction between fibers and composites. on the other hand, this in vitro finding may be different from the clinical circumstances. meanwhile, all specimens employed as the model of color assessment in this study were flat and this led to the omission of surface morphology - associated color characteristics. in this study, the comparison between the observations of the human eyes or conventional methods showed that spectrophotometer offered a 33% enhancement in precision. in the present study, the visual inspection of skillful people and other viewers did not verify the results of the spectrophotometer. conversely, one review highlighted that visual and instrumental methods completed each other and could serve as a guide towards predictable cosmetic results. thus, evaluation of other color coordinates is essential. with respect to the values of l, the incorporation of fibers caused a decrease of the l values (samples became darker) for all the experimental groups except in g7. more negative l values between the polyethylene experimental groups and the glass experimental groups possibly originated from the greater thickness of the polyethylene fibers, and also from the difference in the nature of fibers between these two types of fibers, which could result in a slighter amount of beam reflected back ; back - scattered out of the specimen or absorbed. in the present state of our knowledge, we did not find any justification for the result in g7. there is a color shift of experimental groups towards the shorter wavelength regions, which is in the direction of green and blue, except in g1. these findings are inconsistent with the previous study because they saw a shift toward the longer wavelength (red - yellow). perhaps the interactions between fibers and veneering composite in all experimental groups (except in g1) were followed by shifts toward the lower wavelength area. on the basis of the limited information on the interaction modality of the optical properties of the fiber and the veneering composite in literature, we did not suggest any explanation responsible for the shift to the red axis in g1. it should be kept in mind that the result of the present article is based on an in vitro condition. meanwhile, this study only investigated the combination application of the two types of fibers and veneering composites. therefore, it is intricate to generalize the outcome of this study to all frc systems and clinical conditions. the clinical conditions may worsen the status of the continuing test and may affect the results. several variations exist between clinic and test conditions that may influence the color change of frcs including : (i) the investigated specimens had flat surfaces ; whereas, in clinical status the anatomical surfaces were reproduced on prosthesis, (ii) the preparation of the abutment teeth, (iii) oral conditions (loading, temperature changes, saliva, diet and oral hygiene). consequently, a more complete strategy should be developed to assess the oral environment effects on color changes of frcs. with the limitations of the current study, veneering composites and the fibers showed no statistical effect on the color change (e) of frcs. all experimental groups were darker compared with the control groups except for the glass fibers - gradia indirect group. | objective : color match between fiber - reinforced composite (frc) restorations and teeth is an imperative factor in esthetic dentistry. the purpose of this study is to evaluate the influence of veneering composites and fibers on the color change of frc restorations.materials and methods : glass and polyethylene fibers were used to reinforce a direct microhybrid composite (z250, 3 m espe) and a microfilled composite (gradia indirect, gc). there were eight experimental groups (n=5 disks per group). four groups were used as the controls (non - frc control) and the others were used as experimental groups. cielab parameters (l, a and b) of specimens were evaluated against a white background using a spectrophotometer to assess the color change. the color difference (e) and color coordinates were (l, a and b) analyzed by two - way anova and tukey s test.results:both types of composite and fiber influenced the color parameters (l, a). the incorporation of fibers into the composite in the experimental groups made them darker than the control groups, except in the gradia indirect+ glass fibers group. b is affected by types of fibers only in direct fiber reinforced composite. no statistically significant differences were recognized in e among the groups (p>0.05).conclusion : the findings of the present study suggest that the tested frc restorations exhibited no difference in color in comparison with non - frc restoration. hence, the types of veneering composites and fibers did not influence the color change (e) of frc restorations. |
initially we performed a pilot study with a yorkshire pig model, but because thin - section ct showed that the bronchi of this animal were relatively thick - walled and small - calibered, and the response to airway stimulating agents was thus minimally visible, the model was rejected as unsuitable. these animals have relatively thin - walled and large - calibered bronchi, and ct thus demonstrates airway reactivity ; they are, in addition, relatively easy to handle. eight mongrel dogs weighting 10 - 12 kg underwent fasting for 6 hours prior to anesthesia, and atropine (daehan atropine ; daehan pharmaceutical, seoul) was injected intramuscularly. the dogs were anesthetized by intramuscular injection of 0.2 ml / kg of a mixture of 1ml of 2% xylazine hydrochloride (rompun ; bayer korea, seoul, korea) and 1ml of 10% ketamine hydrochloride (ketara ; yuhan yanghang, seoul, korea). anesthesia was maintained by intravenous injection of 5 - 7 mg / kg of thiopental sodium (pentothal ; choong wae pharmacy, seoul, korea). immediately after the induction of anesthesia, intubation was performed using a 7.5-mm inside - diameter endotracheal tube and a bear-2 adult volume ventilator (bear medical systems corporation, riverside, cal.) provided ventilation at a rate of 20 breaths/ minute and a tidal volume of 300 ml. to minimize motion artifacts and achieve constant lung volumes during ct scanning, the animals were paralyzed by intravenous injection of 1 mg/ kg of succinylcholine chloride (quelin ; abbott laboratories, chicago, ill.) at functional residual capacity (11). it has been reported that intravenous methacholine induces constriction only in the airways, whereas aerosolized methacholine causes constriction both in the airways and in the parenchyma (12 - 13), and to induce bronchoconstriction, intravenous bolus injection of 0.1 mg / kg methacholine chloride (provocholine ; roche, u.s.a.) was therefore performed. to induce bronchodilation, 2 ml of 1% salbutamol (ventolin ; glaxowellcome) was inhaled for 1 minute through a nebulizer connected to the ventilator. in our study, the procedure adopted by amirav. (15) was modified in such a way that initially, each dog underwent control thin - section ct, and after subsequent methacholine injection, the second series of ct scans was immediately obtained. after a 5-min delay, five minutes later, the final series of scans was obtained. in order to demonstrate the relationship between morphologic airway reactivity and physiologic parameters, peak airway pressure (pap) was measured through a pressure gauge connected to the ventilator immediately before ct scanning. during the early period when spiral ct was not available, a ct / t 9800 quick scanner (general electric medical system, milwaukee, wis.) the number of slices was five to seven, each 3 cm below the tracheal carina and just above the diaphragm with an interval of 3-mm. scanning parameters were 1.5-mm collimation, 1.5-mm interslice gap, 140 kvp, 170 ma and 1.5-sec scan time. for the last four examinations, spiral ct scans covering the entire thorax were obtained with a somatom plus - s scanner (siemens medical systems, erlangen, germany). the parameters were a 3-mm collimation, 1-to-1 pitch, 1-sec scan time, 120 kvp, 165 ma, and a reconstruction interval of 2 mm. for the measurement of cross - sectional area (csa), we used the region - of - interest (roi) stat program, built into the ge 9800 quick scanner, by drawing a circle around selected bronchial lumen. measurements were taken at four sites : both diaphragmatic bronchi and the lower portion of these bronchi that could be unambiguously identified at the same anatomic level under all experimental conditions (fig. the image data obtained from the somatom plus - s were transferred to an allegro medical imaging workstation (isg technologies inc., canada), and using a seeded volume of interest (voi) technique, csas were calculated (16). measurements were obtained at ten sites : the main, apical, diaphragmatic, and lower portion of diaphragmatic bronchi at both sides, the right diaphragmatic bronchus after the azygos, and the azygos bronchus (fig. when the operator set both upper and lower thresholds and defined a seed point in the selected bronchial lumen, an isodense area was automatically filled and the corresponding csa was calculated. if a portion of the voi leaked into an area that we did not wish to include, the portion could be cut off by drawing a line at the point of leakage. window width/ level were fixed at 1350 hu/ -450 hu, which were considered suitable for airway observation (10 - 11). we selected longitudinal airways, which were round. to compensate for errors due to slight differences in location at the selected bronchial site, csa was measured two to five times at each site, depending on the length and direction of each bronchus, and averaged. in four examinations in which spiral ct was performed, 3-d reconstruction by means of the shaded surface - display technique was performed, using the data transferred to the allegro medical imaging workstation. the volume data included from round tracheal lumen to the smallest bronchial lumen. using the seeded voi technique, as explained above, proximal airway volume (pav) the mean csa at each bronchial site represents the average of measured csas of nine examinations. percentage changes occurring in mean csa, pav, and pap during the methacholine challenge and delayed state were represented as percentages of the control state, while those occurring during the ventolin challenge state were expressed as percentages of the delayed state, which provided a baseline value. using wilcoxon 's signed rank test, changes in mean csas, suggesting airway reactivity, and in pav and pap after the administration of drugs, were statistically analyzed. by means of linear regression analysis, we correlated degree of airway activity, expressed as the percentage change induced by methacholine, with airway size, expressed as csa during the control state. initially we performed a pilot study with a yorkshire pig model, but because thin - section ct showed that the bronchi of this animal were relatively thick - walled and small - calibered, and the response to airway stimulating agents was thus minimally visible, the model was rejected as unsuitable. these animals have relatively thin - walled and large - calibered bronchi, and ct thus demonstrates airway reactivity ; they are, in addition, relatively easy to handle. eight mongrel dogs weighting 10 - 12 kg underwent fasting for 6 hours prior to anesthesia, and atropine (daehan atropine ; daehan pharmaceutical, seoul) was injected intramuscularly. the dogs were anesthetized by intramuscular injection of 0.2 ml / kg of a mixture of 1ml of 2% xylazine hydrochloride (rompun ; bayer korea, seoul, korea) and 1ml of 10% ketamine hydrochloride (ketara ; yuhan yanghang, seoul, korea). anesthesia was maintained by intravenous injection of 5 - 7 mg / kg of thiopental sodium (pentothal ; choong wae pharmacy, seoul, korea). immediately after the induction of anesthesia, intubation was performed using a 7.5-mm inside - diameter endotracheal tube and a bear-2 adult volume ventilator (bear medical systems corporation, riverside, cal.) provided ventilation at a rate of 20 breaths/ minute and a tidal volume of 300 ml. to minimize motion artifacts and achieve constant lung volumes during ct scanning, the animals were paralyzed by intravenous injection of 1 mg/ kg of succinylcholine chloride (quelin ; abbott laboratories, chicago, ill.) at functional residual capacity (11). two examinations were performed at an interval of two weeks. it has been reported that intravenous methacholine induces constriction only in the airways, whereas aerosolized methacholine causes constriction both in the airways and in the parenchyma (12 - 13), and to induce bronchoconstriction, intravenous bolus injection of 0.1 mg / kg methacholine chloride (provocholine ; roche, u.s.a.) was therefore performed. to induce bronchodilation, 2 ml of 1% salbutamol (ventolin ; glaxowellcome) was inhaled for 1 minute through a nebulizer connected to the ventilator. in our study, the procedure adopted by amirav. (15) was modified in such a way that initially, each dog underwent control thin - section ct, and after subsequent methacholine injection, the second series of ct scans was immediately obtained. after a 5-min delay, five minutes later, the final series of scans was obtained. in order to demonstrate the relationship between morphologic airway reactivity and physiologic parameters, peak airway pressure (pap) was measured through a pressure gauge connected to the ventilator immediately before ct scanning. during the early period when spiral ct was not available, a ct / t 9800 quick scanner (general electric medical system, milwaukee, wis.) the number of slices was five to seven, each 3 cm below the tracheal carina and just above the diaphragm with an interval of 3-mm. scanning parameters were 1.5-mm collimation, 1.5-mm interslice gap, 140 kvp, 170 ma and 1.5-sec scan time. for the last four examinations, spiral ct scans covering the entire thorax were obtained with a somatom plus - s scanner (siemens medical systems, erlangen, germany). the parameters were a 3-mm collimation, 1-to-1 pitch, 1-sec scan time, 120 kvp, 165 ma, and a reconstruction interval of 2 mm. for the measurement of cross - sectional area (csa), we used the region - of - interest (roi) stat program, built into the ge 9800 quick scanner, by drawing a circle around selected bronchial lumen. measurements were taken at four sites : both diaphragmatic bronchi and the lower portion of these bronchi that could be unambiguously identified at the same anatomic level under all experimental conditions (fig. the image data obtained from the somatom plus - s were transferred to an allegro medical imaging workstation (isg technologies inc., canada), and using a seeded volume of interest (voi) technique, csas were calculated (16). measurements were obtained at ten sites : the main, apical, diaphragmatic, and lower portion of diaphragmatic bronchi at both sides, the right diaphragmatic bronchus after the azygos, and the azygos bronchus (fig. when the operator set both upper and lower thresholds and defined a seed point in the selected bronchial lumen, an isodense area was automatically filled and the corresponding csa was calculated. if a portion of the voi leaked into an area that we did not wish to include, the portion could be cut off by drawing a line at the point of leakage. window width/ level were fixed at 1350 hu/ -450 hu, which were considered suitable for airway observation (10 - 11). we selected longitudinal airways, which were round. to compensate for errors due to slight differences in location at the selected bronchial site, csa was measured two to five times at each site, depending on the length and direction of each bronchus, and averaged. in four examinations in which spiral ct was performed, 3-d reconstruction by means of the shaded surface - display technique was performed, using the data transferred to the allegro medical imaging workstation. the volume data included from round tracheal lumen to the smallest bronchial lumen. using the seeded voi technique, as explained above, proximal airway volume (pav) the mean csa at each bronchial site represents the average of measured csas of nine examinations. percentage changes occurring in mean csa, pav, and pap during the methacholine challenge and delayed state were represented as percentages of the control state, while those occurring during the ventolin challenge state were expressed as percentages of the delayed state, which provided a baseline value. using wilcoxon 's signed rank test, changes in mean csas, suggesting airway reactivity, and in pav and pap after the administration of drugs, were statistically analyzed. by means of linear regression analysis, we correlated degree of airway activity, expressed as the percentage change induced by methacholine, with airway size, expressed as csa during the control state. ct images revealed that the mean csas at multiple bronchial sites of the bronchi on changed after the injection of methacholine and the inhalation of ventolin (table 1, fig. the mean csas of selected bronchi, as shown by ct, ranged from 9.6 to 101.8 (median ; 32.9) mm. immediately after the injection of methacholine, mean csas of the bronchi at all sites significantly decreased (change, 70.26.2% (meanstandard deviation) ; p = 0.002). during the 5-min delayed state, csas were close, but still significantly different, to those observed during the control state (change, 92.36.5% ; p = 0.009). five minutes after the inhalation of ventolin, mean csas significantly increased compared to those seen during the delayed state (change, 113.111.4% ; p = 0.002) (fig. three - dimensional reconstruction images obtained in four dogs showed that the median value of pav decreased from 19270 mm during control state to 15801 mm immediately after the injection of methacholine (change, 83.03.0%). during the 5-minute delay, the median value of pav increased to 18497 mm (change, 92.46.5%), and five minutes after the inhalation of ventolin increased to 21084 mm (change, 113.18.6%) (fig. 4). during no sequence were the changes in pav statistically significant, however. pap also changed after the injection of methacholine and the inhalation of ventolin (table 2, fig. its level increased significantly from 15.41.0 cm h2o during the control state to 23.32.2 cm h2o immediately after the injection of methacholine (change, 149.821.1% ; p = 0.003). during the 5-minute delay, pap decreased to 16.31.1 cm h2o (change, 105.95.2%), a significantly different level from that seen during the control state (p = 0.03). five minutes after the inhalation of ventolin, pap rather increased to 16.61.5 cm h2o (change, 100.74.4%), but this change was not statistically significant (p = 0.9). although the absolute difference in csas induced by methacholine challenge was much greater in large airways than in small ones (p = 0.0001), the degree of airway reactivity, expressed as percentage change of in csas, did not correlate with airway size during the control state [(regression coefficient) = 0.01 ; p = 0.71 ]. ct images revealed that the mean csas at multiple bronchial sites of the bronchi on changed after the injection of methacholine and the inhalation of ventolin (table 1, fig. the mean csas of selected bronchi, as shown by ct, ranged from 9.6 to 101.8 (median ; 32.9) mm. immediately after the injection of methacholine, mean csas of the bronchi at all sites significantly decreased (change, 70.26.2% (meanstandard deviation) ; p = 0.002). during the 5-min delayed state, csas were close, but still significantly different, to those observed during the control state (change, 92.36.5% ; p = 0.009). five minutes after the inhalation of ventolin, mean csas significantly increased compared to those seen during the delayed state (change, 113.111.4% ; p = 0.002) (fig. three - dimensional reconstruction images obtained in four dogs showed that the median value of pav decreased from 19270 mm during control state to 15801 mm immediately after the injection of methacholine (change, 83.03.0%). during the 5-minute delay, the median value of pav increased to 18497 mm (change, 92.46.5%), and five minutes after the inhalation of ventolin increased to 21084 mm (change, 113.18.6%) (fig. 4). during no sequence were the changes in pav statistically significant, however. pap also changed after the injection of methacholine and the inhalation of ventolin (table 2, fig. its level increased significantly from 15.41.0 cm h2o during the control state to 23.32.2 cm h2o immediately after the injection of methacholine (change, 149.821.1% ; p = 0.003). during the 5-minute delay, pap decreased to 16.31.1 cm h2o (change, 105.95.2%), a significantly different level from that seen during the control state (p = 0.03). five minutes after the inhalation of ventolin, pap rather increased to 16.61.5 cm h2o (change, 100.74.4%), but this change was not statistically significant (p = 0.9). although the absolute difference in csas induced by methacholine challenge was much greater in large airways than in small ones (p = 0.0001), the degree of airway reactivity, expressed as percentage change of in csas, did not correlate with airway size during the control state [(regression coefficient) = 0.01 ; p = 0.71 ]. in this study, we were able to demonstrate by means of ct the extent to which bronchial reactivity was induced by both bronchoconstrictor and bronchodilator. csa decreased significantly after the administration of methacholine, but a scan obtained five minutes later showed insufficient normalization. methacholine induced a significant increase in pap, but again, the normalization observed after five minutes was insufficient. the changes in pap induced by ventolin were not statistically significant, and we can speculate that after the five - minute delay, the methacholine effect had not completely disappeared. methacholine has both a rapid onset (< 2 mins) and a relatively long duration of action (at least 30 mins), and at the time of ventolin inhalation, both the bronchodilator effect of ventolin itself and a possible decrease in the effect of methacholine could have induced airway dilatation. after the inhalation of ventolin, pap did not significantly decrease despite the significant bronchodilation visible on ct, including that seen in a dog which showed an unexplainable increase in pap (table 2, examination 1). the effect of ventolin on the remaining dogs was that airway pressure either decreased or remained the same (table 2). we believe that this discrepancy between the changes occurring in csa and in pap was due to the nonuniform deposition of aerosolized particles and discordance between morphology and physiology. these particles, which are predominantly deposited in large airways, act only on those parts of the airway in which they are deposited (17). furthermore, since it is influenced much more severely by changes in small airways (18), pap might not significantly decrease, even though sufficient bronchodilation of large airways was achieved by the amount of ventolin we used. we believe, in addition, that the changes in airway areas revealed by ct, rather than changes in airway pressure, more sensitively reveal the bronchodilation induced by ventolin. this study of the relationship between degree of airway reactivity and airway size was a trial for investigating local response at each bronchial level. drazen and schneider (19) demonstrated a substantial decrease in the density of cholinergic receptors between trachea and lung parenchymal strips in the guinea pig. nadel. (20) and shioya. (21), on the other hand, observed that maximum constriction in airways, expressed as percentage change in diameter, occurred in smaller bronchi. we observed that the percentage decrease in cross - sectional areas did not correlate with airway size, though absolute differences in area were larger in larger bronchi. we speculate that the averaging of heterogeneous response in individual dogs led to a statistically insignificant result. in bronchi at the same level, individual dogs in our study demonstrated bronchoconstriction ranging widely from 40 to 80% of the control value. herold. (11) believed that heterogeneity among dogs represented variation in individual responsiveness to bronchoconstrictor challenge. physiologic studies to assess bronchial reactivity to stimuli provide information regarding overall response of the airway, but not on local response at each bronchial level, and morphologic as well as physiologic analysis may be valuable in assessing the degree of airway reactivity or the site of action of therapeutic agents. since the trial using tantalum bronchography in the study by nadel. (20) of the effect of vagal stimulation on airways, several reports have described the physiologic imaging of airways affected by bronchoconstrictor. benson. (22) directly visualized airway response to vagal stimulation and inhaled histamine by using tantalum bronchography in their experiment involving dogs. they were able to directly visualize changes in airway caliber, an approach which was more comprehensive than tests of forced expiration or measurements of total airway resistance. in contrast to tantalum bronchography, which itself can provoke bronchoconstriction (11), ct can demonstrate changes in the diameter of the central airways without additional stimulation of the bronchi, and human studies involving normal and asthmatic patients are thus possible safely. high - resolution ct (hrct) can demonstrate bronchioles with a diameter of 2 mm or more, or with a wall thickness of more than 0.1 mm (23). the clinical application of hrct to airway diseases has been limited to static studies for the evaluation of fine structural abnormalities occurring in bronchiectasis, bronchiolitis, bronchial tumors, bronchial stenosis and congenital anomalies of the airways (24). the use of hrct as a tool with which to assess dynamic response of the lung to various stimuli has recently been introduced and actively investigated. using a dog model, brown. (10) and herold. (11) reported the hrct findings of the airways after the administration of bronchoconstrictor, demonstrating decreased csa of the bronchi after the inhalation of histamine. bronchoconstriction has been induced by the inhalation of methacholine or histamine, and in normal subjects, it has been suggested that the predominant site for bronchoconstriction by methacholine is the large airways, while histamine constricts the small airways around the alveolar ducts and alveoli in normal subjects via its direct action (4). we used methacholine in this study because of its preferential constricting effect on the large airways, visible with thin - section ct. although it has been suggested that the respiratory tract is most reactive to nebulized methacholine (25), we administered the drug intravenously because the sites and rates of deposition of aerosolized particles are determined by the particle size of aerosols, and the frequency and tidal volume of respiration. due to its commercial availability, we used ventolin (salbutamol) as (2-agonist acting on both the central and peripheral airways in subjects with asthma (6), and most commonly inhaled. volumetric acquisition by means of spiral ct and 3-d volume rendering of the proximal airway, performed in four dogs in our study, showed results similar to those obtained by axial ct imaging. because it reflects not only transverse but also longitudinal changes, the measurement of airway volume using volumetric ct data might be more accurate in the evaluation of airways than measurement involving axial images. according to a phantom study performed to determine the accuracy of the method by which the length, diameter, and branch angles of pulmonary trees are measured using ct data, thin - section ct and volumetric spiral ct with 3-d reconstruction can clearly demonstrate airway reactivity to bronchostimulator. in our limited study, the degree of such reactivity revealed by thin - section ct did not correlate with airway size. ct scanning can therefore be used in the evaluation of pathophysiologic response of the airways. | objectiveto determine the extent to which thin - section and volumetric three - dimensional ct can depict airway reactivity to bronchostimulator, and to assess the effect of different airway sizes on the degree of reactivity.materials and methodsin eight dogs, thin - section ct scans were obtained before and after the administration of methacholine and ventolin. cross - sectional areas of bronchi at multiple levels, as shown by axial ct, proximal airway volume as revealed by three - dimensional imaging, and peak airway pressure were measured. the significance of airway change induced by methacholine and ventolin, expressed by percentage changes in cross - sectional area, proximal airway volume, and peak airway pressure was statistically evaluated, as was correlation between the degree of airway reactivity and the area of airways.resultscross-sectional areas of the bronchi decreased significantly after the administration of methacholine, and scans obtained after a delay of 5 minutes showed that normalization was insufficient. ventolin induced a significant increase in cross - sectional areas and an increase in proximal airway volume, while the effect of methacholine on the latter was the opposite. peak airway pressure increased after the administration of methacholine, and after a 5-minute delay its level was near that of the control state. ventolin, however, induced no significant decrease. the degree of airway reactivity did not correlate with airway size.conclusionthin-section and volumetric spiral ct with three - dimensional reconstruction can demonstrate airway reactivity to bronchostimulator. the degree of reactivity did not correlate with airway size. |
papillary lesions of the breast include benign (papilloma) as well as malignant (papillary carcinoma) entities. both the ends of the spectrum are characterized by the presence of fibrovascular cores lined by epithelial proliferation with varying degrees of atypia. though a definite diagnosis of the nature of tumor is possible on an excision biopsy, the distinction is not easy on aspiration cytology. this is due to the overlapping of cytologic features between benign and malignant as well as other entities containing papillary component. earlier authors have attempted to define the differentiating cytologic features between benign and malignant papillary breast lesions. features like high cellularity, complex branching papillary fragments and single atypical intact cells have been suggested to point toward the malignant nature of the tumor. however, these features have not been found to be restricted to the malignant tumors. hence, a definite diagnosis of papillary breast carcinoma on aspiration cytology is usually not possible. we describe the cytologic and histopathologic features of a case of papillary carcinoma of the breast in an adult female. a 50-year - old female presented with history of painless lump in the left breast. local examination revealed a well - circumscribed lump in the lower outer quadrant of left breast. mammography of the left breast showed a well - defined mass in the left breast with birads score of 4 (suspicious for malignancy). considering the age and mammographic findings, a possibility off carcinoma of left breast was considered and fine - needle aspiration (fna) performed. fna smears, stained by may - grnwald - giemsa, showed high cellularity composed of cohesive clusters and few singly dispersed cells. numerous papillary fragments with finger - like branching were also seen [figure 1a, b ]. some of the papillary fragments were three dimensional with delicate fibrovascular cores. the cells were round to oval ith moderate amount of basophilic cytoplasm, hyperchromatic nuclei with prominent nucleoli [figure 1c ]. background showed few singly - lying intact tumor cells [figure 1d ] along with cystic macrophages and apocrine cells. (c) the tumor cells have moderate cytoplasm, hyperchromatic nuclei and small nucleoli (giemsa, 400). (d) few singly - lying intact tumor cells seen in the background (giemsa, 400) the patient underwent left simple mastectomy. on gross examination, a grey - white tumor, 4 3.5 2 cm was seen in the lower outer quadrant. histologic examination showed features of a papillary carcinoma with microscopic foci of stromal invasion [figure 2a, b ]. (a) histologic photomicrograph of the resected tumor showing a papillary tumor with complex papillae (h and e, 100). (b) focus of stromal invasion (h and e, 200) the patient has been recurrence - free after 1 year of follow up. papillary lesions of the breast encompass a complete spectrum including benign lesions (papilloma) to noninvasive (intraductal papillary carcinoma) to invasive papillary carcinoma. these lesions are characterized by epithelial proliferation overlying a fibrovascular core with the presence or absence of a myoepithelial cell layer. hence, it is suggested that papillary lesions would be encountered more frequently in fna of male breast. accurate diagnosis of papillary lesions by fna is fraught with complications largely because of the overlapping cytologic features of benign and malignant lesions as also between true papillary lesions and other entities with papillary component. the cytologic features of fibroadenoma, fibrocystic change and papilloma of the breast may be similar. however, the presence of numerous oval bare nuclei in the background, isolated stromal fragments (not associated with epithelial fragments) without fibrovascular cores and absence of columnar epithelial cells favor a cytological diagnosis of fibroadenoma. three - dimensional branched epithelial cell sheets may be seen, however fibrovascular cores are not usually present. benign columnar cells, if present in fibrocystic change, are less in quantity than papillomas. among the malignant lesions, ductal carcinoma - in - situ (papillary, micropapillary and cribriform), invasive duct carcinoma, intraductal papillary carcinoma and invasive papillary carcinoma need to be differentiated. papillary and cribriform dcis are low nuclear grade lesions that may or may not be associated with an invasive component. invasive ductal carcinoma with focal papillary areas usually shows highly cellular smears with complex crowded epithelial cell sheets displaying nuclear atypia and irregularities. micropapillary carcinoma, an uncommon histologic type, lacks true fibrovascular cores and shows angulated papillary and tubuloalveolar pattern of cellular aggregates with single atypical cells. smears from intracystic papillary carcinoma are highly cellular composed predominantly of discohesive epithelial cells with minimal to mild cytological atypia. the national cancer institute (nci)-sponsored conference for formulating guidelines for breast fna placed the papillary lesions in the indeterminate category since the criteria for distinction of benign and malignant lesions on cytology are not well established. there have been studies to delineate the distinctive cytologic features of benign and malignant papillary lesions of the breast. it has been suggested from these and other studies that malignant papillary lesions have high cellularity, complex branching papillary fragments, single intact atypical cells, absence of bland columnar cells and lack of foamy or hemosiderin - laden macrophages in the background. though these features are said to be diagnostic of papillary carcinoma, single intact cells with moderate nuclear atypia may be seen in infarcted papilloma or cases of atypical papillomas. the atypical papillomas, in addition, show high cellularity with complex papillae and single atypical cells, making the distinction from carcinoma difficult. in addition, the differentiation of noninvasive intraductal papillary carcinoma from frankly invasive papillary carcinoma is problematic due to identical cytologic features. though the cytological features of papillary carcinoma are well described, distinction from papilloma may not be possible in some cases on cytology alone and histopathology offers the accurate diagnosis. in the present case, a malignant lesion was considered due to the high cellularity with 3d papillary fragments, delicate fibrovascular cores and single intact tumor cells. the lesion was confirmed as an invasive papillary carcinoma on histopathologic examination. in conclusion, cytologic diagnosis of the lesion is difficult due to overlap with benign entity and other mimics. hence, cytopathologists need to be aware of the features helpful in distinction between benign and malignant papillary lesions. also, all lesions seen as papillary on fna should be excised completely to allow accurate classification. | papillary lesions of the breast pose diagnostic challenges on aspiration cytology due to overlapping features of benign and malignant entities. accurate cytologic diagnosis of papillary breast carcinoma can not usually be made pre - operatively. we present the case of an adult female who underwent fine - needle aspiration (fna) of a left breast lump. fna smears were highly cellular showing cohesive clusters, complex papillary fragments and few singly dispersed intact cells. the tumor cells had hyperchromatic nuclei, prominent nucleoli and mild nuclear pleomorphism. a cytologic impression of papillary lesion, possibly malignant (in view of high cellularity, complex papillae and single intact cells) was rendered. the lesion proved to be a papillary carcinoma with microscopic foci of stromal invasion on histologic examination. papillary carcinoma, an uncommon subtype of breast carcinoma, should be considered while evaluating a papillary lesion with complex branching papillae containing delicate fibrovascular cores and singly lying intact atypical cells. |
understanding the rules that govern protein folding is one of the great challenges of molecular biology. studies of protein folding, combining experiment and simulation, have led to a solid understanding of the physical process of folding and the forces that stabilize proteins. the last 10 years have witnessed a revolution in our understanding of the pathway and stability of protein folding (1). the sustained growth of folding studies is fuelled by the availability of new sequences, rapid structure determination and radical developments in experimental methods. furthermore, recent successes in folding simulations have improved our understanding of the protein folding process at atomic resolution (2), providing further avenues for experimental investigation. analysis of the folding mechanisms and pathways of proteins within homologous families has propelled protein folding into the post - genomic era (3). traditionally, kinetic and thermodynamic data are collected and analysed on an individual protein basis, and is published in an unstructured fashion, despite the best efforts to tabulate it. clearly, this presents an enormous challenge for data analysis, even simple searching for trends requires exhaustive manual inspection of the literature. with the exception of protherm [thermodynamic database for proteins and mutants (4) ], the vast majority of web - accessible databases focus on sequences and structures. there are currently no tools that bring together both kinetic and thermodynamic folding data for proteins and mutants. a comparison of the folding properties for more than 50 proteins represents the most comprehensive compilation of folding data to date (5). this painstaking analysis uncovered some general trends but also highlighted the great diversity in folding behaviour. the speed at which a protein folds and the pathway it takes are dictated by its structural and energetic characteristics. recent work suggests that the fundamental physics underlying folding may be relatively simple : the mechanism of folding appears to be dictated by the low - resolution features (or topology) of the folded protein structure (6). topology can be described by the parameter contact order, which is defined as the average sequence separation between contacting residues in the 3d structure. proteins having a low contact order, e.g. -helical bundles, fold faster than those with a high contact order, e.g. -sandwiches (6). topology has been found to be the overriding determinant of folding rate for a wide range of proteins (69). however, studies on the topologically similar members of the immunoglobulin family have shown that they fold with rate constants which correlate better with stability (10). studies on horse and yeast cytochrome c also suggest that stability is an important factor (11). furthermore, protein engineering studies show that mutations which do not affect the contact order can change the folding rate by many orders of magnitude (5). thus, in many cases, factors other than topology must also be significant. the last six years have witnessed a huge increase in the number of proteins being studied, and is set to grow further as structural genomics projects gain momentum. in order to exploit this wealth of data so that data mining efforts may uncover further relationships between folding behaviour and structural character, indeed, recent benchmarking of predicted folding rates (12), together with comparisons of the folding behaviour of two- and three - state folding proteins (13), emphasizes the need for a centralized database. in order to address this issue, here, we describe the design and implementation of a relational database for protein folding, protein folding database (pfd). a user - friendly web interface to the database allows querying using many parameters, as well as retrieval and presentation of data. the database will have three distinct roles : (i) data repository : new data can be rapidly deposited, validated and made available to the folding community and wider scientific arena ; (ii) experimental resource, the database will be of use to the biophysicist seeking to compare new folding data with the current dataset for similar proteins, bypassing the relatively slow and inefficient examination of the literature. the database will play a useful role in the design of folding experiments, e.g. both as a guide in the design of experimental methodology and in the selection of proteins belonging to homologous families ; and (iii) theoretical resource, all experimental folding data will be at the disposal of theoreticians, strengthening the emerging conspiracy between experiment and simulation. our approach is to create a database that captures as much as possible of the relevant information important for a folding experiment : kinetic rates of folding and unfolding ; equilibrium free energies ; experimental methods such as spectroscopic technique (probe) and method of perturbation (e.g. denaturant), and instrument details ; publication information ; protein details, such as fold, structural class, biological function and mutation information. pfd was created using open - source mysql relational database server software, version 4.0.16 (www.mysql.com), running on an apple dual 2.0 ghz g5/os x server (version 10.3.4). a web - based query interface to the database was created using the java programming language and apple webobjects software (version 5.2.2) and the xcode development environment (figure 1). the essence of our approach is to allow a diverse collection of folding data to be searched via multiple parameters, and the results presented in a structured fashion. typical queries that can be formulated are compare the folding behaviour of monomeric -helical proteins? ; and which beta proteins larger than 60 residues have folding rates greater than 10 s?. the web interface allows a detailed, spreadsheet - like list of results allowing quick visualization of general trends in data (figure 2). the results of a search can be sorted on any heading, which is useful, e.g. when inspecting the variability of folding rates among proteins within a family. each entry also contains information of the publication and a url to the entry in ncbi pubmed literature database. annotation of proteins exploits the hierarchy used by the structural classification of proteins database [scop (14) ] : proteins belong to families, which in turn belong to a structural class (e.g. all alpha proteins). this was performed to minimize redundancy in the database so that all structural information for an entry can be retrieved via the scop link. scop and pdb provide an array of links to other databases (such as entrez, pfam and astral), as well as an array of tools that operate on the data (e.g. 3d visualization). the hierarchical classification of structural class / family / protein allows convenient browsing (akin to browsing proteins belonging to a particular fold in scop) : folding data for proteins are grouped under their fold or structural class, which may prove convenient when examining the folding behaviour of proteins within a family. examining any entry in more detail yields information on the protein structure, folding thermodynamics and kinetics, experimental methods, mutations (if any), publication(s) and annotations (figure 3). the power of the relational database approach allows us to visualize folding data in a novel way. availability and submissions : pfd is freely available at http://pfd.med.monash.edu.au. submissions and enquiries should be emailed to [email protected]. the constructed database and web - based query interfaces have demonstrated the applicability and usefulness of the database design. questions indicates that its design accurately reflects the organization of data in a real folding experiment. future work will focus on the following areas : functional annotation : an analysis of folding data must take into account the biological function of the protein. any trends uncovered must also be considered in the context of function. to enable these entries will be linked to the gene ontology database (15), which annotates database entries on molecular function, biological process and cellular location.data exchange : how will other databases be able to use data from the folding database ? this is a serious challenge because of the vast heterogeneity in database standards and data structure. this can be addressed by making folding data available using extensible markup language (xml). xml provides the capability of representing protein data in a single, standardized data structure that is easily transmitted over a network. this will require the construction of a specification language for protein folding data that will allow for portable, system - independent, machine - parsable and human - readable representation of essential features of protein folding. all folding data can then be made available in xml format.data visualization : as the dataset grows, visualization of text becomes cumbersome. this will require the development of graphical representations of the data, such as chevron plots. in particular, graphical methods allowing the visualization of relationships between structural parameters, such as contact order and folding kinetics, will prove very useful.data deposition and validation : it is vital that new folding data is deposited in the same timeframe as publication (as is the case of the pdb). this means that the data becomes readily available to the community and amenable to analysis. this can be achieved using a forms - based system that will allow data to be deposited, via a web - browser, directly by the originator of the data, again in an analogous manner to the pdb. validation logic can also be built into the deposition process, providing both a useful service to the depositor as well as an indication on data quality to users. the latter two aims are particularly important for database functionality and growth, respectively, and will be given priority. this approach will allow us to achieve a high degree of uniformity in the structure of folding data, which will benefit experimentalists in data acquisition and handling. functional annotation : an analysis of folding data must take into account the biological function of the protein. any trends uncovered must also be considered in the context of function. to enable these entries will be linked to the gene ontology database (15), which annotates database entries on molecular function, biological process and cellular location. data exchange : how will other databases be able to use data from the folding database ? this is a serious challenge because of the vast heterogeneity in database standards and data structure. this can be addressed by making folding data available using extensible markup language (xml). xml provides the capability of representing protein data in a single, standardized data structure that is easily transmitted over a network. this will require the construction of a specification language for protein folding data that will allow for portable, system - independent, machine - parsable and human - readable representation of essential features of protein folding. this will require the development of graphical representations of the data, such as chevron plots. in particular, graphical methods allowing the visualization of relationships between structural parameters, such as contact order and folding kinetics, will prove very useful. data deposition and validation : it is vital that new folding data is deposited in the same timeframe as publication (as is the case of the pdb). this means that the data becomes readily available to the community and amenable to analysis. this can be achieved using a forms - based system that will allow data to be deposited, via a web - browser, directly by the originator of the data, again in an analogous manner to the pdb. validation logic can also be built into the deposition process, providing both a useful service to the depositor as well as an indication on data quality to users. the latter two aims are particularly important for database functionality and growth, respectively, and will be given priority. this approach will allow us to achieve a high degree of uniformity in the structure of folding data, which will benefit experimentalists in data acquisition and handling. we thank christina mitchell for financial support, and james whisstock and ross coppel for continuing support. | we have developed a new database that collects all protein folding data into a single, easily accessible public resource. the protein folding database (pfd) contains annotated structural, methodological, kinetic and thermodynamic data for more than 50 proteins, from 39 families. a user - friendly web interface has been developed that allows powerful searching, browsing and information retrieval, whilst providing links to other protein databases. the database structure allows visualization of folding data in a useful and novel way, with a long - term aim of facilitating data mining and bioinformatics approaches. pfd can be accessed freely at http://pfd.med.monash.edu.au. |
