article
stringlengths 0
682k
| abstract
stringlengths 146
3.69k
|
|---|---|
thalassemia syndromes and iron deficiency anemia (ida) are the two most common etiologies of microcytic hypochromic anemia in children and adults. it has long been considered that iron deficiency does not exist in thalassemia syndromes, including thalassemia major as well as trait. however, studies have shown the occurrence of iron deficiency in patients with beta thalassemia trait (btt). earlier authors have demonstrated lower initial hemoglobin levels in patients with coexisting ida and btt [13 ]. this has been explained by the lack of hemopoietic nutrients due to iron deficiency superimposing on the imbalance in globin chain synthesis. similar changes have also been shown in other red cell parameters, serum iron, ferritin, and total iron binding capacity. these changes have also been demonstrated to improve after adequate iron replacement therapy [1, 2, 5 ]. hba2 levels have been reported to be lower in patients with coexisting ida and btt, with improvement in levels after iron therapy [1, 6 ]. however, other studies have shown no significant difference in hba2 levels in such patients [7, 8 ]. the reduction in hba2 levels in patients with concomitant btt and ida has been suggested to interfere in the diagnosis of the former. a recent study has hypothesized that such an occurrence can lead to these patients with btt marrying another person with btt with attendant risk of birth of thalassemia major child. an extensive search of the available indexed english literature yielded only few indian reports of concomitant btt and iron deficiency [4, 1012 ]. none of these studies evaluated the effect of iron therapy on red cell parameters, iron status, and hemoglobin subtypes in indian btt patients with concomitant iron deficiency. the present study aimed at an extensive analysis of the effect of iron therapy on various red cell parameters and iron status in patients with concomitant ida and btt in our country. this prospective study included patients attending the hematology clinics of departments of pediatrics and medicine at a tertiary care centre over a period of two years (dec 2006nov 2008). patients with hba2 levels > 3.7% with low serum ferritin (3.7%) with concomitant iron deficiency, these results can be extrapolated to patients with hba2 levels < 3.7% due to effect of iron deficiency and expect similar changes in various parameters after iron replacement therapy. a recent study from pakistan reported low hba2 levels in btt with concomitant iron deficiency leading to diagnostic difficulties. the authors suggested that such patients, who may be diagnosed as normal on hemoglobin electrophoresis or hplc, could marry a person with btt and lead to birth of children with beta thalassemia major. hence, the authors concluded that coexisting pathological conditions should be identified before reporting the hemoglobin electrophoresis or hplc as normal, especially in countries with high incidence of both iron deficiency and btt. in conclusion, the present study highlights the coexistence of iron deficiency anemia and beta thalassemia trait in indian patients. the diagnosis of beta thalassemia trait in such patients may be confounded by reduction in hba2 levels. hence, iron deficiency should be identified and corrected in patients with high suspicion of beta thalassemia trait, especially if hba2 levels are within normal range. | background. coexistence of iron deficiency anemia (ida) and beta thalassemia trait (btt) has been the topic of few studies. however, no study from our country was found evaluating the effect of iron therapy in patients with concomitant ida and btt. methods. over a period of two years, 30 patients with concomitant ida and btt were included. all the patients had a complete blood count, serum iron studies, and thalassemia screening using bioradtm hemoglobin testing system. the patients received oral iron therapy in appropriate dosages for a period of twenty weeks, after which all the investigations were repeated. appropriate statistical methods were applied for comparison of pre- and posttherapy data. results. all except two patients were adults with a marked female preponderance. oral iron therapy led to statistically significant improvement in hemoglobin, red cell indices (p < 0.05), and marked change in serum iron, ferritin, and hba2 levels (p < 0.001). there was a significant reduction in the total iron binding capacity levels. conclusion. the present study shows the frequent occurrence of iron deficiency anemia in patients with beta thalassemia trait, which can potentially confound the diagnosis of the latter. hence, iron deficiency should be identified and rectified in patients with suspicion of beta thalassemia trait. |
idiopathic normal pressure hydrocephalus (inph) is a syndrome that is characterized by gait disturbance, mental deterioration and urinary incontinence, in association with normal cerebrospinal fluid (csf) pressure. the characteristic mri findings in inph include enlarged ventricle systems (vs) and sylvian fissures (sf), and tight medial and high convexity sulci. most cases of inph exhibit these findings and are defined as disproportionately enlarged subarachnoid - space hydrocephalus (desh). the callosal angle (ca) is also a useful index of the mri finding of desh and in discriminating inph from other diseases. however, the evans index and ca are indices that indirectly express some components of desh findings. desh findings include tight sulci at high convexity and medial subarachnoid spaces and enlarged sf with ventriculomegaly, defined as disproportionately enlarged subarachnoid space. however, there is no single characteristic index that allows physicians to quantitatively demonstrate these conditions. when considering these findings visually, there are some cases in which the judgment of the enlarged size and the degree of narrowing is difficult. therefore, it is anticipated that the measurement of these csf spaces would be simple and easy. a voxel - based morphometry (vbm) method was used to investigate the characteristic regions of inph, and yamashita. reported that the ratio of the csf volume in the lateral ventricle / sf area to that in the high convexity / midline area in inph patients could discriminate between inph and patients with alzheimer 's disease (ad) and normal controls. we improved upon an automatic brain volumetric software program (avsis), which we developed earlier, to automatically measure the volumes of the vs, sf, and medial and high convexity subarachnoid spaces in inph, ad patients and healthy volunteers (hvs). fifteen consecutive patients with inph, who had been admitted to our hospital for examination and treatment, were selected retrospectively from our institute 's dementia registry. the patients had an mri taken before a spinal tap test and fulfilled the criteria for diagnosis of probable inph according to both the inph guidelines and the guidelines for management of idiopathic normal pressure hydrocephalus : second edition. their mean age was 78.4 6.2 years, the mean mini - mental state examination (mmse) score was 23.1 4.6, and the mean modified rankin scale score was 2.6 1.2 (table 1). comorbidities included gait disturbance in all 15, cognitive disorders in 14, and urinary incontinence in 11 patients. fifteen patients with probable ad, who had been diagnosed using the criteria from the national institute of neurological and communicative disorders and stroke / alzheimer 's disease and related disorders association (nincds / adrda), were also selected from our institute 's dementia registry. the mean age was 76.5 5.8 years and the mean mmse score was 22.1 5.7. the mean age was 64.7 8.9 years and the mean mmse score was 29.1 1.2. all study procedures were in agreement with the clinical study guidelines of the ethics committee of our institute. we used 1.5-tesla intera and 3.0-tesla achieva mr scanners (both philips medical systems, best, the netherlands). the images were taken with a 3d magnetization prepared rapid acquisition gradient echo (mprage) imaging sequence. the nominal parameters of the mprage were : sagittal plane, tr / te / ti 2,400/3/1,000 ms, flip angle 8, 24 cm fov, 192 192 in - plane matrix, 1.2-mm slice thickness. volumetry was performed with our avsis, which was improved for this study. in brief, the new avsis process is as follows : voxel of interest (voi) templates for the intracranial, vs, sf, and the medial and high convexity subarachnoid space were prepared prior to this analysis. each regional voi template was produced on a digital phantom simulated brain database (sbd ; http://www.bic.mni.mcgill.ca/brainweb/) according to the standard montreal neurological institute (mni) space, with manual delineation of the contours of each structure (fig. the medial and high convexity subarachnoid space voi template was produced manually, in reference to the results of a previous study of vbm between inph patients and hvs (fig. the process of this modified avsis is as follows : the mr image for each subject was segmented into gray matter (gm), white matter (wm), and csf using the spm8 segmentation program. the gm template image derived from the sbd was then spatially transformed into the gm image for each subject, and a normalization parameter was produced using spm8 and the dartel technique. this normalization parameter functions in the same manner as a reverse parameter produced in the anatomical normalization of an individual brain to a standard brain. using this parameter, the intracranial, hippocampal, vs, sf, and medial and high convexity subarachnoid space voi templates were transformed to each individual subject 's space. the intracranial volume (icv) was adjusted using an image derived from the segmented gm, wm and csf images. the segmented images were derived as follows : wm and gm areas were calculated with the voxels in the icv voi template. csf volumes of the vs, sf, and sulci at high convexity and midline (shm) were calculated using the transformed vs, sf, and shm subarachnoid space voi templates for each subject. each regional relative volume was calculated by normalization to the icv. the volume ratios of each structure in the 3 groups were compared with anova and multiple group comparisons were performed. correlations were evaluated between evans index and ca and each relative volume of vs, sf and shm subarachnoid space, and the hippocampus. the relative volumes of the vs, sf and shm were tested as for their ability to distinguish between probable inph and probable ad. a receiver - operating characteristic (roc) analysis was performed to compare these relative volumes. fifteen consecutive patients with inph, who had been admitted to our hospital for examination and treatment, were selected retrospectively from our institute 's dementia registry. the patients had an mri taken before a spinal tap test and fulfilled the criteria for diagnosis of probable inph according to both the inph guidelines and the guidelines for management of idiopathic normal pressure hydrocephalus : second edition. their mean age was 78.4 6.2 years, the mean mini - mental state examination (mmse) score was 23.1 4.6, and the mean modified rankin scale score was 2.6 1.2 (table 1). comorbidities included gait disturbance in all 15, cognitive disorders in 14, and urinary incontinence in 11 patients. fifteen patients with probable ad, who had been diagnosed using the criteria from the national institute of neurological and communicative disorders and stroke / alzheimer 's disease and related disorders association (nincds / adrda), were also selected from our institute 's dementia registry. the mean age was 76.5 5.8 years and the mean mmse score was 22.1 5.7. the mean age was 64.7 8.9 years and the mean mmse score was 29.1 1.2. all study procedures were in agreement with the clinical study guidelines of the ethics committee of our institute. we used 1.5-tesla intera and 3.0-tesla achieva mr scanners (both philips medical systems, best, the netherlands). the images were taken with a 3d magnetization prepared rapid acquisition gradient echo (mprage) imaging sequence. the nominal parameters of the mprage were : sagittal plane, tr / te / ti 2,400/3/1,000 ms, flip angle 8, 24 cm fov, 192 192 in - plane matrix, 1.2-mm slice thickness. volumetry was performed with our avsis, which was improved for this study. in brief, the new avsis process is as follows : voxel of interest (voi) templates for the intracranial, vs, sf, and the medial and high convexity subarachnoid space were prepared prior to this analysis. each regional voi template was produced on a digital phantom simulated brain database (sbd ; http://www.bic.mni.mcgill.ca/brainweb/) according to the standard montreal neurological institute (mni) space, with manual delineation of the contours of each structure (fig. the medial and high convexity