the impetus to frame a new area of physiology often arises at the interface of existing fields of inquiry. as prime examples, neuroendocrinology emerged when nerve endings in the hypothalamus, near the base of the brain, were observed to release hormones that cue the anterior pituitary to regulate an array of endocrine tissues ; psychoneuroimmunology emerged when the phenomenon of conditioned immunosuppression was observed and when nerve endings were discovered adjacent to lymphocytes in secondary lymphoid tissue ; cognitive neuroscience came into its own when correlates of mental processes began to be identified by means of increasingly sensitive brain imaging techniques. we suggest that biofield physiology, with its initial focus on the characterization of endogenous electrical and magnetic fields as indices of health and illness eg, via electroencephalography or magnetoencephalography (eeg and meg) or electrocardiography and magnetocardiography (ecg and mcg)represents another such confluence of disciplines, integrating concepts and information from cell biology, biophysics, and medical physiology. biologically - generated fields (biofields) are a spatially distributed set of forces and physical properties that have the capacity to encode information and exert instructive influences on cells and tissues capable of perceiving and being modified by them. as such, biofields complement molecular processes as key contributors to what biophysicist mae - wan ho, phd, describes as global coherence the multilevel integration of diverse biological activities across time and scale. in her view, global coherence the defining quality of living organisms accounts for their most salient properties such as long - range order and coordination, rapid and efficient energy transfer, and extreme sensitivity to specific signals. although we focus in this paper on fields generated by living systems, there is substantive scientific literature demonstrating that physiological regulatory systems in humans and animals are also affected by and even synchronized to environmentally generated fields, eg, of geomagnetic and solar origin. of additional interest, disruptions in these fields a companion paper in this supplement reviews evidence for the therapeutic use of externally applied electrical and magnetic fields (see muehsam,, this issue). for example, a recent cochrane review concludes that pulsing electromagnetic field therapy may offer some benefit in the treatment of delayed union and non - union of long bone fractures, a finding supportive of the us food and drug administration approval of such therapeutic usage. given that electrical and magnetic fields, as well as biophotons in the full range from ultraviolet to infrared, are detected during normal physiological activity, the question often arises whether such endogenous phenomena are merely epiphenomena of metabolic events or are incompletely understood biological signaling systems. we suggest physiological regulatory systems are affected by biofields in a manner that complements the more familiar molecular - based mechanisms, by which regulatory systems respond to endogenous biochemical signals and exogenous pharmacological agents. we begin our article by describing known and postulated biofields, including how they are generated and which physiological systems may be affected. next, we consider receptor systems that may detect, integrate, and trigger responses to both biofields and environmental fields. we conclude by identifying areas for future research aimed at clarifying form and function of biofields. overall, a case will be made that sufficient evidence has accrued to consider biofield physiology as a viable, if nascent - stage, scientific discipline that is likely to expand the current biomedical model of health and disease. every region of the body, however superficial or deep, is crisscrossed with well - studied communication and regulatory systems, including neural pathways, blood - borne hormones and exosomes (cell - derived vesicles), and immune surveillance. yet the existence of fluctuating endogenously generated electromagnetic and other fields, which also suffuse all our cells and comprise an additional rich source of biological information and regulation, remains an underappreciated aspect of physiology. electrical activity, in the form of charge separation, is a fundamental feature of every living cell. as single cell and multicellular organisms evolved in a primordial sea, the ability to maintain a low - sodium / high - potassium intracellular milieu, in the face of the high - sodium / low - potassium concentrations in sea water, served as a source of energy to enable uptake of metabolites and discharge of waste products across the cell surface. proteins, evolved to serve as specific ion channels and pumps, maintain this ionic gradient (the resting potential) between inside and outside of each cell. but evolution found greater promise for the resting potential than merely as an energy source for ion pumps and crossmembrane transport of molecules. as multicellular organisms evolved, patterns of resting potentials of cells throughout the body became designated as instructive scaffolding to guide pattern formation and stem cell behavior during embryogenesis and organ regeneration. for example, endogenous arrays of bioelectric potentials are now known to instruct left - right patterning, eye induction, size regulation, and patterning during complex organ regeneration. new tools allow these bioelectric gradients to be directly observed noninvasively in vivo and to be specifically altered to assess effects on intercellular communication and tissue - level or organ - level outcomes. importantly, the molecular mechanisms that couple changes in bioelectric gradient distribution to downstream transcriptional and epigenetic targets are also being characterized. further, as the advent of multicellular organisms led to increased cellular specialization, muscle and nervous tissue developed mechanisms to turn their resting potentials into high - speed action potentials, propagating along the cell surface with frequencies and other characteristics that encode information. passage of this information from cell to cell via chemical and electrical synapses expanded the effective area of these electrical fields. (nonsynaptic electrical coupling) between adjacent axons, which influences the synchronization and timing of action potential firing in neurons. as further examples, various types of electrical fields created by either mechanical stress (piezoelectricity) or streaming potentials in bone, tendons, skin, and fascia are thought to regulate the functioning of osteocytes and fibroblasts to adjust the density of supporting tissues in response to loads. also, electric fields generated by the intracellular network of microtubules, centrosomes, and chromosomes appear to play fundamental roles in regulating the dynamics of mitosis, meiosis, and a variety of other cellular activities. in addition to the high - speed electrical signals conducted along nerve axons, a second communication network, based in ubiquitous epithelial cells, conducts information as slowly varying direct currents. the dc fields generated by this system, which spread across considerable distances, play key roles in recognizing damage and guiding cell migration necessary for wound healing (especially in skin, heart, and cornea) as well as in regulating the migration of neuronal path - finding. recent research has identified numerous molecular signaling pathways that mediate the interactions of these bioelectric fields, first described decades ago, with the plasma membrane and cytoskeletal mechanisms to facilitate tissue repair. although the transepithelial dc fields and the gradients of resting membrane potentials (vmem) share functional similarities, the dc fields are produced only by epithelial layers in a relatively standardized form, while vmem are generated by all cells in a wide variety of patterns. the vmem patterns are sensed by a different set of membrane proteins from those that respond to the dc fields. cells use both systems during morphogenesis : the dc fields set directionality of growth and positional information and the vmem gradients control differentiation and proliferation and establish anatomical identity of whole regions. since electric charge in motion, whether along a wire or a nerve axon, produces a magnetic field in the surrounding space, this phenomenon represents a further type of biofield. magnetic fields emanating from the body, although extremely weak relative to the geo - magnetic field of the earth, are readily detected by superconducting quantum interference device (squid)based magnetometers. evidence has recently been summarized that nonthermal electromagnetic fields of amplitude similar to the cardiac field can affect a wide variety of biological functions, including gene expression, particularly in stem cells. the strongest rhythmic electrical and magnetic fields in the body are produced by synchronous activity of heart muscle cells. while the ecg is readily detected via surface electrodes, the heart 's magnetic field can be recorded up to several feet from the body surface as an mcg. magnetic fields produced by the heart appear to carry information that can also be detected by other persons or animals. an example of the informational potential (bioeffectiveness) of these heart fields is cardiac - induced entrainment, or frequency locking, detected when the r - waves of one subject 's ecg become precisely synchronized with the onset of eeg alpha waves of another subject at a distance of up to 5 feet. heart fields may also encode psychoemotional information, as indicated by the 75% accuracy rate in detecting discrete emotional states from patterns of heart rate variability. the electrical and magnetic fields generated by the composite activity of thousands of brain cells are detected as an eeg and meg, respectively. at a functional level, the electromagnetic activity of neural assemblies has been proposed to modulate neuron synchronization and circadian rhythmicity and to underlie the computational and cognitive processes of the brain. more specifically, weak sinusoidal electric fields appear to enhance and entrain physiological neocortical network activity. thus, in a feedback loop, the local fields help to synchronize the neural network that generates them. another type of biofield phenomenon is the coherent, ultraweak photon emissions (upe), detected from cell cultures and from the body surface. since the initial observations of upe or biophotons were detected from inflammation - producing reactive oxygen species, the level of these emissions has been explored as a noninvasive marker of metabolic stress and a measure of overall health. more broadly, such upe, instead of being considered as metabolic epiphenomena a role for ultraweak light signaling in normal physiological regulation is suggested by evidence of intercellular communication under chemically separated but optically coupled in vitro conditions, eg, through a thin glass film. these studies have identified infrared as a primitive source of cellular vision to guide migration and other behaviors. more recently, a role for biophotons in neural activity was based on observations that fluctuations in upe correlate with cerebral blood flow and cerebral energy metabolism as well as with eeg activity. moreover, photonic stimulation at one end of a nerve appears to elicit increased upe at the other end. as a means of information transfer, biophotons have the advantages of extremely high speed and the ability to penetrate into and through cell membranes and organs that present barriers to the diffusion of molecular signals. nonconventional means of upe - mediated biosignaling include wave propagation within longitudinally - oriented neuronal microtubules and passage through membrane - spanning regions of proteins that may serve as light pipes. considerations of physiological activity of biofields also include resonance signaling, ie, the modulation of cell function by specific electromagnetic frequencies. involvement of nonclassical and quantum forms of energy (eg, a - fields and scalar waves) has not been explored to the same level of rigorous detail as the bioelectric gradients and fields discussed above, and physiological roles for such phenomena have not yet been demonstrated. (see the article biofield science : current physics perspectives in this supplement for a more extensive discussion of non - classical and quantum forms of energy.) a further challenge for framing a physiology of biofields is to identify endogenous receptor systems that detect electromagnetic or other types of fields and trigger responses to these nonmolecular stimuli. while the concept of receptor brings to mind the conformational matching invoked to characterize receptor - mediated responses to hormones and drugs, biofield reception may be better described by phenomena from physics, such as resonance and impedance matching, based on tuning to signal frequencies. as previously proposed, 3 overlapping categories of biofield receptors can be considered : molecular - level receptors, charge flux sites, and endogenously generated electric or electromagnetic fields. an important series of studies on cultured cells identified 2 examples of the first type of receptor sites deoxyribonucleic acid (dna) and the cell membrane at which exogenous electromagnetic signals exert specific biological effects. just as steroid hormones upregulate transcription of particular genes by binding to hormone response elements of dna, so do low - frequency (< 300 hz) electromagnetic fields appear to increase transcription of select genes by acting at upstream regions of dna designated as electromagnetic response elements (emre). deletion of the emre eliminates the ability of the applied electromagnetic field to regulate the target genes, while other genes can be converted from electromagnetic nonresponders to responders by inserting the emre at upstream regions. similar electromagnetic fields, as demonstrated by the same researchers, appear to increase the activity of several membrane - bound enzymes. charge flux sites, the second type of receptor as exemplified by the perturbation of transmembrane calcium fluxes, have been proposed as a generic mechanism by which weak electromagnetic fields affect biological systems. if voltage sensitivity of calcium ion (ca) channels facilitates the targeting of these sites by electromagnetic fields, voltage - modulated channels for other ions should also be tested as potential target sites. low - frequency electromagnetic fields have also been proposed to interact with dna by accelerating the movement of electrons within the helical arrays of base pairs. changes in charge separation in small dna regions occur during aggregation, so that interactions may be more pronounced in specific active segments of dna. while ion channels and ion pumps have major roles in establishing the resting potential of an individual cell, it is gap junctions, the specialized electrical connections between adjacent cells, that allow voltage and current - mediated signals to be propagated across groups of cells. in this manner, spatiotemporal patterns of resting potentials arise to provide bioelectrical guidance during tissue development, regeneration, and cancer suppression. although it is not yet apparent that applied weak electromagnetic fields can alter resting potentials, affect multicellular patterns of membrane voltage, applied weak electrical currents do appear to induce regeneration of adult frog limbs. these exogenously applied currents are comparable in direction and density to the outward electrical currents detected from regenerating amphibian limbs, and it is possible that some of the reported effects of applied electromagnetic fields are due to modification of endogenous bioelectric gradients. a final candidate for a receptor system for endogenous and exogenous biofields is a body - wide network that appears to exhibit all 3 types of potential receptor sites : molecular, charge flux, and endogenous field. loose '' connective tissue, often referred to as fascia, forms a continuous head to toe network surrounding and permeating all tissues and organs. as an extracellular matrix, structured mainly by collagen fibers, fascia provides a supportive and regulatory framework for all organs of the body as it coordinates cellular perception and interpretation of mechanical forces. this extracellular system reaches into the interior of cells via transmembrane bridging molecules known as integrins, which allow information from the fascia to modify cell metabolism and genetic activity. speculation on the nature of such collagen - signaling focuses on water molecules hydrogen - bonded along the outer shell of the collagen triple helix, oriented in a manner that supports the rapid jump conduction of protons along the length of the collagen fibers. since collagen structures both conduct and modify photon pulses emitted from biological sources, it is conceivable that signaling along collagen fibers serves as a surveillance system of endogenous biofield emission to complement the immune and nervous systems in monitoring tissue health. further speculation based on the water - protein relationship along collagen fibers invokes quantum coherence, a state that can occur when all water molecules in a particular domain or region are spinning synchronously, emitting spin or torsion waves. such spin coherence and quantum coherence enable the collagen matrix to be ultrasensitive to electromagnetic fields in a manner that can be frequency selective due to a quantum phenomenon known as the larmor precession. this effect, resulting from the torque of an external magnetic field exerted on the spin of subatomic particles, is the basis of magnetic resonance imaging (mri). known sensitivities of organisms to extremely small environmental cues, including visible light and electromagnetic fields, merit consideration in this overview of biofield receptors. these sensitivities which evolved, for example, to locate prey, avoid predators, navigate, and sense changing weather patterns often operate at or near limits set by physics. an exemplar is the ability of the retina to detect a single photon of light, which occurs via calcium channel mediated signal amplification and allows thousands of calcium ions enter a retinal rod in response to an individual photon. the public health debate concerning potentially harmful effects of electromagnetic fields was influenced for decades by the conventional physics doctrine that living systems could only be affected by energy strong enough to cause ionization or heating of tissues. in contrast, evidence that very weak, nonionizing electromagnetic fields exert biological effects is well documented, and the history of the shift away from the thermal model has been chronicled. finally, german researchers have demonstrated that individual molecules can act as transmitting and receiving antennae in the mediation of efficient inter - molecular communication via single photons. sufficient evidence has accrued to consider biofield physiology as a viable scientific discipline, based on nonlocal, integrated, information - conveying phenomena as well as on emerging molecular details of localized biophysical interactions. endogenously generated pulses of ultraweak photons, electromagnetic fields directly related to cardiac activity, and patterns of distributed membrane voltage are varied forms of physiological activity designated as biofields, each with established properties and proposed biological functions. several receptor systems have been identified that mediate responses to these biofields. by analogy with the hormones, receptors, and regulatory functions that comprise endocrinology, components of the biofield physiology framework are in place. in seeking to define biofield physiology as an area of research, it is helpful to distinguish it from the existing discipline of bioelectromagnetics and to consider the 2 approaches as different phases of a continuum. if bioelectromagnetics is more about defining mechanisms of local interactions, then biofield physiology is more about understanding the integrated, longer - range functions within the whole organism : the former more reductive, the latter more integrative. while it is incontrovertible that biological systems emit and react to a wide range of energetic influences, we have not achieved a detailed understanding or mathematical modeling of the essential field aspect of such interactions (a prerequisite for exploiting their long - range organizing properties). moreover, many of the experimental findings are preliminary, while the biofields studied are varied in form and can not yet be considered as interrelated representatives of a clearly defined system of biological self - regulation. further, much of the research appears guided by existing paradigms of biochemistry and physiology. as one example, evidence of dna response elements that respond to specific electromagnetic frequencies, analogous to dna regions responsive to specific hormones, is an important finding. however, biofields may also act in a more dispersive, nonspecific manner to activate self - regulatory systems that, in turn, stimulate surveillance to detect the source of tissue imbalance or disease. as future research is likely to reveal, such imbalances may be understood via models based on either molecular - level or biofield - level dysfunction, a perspective that will further expand diagnostics, treatment options, and our concepts of physiology. while there is broad acceptance that the nervous, endocrine, immune, and cardiovascular systems are in continuous intercommunication via electrical and molecular signals, the possibility must also be considered that endogenous biofields act as carriers of information between these systems. an exemplar is heart - brain interaction, where several types of cardiac - initiated signals appear to exert sequential effects on brain activity. electromagnetic signals from the heart reach the brain in a relatively instantaneous manner, followed first by a range of neural signals arriving in millisecond timeframes and subsequently by pressure waves and hormonal signals arriving with delays of seconds. in general, different types of signals mediate rapid / short - acting vs slower / longer - lasting responses, eg, neurally - released adrenaline and hormonally released corticosteroids, respectively, coordinate the stress response. physiological requirements for ultra - rapid responses may be met by biofields. as research continues to identify physiological roles of endogenous biofields, a wider lens should be used to examine whether and how biofields may have intersystem integrative roles in physiological regulation. in regard to human health, biofield research has taken 2 broad directions aimed at establishing salutary and detrimental effects of biofields and biofield therapies. caution is recommended regarding attempts to draw correlations between biofields and health based on present data. for example, a recent review of biophoton detection as a potential noninvasive means of health assessment stresses the need for standardization of devices and conditions used to monitor this upe. epidemiological assessments of adverse effects of ambient electromagnetic fields face critiques common to such long - term correlational studies. future research on biofields and health needs to include state - of - the - science physiological endpoints that best reflect clinical conditions. such research will benefit from advances in calibrating biofield therapy practitioners and biofield devices as well as from improved methodology for designing and implementing appropriate controls. many of the hypotheses gathered for this paper are, at present, at the leading edge of speculation, but they are offered with confidence that emerging technologies will eventually be able to either validate or refute them. as an instructive example, pienta and coffey stated in 1991 that cells and intracellular elements are capable of vibrating in a dynamic manner with complex harmonics, the frequency of which can now be measured and analyzed in a quantitative manner by fourier analysis. in the decades since that statement, other technologies have been developed to characterize ultrafast activities in the molecular fabric of the fascia or living matrix and/or ground regulation systems and wetware. as a final thought, new insights into the properties of water and applications of quantum field theory will undoubtedly contribute to a deeper understanding of the relationships between biofields and molecular dynamics. raman and infrared spectroscopic techniques are now enabling rapid and sensitive chemical characterization of samples based strictly on the vibrational signatures of the molecules present in a sampling volume. when applied to biological systems, the techniques provide highly complex spectra that document changes taking place in the entire genome, proteome, and metabolome ; real time in - vivo applications are possible. the january 2013 issue of the journal of photonics was devoted to the most recent developments, with commentary on possible future directions. while there is broad acceptance that the nervous, endocrine, immune, and cardiovascular systems are in continuous intercommunication via electrical and molecular signals, the possibility must also be considered that endogenous biofields act as carriers of information between these systems. an exemplar is heart - brain interaction, where several types of cardiac - initiated signals appear to exert sequential effects on brain activity. electromagnetic signals from the heart reach the brain in a relatively instantaneous manner, followed first by a range of neural signals arriving in millisecond timeframes and subsequently by pressure waves and hormonal signals arriving with delays of seconds. in general, different types of signals mediate rapid / short - acting vs slower / longer - lasting responses, eg, neurally - released adrenaline and hormonally released corticosteroids, respectively, coordinate the stress response. physiological requirements for ultra - rapid responses may be met by biofields. as research continues to identify physiological roles of endogenous biofields, a wider lens should be used to examine whether and how biofields may have intersystem integrative roles in physiological regulation. in regard to human health, biofield research has taken 2 broad directions aimed at establishing salutary and detrimental effects of biofields and biofield therapies. caution is recommended regarding attempts to draw correlations between biofields and health based on present data. for example, a recent review of biophoton detection as a potential noninvasive means of health assessment stresses the need for standardization of devices and conditions used to monitor this upe. epidemiological assessments of adverse effects of ambient electromagnetic fields face critiques common to such long - term correlational studies. future research on biofields and health needs to include state - of - the - science physiological endpoints that best reflect clinical conditions. such research will benefit from advances in calibrating biofield therapy practitioners and biofield devices as well as from improved methodology for designing and implementing appropriate controls. many of the hypotheses gathered for this paper are, at present, at the leading edge of speculation, but they are offered with confidence that emerging technologies will eventually be able to either validate or refute them. as an instructive example, pienta and coffey stated in 1991 that cells and intracellular elements are capable of vibrating in a dynamic manner with complex harmonics, the frequency of which can now be measured and analyzed in a quantitative manner by fourier analysis. in the decades since that statement, other technologies have been developed to characterize ultrafast activities in the molecular fabric of the fascia or living matrix and/or ground regulation systems and wetware. as a final thought, new insights into the properties of water and applications of quantum field theory will undoubtedly contribute to a deeper understanding of the relationships between biofields and molecular dynamics. raman and infrared spectroscopic techniques are now enabling rapid and sensitive chemical characterization of samples based strictly on the vibrational signatures of the molecules present in a sampling volume. when applied to biological systems, the techniques provide highly complex spectra that document changes taking place in the entire genome, proteome, and metabolome ; real time in - vivo applications are possible. the january 2013 issue of the journal of photonics was devoted to the most recent developments, with commentary on possible future directions. | biofield physiology is proposed as an overarching descriptor for the electromagnetic, biophotonic, and other types of spatially - distributed fields that living systems generate and respond to as integral aspects of cellular, tissue, and whole organism self - regulation and organization. medical physiology, cell biology, and biophysics provide the framework within which evidence for biofields, their proposed receptors, and functions is presented. as such, biofields can be viewed as affecting physiological regulatory systems in a manner that complements the more familiar molecular - based mechanisms. examples of clinically relevant biofields are the electrical and magnetic fields generated by arrays of heart cells and neurons that are detected, respectively, as electrocardiograms (ecgs) or magnetocardiograms (mcgs) and electroencephalograms (eegs) or magnetoencephalograms (megs). at a basic physiology level, electromagnetic activity of neural assemblies appears to modulate neuronal synchronization and circadian rhythmicity. numerous nonneural electrical fields have been detected and analyzed, including those arising from patterns of resting membrane potentials that guide development and regeneration, and from slowly - varying transepithelial direct current fields that initiate cellular responses to tissue damage. another biofield phenomenon is the coherent, ultraweak photon emissions (upe), detected from cell cultures and from the body surface. a physiological role for biophotons is consistent with observations that fluctuations in upe correlate with cerebral blood flow, cerebral energy metabolism, and eeg activity. biofield receptors are reviewed in 3 categories : molecular - level receptors, charge flux sites, and endogenously generated electric or electromagnetic fields. in summary, sufficient evidence has accrued to consider biofield physiology as a viable scientific discipline. directions for future research are proposed. |
coexistence of systemic lupus erythematosus and vitiligo has been infrequently reported. however, cases of vitiligo coexisting with discoid lupus erythematosus (dle) have been much rarer. this is an important consideration as the presence of one disorder may affect the therapy of the second and require detail clinical as well as laboratory examination to rule out other autoimmune disorders. in the present case, association of dle with vitiligo and a 36-year - old female presented with complaints of a reddish, raised lesion on left cheek since 8 years. she also gave history of appearance of similar lesions on nose, malar area, and near the ears since 2 years. there were also depigmented asymptomatic lesions on tips of fingers, dorsa of bilateral hands, perioral area and lips since 2 months and appearance of similar lesions on tips of toes since 1 month. on examination, a depigmented well defined plaque was present over left side of the malar area extending up to nasal bridge, external auditory meatus and also the mandibular area. the central area of the plaque showed erythema and scaling and the plaque was surrounded by a hyperpigmented border. atrophy was present over the central area of the plaque while induration was present over the peripheral area [figure 1 ]. similar plaques were present over right eyelid, left ear, bilateral extensor surface of forearm, which were variable in size ranging from 1 2 cm to 3 6 cm in size in their largest diameters. depigmented macules were present over bilateral proximal nail folds extending up to half of the lateral nail fold of the fingers and similar types of depigmented macules were observed over bilateral toe nails extending from distal nail fold to lateral nail fold, upper perioral area and lips [figure 2 ]. although all the lesions were depigmented, a clinical diagnosis of disseminated lupus erythematosus with lip - tip vitiligo was entertained. depigmented well defined plaque with scaling on left side of the malar area extending up to external auditory meatus, nasal bridge and the mandibular area depigmented maculeson upper and lower lip and bilateral proximal nail folds extending up to half of the lateral nail fold of the fingers histopathological examination of the lesion on the face showed follicular plugging, basal cell degeneration, perivascular and periappendageal lymphocytic infiltrate, hence was consistent with the diagnosis of discoid lupus erythematosus [figure 3 ]. histopathological examination from depigmented macule over finger showed decreased number of melanocytes in basal layer and was suggestive of vitiligo [figure 4 ]. epidermis shows presence of follicular plugging and basal cell degeneration while perivascular and periappendageal lymphocytic infiltrate is seen in the in the dermis (h and e, 45) decreased number of melanocytes in basal layer of epidermis (h and e, 45) lupus band test from lesional exposed site was positive and non - lesional, non - exposed skin was negative. laboratory test revealed positive ana, and anti ssa (ro) rheumatic factor, ds - dna and other connective tissue disease markers were negative. we sent stool for occult blood, thyroid function test and serum cortisol examination to rule out possibility of other associated autoimmune disorders. stool for occult blood was negative ; serum cortisol level was normal but and thyroid function tests showed increased of tsh and decreased of t4. the patient was advised photoprotection and started on oral hydroxychloroquine 200 mg once a day for 1 week then 200 mg twice a day dosage for dle and topical steroids for the vitiligo lesions keeping in mind that although the lip tip vitiligo lesions would have responded well to photochemotherapy, this therapy would have aggravated the lupus erythematosus lesions. the patient was followed up after 6 weeks and 12 weeks when there was a partial resolution of facial lesions. further patient was advised to apply 0.1% topical tacrolimus on facial lesions but follow up was not possible as the patient probably left the city. it has been observed that the autoimmune disorders are significantly elevated in vitiligo probands : vitiligo itself, autoimmune thyroid disease, pernicious anemia, addison 's disease, systemic lupus erythematosus, and probably inflammatory bowel disease. autoimmune thyroid disease association with systemic lupus erythematosus is commonly reported (prevalence = 3.9 - 24%) and hypothyroidism is much more common as compare to hyperthyroidism (5.7%/1.7%). data regarding autoimmune thyroid disease association with dle are not available in the literature. in two case reported by forestier., dle occurred within the vitiliginous skin on both exposed and non - exposed surfaces. a similar occurrence was reported by jeffrey callen, temine and tramier, chowdhury and banerjee, forestier. and johnson.[147 ] dle coexisting with vitiligo has also been reported with alopecia universalis, dermatophyte nail infection, malignant melanoma and urticaria.[810 ] table 1 shows a few case reports in the indian setup and the west where patients had coexisting vitiligo and dle and their treatment. the majority of patients with concurrent dle and vitiligo resided in regions with potential chronic sun exposure, such as india and southern europe. identified several chromosomal regions that appear to contribute to this epidemiologic association, including one on chromosome 17p13. alternative therapies include retinoids or immunosuppressive agents, such as thalidomide, methotrexate, mycophenolate mofetil, or azathioprine. however, it is known that lip tip vitiligo would not respond much to topical and systemic corticosteroids. the presence of one disorder may affect the therapy of the other, as photochemotherapy which would be a good alternative for lip tip vitiligo can not be given in the presence of dle so one has to cautiously treat the two. we conclude that hypothyroidism may worsen the dle if not treated and there are higher chances for showing resistance to treatment. case reports of discoid lupus erythematosus with vitiligo and other diseases it is important to treat concomitant medical or endocrinal abnormalities as well as other cutaneous conditions. instead of topical steroids for vitiliginous lesions we can also give topical tacrolimus as an alternative. we discuss how the treatment has to be modified and innovative in the presence of these three coexisting autoimmune disorders and how the dermatologist should do this to get a successful outcome. | there have been rare published cases of discoid lupus erythematosus (dle) with other autoimmune cutaneous and systemic disorders. we describe a 36 years old female patient with dle lesions on the face and hands with coexistence of lip - tip vitiligo and hypothyroidism. we discuss how the treatment has to be modified and innovative in the presence of these three coexisting autoimmune disorders and how the dermatologist should do this to get a successful outcome. |
in global era and resulting from asean economic community (aec) s policy to induce rapid economic, social, and environmental changes. these changes led to the change of employee system, especially, thai immigrant employees in asia. the characteristic of employees movement among all employees in many countries has the employee, native as well as foreigners, moving within countries and between countries. the incremental employee movement increased from past became an important turning point in employees lifestyle. these resulted in stress to both immigrant employees, that is to say native and foreign immigrant employees within countries and between countries in aec group (2). implementation of aec s policy led to the incremental working s turning lifestyle among asian professional employees from western countries to asean countries (2), as the same times, the majority of thai immigrant employees who are the major empowerment to drive thai economic. statistical data from national statistical office in 2014 found that thai employees were stressed/ neurosis which were the third health problems in 2010 (56.42%), in 2011 (60.43%), and in 2011 (53.65 %). in 2011, mental and behavioral problems, and mental health problems were 62.35%, and 63.3%, respectively (3). job stress as social determinants of health and public health perspective explained about poverty, health inequality and inequity, discrimination, housing and environmental conditions, working conditions, which related to physical and mental health under public health working. this concept linked to working conditions so that characteristic of job /employment conditions became a pressure, and tensions bringing job stress. previous researchers found that monopoly of capitalist government policy, rapid social network, high competitive labor market, workloads, differences job and environmental conditions were linked to different stress level among thai farmers, and farm workers (4, 5), as the same for academic staffs in universities (68). different job conditions and wages among female academic university employees were related to occupational stress (9), besides, thai immigrant employees national research council of thailand. the causes of occupational stress among native employees and immigrant employees in conclusion were workloads (10, 11), working conditions (12, 13), low wages (14, 15) and job insecurities (16). as a result, occupational stress led to sickness absence (17), turnover, atherosclerosis (18), hypertension, silicosis (19), lung cancer (4), stress at work and home (20), and health inequality (13, 21). the hypothesis is an increment in hard working conditions, high workloads, low job securities, and low wages lead to job stress among thai immigrant employees at the central region of thailand. operational definitions of this research consisted of working conditions, workloads, job securities by using a 4-point likert scale ranging from none (1) to (4) as the most, and job stress by using the thai job content questionnaire (thai - jcq) (22) which it applied from karasek. working conditions were taken to be factors such as the exploitation of the employees by the employers, characteristic of occupation and environment at workplace had effect on job stress. workloads were taken to be the controlling of job task/ products per hour or day, the consideration of the amount of working hours per day related to wage, the evaluation of job task in a period to collect data for promotion/ qualification, the control to determine how suitable is the job task. job securities were taken to be employment conditions used for a short contracted, employment condition had effect to job insecurity, a long term for working, better working, turnover, got higher position. wages were taken to be total income per month (baht=1 us dollar equaled to 36 baht). immigrant employees referred to as thai immigrant employees who worked in phranakron si ayutthaya, nonthaburi, and bangkok provinces but previously lived in other provinces in the central region of thailand including the other regions. the objective of this study was to verify a path model of job stress using thai - jcq. the population of the cross - sectional study was thai immigrant employees at the central region of thailand in 2015. the sample size was estimated using the proportion formula of unknown population and m - plus guideline, with 95% confidence interval. inclusion criteria were made of thai immigrant employees - aged > 20 yr old and literates worked in phranakhon si ayuthaya, nonthaburi, and bangkok provinces, which were 3 of 22 provinces in the central region of thailand. these provinces had transitional phases of the social, economic, and high technological changes. thai immigrant employees worked in the other provinces in the central region of thailand were excluded. phranakhon si ayutthaya, nonthaburi, and bangkok provinces were selected by random sampling from these 22 provinces. therefore, thai immigrant employees in this study totaled 800 cases worked in 3 provinces mentioned above. research instruments used both the applied (20 closed items) and standard (54 closed items) questionnaires. second part about path model of job stress contained 4 variables (working conditions, workloads, job securities, and wages). working conditions consisted of 3 items (the exploitation of employee by the employer, characteristic of occupation had effect on job stress, job environment at workplace had effect on job stress). workloads contained 4 items (the controlling of job task/ amount per hour or day, the consideration of the outcome per day related to wage, the control of job task in a period to collect data for standard, the evaluation of job task for its suitability). job securities consisted of 6 items (employment condition used a short contracted employment, employment condition had effect on job insecurity, a long - term for working, better employment, turnover, got higher position). these items were replied using a 4-point likert - type of scale ranging from none (code as 1) to most (code as 4). although, wage variable was answered using code as 1 (5,000 baht), 2 (5,00110,000 baht), 3 (10,00115,000 baht), 4 (15,00120,000 baht), 5 (20,00125,000 baht), 6 (25,00130,000 baht), 7 (30,00135,000 baht), 8 (35,00140,000 baht), 9 (40,00145,000 baht), 10 (45,00150,000 baht), and 11 (> 50,000 baht). third part of standard questionnaire by using thai - jcq dealt with psychosocial work factors. this questionnaire was translated into thai with minor modifications to assess 6 major thai - jcq scales. job control, psychological job demand, physical job demand, job security, social support, and hazard/ risks at work scales were measured by 11 (e.g. develop own abilities, learn new things), 12 (e.g. work hard, enough time), 6 (conflicting demand, financial risk), 5 (e.g. q32 : do your work annual year ?, q33 : you were faced with unemployment at last year, q34 : you will become an unemployed person because of your employer in the next 2 yr), 8 (e.g. supervisor is concerned, supervisor pays attention, coworkers friendly), and 12 items (e.g. equipment hazard, loud noise, occupational infection), respectively. for each item, the answer was recorded on a 4-point likert - type scale, ranging from 1 (strongly disagree), 2 (disagree), 3 (agree), to 4 (strongly agree) except q 3234. for q32, the answer was recorded on a 4-point likert - type scale, ranging from 1 (no, i am still an employee and sometimes lay off), 2 (no, i am always laid off), 3 (no, i worked sometimes), 4 (i had worked in every year). for q33, the response was recorded ranging from 1 (i was unemployed person /laid off last year), 2 (always), 3 (sometimes), to 4 (none). for q34, the answer was recorded on a 4-point likert - type scale, ranging from 1 (high), 2 (sometimes), 3 (seldom), to 4 (none). total thai - jcq score had slightly stress (code as 1=060 scores), moderate stress (code as 2=6080 scores), and high stress (code as 3=>80 scores). the cronbach s alpha coefficient for working conditions, workloads, job securities, wages, and job stress was 0.85, 0.82, 0.81, 0.81, and 0.82, respectively. reliability was checked by pre - test and post - test reliability that the reliability of predictor variables and job stress were 0.82 by spss program. researchers introduced and asked to distribute questionnaires to thai immigrant employees during a rest hour. data for variables were analyzed by minimum, maximum, means, standard derivations (sd.), and medium using the spss program. a path model of job stress using thai - jcq was verified to analyze r square including measure the goodness of fit of the path model and to establish the direct and indirect effect among the variables measuring job stress. rule for test of model fit of the path model for population (> 250 cases) and observed variables 0.05, cfi (comparative fit index) > 0.95, rmsea (root mean square error of approximation) < 0.07, srmr (standardized root - mean - square residual) < 0.05. the minimum, maximum, means, standard derivations (sd.), and medium of wages, job securities, workloads, work conditions, and job stress among participants are displayed in table 2. frequency and percent among thai immigrant employees at the central region of thailand general statistic data among thai immigrant employees at the central region of thailand (n= 800) based on the goodness of fit indices among thai immigrant employees at the central region of thailand, the model showed a close fit. r - square or percent of variance explained, by job stress, job securities, and wages. the model fit of the path model of job stress using thai - jcq among thai immigrant employees at the central region of thailand was acceptable, with a chi - square of 0.018 (degree of freedom=1, p = 0.8932), a cft of 1.000, a tli of 1.027, an rmsea of 0.000, a srmr of 0.001. these variables could explain the job stress change by 22.2% (r square=0.222, p<0.01). a path model showed a mediating effect of wages, job securities on the relationship between working conditions and job stress including the relationship between workloads and job stress (fig. 1). a path model of job stress using thai - jcq among thai immigrant employees at the central region of thailand (n= 800) indirect of the variables on job stress among thai immigrant employees at the central region of thailand found that both working conditions and workloads had direct effects on job stress, with standardized regression weights of 0.273 and 0.259 (p < 0.01). job securities had direct effect on job stress, with standardized regression weight of 0.076 (p<0.05). besides, workloads had indirect effect on job stress, with standardized regression weight of 0.031 (p<0.05). workloads had direct effect on job securities, with standardized regression weight of 0.403 (p<0.01) (fig. this study was conducted as an initiated step for developing community - based interventions with coping management, health policy toward the economic competition in asean community for preventing job stress among thai immigrant employees in the central region of thailand. as suggested in previous studies, migrant employees in korea comprise a vulnerable population with the relationship between job stress and depressive symptoms (23). additionally, a study found that work - related psychosocial factors are salient facts that led to depression through acculturative stress among korean - chinese immigrant employees living in korea (24). in current additionally, job stress has been displayed to be a predictor of poor health and mental health status (11, 13, 18). job stress is also known to decrease job performance, increase absenteeism, high turnover, and job confliction (25). moreover, aec in global era had effect to change as a signal of economic crisis, society, and environment such as complexity employment conditions due to job stress. these turning points to opening up to aec led into to driving both international and national immigrant employees movement (2). according to the occupational health theory of psychosocial dimension, this links to job stress. it had many causal factors related to job stress (e.g. poor form working conditions, workloads, low wages, characteristic of each occupation, high job responsibility, confliction, and relationship (2628). job conditions, workloads, wages, job securities were found to be a significant contributor to job stress for the immigrant employee. in this study, thai immigrant employees in the central region of thailand were found to be more likely to experience job stress. in previous studies, immigrant employees in ghana expressed job stress due to work overload, job insecurity, as same as immigrant employees in spain (11, 18). while poor working conditions are a causal relationship between job stress., working conditions among female immigrant employees became an important factor due to physical and mental health (12, 14). besides, low wages among immigrant employees in spain also lead into pressure and job stress (14), as the same as, stress among thai university employees it found that job & environmental condition, and wages inequality were the exogenous causal factors. they had direct effect on stress among thai university employees (29), including female academic university employee (9). a study about the relationship between psychosocial dimension among immigrant employees and mental health, found that job securities and psychosocial demand became factors due to job stress (16). in the path model for example, thai immigrant employees in the central region of thailand treated differently under employment pressures contracted, high turnover, long - term for working period, slow / little advance in job position, high quantitative demand, and emotional demand were perceived due to their job insecurities. in fact, thai immigrant employees who felt nervous about job stress hesitated to ask to relocate multiple questions job securities requested at a time. in addition, the exploitation of employers, career s characteristic, job environment under working conditions, over workloads, and low wages among thai immigrant employees may intensely be absorbed by their job stress.. these results are consistent with some previous studies that found that majority of immigrant employees had job stress (28, 30), and anxiety (2427). today, immigrant employees are affected by both acculturative and work - related psychosocial stress from workplace. this study is the first to investigate path model of job stress using thai - jcq among thai immigrant employees in the central region of thailand toward aec s policy. our findings suggest that working conditions and workloads affect job stress in particular through the influence of wages, and job securities, which are the main concerns of this study. information about the mediating effects of job stress may be emphasized in other studies and interventions targeting components of the stress process from working conditions that may affect mental health of immigrant employees. it was applied using thai - jcq appropriates for the target thai population because it was to express the specific and standard job stress measurement more than general stress measurement for clarification among thai immigrant employees. the benefit of this study can be applied to create health policy with government to decrease health disaster expenditure and the risk of preventing mental health problems. firstly, the data collection did not separate for comparisons between the groups of thai immigrant employees who had home address without three provinces selected and the groups of them who had home address within three provinces but worked within three provinces. secondly, it lacked a causal factor about distance between home address and work address among thai immigrant employees in thailand because this factor had negative direct effect on mental health from previous researches (30) that still studied or precisely it should be reexamined / revisited. however, it may have had effect on job stress investigated for increasing causal factor in path model. finally, this research focused on quantitative study that some data, may be, did not enough to discuss. it also should be adjusted to increase qualitative method or combine methods or sem and extent enormous area for the next research. working conditions had the most direct effect on occupational stress. in line with previous studies, a significant relationship between job stress the results have implications for public health under occupational health research and practice by making public health and occupational health professionals aware of the importance of a comprehensive approach to job stress prevention in the vulnerable population toward aec s policy. ethical issues (including plagiarism, informed consent, misconduct, data fabrication and/or falsification, double publication and/or submission, redundancy, etc.) have been completely observed by the authors. the research protocol was approved by the committee for research ethics, mahidol university, thailand (no. | background : the aim of this study was to verify a path model of job stress using thai-jcq.methods:the population of this cross - sectional study was 800 immigrant employees in the central region of thailand in 2015 by stratified random sampling. instruments used both the applied and standard questionnaires. job stress was measured using thai - jcq dealt with psychosocial work factors. a path model of job stress using thai - jcq was verified using m-plus.results:variables could explain the job stress change by 22.2%. working conditions, job securities, workloads had direct effect on job stress while, workloads had indirect effect as well. wages did not have any significance.conclusion:the results of this study have implications for public health under occupational health research and practice by making public health and occupational health professionals aware of the importance a comprehensive approach to job stress prevention in the vulnerable population. |
the mammalian target - of - rapamycin inhibitor (mtor) everolimus has been licensed in europe since 2004 for the prevention of organ rejection in adult patients at low to moderate immunological risk receiving an allogeneic kidney, liver or heart transplant. it was developed to improve the pharmacokinetics of the mtor inhibitor sirolimus through a stable 2-hydroxyethyl chain substitution at position 40 of the sirolimus molecule. this change confers a shorter half - life, permitting faster reduction or elimination of everolimus exposure and obviating the need for a loading dose. in a pivotal double - blind phase 3 (b253) trial in de novo heart transplant recipients published in 2003, eisen. demonstrated that everolimus provided equivalent immunosuppressive efficacy to azathioprine. inhibition of vascular smooth muscle cell proliferation by everolimus reduced intimal thickening and lowered the incidence of cardiac allograft vasculopathy (cav). based on these findings and early clinical experience in germany and austria, recommendations on the use of everolimus in heart transplantation were developed at two expert meetings held in 2004 and 2006. since then, the evidence base relating to everolimus in heart transplantation has expanded substantially with additional randomized studies in de novo and maintenance [68 ] heart transplant patients. recently, results from the 24-month, international, randomized, open - label study a2310 have been published, refocusing attention on the use of everolimus in de novo heart transplant patients. this paper considers the current data set and considers the implications for use of everolimus in this setting. the key studies evaluating the de novo use of everolimus following heart transplantation and their primary endpoints, are summarized in table 1. in a 24-month, multicenter, randomized, double - blind, double - dummy, phase 3 study (b253), the efficacy, safety, and tolerability of two fixed doses of everolimus (1.5 and 3.0 mg / day) all patients received a triple drug regimen that included standard - dose cyclosporine (csa) and corticosteroids. in the multicenter, randomized a2411 trial (n = 176), the immunosuppressive regimen was changed to concentration - controlled everolimus (initial dose 1.5 mg / day, target trough level c0 38 ng / ml) and reduced - exposure csa to examine whether renal toxicity was reduced compared to mycophenolate mofetil (mmf, 3 g / day) with standard csa. both groups received steroids and antibody induction therapy according to local practice. in an observational study by lehmkuhl., everolimus (c0 38 ng / ml) with low - exposure csa was compared to mmf (mean dose 1.252.5 g / day) in combination with standard csa in 52 de novo heart transplant patients. all patients received induction with antithymocyte globulin (two doses of 2.5 mg / kg) and steroids. mean csa c0 decreased by 58% from week 2 to month 12 in the everolimus group versus 35% in the mmf cohort (mean [sd ] at month 12 : 101 ng / ml) versus 160 ng / ml). the a2310 trial was an international, open - label, 24-month study in which 721 de novo heart transplant recipients were randomized to (i) standard everolimus trough concentration (38 ng / ml), to (ii) high everolimus trough concentration (612 ng / ml) both with reduced - dose csa, or to (iii) mmf 3 g / day with standard - dose csa. randomization to the high everolimus trough concentration group (612 ng / ml) was stopped prematurely due to higher early mortality, and data from this group were not analyzed in detail. the primary efficacy endpoint was the composite efficacy failure (biopsy - proven acute rejection of ishlt grade 3a, acute rejection episodes associated with hemodynamic compromise, graft loss / retransplant, death, and loss to followup) and the main secondary efficacy endpoint was the incidence rate of graft loss / retransplant, death, or loss to followup, both at month 12. according to the primary efficacy endpoints, everolimus was significantly more efficacious than azathioprine at month 6 aftertransplant when both agents were administered with standard - dose csa (b253), and noninferior when given with reduced - exposure csa compared to mmf plus standard - exposure csa at months 12 and 24 aftertransplant (a2310) (table 2). the german single - center observational study by lehmkuhl. indicated that a low initial csa target trough range of 200250 ng / ml during the first month aftertransplant, subsequently downtitrated to achieve a reduction of 58% by month 12, is feasible without loss of immunosuppressive efficacy. in b253, the incidences of graft loss and death were comparable between treatment groups. in the a2310 trial, the combination of highly - exposure everolimus (target c0 612 ng / ml) with csa and mmf was associated with increased mortality, leading to discontinuation of recruitment to that study arm. in the standard - exposure everolimus group, mortality was similar to the control arm only in the absence of induction therapy. increased infection - related mortality was observed during the first three months aftertransplant in patients receiving standard - exposure everolimus in conjunction with antithymocyte globulin (thymoglobulin) induction. further subanalyses revealed an association of deaths in the everolimus group with the use of a left ventricular assist device (lvad) beforetransplant, and that virtually all deaths in patients with lvad and thymoglobulin induction occurred in german centers. the german procedure for selecting highly urgent heart transplant recipients for preferred allocation results in a very high - risk population ; for example, lvad patients are only allocated to a donor very urgently in the event of technical failure, relapsing strokes, or lvad infection. if these lvad patients, often with specific risks such as concomitant infection, receive thymoglobulin induction plus early introduction of a mtor inhibitor, the intensity of immunosuppression can become supratherapeutic. in these patients, everolimus should not be initiated until wound healing is complete and any bacterial or fungal infections have been cleared. by month 24, the mortality rate in the a2310 study was similar in the everolimus and mmf groups (10.6% versus 9.2%, resp.). other efficacy endpoints were also similar between the two treatment groups, consistent with earlier data from the a2411 trial in de novo heart transplant patients (table 2). in most cases, the side effects of everolimus (e.g., dyslipidemia, elevated creatine kinase, acne, aphthous stomatitis, edema, pneumonia, proteinuria, leukopenia, and thrombocytopenia) are manageable with the adjustment of concomitant medication or reduction of everolimus dose or with interruption of everolimus therapy for a few days. due to their antiproliferative properties clinical evidence regarding an effect on wound healing in heart transplantation is mixed [5, 9, 13 ]. randomized studies indicate an elevated incidence of pericardial and possibly pleural effusion (see supplementary table 1 in supplementary material available online at http://dx.doi.org/10.1155/2013/683964). in the a2310 study, pericardial effusions were most frequent in the everolimus treatment group (43.4% versus 28.4% with mmf at month 12, p < 0.001), but rates of pericardial tamponade, pleural effusions, sternal and nonsternal wound healing complications, and wound infections were similar between groups [5, 9, 13 ] (supplementary table 1). the difference in pericardial effusions contributed to a higher overall rate of study drug discontinuation due to adverse events with everolimus versus mmf at 12 months (29.7% versus 19.0%) although this diminished by month 24 (33.3% versus 25.7%). the ongoing everheart study (nct01017029), which is being undertaken in a de novo heart transplant population randomized to receive everolimus immediately or with a delay of 46 weeks, includes pericardial effusion as a prespecified endpoint. viral infections were less frequent with everolimus versus mmf in the a2310 trial, largely accounted for by a lower rate of cytomegalovirus (cmv) infection in everolimus - treated patients (8.2% versus 20.5% with mmf at 12 months, p < 0.001 ; 9.3% versus 23.9% at month 24, p < 0.001). these results substantiate similar findings in the a2411 study, in b253 study, and a recent pooled analysis. the consistent reduction in cmv infection with everolimus versus azathioprine or mmf [2, 5, 9 ] is independent of cmv prophylaxis and donor / recipient serostatus. other viral infections such as herpes simplex virus, epstein - barr virus, polyoma virus, and herpes zoster virus may be lowered by everolimus, but studies have not been designed with these infections as predefined endpoints. of note, although viral infections are reduced, bacterial or fungal infections may be more frequent with everolimus, and avoiding overimmunosuppression is critical to reduce this risk. neither the a2310 study nor the a2311 trial showed a renal benefit for everolimus versus mmf (supplementary table 2). indeed, noninferiority of renal function for everolimus versus mmf was not shown in the a2310 study since the lower limit of the confidence interval was lower than the prespecified margin of 10 ml / min/1.73 m (the difference in mean egfr was 5.55 ml / min/1.73 m, 97.5% ci [10.9, 0.2 ]). this was probably due to the absence of csa dose reduction during the first month aftertransplant and subsequent nonadherence to targets for csa reduction in the everolimus group. it is interesting to note that from month 1 to month 12, when csa target levels were lower in everolimus - treated patients, the decline in egfr was smaller with everolimus versus mmf (8.6 versus 14.6 ml / min/1.73 m, p = 0.009). converting maintenance heart transplant patients from a standard cni regimen to everolimus with reduced cni therapy can offer a significant improvement in renal function, as demonstrated in the randomized noctet study and during single - center experience, even when administered at a low dose, although conflicting data exist. csa dose must be reduced stepwise compared to standard dosing in the presence of everolimus, which can be undertaken without loss of efficacy, or the csa reduction is inadequate to protect renal function. in the event of cni - related nephrotoxicity, early switch to a mtor inhibitor appears advisable since the positive effects on renal function are more pronounced if conversion is performed in the first year, although no specific time limit has been established. in the shirakiss trial of 34 maintenance patients with renal dysfunction who were between one and four years aftertransplant, conversion to everolimus with a 70% reduction in csa exposure only improved renal function in patients without proteinuria at the time of conversion. the decision on timing needs to take into account the fact that cni therapy may be necessary for the first nine months after heart transplantation. most side effects in maintenance patients occur within six months after starting everolimus and may necessitate a temporary switch back to cni therapy. in patients with steroid - resistant recurrent myocardial rejection, permanent reintroduction of low - dose cni may be required. there is widespread experience in german centers of cni withdrawal and long - term cni - free immunosuppression using everolimus in maintenance patients after heart transplantation. described a cohort of 60 patients switched to a cni - free regimen in response to deteriorating renal function, recurrent rejection, or side effects under cni - based therapy. after 24 months, renal function had improved significantly (mean (sd) creatinine clearance (cockcroft - gault) 41.8 ml / min versus 48.6 [21.8 ] ml / min at baseline, p < 0.001). the b253 study of everolimus versus azathioprine in de novo heart transplant patients first indicated that everolimus may inhibit the development of cav. intravascular ultrasonography (ivus) studies showed a significant reduction of the average increase of the maximal intimal thickness (mit) from baseline to month 12 aftertransplant in patients receiving everolimus compared to azathioprine and a significantly lower incidence of cav (defined as an increase in mit 0.5 mm) (table 3). these findings are highly relevant since mit at 12 and 24 months after heart transplantation predicts subsequent major adverse cardiac events and death [21, 22 ]. in the a2310 study, ivus data at month 12 confirmed that the mean increase in mit was smaller with everolimus than mmf, accompanied by a lower incidence of protocol - defined cav (table 3). all other predefined ivus endpoints were also significantly in favor of everolimus. this benefit was observed despite higher mean levels of total cholesterol in everolimus - treated patients. according to ishlt guidelines everolimus, sirolimus as tolerated, or mmf should be a part of the immunosuppression regimen after heart transplantation to reduce the onset and progression of cav. mtor inhibition can be substituted for mmf or azathioprine in patients who develop cav, although data are lacking regarding the effect of late conversion to mtor inhibition on cav progression. mtor inhibitors exert a direct antineoplastic effect by the inhibition of the phosphatidylinositol-3-kinase (pi3k) pathway and by sensitization of tumor cells to apoptosis via inhibition of the p53-induced p21 expression regulating abnormal cellular proliferation and differentiation. a randomized, double - blind, phase 3 trial has demonstrated significantly better progression - free survival in patients with metastatic renal cell carcinoma who received everolimus compared to placebo (record-1) [25, 26 ]. everolimus is licensed for the treatment of advanced renal cell carcinoma and for advanced breast cancer and is currently under investigation for the management of other types of malignancy. there are case reports describing regression of kaposi 's sarcoma and malignant neoplasia [28, 29 ] in kidney transplant recipients following conversion from cni to everolimus, and tiberio. reported a case of successful management of diffuse large b - cell lymphoma 29 months after cardiac transplantation in a 47-month - old boy using minimized csa in combination with everolimus following rituximab treatment and chemotherapy. conversion from cni to everolimus therapy to control malignancy following heart transplantation would seem a reasonable therapeutic approach, particularly for kaposi 's sarcoma, nonmelanoma skin cancer, and renal cell carcinoma but robust data are lacking. the ongoing multicenter, randomized certicoeur trial (nct00799188) is comparing the development of new skin cancers in 159 heart transplant patients suffering recurrent skin cancer receiving everolimus and reduced or discontinued cni therapy versus standard cni therapy. importantly, evidence is also growing for a protective role of mtor inhibitors on the risk of developing new malignancies or nonskin solid tumors following kidney transplantation. minimization of steroids and exposure to cnis are especially vital in children to reduce the risk of metabolic disorders, renal dysfunction, and cancer. while early withdrawal of steroids is a well established strategy in pediatric transplant recipients, there is only limited experience with - reduced - cni or cni - free regimens [33, 34 ]. everolimus is not currently licensed in children and its use in pediatric heart transplant patients is largely restricted to high - volume centers. behnke - hall. have published their experience of switching from cni therapy to everolimus in 28 children with poor renal function (egfr < 75 ml / min/1.73 m) at a median of 9.81 years following heart transplantation. all patients were also receiving azathioprine or mmf (those on azathioprine were converted to mmf before the switch to everolimus). in this series, median egfr increased significantly from the time of conversion (47.81 ml / min/1.73 m) to six months (63.1 ml / min/1.73 m) and 12 months (64.8 ml / min/1.73 m) after conversion (both p < 0.05), although three patients experienced rejection and side effects were common. more extensive experience is available in pediatric kidney transplantation [3739 ], indicating that de novo use of everolimus with csa offers effective immunosuppression and good renal function to three years aftertransplant. analyzing protocol biopsies at six months after renal transplantation, kanzelmeyer. found a significantly lower number of pathological changes in patients treated with everolimus and low - dose cni compared to standard cni - based treatment. due to greater oral clearance, pediatric patients may require higher dosages than adults when adjusted according to weight and body surface area or shorter dosing intervals. in their series of pediatric maintenance heart transplant recipients converted from cni therapy to everolimus, behnke - hall and colleagues targeted an everolimus trough concentration of 58 ng / ml, with a mean (sd) starting dose of 0.07 (0.05) mg / kg given in two divided doses. the mean (sd) change in everolimus dose after three months was 0.15 (0.17) mg / kg. in this cohort of 28 patients, experience from pediatric kidney transplantation suggests that an everolimus trough concentration of 46 ng / ml for the first 6 months aftertransplant and then 35 ng / ml thereafter or more simply a trough level of 3 off - label use in pediatric liver transplant patients is limited, but initial data suggest that a trough concentration in the range 46 ng / ml with reduced - exposure csa may be sufficient when introducing everolimus as rescue therapy for chronic graft failure. everolimus acts synergistically with csa, such that csa exposure can be reduced without the loss of efficacy. to avoid the risk of potentiating cni - related nephrotoxicity reported a reduction in mean csa trough concentration of 47% at two weeks and 58% at 12 months after transplantation compared to standard dose. a drug - drug interaction between everolimus and tacrolimus, by which everolimus decreases tacrolimus oral bioavailability in a dose - dependent manner, means that tacrolimus dose reductions should be smaller than those required for csa, particularly during the early posttransplant phase, to avoid rejection. in cni - free regimens, everolimus has a shorter half - life than sirolimus (28 hours versus 62 hours) with a more rapid time to steady state (4 days versus 57 days) and as a result does not require a loading dose [4550 ] (supplementary table 3). it is administered twice daily together with the concomitant immunosuppressive medication. stable trough blood levels (38 ng / ml) can be obtained after approximately 37 days and should be monitored 12 times a week initially, then weekly for the following two months, and every 24 weeks thereafter. if the everolimus dose or concomitant medication is changed, the frequency of monitoring should be increased until steady state is achieved. the daily dose should not exceed 3.0 mg even if the target trough concentration is not achieved other than in a very few instances (e.g., in patients receiving comedication that induces enzymatic induction), when a higher dose may be appropriate for a limited period. unless there are special considerations to take into account, all de novo heart transplant patients can be considered potential candidates for everolimus - based immunosuppression. caution should be exercised in certain categories of patients, however, such as those at risk of severe proteinuria, poor wound healing, or patients who have uncontrolled severe hyperlipidemia or a highly elevated risk of infection (table 4). the potential risk of impaired wound healing and fluid retention at operative sites indicates that delayed initiation of everolimus after transplantation (e.g., approximately 814 days) or after other surgical interventions may be helpful although such an approach has shown no benefit in kidney transplantation. delayed introduction of everolimus has not yet been systematically explored in heart transplantation but may be most relevant in heart transplant patients with risk factors for poor healing, particularly obesity or diabetes, and in patients with previous coronary artery bypass grafting with bilateral harvesting of the mammarial arteries or those undergoing re - thoracotomy early after transplantation [13, 52 ]. routine use of everolimus in the early phase post - transplant is not appropriate in patients with severe end - organ dysfunction prior to transplantation or in patients on lvad who are considered to be at high risk for infection or wound healing complications. this is especially the case if lvad infection was the indication for heart transplantation and thymoglobulin is used as induction therapy (or, potentially, to treat early rejection) since the findings of a2310 suggest that this combination may lead to overimmunosuppression. the most frequent reason for introducing everolimus to a maintenance immunosuppression regimen is to support the minimization or withdrawal of cni therapy, for example, in response to impaired renal function or malignancy. in such cases, conversion to a combination of everolimus with mycophenolic acid plus steroids is usually an appropriate option. additionally, an antimetabolite agent may be switched to everolimus at any time after transplantation with the most likely indications being repeated rejection or adverse events caused by azathioprine or mycophenolic acid. theoretically, conversion from an antimetabolite to everolimus could be used to inhibit the development of cav progression, but currently there is only very limited clinical experience to suggest that late switch is beneficial in patients with established cav. when everolimus is introduced to replace an antimetabolite agent (mycophenolate or azathioprine), the dose of csa should be reduced immediately at the time of everolimus initiation. for a short period (approximately four days), everolimus should be given in addition to the antimetabolite, which is then withdrawn as soon as an adequate everolimus trough concentration (c0 38 ng / ml) is achieved. close surveillance by echocardiography and at outpatient visits is important during the first weeks after conversion to ensure that acute rejection, while unlikely, is detected promptly. in cases where everolimus is introduced to substitute for cni therapy in patients receiving mycophenolic acid, everolimus should be started at a dose of 0.75 mg b.i.d., with stepwise reductions in cni dose. once the everolimus trough concentration is in the range 38 ng / ml, the cni is withdrawn. in patients receiving everolimus with cni and a cni - free regimen is sought, mmf can be introduced at a dose of 1.01.5 g b.i.d. with stepwise withdrawal of cni starting approximately one week later. in the early period after cni withdrawal, close observation of allograft function by echocardiography and endomyocardial biopsy coupled with monitoring of everolimus and mycophenolic acid trough concentrations is very important. patients who are receiving azathioprine and cni also need a stepwise approach to cni discontinuation. azathioprine is discontinued as soon as adequate everolimus trough concentrations are reached. in a second step, several weeks later, the cni dose is reduced stepwise while mycophenolic acid is introduced. everolimus interacts with cytochrome p450 (cyp) enzymes 3a4, 3a5, and 2c8.. concomitant administration of some cyp3a4 inhibitors (e.g., azithromycin, erythromycin, ketoconazole, and itraconazole) induces 1874% reduction in everolimus clearance, resulting in an increased maximum concentration and prolonged everolimus half - life, while others (e.g., calcium channel blockers, quinolones, and trimethoprim - sulfamethoxazole) have no relevant effect. cyp3a inducers (rifampicin, phenytoin, and carbamazepine) decrease everolimus blood concentration to varying degrees. csa is metabolized via the cyp3a isoenzyme system and has been shown in single - dose healthy volunteer studies to increase everolimus blood concentration but the steady - state pharmacokinetics of csa are not influenced by coadministration of everolimus. a reduction in csa exposure is necessary to avoid cni - related nephrotoxicity in combination with everolimus. the combination of tacrolimus and everolimus for prophylaxis of acute rejection after heart transplantation is administered in selected patients in some german centers, although this remains off - label use. there is evidence from kidney transplantation that co - administration of everolimus with tacrolimus reduces tacrolimus exposure. therefore, tacrolimus dose reduction is considered necessary, although to a lesser extent than for csa. tacrolimus does not influence everolimus blood levels, such that higher doses of everolimus are required than those in csa - treated patients to maintain therapeutic blood levels of everolimus. tacrolimus is as effective as csa in combination with everolimus after heart transplantation, and the incidence of serious hypertriglyceridemia is similar. everolimus trough blood concentrations in the range 38 ng / ml are well tolerated and associated with a low incidence of side effects, but higher levels are not well tolerated. if everolimus trough concentration exceeds 10 ng / ml, an immediate dosage reduction is likely to be necessary since in addition to a high incidence of everolimus - specific side effects there is an increased risk of over - immunosuppression. most adverse events are not lifethreatening and are responsive to treatment. in clinical practice, preventive measures, optimal screening, and management of side effects should be routine. experienced - based algorithms may help to avoid the need for everolimus discontinuation. management strategies for specific types of everolimus - related adverse events in heart transplant recipients have been discussed in detail elsewhere [4, 11 ] and key aspects are summarized in table 5. routine comedication with lipid - lowering medication is essential in heart transplant patients receiving a mtor inhibitor. statin therapy is standard, but in view of the known potential for drug - drug interactions between drugs that affect cyp3a metabolism of everolimus, agents that do not interact with cyp450 should be selected, such as pravastatin, fluvastatin, or fibrates. discontinuation of everolimus in heart transplant recipients is associated with a decline in renal function but withdrawal or temporary interruption may be necessary if severe everolimus - related side effects can not be managed or if surgery is planned. everolimus can be replaced by mmf using a stepwise switch. in the event of surgery, this stepwise process should be timed to ensure that everolimus is withdrawn at least seven days before the operation is scheduled. since adequate blood concentration of mmf requires several days to achieve, overlap of everolimus and mmf administration is advisable for approximately four days. the cni blood level is likely to increase during everolimus withdrawal and both blood concentrations and renal function should be monitored closely during and after discontinuation. after the side effects have resolved or wound healing is complete, reintroduction of everolimus can be considered. in patients receiving cni - free immunosuppression, the risk of postoperative infection must be carefully balanced with the risk of renal function impairment associated with the reintroduction of cni. for elective major thoracic, abdominal, and retroperitoneal surgery, this switch should be undertaken approximately two weeks before surgery with reconversion to a cni - free regimen as soon as wound healing is completed. the efficacy of everolimus at a trough concentration of 38 ng / ml in combination with reduced - exposure csa is noninferior to mmf plus full - exposure csa up to two years after heart transplantation. the side effects which are potentially associated with the use of mtor inhibitors do not represent a major threat in the clinical situation. in addition, when administered in combination with mmf, everolimus offers the option of cni - free immunosuppression in selected patients beyond the first year after heart transplantation. recent concerns about early increased mortality in the everolimus groups of the a2310 study can be explained by overimmunosuppression in patients with lvad before transplantation, which arose predominantly from a country - specific effect in germany. if patients with lvad and specific risks such as infection receive thymoglobulin induction plus early mtor inhibition, the intensity of immunosuppression accumulates to an intolerable level with an associated increase in infection - related mortality. such patients should not receive everolimus before wound healing is completed and any bacterial or fungal infection has been cleared. the most important benefit of everolimus therapy in heart transplantation may be that its dual mode of action prevention of acute allograft rejection coupled with suppression of growth factor - driven smooth muscle cell proliferation combines immunosuppressive potency with the reduction of de novo cav disease. the significant reduction in cmv infection in everolimus - treated patients may also contribute to the minimization of intimal vascular changes. for the first time, the a2310 study has shown superiority for everolimus versus mmf in all relevant ivus parameters, in accordance with earlier subanalyses from the b253 study comparing everolimus with azathioprine. of note, everolimus was initiated early (i.e., within the first 72 hours after transplantation) in both trials. this may be an important detail as many preconditioning events which predispose to cav start at the time of heart transplantation. careful patient selection and individualized immunosuppression are a key to achieving optimal outcomes after heart transplantation. due to its potential to inhibit progression of cav and to reduce cmv infection, everolimus should be initiated as soon as possible after heart transplantation and be included in standard immunosuppressive regimens if special care is applied in specific patient types and unsuitable patients are excluded (table 5). immediate and adequate reduction of csa exposure is mandatory from the start of everolimus therapy. the findings of the mandela and schedule trials may, in the future, support adoption of cni - free immunosuppression with combined everolimus and mmf therapy beyond six months after heart transplantation, and results of these trials are awaited with interest. | the evidence base relating to the use of everolimus in heart transplantation has expanded considerably in recent years, providing clinically relevant information regarding its use in clinical practice. unless there are special considerations to take into account, all de novo heart transplant patients can be regarded as potential candidates for immunosuppression with everolimus and reduced - exposure calcineurin inhibitor therapy. caution about the use of everolimus immediately after transplantation should be exercised in certain patients with the risk of severe proteinuria, with poor wound healing, or with uncontrolled severe hyperlipidemia. initiation of everolimus in the early phase aftertransplant is not advisable in patients with severe pretransplant end - organ dysfunction or in patients on a left ventricular assist device beforetransplant who are at high risk of infection or of wound healing complications. the most frequent reason for introducing everolimus in maintenance heart transplant patients is to support minimization or withdrawal of calcineurin inhibitor therapy, for example, due to impaired renal function or malignancy. due to its potential to inhibit the progression of cardiac allograft vasculopathy and to reduce cytomegalovirus infection, everolimus should be initiated as soon as possible after heart transplantation. immediate and adequate reduction of cni exposure is mandatory from the start of everolimus therapy. |