subarachnoid space voi template was produced manually, in reference to the results of a previous study of vbm between inph patients and hvs (fig. the process of this modified avsis is as follows : the mr image for each subject was segmented into gray matter (gm), white matter (wm), and csf using the spm8 segmentation program. the gm template image derived from the sbd was then spatially transformed into the gm image for each subject, and a normalization parameter was produced using spm8 and the dartel technique. this normalization parameter functions in the same manner as a reverse parameter produced in the anatomical normalization of an individual brain to a standard brain. using this parameter, the intracranial, hippocampal, vs, sf, and medial and high convexity subarachnoid space voi templates were transformed to each individual subject 's space. the intracranial volume (icv) was adjusted using an image derived from the segmented gm, wm and csf images. the segmented images were derived as follows : wm and gm areas were calculated with the voxels in the icv voi template. csf volumes of the vs, sf, and sulci at high convexity and midline (shm) were calculated using the transformed vs, sf, and shm subarachnoid space voi templates for each subject. the volume ratios of each structure in the 3 groups were compared with anova and multiple group comparisons were performed. correlations were evaluated between evans index and ca and each relative volume of vs, sf and shm subarachnoid space, and the hippocampus. the relative volumes of the vs, sf and shm were tested as for their ability to distinguish between probable inph and probable ad. a receiver - operating characteristic (roc) analysis was performed to compare these relative volumes. table 2 presents the mean evans index and ca, and the mean icv and volume of the whole brain (wb), hippocampus, vs, sf, and shm subarachnoid space in the inph, ad and hv groups. the ca of the inph group was significantly smaller than those of the ad and hv groups. the hippocampus of the ad group was significantly smaller than those of the inph and hv groups. the volume of the cerebrospinal space at high convexity of inph group was the smallest among the 3 groups. the volumes of the vs and sf of the inph group were significantly larger than those of the ad and hv groups. table 3 shows the relative hippocampal volume, and the relative volumes of the shm, vs and sf normalized to icv. the relative hippocampal volume of the ad group was significantly smaller than those of the other 2 groups. the relative volume of the shm of the inph group was the smallest among the 3 groups. the relative volumes of the vs and sf of the inph group were the largest among the 3 groups. the evans index correlated well with the relative volume of the vs and sf, and it correlated inversely with the relative volume of the shm. the ca also exhibited a good negative correlation with the relative volume of the vs and sf, and it correlated positively with the relative volume of the shm (table 4). table 5 shows the area under the roc curve for discriminating inph from ad, based on the relative volume of vs, sf and shm. the area under the roc curve was the largest when based on the relative volume of the shm, and it exhibited a very good performance in discriminating inph patients from ad patients. the characteristic findings of inph : (1) vs enlargement, (2) dilated sf and (3) tight sulci at high convexity were first reported by kitagaki., and these findings were confirmed by the voxel - based analysis. the evans index can be used as an indirect index for detecting these findings, demonstrating an enlargement of the ventricles ; however, there are currently no objective indices for dilated sf and tight sulci at medial parietal and high convexity. by visual inspection, there should be some variation between the observers in evaluating the widening of the sf and narrowing of the sulci. the ratio of the csf volume in the lateral ventricle / sf area to that in the high convexity / midline area measured by the vbm method has been reported to be a good index for discriminating inph from ad patients and in monitoring the shunt responsiveness. because the template rois used in those studies were produced from the areas in which the csf density of the inph patients was significantly different from that of the ad patients or normal elderly controls, the rois did not cover the precise areas of the anatomically defined vs, sf, or shm, and the method could not be used to measure the absolute values of each structure. therefore, in order to measure the absolute values of those areas, we developed an automatic measuring system and obtained reasonable findings. as we have produced a program that automatically measures the volume of brain structures, we improved this system to allow us to measure csf spaces. a previous study reported on siena, a tool from the fsl software library, it automatically measures the global brain volume, but the volume of the ventricles was measured by manual segmentation. evaluated a commercially available automatic software for measuring icv, brain tissue and ventricular volume. however, icv was measured on t2-weighted images, and brain tissue volume and ventricular volume were measured on flair images with 3 mm thickness and 0.5 mm intersectional gaps, which were not 3d images. the semi - automated software brain ventricle quantification (bvq) is available, but it requires operator - selected seed points in each lateral ventricle, and a region - growing algorithm automatically expanded the seed points within the 3d space of the image to the margin of the periventricular tissue.. reported on a new automatic method to measure the volumes of the csf spaces for the diagnosis of hydrocephalus through segmentation and separation steps, which implements image properties, anatomical and geometrical features as well as topological assumptions of the entire fluid shape. however, this method requires another whole - body mri sequence that significantly highlights the csf. our method, on the other hand, requires no new mri sequence(s) but uses previously scanned 3d t1-weighted images (e.g. mprage). the results of this study met our expectations : the vs and fs volumes of the inph patients were significantly larger than those of the ad patients, and the shm volume of the inph patients was significantly less than that of the ad patients, which is precisely consistent with the desh findings. thus, the measurement of these volumes will allow a discrimination of inph patients from brain atrophy diseases, such as ad. a previous report indicated a very strong correlation (r : 0.95) between the evans index and ventricle volumes ; thus, while our findings are good (r : 0.76), they are not as good as theirs. however, our findings are compatible with the previous report, as the evans index demonstrated an enlargement of the anterior horn of the lateral ventricles, but not of the whole volume of the ventricles. the ca also correlated well with the enlargement of sf and vs, and the correlation coefficient between ca and shm volume was the largest (r : 0.854). this means that tight sulci, especially at the midline, lead to a sharp ca and that tight shm are probably due to a compression by the enlarged sf and vs. therefore, the correlation coefficients between the ca, sf and vs were not as good as those of the shm volume. measuring the shm volume and demonstrating a smaller shm volume is very useful in discriminating inph patients from ad patients. the area under the roc curve of shm was larger than the others and the accuracy was the highest. the vs and sf volumes tend to increase due to brain atrophy ; therefore, the areas under the roc curves of vs and sf are inferior to that of shm. one limitation of this study is that this was a retrospective study that was performed at a single institution. further multicenter studies are necessary, and the usefulness of this automatic volumetry software should be verified. we further developed an automatic measurement software for inph that demonstrates the characteristic csf volumes and obtains compatible findings. this approach supports the diagnosis of inph and will aid in further research of the pathophysiology of inph. | objectivesto measure the cerebrospinal fluid (csf) space volume in idiopathic normal pressure hydrocephalus (inph), we developed a software that allows us to automatically measure the regional csf space and compared the volumes of the ventricle systems (vs), sylvian fissures (sf) and sulci at high convexity and midline (shm) among inph patients, alzheimer 's disease (ad) patients and healthy volunteers (hvs).methodsfifteen inph patients, 15 ad patients and 15 hvs were retrospectively selected for this study. 3d - t1 mr images were obtained. we improved upon an automatic gray matter volume system to measure csf spaces, adopting new regions for the template of inph - characteristic csf spaces and measured them. the vs, sf and shm volumes were calculated relative to the intracranial volume.resultsthe relative shm volume of the inph group (0.0237 0.0064) was the smallest among the 3 groups (ad : 0.0477 0.0109, hv : 0.0542 0.0045). the vs (0.0499 0.0135) and sf (0.0187 0.0037) volumes of the inph group were significantly larger than those of the ad (vs : 0.0311 0.0075, sf : 0.0146 0.0026) and hv groups (vs : 0.0167 0.0065, sf : 0.0111 0.017).conclusionautomatic volume measurement can be used to delineate the characteristic changes in csf space in patients with inph and is useful in the diagnosis of inph. |
obesity is a risk factor able to trigger several inflammatory alterations favorable for the chronic low - grade inflammation, by imbalance between pro- and anti - inflammatory cytokine productions. furthermore, obesity is positively associated with installation and development of diseases as type 2 diabetes, cardiovascular diseases and metabolic syndrome in populations of different ages and genders (weghuber., 2014 ; wen., 2013). chronic low - grade inflammation observed in illness associates with modifications in plasmatic cytokines concentration, as high concentrations of plasminogen activator inhibitor-1 (lira., 2010), c - reactive protein, interleukin (il) 6 and tumor necrosis factor - alpha (tnf-), which are considered pro - inflammatory biomarkers. in addition, this inflammatory context reduces anti - inflammatory cytokine concentration, as adiponectin, and il-10. obese individuals have low concentrations of adiponectin, and this is associated with the metabolic syndrome (renaldi., 2009), type 2 diabetes (hotta., 2000), dyslipidemia (lara - castro., 2006) and coronary artery diseases (vilarrasa., several studies have documented the effectiveness of exercise training on metabolic disorders, prevention and treatment, and its anti - inflammatory effect (de meirelles., 2014 ; karstoft and pedersen, 2016 ; lira. high intensity interval training (hiit) has been proposed to be a time - efficient (low volume) method to improve aspects related to body composition and disease (madsen., 2015b ; sijie., 2012 ; talanian., 2007). (2015a) showed only a modest improvement in anti - inflammatory cytokine after eight weeks of hiit for subjects at risk for metabolic syndrome individuals, while inflammatory cytokines did not change. on the other hand, have observed that hiit is more effective to treat excessive body weight than moderate continuous training (sijie., 2012). these differences in results may be due to differences in training intensity and volume, and training length (8 weeks) (madsen., 2015a). thus, whether longer than 8-week hiit, with lower volume than typical training session can improve metabolic and inflammatory profile of subjects with overweight and obesity is unknown. therefore, the purpose of the present study was (a) analyze the effects of 16 weeks of different models exercise training (high - intensity interval vs. moderate - intensity continuous training) on inflammatory profile ; and (b) analyze the effects of 16 weeks of two hiit protocols (1-bout 14 min vs. hiit 44 min) on metabolic and inflammatory profile of subjects with overweight and obesity. subjects with overweight and obesity (body mass index25 kg / m) were invited to participate in the study through dissemination of the project in social networks, printed posters, emails list from students and employees at the university of sao paulo - campus of ribeirao preto, patients list of hospital s ribeirao preto medical school, university of so paulo, radio, and television stations. in this study, subjects of both genders (women and men), aged 18 years old or more, was randomized and stratified into three groups : hiit 3 times a week, 44 min (hiit) ; one bout training 3 times a week, 14 min (1-bout) ; and continuous training (cont) (30 min, 5 times a week). the criteria for exclusion were : unstable angina, recent heart attack (4 weeks), decompensated heart failure, severe valvular disease, uncontrolled hypertension, renal failure, orthopedic / neurological limitations, cardiomyopathy, presence of surgeries planned during the study period, reluctance to sign the consent form and informed participation in another study, and alcohol or drug abuse. hiit and 1-bout programs were carried out by walking / running 3 times a week on a treadmill. warming up consisted of 10 min at 70% of maximum heart rate (hrmax) (13 on borg scale of 6 to 20 points). afterwards subjects performed four (hiit) or a unique (1-bout) period of four minutes at 90% of hrmax (16 on borg scale). on the hiit session the bouts were interspersed by 3 min of active recovery (70% of hrmax). finally, both groups, there were 5 min cool down. the cont corresponded to 70% of hrmax (13 on borg scale) for 30 min, 5 times a week. the duration of all three training programs was 16 weeks being the faults recorded and heart rate monitored continuously during the sessions supervised to ensure that the subjects exercised at the correct intensity (tjnna., 2008). blood samples was collected by venipuncture in the antecubital fossa and collected 10 ml of blood that were centrifuged at 3,000 rpm for 8 min at 4c to separated serum and plasma, and then stored in aliquots at 80c for future analysis. analysis of cytokines were performed by enzyme immunoassay elisa (enzyme - linked immunosorbent assay) using a microplate reader by spectramax plus 384 absorbance microplate reader (san diego, ca, usa) with a 450 nm filter for reading absorbance. analysis of tnf-, il-6 and adiponectin concentrations was performed using reagents kits from r&d system (r&d system inc, minneapolis, mn, usa) with sensitivity of 1,000 to 15.6 pg / ml, 300 to 4.7 pg / ml, and 4,000 to 62.5 pg / ml, respectively. the intra - assay variability of the tnf- kit was 4.2 to 5.2% ; il-6 kit was 1.6 to 4.2% and adiponectin kit was 0.6 to 6.0%. for the analysis of circulating il-10 concentrations the reagent kits from ebioscience (affymetrix inc,, san diego, ca, usa) was used, with sensitivity of 300 to 2.3 pg / ml, intra - assay variability was 0.3 to 1.0%. analysis of insulin concentrations was performed using reagents kits from accubind (monobind inc., lake forest, ca, usa) with sensitivity of 0 to 300 lu / ml, intra - assay variability was 4.3 to 8.3%. the student t - test was applied between pre and post 16 weeks in each group. to verify possible differences between baseline (pretraining), as well as the magnitude of the variations () after training among the three groups we used the one - way analysis of variance. for all analyzes, we used the spss ver. 13.0 (spss inc., chicago, il, usa). subjects with overweight and obesity (body mass index25 kg / m) were invited to participate in the study through dissemination of the project in social networks, printed posters, emails list from students and employees at the university of sao paulo - campus of ribeirao preto, patients list of hospital s ribeirao preto medical school, university of so paulo, radio, and television stations. in this study, subjects of both genders (women and men), aged 18 years old or more, was randomized and stratified into three groups : hiit 3 times a week, 44 min (hiit) ; one bout training 3 times a week, 14 min (1-bout) ; and continuous training (cont) (30 min, 5 times a week). the criteria for exclusion were : unstable angina, recent heart attack (4 weeks), decompensated heart failure, severe valvular disease, uncontrolled hypertension, renal failure, orthopedic / neurological limitations, cardiomyopathy, presence of surgeries planned during the study period, reluctance to sign the consent form and informed participation in another study, and alcohol or drug abuse. hiit and 1-bout programs were carried out by walking / running 3 times a week on a treadmill. warming up consisted of 10 min at 70% of maximum heart rate (hrmax) (13 on borg scale of 6 to 20 points). afterwards subjects performed four (hiit) or a unique (1-bout) period of four minutes at 90% of hrmax (16 on borg scale). on the hiit session the bouts were interspersed by 3 min of active recovery (70% of hrmax). finally, both groups, there were 5 min cool down. the cont corresponded to 70% of hrmax (13 on borg scale) for 30 min, 5 times a week. the duration of all three training programs was 16 weeks being the faults recorded and heart rate monitored continuously during the sessions supervised to ensure that the subjects exercised at the correct intensity (tjnna., 2008). blood samples was collected by venipuncture in the antecubital fossa and collected 10 ml of blood that were centrifuged at 3,000 rpm for 8 min at 4c to separated serum and plasma, and then stored in aliquots at 80c for future analysis. analysis of cytokines were performed by enzyme immunoassay elisa (enzyme - linked immunosorbent assay) using a microplate reader by spectramax plus 384 absorbance microplate reader (san diego, ca, usa) with a 450 nm filter for reading absorbance. analysis of tnf-, il-6 and adiponectin concentrations was performed using reagents kits from r&d system (r&d system inc, minneapolis, mn, usa) with sensitivity of 1,000 to 15.6 pg / ml, 300 to 4.7 pg / ml, and 4,000 to 62.5 pg / ml, respectively. the intra - assay variability of the tnf- kit was 4.2 to 5.2% ; il-6 kit was 1.6 to 4.2% and adiponectin kit was 0.6 to 6.0%. for the analysis of circulating il-10 concentrations the reagent kits from ebioscience (affymetrix inc,, san diego, ca, usa) was used, with sensitivity of 300 to 2.3 pg / ml, intra - assay variability was 0.3 to 1.0%. analysis of insulin concentrations was performed using reagents kits from accubind (monobind inc., lake forest, ca, usa) with sensitivity of 0 to 300 lu / ml wilks test. to evaluate the effect of training the student t - test was applied between pre and post 16 weeks in each group. to verify possible differences between baseline (pretraining), as well as the magnitude of the variations () after training among the three groups we used the one - way analysis of variance. for all analyzes, we used the spss ver. 13.0 (spss inc., chicago, il, usa). a significance level of 5% the modification of total body mass and body mass index before and after training are presented in table 2. none group promoted significant changes in body composition of participants, however the hiit group tended to reduce the total body weight and bmi (p=0.059 and p= 0.060, respectively). group il-6 concentrations decreased (p= 0.035) in contrast to tnf- that increased (p=0.001) with training. in cont group the plasma concentrations of adiponectin decreased significantly in all three groups (p=0.009, p=0.022, and p=0.0002 in cont, 1-bout, and hiit, respectively), but there was no difference in magnitude (%) of these changes between group (% cont=43.725.6 ; % 14 min=28.9 74.9 ; %=66.315.5 hiit). with the exception of adiponectin il-10, insulin, and homeostasis model assessment insulin resistance (homa - ir) did not change across the three training models. the aim of the present study was to evaluate the effect of 16 weeks of different models of exercise training on metabolic and inflammatory profile of subjects with overweight and obesity. the main findings were that 16 weeks of training on a treadmill (a) reduced il-6 in the hiit-44 min group, (b) increased tnf- in hiit-44 min group and reduced it in cont, and (c) reduced adiponectin levels in all groups. the elevated il-6 production by skeletal muscle during training sessions performs important functions for auxiliary energy supply, stimulating lipolysis in situations of high adenosine monophosphate / adenosine triphosphate ratio and low glycogen stores (pedersen, 2012). it also acts on anti - inflammatory form, promoting il-10 production, which in turn inhibits the action of nuclear factor kappa b, and therefore the synthesis of pro - inflammatory cytokines such as tnf- and interleukin-1 (galic., 2010). in a recent study cabral - santos. (2015) showed that il-6 concentrations are significantly elevated after high intensity intermittent stimulus (5 km performed 1:1 100% of vo2peak [peak oxygen consumption ]) when compared to continuous moderate intensity. this may be due to increased demand for glucose, as evidenced by the high blood lactate concentrations usually found in these training models. (2015) reported that in a protocol in cycle ergometer (44 min - 95% of hrmax) similar to the present study hiit the blood lactate concentrations and respiratory exchange ratio were significantly higher than in the lower intensity continuous. these data indicate the highest metabolic stress generated in hiit favoring greater il-6 production. unlike the exercise, at rest approximately 30% of circulating il-6 comes from the adipose tissue and that total two - thirds of infiltrated macrophages (fried., 1998 ; mohamed - ali., it is important to consider that the il-6 is also considered to be the main inducer of the expression of several proteins that play an important role on inflammatory status. high plasma concentrations of il-6 together with c - reactive protein, fibrinogen, and amyloid a are related to chronic low - grade inflammation and involved with the development of some diseases, such as diabetes, atherosclerosis, and rheumatoid arthritis (reihmane and dela, 2014). thus, the present study showed that 16 weeks of hiit training reduced il-6 concentration in overweight / obeses subjects. these lifestyle habits promote the adipocyte hypertrophy, which decreases blood and oxygen supply to the adipose tissue. this chronic and progressive reduction stimulates the recruitment of monocytes and secretion of pro - inflammatory cytokines, such as il-6 and tnf- (gleeson., 2011). however, other immune cells, such as lymphocytes and natural killer cells, may also produce it. high concentration of tnf- is usually associated with cell death, cardiovascular diseases, inflammation and other acute phase proteins (golbidi and laher, 2014). this cytokine also activates certain intracellular kinases, which inhibit the signaling of insulin, impairing glucose uptake (diehl, 2004). the leggate.s (2012) study with overweight / obese men showed that 2-week hiit not alter the blood concentrations of il-6, il-10, and tnf-. on the other hand, adipose tissue concentrations of monocyte chemoattractant protein-1, il-10, and tnf- were undetectable after training, indicating beneficial adaptations in the resting inflammatory profile. robinson. (2015) evaluated the effects of hiit and continuous in the same population (predominantly obese women) and also found an improvement in inflammatory profile indicated by the decrease of toll - like receptors type 4 (lymphocytes and monocytes) and type 2 (lymphocytes), membrane receptors known to be related to inflammatory response, even without changes in blood cytokines. in light of this knowledge, the reduction of circulating tnf- after 16 weeks of cont training can be beneficial, but we can not claim that the increase in circulating tnf- post hiit is harmful because it is known that blood concentrations can not accurately reflect the intracellular and tissue reality. in addition these changes did not alter the concentrations of insulin and homa - ir values, suggesting that insulin sensitivity was not affected by different concentrations of tnf-. another issue to consider is that the action of tnf-, as well as its efficiency, are dependent on their receivers. in cell membrane there are two types of receptors (tnfr1 and 2) and pro - inflammatory characteristics generally associated with the protein (mainly in adipose tissue) are past their binding to tnfr1. these receptors may also be cleaved and become soluble in plasma (stnfr) and thus act in on anti - inflammatory form, binding to tnf- and prevent its connection to the cell membrane and subsequent signal transduction (cawthorn and sethi, 2008 ; gatanaga., 1990 ; so, if tnf- post hiit increases are accompanied by the increase of stnfr, the functions of this protein can be suppressed. studies showed that it is reduced in situations of obesity and insulin resistance when compared to healthy individuals and animals (hu., 1996 ; weyer., 2001). weight loss and exercise are common treatments for improvement in insulin sensitivity, but hulver. (2002) showed that only the weight loss is effective for increased in the adiponectine levels. suggesting that exercise training improves insulin sensitivity by independent mechanisms for weight loss and adiponectin action. (2008) showed that an increase in adiponectine levels requires a reduction of at least 10% in total body mass. (2010) found conflicting results showing augment of adiponectin only in the groups that performed restrictive diet and diet coupled with aerobic exercise for 12 weeks. in this study there was also a third group that performed only exercises without calorie restriction, with