older people 's participation in leisure activities, such as involvement in cultural, social, and physical activities, is known to be positively associated with health and survival. it is therefore important to improve the understanding of the risk factors that might cause a decline in such participation. accordingly, this study aims to investigate the impact that health - related risk factors, such as medical conditions, mobility difficulties, and activity limitations, may have on older people 's engagement in leisure activities. european countries are currently facing major demographic changes due to substantial increases in longevity (a large reduction in late life mortality) and declines in fertility [2, 3 ]. as a consequence, this fact has led to a growing interest in understanding how to meet the needs of an ageing population. it is also a public health priority that includes, among other things, the identification of components that can promote factors to support active and healthy ageing [4, 5 ]. in an aging population, the prevalence of health - related risk factors such as medical conditions, mobility related difficulties (limits in functions), and activity limitations (inability to perform activities) increase with age. the relation between the above - mentioned health - related risk factors and health is, however, complex and much discussed. according to the world health organization, health is a state of complete physical, mental, and social well - being, and to reach this state we must be able to identify and realize aspirations in life, satisfy our needs, and be able to change or cope with the environment. therefore, the relationship between engaging in activities and becoming healthy is an important perspective of health with a long history. on a general level, engagement in leisure activities has demonstrated positive health - related outcomes and correlates explicitly with increased survival and life expectancies, lower mortality rates [1317 ], and higher levels of happiness [18, 19 ]. engagement in leisure activities seems therefore to be an important health promoter in the case of older people. engagement and participation in leisure activities are reported slowly decline over time in later life [20, 21 ], but how this decline can be promoted is less known. participation in leisure activities is often studied from the aspect of performing activities as such, while some studies also highlight the importance of incorporating the purpose or motivational aspects for added understanding [22, 23 ]. being motivated is a crucial component for making the leisure activities meaningful, and therefore the motivation component is an important factor to take into account when conducting research on leisure engagement and its relation to health - related conditions. earlier research has shown that functional decline could be an important indicator of ill - health in later life [24, 25 ]. however, according to the world health organization, functional decline and limitations might not be the direct cause of the limited ability to perform activities, as the adaptation to the environment or by the person could reduce the negative effect of such decline., for example, did not find any associations between medical diseases and activities of daily living (adl), whereas gill. found change in physical performance as independently associated with adl dependency. while maintaining healthy habits is described as preventing the deterioration of functional capacity [28, 29 ], few studies focus on leisure engagement as a result or indicator of a person enjoying good health. atchley found that limitations in performance affected leisure patterns in older people, but if and how this is true also for mobility difficulties and other important health - related risk factors in later life needs further investigation. in this study, we therefore wanted to explore potential health - related risk factors related to leisure engagement decline by studying the impact of medical conditions, mobility difficulties, and activity limitations in relation to leisure engagement. while studying this relation, it is important to consider the influence of personal characteristics upon these relationships. for example, it is known that later life health problems seem to vary between genders, to be influenced by socioeconomic aspects, and to vary between countries or geographic regions. therefore, these potential confounders must be considered as having a possible impact on this relation. specifically, the research questions for this paper are the following.is there a relationship between medical conditions, mobility difficulties, activity limitations, and leisure engagement in older people?is the relationship influenced by sociodemographic aspects such as gender, age, economy, and geography ? is there a relationship between medical conditions, mobility difficulties, activity limitations, and leisure engagement in older people ? is the relationship influenced by sociodemographic aspects such as gender, age, economy, and geography ? the analyses are based on a cross regional survey carried out in 2010 as a part of an interregional eu - funded research project (gerontological regional database and resource centre, gerda). the overall aim of the multidisciplinary project was to map living and health conditions of older adults (aged 65, 70, 75, and 80 years) in the bothnia region, that is, on both sides of the gulf of bothnia, in vsterbotten in sweden and in sterbotten / pohjanmaa in finland (more information about the project is available at the project website (http://web.novia.fi/gerda/)). although the two regions sterbotten and pohjanmaa belong to the same geographical region, they can in fact be treated as two separate regions due to different linguistic conditions (the (technical) division between sterbotten and pohjanmaa relates to a language stratification of citizens in this particular west - finnish region. elderly swedish - speaking inhabitants were coded as belonging to sterbotten and those with finnish as their mother tongue were coded as belonging to pohjanmaa). in this paper, however, we do not separate these two areas from each other, since the linguistic characteristics of the finnish population are controlled for by the language variable. in 2010, the swedish region vsterbotten consisted of 15 municipalities, including two more densely populated areas (ume and skellefte), with an overall population of approximately 260,000 inhabitants. the overall population in the west - finnish region sterbotten / pohjanmaa (including the town of vaasa) consisted of approximately 178,000 inhabitants. although the above - mentioned regions share several common structural features, such as common cultural characteristics and common historical bonds, there are also noticeable differences between them, such as differing linguistic conditions. finland is an officially bilingual state with a large finnish - speaking majority and a small swedish - speaking minority of approximately 6 percent. however, in sterbotten / pohjanmaa, 51 percent of the population belong to the swedish - speaking group and form to some extent a majority at the local level. in 2010, three out of 17 municipalities in sterbotten / pohjanmaa were officially monolingual (finnish) whereas swedish - speakers formed the local majority in nine municipalities. a total sample of 10,696 was selected from the national tax board in sweden and the population register centre in finland. questionnaires were sent to all people that in 2010 were 65, 70, 75, and 80 years old in rural municipalities, to every second person in the most populous town in finland and to every third person residing in the two most populous towns in vsterbotten. in total, 6 838 persons (64%) replied. the response rate varied between the regions, with 70% responding in vsterbotten, 62% in sterbotten, and 53% in pohjanmaa. the response rate was somewhat higher amongst the two younger age groups (66%) than those aged 75 and 80 years (61.9 and 59.2%, resp.). in order to be selected as a part of the sample, valid responses on leisure engagement were required. a posted questionnaire was sent out during late 2010 and included a broad range of questions related to aspects of societal engagement, medical history, health, and sociodemography. the battery of questions was developed by the multidisciplinary team of researchers included in the gerda, and for this paper we analyzed medical conditions (integrating 5 pharmaceutical drugs, stroke, heart disease, cancer, and hospital stays during the last 12 months into an index) ; mobility difficulties (integrating fear of falling and mobility device into an index) ; activity limitations (integrating independent bathing and independent cleaning into an index) ; and leisure engagement. the sociodemographic variables included in the analysis were age (65/70/75/80 yrs), language (swedish / finnish and other languages), gender (man / women), civil status (single / together), income (1000/>1000), education (9 yrs/10 yrs), and country (finland / sweden). leisure engagement was measured by asking about two aspects of 20 different leisure activities (task) : first if the participant had a habit of performing the task and then if the participant was motivated to perform the said task. these questions were a part of the mnps leisure checklist that has been used in previous similar samples and that has been evaluated for its validity [23, 34 ]. firstly, we calculated the extension of medical conditions, mobility difficulties, and activity limitations in every person by adding up each component in the index into a number. more specifically, each person was assigned a number that put their medical condition between 0 and 5 based on if they reported using 5 pharmaceutical drugs, personal incidence of stroke, heart disease, cancer, or / and hospital stays during the last 12 months. similarly, a number between 0 and 2 was assigned for mobility difficulties (adding a fear of falling, dependency on mobility devices) and activity limitations (dependency on help for bathing, dependency on help for cleaning). a higher number was interpreted as showing a more severe medical condition, mobility difficulties, or activity limitations. secondly, to generate the measures of leisure engagement, the raw data of leisure performance and the raw data of leisure motivation were combined and subjected to the rasch rating scale analysis by using the winsteps program. this procedure has been used and found to be a valid measurement for groups of older people. the generated data was treated as valid if it met the common criteria for surveys of mnsq 1.5 and z 2.0. to be included in the study, a valid response regarding leisure engagement was required. in total, data from 1 403 respondents was excluded due to invalid responses. a major reason for this error was that many participants had not answered the question about leisure motivation (do you want to perform this activity ?). lastly, we exported the leisure engagement scale measures to ibm spss statistics, version 20, for continued analysis. the relationship between the engagement in leisure activities of older adults, different health indicators and sociodemographic control variables was assessed by using ordinary least squares (ols) multivariate regression. we used the above - mentioned measure for leisure engagement as our dependent variable as well as three indexes measuring medical condition, mobility difficulties, and activity limitations as independent variables. the first model calculated a bivariate regression coefficient for each separate health indicator index on leisure engagement. the second model consisted of multivariate regressions of the above - mentioned health indicator indexes on leisure engagement. the third model was a full model assessing the association between leisure engagement and health indicators while controlling for sociodemographic characteristics. in this study a total of 5435 participants met the inclusion criteria, 1375 from sterbotten (25.3%), 845 from pohjanmaa (15.5%), and 3215 from vsterbotten (59.2%). the most dominant type of person found in the sample was a 65-year - old (40.2%) women (55.5%) living in vsterbotten, sweden (59.2%), together with someone (74%) and earning more than 1000 a month (72.8%). the basic characteristics were similarly distributed in finland and sweden. of the total sample 59.2% were swedes (from vsterbotten, sweden), 25.3% were swedish - speaking finns (from sterbotten, finland) and 15.5% were finnish - speaking finns (from pohjanmaa, finland). leisure engagement varied in the sample between the most engaged (5.10) and the least engaged (4.60) with a mean 0.28 (sd 0.99). every fifth participant (about 20%) used 5 or more pharmaceutical drugs and reported a hospital stay during the last 12 months. the most frequently reported medical diagnosis was (some form of) cancer (15%). one quarter of the participants (about 25%) reported a fear of falling and about 14% needed help with cleaning. more details about medical diagnoses, mobility difficulties, and activity limitations are described in table 2. the first two models of the ols regression (see table 3) indicate that medical conditions, mobility difficulties, and activity limitations all have hampering effects on the leisure engagement of older adults, both when we consider the bivariate associations between each of the three indicators and leisure engagement (model 1) and when their relative importance for leisure engagement (model 2) is taken into consideration. as is shown in the table, the indicator having the biggest impact on the leisure engagement of older adults is activity limitations, while the two other health status indexes play somewhat lesser roles. interestingly, the strong negative association between activity limitations and leisure engagement remains significant (which is also the case with mobility difficulties) even after we control for individual, sociodemographic characteristics, and country (model 3). this suggests an independent association between activity limitations, mobility difficulties, and leisure engagement. the table also shows that leisure engagement tends to decline with old age and that leisure engagement is higher among swedish - speaking older adults than among finnish - speakers and persons with other mother tongues. it is intriguing to note that one 's mother tongue seems to play an important role in this respect, although the country variable does not seem to matter a great deal. as it is revealed in the figure, the swedish - speakers in finland also show a high rate of leisure engagement, which may explain why the country variable remains insignificant (see figure 1). furthermore, table 3 shows that leisure engagement is higher among women, persons living together with someone else, persons with high incomes (pensions), and persons with higher levels of education. in this paper, we have analyzed the relationship between leisure engagement and medical conditions, mobility difficulties, and activity limitations. this study demonstrates that having a fear of falling, using mobility devices, and needing help with bathing and/or cleaning all have a significant impact on the level of leisure engagement in the case of older people. this impact remains significant even after controlling for variables such as gender, age, civil status, income, education, and language group affiliation. for the purpose of this study, we operationalized mobility difficulties and activity limitations as an index that assessed whether older persons were experiencing a fear of falling and using mobility devices or if they were in need of help in order to bathe or clean themselves, respectively. even though this is only one way of operationalizing mobility difficulties and activity limitations, it still gives an insight into how mobility issues as well as ability factors influence the extent to which older persons engage in leisure activities. mobility issues and particularly a fear of falling have previously been studied and found to influence physical leisure activities negatively [38, 39 ]. this variable does not seem to play a role as big as that of mobility difficulties and activity limitations. moreover, the variable of medical conditions loses its strength after controlling for sociodemographic variables. these results are somewhat supported by earlier findings [6, 40 ], which report that older people may view themselves as healthy despite suffering from chronic illnesses and disabilities. however, the negative link between illnesses or diagnoses and activities is often taken for granted or regarded as obvious (e.g., [4143 ]) even though other researchers found that engagement in activities is affected by more than just diseases. life style factors as well as persons ' physical and social environment, for example, have been noted to play a role in the level of engagement in such activities [4447 ]. with a regression model explaining about 10% of the variance in leisure engagement, this study demonstrates the need to examine leisure engagement no matter medical conditions, mobility difficulties, or activity limitations. moreover, this study supports the need to consider age, gender, civil status, and socioeconomic status in terms of income and educational level when examining leisure engagement in the case of older people. in this study, leisure engagement varied between finnish- and swedish - speakers, but the country variable as such showed no impact on their engagement in leisure activities. this is an interesting finding that seems to separate the effects of language group affiliation from those of the geographic region where a person is resident (e.g.,). the results found in this paper also corroborate the findings from a recent study, which found that good self - rated health was high among swedish - speakers in sweden and finland, respectively, but lower among finnish - speakers in finland. further, being in line with previous research, it seems like historical, social, and cultural differences attributed to belonging to a specific language group in finland are playing an important role in explaining language group differences in leisure engagement. it has been suggested that the swedish - speaking community in finland live in tighter social networks as compared to the finnish - speaking community which might explain the high levels of leisure engagement among the swedish - speakers in finland in our study. to what extent does leisure engagement of older persons depend on their level of activity limitations, their level of mobility difficulties, or their medical diagnoses, and to what may such engagement be related to other factors not examined in the present study ? environmental issues and physical and social factors may also be important here, as suggested in many theories [5052 ]. supports and barriers in the social, physical, or societal environment could, for example, be a part of interventions but are also shown to influence physical activities and suggested to be used as predicting factors. there might also be other, yet unknown, factors of importance to identify and incorporate into future evaluations of leisure engagement. earlier research supports a relationship between self - rated health, seen as an overall measure of health, and leisure engagement [55, 56 ] and this needs to be investigated further. perhaps self - rated health could go together with medical conditions, mobility difficulties, and activity limitations to create a broader understanding of factors influencing the engagement in leisure activities. based on the results, we can question whether medical conditions have a great impact on leisure engagement. other findings similarly reveal limitations in using medical conditions to predict a decline in the activities of daily living. hence, it is important to remember that only a few diagnoses and signs of medical conditions were included in this study 's medical condition variable. if other diagnoses or signs, such as symptoms of depression and cognitive limitations, were included, the predictive strength of the regression models might be improved in terms of leisure engagement. another limitation of this study is that self - reports of diseases are prone to be influenced by individual bias, particularly in the case of illnesses perceived as nonthreatening and that do not hamper a person 's ability to live normally. these illnesses may nevertheless increase the risks for a decline of a person 's ability to function normally and need therefore to be considered. although we used a population - based cohort, the exclusion from the analyses of participants with invalid responses on leisure engagement measures may have introduced bias and reduced the generalizability of the results. however, as the study is not limited to include only the performance of leisure activities, but also the motivational aspect of these activities, our measure on leisure engagement can arguably be seen as robust. this study is based on self - reports, that is, on the accounts of older people assessing their engagement in leisure activities as well as their experienced medical diagnoses, mobility difficulties, and activity limitations. there is however a great need to study also other variables in the complex field of leisure engagement. | objectives. this study aims to investigate the impact of medical conditions, mobility difficulties, and activity limitations on older people 's engagement in leisure activities. methods. the analyses are based on a cross regional survey carried out in 2010 in the bothnia region (northern sweden and western finland). a posted questionnaire, which included questions on different aspects of leisure engagement, medical history, and health, was sent out to older persons in the region. the final sample consisted of 5435 persons aged 65, 70, 75, and 80 years. the data was analyzed by using ordinary least squares (ols) multivariate regression. results. the most important predictor of leisure engagement abstention among older people is the prevalence of activity limitations, whereas mobility difficulties and medical conditions play less important roles. the strong negative association between activity limitations and leisure engagement remains significant even after we control for individual, sociodemographic characteristics, and country. discussion. this study provides a window into leisure engagement in later life and factors influencing the magnitude of engagement in leisure activities. |
multidrug resistance (mdr) is one of the main causes of the failure of cancer chemotherapy. one of the major mechanisms of drug resistance is mediated by overexpression of p - glycoprotein (p - gp, abcb1, mdr1). p - gp is a membrane - bound protein that functions as a drug efflux transporter. this protein has two halves, each containing six transmembrane domains and an atpase domain. the drug - binding site is the primary site to interact with its substrates, and its complex structure allows structurally and functionally complex compounds to interact with it. drugs interact with p - gp and stimulate atpase activity, which energizes drug extrusion from cells, thereby reducing intracellular drug concentration. because of the wide range of compounds recognized by p - gp, mdr cells expressing p - gp also exhibit cross - resistance to other drugs. evidence from in vivo and in vitro studies indicates that p - gp plays an important role in drug pharmacokinetics, making it a major target to circumvent drug resistance and increase drug bioavailability. to overcome p - gp - mediated drug resistance, most of the drugs were developed as p - gp inhibitors to block the function of p - glycoprotein. three generations of p - gp inhibitors have been developed and have proved to be effective in vitro. multiple reasons have been suggested for these failures, including suboptimal clinical trial design, heterogeneity of patient mdr phenotypes, unexpected drug toxicity, poor pharmacokinetics of p - gp inhibitors, and the influence of endogenous p - gp or other drug transporters. therefore, novel strategies to circumvent p - gp function in drug - resistant cancer cells are actively under development. we have focused on the effect of collateral sensitivity (cs), a phenomenon that occurs when cytotoxic drugs are more sensitive to mdr cells than the drug - sensitive, parental cells. first described in the 1950s, cs has recently emerged as a promising strategy to overcome mdr in cancer. our laboratory identified a thiosemicarbazone named nsc73306 that is selectively toxic toward p - gp - expressing cells. cytotoxicity studies suggest that the degree of sensitivity to nsc73306 is dependent upon the expression level of functional p - gp. modulation of p - gp activity by p - gp inhibitors or downregulation of p - gp reverses hypersensitivity to nsc73306, suggesting that the cytotoxic effect of nsc73306 is linked to p - gp function. the molecular interactions of nsc73306 were tested with other multidrug resistance related abc transporters, including abcg2. nsc73306 does not specifically kill abcg2-expressing cells, but is a potent modulator of abcg2 by virtue of its affinity as a substrate for that efflux transporter. as nsc73306 can interact with other membrane proteins and metals, we hypothesized that nsc73306 might be a substrate of an unknown solute carrier (slc) family uptake transporter. in this study, we identified compounds that could inhibit cellular accumulation of [h]nsc73306. to achieve this goal, we established p - gp - expressing stable cell lines in llc - pk1 porcine kidney cells. we found that cisplatin, a substrate transported by copper transporter 1 (ctr1, slc31a1), is able to block nsc73306 accumulation. nsc73306 was obtained from the drug synthesis and chemistry branch, developmental therapeutics program, division of cancer treatment and diagnosis, national cancer institute, nih. [h]nsc73306 (specific activity : 40 ci / mmol) was obtained from american radiolabeled chemicals (st. bodipy - verapamil, fumitremorgin c (ftc) (inhibitor of abcg2/bcrp), and mk571 (inhibitor of multiple mrps) were kindly provided by dr. (2r)-anti-5-[3-[4-(10,11-dichloromethanodibenzo - suber-5-yl)piperazin-1-yl]-2-hydroxypropoxy ] quinoline trihydrochloride (dcpq) was kindly provided by dr. 3-(4,5-dimethylthiazolyl-2)-2,5-diphenyltetrazolium bromide (mtt), doxorubicin, verapamil, cisplatin, carboplatin, oxaliplatin, pyrilamine, quinidine, copper chloride, triethylamine, cimetidine, trimethyoprim, 3-o - methylglucose, sodium azide (nan3), and sodium fluoride (naf), sodium deoxycholate, and dithiothreitol (dtt) were purchased from sigma - aldrich (st. louis, mo). medium 199, dulbecco s modified eagle medium (dmem), trypsin / edta solution, lipofectamine2000, sirna - oligofectamine, and geneticin were obtained from life technologies (carlsbad, ca). monoclonal anti - gapdh and polyclonal anti - human ctr1 (f-190) antibodies were purchased from santa cruz (santa cruz, ca). monoclonal mouse anti - p - gp c219 antibody was obtained from dako (carpinteria, ca). the ctr1 sirnas and the ctrl_allstars_1 sirna were purchased from qiagen (valencia, ca). llc - pk1, hek-293, and cos7 cell lines were obtained from the american type culture collection (manassas, va). llc - pk1 parental cells were grown at 37 c in medium 199 with 4.5 g / l glucose (gibco, carlsbad, ca) supplemented with 3% (v / v) fetal bovine serum (biowhittaker, walkersville, md) with l - glutamine, penicillin, and streptomycin. the llc - mdr1-wt and llc - mdr1-eq cell lines were maintained in the above medium plus 500 g / ml geneticin (invitrogen, carlsbad, ca). the parental human epidermoid carcinoma cell line kb-3 - 1 (a hela subclone) and two independent cisplatin - resistant derivatives were studied : kb - cp.5 (selected in a single step at 0.5 g of cisplatin / ml) and kb - cp20 (selected with stepwise increases up to 20 g of cisplatin / ml). the parental liver carcinoma cell line bel-7404 and its cisplatin - resistant derivatives bel-7404-cp1 (selected in a single step at 1 g of cisplatin / ml) and bel-7404-cp20 (selected with stepwise increases up to 20 g of cisplatin / ml) were studied. with the exception of the llc - pk1 cell lines, all cell lines were grown at 37 c in 5% co2, using dulbecco s modified eagle medium (dmem) with 4.5 g / l glucose, supplemented with l - glutamine, penicillin, streptomycin, and 10% fetal bovine serum. briefly, 2 10 cells were grown in each well of a 24-well culture plate (corning, corning, ny) for 24 h. before initiation of the assay, cells were washed with a transport buffer containing 125 mm nacl, 20 mm nahco3, 3 mm kcl, 1.8 mm cacl2, 1 mm kh2po4, 1.2 mm mgso4, 10 mm d - glucose, and 10 mm hepes (ph 7.4) and preincubated in the same buffer for 5 min. subsequently, 200 l of transport buffer containing [h]nsc73306 (1 ci / ml) and, where relevant, other small molecules was simultaneously added. to stop the experiment, drugs were removed and the cells were washed three times with ice - cold pbs. cells were dissolved in 100 l of 0.3 m naoh for 3 h following neutralization with an equal volume of 0.3 m hcl. an aliquot of sample (100 l) was taken and mixed with scintillation cocktail (10 ml) (bio - safe ii), and the disintegrations per minute were measured using a beckman coulter ls-6500 liquid scintillation analyzer. each assay was repeated at least 3 times. for calcium - dependent transport assays, calcium was replaced with magnesium in the transport buffer. for sodium - dependent transport assays, nacl or nahco3 transfection of pcmv6 or pcmv6-hctr1-gfp vectors was performed by lipofectamine2000 transfection reagent according to the manufacturer s instructions. briefly, dna and lipofectamine2000 were mixed in opti - mem medium at room temperature for 30 min. the mixture was added to the cells and incubated for 24 h. transfection efficiency was estimated by western blot analysis using anti - ctr1 antibody. four distinct small interfering rnas (sirnas) were designed to target human ctr1/slc31a1 transcripts based on predictors of on- and off - target activity (qiagen). the sense sequences of sirnas were as follows : hs_slc31a1_8, cagcatgagctgctatagaat ; hs_slc31a1_9, agcctactggattgaggttaa ; hs_slc31a1_10, ccgagagagcctgctgcgtaa ; hs_slc31a1_7, atcgacttgcattcccactta. individual sirnas were reconstituted in nuclease - free water to achieve a 10 m solution. the ctrl_allstars_1 sirna (1 nmol) negative control was reconstituted to 10 m according to the manufacturer s protocol. briefly, prior to transfection, sirna - oligofectamine (invitrogen) complexes were established according to the manufacturer s protocol and then added to each well to achieve a final concentration of 50 nm sirna and 0.5% oligofectamine. after incubation at 37 c in 5% co2 for 20 h, medium was removed from the cells and replaced with assay medium. cell survival was measured by the mtt (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium) assay following the published protocol. briefly, cells were seeded on 96-well plates and allowed to incubate for 24 h. drugs were then added to the cells and incubated for an additional 72 h. the remaining viable cells converted mtt to a purple formazan product, and after solubilization the absorbance at 570 nm was recorded. cytotoxicity (ic50) was defined as the drug concentration that reduced cell viability to 50% of the untreated control. the ic50 values were calculated by graphpad prism 5 software (la jolla, ca). cells grown on tissue culture plates were washed three times with ice - cold pbs and solubilized in ice - cold extraction buffer (50 mm triscl ph7.5, 150 mm naoh, 0.5% np-40, 1 mm dtt, 0.25% sodium deoxycholate, 1 mm edta ph8, 1 mm naf, 1 mm sodium vanadate, and 1 mm pmsf). total protein was released from the cells by repeated freeze thawing and centrifugation (16,000 rpm, 4 c, 5 min). in each sample, protein concentration was estimated by the bradford method, and protein (25 g total) was denatured and allowed to separate in 10% sds page. the acrylamide gel was transferred to a nitrocellulose membrane using the iblot system (invitrogen). the membrane was first treated with blocking solution for 4 h (tbs - t supplemented with 5% nonfat dry milk) and then incubated with anti - ctr1 antibody (1:2,000) or anti - gapdh antibody (1:25,000) in 1% tbs - t at 4 c overnight. the following day, the membrane was washed with tbs - t, and incubated with hrp - conjugated igg secondary antibody (1:20,000) for 90 min. statistical significance of the experimental results was calculated by the two - sample t test using prism 5 (graphpad, la jolla, ca). to determine the rate of initial drug uptake, llc - pk1 (p - gp nonexpressing) and llc - mdr1-wt (wild type p - gp expressing) cells were incubated with increasing concentrations of [h]nsc73306 for 5 min. the initial drug accumulation rate of llc - pk1 cells was 1.36 0.2 pmol mg min, and for p - gp - expressing llc - mdr1-wt cells it was 1.58 0.1 pmol mg min. there was no statistically significant difference in the initial drug accumulation rates between these two cell lines (figure s1 in the supporting information). this lack of difference between p - gp - expressing and parental cell lines was also confirmed in kb-3 - 1 and kb - v1 cells (figure 3d). as there was no significant difference in [h]nsc73306 accumulation between llc - pk1 and llc - mdr1-wt cells, we screened for small molecules that inhibit the uptake of nsc73306 into llc - pk1 cells. llc - pk1 cells were incubated with [h]nsc73306 for 5 min in the presence of various compounds (figure 1). we found that cisplatin (100 m), cyclosporin a (1 mm), and verapamil (1 mm) significantly inhibited [h]nsc73306 uptake (figure 1a). however, we found that the p - gp inhibitors tariquidar (100 nm) and dcpq (100 nm), the mrp inhibitor mk571 (50 m), the bcrp inhibitor ftc (20 m), and the slc uptake transporter inhibitors pyrilamine (1 mm), quinidine (1 mm), tetraethylammonium (tea) (1 mm), cimetidine (1 mm), and trimethoprim (1 mm) had no effect on [h]nsc73306 uptake (figure 1a). the p - gp substrates doxorubicin or paclitaxel also did not inhibit [h]nsc73306 uptake. other than drug transporter substrate / modulators, we tested whether [h]nsc73306 uptake is dependent on sodium or calcium. uptake studies were performed in sodium - free or calcium - free transport buffers. a significant drop in [h]nsc73306 accumulation was observed when cold nsc73306 was added, suggesting saturable uptake of [h]nsc73306. (a) [h]nsc73306 (25 pmol / ml) was incubated with llc - pk1 cells for 5 min following cell lysis and scintillation counting. the relative [h]nsc73306 accumulation after cells were treated with [h]nsc73306 and dmso was calculated. (b) [h]nsc73306 accumulation in llc - pk1 cells with various concentrations of verapamil (up to 1 mm). (c) [h]nsc73306 accumulation in llc - pk1 cells treated with various concentrations of cyclosporin a (up to 1 mm). (d) time course [h]nsc73306 accumulation assay in the presence of cyclosporin a (0.5 mm) (black line). for control experiments, (a) determination of ic50 of cisplatin after [h]nsc73306 accumulation in llc - pk1 cells and kb-3 - 1 cells. cells were treated with various concentrations of cisplatin for either 5 min (llc - pk1 cells) or 3 min (kb-3 - 1 cells). (b) inhibition of accumulation of [h]nsc73306 in llc - pk1 and llc - pk1-mdr1 cells. cells were incubated with cisplatin (gray bars) or dmso (black bars) for 5 min, and the relative [h]nsc73306 accumulation in the dmso - treated llc - pk1 cells was calculated. (c) [h]nsc73306 uptake can be inhibited by cisplatin but not carboplatin or oxaliplatin. cells were preincubated (gray) or coincubated (black) with [h]nsc73306 and platinum drugs. each point in the plot represents an average cell number from 3 independent experiments. cell lysates were extracted after transfection for 24 h. the presence of endogenous ctr1 and ctr1-gfp proteins was detected by immunoblotting using a polyclonal anti - ctr1 antibody. accumulation of drug in control cells and ctr1-overexpressing cells was estimated. at each time point, the drug accumulation relative to time 0 was determined. (c) knockdown of ctr1 in kb-3 - 1 and kb - v1 cells. immunoblot by ctr1 antibody showing the presence of ctr1 in mock - transfected kb-3 - 1 and kb - v1 and ctr1 sirna - transfected kb-3 - 1 and kb - v1 cells. results of the same immunoblot with low exposure and high exposure are shown. (d) drug accumulation assay showing [h]nsc73306 accumulation in kb-3 - 1 and kb - v1 with ctr1 knockdown cells. the cells were incubated with [h]nsc73306 for 3 min, and the relative drug accumulation values with mock - transfected cells were determined. results are mean sd of 3 independent experiments. to characterize further the inhibitory effect of cyclosporin a, verapamil, and cisplatin, the half maximal inhibitory concentrations (ic50s) of [h]nsc73306 cell uptake were determined. the ic50 of verapamil against [h]nsc73306 uptake was 0.7 0.1 mm (figure 1b), and that of cyclosporin a was 0.5 0.05 mm (figure 1c). the time course of [h]nsc73306 uptake revealed that, in the presence of cyclosporin a (0.5 mm), [h]nsc73306 uptake was lower at all time points (compared with dmso control) and the maximum reduction in [h]nsc73306 uptake was 62% (figure 1d). there were no significant differences between inhibitor - treated llc - pk1 and llc - mdr1-wt cells (not shown). these results showed that the ic50 values of verapamil and cyclosporin a are much higher than the amount required to inhibit p - gp function (20 m), suggesting that inhibition of nsc73306 uptake by these compounds may involve other mechanisms that are yet to be identified. cisplatin inhibited [h]nsc73306 uptake in a concentration - dependent manner (figure 2a). the ic50 of cisplatin to inhibit [h]nsc73306 uptake was 77 2 m for llc - pk1 cells and 128 40 m for kb-3 - 1 cells, suggesting that this inhibitory effect is not a cell - specific effect (figure 2a). uptake of [h]nsc73306 in llc - pk1 and llc - mdr1-wt cells in the presence and absence of cisplatin were evaluated. coincubation of 100 m cisplatin and [h]nsc73306 equally reduced [h]nsc73306 uptake in both cell lines (figure 2b). in addition to cisplatin, a pt - containing anticancer agent, we sought to explore whether other pt - based compounds could share similar inhibitory effects. both 1 mm carboplatin and 250 m oxaliplatin had no statistically significant effect on [h]nsc73306 uptake (figure 2c), suggesting that the inhibitory effect of [h]nsc73306 on platinum drug uptake is dependent on the nature of the platinum compound. also, preincubation of cells with cisplatin, carboplatin, and oxaliplatin did not affect the ic50 (figure 2c). the incomplete inhibition of uptake is consistent with a transporter - facilitated component of uptake, and a passive component. since [h]nsc73306 uptake and function could be modulated by cisplatin, we decided to investigate whether these two compounds share a common uptake pathway. given cisplatin s association with ctr1-mediated uptake, we hypothesized that ctr1 might play a role and therefore examined the effect of this cu transporter on the cellular accumulation of nsc73306. cos7 african green monkey kidney cells were used for this experiment because they have low endogenous ctr1 expression. cells were transfected with gfp - tagged human ctr1 cdna, resulting in expression of recombinant protein (figure 3a). in cells overexpressing ctr1, higher [h]nsc73306 uptake was observed (figure 3b). at 45 min, [h]nsc73306 uptake was 36% higher in ctr1-overexpressing cells (figure 3b). in another experiment, we examined drug accumulation in cells treated with ctr1 sirna. we used kb-3 - 1 (p - gp negative) and kb - v1 (p - gp positive) human adenocarcinoma cell lines because they express human ctr1 protein (vide infra, figure 7a). western blot analysis confirmed that transfection of ctr1 sirna reduced ctr1 levels in kb-3 - 1 and kb - v1 cells (figure 3c). drug uptake experiments showed that ctr1 sirna treatment of kb-3 - 1 and kb - v1 cells reduced [h]nsc73306 accumulation by approximately the same amount (figure 3d). we further wanted to determine if cisplatin - resistant cell lines showed cross - resistance to nsc73306, as cisplatin resistance is associated with a decrease in ctr1 protein in small cell lung cancer cells (sclcs). western blot analysis showed that the kb - cp20 cell line, which is highly resistant to cisplatin, expresses more ctr1 protein than the kb-3 - 1 cells (figure 4a, left). however, cisplatin - sensitive kb-3 - 1 cells express amounts of ctr1 comparable to cisplatin - resistant kb - cp.5 cells. in the liver cancer cell line bel-7404-cp20, which is highly resistant to cisplatin, ctr1 overexpression was also observed. ctr1 was not detected in the parental cell line, bel-7404, or in its subline bel-7404-cp1, with lower - level cisplatin resistance (figure 4a, right). (a) immunoblot showing the level of ctr1 protein in kb-3 - 1, kb - cp.5, kb - cp20, bel-7404, bel-7404-cp1, and bel-7404-cp20 cells (b) [h]nsc73306 accumulation in kb-3 - 1 and kb - cp20 cells. (c) [h]nsc73306 accumulation in kb-3 - 1, kb - cp20, and kb - cp20 cells treated with scrambled sirna or ctr1 sirna. (d) sensitivity of kb-3 - 1, kb - cp.5, and kb - cp20 cells to nsc73306. cells were incubated with increasing concentrations of nsc73306 for 72 h at 37 c. the function of ctr1 with respect to nsc73306 in cisplatin - resistant cells was examined by drug uptake assays. kb - cp20 cells showed a 2.1-fold increase in [h]nsc73306 uptake relative to the parent line kb-3 - 1 (figure 4b). to confirm that the increase in drug uptake was caused by upregulation of ctr1, we also determined the uptake of [h]nsc73306 in kb - cp20 cells transfected with ctr1 sirna. in ctr1 knockdown kb - cp20 cells, a significant reduction of nsc73306 uptake was observed (figure 4c). ctr1 knockdown cells showed drug accumulation comparable to that of kb-3 - 1 cells. control kb - cp20 cells transfected with scrambled sirna also had decreased drug accumulation, suggesting that some of the reduction in nsc73306 uptake may be caused by the sirna transfection method. since ctr1 levels are upregulated in kb and bel-7404 cisplatin - resistant cells, we examined whether the cellular toxicity of nsc73306 could be enhanced by the high levels of ctr1 in cisplatin - resistant cells. as noted earlier, cytotoxicity assays showed that the nsc73306 ic50 values of the kb-3 - 1, kb - cp.5, and kb - cp20 cells were not significantly different, suggesting that the cytotoxic effect of nsc73306 in cisplatin - resistant cells is not dependent on total intracellular nsc73306 levels (figure 4d). the correlation of p - gp expression and function with nsc73306 cytotoxicity in llc - pk1 cells was assessed, using a wild - type p - gp - expressing stable cell line (llc - mdr1-wt) and a functional mutant p - gp - expressing stable cell line (llc - mdr1-eq). the ic50 values of nsc73306 to llc - pk1, llc - mdr1-wt, and llc - mdr1-eq cells were 4.7 2.0 m, 0.9 0.2 m, and 4.5 1.0 m, respectively (figure 5a). the selectivity ratio (sr) of nsc73306 killing llc - mdr1-wt cells over parental llc - pk1 cells was 5.4-fold (figure 5a), which was comparable to other cell line pairs that we reported. sensitivity of nsc73306 requires functional p - gp and loss of nsc73306 sensitivity in llc - mdr1-wt cells upon cisplatin treatment. llc - pk1 cells were treated with increasing concentrations of nsc73306 in 37 c for 72 h following mtt assay. (b) the llc - pk1 and llc - mdr1-wt cells were treated with various concentrations of nsc73306. llc - mdr1-wt cells were treated with 0, 5, 10, or 40 m of cisplatin. each point in the plot represents an average cell number from 3 independent experiments. we further examined whether cisplatin could influence the hypertoxicity of nsc73306 in cells expressing p - gp. llc - mdr1-wt cells were treated with increasing concentrations (5 m, 10 m, and 40 m) of cisplatin for 72 h. as expected, in the absence of cisplatin, llc - mdr1-wt cells showed 4-fold lower ic50 values for nsc73306 than the llc - pk1 cells (figure 5b). however, coincubation of cisplatin in llc - mdr1-wt cells reversed their hypersensitivity to nsc73306 in a dose - dependent manner. in the presence of 40 m cisplatin, the ic50 of llc - mdr1-wt cells was 76% that of llc - pk1 cells (figure 5b). to determine if ctr1 could be regulated by nsc73306, we analyzed ctr1 levels after drug treatment. hek293 human embryonic kidney cells, known to express ctr1, were treated with increasing concentrations of nsc73306. as negative feedback mechanisms of ctr1 in response to cu and cisplatin have been reported, we sought to explore whether nsc73306 could also reduce ctr1 expression. as control experiments, cells exposed to cisplatin (cddp) for 1 h or copper (cucl2) for 3 h produced lower ctr1 levels, as expected (figure 6a). after 24 h, treatment with nsc73306 reduced the ctr1 level in a dose - dependent manner (figure 6b). as gapdh levels were slightly affected by nsc73306, the relative ctr1 level was calculated by densitometry analysis. reduction in ctr1 levels was observed at even the lowest nsc73306 concentration tested (1 m). in cells treated with 10 m nsc73306, the ctr1 level was reduced by 63%, which was comparable to the effect of cisplatin (60% reduction). ctr1 levels in cells treated with nsc73306 for 3 h were not affected (figure s2 in the supporting information). (a) hek293 cells were treated with different concentrations of nsc73306 at 37 c for 24 h following cell lysis and immunoblotting. as a positive control, cells were treated with cisplatin (5 m) and cucl2 (100 m) for 3 h. the presence of ctr1 was detected by polyclonal anti - ctr1 antibody. the same blot was labeled with gapdh antibody, serving as a loading control. (b) the ctr1 level in each sample was analyzed by imagej software and displayed as a bar chart. change in ctr1 level relative to control was determined by densitometry analysis. statistical significance between nsc73306-treated cells and the control cells sd of 3 independent experiments. to examine whether overexpression of p - gp modulates ctr1 levels, we tested for the presence of ctr1 in drug - resistant cell lines and recombinant cell lines. we found that ctr1 protein levels were not significantly different between kb-3 - 1 and kb - v1 cells, the latter expressing a high level of p - gp (figure 7a). in llc - pk1, llc - mdr1-wt, and llc - mdr1-eq cells, ctr1 levels were also unaltered (figure 7b). conversely, p - gp levels did not change in kb - v1 cells overexpressing ctr1-gfp, as determined by western blot analysis with anti - p - gp monoclonal antibody (c219) (figure 7c). immunoblots showing ctr1, p - gp, and gapdh levels in (a) kb-3 - 1 and kb - v1 cells and (b) ctr1 and gapdh levels in llc - pk1, llc - mdr1-wt, and llc - mdr1-eq cells. (c) transient overexpression of the ctr1 gene does not change p - gp level. protein lysate from p - gp negative kb-3 - 1 cells, p - gp positive kb - v1 cells, and kb - v1 cells overexpressing ctr1-gfp protein were analyzed in an immunoblot labeled with anti - p - gp antibody (c219). since cellular ctr1 levels affect intracellular levels of nsc73306 and vice versa, we examined whether the cytotoxicity of nsc73306 could be affected by ctr1 levels. transfection of kb-3 - 1 and kb - v1 cells with ctr1 sirna resulted in a 25% reduction of ctr1 protein. scrambled sirna and ctr1 sirna - transfected cells were incubated with nsc73306 for 72 h, and then ic50 values were determined by mtt assay. as expected, mock control and control scrambled sirna - transfected kb - v1 cells showed higher sensitivity to nsc73306 than similarly treated kb-3 - 1 cells. ctr1-sirna treatment only slightly decreased ic50 values in both kb-3 - 1 (from 10.9 0.04 m to 7.9 0.02 m) and kb - v1 cells (from 3.3 0.04 m to 1.7 0.04 m) (table 1). this slight decrease might be due to the toxicity mediated by sirna transfection. in another experiment, we sought to compare the effect of nsc73306 in kb-3 - 1 and hek293 cells overexpressing ctr1. we used hek293 cells that express low levels of p - gp instead of kb - v1 cells, because overexpression of ctr1 in kb - v1 cells resulted in cell death (not shown). compared with the kb-3 - 1 cells, hek293 cells showed higher sensitivity to nsc73306 (ic50 10.9 0.04 m vs 4.42 0.03 m), possibly due to endogenous p - gp expression. however, when compared with the mock and ctr1-gfp transfected hek293 cells, they showed similar cytotoxicity. in addition, the ic50s were evaluated for cells incubated with nsc73306 for an extended period of time and we found no significant differences. similarly, nsc73306 cytotoxicity was not significantly different in mock - transfected kb-3 - 1 cells and ctr1-gfp - transfected kb-3 - 1 cells (table 1). these results indicate that while ctr1 levels affect uptake of nsc73306 (figure 3), in the absence of p - gp, they do not correlate with toxicity of nsc73306. cells were incubated with increasing concentrations of nsc73306 at 37 c for 72 h. ic50 values were determined by survival curves obtained using mtt assays. in this work, a search was conducted for molecules that could inhibit cellular uptake of nsc73306, a compound that specifically kills p - gp - expressing cells. at physiological ph, nsc73306 is neutral, lipophilic (clogp = 2.02) and likely capable of passive diffusion. we found that its uptake in the nm range is saturable and inhibited by cisplatin, verapamil, and cyclosporin a. therefore, we hypothesized that nsc73306 could be transported by the cu and cisplatin uptake transporter ctr1 (verapamil and cyclosporin a are not known to be substrates of ctr1), and we show here that cellular uptake of the drug is modulated by levels of ctr1. ctr1 is a cu uptake transporter that mediates cu homeostasis and is expressed in many human tissues. it is essential for embryonic development, and knockout of both alleles of ctr1 in the mouse produces an embryonic lethal phenotype. the functional unit of ctr1 is a homotrimeric complex with each monomer containing 190 amino acid residues, spanning the cell membrane. electron crystallographic analysis of human ctr1 shows that the complex forms a cone - shaped structure with a narrower extracellular pore (8) and a wider intracellular pore (22). human ctr1 has also been found to transport silver and regulates platinum (pt) drug uptake (reviewed by liu.). as such, ctr1 influences the cytotoxicity of pt - based drugs including cisplatin, carboplatin, and oxaliplatin. yeast and mammalian cells that do not express ctr1 are more resistant to cu and pt drugs, whereas overexpression of ctr1 increases drug uptake and increases drug sensitivity. exposure of cells to cisplatin causes a rapid reduction in ctr1 protein, and this can be triggered by a low concentration of the drug. although it is known that ctr1 mediates cisplatin uptake, the mechanism of pt translocation into cells by ctr1 remains to be defined. our results indicate that [h]nsc73306 uptake is inhibited by cisplatin and by cold nsc73306 in the micromolar range (77 2 m and 7.1 1 m). however, to inhibit [h]nsc73306 uptake, 10-fold higher concentrations of cisplatin were required as compared to cold nsc73306, suggesting that the drug uptake pathway of nsc73306 may partially overlap with the uptake pathway of cisplatin. also, [h]nsc73306 uptake can be inhibited by cisplatin but not by other pt drugs such as carboplatin and oxaliplatin. others have reported that ctr1 is able to transport cisplatin, carboplatin, and oxaliplatin, although the kinetics of these compounds are different. there is still no consensus on exactly how pt drugs or cu enter the cell via ctr1. several reports have strongly suggested that the coordination of cisplatin with ctr1 is very different from its coordination with cu. human ctr1 includes a long stretch of extracellular domain rich in methionine and histidine. mutagenesis and truncation studies have revealed that several amino acid residues critical to regulation of cu uptake do not affect pt drug transport. because of this, alternative modes of pt drug transport by ctr1 have been proposed. proposed that the methionine residues of the extracellular domain of ctr1 cooperatively assist pt drug uptake. the results of our drug inhibition experiments suggest that the transport of nsc73306 via ctr1 might be different from pt or cu transport mechanisms. also, uptake studies and cytotoxicity studies of copper and pt drugs are not included. further analysis will be needed to determine the functional effects of ctr1 transport of nsc73306 and pt drugs or cu, and also the critical amino acids / motifs required for nsc73306 transport. ctr1 has been known to regulate itself post - translationally in response to a sudden surge of substrates. our experiments confirmed that nsc73306 could reduce ctr1 expression in a dose - dependent manner. time - course experiments showed that the effect of nsc73306 is slower than that of cisplatin or cu. however, the molecular mechanism of this downregulation by nsc73306 is not clear. in mammalian cells, cisplatin- and cu - induced downregulation of ctr1 involves non - clathrin - mediated endocytosis followed by formation of ubiquitinated intermediates and degradation in the 26s proteasome. in yeast, the copper ion - sensing transcription factor mac1p post - translationally controls the degradation of yeast ctr1, ctr1p. however, our findings suggest that ctr1-mediated nsc73306 uptake in mammalian cells is regulated by a post - translational mechanism involving drug - stimulated degradation of the transporter. this study confirms that nsc73306 requires the presence of functional p - gp in order to increase cytotoxicity to the cell. our results demonstrate that there is no direct relationship between ctr1 expression and p - gp expression. in the llc - mdr1-wt cells, no statistical significance was found when we compared [h]nsc73306 uptake in drug - sensitive kb-3 - 1 and llc - pk1 and drug - resistant kb - v1 and llc - mdr1-wt cell lines. these results indicate that [h]nsc73306 import is independent of p - gp, a drug efflux transporter, and that the intracellular level of nsc73306 does not correlate with cytotoxicity. this can be understood if one considers that the [h]nsc73306 uptake assay is done using low nm concentrations of nsc73306, while its toxicity occurs in the low m range (a difference of 3 orders of magnitude), where uptake is likely to be diffusion - limited and not carrier dependent. this is consistent with a previous publication showing that nsc73306 interacts with the major abc multidrug transporter abcg2. although nsc73306 alone can not sensitize abcg2-expressing cells, it can reduce abcg2-mediated drug transport of other known abcg2 substrates including mitoxantrone. in the current study, we found that a slc transporter such as ctr1 could influence cellular drug uptake of nsc73306. the concentration of nsc73306 in the cell lines we tested was affected by the presence of cisplatin or a change in ctr1 protein level. however, in the absence of p - gp, ctr1 itself could not change cellular sensitivity to nsc73306. together with abcg2, ctr1 is involved in the drug transport pathway, but not the cell killing pathway of the drug nsc73306. in this study, elevated ctr1 levels were found in two cell lines highly resistant to cisplatin, kb - cp20 (cervical adenocarcinoma, a hela subclone) and bel-7404-cp20 (hepatoma) cells. these cells have different cellular origins, suggesting that the effect is not cell - type specific. however, we did not observe changes in ctr1 expression in cell lines only moderately resistant to cisplatin, which is in agreement with a previous study. our results indicate that expression of ctr1 in cells shows three responses to cisplatin. short - term drug exposure results in decreased ctr1 levels resulting from rapid degradation. but ctr1 levels do not vary after long - term drug exposure and selection of cisplatin - resistant cells compared with control parental cells. western blot analysis confirmed that ctr1 levels in low - level cisplatin - resistant cells were very similar to those of the parental cells, suggesting that inhibition of drug uptake by shutting down drug transporters is replaced by another signaling mechanism, perhaps because a supply of cu is essential. the exact mechanism that leads to higher ctr1 levels in highly cisplatin - resistant cells is not clear, but may be the result of mislocalization or a defect in post - translational modification that allows cells with such high levels of resistance to survive in cisplatin. we have shown that these cells accumulate less pt than parent cells, consistent with the expected resistance phenotype, but not consistent with the expected facilitation of pt uptake by ctr1. we can not rule out the possibility that the ctr1 protein found in kb - cp20 and bel-7404-cp20 cells is folded differently, so as to change its function, perhaps as a result of altered post - translational modification. while ctr1 levels were significantly increased in two highly cisplatin - resistant cell lines (kb - cp20 and bel-7404-cp20), mtt assays showed that the kb - cp20 cells were not sensitized to nsc73306, in keeping with our other results showing no correlation between ctr1 levels and nsc73306 cytotoxicity. in summary, this study demonstrates that uptake of the thiosemicarbazone nsc73306 is affected by levels of ctr1, an slc transporter. our data strongly suggest that, at nm concentrations, nsc73306 transport is dependent on ctr1 level and can be inhibited by the ctr1 substrate cisplatin. the connection between p - gp, ctr1, and nsc73306 provides important clues to the mechanism of p - gp sensitizing drugs that confer collateral sensitivity. | acquired drug resistance in cancer continues to be a challenge in cancer therapy, in part due to overexpression of the drug efflux transporter p - glycoprotein (p - gp, mdr1, abcb1). nsc73306 is a thiosemicarbazone compound that displays greater toxicity against cells expressing functional p - gp than against other cells. here, we investigate the cellular uptake of nsc73306, and examine its interaction with p - gp and copper transporter 1 (ctr1, slc31a1). overexpression of p - gp sensitizes llc - pk1 cells to nsc73306. cisplatin (ic50 = 77 m), cyclosporin a (ic50 = 500 m), and verapamil (ic50 = 700 m) inhibited cellular accumulation of [3h]nsc73306. cellular hypertoxicity of nsc73306 to p - gp - expressing cells was inhibited by cisplatin in a dose - dependent manner. cells transiently expressing the cisplatin uptake transporter ctr1 (slc31a1) showed increased [3h]nsc73306 accumulation. in contrast, ctr1 knockdown decreased [3h]nsc73306 accumulation. the presence of nsc73306 reduced ctr1 levels, similar to the negative feedback of ctr1 levels by copper or cisplatin. surprisingly, although cisplatin is a substrate of ctr1, we found that ctr1 protein was overexpressed in high - level cisplatin - resistant kb - cp20 and bel7404-cp20 cell lines. we confirmed that the ctr1 protein was functional, as uptake of nsc73306 was increased in kb - cp20 cells compared to their drug - sensitive parental cells, and downregulation of ctr1 in kb - cp20 cells reduced [3h]nsc73306 accumulation. these results suggest that nsc73306 is a transport substrate of ctr1. |
increase in the prevalence of neurodegenerative diseases and neural damage has caused the scientists to search for various approaches such as cell therapy to improve the neurogenesis techniques. a lot of investigations confirmed the presence of adult stem cells in various tissues including breast milk. breast milk contains a heterogeneous cell population ; besides, a subpopulation with stem cell properties including the ability to be differentiated into different cell lineages has been isolated from fresh human milk [2, 3 ]. a bipotential stem cell with the differentiation capacity into mammary epithelial cell and myoepithelial cells has been detected in mammary gland tissue. maternal mammary stem cells have been considered as one of the cell sources in breast milk. the presence of exfoliated epithelial cells from alveoli, macrophages, and lymphocytes was also reported [6, 7 ]. it has been also reported that 1015% of the cells isolated from fresh breast milk expressed mesenchymal stem cell (msc) markers and culturing the isolated cells led to an increase in the msc population due to their higher capacity of cell proliferation. the presence of a nestin - positive subpopulation was also reported in the breast milk - derived cells ; however, the frequency of these cells was low [8, 9 ]. previous studies identified the presence of activated mammary stem cell (masc) in breast milk through staining cells for masc markers. hassiotou. named these cells as human breast - milk stem cells (hbscs). their results demonstrated that these stem cells have a capability to be differentiated into mammary cells (luminal and myoepithelial). furthermore, they determined the expression of a group of embryonic stem cell- (esc-) associated genes such as oct4, klf4, nanog, and sox2 in hbscs. also, it has been reported that the phenotype, colony morphology, and differentiating capability of hbscs are similar to those in esc [3, 10 ]. consequently, as breast milk contains these special pluripotent stem cells, it can be utilized as a valuable and a new easily available source for regenerative medicine [3, 10 ]. the presence of nestin - positive cell population and also a subpopulation of expressed esc markers in breast milk caused this noninvasive source of stem cells to be considered as a good candidate for differentiation into neural cell lineage. it has been demonstrated that the common regulators play role in the development of both mammary gland and neuroepithelium, and these regulators are also involved in escs differentiation and self - renewal. these common embryonic origins and also common regulators may suggest breast milk - derived cells as a good source for neural cell lineages differentiation. previous studies reported that neural stem cells showed the capability to be differentiated toward neuronal cells [12, 13 ]. they may be considered as an appropriate source for cell replacement therapies (crts) of the brain diseases. however, there have been various reports which show the risks of neural stem cell application for the patients including tumor formation, insufficient migration, immune rejection, surgical threats, and transmission of infections possibility during transplantation. besides, neural stem cell isolation is invasive. therefore, finding an alternative stem cell source is essential to overcome such issues and barriers. the pluripotency of the breast milk - derived cells was evaluated by exposing the cells to various culture conditions. the cells treated with neurogenic medium expressed nestin and tubulin which indicated the cell differentiation into neural progenitor cell and neuron - like cells, respectively. this study tried to find the breast milk - derived cell ability to be differentiated into three neural cell lineages, neurons, astrocytes, and oligodendrocytes. also, the current study showed that the breast milk - derived cell behaved in a similar way to neural stem cells in vitro. this study was approved by the ethics committee of shiraz university of medical sciences, and all participants provided informed written consent. women, who were healthy breastfeeding participants, submitted informed written consent prior to sample collection. in aseptic procedures, mature breast milk (5200 ml) disinfected phosphate buffered saline (pbs) (ph 7.4, gibco) equal volumes were used to dilute the breast milk and they were centrifuged for 20 minutes at 20c at 805 g. then, skim milk liquid component and fat layer were taken out. in pbs, after that, the cell pellet was resuspended in 10% fetal bovine serum (fbs, certified, invitrogen) within pbs (blocking buffer). to determine each sample 's cell viability and cell concentration, breast milk cells (40000 cells / ml) were cultured in plates coated with gelatin. they were incubated at 5% co2 and 37c ; also, the media were changed daily. after 5 days of culturing, each colony was separately selected and relocated in new dishes and cultured in medium in order to make feeder culture of the second and third ones. furthermore, ultralow binding plates were used to seed cells on them to have spheroid culture and the es media (dmem / f12, kosr (knockout serum replacement) 10%, nonessential amino acid 1%, bfgf 10 g / ml, and pen / strep 1%) were added to the plates. whenever the cells needed to be passaged, they were trypsinized (gibco) at 37c in 5 minutes and were divided to 1 : 2. some embryonic and mesenchymal stem cell markers antibodies such as nanog, oct4 (abcam ab19857 1 : 500), sox2, cd44 (abcam ab119863 1 : 500), cd105 (abcam ab44967 1 : 250), cd106 (abcam ab19569 1 : 500), cd90 (abcam ab225 1 : 250), and cd133 (millipore mab4399) were used to characterize the isolated cells from human breast milk by immunocytochemistry method. briefly, the cultured cells were fixed by paraformaldehyde 4% in 4c for 20 minutes ; after washing with pbs, primary antibodies were diluted in pbs containing 0.3% triton and 5% goat serum and the samples were kept in room temperature for 60 minutes. after that, washing with pbs was performed for 3 times. then secondary antibodies were added and, after 45 minutes of incubation in room temperature, the last washing with pbs was done. the isolated cells were cultured in gelatin coated plates with concentration of 10000 cells / cm with dmem / f12, 1% b27, and 2% n2 for 710 days. these spheres were separated and passaged in a different plate using dmem / f12 containing b27, n2, bfgf 10 g / ml, and egf 20 g / ml (ns - a media). then, the spheres were formed and each cell of these spheres was capable of providing another sphere by passaging. for neural stem cells identification, immunocytochemistry was performed for nestin antibody (millipore, ab5922) on neurospheres and cd133 (millipore mab4399) for neural stem cells with protocol mentioned above. neural stem cells (nscs) (5000 cells / ml) were seeded in poly - l - ornithine - coated culture dishes to be differentiated into neuron, oligodendrocyte, and astrocyte. for differentiation, bfgf and egf were removed from the media and fcs 5% was added to them and after 5 days the differentiated neural stem cells provided neurons, oligodendrocytes, and astrocytes. for neuron, oligodendrocyte, and astrocyte detection, antibodies, -tubulin iii (promega g7121, 1 : 2000), o4 (millipore, mab345 1 : 50), and gfap (dakocytomation, code number z0334 1 : 500), respectively, were assessed by an immunocytochemistry method similar to the one previously described. to detect the cells ' nucleus, they were fixed with paraformaldehyde 4% and then 4,6-diamino-2-phenylindole dihydrochloride (millipore s7113 1 : 1000) was added to the fixed cells and they were kept in room temperature for 30 minutes. the isolated breast - milk - derived cells were adherent to the plates and their morphology was similar to the cells of myoepithelium of the breast (figure 1). they were cultured to the 10th passage and after each passage the provided cells were capable of proliferating and kept their expansion potential. the immunohistochemistry staining showed a subpopulation of breast milk - derived cells that expressed embryonic stem cells markers such as nanog (66.2% 6.52), oct4 (42.9% 6.99), and sox2 (57.3% 7.74) (figure 2). a subpopulation of the isolated cells also expressed markers that were also detected on the surface of mesenchymal stem cells including cd44 (67% 10.7), cd105 (68.3% 3.91), cd106 (8.4% 2.36), and cd133 (2.76% 1.93). table 1 summarizes the frequency of the positive cell for each marker. after exposing the breast - milk stem cells to ns - a media (dmem / f12, n2, b27, bfgf, and egf) for 5 days, they formed shiny, floating, sphere - like cell aggregations, neurospheres, measuring about 100 m in diameter (figure 3). the enzymatically dissociated neurospheres showed the capability of forming a new sphere within 57 days. in addition, the cells kept their sphere - forming ability till the 8th passage without any significant change in their sphere - forming frequency (figure 8). a small subpopulation of the breast milk - derived cells expressed nestin (7.4% 3.30) and cd133 (2.76% 1.93) as markers for neural stem cells. the frequency of the nestin - positive (58.20% 6.71) (figures 6 and 9) and cd133-positive (58.74% 3.36) (figures 7 and 10) cells was increased significantly after exposing the cells to neurogenic media and neurosphere formation. the behavior of the nestin - positive breast milk - derived cells treated with neurogenic media, including the formation of spheroid aggregates, was similar to the neural stem cells. the most important characteristic for specification of neural stem cells is their ability to produce three neural lineages consisting of neurons, oligodendrocytes, and astrocytes. differentiated astrocytes showed a flat or polygonal cell body with several processes. after adding 5% fetal bovine serum, removing growth factors (bfgf and egf), to the cells for 5 days, the neural stem cell - like cells proliferated and attached to the plate totally and their appearances were completely changed into three neural cell lineages (figure 4). to detect neurons, the expression of neuronal marker, -tubulin iii, was evaluated. the percentage of the tubulin iii was 19% 2.44 of the cells treated with neurogenic media. for detection of oligodendrocyte, anti - o4 antibody was used and the frequency of the o4-positive cells was 14.31% 2.31 ; and for detection of astrocytes, anti - gfap antibody was administrated and it was shown that 66.69% 7.50 of the cells were astrocytes (figure 5, table 2). therefore, breast milk cells have been suggested to be used for treating neonatal disorders. breast - milk stem cells have been previously demonstrated to express nestin, a neuroectoderm marker ; however, a few samples contained the cells expressing neurofilament, a late neural differentiation marker. the presence of nestin - positive cells indicated that the breast - milk stem cells can be an appropriate candidate for differentiation toward neurons or neuroglia. the results of the current study revealed that the exposure of the whole cell population of breast milk to neurogenic medium led to an increase in the presence of nestin - positive cells and that the cell behavior in neurosphere formation is the same as what happened in the culture of neural stem cells. further differentiation of nestin - positive cells into the neuron as well as neuroglia was shown in this study as indicated by the presence of cells that expressed -tubulin as neuron marker, o4 as oligodendrocyte marker, and gfap as astrocyte marker. several studies also showed that nestin - positive cells were derived from the neurosphere of the neural stem cells isolated from the avian species, mouse embryo, adult mouse, and human and differentiated into three neural lineages. it seems that the cells derived from breast milk were differentiated in the same way as in the case of neural stem cells. mesenchymal stem cells derived from human adipose tissue [25, 26 ], bone marrow, muscle, and umbilical cord have been shown to be able to be differentiated toward neuron - like cells. neuron - like cells differentiated from wharton jelly of the umbilical cord were also transplanted to the app / ps1 mouse. the transplantation improved the cognitive reactions of the mouse and decreased the level of amyloid -peptides deposition. human umbilical mesenchymal stem cells - derived neurospheres with bdnf were transplanted to the injured spinal cord and the morphologic and functional recoveries have been demonstrated. these data indicated that nonneural stem cells may be functional when they were transplanted to the animal models. therefore, the neural - like cells or neuroglia derived from breast milk also may be as effective as those derived from the other sources ; however, it needs further investigations. our results indicated that breast milk - derived stem cells express embryonic cell markers such as nanog, oct4, sox2, seea4, and tra 160/81. embryonic stem cells have a great potential to be differentiated toward neural cell lineages [31, 32 ]. the stability in electrical phenotype of stem cell - derived neuron has been shown previously, revealing that the differentiated cells may be functional. the transplanted mesenchymal stem cells in cns has been shown they are capable to survive and differentiate to neural lineages. the breast milk - derived stem cells showed the capability to be differentiated into neural cell lineages and their similarity to both embryonic and mesenchymal stem cells makes them a good candidate for cell therapy in neurodegenerative diseases. as the isolation of neural stem cells is an invasive procedure, using breast milk - derived cells as a source of cell therapy may be preferable especially for the patients in child - bearing ages. however, the physiological test and also in vivo studies should be done to ensure that the cells do not dedifferentiate and are functional when they are transplanted. | objectives. human breast milk contains a heterogeneous population of cells that have the potential to provide a noninvasive source of cells for cell therapy in many neurodegenerative diseases without any ethical concern. the objectives of this study were to differentiate the breast milk - derived stem cells (bmdsc) toward neural stem cells and then into the neurons and neuroglia. materials and methods. to do this, the bmdsc were isolated from human breast milk and cultured in dulbecco 's modified eagle medium / f12 (dmem / f12) containing fibroblast growth factor (bfgf). the cells were then characterized by evaluation of the embryonic and stem cell markers. then, the cells were exposed to culture medium containing 1% b27 and 2% n2 for 710 days followed by medium supplemented with b27, n2, bfgf 10 g / ml, and endothelial growth factor (egf) 20 g / ml. then, the sphere - forming assay was performed. the spheres were then differentiated into three neural lineages by withdrawing growth factor in the presence of 5% fbs (fetal bovine serum). the immunofluorescence was done for -tubulin iii, o4, and gfap (glial fibrillary acidic protein). results. the results indicated that the cells expressed both embryonic and mesenchymal stem cell (msc) markers. they also showed neurospheres formation that was nestin - positive. the cells were also differentiated into all three neural lineages. conclusion. the bmdsc can behave in the same way with neural stem cells. they were differentiated into oligodendrocytes, and astrocytes as well as neurons. |
the morphology of the human face varies with individuals and even more with races and ethnic group.1 the identification of aesthetic facial qualities began with ancient civilizations such as egyptians and greeks, who captured their ideals of facial beauty in artform.2 some of the classical greek canons of facial proportions, with modifications, are still embraced today as the basic foundation of aesthetic facial analysis. variations in facial parameters (facial anthropometry) have been studied extensively for different ethnic groups and races. for instance, oyinbo.,3 carried out normal outer and inner central measurements for the ijaws of southern nigeria and compared the result with that obtained for igbos of south eastern nigerian. they found out that there were significant differences between the two ethnic groups at p<0.05. these observed variations may be favourable or unfavourable, depending on the individual 's aesthetic preferences, as well as that of the society in which he lives. in a society focused on youth and beauty, individuals with less visible disfigurements have higher self - esteem4 and can more effectively socialize with peers and members of the opposite sex.5 perhaps this has also informed the increased attention given to aesthetic facial analysis. besides the use of direct measurements for the determination of facial proportions, photometry, which rather involves the use of photographs, has also been employed as seen in the case of powell and humphries,6 who introduced the use of the aesthetic facial triangle. extensive literature in this area is already available for north americans and europeans.6 similar studies have also been published for asians, especially in recent times. in our environment one hundred and twenty subjects aged between 18 and 28 years participated in this study. included in the study were subjects whose parents and grandparents were all of igbo ethnic origin. photographs of the front and lateral views of the subjects were taken from a distance of 1.0 - 1.5 m with 28 focus free manual camera (prestige 280s). each subject was asked to relax against a plain white background, with both hands hanging beside the trunk. the subjects position was clearly marked on the floor, and a meter rule placed by the subject to enable measurement at life size 150 cm in front of the subject. the subjects were asked to look straight into the camera with their lips relaxed so that both the front and side view profiles were taken in the natural head position. clear view of the forehead, neck, and ear were ensured with the lips relaxed. the photographs obtained were colour printed, and their facial areas were traced out using tracing paper. on the trace outs of the frontal views, the following soft - tissue points (land marks) were introduced as shown in figure 1 ; the nasion (n), subnasale (sn) and menton (mn). using the same trace - outs, landmarks on the frontal facial view n : the deepest point on the bridge of the nose overlying the centre of the suture between the nasal and frontal bones. subnasale : the point at which the base of the nose merges with the nasal cutaneous tip. menton : the lowest point of the soft - tissue skin in the sagittal plane overlying the bony menton. the vertical distances shown in figure 1, include a vertical line drawn from nto menton, and it is divided into two parts : nasion to subnasale (n - sn)/middle face. using the trace - outs of the right lateral views, the following landmarks and angles were noted and measured respectively. below are the landmarks : glabella (g) : the smooth rounded surface of the frontal bone in the middle of the forehead, between the two eyebrows [figure 2 ]. pogonion (p) : the most prominent point on the soft - tissue chin in the mid sagittal plane overlying the bony progonion [figure 2 ]. cervical (c) : the point where the neck meets with the soft tissue. the angles : nasofrontal angle (nfa) : angle formed at the point where a line drawn tangent to the glabella through the nintersects with a line drawn tangent to the nasal dorsum [figure 3 ]. nasomental angle (nma) : angle formed at the point of intersection of the line drawn through the nasal dorsum and that drawn from the nasal tip to the pogonion [figure 4 ]. mentocervical angle (mca) : angle formed at the meeting point of a vertical line drawn from the glabella to the pogonion and that drawn fromthe cervical through the soft - tissue menton. landmarks on the right lateral view computation and analysis of data from the measurements were done by microsoft excel 2007, version 10 using some simplified mathematical relations to show the measures of dispersion. computation and analysis of data from the measurements were done by microsoft excel 2007, version 10 using some simplified mathematical relations to show the measures of dispersion. the study was carried out on 120 subjects comprising adult males aged between 18 and 28 years. table 1 shows the results of the vertical distance (n - sn) and (sn - mn) of the igbo nigerian adult male in millimeters (mm). analysis of the frontal view photographs showed that the distance from n - sn varied from 10 mm to 17 mm with a mean value of 13.2 mm while that from subnasale to menton varied from 14 mm to 22 mm with a mean value of 18.4 mm. the results of the vertical distance, nasion to subnasale and subnasale to menton of the igbo nigerian adult male in millimeters table 2 shows vertical distance (n - sn) and (sn - mn) of the igbo nigerian adult male in percentage ratio (%). percentage ratio of these distance (lengths) n - sn and subnasale to menton (sn - mn) to n - mn varied from 37.9% to 48.3% with a mean value of 41.8% for n - sn and 51.7% to 62.1% with a mean value of 58.2%. vertical distancenasion to subnasale and subnasale to menton of the igbo nigerian adult male in percentage ratio (%) table 3 shows the values of the angles of aesthetic triangle i.e., nasofrontal (nf) nasofacial (nfc) [figure 5 ], nasomental (nm) and mentocervical (mc) angles of the igbo nigerian male in degrees (). angles of aesthetic triangle, i.e., nasofrontal, nasofacial, nasomental and mentocervical angles of the igbo nigerian male in degrees (%) analysis of the right lateral view photograph of the subjects showed variations in the angles of aesthetic triangle, which include ; nf, nfc, nm and mentocervical (mc) angles [figure 6 ]. nfa was observed to be the largest angle with a mean value of 134 and the values ranging from 118 to 150. this is followed by the nma with a mean value of 126 and the values ranging from 115 to 140. next to nma is the mca whose values range from 90 to 110 and has a mean value of 99. the smallest angle is the nfc with a mean value of 39 ranging from 28 to 50%. table 4 shows the comparison of mean values of vertical distances between adult nigerians and himanchali adults and north american adult males. the n - sn shows lower values for adult nigerian males while the sn - mn is higher in adult nigerian males than for the other two races. comparison of mean values of vertical distance of the igbo nigerianadult male and those of the himachali indian and north american adult males in percentage ratio (%) table 5 shows the comparison of mean values of angles of aesthetic triangle of the igbo nigerian adult male and those of the himachali indian, north american, urhobo nigerian and itsekiri nigerian adult males the results reveal that the himachali indian has the highest nf and mcas with respective values as 134 and 100, urhobo nigerian has the highest nfc angle at 40, while the itsekiri nigerian has the highest nma at 129. comparison of mean values of angles of aesthetic triangle of the igbo nigerian adult male and those of the himachali indian, north american, urhobo nigerian and itsekiri nigerian adult males photometric facial analysis has been documented by various authors.69 photometric analysis offers some advantages in terms of human profile analysis. in contrast to cephalometric analysis, angular measurements are not affected by photographic reduction.10 the use of photometric analysis makes the employment of expensive and sophisticated instruments unnecessary. leonardo da vinci divided the face into thirds namely ; from the frontal hair line to the root of the nose ; from the nasal root to nasal base ; and from the nasal base to the bottom of the chin, menton, but only the lower two - thirds were considered in this study, because the frontal hair line, which is a landmark for the first - third was absent in some of the subjects and this is consistent with the finding and method of powell and humphries (1984).6 in this study, it was discovered that the middle face (n - sn) was shorter than the lower face (sn - mn) i.e., 41.76% vs. 59.95%, which is similar to the report by jain., 2004 and powell and humphries, 1984 on the himachali indians and north americans respectively.67 our studied population, however, anibor and okumagba9 in their study stated that the aesthetic angles of the igbos are different from those of the urhobos, itsekiris, himachalians and north americans. the present study shows that the nfc angle of igbo males were similar to that of the urhobos and itsekiri and different from those of the himachali indians and north americans [table 5 ]. the nfa was also similar to those of himachali, indians, urhobos and itsekiri but were strikingly different from those of north americans. thus, the population under study was found to have a less prominent glabella than the north americans. jain.,7 stated that the nfc angle shows the degree of nose projection from the skin of the face in an individual. since the nfc angle of the igbo nigerian adult male is 38.68 [table 6 ], it shows that he has a projected nose bigger than that of the himachali and north american, but smaller compared to those of the urhobo and itsekiri of nigeria. the nma from the present study was found to be the least among the different populations [table 5 ]. this study has, therefore, shown that aesthetic angles using photometric analysis may be used as a means of racial and ethnic identification. comparison of values of the angles of aesthetic triangle of the igbo nigerian male and those of the himachali indian and north american males in degrees (%) the results of this photographic documentation as used here is the most convenient and helpful method for facial analysis. it will be particularly useful in plastic surgery to compare the pre - and post - operative results, orthodontic, anatomical modeling and for identification purposes. | background : a carefully performed facial analysis can serve as a strong foundation for successful facial reconstructive and plastic surgeries, rhinoplasty or orthodontics.aim:the purpose of this study is to determine the facial features and qualities of the igbo nigerian adult male using photometry.materials and methods : one hundred and twenty subjects aged between 18 and 28 years were studied at the anambra state university, uli, nigeria. the frontal and right lateral view photographs of their faces were taken and traced out on tracing papers. on these, two vertical distances, nasion to subnasal and subnasale to menton, and four angles, nasofrontal (nf), nasofacial, nasomental (nm) and mentocervical, were measured.results:the result showed that the igbo nigerian adult male had a middle face that was shorter than the lower one (41.76% vs.58.24%), a moderate glabella (nf=133.97), a projected nose (nm=38.68) and a less prominent chin (nm=125.87).conclusion : this study is very important in medical practice as it can be used to compare the pre- and post - operative results of plastic surgery and other related surgeries of the face. |