smaller reduction in fat mass and no significant decrease in adiponectine levels. a review by simpson and singh (2008) showed that only three of eight studies with exercise increased adiponectine levels. despite the benefits of this adipokine in increased insulin sensitivity, it is important to note that there are different isoforms of adiponectin with not entirely clear functions, and exercise seems to regulate differently each isoform. | obesity is a risk factor able to trigger several inflammatory alterations and the imbalance between pro- and anti - inflammatory cytokine productions. physical exercise is an important strategy for reduction of inflammatory established process. the aim of this study was to evaluate the effect of 16 weeks of three exercise training programs in the inflammatory profile and insulin resistance in overweight / obesity. thirty two men and women (46.410.1 years ; 162.09.1 cm ; 82.013.6 kg) were divided into three groups for training on a treadmill : continuous at 70% maximum heart rate (hrmax) 5 times a week (cont) ; 14 min (1-bout) and 44 min (high intensity interval training, hiit) at 90% hrmax 3 times a week. interleukin (il) 6 and il-10, tumor necrosis factor - alpha (tnf-), insulin and adiponectin levels were analyzed by enzyme - linked immunosorbent assay, and homeostasis model assessment insulin resistance was calculated. after 16 weeks of training blood concentrations of il-6 decreased in the hiit group (p=0.035), tnf- decreased in the cont (p=0.037) and increased in hiit (p=0.001) and adiponectin decreased in the three training models. there was a trend towards decreased body weight and body mass index (bmi) after hiit only (p=0.059 and p=0.060, respectively). despite the decrease of adiponectin and the increase of tnf- in hiit group, insulin sensitivity showed a trend for improvement (p=0.08). hiit program decreased il-6 at rest and although not significant was the only who tended to decrease total body weight and bmi. taken together, our data suggest that both hiit as well as cont exercises training program promotes changes in inflammatory profile in overweight / obesity, but dissimilar response is seen in tnf- levels. |
113 705) predispose carriers to early - onset of breast and ovarian cancer with a risk of 6571% for breast cancer and 3959% for ovarian cancer by age 70 years. variants in brca1 are scattered throughout the gene, and to date (until 1 october 2013), approximately 14 900 variants (listed online at the breast cancer information core (bic) database : http://research.nhgri.nih.gov/bic/) have been identified by mutational screening since the cloning and characterization of brca1 in the mid-1990s. many of these variants are pathogenic, such as frameshift and nonsense variants, as well as variants affecting splicing, of which several have been identified in danish breast and/or ovarian cancer patients. however, a large number of the brca1 variants, including small in - frame insertions or deletions, missense, silent, and intron variants, are variants of unknown clinical significance (vus), which makes genetic counseling of patients and their families complicated. to characterize the biological effect of these variants and to provide clinicians with better evidence about treatment and preventive care, functional studies are required. it has been previously shown that a large portion of brca1 variants induce splicing defects. ideally, rna from a patient should be examined by rt - pcr analysis to establish if a variant has an effect on splicing. however, in many cases, rna is not available from the patient. alternatively, the variant can be examined by mini - gene splicing analysis. to confidently interpret the obtained splicing results, a mini - gene splicing assay should be validated by assessment of the sensitivity and specificity using a panel of variants classified previously. here, we report the in silico and functional examination of 37 brca1 variants using a mini - gene splicing assay, of which 24 were used to validate the use of the mini - gene splicing assay by comparing data to rt - pcr results using rna from blood samples / lymphoblastoid cell lines. brca1 variants are numbered according to the guidelines from the human genome variation society (http://www.hgvs.org/mutnomen) using ncbi reference sequence ng_005905.2, as well as according to genbank accession number u14680.1, in which the a in the aug start codon has number 120. all data have been submitted to the leiden open variation database v.2.0 (http://chromium.liacs.nl/lovd2/cancer/home.php). the following five splice site prediction programs were used to predict the effect of variants on the efficiency of splicing : splicesitefinder (http://www.interactive-biosoftware.com) ; genesplicer (http://www.cbcb.umd.edu/software/genesplicer) ; splice site prediction by neural network (http://www.fruitfly.org/seq_tools/splice.html) ; maxentscan (http://genes.mit.edu/burgelab/maxent/xmaxentscan_scoreseq.html) ; and human splicing finder (http://www.umd.be/hsf/). the analysis was performed by the integrated software alamut v.2.3 (http://www.interactive-biosoftware.com) using default settings in all predictions. a variation of more than 10% in at least two algorithms was considered as having an effect on splicing. wild - type brca1 exons (2, 3, 5, 6, 7, 8, 9, 10, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, and 23) along with at least 200 bp of 5 and 3 intronic sequences were pcr amplified from human genomic dna using phusion dna polymerase (roche, hvidovre, denmark) and forward and reverse primers carrying restriction sites for either ecori, bamhi, noti, or xhoi (primer sequences are available on request). single - nucleotide substitutions or deletions were introduced using finnzymes ' phusion high - fidelity dna polymerase according to the accompanying instructions. wild - type and mutant constructs were transfected in duplicate into cos-7 cells as described recently, to account for differences in transfection efficiencies. cells were harvested after 48 h and total rna was extracted using trizol reagent (invitrogen, naerum, denmark). cdna was synthesized using 1 g of total rna, m - mulv reverse transcriptase polymerase (new england biolabs, hitchin, uk), and 20 m of nucleotide oligo(dt)15 primer. cdna was amplified with phusion dna polymerase using the primers dusd2 (5-tctgagtcacctggacaacc-3) and dusa4 (5-atctcagtggtatttgtgagc-3). each dna band was gel purified using ge healthcare 's (bronby, denmark) illustra gfx pcr dna and gel band purification kit and sequenced with dusd2 and dusa4 primers. brca1 variants are numbered according to the guidelines from the human genome variation society (http://www.hgvs.org/mutnomen) using ncbi reference sequence ng_005905.2, as well as according to genbank accession number u14680.1, in which the a in the aug start codon has number 120. all data have been submitted to the leiden open variation database v.2.0 (http://chromium.liacs.nl/lovd2/cancer/home.php). the following five splice site prediction programs were used to predict the effect of variants on the efficiency of splicing : splicesitefinder (http://www.interactive-biosoftware.com) ; genesplicer (http://www.cbcb.umd.edu/software/genesplicer) ; splice site prediction by neural network (http://www.fruitfly.org/seq_tools/splice.html) ; maxentscan (http://genes.mit.edu/burgelab/maxent/xmaxentscan_scoreseq.html) ; and human splicing finder (http://www.umd.be/hsf/). the analysis was performed by the integrated software alamut v.2.3 (http://www.interactive-biosoftware.com) using default settings in all predictions. a variation of more than 10% in at least two algorithms was considered as having an effect on splicing. wild - type brca1 exons (2, 3, 5, 6, 7, 8, 9, 10, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, and 23) along with at least 200 bp of 5 and 3 intronic sequences were pcr amplified from human genomic dna using phusion dna polymerase (roche, hvidovre, denmark) and forward and reverse primers carrying restriction sites for either ecori, bamhi, noti, or xhoi (primer sequences are available on request). single - nucleotide substitutions or deletions were introduced using finnzymes ' phusion high - fidelity dna polymerase according to the accompanying instructions. wild - type and mutant constructs were transfected in duplicate into cos-7 cells as described recently, to account for differences in transfection efficiencies. cells were harvested after 48 h and total rna was extracted using trizol reagent (invitrogen, naerum, denmark). cdna was synthesized using 1 g of total rna, m - mulv reverse transcriptase polymerase (new england biolabs, hitchin, uk), and 20 m of nucleotide oligo(dt)15 primer. cdna was amplified with phusion dna polymerase using the primers dusd2 (5-tctgagtcacctggacaacc-3) and dusa4 (5-atctcagtggtatttgtgagc-3). each dna band was gel purified using ge healthcare 's (bronby, denmark) illustra gfx pcr dna and gel band purification kit and sequenced with dusd2 and dusa4 primers. we have previously used a mini - gene splicing assay to examine the effect of brca1/brca2 variants on splicing. to validate this assay, 24 variants previously examined by rt - pcr using rna from blood samples / lymphoblastoid cell lines were introduced into the pspl3 vector (figure 1a). variants present in brca1 exon 11 were excluded as we were unable to achieve the expression of wild - type exon 11, probably owing to its large size. however, variants in the exon 2, 3, 5, 6, 7, 8, 9, 10, 13, 14, 15, 16, 17, 19, 20, 21, 22, and 23 vector constructs were examined in the validation setup (supplementary figures 1a u). as summarized in table 1, all major effects identified in the rt - pcr analyses on rna from blood samples / lymphoblastoid cell lines were also identified by the mini - gene splicing assays. thus, there is 100% concordance between the mini - gene splicing assay results and the results from rna from blood samples / lymphoblastoid cell lines, taking into account that the position of the cryptic splice sites activated by two brca1 variants (c.5074 + 1g > t and c.5277 + 1g > a) were wrongly annotated in the original publications but are identical to our findings upon sequence comparison. moreover, in our hands, a minor increased skipping of exon 17 was observed for the c.5074 + 6c > g variant that was not described in the literature, although splicing data were not presented in the studies. following this successful validation of the mini - gene splicing assay, we investigated 13 brca1 variants not previously examined by functional assays (table 2). first, the potential pathogenicity of the variants was investigated using five different in silico splice site prediction programs, which predict changes in splice site strength. the applicable threshold was a variation between the wild - type and the variant score of more than 10% in at least two different algorithms. according to this criterion, seven brca1 variants, c.80 + 1g > a, c.132c > t (p.=), c.2131g > a, c.30215c > g, c.670 + 1delg, c.4185 + 1g > a, and c.50751g > c (table 2), were suggested to have an effect on splicing, whereas no splicing alterations were predicted for the remaining six variants (c.-19 - 22_-19 - 21dupat, c.547 + 14delg, c.670 + 16g > a, c.467620a > g, c.498721g > t, and c.527814c > the functional effects of all 13 brca1 variants were subsequently examined by mini - gene splicing assays. then, mrna was purified, analyzed by rt - pcr, and finally pcr products were visualized on 1% agarose gels (figure 1b m). in accordance with the in silico results, six brca1 variants (c.80 + 1g > a, c.132c > t (p.=), c.213 - 1g > a, c.670 + 1delg, c.4185 + 1g > a, and c.50751g > c) revealed the presence of alternative gel bands compared with the corresponding wild types. the wild - type brca1 exon 2 construct generated one transcript comprising the expected 276 bp, whereas the c.80 + 1g > a mutant yielded one strong band of 177 bp lacking exon 2 (figure 1b). wild - type brca1 exon 3 generated one transcript at the expected 231 bp, whereas the c.132c > t (p.=) mutant resulted in one strong band of 227 bp excluding the last four bases of exon 3 (figure 1c). wild - type brca1 exon 6 generated one transcript at the expected size of 266 bp, whereas the c.2131g > a mutant resulted in one strong band of 325 bp, including 59 bp of intron 5 (figure 1d). wild - type brca1 exon 10 revealed the presence of two bands, one of 254 bp including exon 10 and one of 177 bp excluding exon 10. the c.670 + 1delg mutant resulted in a 253-bp transcript lacking 1 bp of exon 10 (figure 1e). wild - type brca1 exon 12 revealed the presence of one band at the expected size of 266 bp, whereas the c.4185 + 1g > a mutant resulted in one strong band of 177 bp lacking exon 12 (figure 1f). wild - type brca1 exon 18 exhibited one band with the expected size of 255 bp, whereas the c.50751g > c mutant revealed a single band of 177 bp lacking exon 18 (figure 1 g). in contrast, the c.