we present a case of an 80-year - old gentleman presenting to the emergency department with a swelling on the anterior abdominal wall in the right upper quadrant extending over the right costal margin. the swelling had developed spontaneously, was painless and increasing in size over two months. he had specifically not complained of any symptoms at all previously in this area and had no other significant medical or surgical history apart from hypertension controlled by beta blockers and thiazide diuretics. prior to admission the area had acutely become inflamed with a purulent discharge and an abscess was diagnosed. the patient showed no signs of systemic sepsis with a mildly elevated serum c - reactive protein of 55 mg / ml being the only biochemical abnormality. incision and drainage was performed and antibiotics were given. at operation a hard, smooth surfaced structure was encountered deep into the cavity, thought to be either a costal margin edge or possibly an intraperitoneal structure. ultrasonography of the area was performed postoperatively, but this was unable to define the anatomy surrounding the abscess cavity. in the postoperative period the wound continued to discharge pus, which on gram stain demonstrated leucocytes and gram - negative bacilli, culturing lactose - fermenting coliforms. from this, the possibility of a colonic component to the pathological process was raised. subsequent computerised tomography scanning of the area revealed an intraabdominal collection in front of segment iv of the liver which was extending inferiorly and pointing on to the abdominal wall where three low density structures were identified, presumed to be loculations of pus (fig. a kocher incision was made and an inflammatory mass containing the gallbladder, an edge of the duodenum and omentum was found to be adherent to the under surface of the liver and to the anterior abdominal wall. careful dissection revealed a chronic fistula from the fundus of the gallbladder to the abdominal wall measuring around 5 mm in diameter. the gallstones were smooth, firm, brown coloured structures consistent with cholesterol - based gallstones usually encountered during elective cholecystectomy. histological examination of the removed gallbladder and adherent abdominal wall demonstrated evidence of gallstone migration both microscopically and macroscopically secondary to active chronic cholecystitis. the abdominal wall section showed inflamed fibrofatty connective tissue containing gallbladder lumen and wall demonstrating fibrosis, chronic inflammation, rotitansky aschoff sinuses and muscular hypertrophy, confirming gallstone fistulation as the underlying aetiology. the patient made an uneventful recovery and was discharged home on day 7 following the procedure with the abscess cavity wound dressed regularly, with a calcium alginate fibre dressing, and allowed to heal by secondary intention. he suffered no recurrence in the following months and was discharged from the surgical team after 12 months having made a full recovery. abdominal wall and intraperitoneal abscess formation after iatrogenic spillage of gallstones following laparoscopic cholecystectomy has been reported [1, 2, 3 ], although this is rare. cholecystocutaneous fistulation is noted in the literature but is still extremely uncommon, with only around 22 cases described over the last two decades or so. the aetiology described usually results from spilled gallstones following laparoscopic cholecystectomy, as mentioned, or is associated with previous episodes of recurrent acute cholecystitis, although rarely other aetiologies such as malignancy have to be considered [6, 7 ]. this is presumably due to the fact that one may suffer symptoms early such as those experienced with cholecystitis and, therefore, have definitive imaging and treatment before this particular eventuality is reached. this theory is also supported by the evidence that prior to 1950, courvoisier had described 169 cases, with henry and orr adding another 36 cases, of external biliary fistulae, but subsequently relatively few cases described. the great majority of biliary fistulas occur with connection to the duodenum, colon, stomach and choledochal duct. spontaneous cholecystocutaneous fistula presenting as a subcutaneous abscess is an exceedingly rare presentation of this pathological process, having only been reported a few times [8, 9 ] in the last twenty years with the patients usually having a known history of gallbladder disease. as is the case represented here, the most likely pathological process is recurrent gallbladder inflammation secondary to gallbladder calculi and chronic cholecystitis, causing adherence to the abdominal wall with eventual fistulation (confirmed histologically), but what is surprising in this case is the lack of symptoms experienced by he patient prior to abscess formation. this case report highlights the need for vigilance by the clinician when investigating unusual and suspicious clinical presentations in this particular area and supports the liberal use of computerised tomography, or other modalities such as magnetic resonance cholangiopancreatography, early to gain an accurate diagnosis so that the appropriate treatment can be instituted. | abdominal wall abscess secondary to spontaneous cholecystocutaneous gallstone fistulation is an uncommon presentation of a rare pathological process. having been described relatively frequently in the 19th century, it is now much less common in the late 20th and early 21st century, probably due to earlier recognition of symptoms, better imaging and surgical treatment of biliary tract disease. here we describe a report of a case with an unusual clinical presentation of the already rare pathological disease process of spontaneous cholecystocutaneous fistula. |
pulmonary arteriovenous malformations (pavms) are unusual abnormalities of the pulmonary vasculature and are often associated with hereditary hemorrhagic telangiectasia (hht) (1). they lead to a right - to - left shunt due to a direct connection between a pulmonary artery and a pulmonary vein. most of the congenital pavms (60% to 90%) are associated with hht (2). common clinical features are epistaxis, telangiectasias, cyanosis, dyspnea, and gastrointestinal bleeding (3). neurological complications such as migraine headaches, strokes, transient ischemic attacks, cerebral abscesses, and seizures are most commonly seen (1). the prevalence of migraines in patients with pavm and hht seems to be high (4). utilizing pulmonary arteriography, arteriovenous malformations can be identified and selectively embolized. however, large - sized single lesions or lesions that are at high risk of complications with transcatheter embolization (tce) are indicated for surgical resection. we reported a case of pavms in a patient presenting with chronic migraines that was successfully treated with surgical resection. a 41-yr - old woman presented to the emergency room with headache, nausea, dyspnea, and cyanosis suddenly worsening five hours prior to presentation. she reported a history of chronic headaches and dyspnea on exertion of 10 yr duration. she suffered from recurrent left temporo - parietal throbbing headaches that had been poorly controlled by nonsteroidal anti - inflammatory drugs, antidepressants, and minor tranquilizers. the headache occurred 4 to 5 times a month and did not worsen with exertion. nausea accompanied her headaches and often was followed by emesis with aggravation of the headaches. an arterial blood gas study revealed ph 7.49, pco2 27 mmhg, po2 69 mmhg, and sao2 95%. simple chest radiography revealed a solitary nodule with a relatively definite boundary in the right lung. this was then further characterized as a possible right middle lobe pavm by computerized tomography (fig. in order to definitively diagnose the lesion as a pavm and to search for accompanying cerebrovascular malformations, we performed pulmonary arteriography and cerebral angiography. the patient 's pavm was found to be a connection between the artery and vein of the right middle lobe (fig. lung perfusion scan performed prior to surgery revealed perfusions of 48% in the right lung and 52% in the left lung, lending further evidence of a right - to - left shunt in the right lung. the patient 's pulmonary arteriogram revealed that the feeding artery of the pavm had gradually expanded in size. if tce were to be performed in this case, there would be a high risk of paradoxical embolism caused by unintended migration of a detachable steel coil. the feeding artery and draining vein measuring about 1 cm in size with a thin pulsatile membrane was found centrally located in the right middle lobe (fig. once the artery and vein were clipped, the pavm lost its pulsatile beat and decreased in size. complete resection of the right middle lobe along with the offending pavm was performed. following the operation, the patient 's presenting symptoms of migraines, nausea, dyspnea, and cyanosis were resolved and arterial blood gas study improved to ph 7.47, pco2 33 mmhg, po2 86 mmhg, and sao2 97%. the patient was subsequently discharged and now lives a healthy life without evidence of recurrence over the past 10 months. although approximately 70% of the cases of pavms are associated with htt, our patient had no personal evidence or family history of hht and was diagnosed with isolated congenital or sporadic pavm. the presentation of our patient with migraines that resolved after surgical resection of her pavm suggests that the etiology of her migraines was related to the pavm. increased prevalence of migraines has been described in patients with hht, the most common cause of pavms (5). approximately 30% of people with hht have pavms, leading to pulmonary right - to - left shunt (6). two studies recently showed an increased prevalence of migraines in patients with pulmonary right - to - left shunts (pavms) (7, 8). a causal relationship between the presence of a right - to - left shunt and migraines it is possible that a particular genetic substrate that may determine pulmonary right - to - left shunt in patients with hht and may also activate migraines (9). secondly, trigger substances might enter the systemic circulation through the right - to - left shunt instead of being trapped in the pulmonary capillaries. these trigger substances might induce cerebral vascular instability or increased excitability of central nervous system and cause migraine headaches. trigger substances that are implicated are vasoactive chemicals such as serotonin or microemboli (10). treatment until 1980 was limited to surgical ligation and resection, but improved catheterization techniques have made embolotherapy the treatment of choice for most patients (11). utilizing pulmonary arteriography in patients with pavms, the origin of the artery that enters into the lesions can be identified and subsequent treatment method can be tailored to the patient 's clinical condition and the characteristics of the pavms including size, number, location, and treatment complications. historically, indications for surgical intervention for pavms include gradual expansion of the lesion and paradoxical embolism (12). as in our case, solitary pavms 2 cm or larger and centrally located two studies recently showed a high prevalence of migraines, 43 to 59%, in patients who were admitted for tce of large pavms (4, 5). these two groups, however, did not study the effects of embolization on the prevalence of migraines. only one study has reported a significant reduction in the prevalence of migraines after tce of pavms (13). however, there has not been a study that describes significant reduction in the prevalence of migraines after surgical operation of pavms. we report a case of a patient whose migraines resolved following successful surgical resection of a sporadic pavm. further studies are needed on a population basis to determine whether surgical resection of pavms reduces the prevalence of migraine headaches in this unique population. | pulmonary arteriovenous malformations (pavms) are thin - walled aneurysms caused by abnormal communication between the pulmonary arteries and veins. migraine headaches are sometimes the presenting clinical manifestation of pavms. although embolotherapy, using detachable balloons or stainless steel coils, is generally accepted as the best choice for the treatment of multiple pavms, the mode of intervention for solitary pavms remains a subject of debate. we present a 43-yr - old woman with a 10-yr history of chronic migraines and dyspnea on exertion. she was discovered to have a large solitary centrally located pavm, placing her at high risk of complications if she were to undergo percutaneous transcatheter embolization. she underwent successful surgical resection of her right middle lobe without complications, resulting in subsequent symptomatic improvement. |
cardiovascular diseases are the most important medical challenge worldwide including iran. 30% of the mortality and 10% of the global burden of diseases are attributed to cardiovascular diseases. myocardial infarction (mi) has the highest contribution among cardiovascular diseases in iran. in 2012, only 4% of 4564 years old population and 1% of 1544 years old population were free of cardiovascular diseases risk factors in both men and women in iran. individual risk factors of mi and the associated mortality have been examined in different countries, including iran. the association of seasons, income, socioeconomic status, individual and clinical risk factors, and geographic and environmental factors with mortality due to mi has been already investigated. mechanisms of geographic and environmental factors could explain the association between cardiovascular diseases and temperature. activation of the sympathetic nervous system and secretion of catecholamine are increased in response to cold temperature, which could result in an increase in blood pressure through increased heart rate and peripheral vascular resistance. in addition, experimental studies suggested that alterations in temperature might influence vascular function through an effect on endothelial nitric oxide synthase and the bioavailability of nitric oxide. in rats, acute and short - term exposure to elevated environmental or core body temperatures has been shown to increase endothelial nitric oxide synthase expression. in different population and communities, the pattern of mi incidence and outcomes varies. to identify the clinical and nonclinical (environmental) characteristics and the factors associated with the mortality due to mi, and to innovate in and implement the program for preventing and controlling the mortality in addition, because of the graded provision of services in iran 's health system and hierarchical structure of the patients data, multilevel analysis is the most appropriate approach to determining the factors associated with mortality in mi patients. no study has been yet conducted worldwide using multilevel analysis and examining concomitant effects of individual and nonindividual variables on mi outcome in different levels considering confounding variables and the interaction among the variables. this study was conducted to determine the factors independently associated with hospital mortality due to mi in iran using a multilevel analysis. in this hospital - based, nationwide and cross - sectional study, the data of 20750 new mi patients between april, 2012 and march, 2013 in iran were used. iran is a country in western asia, the middle east, central asia, and the caucasus. iran is one of the world 's large countries, which range from 25 and 3 to 39 and 47 north latitude, and 44 and 5 to 63 and 18 east longitude. as iran annual average precipitation in some cities in south iran does not exceed 40 mm while it has been reported to exceed 600 mm in western regions. these variations could be seen for other weather elements such as temperature and humidity, as well. the data used in this study were accessed with observance of all rights of the patients, and ethical considerations in research as well as the approval of the university 's ethics committee and noncommunicable diseases management center of iran 's ministry of health and medical education. in addition, the patients individual data were dealt with as confidential, and no data contributing to the identification of the patients were used. the hospital mortality due to mi was considered as the outcome of the disease and hence a dependent variable. definition of world health organization (who) and world heart federation (icd : i21) was adopted for mi diagnosis (as the inclusion criteria). echocardiography (ecg) was used to differentiate between the two types of mis based on the shape of the tracing. an st section of the tracing higher than the baseline is called st - segment elevation myocardial infarction (stemi) which usually requires more invasive treatment. for a person to qualify as having stemi, the ecg must show new st elevation in two or more adjacent ecg leads. the patients with definite diagnosis of mi by the cardiologist were enrolled into the study. the patients with mi history and no mi diagnosis were excluded from the study. in view of the inclusion and exclusion criteria, census enrollment of the patients from all hospitals across the country, and data gathering per a single form, the biases of enrollment, and data were minimized as much as possible. the demographic data and clinical and behavioral risk factors at individual level including age, gender, literacy, place of residence, smoking, type 2 diabetes, hypertension, dyslipidemia, and complications, and place and type of mi were gathered from the patients electronic medical file in iran myocardial infarction registry in 2012. the hospital at which the patient was hospitalized at the county (place of residence) level was defined as the second level analysis. for the second level analysis, valid and reliable geographical and environmental data such as mean temperature, mean minimum and maximum temperature, mean relative humidity, altitude, and mean precipitation for each month were obtained from iran meteorological organization and the ratio of cardiac care unit beds was obtained from treatment deputy of iran ministry of health and medical education. the province where the patient was living was determined as the third level analysis. as with thefirst two levels, for the third level analysis, valid and reliable data on noncommunicable diseases risk factors were used, including prevalence of type 2 diabetes, hypertension, mean body mass index, smoking and hookah smoking, high cholesterol, obesity and overweight, physical inactivity, and the frequency of fish, vegetables, fruits, and fried food in household food basket ; these data were gathered per stepwise approach of who. deviance information criterion, akaike 's information criterion (aic) and bayesian information criterion (bic) were used to select the best model. any model with lower aic or bic the null model was defined as empty model to recognize the variance among the levels. in the second step the slope of thefirst level variables was considered as fixed, as opposed to random, because we did not assume a priori that the effect of these variables on mortality varies among the provinces. in the model two, the variables at the community level (district / hospitals) were introduced into the model one. in the model three, the variables at the community level (province) were added to the model two. after running the third model, we decided to do the analysis at two levels, because the amount of variance was approximately zero at the third level (province). measures of association were calculated and reported by odds ratio (or) (confidence interval [ci ] 95%). the quantitative data were reported as mean standard deviation (sd) and the grouped variables as frequency and percentage. in this hospital - based, nationwide and cross - sectional study, the data of 20750 new mi patients between april, 2012 and march, 2013 in iran were used. iran is a country in western asia, the middle east, central asia, and the caucasus. iran is one of the world 's large countries, which range from 25 and 3 to 39 and 47 north latitude, and 44 and 5 to 63 and 18 east longitude. as iran annual average precipitation in some cities in south iran does not exceed 40 mm while it has been reported to exceed 600 mm in western regions. these variations could be seen for other weather elements such as temperature and humidity, as well. the data used in this study were accessed with observance of all rights of the patients, and ethical considerations in research as well as the approval of the university 's ethics committee and noncommunicable diseases management center of iran 's ministry of health and medical education. in addition, the patients individual data were dealt with as confidential, and no data contributing to the identification of the patients were used. the hospital mortality due to mi was considered as the outcome of the disease and hence a dependent variable. definition of world health organization (who) and world heart federation (icd : i21) was adopted for mi diagnosis (as the inclusion criteria). echocardiography (ecg) was used to differentiate between the two types of mis based on the shape of the tracing. an st section of the tracing higher than the baseline is called st - segment elevation myocardial infarction (stemi) which usually requires more invasive treatment. for a person to qualify as having stemi, the ecg must show new st elevation in two or more adjacent ecg leads. the patients with definite diagnosis of mi by the cardiologist were enrolled into the study. the patients with mi history and no mi diagnosis were excluded from the study. in view of the inclusion and exclusion criteria, census enrollment of the patients from all hospitals across the country, and data gathering per a single form, the biases of enrollment, and data were minimized as much as possible. the demographic data and clinical and behavioral risk factors at individual level including age, gender, literacy, place of residence, smoking, type 2 diabetes, hypertension, dyslipidemia, and complications, and place and type of mi were gathered from the patients electronic medical file in iran myocardial infarction registry in 2012. the hospital at which the patient was hospitalized at the county (place of residence) level was defined as the second level analysis. for the second level analysis, valid and reliable geographical and environmental data such as mean temperature, mean minimum and maximum temperature, mean relative humidity, altitude, and mean precipitation for each month were obtained from iran meteorological organization and the ratio of cardiac care unit beds was obtained from treatment deputy of iran ministry of health and medical education. the province where the patient was living was determined as the third level analysis. as with thefirst two levels, for the third level analysis, valid and reliable data on noncommunicable diseases risk factors were used, including prevalence of type 2 diabetes, hypertension, mean body mass index, smoking and hookah smoking, high cholesterol, obesity and overweight, physical inactivity, and the frequency of fish, vegetables, fruits, and fried food in household food basket ; these data were gathered per stepwise approach of who. deviance information criterion, akaike 's information criterion (aic) and bayesian information criterion (bic) were used to select the best model. any model with lower aic or bic, the null model (random intercept model) was run with no independent variables. the null model was defined as empty model to recognize the variance among the levels. in the second step, the slope of thefirst level variables was considered as fixed, as opposed to random, because we did not assume a priori that the effect of these variables on mortality varies among the provinces. in the model two, the variables at the community level (district / hospitals) were introduced into the model one. in the model three, the variables at the community level (province) were added to the model two. after running the third model, we decided to do the analysis at two levels, because the amount of variance was approximately zero at the third level (province). measures of association were calculated and reported by odds ratio (or) (confidence interval [ci ] 95%). the quantitative data were reported as mean standard deviation (sd) and the grouped variables as frequency and percentage. totally, 20750 patients were enrolled into the study from 208 countries across 31 provinces of iran. mean (sd) age at mi and mortality incidence was 61.2 (13.4) and 65.2 (15.2) years, respectively. 855 (34.1%) of the mortality occurred in women and the rest in men. the individual characteristics of all patients and the deceased and survived patients after mi are shown in table 1 for mi outcome. characteristics of the study population 56.3% of the deceased patients and 44.9% of the survived were illiterate. relative frequency (%) of the academic education in the deceased and survived patients was, respectively, 5.6% and 6.2%. the prevalence of smoking, hypertension, and diabetes in the deceased patients was derived, respectively, 31%, 37.8%, and 24.3%. the prevalence of right bundle branch block (rbbb), left bundle branch block, atrial fibrillation (af), and ventricular tachycardia (vt) in the deceased patients was obtained, respectively, 3%, 3.1%, 4.6%, and 10.5%, all higher than survived patients. use of percutaneous coronary intervention (pci) was obtained 3.1% in the deceased patients, < 7.4% in the survived. descriptive characteristics of the second level (district) and third level (province) variables, such as temperature and humidity, are shown in table 2. descriptive characteristics at the place of residence (study level) in patients with myocardial infarction the mean maximum temperature, relative humidity, precipitation, and altitude of the studied counties was 23.9c, 37.5%, 418.9 mm, and 1027.8 m. the prevalence of hypertension, obesity, type 2 diabetes, smoking, hookah smoking, physical inactivity, vegetables consumption, and fish consumption was obtained, respectively, 16.4%, 44.8%, 9.5%, 10.5%, 2.2%, 35.6%, 11.6%, and 27%. or (ci 95%) is shown in table 3 for the factors associated with the patients mortality at different levels of the analysis. for the avoidance of residual confounding, age was entered in the model as a quantitative rather than grouped variable. with an increase in mean age by one sd, the or for mortality increased by 1.54. or for mortality in patients with primary and secondary school education was significantly less than illiterate patients, both less than the patients with academic education. the highest risk of hospital mortality was obtained for ischemic heart pain with chest pain resistant to treatment (or = 5.2 : 4.635.9). factors associated with the patients mortality at levels (place of residence) of analysis although hospital mortality due to mi was inversely correlated with increase in temperature (or = 0.97 [95% ci : 0.931.02 ]) and directly correlated with decreased temperature (or = 1.04 [95% ci : 0.991.1 ]), the association was not derived as significant in view of the calculated or (95% ci). precipitation had a protective effect on the mortality due to mi (or = 0.79). in contrast, an increase in relative humidity was a risk factor of mortality due to mi. or (ci 95%) is shown in table 4 for risk factors associated with the patients mortality at a two - level model of the analysis. in this study, the association between hospital mortality due to mi and individual, group, and environmental variables was investigated by a multilevel analysis. the strengths of the present study were the avoidance of biases of selection and data, and conduction of a hospital - based, large study with the findings potentially generalizable to the whole country. as the study data were gathered from all iran 's provinces, they are generalizable to the whole country. a study in australia reported annual mortality due to mi in the aboriginals and nonaboriginals, respectively, 10.7% and 1.2%, both lower than 12.1% obtained in the present study. another study conducted in 24 countries between 1998 and 2000 to investigate and determine the real or unreal difference in the outcome of mi reported that the differences after mi were mainly due to the variables at individual levels. hospital - level factors and national level factors have a minor effect on the outcome of mi., the variables age, gender, education, smoking, family history of heart disease, diabetes, chest pain, type of mi, heart failure, and the type of conducted therapies as significant variables at individual level and humidity and precipitation as collective and environmental variables were significantly associated with mortality from mi. out of the advantages of our study was the determination of the factors associated with hospital mortality in multilevel analysis. this analysis is much more accurate than the conventional logistic regression analysis. a hospital - based study by koren., obtained the prevalence of hypertension, dyslipidemia, type 2 diabetes, and smoking 39%, 38%, 24%, and 52%, respectively, which is higher than the present study findings. in koren. study, the rate of coronary artery bypass grafting (cabg) was reported 7%, which is significantly higher than that in our study. willey., compared hispanic and non - hispanic mi patients with regards to cardiac mortality. the mean age of patients was 68.8 years and the history of hypertension, diabetes, and smoking was obtained, respectively, 3.72%, 4.20%, and 9.17%. in willey., study, the percentage of cardiac mortality was 7%, which is lower than that in our study., in brazil reported that post - mi survival followed by thrombolytic therapy was higher in men than women. nicolau., study reported a lower risk of mortality in men than women. after adjusting the relationship for age and other variables, in our study, the ratio of mortality for women in the presence of other variables was significant. gender was derived as a significant variable in the presence of other risk factors in our study, which is consistent with nicolau., study. various studies reported age, gender, family history of heart disease, hyperlipidemia, hypertension, type 2 diabetes, smoking, educational level, obesity, and physical inactivity as risk factors of heart diseases, which confirms our findings. the results of our study are consistent with the studies reporting that type 2 diabetes, hypertension, and smoking were higher in deceased patients due to mi than survived patients. in the present study, age, education, lack of thrombolytic therapy, type 2 diabetes, chest pain before arriving at the hospital, heart failure, family history of cardiovascular disease, rbbb, vt, and stemi were determinants of hospital mortality due to mi, consistent with studies in other countries such as japan and korea. in our study, hypertension and hospital mortality were significant in univariate analysis, but the or for mortality, in multiple analysis, was lower in the patients with hypertension than without hypotension. it seems that the control of hypertension with treatment plays an important role in the mortality due to mi. in japan, hypertension - related mortality was significant in mi patients, which is inconsistent with our study. in thomas. study, age, lack of thrombolytic therapy and vt were the most important determinants of mortality in patients with mi, which is similar to our results. study were derived 49%, 53%, and 30%, respectively, and in the multiple regression model were significant risk factors for mortality. in a study in which 73% were male and the mean age was 68.1 years, the findings were similar to our findings. history of cabg, pci, and type 2 diabetes was reported 4.4%, 12.5%, and 25.3%, respectively, higher than the corresponding values, respectively, 2.6%, 3.2%, and 22.2% in our study. in our study, af was one of the determinants of hospital mortality, which is consistent with a study in france. in india, 30.4% of patients had type 2 diabetes, 37.7% hypertension, and 40% were smokers ; in the present study, the corresponding figures were obtained 22.2%, 5.35%, and 2.26%, respectively. in india, despite the high prevalence of risk factors, the rate of mortality was obtained 6.7%, which is lower than the mortality rate in our study. since 63.2% of the patients in iran with stemi diagnosis, higher than non - stemi, have been registered and the registered figures for diagnosis of the mi type in iran is inconsistent with those in the usa, under - registration of non - stemi cases is probable in iran, which could be explained by the fact that the majority of the patients with non - stemi deceased before arriving at the hospital and hence are not included in hospital figures. the findings indicated that the rate of use of common therapies for mi patients is lower than other countries and hence further use of these therapies, particularly pci, is recommended to reduce hospital mortality from mi, and training of the patients to refer early and undergo therapies at golden time is critical to preventing avoidable deaths. temperature, precipitation, and relative humidity were derived as the determinants of the mi mortality, which is consistent with the studies investigating the relationship alone and/or considering other variables. although the mechanism effect of temperature, precipitation, and humidity on heart disease has not been established well, temperature reduction leads to increased pressure, impaired inversion layer height, and increased concentration of pollutants in the confined space. high temperature causes increased ozone level and other air pollutants, with direct impact on the severity and worsening of cardiovascular diseases. moreover, the precipitation reduces air pollutants and their concentrations and is inversely correlated with cardiovascular morbidity and mortality. although air pollution has been already reported to have no effect on the outcome of mi in the investigation of the temperature and precipitation association with mi outcome, in our study, air pollution could be a confounding factor. due to lack of information needed to control air pollution as a confounding variable, it should be considered in future studies. the knowledge of the role of environmental and biological factors could be used to improve prevention measures and educational strategies, especially in people at risk of diseases. a limitation of the present study was failure to gather the data on ejection fraction as it is one of the predictive factors of mortality, needing to be addressed in future studies. prospective cohort study and follow - up of the patients for the event of interest at frequent intervals are recommended in future investigations. hence, individual interventions in healthcare centers, clinics, and community at large for lifestyle changes contribute importantly to preventing and controlling mortality. less importantly, the variables related to the living environment such as temperature, relative humidity, and precipitation may determine the mortality in patients. implementing educational strategies, motivating people to visit doctors early, and increasing access to treatment especially in the individuals at mi risk could reduce the mortality due to mi. | background : regarding failure to establish the statistical presuppositions for analysis of the data by conventional approaches, hierarchical structure of the data as well as the effect of higher - level variables, this study was conducted to determine the factors independently associated with hospital mortality due to myocardial infarction (mi) in iran using a multilevel analysis.methods:this study was a national, hospital - based, and cross - sectional study. in this study, the data of 20750 new mi patients between april, 2012 and march, 2013 in iran were used. the hospital mortality due to mi was considered as the dependent variable. the demographic data, clinical and behavioral risk factors at the individual level and environmental data were gathered. multilevel logistic regression models with stata software were used to analyze the data.results:within 1-year of study, the frequency (%) of hospital mortality within 30 days of admission was derived 2511 (12.1%) patients. the adjusted odds ratio (or) of mortality with (95% confidence interval [ci ]) was derived 2.07 (95% ci : 1.52.8) for right bundle branch block, 1.5 (95% ci : 1.31.7) for st - segment elevation mi, 1.3 (95% ci : 1.11.4) for female gender, and 1.2 (95% ci : 1.11.3) for humidity, all of which were considered as risk factors of mortality. but, or of mortality was 0.7 for precipitation (95% ci : 0.70.8) and 0.5 for angioplasty (95% ci : 0.40.6) were considered as protective factors of mortality.conclusions:individual risk factors had independent effects on the hospital mortality due to mi. variables in the province level had no significant effect on the outcome of mi. increasing access and quality to treatment could reduce the mortality due to mi. |
we obtained tumor specimens from 231 patients with invasive breast carcinoma and from 200 matched preoperative plasma and tumor specimens from 90 patients with intraductal carcinoma who underwent surgical resection at samsung medical center from may 2002 through december 2004. all of the tissues had been fixed in 10% neutral buffered formalin and embedded in paraffin and were evaluated for a wide variety of pathologic features by examination of the hematoxylin and eosin (h&e)-stained tissue sections and the immunohistochemically - stained slides by two investigators in a blinded fashion without knowledge of the molecular data. the tumor grade and stage were determined based on the american joint committee on cancer guidelines. all of the patients were women, and the median age was 46 years (range, 25 to 83 years). the mean number of metastatic lymph nodes was 4.95 (range, 1 to 27 ; median, 3.00). the survival data were obtained from a review of the patient 's chart in our hospital and from the national cancer registry. the mean follow - up time was 45.5 (range, 1 to 63) months. recurrence - free survival was defined as the number of months from diagnosis to the occurrence of an event (local recurrence / metastasis). plasma specimens were also obtained from 189 healthy individuals (109 men and 80 women) as controls. for dna extraction, we used fresh - frozen tissues for invasive carcinoma and formalin - fixed, paraffin - embedded tissues for intraductal carcinoma. the h&e - stained sections were reviewed to confirm the tumor areas and tumor volume before dna extraction. the tumor - rich areas (> 75%) were extracted from 0.1% methylene blue - stained serial 10 m tissue sections, and the areas corresponding to tumor parenchyma were carefully microdissected from the surrounding stromal tissues. dna was extracted using a dneasy tissue kit (qiagen, valencia, ca, usa) according to the manufacturer 's instructions. the representative areas on the h&e - stained sections were carefully selected and marked on the individual paraffin blocks. two tissue cores (1 mm in diameter) the tissue cores were then inserted in a recipient paraffin block according to the manufacturer 's instructions (isu abxis co., ltd., cambridge, uk). after deparaffinization and rehydration, the 4 m thick sections on the silane - coated slides were heat - pretreated in a citrate buffer (ph 7.3 at 92 in a microwave oven) and immunostained using specific antibodies directed against p16 (g175 - 405, pharmingen, hamburg, germany), her-2 (cb11, novocastra laboratories, newcastle, uk), estrogen receptor (er ; 6f11, novocastra laboratories), progesterone receptor (pr ; 1a6, novocastra laboratories), p53 (zymed, south san francisco, ca, usa), and ki-67 (mib i, dianova, hamburg, germany). an avidin - biotin technique was applied using 3,3'-diaminobenzidine (dab) for visualization and hematoxylin as the nuclear counterstain. a cell was considered positive for p16 protein if it contained staining within the nucleus, cytoplasm, or both the nucleus and cytoplasm. the proportion of positive cells was classified into five categories : 0 (1 - 4% positive tumor cells), 1 (5 - 10%), 2 (10 - 50%), 3 (51 - 80%), or 4 (> 80%). the staining intensity was scored as follows : 1 (weak), 2 (moderate), or 3 (strong). the scores for both parameters were multiplied to generate the immunoreactivity score (is) for each case. as a result, each lesion was examined and scored separately by two pathologists, and the cases with discrepant scores were discussed until agreement was reached between the pathologists. protein expression was determined in a blinded manner for the methylation analyses and vice versa. the distribution of her-2 was assessed according to the following scoring system : 0, no immunoreactivity or immunoreactivity in less than 10% of the tumor cells ; 1 +, faint and incomplete staining of more than 10% of the tumor cells ; 2 +, weak to moderate complete membrane immunoreactivity in more than 10% of the tumor cells ; 3 +, moderate to strong complete membrane immunoreactivity in more than 30% of the tumor cells. the semiquantitative histochemical scores were used to record the results of the er and pr staining according to the allred scoring system.18 the p53 staining in the cell nuclei was assessed, and the patients with staining in more than 5% of the tumor cells were regarded as positive. one microgram of genomic dna was modified using sodium bisulfite with the ez dna methylation kit (zymo research, orange, ca, usa) according to the manufacturer 's instructions. the methylation status of the p16 gene was determined by methylation - specific pcr (msp) using two pairs of primers, as described by herman.3 the msp primers specific for methylated p16 gene were 5'-ttattagagggtggggcggatcgc-3 ' (sense) and 5'-gaccccgaaccgcgaccgtaa-3 ' (antisense), and the primers used for the unmethylated p16 gene were 5'-ttattagagggtggggtggattgt-3 ' (sense) and 5'-ccacctaaatcaacctccaacca-3 ' (antisense). amplification was carried out over 35 cycles (1 minute at 94, 1 minute at the annealing temperature, and 1 minute at 72), followed by 4 minutes at 72. the pcr product sizes were 150 bp and 234 bp for the methylated and unmethylated segments, respectively. cpgenome universal unmethylated dna (s7822, millipore, billerica, ma, usa) was used as a positive control for the unmethylated alleles, and cpgenome universal methylated dna (s7821, millipore) was used as a positive control for the methylated alleles. the primer sequences used to amplify the actin gene were 5'-tggtgatggaggaggtttagtaagt-3 ' (sense) and 5'-aaccaataaaacctactcctcccttaa-3 ' (antisense) were used in conjunction with a fluorogenic probe 5'-(fam)-accaccacccaacacacaataacaaacaca-(tamra)-3 ', and the primer sequences used for the methylated p16 gene were 5'-ggggagagtagatagcgggc-3 ' (sense) and 5'-aaccaatcaaccgaaaattccata-3 ' (antisense) in conjunction with a fluorogenic probe 5'-(fam)-tactccccgccgccgactccat-(tamra)-3 '. each 10 l pcr reaction volume contained 5 l taqman universal pcr master mix no amperase ung (applied biosystems, foster city, ca, usa), 1 pm of each primer, a 0.025 pm probe, and 2 l template dna. assays were run on an abi prism 7900 sequence detection system (applied biosystems). the pcr conditions were as follows : 2 minutes at 50, 10 minutes at 95, followed by 50 cycles of 15 seconds at 95, and 1 minute at 60. real - time quantitative pcr reactions were performed for the detection and quantitation of the bisulfite unconverted methylated version of the p16 gene and the bisulfite - converted unmethylated version of the actin gene. serial dilutions of methylated or unmethylated control genomic dnas (millipore) were used to construct standard curves. the methylation index (mi) in each sample was calculated using the following equation:19 mi values greater than 0.1% were considered positive. statistical analyses of the immunohistochemical abnormalities were performed using the two - tailed fisher 's exact test with a p - value set as 75%) were extracted from 0.1% methylene blue - stained serial 10 m tissue sections, and the areas corresponding to tumor parenchyma were carefully microdissected from the surrounding stromal tissues. dna was extracted using a dneasy tissue kit (qiagen, valencia, ca, usa) according to the manufacturer 's instructions. the representative areas on the h&e - stained sections were carefully selected and marked on the individual paraffin blocks. two tissue cores (1 mm in diameter) were obtained from the regions of interest in each tumor block. the tissue cores were then inserted in a recipient paraffin block according to the manufacturer 's instructions (isu abxis co., ltd., cambridge, uk). after deparaffinization and rehydration, the 4 m thick sections on the silane - coated slides were heat - pretreated in a citrate buffer (ph 7.3 at 92 in a microwave oven) and immunostained using specific antibodies directed against p16 (g175 - 405, pharmingen, hamburg, germany), her-2 (cb11, novocastra laboratories, newcastle, uk), estrogen receptor (er ; 6f11, novocastra laboratories), progesterone receptor (pr ; 1a6, novocastra laboratories), p53 (zymed, south san francisco, ca, usa), and ki-67 (mib i, dianova, hamburg, germany). an avidin - biotin technique was applied using 3,3'-diaminobenzidine (dab) for visualization and hematoxylin as the nuclear counterstain. a cell was considered positive for p16 protein if it contained staining within the nucleus, cytoplasm, or both the nucleus and cytoplasm. the proportion of positive cells was classified into five categories : 0 (1 - 4% positive tumor cells), 1 (5 - 10%), 2 (10 - 50%), 3 (51 - 80%), or 4 (> 80%). the staining intensity was scored as follows : 1 (weak), 2 (moderate), or 3 (strong). the scores for both parameters were multiplied to generate the immunoreactivity score (is) for each case. as a result, each lesion was examined and scored separately by two pathologists, and the cases with discrepant scores were discussed until agreement was reached between the pathologists. protein expression was determined in a blinded manner for the