-19 - 22_-19 - 21dupat (figure 1h), c.30215c > g (figure 1i), c.547 + 14delg (figure 1j), c.467620a > g (figure 1k), c.498721g > t (figure 1l), and c.527814c > g (figure 1 m) variants showed no band size or intensity differences between wild - type and mutant constructs. this was in agreement with the in silico data except for the c.30215c > g variant. the c.670 + 16g > a variant (figure 1e), however, appeared to make the consensus splice donor site stronger. our results revealed a major band of 254 bp including exon 10 and a minor 177-bp band lacking exon 10, which is the opposite to the wild - type pattern. in all cases, all variants were classified according to the 5-tier splicing classification scheme proposed recently (tables 1 and 2). to ensure patients with hereditary breast cancer receive optimal genetic counseling and thereby preventive care, it is important to classify all identified brca1 sequence variants. it has previously been established that all variant types in brca1 can lead to splicing abnormalities, and therefore it is important to investigate all variants at the rna level before classification. splicing analysis is preferably carried out using rna from blood samples / lymphoblastoid cell lines. however, in many cases, rna is not available from the patient. alternatively, the variant can be examined by mini - gene splicing analysis, which has previously been shown to be a valid method for investigating the impact of variants on the splicing pattern. the mini - gene splicing assay validation performed in the current study showed a 100% concordance with the 24 brca1 variants previously classified using rt - pcr analysis on rna from blood samples / lymphoblastoid cell lines and therefore supports the previous findings. the position of two of the cryptic splice sites activated was incorrectly annotated in the original publications. the brca1 c.5074 + 1g > t variant our mini - gene splicing assay showed that 153 bp of intron 17 were included in the transcript, which is in agreement with the sequence reported in the original publication. moreover, the brca1 c.5277 + 1g > a variant was reported to result in an out - of - frame inclusion of 85 bp of intron 20, leading to a premature stop codon. our mini - gene splicing assay results revealed that the variant induced an in - frame inclusion of 87 bp of intron 20, which also is in agreement with the sequence reported in the original publication. therefore, the variant results in the inclusion of an extra 29 amino acids in the protein instead of a premature stop codon, indicating that the variant should be reclassified as a vus. in addition, our validation analysis revealed that the brca1 c.5074 + 6c > g variant showed a minor increase in the transcripts lacking exon 17 compared with the wild type. in two previous studies, this variant was classified as neutral based on rt - pcr using rna from blood samples. splicing data were not presented in these publications, and as they used rna purified from blood samples, the weak band observed here could have been degraded by nonsense - mediated decay. on the basis of the partial skipping of exon 17, we classify this variant as a vus. we also examined the effect of 13 (12 intronic and one exonic) uncharacterized brca1 variants on splicing by in silico analysis and mini - gene splicing assay. the in silico analysis predicted alterations in the splicing pattern for seven brca1 variants (c.80 + 1g > a, c.132c > t (p.=), c.2131g > a, c.30215c > g, c.670 + 1delg, c.4185 + 1g > a, and c.50751g > c), whereas six brca1 variants (c.-19 - 22_-19 - 21dupat, c.547 + 14delg, c.670 + 16g > a, c.467620a > g, c.498721g > t, and c.527814c > however, mini - gene splicing analysis revealed that the c.30215c > g variant had no effect on splicing, suggesting that the criterion used (> 10% difference between wild - type and mutant scores in at least two programs) results in false - positive predictions as shown previously. the mini - gene splicing analysis revealed that three of the six deleterious variants resulted in the use of a cryptic splice site. the silent variant c.132c > t (p.=) was predicted to introduce a new strong splice site located 4 bp upstream from the consensus splice site, which was confirmed by the mini - gene splicing assay. moreover, the c.213 - 1g > a variant destroyed the exon 5 consensus acceptor splice site, resulting in the use of a cryptic splice site located 59 bp upstream of exon 5. this is in agreement with another variant (c.21311t > g), which uses the same cryptic splice site. finally, the c.670 + 1delg variant disrupted the exon 10 consensus donor splice site, creating a new splice site using the last base of exon 10. all three variants ultimately lead to the disruption of the reading frame and are classified as pathogenic. interestingly, 10 of the 20 pathogenic variants investigated in the present study result in the use of a cryptic splice site. this emphasizes the importance of functional evaluation of all potential variants affecting splicing, including variants in the consensus splice sites, as cryptic splice sites can result in small in - frame deletions or insertions that may not be pathogenic. the analysis moreover emphasizes the need for sequencing of all gel bands observed in the mini - gene splicing assay as some variants induce the use of cryptic splice sites in close proximity of the splice donor or acceptor sites (eg, c.132c > t and c.51531g > a). c.80 + 1g > a, c.4185 + 1g > a, and c.50751g > c resulted in skipping of exons 2, 12, and 18, respectively. all three variants result in disruption of the reading frame and are classified as pathogenic. furthermore, our results showed that the brca1 c.670 + 16g > a variant induced almost complete inclusion of exon 10 an exon known to be involved in alternative splicing. the brca1 c.670 + 8c > t variant has previously been found, by both mini - gene splicing assay and rt - pcr using rna from blood samples, to result in complete inclusion of exons 9 and 10. currently, knowledge is lacking regarding the functions of the different brca1 isoforms and their roles in cancer protection. some experiments indicate that the balance between the different isoforms is important, whereas others have shown that the balance between the isoforms changes during the cell cycle and differs between different tissues. until a better understanding of the different isoforms is achieved, variants affecting the ratio of splicing isoforms can not be classified properly. in conclusion, based on a validated mini - gene splicing assay, we classified six brca1 variants (c.80 + 1g > a, c.132c > t (p.=), c.2131g > a, c.670 + 1delg, c.4185 + 1g > a, and c.50751g > c) as pathogenic, whereas six brca1 variants (c.-19 - 22_-19 - 21dupat, c.30215c > g, c.547 + 14delg, c.467620a > g, c.498721g > t, and c.527814c > one variant (c.670 + 16g > a) was shown to increase the inclusion of exon 10 compared with the wild type and was therefore classified as a vus. this study supports the use of in silico prediction tools and mini - gene splicing assays in the assessment of the pathogenicity of brca1 variants. | mutational screening of the breast cancer susceptibility gene brca1 leads to the identification of numerous pathogenic variants such as frameshift and nonsense variants, as well as large genomic rearrangements. the screening moreover identifies a large number of variants, for example, missense, silent, and intron variants, which are classified as variants of unknown clinical significance owing to the lack of causal evidence. variants of unknown clinical significance can potentially have an impact on splicing and therefore functional examinations are warranted to classify whether these variants are pathogenic or benign. here we validate a mini - gene splicing assay by comparing the results of 24 variants with previously published data from rt - pcr analysis on rna from blood samples / lymphoblastoid cell lines. the analysis showed an overall concordance of 100%. in addition, we investigated 13 brca1 variants of unknown clinical significance or putative variants affecting splicing by in silico analysis and mini - gene splicing assay. both the in silico analysis and mini - gene splicing assay classified six brca1 variants as pathogenic (c.80 + 1g > a, c.132c > t (p.=), c.2131g > a, c.670 + 1delg, c.4185 + 1g > a, and c.50751g > c), whereas six brca1 variants were classified as neutral (c.-19 - 22_-19 - 21dupat, c.30215c > g, c.547 + 14delg, c.467620a > g, c.498721g > t, and c.527814c > g) and one brca1 variant remained unclassified (c.670 + 16g > a). in conclusion, our study emphasizes that in silico analysis and mini - gene splicing assays are important for the classification of variants, especially if no rna is available from the patient. this knowledge is crucial for proper genetic counseling of patients and their family members. |
according to the world health organization reports (who), 22% of the world 's population aged over 15 years are smokers and approximately six million people die from tobacco use or exposure to tobacco smoke. studies in iran show that about 26% of the iranian men and 3.6% of the women participating in the study are current smokers (1). unfortunately, the prevalence of smoking between college students is higher than in the general population in iran. with a cross - sectional population - based study, fotouhi. reported that prevalence of smoking in residents of tehran, capital of iran, is 12% (2). on the other hand, jafari. found that among the students of tehran university, 35.4% of men and 12.6% of women are smokers (3). the high prevalence of smoking (42.5%) among university students was also reported by other investigators in the middle - east countries (4). cigarette use among medical students is of particular concern because medically educated persons play a leading role in the development of overall public health policy and the prevention of tobacco use in the society. in some studies on medical students in the developed countries, on the other hand, a multi - country survey in the developing countries revealed a smoking prevalence rate of 11%, 6.7%, 10.6%, 17.8% and 17.4% among medical students of malaysia, india, pakistan, nepal and bangladesh, respectively (9). although many researches are conducted in different countries, there have been few researches on cigarette smoking in iran. nazary. studied the prevalence of smoking among male students in semnan university of medical sciences, iran, and found a smoking rate of 14.4% (10). in another study, ahmadi. assessed the prevalence of cigarette smoking among students of shiraz university of medical sciences. the internship students showed the highest prevalence of smoking (17%) among the medical students (11). the preliminary studies highlight the need for performing more investigations on the prevalence and determinants of tobacco use and developing effective cessation interventions for health professional students. the current study aimed to investigate the prevalence of active cigarette smoking, socio - demographic data, knowledge and attitudes about cigarette use, exposure to second - hand tobacco smoke, attitude of willingness to stop smoking, etc. among health professional students in mums, mashhad, iran. the current cross - sectional study was conducted on the students of six faculties of mums (dentistry, medicine, midwifery and nursing, pharmacy, paramedical sciences and public health) in autumn (october and november) 2008. a standard self - administered questionnaire adopted from the global health professional survey (ghps), designed for health professionals by the who and the canadian public health association was used in this study (12). the inclusion criteria for the analysis were (a) student status, (b) age between 18 and 28 years, (c) consent to participate in the survey, and (d) no missing data for the tobacco - related variables. a total of 936 students met these criteria and completed the information (about 85%). informed consent was obtained from each participant included in the study and the study protocol conformed to the ethical guidelines of the 1975 helsinki declaration. ethical approval was granted by mums ethics committee prior to the data collection (ethical approval code : 87685). the study proposal and instruments, the students were informed that the information collected would be kept anonymous and that participation was completely voluntary. the questionnaire was designed in three parts ; the first part consisted of socio - demographic data (age, sex, health professional discipline, marital status and ethnicity), smoking status of their father / mother / other family members, daily exposure to cigarette smoking and participant smoking status (current smokers including daily smokers and occasional smokers and former smokers). the second part of the questionnaire included the data on attitudes towards using or not using cigarettes, age of the smoking onset, reasons to start smoking, reasons to continue smoking, number of cigarettes smoked per day, duration of smoking, places most commonly smoked in, and the number of quit attempts. the third part included the questions regarding the cigarette advertisements and prohibitions, awareness of cigarette negative effects and reasons, smoking cessation, and the reaction of participant in places where there are people who smoke. in accordance with the who guidelines, the students were categorized as daily smokers, occasional smokers, former smokers or nonsmokers. daily smokers were defined as those who smoked at least one cigarette per day for at least one month before completing the questionnaire ; occasional smokers were defined as those who did not smoke daily ; former smokers (ex - smokers) were defined as those who previously had a daily smoking habit for a continuous period of six months but had given up smoking at least one month prior to completion of the questionnaire ; and nonsmokers were defined as those who had never smoked or who had been smoking for less than one month. descriptive data analysis was performed using statistical package for the social sciences (spss) version 17.0. the independent effect of individual factors, multiple logistic regression analysis was used and odds ratio (or) with 95% cis were computed. among all 936 students included in the study, 44.6% were male and 55.4% were female (table 1). the effects of various independent variables on the prevalence rate of cigarette smoking were investigated, and odds ratios were calculated. the overall prevalence of cigarette smoking was 9.8% with significant differences in prevalence by gender ; 17.6% among males and 4.2% among females (70.57 ; p 0.05). also, the mean age of starting cigarette was 19.6 2.5 and 18.9 2.4 years for male and female students, respectively. among all students, 18.3% (95% ci 8.2 - 15.4) reported never having tried or experienced cigarette smoking. the prevalence of daily, occasional and former smokers was 9.8%, 3% and 5%, respectively (table 2). also, analysis of data showed that men were significantly more likely to become daily smokers than women (18.9% vs. 2.5% ; p < 0.001 ; 70.57). the onset age of female students who smoked regularly was 18.9 2.4 years, lower but not statistically significant compared to that of male students (19.6 2.56 years). most of the men (26.6%) and women (44.5%) were smokers for more than four years (table 3). also, it was found that 50% of the students had smokers in their family, father, mother, brother or sister (table 4). the most common reasons to start smoking were ranked as follows : friends (24.9%), distress and anxiety due to dormitory residency (23%) or pleasure and fun (22.8%). on the other hands, the most important reasons to continue most of the smokers (53%) reported that they achieved their goals set prior to the onset of smoking and 18.5% of smokers believed that cigarette smoking was not helpful to achieve their goals, while 28.4% had no knowledge about it. the number of cigarettes per day was 1 - 5, 6 - 10, 11 - 15, and 16 - 20 cigarettes in 25%, 32%, 17.7% and 25.5% of smokers, respectively. favorite smoking places were as follows : parks and campus (37.8%), dormitory (18%), no particular places (9.4%), at parties (8%) and bath room (7.1%). the majority of participants (92.3%) reported that they were aware of the hazards of smoking. a significant difference regarding awareness of smoking hazards was observed between smokers and non - smokers (604.17 ; p < 0.001). significant gender differences (11.11, p < females (97.9%) were more likely to agree with smoking hazard effects on health than males (85.5%). in the current study, 5% of the participants reported that they have a history of successfully quitting cigarette smoking. they believed that the nisus (50%) was the most important reason to quit smoking. better knowledge about dangerous effects of cigarette smoking on health (27.8%) and caring for one s own health (11%) were the most important reasons to quit smoking. among the smokers, 90% intended to quit smoking, 45.4% had tried to quit smoking without any success, and 54.6% believed themselves able to quit smoking. all of the nonsmokers stated that they avoided environments where people were smoking, because of complications like respiratory distress (60.6%), hatred toward smoking persons (55.8%), headache (42.5%) and other problems such as nausea and vomiting, coughing and tearing. the most important preventive factors upon cigarette smoking were as follows : religious beliefs (70%), parents (40.2%), knowledge about cigarette - induced health problems (33.4%), information from mass media about the hazards of smoking (19%), and close friends (18.7%). the collected data showed that cigarette smoking was common (10%) among medical students in mashhad. previous studies in other cities of iran revealed that prevalence of smoking was 9%, 6%, 11% and 7.4% in shiraz, golestan, kerman and ardabil universities of medical sciences, respectively (13 - 16). therefore, it seems that the prevalence of smoking among iranian health professional students is approximately in the range of 6% to 11%. regarding the other countries in the middle - east, approximately similar prevalence (11%) was found by almerie. among the medical students of syria (17). on the other hand, other researchers reported different incidence of smoking among medical students in the united state (20%), germany (25%), turkey (22%), brazil (16.5%), jordan (28.6) and hong kong (0.7%) (5 - 8, 18, 19). therefore, the prevalence of tobacco smoking in the current sample is still lower than those of medical students in many other countries. also, a cross - country, cross - sectional study among 12 medical schools in four countries in europe (germany, italy, poland and spain) found that the overall prevalence of smoking among medical students (almost 30%) was higher than the general population (20). on the other hand, the rate of regular smokers in the mums is relatively smaller than that of general population in mashhad city (12.7%) described by boskabady. according to the current study data, the prevalence of smokers in male students was more than females. besides, the study found that in mashhad city, the prevalence of female smokers in students of medical sciences was 17.6% which is markedly higher than that of general population (1.7%) reported by boskabady. therefore, this point emphasized the necessity for a quit - smoking plan and a more active approach to prevent smoking among female medical students. moreover, the average age of starting smoking in the current sample was almost 19 years, which is two years lower than that of general population in mashhad and shiraz cities, iran (1, 22). the smoking onset age indicates that most of the participants started smoking after attending the university. in the current study, the most common reason to start smoking was friends. in agreement with the current study findings, previous studies on medical students in japan and albania also reported that friends were the most important factor associated with smoking behavior (22, 23). also in the current study student sample about 50% of the participants had smokers in their family, which again emphasizes on the important role of relatives and friends on starting cigarette smoking. more prevalence of smoking in some ethnicities, particularly turk and lor, emphasizes on identifying the ethnicity and cultural factors which influence the smoking behavior and probably manifests the lower knowledge of these groups regarding smoking complications. sixth - year students had higher prevalence of smoking (20%) than the students in the other study years. therefore, it seems that the students in the last years of education need a specific training regarding smoking cessation. understanding the prevalence and the factors associated with cigarette use among the health professional students is of particular concern because medically educated persons play a leading role in the development of overall public health policy and prevention of tobacco use in the society. thus, this understanding will aid to design tobacco / substance abuse prevention and control activities in the populations. regarding sampling, in order to include as many students as possible, the questionnaires were distributed to the students in dormitories. living without parents (in dormitories) is accompanied with freedom of previous limitations which can be associated with some changes in individual s life (3). therefore, the prevalence of smoking among the students living in dormitories may not be exactly the same as the general population of mums students. also, under - reporting of smoking was possible, because health professional students may be more sensitized than the other populations to reporting their smoking habits (18, 24). in addition, the study used a cross - sectional design to collect data on smoking behavior and related factors and possible bias could have occurred. smoking among medical students and health professionals is a serious concern because they should play important roles in smoking prevention and in assisting patients to quit smoking. this indicated the necessity of much more attention to educate the health professional students. in conclusion, although the prevalence of regular smokers among health professions students of mums was lower than those of the general populations, this level was still alarming and pointed at the rapid growth towards cigarette use, especially among female students. medical schools should work harder to tackle this phenomenon and address it more efficiently in their curricula. | background : tobacco consumption is the second major cause of death and the fourth most common risk factor for diseases, worldwide. epidemiologic studies have traced the use of alcohol, tobacco, and illicit substances among medical students and physicians.objectives:the current study aimed to investigate the prevalence of cigarette smoking and the related factors among the students of medical sciences in mashhad university of medical sciences, mashhad, iran.patients and methods : this cross - sectional study was conducted on 946 health professional students in mashhad university of medical sciences (mums, iran) in autumn 2008. a standard self - administered questionnaire consisting of socio - demographic data, participant smoking status, family and peer smoking, attitudes and beliefs about smoking, awareness of cigarette negative effects and reasons for smoking cessation was used in the current study.results:among the students, 18.3% reported having ever tried or experienced with cigarette smoking. the overall prevalence of cigarette smoking was 9.8% with significant differences in prevalence rates by gender, 17.6% among males and 4.2% among females. starting and continuing smoking was significantly correlated with the family cigarette consumption habits. the most common reason to start smoking was friends (24.9%) and the most important reason to continue smoking was personal life distress (17.6%). the majority of participants (92.3%) reported that they were aware of the hazards of smoking. a significant difference regarding awareness of smoking hazards was observed between smokers and non - smokers. the most important preventive factor for cigarette smoking was religious beliefs (69.1%).conclusions : although the prevalence of regular smokers among health professions students of mums was lower than general populations, but this level is still alarming and points at the rapid growth of cigarette use, especially among female students. medical schools should work harder to tackle this phenomenon and address it more efficiently in their curricula. |