methylation analyses and vice versa. the distribution of her-2 was assessed according to the following scoring system : 0, no immunoreactivity or immunoreactivity in less than 10% of the tumor cells ; 1 +, faint and incomplete staining of more than 10% of the tumor cells ; 2 +, weak to moderate complete membrane immunoreactivity in more than 10% of the tumor cells ; 3 +, moderate to strong complete membrane immunoreactivity in more than 30% of the tumor cells. the semiquantitative histochemical scores were used to record the results of the er and pr staining according to the allred scoring system.18 the p53 staining in the cell nuclei was assessed, and the patients with staining in more than 5% of the tumor cells were regarded as positive. one microgram of genomic dna was modified using sodium bisulfite with the ez dna methylation kit (zymo research, orange, ca, usa) according to the manufacturer 's instructions. the methylation status of the p16 gene was determined by methylation - specific pcr (msp) using two pairs of primers, as described by herman.3 the msp primers specific for methylated p16 gene were 5'-ttattagagggtggggcggatcgc-3 ' (sense) and 5'-gaccccgaaccgcgaccgtaa-3 ' (antisense), and the primers used for the unmethylated p16 gene were 5'-ttattagagggtggggtggattgt-3 ' (sense) and 5'-ccacctaaatcaacctccaacca-3 ' (antisense). amplification was carried out over 35 cycles (1 minute at 94, 1 minute at the annealing temperature, and 1 minute at 72), followed by 4 minutes at 72. the pcr product sizes were 150 bp and 234 bp for the methylated and unmethylated segments, respectively. cpgenome universal unmethylated dna (s7822, millipore, billerica, ma, usa) was used as a positive control for the unmethylated alleles, and cpgenome universal methylated dna (s7821, millipore) was used as a positive control for the methylated alleles. the primer sequences used to amplify the actin gene were 5'-tggtgatggaggaggtttagtaagt-3 ' (sense) and 5'-aaccaataaaacctactcctcccttaa-3 ' (antisense) were used in conjunction with a fluorogenic probe 5'-(fam)-accaccacccaacacacaataacaaacaca-(tamra)-3 ', and the primer sequences used for the methylated p16 gene were 5'-ggggagagtagatagcgggc-3 ' (sense) and 5'-aaccaatcaaccgaaaattccata-3 ' (antisense) in conjunction with a fluorogenic probe 5'-(fam)-tactccccgccgccgactccat-(tamra)-3 '. each 10 l pcr reaction volume contained 5 l taqman universal pcr master mix no amperase ung (applied biosystems, foster city, ca, usa), 1 pm of each primer, a 0.025 pm probe, and 2 l template dna. assays were run on an abi prism 7900 sequence detection system (applied biosystems). the pcr conditions were as follows : 2 minutes at 50, 10 minutes at 95, followed by 50 cycles of 15 seconds at 95, and 1 minute at 60. real - time quantitative pcr reactions were performed for the detection and quantitation of the bisulfite unconverted methylated version of the p16 gene and the bisulfite - converted unmethylated version of the actin gene. serial dilutions of methylated or unmethylated control genomic dnas (millipore) were used to construct standard curves. the methylation index (mi) in each sample was calculated using the following equation:19 mi values greater than 0.1% were considered positive. statistical analyses of the immunohistochemical abnormalities were performed using the two - tailed fisher 's exact test with a p - value set as < 0.05 to indicate significance. fisher 's exact tests were used to compare aberrant p16 gene expression and p16 methylation with the clinicopathologic parameters of breast cancer. comparison of the amount of methylated p16 dna in the plasma between the invasive breast cancer patients and normal controls was performed using the student 's t - test (two - tailed). all statistical comparisons were performed using the statistical software, spss (spss inc., chicago, il, usa). we analyzed the pattern of p16 methylation in the 231 invasive breast carcinomas and 90 intraductal carcinomas. the results of these experiments are summarized in table 2 and representatively illustrated in fig. the p16 promoter was frequently hypermethylated, not only in the invasive tumor samples but also in the intraductal carcinoma specimens. in many of the specimens examined (122/231 [52.8% ] for invasive ductal carcinoma and 52/90 [57.8% ] for intraductal carcinoma) we observed the presence of the amplification band corresponding to the methylated target sequence. we also detected the unmethylated allele in 114 invasive cancer and 53 intraductal carcinoma specimens, suggesting contamination of the dissected tumor samples with normal cells. ninety - eight cases of invasive cancer and 43 cases of intraductal carcinoma were fully unmethylated. the majority of breast carcinoma samples moderately or strongly expressed p16 in either the infiltrating or intraductal component, or both (table 2, fig. as shown in table 2, immunohistochemical analysis showed that 145 of 231 invasive carcinomas (62.8%) and 63 of 90 intraductal carcinomas (70%) overexpressed the p16 protein. the overexpression of p16 in the invasive carcinomas was significantly associated with a high histologic grade, negative er and pr status, p53 immunoreactivity, and high ki-67 proliferation index (table 3). no correlation of p16 expression with clinical stage, her2/neu status, or disease free survival was found. in our study, there was no clear association between promoter hypermethylation of p16 and p16 expression. in the invasive carcinomas, 78 of 122 tumors with methylation revealed p16 overexpression (p=0.7) while 44 tumors showed loss of protein. in the intraductal carcinomas, 34 of 52 tumors with methylation had high expression of p16 (p=0.269), while 18 tumors showed loss of protein (table 2). peripheral blood plasma was obtained from 200 invasive breast cancer patients before surgery and from 189 healthy donors, which were used as normal controls. the amount of methylated p16 gene copies was examined using the quantitative real - time msp approach and was expressed as the mi (%). methylated p16 was found in the plasma of 69 of the 200 (34.5%) invasive breast cancer patients and in 2 of the 189 (1%) normal controls. among the control group, all of the subjects with methylated p16 were men. the mean mi for p16 was 6.37% (range, 0 to 85%) in the cancer patients and 0.06% (range, 0 to 7.3%) in the normal controls (fig. the mean concentration of methylated p16 in the plasma of the invasive breast cancer patients was higher than that in the normal healthy control group, which was statistically significant (t - test, p=0.016). we analyzed the pattern of p16 methylation in the 231 invasive breast carcinomas and 90 intraductal carcinomas. the results of these experiments are summarized in table 2 and representatively illustrated in fig. the p16 promoter was frequently hypermethylated, not only in the invasive tumor samples but also in the intraductal carcinoma specimens. in many of the specimens examined (122/231 [52.8% ] for invasive ductal carcinoma and 52/90 [57.8% ] for intraductal carcinoma) we observed the presence of the amplification band corresponding to the methylated target sequence. we also detected the unmethylated allele in 114 invasive cancer and 53 intraductal carcinoma specimens, suggesting contamination of the dissected tumor samples with normal cells. ninety - eight cases of invasive cancer and 43 cases of intraductal carcinoma were fully unmethylated. the majority of breast carcinoma samples moderately or strongly expressed p16 in either the infiltrating or intraductal component, or both (table 2, fig. as shown in table 2, immunohistochemical analysis showed that 145 of 231 invasive carcinomas (62.8%) and 63 of 90 intraductal carcinomas (70%) overexpressed the p16 protein. the overexpression of p16 in the invasive carcinomas was significantly associated with a high histologic grade, negative er and pr status, p53 immunoreactivity, and high ki-67 proliferation index (table 3). no correlation of p16 expression with clinical stage, her2/neu status, or disease free survival was found. in our study, there was no clear association between promoter hypermethylation of p16 and p16 expression. in the invasive carcinomas, 78 of 122 tumors with methylation revealed p16 overexpression (p=0.7) while 44 tumors showed loss of protein. in the intraductal carcinomas, 34 of 52 tumors with methylation had high expression of p16 (p=0.269), while 18 tumors showed loss of protein (table 2). peripheral blood plasma was obtained from 200 invasive breast cancer patients before surgery and from 189 healthy donors, which were used as normal controls. the amount of methylated p16 gene copies was examined using the quantitative real - time msp approach and was expressed as the mi (%). methylated p16 was found in the plasma of 69 of the 200 (34.5%) invasive breast cancer patients and in 2 of the 189 (1%) normal controls. among the control group, all of the subjects with methylated p16 were men. the mean mi for p16 was 6.37% (range, 0 to 85%) in the cancer patients and 0.06% (range, 0 to 7.3%) in the normal controls (fig. the mean concentration of methylated p16 in the plasma of the invasive breast cancer patients was higher than that in the normal healthy control group, which was statistically significant (t - test, p=0.016). p16 promoter methylation is variably present in breast carcinoma with a prevalence ranging from 4% to 68.4%,3,20 - 22 and our present study revealed a relatively high frequency of methylation of 52.8% (122/231) and 57.8% (52/90) in the invasive and intraductal tumors, respectively. the high prevalence of p16 methylation in both the invasive and intraductal carcinomas may indicate that the epigenetic alterations of the p16 gene play a significant role in the early stage of mammary carcinogenesis. recently, liu.23 suggested that p16 methylation in various intraductal proliferative lesions, such as usual ductal hyperplasia, flat epithelial atypia, atypical ductal hyperplasia, low grade intraductal carcinomas, and high grade intraductal carcinomas, was related to the progression of intraductal epithelial proliferative lesions of the breast. the p16 gene is epigenetically silenced in many human tumors ; however, regardless of the cut - off point of immunoreactivity, our study did not show a firm association between methylation and protein expression. similar findings have been reported in breast carcinomas and in other malignancies.4,24 - 26 there are several possible explanations for this discrepancy between immunohistochemistry and promoter hypermethylation. it is possible that both p16-positive cells and -negative cells were present in some cases, and that the predominant p16-positive cells were analyzed for p16 promoter hypermethylation. another explanation may be the regulation of protein expression by post - transcriptional alterations other than promoter methylation. moreover, the immunoreactivity of p16 proteins has been reported to be variable according to different anti - p16 antibodies. the g175 - 405 antibody used in our study has been reported to be the most specific.27 the present study showed that p16 protein overexpression was correlated with several phenotypic parameters of the tumors indicative of a poor prognosis, although it was not associated with disease - free survival or overall survival. some reports in the literature are in agreement with the above findings,5 - 7,28 whereas other reports did not find any correlation.29 the pathophysiological role of p16 in the oncogenesis of breast carcinoma should be focused in further investigation. p16 is a tumor suppressor, and it is accepted that the loss of p16 expression is related to tumorigenesis. therefore, our data could be interpreted as overexpression of p16 as an attempt to compensate for the oncogenic changes of other proteins, such as retinoblastoma or tp53.30 in the present study, high expression of p16 correlated with both p53 protein positivity and a high ki-67 proliferation index. the p16 overexpression in the patients with high proliferative activity may indicate that p16 is inactive or not sufficient to limit cell growth in breast carcinomas. by using a quantitative pcr approach, we found that methylated p16 dna was present in the plasma of both the cancer patients and healthy subjects. however, the invasive breast cancer patients had significantly higher frequencies and concentrations of methylated p16 dna than the normal controls. our results suggest that a quantitative measurement of methylated p16 dna concentrations in the plasma of cancer patients might be a useful tool for cancer screening and monitoring of treatment effectiveness. nevertheless, a large - scale prospective study of plasma from cancer patients is necessary to further investigate the feasibility of methylated p16 dna as a tumor screening marker in invasive breast cancer. in conclusion, the high frequency of p16 methylation in invasive breast carcinoma and intraductal carcinoma suggest that p16 methylation could be a common and early event in breast carcinogenesis. the overexpression of p16 in the invasive carcinomas was correlated with several phenotypic parameters of the tumors indicative of poor prognosis, although it was not associated with disease free survival or overall survival. therefore, this suggested that the high level of p16 expression may be an indicator of poor prognosis. moreover, the concentrations of p16 methylated dna was significantly higher in the plasma of the invasive breast cancer patients compared with the healthy individuals, suggesting that quantitative measurement of plasma methylated p16 gene concentrations might be a useful and non - invasive tool for cancer screening and monitoring treatment response. | backgroundthe p16ink4a gene methylation has been reported to be a major tumorigenic mechanism.methodswe evaluated the methylation status of the p16ink4a genes in 231 invasive breast cancer and 90 intraductal carcinoma specimens using a methylation - specific polymerase chain reaction and p16 protein expression using immunohistochemistry. the quantity of cell - free methylated p16ink4a dna in the plasma samples of 200 patients with invasive breast cancer was also examined using a fluorescence - based real - time polymerase chain reaction assay.resultsthe frequencies of p16ink4a methylation in invasive and intraductal tumors were 52.8% (122/231) and 57.8% (52/90), respectively. the p16 protein was overexpressed in 145 of the 231 invasive carcinomas (62.8%) and 63 of the 90 intraductal carcinomas (70%). high p16 expression in invasive carcinomas correlated significantly with a high histologic grade, a negative estrogen receptor and progesterone receptor status, p53 immunoreactivity and high ki-67 expression with immunohistochemistry. in addition, the methylation index of p16ink4a was significantly higher in the cancer patients than the normal controls (p<0.001).conclusionshigh p16 immunoreactivity correlated with a loss of differentiation in breast carcinomas and high frequency of p16ink4a promoter methylation in both invasive and intraductal carcinomas, suggesting it may be involved in the pathogenesis of breast cancer. |
larvae of d. pini and n. sertifer were collected in northern italy. in detail, a total of 300 larvae of d. pini were collected on pinus sylvestris plants in 2007, in two sampling sites in the municipalities of san martino in monte (bolzano county) and san dorligo (trieste county) della valle (trento county). a further sampling was performed in 2007 in the municipality of velturno (bolzano county). in this occasion, 42 larvae of d. pini were sampled and used to establish a colony called dpini2. a third colony of individuals, named dpini12, was created by the mating of two females of the dpini2 line, one male of dpini1, and one male of dpini2 ; these four individuals derived from the first generation of each population. additionally, 35 n. sertifer cocoons were collected in ozzano dellemilia (bologna county) in 2007, and four of them resulted to be parasitized by da. the rearing was performed as follows : d. pini larvae from the third to the last instar (fourth instar for males and fifth for females) and n. sertifer cocoons were placed in an artificial cell at a constant temperature of 20c, with a relative humidity of 80%, and a photoperiod of 17 h on white neon light (philips tl - d master 58w/84, philips, amsterdam, netherlands). after measuring the development time of the insects at 20c, we studied the effects of higher temperatures on development. two heat treatment experiments were performed each on 15 d. pini by increasing the rearing temperature. the first experiment consisted of a stable increase in the rearing temperature to 25c, while the second consisted of an increase to 30c for three intervals of 24 h separated by 48 h at 20c. fuscipennis was reared only on n. sertifer, at the conditions described earlier. in total, 30 individuals of n. sertifer (17 males and 13 females), 30 of da. fuscipennis (11 males and 19 females), and 50 individuals of d. pini (20 females, 20 males, and 10 gynandromorphs) were subjected to molecular screening for the presence of symbionts (see table 1 for details). all individuals were stored in absolute ethanol, then washed in sterile water, homogenized with a sterile pestle, and processed for dna extraction using a commercial kit (dneasy blood & tissue kit, qiagen, hilden, germany) following manufacturer s instructions. a molecular screening was performed on the extracted dnas to investigate the presence of endosymbiotic bacteria belonging to the genera wolbachia and cardinium. three specific polymerase chain reaction (pcr) protocols, targeting two different wolbachia genes (16s rdna and ftsz) and one cardinium gene (16s rdna), respectively, were applied, using previously published assays (casiraghi. a subset of the wolbachia - related pcr products (1,393 and 735 bp, respectively) was sequenced using applied biosystems (abi) technology. phylogenetic analysis was performed on the obtained sequences, using an in - house pipeline comprising muscle (edgar 2004), gblocks (castresana 2000), and phyml (guindon. 2010). table 1.number of male, female, and gynandromorph d. pini individuals for each of the three laboratory colonies for each generationcolonylaboratory line 1 (dpini1)laboratory line 2 (dipini2)laboratory line 3 (12) (dpini3)sexmfgynmfgynmfgyngeneration 0168 (2)111 (4)21 (2)192034 (2)11 (2)1generation i143101468 (2)35 (4)12 (2)111generation ii131532091114generation iii119171010generation iv44 (4)52 (2)7 (2)19 (2)84 (2)8generation v18455313651generation vi1442120generation vii52 (4)10 (4)7 (2)83 (4)33 (2)26 (2)total gyn / total individual60/77916/187101/426gyn, gynandromorph ; f, female ; m, male. number of male, female, and gynandromorph d. pini individuals for each of the three laboratory colonies for each generation gyn, gynandromorph ; f, female ; m, male. in d. pini, the sexual dimorphism is strong, and the marked differences between males and females allow the identification of gynandromorphic individuals in the population and a detailed description of the distribution of male and female tissues on the soma of abnormal specimens. in the laboratory - reared d. pini colonies, gynandromorphic individuals were described and the distribution of male and female tissues in these individuals was reported. in each individual, the male and female areas can be distributed in a strikingly bilateral way, patchily or uniformly mixed. in particular, we annotated the frequency of somatic alterations in each body segment (head, thorax, abdomen, and external genitalia) in these individuals. the distribution of the three tissue types is described with different colors : male (black), female (white), and mosaic (gray ; see fig. 1 for an example pattern). 1.dorsal and ventral vision representing the tissue distribution of a gynandromorphic individual : male (black), female (white), and gynandromorph (gray). dorsal and ventral vision representing the tissue distribution of a gynandromorphic individual : male (black), female (white), and gynandromorph (gray). we applied a pearson s chi - square test to evaluate any significant differences between the frequencies of gynandromorphic individuals in the three different d. pini populations. the test was applied between the frequency of gynandromorphs and normal individuals, respectively, in dpini1 and dpini2 and between each of the two populations and the inbreed line dpini12 (2 2 contingency table, 1 df). we investigated the presence of two insect symbionts, wolbachia and cardinium, in the three different d. pini populations. cardinium was never detected in any of the sampled individuals, whereas all d. pini samples investigated resulted positive to wolbachia. fuscipennis were also tested for the presence of two endosymbionts, and both resulted positive to wolbachia with 100% prevalence and negative to cardinium. see table 1 for a detailed description of the examined individuals, sexes, and rearing generations. partial 16s rdna and ftsz wolbachia gene sequences were generated from individuals belonging to the three species investigated in this study (d. pini, n. sertifer, and da. all the obtained sequences showed 100% identity between them, excluding artifacts, indicating that we detected a single wolbachia strain that presents a high capacity of colonizing the three examined hymenopteran species. gene sequences were submitted to the national center for biotechnology information (ncbi) database under the accession numbers he814622 (978 bp) and he814623 (690 bp), respectively, for 16s rdna and ftsz. phylogenetic analyses were performed aligning the obtained ftsz gene sequence with the homologous sequences of 21 wolbachia strains retrieved from the database. the resulting tree (fig. 2) shows that the novel strain belongs to the a wolbachia supergroup (casiraghi. 2005) and that it is most closely related with two other wolbachia strains, one infecting a member of diptera (drosophila borealis) and one infecting a member of hymenoptera (technomyrex albipes). the name of the host species and the sequence accession number are indicated on each branch. the name of the host species and the sequence accession number are indicated on each branch. we performed two heat treatments on the colony of d. pini to investigate the effect of temperature increase on the presence of wolbachia. in fact, it has been shown in the literature that an increase in temperature can be an effective way to cure wolbachia infection (van opijnen and breeuwer 1999, sakamoto. additionally, it must be considered that to complete the d. pini biological cycle under standard laboratory experimental conditions (bombosch and ramakers 1976, eichhorn. 1976, kpke. 2010), an average time of 60 d is required (16-d embryonic, 28-d larval, and 16-d pupal developments). for the first treatment, the temperature was set up at 25c, resulting in a complete biological cycle of 48 d instead of 60 d, but with a great reduction of success in egg hatching. the second heat treatment (30c) led to interruption of development of the d. pini larvae. in fact, none of the larvae subjected to the treatment were able to molt into adults. molecular screening on these larvae revealed that wolbachia had been eliminated (all 11 tested larvae were negative to both wolbachia - specific pcrs). further studies should be carried out to establish whether these effects are due to the absence of wolbachia symbionts or simply to the temperature increase. to study the effects of inbreeding on production of gynandromorphs, three different populations of d. pini were followed under controlled laboratory conditions for up to seven generations. we succeeded in maintaining the two field - derived colonies (dpini1 and dpini2), respectively, for seven and three generations, whereas the third colony (dpini12), obtained from a cross between individuals of the two colonies, was more successful and was interrupted after seven generations, while still actively reproducing. in all experimental populations, the total number of gynandromorphs was 177 of 1,392 individuals (mean frequency, 0.12) : 60/719 in dpini1 (mean frequency, 0.08), 16/187 in dpini2 (mean frequency, 0.08), and 101/426 in dpini12 (mean frequency, 0.23). in the laboratory - interbred population of d. pini (dpini12), indeed, we registered a statistically significant difference in the frequency of gynandromorphs within the population of the line dpini12 compared with both dpini1 (= 60.956 ; 2 2 contingency table ; 1 df ; two - tailed p < 0.0001) and dpini2 (= 19.321 ; 2 2 contingency table ; 1 df ; two - tailed p < 0.0001), whereas there is no significant difference in the frequencies of gynandromorphs between the lines dpini1 and dpini2 (= 0.152, 1 df, two - tailed p = 0.6969). in the majority of gynandromorphic individuals (90.3%), we reported a complex pattern of external male, female, or gynandromorphic tissues distributed in more than one body district (see fig. 1 for an example pattern). worthy of note, external genitalia were frequently affected by gynandromorphism (61/177 = 34.5%). we investigated the presence of wolbachia and cardinium symbionts in d. pini, n. sertifer, and da. our results indicate the presence of wolbachia in all examined individuals of all three hymenopteran species, whereas cardinium was not found in any of the examined samples. although 100% prevalence of wolbachia in individuals collected in the wild suggests a complete pervasiveness of the symbiont in the examined species, additional sampling from different geographical sites would be required to allow a definitive conclusion on this issue. the second part of the study was focused on d. pini to investigate the occurrence of gynandromorphism in wild and laboratory populations. finally, heat treatments were performed in d. pini to try to evaluate whether removal of the wolbachia symbionts was possible and whether this would have an effect on the host, particularly in terms of frequency of occurrence of gynandromorph individuals. we were not able to link the presence of gynandromorphic individuals in d. pini to the presence of wolbachia because these bacteria are always present in all investigated individuals (i.e., males, females, and gynandromorphs). the lack of genetic variability between bacteria of the genus wolbachia recorded in d. pini, n. sertifer, and da. fuscipennis were reared on n. sertifer in our laboratory, the acquisition of wolbachia in the parasitoid could also be explained through an event of symbiont transfer between these two species. fuscipennis were reared separately from d. pini populations, so we can exclude the occurrence of horizontal transfer between the laboratory populations. nevertheless, horizontal wolbachia transmission from infected to uninfected individuals within (intraspecific) and between (interspecific) host species has been previously observed both in the laboratory and over evolutionary timescales (cordaux. horizontal transmission allows wolbachia to infect several host species and contributes to its vast host range. interspecific horizontal transmission has been reported, e.g., in wasps of the genus trichogramma (huigens. we can hypothesize that the wolbachia strain detected in this study was horizontally transferred between the three analyzed hymenopteran species in the wild. it seems reasonable to hypothesize that the parasitoid behavior is involved in this pattern of transmission. fuscipennis could have acquired the bacteria while feeding on the caterpillar of diprionid wasps, and it could also have transmitted it to additional hosts. for this model to be acceptable, the efficiency of infestation of the parasitoid must be < 100% ; otherwise, all infected host individuals would be killed by the infestation. a study on 16 caterpillar species highlighted the existence of immune response mechanisms that allow the host to survive parasitoid infestations (smilanich. we currently can not conclude which was the original host of the detected wolbachia strain or whether the symbiont exerts specific effects on the three hosts. wolbachia infection in a parasitoid was previously reported in the uzifly, exorista sorbillans (wiedemann) (diptera : tachinidae), which parasitizes the silkworm, bombyx mori (l.) (lepidoptera : bombycidae). administration of tetracycline to the adult uziflies removed wolbachia endosymbionts and resulted in several reproductive disorders. however, tetracycline treatment did not show marked effects on the life expectancy of the uzifly (puttaraju and prakash 2005). developmental defects, which occur at low frequencies under natural conditions, can lead to morphologically anomalous individuals with both male and female traits. even though gynandromorphic individuals are described in many insect taxa (sassaman and fugate 1997, narita. 2010), the specific mechanisms and driving forces causing this peculiar developmental abnormality are not known. in the examined populations of d. pini, the phenomenon of gynandromorphism occurred with a high frequency in the three populations (8% in dpini1 and dpini2 and 23% in dpini12, respectively) with marked variability throughout different generations. hence, random events, such as the occurrence of binucleate eggs, dispermy / polyspermy, reduction / duplication of the chromosome number, and loss of part of the genetic material, implicated in cases of gynandromorphism in natural and laboratory populations of other arthropods (kamping. 2007, narita. 2010, ford 2012), unlikely explain the recurrence of this condition in d. pini. environmental temperature is considered another key factor involved in gynandromorphism occurrence in arthropods (narita. in fact, increase in temperature has been demonstrated as an important factor for the production of gynandromorphic individuals in ooencyrtus submetallicus (wilson 1962). in the parasitic wasp nasonia vitripennis, the proportion of gynandromorphic individuals can also be increased by exposing the mother or early - stage embryos to high temperature (kamping. the three different d. pini populations were kept for the whole duration of the main experiment at a constant temperature (20c) inside the rearing cell. under these persistent conditions, we could appreciate a high variability in the number of gynandromorphic individuals between the different generations. unfortunately, our studies on the experimental increase in rearing temperature of d. pini were not sufficient to elucidate the role of this factor in d. pini because these experiments highly decreased the hatching success of the eggs and increased the larval mortality rate (25c), and they also blocked the development of adults (30c). the association between the presence of wolbachia and the occurrence of gynandromorphism and other developmental abnormalities has been proposed in diverse arthropod groups (pereira. 2003). intriguingly, a partial wolbachia reduction using antibiotics led to the appearance of ostrinia scapulalis (walker) intersexes having exclusively male genotype (kageyama and traut 2004). in zyginidia pullula (hemiptera : these feminized males are characterized by intersexual phenotypes, females presenting upper pygofer appendages, a typical male secondary sexual feature (negri. another example can be found in the isopod armadillidium vulgare, where a conflict between feminizing sex ratio distorters and autosomal masculinizing genes can be traced to the origin of intersexes (rigaud and juchault 1993). in the case of d. pini, a possible link between the presence of wolbachia and the occurrence of gynandromorphism remains an issue to be clarified with specific experiments, such as the use of antibiotics. besides, the possible discovery of wolbachia - free populations of d. pini could also shed light on the mechanisms leading to gynandromorphism in this species. the findings presented here spring a number of intriguing questions to be answered before a full picture of the many genetically ecological and evolutionary aspects of gynandromorphism in d. pini will be clarified. fruit fly wolbachia strains were demonstrated to be able to invade and prosper in mosquito populations, also reducing adult host lifespan, affecting host reproduction, and interfering with pathogen replication (iturbe - ormaetxe. our work on the presence of wolbachia endosymbionts in the three hymenopteran species represents an initial step for potential biocontrol applications. | sawflies are important pests of various plant species. diprion pini (l.) and neodiprion sertifer (geoffroy) (hymenoptera : diprionidae) are two of the most important sawfly pests in italy, and both species are parasitized by the hymenopteran parasitoid dahlbominus fuscipennis (zetterstedt). bacterial endosymbionts are currently studied for their high potential in strategies of biocontrol in a number of insect species. in this study, we investigated the presence of symbiotic bacteria (wolbachia and cardinium) in the three species of hymenoptera mentioned earlier, both in wild and laboratory populations. although all samples were negative for the presence of cardinium, 100% prevalence for wolbachia was detected, as all examined individuals resulted to be pcr positive. furthermore, 16s rdna and ftsz gene sequencing indicated that all individuals from the three hymenopteran species are infected by a single wolbachia strain. additionally, we report the presence of gynandromorphic individuals in d. pini, both in wild and laboratory - reared populations. heat treatments on d. pini colonies removed the wolbachia symbionts, but they also prevented the development of adults. |
twenty - three pgdm and eight women without any risk factors for type 2 diabetes serving as controls (con) were recruited from the outpatient service of the division of endocrinology and metabolism, department of internal medicine iii, medical university of vienna. gdm was diagnosed according to the criteria of the fourth workshop conference of gestational diabetes. the women were continuously seen in the outpatient service so that all data on diagnosis and treatment were recorded and validated. fifteen pgdm had been on insulin therapy (it), and eight pgdm had been on diet treatment (dt) only. they were instructed to ingest an isocaloric diet (carbohydrate / protein / fat : 60/20/20%) and refrain from any physical exercise during the 3 days preceding the examinations. metabolic tests were performed on different days during the first phase (days 58) of the menstrual cycle after 1012-h overnight fasting. all participants gave written informed consent to the protocol, which had been approved by the institutional ethics board of the medical university of vienna. a solution containing 75 g of glucose was ingested within 2 min, and venous blood samples were collected for measurements of glucose and hormones. during fasting, insulin sensitivity was assessed with the quantitative insulin - sensitivity check index (quicki) = 1/[log(fasting - glucose) + log(fasting - insulin) ], which mostly indicates hepatic insulin sensitivity (11). under dynamic conditions, the oral glucose insulin sensitivity (ogis) index (12) was used, which quantifies glucose clearance per unit change of insulin and has been validated against the glucose clamp (12,13) and in terms of reproducibility and variability (14). the ogis correlates more closely with total glucose disposal than with hepatic insulin sensitivity in a study directly comparing the glucose clamp with the oral glucose tolerance test (ogtt) (11). thus, we used ogis as a measure of whole - body insulin sensitivity during glucose ingestion. insulin delivered into peripheral circulation was assessed with the total area under the insulin concentration curve (aucins), calculated with the trapezoidal rule. an integrated index of -cell function (adaptation index), as its ability to compensate insulin resistance by increasing insulin release, was calculated as ogis auccp, where auccp is the suprabasal area under the c - peptide concentration curve. in addition, the frequent sampling intravenous glucose tolerance test was performed and analyzed for assessing si as a measure of insulin sensitivity and disposition index, di = si airgluc as a measure of combined effects of insulin secretion and sensitivity on glucose disposal as described previously (15). measurements were performed in participants lying supine inside a 3-t whole - body spectrometer (bruker biospin, ettlingen, germany). 1) p mrs (magnetic resonance spectroscopy) : a 10-cm circular double - resonant surface coil was positioned over the medial head of the right gastrocnemius muscle. intramyocellular concentrations of inorganic phosphate and atp, as well as rate constant (katp) and unidirectional fatpase, using the saturation transfer experiment, were measured as described (4,16). 2) h mrs : a 10-cm, circular, double - resonant surface coil was applied above the right soleus muscle to measure imcl from localized h spectra using the series stimulated echo acquisition mode sequence within a volume of interest of 1.73 cm (5). hcl were quantified using the stimulated echo acquisition mode within a volume of interest of 27 cm (5). body fat mass (bfm) was assessed from bioimpedance analysis (akern - rjl systems, florence, italy). prediction errors of body composition equations estimating percent fat free mass are based on empirically derived measurement errors associated with the reference method, hydrodensitometry. resting energy expenditure (ree) tokyo, japan), hba1c (a1c) was measured by high - performance liquid chromatography (variant hemoglobin testing system, hercules, ca), and ultrasensitive c - reactive protein was measured by particle - enhanced immunonephelometry (n high - sensitivity - crp reagent, bn systems ; dade behring, deerfield, il). fasting plasma adiponectin was measured in duplicate using an enzyme - linked immunosorbent assay system (otsuka pharmaceutical co. ltd. relationships among fatpase, imcl, hcl, insulin sensitivity, and metabolic and inflammatory parameters were further analyzed in pgdm and con, insulin - sensitive (is) subjects (n = 15), insulin - resistant (ir) subjects (n = 16), insulin - sensitive (pgdm - is, n = 9), and insulin - resistant pgdm (pgdm - ir, n = 14). the cutoff value (462.8 ml m) for insulin resistance was derived from ogis values in control women of this study and other studies. the lowest quantile of the distribution gave the value defined as cutoff point between normal and impaired (lower) ogis. further, all women and pgdm were divided into three groups according to ogis tertiles. data are presented as means sd in text and tables or box - and - whisker plots in figures. the tukey test was applied for post hoc testing, and the wilcoxon rank - sum test was applied for nonparametric parameters. twenty - three pgdm and eight women without any risk factors for type 2 diabetes serving as controls (con) were recruited from the outpatient service of the division of endocrinology and metabolism, department of internal medicine iii, medical university of vienna. gdm was diagnosed according to the criteria of the fourth workshop conference of gestational diabetes. the women were continuously seen in the outpatient service so that all data on diagnosis and treatment were recorded and validated. fifteen pgdm had been on insulin therapy (it), and eight pgdm had been on diet treatment (dt) only. they were instructed to ingest an isocaloric diet (carbohydrate / protein / fat : 60/20/20%) and refrain from any physical exercise during the 3 days preceding the examinations. metabolic tests were performed on different days during the first phase (days 58) of the menstrual cycle after 1012-h overnight fasting. all participants gave written informed consent to the protocol, which had been approved by the institutional ethics board of the medical university of vienna. a solution containing 75 g of glucose was ingested within 2 min, and venous blood samples were collected for measurements of glucose and hormones. during fasting, insulin sensitivity was assessed with the quantitative insulin - sensitivity check index (quicki) = 1/[log(fasting - glucose) + log(fasting - insulin) ], which mostly indicates hepatic insulin sensitivity (11). under dynamic conditions, the oral glucose insulin sensitivity (ogis) index (12) was used, which quantifies glucose clearance per unit change of insulin and has been validated against the glucose clamp (12,13) and in terms of reproducibility and variability (14). the ogis correlates more closely with total glucose disposal than with hepatic insulin sensitivity in a study directly comparing the glucose clamp with the oral glucose tolerance test (ogtt) (11). thus, we used ogis as a measure of whole - body insulin sensitivity during glucose ingestion. insulin delivered into peripheral circulation was assessed with the total area under the insulin concentration curve (aucins), calculated with the trapezoidal rule. an integrated index of -cell function (adaptation index), as its ability to compensate insulin resistance by increasing insulin release, was calculated as ogis auccp, where auccp is the suprabasal area under the c - peptide concentration curve. in addition, the frequent sampling intravenous glucose tolerance test was performed and analyzed for assessing si as a measure of insulin sensitivity and disposition index, di = si airgluc as a measure of combined effects of insulin secretion and sensitivity on glucose disposal as described previously (15). measurements were performed in participants lying supine inside a 3-t whole - body spectrometer (bruker biospin, ettlingen, germany). 1) p mrs (magnetic resonance spectroscopy) : a 10-cm circular double - resonant surface coil was positioned over the medial head of the right gastrocnemius muscle. intramyocellular concentrations of inorganic phosphate and atp, as well as rate constant (katp) and unidirectional fatpase, using the saturation transfer experiment, were measured as described (4,16). 2) h mrs : a 10-cm, circular, double - resonant surface coil was applied above the right soleus muscle to measure imcl from localized h spectra using the series stimulated echo acquisition mode sequence within a volume of interest of 1.73 cm (5). hcl were quantified using the stimulated echo acquisition mode within a volume of interest of 27 cm (5). body fat mass (bfm) was assessed from bioimpedance analysis (akern - rjl systems, florence, italy). prediction errors of body composition equations estimating percent fat free mass are based on empirically derived measurement errors associated with the reference method, hydrodensitometry. resting energy expenditure (ree) tokyo, japan), hba1c (a1c) was measured by high - performance liquid chromatography (variant hemoglobin testing system, hercules, ca), and ultrasensitive c - reactive protein was measured by particle - enhanced immunonephelometry (n high - sensitivity - crp reagent, bn systems ; dade behring, deerfield, il). fasting plasma adiponectin was measured in duplicate using an enzyme - linked immunosorbent assay system (otsuka pharmaceutical co. ltd., relationships among fatpase, imcl, hcl, insulin sensitivity, and metabolic and inflammatory parameters were further analyzed in pgdm and con, insulin - sensitive (is) subjects (n = 15), insulin - resistant (ir) subjects (n = 16), insulin - sensitive (pgdm - is, n = 9), and insulin - resistant pgdm (pgdm - ir, n = 14). the cutoff value (462.8 ml min m) for insulin resistance was derived from ogis values in control women of this study and other studies. the lowest quantile of the distribution gave the value defined as cutoff point between normal and impaired (lower) ogis. further, all women and pgdm were divided into three groups according to ogis tertiles. statistical analyses were performed using sas software 9.1.3 (sas institute, inc., cary, nc). data are presented as means sd in text and tables or box - and - whisker plots in figures. the tukey test was applied for post hoc testing, and the wilcoxon rank - sum test was applied for nonparametric parameters. all women had normal glucose tolerance based on the 75-g ogtt and comparable habitual physical activities according to baecke s questionnaire (table 1). this also held true for pgdm - ir, but not for pgdm - is. adjustment for clinical characteristics and metabolic parameters (means sd) of women with pgdm and their insulin - resistant (pgdm - ir) and insulin - sensitive (pgdm - is) subgroups compared with control subjects (con) ir was defined by means of ogis 0.2) and in pgdm alone (p > 0.4). katp was not different between pgdm and con (0.06 0.02 1/s vs. 0.07 0.01 1/s ; p = 0.1) or between subgroups (pgdm - ir vs. pgdm - is : 0.06 0.02 1/s vs. 0.06 0.02 1/s ; p = 0.6). fatpase was also comparable between pgdm with and without insulin therapy (it) during their pregnancies. 2a), but 61% higher in pgdm - ir than in pgdm - is (p 0.2) and in pgdm alone (p > 0.4). katp was not different between pgdm and con (0.06 0.02 1/s vs. 0.07 0.01 1/s ; p = 0.1) or between subgroups (pgdm - ir vs. pgdm - is : 0.06 0.02 1/s vs. 0.06 0.02 1/s ; p = 0.6). fatpase was also comparable between pgdm with and without insulin therapy (it) during their pregnancies. 