halogenated ethers bearing several f or cl atoms have been known for many years as narcotic gases. in these derivatives, the presence of one or several halogen atoms tends to make the ch bonds more acidic, which gives rise to specific interactions with surrounding enzymes and neuroreceptors [16 ]. enflurane (chclf - cf2-o - chf2), a volatile anaesthetic, is characterized by two ch bonds which can interact with neighboring molecules. the structures of the stable conformers of this molecule have been reported in earlier works [79 ]. the basicity of enflurane and its interaction with guest molecules have been investigated as well [1013 ]. recently, the atmospheric chemistry of halogenated ethers, such as isoflurane (cf3-chcl - o - chf2), desflurane (cf3-chf - o - chf2) and sevoflurane ((cf3)2-ch - o - ch2f) have been studied in the reaction with chlorine atoms and oh radicals, with respect to the global warming potentials of these compounds. lane and coworkers studied the reaction of enflurane with chlorine atom and the problems of ozone depletion. it is therefore important to investigate the interaction between halogenated ethers and water, which is one of the major constituents of the atmosphere. as far as we know, no theoretical or experimental data have been reported for the enflurane - water complexes., we will discuss the structures, binding energies and enthalpies of formation of the hydrogen bonded enflurane complexes with water. the stabilization energies of the complexes have been determined at the mp2/6311++g(d, p) and ccsd(t)/complete basis set (cbs) levels of theory. to estimate the role of the cooperativity or anti - cooperativity effects, the three - body contributions to the total binding energies have been calculated. in the second part, the cl halogen bonded complexes between enflurane and water full geometry optimizations followed by the calculations of vibrational frequencies and infrared intensities were performed for the two most stable conformers of enflurane and their complexes with water using an ab initio second order mller - plesset perturbation method combined with the 6311++g(d, p) basis set [16, 17 ]. the counterpoise cp - corrected gradient optimization, which eliminates the basis set superposition error (bsse), has been used in all calculations of the minimum energy structures of the complexes investigated. the proton affinity (pa) as well as the deprotonation energy (dpe) were calculated as the negative enthalpy change and the enthalpy change of the reactions (1) and (2), respectively, assuming standard conditions in the gas phase. 1\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ { \rm{a}}{{{\rm{h}}}_{{({\rm{g } }) } } } + { { { \rm{h}}}_{{({\rm{g}})}}}^ { + } \ ; \to { \rm{a}}{{{\rm{h}}}_{{2({\rm{g}})}}}^ { + } { \rm{pa } } = - \delta { { { \rm{h}}}^{{298 } } } $ $ \end{document}2\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ { \rm{a}}{{{\rm{h}}}_{{({\rm{g } }) } } } \to { { { \rm{a}}}_{{({\rm{g}})}}}^ { - } + { { { \rm{h}}}_{{({\rm{g}})}}}^ { + } \ ; \;{\rm{dpe } } = \delta { { { \rm{h}}}^{{298 } } } $ $ \end{document}where ah = isolated enflurane molecule. the total stabilization energies of the enflurane - water complexes were determined at the mp2/6311++g(d, p) and ccsd(t)/complete basis set (cbs) levels of theory. the ccsd(t)/cbs stabilization energy was calculated as the sum of the mp2/cbs stabilization energy and the ccsd(t) correction term. the mp2/cbs energy was extrapolated from the mp2 energies evaluated with the aug - cc - pvdz and aug - ccpvtz basis sets. the ccsd(t) correction term (the difference between the ccsd(t) and mp2 interaction energies) was determined with the aug - cc - pvdz basis set [21, 22 ]. enthalpies of formation of the enflurane - water complexes under standard conditions, in the gas phase, were calculated at the mp2/6311++g(d, p) and ccsd(t)/cbs levels. the ccsd(t)/cbs enthalpy was determined as the sum of the ccsd(t)/cbs electronic energy and the zero - point vibrational energy and the thermal correction to enthalpy obtained by the mp2/6311++g(d, p) method. the evaluation of the three - body contribution (e3b) to the total interaction energy (eint) of the enflurane complex with two water molecules was performed at the mp2/6311++g(d, p) and ccsd(t)/cbs levels of theory. the value of e3b was obtained as the difference between eint of the complex and the sum of three pairwise (two - body) interaction energies, e2b. the negative value of e3b means a cooperative effect, while the positive one corresponds to an anti - cooperative interaction in the three - body unit. natural bond orbital (nbo) analysis has been applied to calculate charges on individual atoms, orbital occupancies, hybridizations, and the second - order interaction energy (e) between the donor and acceptor orbitals. it should be mentioned that nbo method evaluates the energies of orbitals and the 2nd - order stabilization energies only in this case, when the 1-electron effective hamiltonian operator is well defined (e.g., fock or kohn - sham operator). therefore, in the mp2 calculations, the nbo analysis has been performed at the scf level. the two most stable structures of enflurane optimized at the mp2/6311++g(d, p) level of theory are shown in fig.1. conformers i and ii differ in energy by only 0.07 kcal mol. it should be mentioned that the stability order of the conformers is slightly different from that obtained at the mp2/6311g(2d) level in our earlier studies. conformers i and ii of the present work correspond to the b and c conformers of ref. let us notice that in i, the two ch bonds are in a trans position, and in ii, the two ch groups adopt the cis position. fig. 1structures of two most stable conformers of enflurane optimized at the mp/6311++g(d, p) level of theory and the numbering of atoms structures of two most stable conformers of enflurane optimized at the mp/6311++g(d, p) level of theory and the numbering of atoms the structures of enflurane (i and ii) complexes with one water molecule (1 - 1) are illustrated in fig. 2. as is seen, in the 1 - 1 complexes involving both conformers, water interacts with enflurane through ch ow hydrogen bonds, with the c1h5 ow or c4h12 ow distances varying between 2.23 and 2.32. weak interaction between one of the f atoms and the h atom of water is also possible, the hw f distances being much longer (between 2.60 and 2.87). o3 complex has been found on the potential energy surface. in the ia complex (fig. o3 distance is too long (2.80) to be classified as a true hydrogen bond. 2structures of enflurane complexes with one water molecule optimized at the mp2/6311++g(d, p) level. the dot lines indicate selected intermolecular distances (in angstroms), angles are in degrees structures of enflurane complexes with one water molecule optimized at the mp2/6311++g(d, p) level. the dot lines indicate selected intermolecular distances (in angstroms), angles are in degrees the structures of enflurane complexes with two water molecules (12) are shown in fig. it is important to notice that in these complexes, the intermolecular distances remain approximately the same as in the 1 - 1 complexes, the ch ow distances varying between 2.23 and 2.34, and the owhw f distances being between 2.41 and 2.61. in ia and ic, the o13h14 f11 intermolecular angles are markedly larger (146 and 152, respectively) than the oh f intermolecular angles in the remaining complexes (100110). further, the c4h12 ow hydrogen bonds tend to be more linear than the c1h5 ow. it is worth mentioning that in the enflurane dimer, the o3 atoms do not participate in the interaction. the two enflurane molecules having the trans conformation are held together by ch f hydrogen bonds. 3structures of enflurane complexes with two water molecules optimized at the mp2/6311++g(d, p) level. the dot lines indicate selected intermolecular distances (in angstroms), angles are in degrees structures of enflurane complexes with two water molecules optimized at the mp2/6311++g(d, p) level. the dot lines indicate selected intermolecular distances (in angstroms), angles are in degrees the enthalpy of deprotonation and protonation of the two conformers are presented in table 1. table 1enthalpies of deprotonation of h5 or h12 atoms and proton affinities (pa) of o3 for the two most stable conformers of enflurane (under standard conditions), calculated at the mp2/6311++g(d, p) and ccsd(t)/cbs levels [all values in kcal mol]conformerhhidpe (c1h5)365.6363.1dpe (c4h12)367.5367.3pa150.3151.8iidpe (c1h5)365.2362.8dpe (c4h12)368.6368.1pa154.5156.4the numbering of atoms is shown in fig. 1calculated as sum of e and zero - point vibrational energy and thermal correction to enthalpy obtained at the mp2 levelpa = h enthalpies of deprotonation of h5 or h12 atoms and proton affinities (pa) of o3 for the two most stable conformers of enflurane (under standard conditions), calculated at the mp2/6311++g(d, p) and ccsd(t)/cbs levels [all values in kcal mol ] the numbering of atoms is shown in fig. 1 calculated as sum of e and zero - point vibrational energy and thermal correction to enthalpy obtained at the mp2 level in the present systems, the ch this can be related to a larger basicity (pa = 165 kcal mol) and a lower acidity (dpe = 390 kcal mol) of water molecule, in comparison to the corresponding values calculated for the two conformers of enflurane. h2o (pa(o) = 174 kcal mol) is stabilized by an owhw o interaction, while in the chfclochf2 h2o complex (pa(o) = 155 kcal mol), the ch o, showing the predominance of the ch ow hydrogen bond over the owhw o interaction. in contrast, the complex between ch2fcho (pa(o) = 161 kcal mol, dpe(ch) = 352.3 kcal mol) and water shows a preference for a cyclic structure, the owhw o hydrogen bond being shorter than the ch table 2 lists the binding energies for the interaction of the i and ii conformers of enflurane with one water molecule calculated at the mp2/6311++g(d, p) and ccsd(t)/cbs levels of theory. the ccsd(t)/cbs stabilization energies for the ia, ib, iia and iib complexes are 5.89, 5.04, 4.67 and 4.66 kcal mol, respectively. these results indicate that ia and ib are more stable than the iia and iib complexes. table 2binding energies (e and e) and enthalpies of formation (hf and hf) of the enflurane - water complexes, calculated at the mp2/6311++g(d, p) and ccsd(t)/cbs levels [all values in kcal mol]iaibiiaiibe4.594.163.833.85e5.895.044.674.66hf3.062.732.432.42hf4.353.583.293.22corrected for bsseenthalpy of formation under standard conditionszero - point vibrational energy and thermal correction to enthalpy obtained at the mp2 level binding energies (e and e) and enthalpies of formation (hf and hf) of the enflurane - water complexes, calculated at the mp2/6311++g(d, p) and ccsd(t)/cbs levels [all values in kcal mol ] enthalpy of formation under standard conditions zero - point vibrational energy and thermal correction to enthalpy obtained at the mp2 level table 2 also shows the values of the enthalpies of formation of the enflurane - water complexes, calculated at both levels of theory (under standard conditions in the gas phase). the ccsd(t)/cbs calculated enthalpies of formation are 4.35, -3.58, 3.29 and 3.22 kcal mol for the ia, ib, iia and iib complexes, respectively. the negative value of enthalpy implies that the formation of the enflurane - water complexes is the exothermic process. binding energies and dpes vary in a very small range and no correlation could be found between these two parameters as in the case of the halogenated ethers and water complexes. cooperative and anti - cooperative effects have been the subject of many studies [23, 2934 ]. table 3 collects the total binding energies, sum of the pairwise interaction energies and the three - body contribution (e3b) to the interaction energies of the two complexes of enflurane with two water molecules (ic and iic, shown in fig. 3), calculated at the mp2/6311++g(d, p) and ccsd(t)/cbs levels of theory. table 3total binding interaction energy (eint), sum of pairwise interaction energies (e2b), and the three - body contribution (e3b) of enflurane (enf) complexes with water (a and b) molecules. calculations performed at the mp2/6311++g(d, p) and ccsd(t)/cbs levels [all values in kcal mol]mp2ccsd(t)iciiciciiceint9.017.6011.419.56e2b8.947.7511.329.68e3b0.070.150.090.12corrected for bsse total binding interaction energy (eint), sum of pairwise interaction energies (e2b), and the three - body contribution (e3b) of enflurane (enf) complexes with water (a and b) molecules. calculations performed at the mp2/6311++g(d, p) and ccsd(t)/cbs levels [all values in kcal mol ] as follows from this table, the ccsd(t)/cbs absolute value of the total interaction energy of ic amounts to 11.41 kcal mol, and is larger (by 1.85 kcal mol) than that of the complex iic. for the ic complex, the value of e3b is negative and very small (0.09 kcal mol), which indicates that the cooperativity is negligible. in the case of the iic complex, the value of e3b is positive and small (0.12 kcal mol, about 1 % of eint) which implies the presence of a very weak anti - cooperative effect. examples of the cooperativity effects have been recently illustrated in the cyclic complexes between cycloethers and h2o where both ch ow and owhw o are strengthened. as expected, with regard to the ic complex (negligible cooperativity) there is no change in the intermolecular ch ow distances, in comparison to ia and ib, while in the iic complex (a small anticooperativity) the c1h5 o13 and c4h12 o16 distances are longer, by 0.05 and 0.02, than the corresponding distances in the iia and iib complexes, respectively. complex formation with water results in a contraction of the ch bond involved in the ch ow interaction along with a blue shift (between 18 and 26 cm) of the corresponding vibration. blue shifts of the same order of magnitude (between 19 and 25 cm) were predicted for the complexes