2a), but 61% higher in pgdm - ir than in pgdm - is (p < 0.05). among all women, ir women had 69% higher imcl than is women (p < 0.007 ; fig. pgdm on it during their pregnancies had higher imcl than those on diet treatment (dt) (it vs. dt : 0.86 0.29% vs. 0.51 0.25%, p = 0.01). ectopic lipids in skeletal muscle (imcl ; a and c) and liver (hcl ; b and d) of pgdm compared with con (a and b) and in ir and is subgroups of the total cohort according to their insulin sensitivity (ogis) (c and d). boxes delineate lower and upper quartile, whiskers represent minima and maxima, respectively, medians are indicated by solid line within boxes, and small circles / asterisks represent experimental outliers. imcl : pgdm vs. con (0.73 0.32% h2o vs. 0.69 0.5% h2o ; p = 0.08 ns) hcl : pgdm vs. con (3.7 3.5% vs. 1.5 0.9% signal ; p < 0.05) imcl : ir vs. is (0.90 0.3% h2o vs. 0.54 0.32% h2o ; p < 0.003) hcl : ir vs. is (4.0 3.3% vs. 2.0 1.8% signal ; p < 0.05). 2b). likewise, hcl were twice as high in ir than in is subjects (p < 0.05 ; fig. 2d), but not different among pgdm subgroups. adjusting for bfm diminished these differences. hcl were not different between pgdm with or without it during pregnancy (dt vs. it : hcl 4.8 5.0% signal vs. 3.1 2.4% signal). partial correlation analysis, controlled for bfm, revealed a relationship between fatpase and plasma adiponectin across all women (p < 0.04, r = 0.44). fatpase did not relate to measures of insulin sensitivity (ogis : r = 0.002, si : r = 0.07) or glucose tolerance (aucgluc : r = 0.005) in any subgroup. however, the disposition index related to hcl (r = 0.59, p = 0.002) and fatpase (r = 0.37, p = 0.04) in all women. fasting plasma ffa did not relate to fatpase, whereas 2-h postload plasma ffa related to hcl (r = 0.59, p = 0.01) and insulin sensitivity as assessed from ogis (r = 0.44, p = 0.04) or si (r = 0.42, p = 0.04) in pgdm. hcl related to insulin sensitivity (r = 0.47, p < 0.02) across all women and to imcl (r = 0.59, p = 0.05) and a1c across ir (r = 0.64, p < 0.03). after adjustment for bfm, hcl still related to a1c (r = 0.57, p < 0.02) in all women. within pgdm, the correlation of hcl with hip circumference (r = 0.59, p = 0.04) and a1c (r = 0.62, p = 0.03) remained after adjustment for bfm. we found that myocellular fatpase is lower in pgdm than in con and does not relate to insulin sensitivity or imcl, but correlates positively with plasma adiponectin across all women, suggesting a yet unknown relationship between energy metabolism and adipocyte function. hcl were greater in pgdm, and hcl and postload ffa were negatively related to insulin sensitivity. our pgdm featured slightly greater fat mass, postload glycemia, and insulin resistance than con. except for hdl - cholesterol, they did not differ from con in other variables, including physical activity and resting energy expenditure. this held true even for pgdm - ir, suggesting that this cohort is at lower risk for type 2 diabetes than other mostly obese and glucose - intolerant pgdm, but already exhibits distinct metabolic features. we found moderately lower myocellular fatpase in pgdm compared with con, which was significant only on log - transformation. our cohort was carefully matched to con, except for insulin sensitivity, and probably bears a low risk for rapid progression to diabetes. the observed small differences could also be due to this specific cohort maintaining normal glucose tolerance for up to 4 years postpartum. the difference in fatpase between pgdm and con, however, vanished on correction for bfm and was not found when comparing pgdm - ir with pgdm - is. although one might speculate that the reduction of fatpase resulted from greater body fat content as reported for obese insulin - resistant and overweight type 2 diabetes cohorts (17), our data do not allow such a conclusion. basal fatpase, the final step of mitochondrial oxidative phosphorylation, is impaired only in some cohorts presenting with severe insulin resistance and elevated imcl, such as elderly and lean relatives of patients with type 2 diabetes (4). the overall higher insulin sensitivity compared with other populations at risk for or having overt type 2 diabetes (5,6,18) suggests that muscle metabolism was almost normal in our pgdm. the finding that imcl were not different between pgdm and con, but 69% higher in ir than is, underlines the contention that imcl generally correlate with insulin resistance (8,19) and can be elevated in patients with type 2 diabetes and their insulin - resistant first - degree relatives (4). further, the pgdm of our previous study exhibited higher imcl along with greater insulin resistance and bfm (8). of note, baseline fatpase is not necessarily different in patients with overt type 2 diabetes (5,6), indicating that mitochondrial dysfunction is not a uniform feature of type 2 diabetes (5). the increase in imcl relates to not only diminished mitochondrial capacity for oxidative phosphorylation but also lipid availability. plasma ffa elevation decreases insulin - stimulated fatpase and insulin sensitivity before changes in imcl (16). of note, postchallenge plasma ffas were not different between pgdm and con and only slightly higher in ir - pgdm than in is - pgdm. the increase in insulin secretion further argues against mitochondrial dysfunction at the level of the -cell, which has been observed in gdm and some pgdm (20). despite the only discrete alterations in muscular metabolism, liver fat content was more than double in all pgdm and even three times more in ir - pgdm compared with that in con, which was still below the detection limits of clinical routine ultrasound. higher hcl have been reported in obese pgdm (9) and type 2 diabetic patients, in whom hcl tightly correlate with whole - body and hepatic insulin resistance (5). steatosis even predicts the development of insulin resistance, type 2 diabetes, and cardiovascular end points (1,21). of note, similar to skeletal muscle, impaired mitochondrial function has been recently detected in livers of patients with type 2 diabetes (1,22). it has been proposed that primary muscular insulin resistance promotes shifting of ingested carbohydrates away from skeletal muscle to hepatic de novo lipogenesis, thereby increasing hcl independently of obesity (18). alternatively, steatosis and/or impaired hepatic mitochondrial function could lead to muscular insulin resistance (1,22). we can not address this issue directly, because liver biopsies are not permitted in healthy humans and noninvasive assessment with in vivo p mrs was not available. in pgdm, the 2-h post - glucose load plasma ffa further correlated positively with hcl and negatively with whole - body insulin sensitivity. even after correction for bfm, pgdm and of note, despite the greater bfm, none of the anthropometric parameters reached the cutoff values of the metabolic syndrome. from this it seems that impaired insulin action in these pgdm is primarily located at the level of the liver and already present in the glucose - tolerant state. steatosis may result not only from abnormal fat metabolism but also from disturbed cytokine release. of note, pgdm exhibit higher hcl and lower plasma adiponectin, which is a sensitive predictor for future deterioration of glucose metabolism (10). adiponectin has been linked to improved muscular and hepatic insulin sensitivity, which might result from anti - inflammatory and antiatherogenic activity, decreased triglyceride synthesis, and stimulated -oxidation (2). adiponectin may also increase muscular mitochondrial number and function, and exert antidiabetic effects (23). in support of this contention, the current study showed that plasma adiponectin relates positively to fatpase in all women after adjustment for bfm. moreover, prevention of the development of type 2 diabetes in pgdm by thiazolidinediones (24,25) could be mediated by increased plasma adiponectin with subsequent reduction of hcl and hepatic and peripheral insulin resistance. in addition, primary abnormal hepatic mitochondrial function could lead to steatosis, because patients with type 2 diabetes have reduced hepatocellular atp levels that correlate with hepatic insulin sensitivity and hcl (22). the limitations of the study are the small sample size and the specific selection of pgdm, which restrict the extrapolation of the results to all pgdm. on the other hand, the selected group underwent intensive phenotyping, including tissue - specific metabolic assessment. in summary, glucose - tolerant nonobese pgdm do not show major alterations of muscle glucose and energy metabolism, but already exhibit a subclinical increase of liver fat content suggesting early abnormalities or adaptations of hepatic metabolism. | objectiveectopic lipid storage in muscle (intramyocellular lipids [imcl ]) and liver (hepatocellular lipids [hcl ]) coexists with impaired myocellular flux through atp synthase (fatpase) in certain cohorts with increased risk of type 2 diabetes. because women with a history of gestational diabetes mellitus (pgdm) have elevated ectopic lipids and diabetes risk, we tested whether deteriorated energy metabolism contributes to these abnormalities.research design and methodsa total of 23 glucose - tolerant nonobese pgdm and eight women with normal glucose metabolism during pregnancy with similar age, body mass, and physical activity underwent oral glucose tolerance tests (ogtt) and intravenous glucose tolerance tests at 45 years after delivery. ogtt values < 463 ml min1 m2 were considered to indicate insulin resistance. pgdm were further stratified into insulin - resistant (pgdm - ir) and insulin - sensitive (pgdm - is) groups. imcl, hcl, and fatpase were measured with 1h/31p magnetic resonance spectroscopy.resultspgdm had 36% higher fat mass and 12% lower insulin sensitivity. log - transformed fatpase was lower in pgdm (10.6 3.8 mol ml muscle1 min1 vs. 12.1 1.4 mol ml muscle1 min1, p < 0.03) and related to plasma adiponectin after adjustment for body fat (r = 0.44, p < 0.04). imcl were 61% and 69% higher in pgdm - ir (p < 0.05 vs. pgdm - is) and insulin resistant women (p < 0.003 vs. insulin sensitive), respectively. hcl were doubled (p < 0.05) in pgdm and insulin resistant women, and correlated positively with body fat mass (r = 0.50, p < 0.01) and inversely with insulin sensitivity (r = 0.46, p < 0.05).conclusionsglucose - tolerant pgdm show increased liver fat but only slightly lower muscular insulin sensitivity and atp synthesis. this suggests that alteration of hepatic lipid storage represents an early and predominant abnormality in this cohort. |
in the past decade, cardiac resynchronization therapy (crt) has become an important treatment option for symptomatic heart failure patients with reduced left ventricular (lv) ejection fraction and abnormal qrs duration mostly in the form of left bundle branch block (lbbb). until recently, little was known about the pathophysiology of the conduction disease and its adverse effects on ventricular contractility. large clinical trials have shown that crt benefits most patients but approximately one third of patients to not show clinical or echocardiographic response. furthermore, further analysis of these studies show that the amount of responders was considerably higher in patients with lbbb as compared with patients without this conduction disease. this interest is further enforced by the difficulties of echocardiographic mechanical dyssynchrony measurements to adequately predict crt response. insight in electrical activation during lbbb and ventricular pacing during crt has steadily increased over the last few years. lbbb appears to be the hallmark conduction disease that is treatable by crt independently from etiology, as evidenced by efficacy of crt in canine hearts with isolated lbbb and in crt patients with lbbb compared to crt patients with other conduction disorders [2, 3 ]. it is also becoming increasingly apparent that the site of lv stimulation, the electrical and mechanical activation patterns, and the presence of little or no scar are all critical for crt success. in this paper, why these aspects are important for the delivery of a successful therapy is also shown. one hundred years ago, eppinger and tothberger reported distinctive changes in qrs morphology after the destruction of only a small region in the interventricular septum in canine hearts. since the esophageal - to - rectal leads in the dogs were directly extrapolated to leads ii and iii in human patients, lbbb too was erroneously diagnosed as right bundle branch block (rbbb) and vice versa for 25 years. this misinterpretation illustrates the fact that the conduction disease was not considered important, and lbbb was solely considered a sign of poor prognosis. only later it was discovered that most patients with lbbb who died shortly after diagnosis died of underlying heart disease and that the conduction disease on its own was not as dangerous as previously believed. it was not until 1972 that the anatomy of the left bundle branch (lbb) was described in more detail. a histopathological study in human patients without known cardiac disease, showed that the lbb is a continuation of the his bundle and initiates between the non - coronary and right - coronary aortic cusps. it runs as a 6 to 10-mm wide ribbon - like structure under the septal endocardium in inferior and anterior directions. the fibers of the lbb fibers then separate to form fasciculi into anterior, posterior, and often septal radiations in heterogeneous patterns. ultimately, the peripheral purkinje fibers are coupled with individual (sub)endocardial myocardial cells which allows fast depolarization of the lv. in isolated human hearts with an intact lbb, extensive electrical mapping showed up to three lv endocardial breakthrough sites which resulted in a rapid electrical activation of the lv. investigation of the electrical activation during lbbb can be performed in patients but is limited by the presence of comorbidities and the lack of knowledge concerning the duration and extent of the lesion (or lesions). animal models can be used to specifically investigate the effects of isolated lbbb as discussed more extensively elsewhere in this edition. examples of three - dimensional activation time maps in a canine heart before and after induction of lbbb are shown in fig. 1. in lbbb, onset of electrical activation occurs inside the right ventricle and the electrical wavefront then slowly propagates through the interventricular septum towards the lateral wall of the lv. as is also shown in a schematic representation of transmural conduction during normal and lbbb conduction in humans (fig. 2), lbbb reverses transseptal activation and causes large changes in qrs morphology and duration. electrocardiographic imaging (ecgi, a novel technique that extracts estimated epicardial activation sequence from body surface maps) shows multiple epicardial conduction patterns in crt candidates with lbbb of which an example is shown in fig. the lv endocardial activation sequence during lbbb has also proven to be heterogeneous in heart failure patients as shown by conventional point - by - point technique or three - dimensional electroanatomical reconstruction contact (carto) and non - contact mapping (ensite) technique. these studies have shown that in lbbb patients with heart failure, lv endocardial breakthrough is heterogenous and may occur at different septal regions [11, 12 ]. in some patients, breakthrough occurred in the mid - septal region, which could suggest activation by slow conduction through the lbb, in some others, via right - to - left transseptal activation as observed in dog models. narula reported in 1977 that by distal his - bundle pacing in the right ventricle, he was able to abolish the electrocardiographic signs of lbbb in 25 patients, thereby curing the conduction disease. in these lbbb patients, the lesions were apparently located proximal in the rapid conduction system, just below the av node.fig. 1typical examples of 3d electrical activation in canine hearts during normal conduction (left panel) and after creation of left bundle branch block (right panel). each electrical activation map is reconstructed using a single - beat recording of simultaneous epicardial and endocardial electrical mapping. epicardial potentials were derived using electrode bands placed around the heart, containing over 100 contact electrodes while the lv endocardium was mapped using custom - made plunge electrodes. early activated regions are indicated by a red color (close to 0 ms) and late activation regions are indicated by a dark blue color (over 100 ms), see color bar. reproduced with permission fig. 2timing of electrical activation (depolarization) wavefronts in normal conduction and during lbbb shown in sagittal view. for reference, two qrs - t waveforms are shown in their anatomic locations (v3 on the chest and avf inferiorly). electrical activation starts at the small arrows and spreads in a wavefront with each colored line representing successive 10 ms. in normal conduction activation only begins in the rv and must proceed through the septum before reaching the lv endocardium. 3epicardial isochrone maps during native rhythm in a patient with lbbb. left anterior escending (lad) coronary artery is shown and the approximate valve region is covered by gray. earliest and latest ventricular activation times (in milliseconds) are indicated by framed numbers. qrsd qrs duration. reproduced with permission typical examples of 3d electrical activation in canine hearts during normal conduction (left panel) and after creation of left bundle branch block (right panel). each electrical activation map is reconstructed using a single - beat recording of simultaneous epicardial and endocardial electrical mapping. epicardial potentials were derived using electrode bands placed around the heart, containing over 100 contact electrodes while the lv endocardium was mapped using custom - made plunge electrodes. early activated regions are indicated by a red color (close to 0 ms) and late activation regions are indicated by a dark blue color (over 100 ms), see color bar. reproduced with permission timing of electrical activation (depolarization) wavefronts in normal conduction and during lbbb shown in sagittal view. for reference, two qrs - t waveforms are shown in their anatomic locations (v3 on the chest and avf inferiorly). electrical activation starts at the small arrows and spreads in a wavefront with each colored line representing successive 10 ms. in normal conduction activation only begins in the rv and must proceed through the septum before reaching the lv endocardium. reproduced with permission epicardial isochrone maps during native rhythm in a patient with lbbb. left anterior escending (lad) coronary artery earliest and latest ventricular activation times (in milliseconds) are indicated by framed numbers. could thus be caused by one or more of the following aspects : (1) the varying structure of the lbb, (2) variability in the location of the lbb block, being either a proximal lesion or a more distal and diffuse disease, (3) lv hypertrophy and fibrosis as associated cellular uncoupling can result in increasing qrs duration and a lbbb - like qrs morphology. the heterogeneous activation patterns seen in heart failure patients with lbbb might in part explain why crt leads to varying amount of response. in addition, mentioned data accentuate the need for patient tailored therapy by carefully selecting the site of pacing and pacing settings. the key clinical investigation to detect and evaluate the extent of ventricular conduction delay remains the surface electrocardiogram. to diagnose lbbb in patients, specific ecg criteria exist in addition to qrs width 120 ms such as a broad notched or slurred r wave in leads i, avl, v5, and v6, an occasional rs pattern in v5 and v6 attributed to displaced transition of qrs complex, and absent q waves in leads i, v5, and v6 (in the absence of a large anterior - apical infarction). note that although scar in the septum causes q waves in v1 to v3 when normal conduction is present, the same scar causes large r waves in v1 to v3 in the presence of lbbb because of unopposed electrical forces in the rv free wall. when these criteria are not met, it is likely that patients have rbbb or slowed conduction by lv hypertrophy. some heart failure patients with rbbb have been shown to have lv conduction delay similar to lbbb patients but large trials have failed to show crt response in these patients [1820 ]. recently, it has been shown that patients with qrs duration > 150 ms and lbbb morphology show the highest response rate in large multicenter trials [21, 22 ]. it should be mentioned however that in most crt trials, patients were required to have qrs duration of at least 120 ms, and approximately one third of these patients did not have lbbb [3, 20 ]. on top of that, one third of patients diagnosed with lbbb by conventional electrocardiographic criteria may not have true complete lbbb but likely have a combination of left ventricular hypertrophy and left anterior fascicular block [9, 23 ]. a recent electrical mapping study showed that true lbbb was only seen in patients with a qrs duration exceeding 140 ms. in the past decade, most efforts focused on finding dyssynchrony parameters to predict crt response were based on echocardiography, which are discussed later in this review. interestingly, recent studies have revamped the interest in using the surface ecg for exactly that purpose. an example is the prospect trial where multiple echocardiography derived dyssynchrony parameters were investigated, followed by a sub - study where various ecg parameters were tested [22, 25 ]. in fact, lbbb morphology was the only parameter that was predictive for both volumetric and clinical response after 6 months (defined by lv end - systolic volume reduction of 15% and improvement in clinical composite score, respectively). in addition, a broad qrs complex during single - site lv pacing was predictive of failure of volumetric response (or = 0.86 per 10 ms increment). in non - ischemic patients, an lv paced qrs width of 200 ms was five times more likely to be associated with a positive response than having a lv paced qrs width greater than 200 ms, while no such difference was found in ischemic patients. the authors of this article postulate that lv paced qrs width may be an indirect method of identifying a region near scar or an area of poor conduction. sweeney. carefully inspected standard 12-lead electrocardiograms of 202 lbbb patients indicated for crt. based on the comparisons of baseline and post - implant electrocardiograms the authors introduced new measurements, which predicted crt response (defined as at least 10% reduction in end - systolic volume as derived by echocardiography at 6 months). a notch, which occurred after 40 ms of qrs onset, was regarded as the transition from rv to lv depolarization and the time difference between this notch and the end of qrs was indicated as the lv activation time (lvatmax). qrs duration was weakly associated with reverse remodeling probability and this relationship was replaced by lvatmax in the multivariable model. a longer lvatmax at baseline was predictive of crt response (or 1.30 for each 10 ms increase up to 125, p = 0.001). the selvester qrs score was used to quantify lv scar and a higher score was detrimental to volumetric response (or 0.49 for each 1 point increase from 0 to 4, p = 0.002). the appearance of anterior forces in the precordial leads after implantation (change in r amplitude in v1 and v2 in expected direction) was also predictive of crt response. an alternative method to estimate lv electrical asynchrony is by calculating the delay between qrs onset and lv lead depolarization. varma found in heart failure patients that this delay exceeded 100 ms in 87% of lbbb patients as compared to 45% of rbbb patients, even though there was no difference in qrs duration. singh. showed that crt patients with a reduced lv lead electrical delay (80%, specificity > 75%, or roc > 0.80) measurements to detect mechanical discoordination caused by ventricular conduction delay, such as lbbb, in crt candidatesauthorparameterdesignpatients (n)ischemic etiology (%) follow - up (months)cut - offechocardiographic measurements of regional delaysoliman (2009) 3d - sdisc, obs90511>10%bax (2004) ts-4sc, obs8055665 msyu (2003) ts - sdi2sc, obs3040332.6 mssuffoletto (2006) 2d - rssc, obs50628130 msechocardiographic measurements of mechanical discoordination and inefficiencyjansen (2007) shuffle and septal motionsc, obs53493nabuss (2009) episc, obs42436859%de boeck (2009) srsseptsc, obs62446.54.7%lim (2008) strain - delaysc, obs6235325%cardiac magnetic resonance measures of dyssynchronybilchick (2008) cure indexsc, obs, control2040/ 80%, specificity > 75%, or roc > 0.80) measurements to detect mechanical discoordination caused by ventricular conduction delay, such as lbbb, in crt candidates 2d - rs speckle tracking radial strain ; 3d - sdi standard deviation of 16 time - volume peaks ; cure index circumferential uniformity ratio estimate ; epi echocardiographic phase imaging ; obs observational ; sc single center ; srs sept systolic rebound stretch in the septum ; ts-4 maximal velocity delay between four basal segments ; ts - sd12 standard deviation of velocity peaks in 12 basal and midventricular segments further development of echocardiographic methodologies coupled with the advances in the field of cardiac magnetic resonance have provided greater depth of understanding in the complex mechanical myocardial wall behavior during lbbb. some additional aspects of the physiology of myocardium wall motion during lbbb should be taken into account. myocardial fiber spatial disposition in three different layers cause the mechanical contractile movement to be nonsymmetrical and in different directions. myocardial contractile thickening has been observed to be longitudinal, circumferential, and radial, thus conferring a movement of torsion during systole. in the context of important ventricular conduction delay such as lbbb it follows therefore that measures evaluating global wall motion or myocardial efficiency in all three different perspectives, rather than regional two - dimensional measures, may be more suitable to characterize contractile mechanics during lbbb. with these notions, echocardiography has manifested a new drive in the last few years with the emergence of new dyssynchrony measures. the most widely used technique for the detection of myocardial deformation by discriminating active from passive wall motion is speckle tracking imaging (sti) strain. by considering the sum of the difference between peak and end - systolic strain across 16 segments (strain delay index), lim. found that longitudinal strain by sti in hf patients with ventricular conduction delay was predictive of crt response. another study by klimusina. utilized segmental peak myocardial strain in heart failure patients derived from speckle tracking and showed that heart failure patients with intraventricular conduction delay presented heterogeneity in longitudinal and radial strain distributions, with amplitudes being particularly low in the septum and higher in the lateral and posterior walls. based on the speckle tracking and resynchronization study (star) for prediction of volume response after crt, roc for circumferential and longitudinal speckle - tracking was 0.59 and 0.57, respectively, whereas that of radial and transverse strain was superior (0.79 and 0.75, respectively). it should be mentioned however that a proportion of patients without detected dyssynchrony nevertheless showed reverse remodeling after crt ; these patients were most likely to present a wide qrs and non - ischemic heart failure etiology. srssept is defined as systolic stretch occurring after initial shortening in the early activated septum. de boeck. showed that srssept strongly correlated with an increase in lv ejection fraction after crt as well as a reduction in lvesv and brain natriuretic peptide. cardiac magnetic resonance is a high resolution image modality which allows complex and global assessment not only of cardiac morphology, but also function. indeed, this imaging modality has emerged to become the gold - standard for the characterization of myocardial contractile behavior. by using mri tagging, time plots of strain are generated for each segment in each short - axis slice, and the circumferential uniformity ratio estimate (cure) is calculated. this ratio considers 0 most dyssynchronous and 1 absence of dyssynchrony. a cure cut - off of 150 ms and lbbb morphology show the highest response rate in large multicenter trials [21, 22 ]. it should be mentioned however that in most crt trials, patients were required to have qrs duration of at least 120 ms, and approximately one third of these patients did not have lbbb [3, 20 ]. on top of that, one third of patients diagnosed with lbbb by conventional electrocardiographic criteria may not have true complete lbbb but likely have a combination of left ventricular hypertrophy and left anterior fascicular block [9, 23 ]. a recent electrical mapping study showed that true lbbb was only seen in patients with a qrs duration exceeding 140 ms. in the past decade, most efforts focused on finding dyssynchrony parameters to predict crt response were based on echocardiography, which are discussed later in this review. interestingly, recent studies have revamped the interest in using the surface ecg for exactly that purpose. an example is the prospect trial where multiple echocardiography derived dyssynchrony parameters were investigated, followed by a sub - study where various ecg parameters were tested [22, 25 ]. in fact, lbbb morphology was the only parameter that was predictive for both volumetric and clinical response after 6 months (defined by lv end - systolic volume reduction of 15% and improvement in clinical composite score, respectively). in addition, a broad qrs complex during single - site lv pacing was predictive of failure of volumetric response (or = 0.86 per 10 ms increment). in non - ischemic patients, an lv paced qrs width of 200 ms was five times more likely to be associated with a positive response than having a lv paced qrs width greater than 200 ms, while no such difference was found in ischemic patients. the authors of this article postulate that lv paced qrs width may be an indirect method of identifying a region near scar or an area of poor conduction. sweeney. carefully inspected standard 12-lead electrocardiograms of 202 lbbb patients indicated for crt. based on the comparisons of baseline and post - implant electrocardiograms the authors introduced new measurements, which predicted crt response (defined as at least 10% reduction in end - systolic volume as derived by echocardiography at 6 months). a notch, which occurred after 40 ms of qrs onset, was regarded as the transition from rv to lv depolarization and the time difference between this notch and the end of qrs was indicated as the lv activation time (lvatmax). qrs duration was weakly associated with reverse remodeling probability and this relationship was replaced by lvatmax in the multivariable model. a longer lvatmax at baseline was predictive of crt response (or 1.30 for each 10 ms increase up to 125, p = 0.001). the selvester qrs score was used to quantify lv scar and a higher score was detrimental to volumetric response (or 0.49 for each 1 point increase from 0 to 4, p = 0.002). the appearance of anterior forces in the precordial leads after implantation (change in r amplitude in v1 and v2 in expected direction) was also predictive of crt response. an alternative method to estimate lv electrical asynchrony is by calculating the delay between qrs onset and lv lead depolarization. varma found in heart failure patients that this delay exceeded 100 ms in 87% of lbbb patients as compared to 45% of rbbb patients, even though there was no difference in qrs duration. singh. showed that crt patients with a reduced lv lead electrical delay (80%, specificity > 75%, or roc > 0.80) measurements to detect mechanical discoordination caused by ventricular conduction delay, such as lbbb, in crt candidatesauthorparameterdesignpatients (n)ischemic etiology (%) follow - up (months)cut - offechocardiographic measurements of regional delaysoliman (2009) 3d - sdisc, obs90511>10%bax (2004) ts-4sc, obs8055665 msyu (2003) ts - sdi2sc, obs3040332.6 mssuffoletto (2006) 2d - rssc, obs50628130 msechocardiographic measurements of mechanical discoordination and inefficiencyjansen (2007) shuffle and septal motionsc, obs53493nabuss (2009) episc, obs42436859%de boeck (2009) srsseptsc, obs62446.54.7%lim (2008) strain - delaysc, obs6235325%cardiac magnetic resonance measures of dyssynchronybilchick (2008) cure indexsc, obs, control2040/ 80%, specificity > 75%, or roc > 0.80) measurements to detect mechanical discoordination caused by ventricular conduction delay, such as lbbb, in crt candidates 2d - rs speckle tracking radial strain ; 3d - sdi standard deviation of 16 time - volume peaks ; cure index circumferential uniformity ratio estimate ; epi echocardiographic phase imaging ; obs observational ; sc single center ; srs sept systolic rebound stretch in the septum ; ts-4 maximal velocity delay between four basal segments ; ts - sd12 standard deviation of velocity peaks in 12 basal and midventricular segments further development of echocardiographic methodologies coupled with the advances in the field of cardiac magnetic resonance have provided greater depth of understanding in the complex mechanical myocardial wall behavior during lbbb. some additional aspects of the physiology of myocardium wall motion during lbbb should be taken into account. myocardial fiber spatial disposition in three different layers cause the mechanical contractile movement to be nonsymmetrical and in different directions. myocardial contractile thickening has been observed to be longitudinal, circumferential, and radial, thus conferring a movement of torsion during systole. in the context of important ventricular conduction delay such as lbbb, it follows therefore that measures evaluating global wall motion or myocardial efficiency in all three different perspectives, rather than regional two - dimensional measures, may be more suitable to characterize contractile mechanics during lbbb. with these notions, echocardiography has manifested a new drive in the last few years with the emergence of new dyssynchrony measures. the most widely used technique for the detection of myocardial deformation by discriminating active from passive wall motion is speckle tracking imaging (sti) strain. by considering the sum of the difference between peak and end - systolic strain across 16 segments (strain delay index), lim. found that longitudinal strain by sti in hf patients with ventricular conduction delay was predictive of crt response. utilized segmental peak myocardial strain in heart failure patients derived from speckle tracking and showed that heart failure patients with intraventricular conduction delay presented heterogeneity in longitudinal and radial strain distributions, with amplitudes being particularly low in the septum and higher in the lateral and posterior walls. based on the speckle tracking and resynchronization study (star) for prediction of volume response after crt, roc for circumferential and longitudinal speckle - tracking was 0.59 and 0.57, respectively, whereas that of radial and transverse strain was superior (0.79 and 0.75, respectively). it should be mentioned however that a proportion of patients without detected dyssynchrony nevertheless showed reverse remodeling after crt ; these patients were most likely to present a wide qrs and non - ischemic heart failure etiology. srssept is defined as systolic stretch occurring after initial shortening in the early activated septum. de boeck. showed that srssept strongly correlated with an increase in lv ejection fraction after crt as well as a reduction in lvesv and brain natriuretic peptide. cardiac magnetic resonance is a high resolution image modality which allows complex and global assessment not only of cardiac morphology, but also function. indeed, this imaging modality has emerged to become the gold - standard for the characterization of myocardial contractile behavior. by using mri tagging, time plots of strain are generated for each segment in each short - axis slice, and the circumferential uniformity ratio estimate (cure) is calculated. this ratio considers 0 most dyssynchronous and 1 absence of dyssynchrony. a cure cut - off of < 0.75 accurately predicts symptomatic response after crt. an important additional aspect is that cure uses information from the full cardiac cycle and not only time - to - peak. the paucity of consistent prospective, multicenter data on echocardiographic and cmr parameters estimating lv dyssynchrony during lbbb, along with the expensive, time - consuming, and knowledge - intensive nature of these investigations, have limited the diffusion of such technologies to select the adequate crt candidate. most studies show that crt response is higher in non - ischemic patients [43, 44 ]., the extent of resynchronization would be limited as a result of slow - conducting or non - conducting regions. this would mean that a good response to crt not only requires clear conduction disease, but also the capability to properly resynchronize the heart. figure 4 shows examples of how an lad or lcx infarction can influence electrical resynchronization in dogs with lbbb. an important feature in this regard is the site of pacing as pacing in the vicinity of scar tissue can compromise conduction. in canine hearts with lbbb and transmural infarction, pacing away from the infarcted regions resulted in a similar crt response as in non - infarcted canine lbbb hearts.fig. 43d reconstruction of electrical activation times of the lv and the rv during intrinsic conduction (lbbb) and biv pacing (at the rv apex and basal - lateral lv wall) in representative hearts with lbbb (left), lbbb with lad infarction (middle), and lbbb with lcx infarction (right). reproduced with permission 3d reconstruction of electrical activation times of the lv and the rv during intrinsic conduction (lbbb) and biv pacing (at the rv apex and basal - lateral lv wall) in representative hearts with lbbb (left), lbbb with lad infarction (middle), and lbbb with lcx infarction (right). reproduced with permission in line with the pre - clinical data, clinical response after crt is assumed to involve three key factors : lead position (in relation to area of greatest delay or vicinity to scar tissue), the presence of discoordinate and inefficient area of myocardial contractility, and quantity / degree of scarred tissue. however, rapid, effective, and integrated assessment of these features in the diagnostic build - up of patients considered for crt, remains an unresolved challenge. some important single center studies have shown how measures derived from cmr may be of great use. the relation between scar and left ventricular lead deployment has been unveiled using cmr late gadolinium enhancement [46, 47 ]. this method, besides emphasizing how scar size and transmurality were associated to a dismal prognosis after crt, also showed how pacing scar localized in a postero - lateral area reduces crt response rate. another cmr study, which examined the relationship between left ventricular myocardial dyssynchrony (circumferential uniformity ratio estimate derived from myocardial tagging mt) and scar location (delayed enhancement de), found that functional class improvement after crt was predicted by mt and that de offered further predictive value. though the data are limited, there is no doubt that the development of integrated measures derived from cmr may be of great use to improve selection eligible for crt (see table 1). worthy to mention is the study by delgado. who have addressed the relative influence of ventricular dyssynchrony, left ventricular lead position, and myocardial scar on the long - term prognosis of patients treated with crt. through the use of two - dimensional speckle tracking radial strain imaging lv dyssynchrony (difference between the earliest and latest of six segments) was measured and the regions of scar were identified (considered segments with peak radial strain value < 16.5%). after crt, the influence of lv lead position was assessed retrospectively radiographically and placed in relation to the segment of greatest delay or the area of scar. the investigators found that the independent predictors of unfavorable prognosis after crt were discordant lv lead position with respect to the radial segment of greatest delay and the presence of myocardial scar at the level of the pacing lead. a significantly better prognosis was found in patients with a substantial time delay between the antero - septal and posterior segments (130 ms). in spite of the methodological limits of the study, i.e., only radial strain to assess left ventricular dyssynchrony and simple retrospective radiographical assessment of lead position, this study is the first which demonstrates how lead position, electro - mechanical delay, and presence of scar are inextricably linked and impact on the prognosis of crt patients.. also showed that lv lead position inside the scar region results in a fivefold risk of pump failure and sudden cardiac death as compared to patients with no scar and patients with scar, but lv lead positioned elsewhere combined. besides avoiding scar tissue, the position of the lv could also be improved by moving from the epicardium (epicardial implant or coronary sinus) to the endocardium. under physiological conditions, excitation of the lv initiates at the endocardium while in crt, the lv is most often paced at the epicardial surface. as discussed, conventional crt can resynchronize the heart but not to (near) normal conditions. in canine lbbb hearts with myocardial infarction, endocardial lv pacing during crt consistently improved systolic lv pump function, reduced electrical dyssynchrony and decreased dispersion of repolarization, as compared to epicardial lv pacing at the same site (fig. additionally, the hemodynamic effects for endocardial sites were less dependent on location and av - delay than epicardial sites. the added benefit of endocardial crt was also seen in dogs with heart failure (induced by tachypacing) and in dogs with isolated lbbb. support for these experimental findings come from studies by spragg. in seven icm patients where lv endocardial and epicardial pacing at immediately transmural sites gave equivalent lv dp / dtmax values. however, lv dp / dtmax at best lv endocardial sites was greater than conventional crt. given individual variations in etiology, severity, patterns of delayed ventricular activation, location of regions of scar, and extent of mitral regurgitation in heart failure, it seems indeed unlikely that one pacing site will fit all. individual tailoring of endocardial crt by searching the optimal pacing site within the endocardium is warranted. lv endocardial pacing in humans can be established through an atrial transseptal approach [53, 54 ] or a left transapical approach can be used. in the future, wireless endocardial lv stimulation might become the most feasible approach.fig. 5typical examples of 3d electrical activation in canine hearts with chronic lbbb and transmural myocardial infarction during crt with epicardial lv pacing (left panel) and endocardial lv pacing (right panel). reproduced with permission typical examples of 3d electrical activation in canine hearts with chronic lbbb and transmural myocardial infarction during crt with epicardial lv pacing (left panel) and endocardial lv pacing (right panel). reproduced with permission left bundle branch block results in asynchronous electrical activation, which can be largely reversed by crt, thus conferring favorable clinical effects. it is imperative that correct electrical substrate, preferably in the form of true left bundle branch block, coexists with adequate morphological and anatomical conditions to allow adequate crt delivery. in the future, integrated multi - modality imaging presents the central and challenging task to transfer pre - clinical knowledge into clinical practice, hence further defining the complex mechanical and functional effects of lbbb. on the other hand, with the aid of endocardial lv pacing, with- or without rv pacing, patient - specific tailoring of crt | cardiac resynchronization therapy (crt) aims to treat selected heart failure patients suffering from conduction abnormalities with left bundle branch block (lbbb) as the culprit disease. lbbb remained largely underinvestigated until it became apparent that the amount of response to crt was heterogeneous and that the therapy and underlying pathology were thus incompletely understood. in this review, current knowledge concerning activation in lbbb and during biventricular pacing will be explored and applied to current crt practice, highlighting novel ways to better measure and treat the electrical substrate. |
Subsets and Splits
No saved queries yet
Save your SQL queries to embed, download, and access them later. Queries will appear here once saved.