between enflurane and acetone (i conformer, bound with water at the c1h5 and c4h12 sites). as seen in table 4, an ir intensity increase was predicted for the complexes formed at the c1h5 bond, while an ir intensity decrease was predicted for the complexes formed at the c4h12 bond. let us notice that the analogous variations of ir intensity have been observed experimentally in our earlier work on enflurane complexes with acetone. table 4c - h distances (r in), frequencies (in cm) and corresponding infrared intensities (a in km mol) of c - h stretching vibration in two conformers of enflurane and their complexes with water molecules. calculations performed at the mp2/6311++g(d, p) levelc1h5rraai1.09031855ia1.0890.0013204 + 1911 + 6ib1.0900.0003186 + 150ic1.0890.0013203 + 1811 + 6ii1.09031765iia1.0890.0013202 + 2612 + 7iib1.0900.000317516 + 1iic1.0890.0013199 + 237 + 2c4h12i1.089321012ia1.0880.0003215 + 5111ib1.0880.0013229 + 1975ic1.0880.0013233 + 2375ii1.089320514iia1.0890.0003205015 + 1iib1.0880.0013229 + 2468iic1.0880.0013226 + 21410the corresponding structures are shown in figs. 1 and 2,changes in the bond length in comparison to the isolated conformer, changes in the (c - h) frequency in comparison to the isolated conformer, changes in the ir intensity (a) c - h distances (r in), frequencies (in cm) and corresponding infrared intensities (a in km mol) of c - h stretching vibration in two conformers of enflurane and their complexes with water molecules. calculations performed at the mp2/6311++g(d, p) level the corresponding structures are shown in figs. 1 and 2, changes in the bond length in comparison to the isolated conformer, changes in the (c - h) frequency in comparison to the isolated conformer, changes in the ir intensity (a) the selected results from the nbo analysis are collected in table 5. as seen in this table, the contraction of the c1h5 and c4h12 bonds mainly results from the decrease in occupancy of the corresponding (ch) orbital. a small increase of the s - character of the c atom may also contribute to this contraction, which has been largely discussed in earlier works [3543 ]. the interaction with water also leads to a decrease of the positive charge on c and an increase of this charge on the h atom. table 5electron density in the (ch) and (ch) orbitals and the s - character of the valence orbital on the c atom (in %) in isolated i and ii conformers and their complexes with h2oc1h5% s - char% s - chari1.98600.029727.2ia1.98550.00050.02790.001828.31.1ib1.98600.00000.02960.000127.20ic1.98540.00060.02780.001928.21ii1.98710.029426.8iia1.98680.00030.02760.0018281.2iib1.98730.00020.02940.000026.80iic1.98690.00020.02760.001827.91.1c4h12i1.99420.034730.2ia1.99430.00010.03400.000730.30.1ib1.99440.00020.03310.001631.41.2ic1.99430.00010.03260.002131.61.4ii1.99420.035230.1iia1.99420.00000.0354 + 0.0002300.1iib1.99430.00010.03340.001831.41.3iic1.99430.00010.03340.001831.31.2changes of, and s - char, respectively, caused by interaction with water molecules electron density in the (ch) and (ch) orbitals and the s - character of the valence orbital on the c atom (in %) in isolated i and ii conformers and their complexes with h2o changes of, and s - char, respectively, caused by interaction with water molecules the values of the hyperconjugation energies (e) in the isolated conformers and their h2o complexes are collected in table 6. in all the systems, there is an intermolecular charge transfer from the lone pair orbital (lp) of the o atom of water (ow) to the (c1h5) or (c4h12) orbitals, as indicated by the corresponding second - order interaction energies (einter) in table 6. these energies are moderate, ranging from 1.8 to 3.6 kcal mol, and are somewhat larger for the complexes formed at the c4h12 bond. table 6intermolecular second - order interaction energies (e, kcal mol) in the i and ii complexes of enflurane with h2oiiaibiclpow (c1h5)1.941.84lpow (c4h12)3.613.54iiiiaiibiiclpow (c1h5)2.121.76lpow (c4h12)3.503.19 intermolecular second - order interaction energies (e, kcal mol) in the i and ii complexes of enflurane with h2o finally, it should be noted that the interaction between enflurane and water results in a small perturbation of the normal vibrational modes of water. for the ic(1) complex as for example, the and (oh) stretching frequencies are red - shifted, by 13 and 12 cm, respectively, while the (oh) bond frequency is blue - shifted by 12 cm. it is also worth stressing that in contrast to most of the oh o hydrogen bonds, the intensity ratio v(oh)/(oh) is larger than 1. studies of the electrostatic potentials of the halogen bonded systems show that the lone electron pairs of the halogen atom bonded to the carbon atom form a belt of negative electrostatic potential around its central part leaving the outermost region positive, the so called -hole [44, 45 ]. the halogen bonding was explained as a noncovalent interaction between a covalently bound halogen on one molecule and a negative site of another [4449 ]. the structures of the halogen bonded enfluraneoh2 complexes optimized at the mp2/6311++g(d, p) level are illustrated in fig.4. 4structures of halogen bonded complexes of enflurane with water molecule optimized at the mp2/6311++g(d, p) level. the dot lines indicate selected intermolecular distances (in angstroms), angles are in degrees structures of halogen bonded complexes of enflurane with water molecule optimized at the mp2/6311++g(d, p) level. the dot lines indicate selected intermolecular distances (in angstroms), angles are in degrees the c1-cl7 bond distance is equal to 1.748 in two complexes, thus, it is shorter by 0.004 relative to that in the enflurane monomers (1.752). the contraction of this bond is concomitant with an increase of the (c1cl7) stretching frequency (blue - shift) by + 2 and + 4 cm, in the i d and iid complexes, respectively. the infrared intensities of the corresponding stretching mode decrease by 6 and 12 km mol, respectively. as depicted in fig.4, the intermolecular cl7o13 distances in the i d and iid complexes are equal to 3.17 and 3.18, respectively. these values are smaller than the sum of the van der waals radii of the chlorine and oxygen atoms, 3.27. the analogous (clo) distance, in the halogen bonded enfluraneformaldehyde complex was found to be 3.30. in biological molecules with the halogen bond, the average cclo angle is between 160 and 180. in the i d and iid complexes, the c1cl7o13 angles are 176.8 and 166.3, respectively. nbo analysis has revealed that in the halogen bonded enfluranewater complexes, the cl atom shows the largest change of the atomic charge, in comparison to isolated molecules. in i d and iid, the charge on cl increases by 0.026 and 0.023 e, respectively. as was mentioned earlier, the chlorine atom has three lone electron pairs which form a belt of negative electrostatic potential around the central part of this atom, leaving the outermost region positive (-hole). one of them (lp(2)o13) is involved in the formation of the halogen bond, and it overlaps with the (c1cl7) orbital of enflurane. in both the complexes considered, the second - order interaction energies (e) between the donor (lp(2)o13) and acceptor ((c1cl7)) orbitals are smaller than 0.5 kcal mol. the ccsd(t)/cbs stabilization energies for the i d and iid complexes are 1.81 and 1.89 kcal mol, respectively. thus, the halogen bonded enfluraneoh2 complexes are weaker than the hydrogen bonded enfluraneoh2 complexes, by more than 3 kcal mol. the two most stable structures of enflurane optimized at the mp2/6311++g(d, p) level of theory are shown in fig.1. conformers i and ii differ in energy by only 0.07 kcal mol. it should be mentioned that the stability order of the conformers is slightly different from that obtained at the mp2/6311g(2d) level in our earlier studies. conformers i and ii of the present work correspond to the b and c conformers of ref. let us notice that in i, the two ch bonds are in a trans position, and in ii, the two ch groups adopt the cis position. fig. 1structures of two most stable conformers of enflurane optimized at the mp/6311++g(d, p) level of theory and the numbering of atoms structures of two most stable conformers of enflurane optimized at the mp/6311++g(d, p) level of theory and the numbering of atoms the structures of enflurane (i and ii) complexes with one water molecule (1 - 1) are illustrated in fig. 2. as is seen, in the 1 - 1 complexes involving both conformers, water interacts with enflurane through ch ow hydrogen bonds, with the c1h5 ow or c4h12 ow distances varying between 2.23 and 2.32. weak interaction between one of the f atoms and the h atom of water is also possible, the hw f distances being much longer (between 2.60 and 2.87). o3 complex has been found on the potential energy surface. in the ia complex (fig. o3 distance is too long (2.80) to be classified as a true hydrogen bond. 2structures of enflurane complexes with one water molecule optimized at the mp2/6311++g(d, p) level. the dot lines indicate selected intermolecular distances (in angstroms), angles are in degrees structures of enflurane complexes with one water molecule optimized at the mp2/6311++g(d, p) level. the dot lines indicate selected intermolecular distances (in angstroms), angles are in degrees the structures of enflurane complexes with two water molecules (12) are shown in fig. it is important to notice that in these complexes, the intermolecular distances remain approximately the same as in the 1 - 1 complexes, the ch ow distances varying between 2.23 and 2.34, and the owhw f distances being between 2.41 and 2.61. in ia and ic, the o13h14 f11 intermolecular angles are markedly larger (146 and 152, respectively) than the oh f intermolecular angles in the remaining complexes (100110). further, the c4h12 ow hydrogen bonds tend to be more linear than the c1h5 ow. it is worth mentioning that in the enflurane dimer, the o3 atoms do not participate in the interaction. the two enflurane molecules having the trans conformation are held together by ch f hydrogen bonds. 3structures of enflurane complexes with two water molecules optimized at the mp2/6311++g(d, p) level. the dot lines indicate selected intermolecular distances (in angstroms), angles are in degrees structures of enflurane complexes with two water molecules optimized at the mp2/6311++g(d, p) level. the dot lines indicate selected intermolecular distances (in angstroms), angles are in degrees the enthalpy of deprotonation and protonation of the two conformers are presented in table 1. table 1enthalpies of deprotonation of h5 or h12 atoms and proton affinities (pa) of o3 for the two most stable conformers of enflurane (under standard conditions), calculated at the mp2/6311++g(d, p) and ccsd(t)/cbs levels [all values in kcal mol]conformerhhidpe (c1h5)365.6363.1dpe (c4h12)367.5367.3pa150.3151.8iidpe (c1h5)365.2362.8dpe (c4h12)368.6368.1pa154.5156.4the numbering of atoms is shown in fig. 1calculated as sum of e and zero - point vibrational energy and thermal correction to enthalpy obtained at the mp2 levelpa = h enthalpies of deprotonation of h5 or h12 atoms and proton affinities (pa) of o3 for the two most stable conformers of enflurane (under standard conditions), calculated at the mp2/6311++g(d, p) and ccsd(t)/cbs levels [all values in kcal mol ] the numbering of atoms is shown in fig. 1 calculated as sum of e and zero - point vibrational energy and thermal correction to enthalpy obtained at the mp2 level in the present systems, the ch this can be related to a larger basicity (pa = 165 kcal mol) and a lower acidity (dpe = 390 kcal mol) of water molecule, in comparison to the corresponding values calculated for the two conformers of enflurane. h2o (pa(o) = 174 kcal mol) is stabilized by an owhw o interaction, while in the chfclochf2 h2o complex (pa(o) = 155 kcal mol), the ch o, showing the predominance of the ch ow hydrogen bond over the owhw o interaction. in contrast, the complex between ch2fcho (pa(o) = 161 kcal mol, dpe(ch) = 352.3 kcal mol) and water shows a preference for a cyclic structure, the owhw o hydrogen bond being shorter than the ch table 2 lists the binding energies for the interaction of the i and ii conformers of enflurane with one water molecule calculated at the mp2/6311++g(d, p) and ccsd(t)/cbs levels of theory. the ccsd(t)/cbs stabilization energies for the ia, ib, iia and iib complexes are 5.89, 5.04, 4.67 and 4.66 kcal mol, respectively. these results indicate that ia and ib are more stable than the iia and iib complexes. table 2binding energies (e and e) and enthalpies of formation (hf and hf) of the enflurane - water complexes, calculated at the mp2/6311++g(d, p) and ccsd(t)/cbs levels [all values in kcal mol]iaibiiaiibe4.594.163.833.85e5.895.044.674.66hf3.062.732.432.42hf4.353.583.293.22corrected for bsseenthalpy of formation under standard conditionszero - point vibrational energy and thermal correction to enthalpy obtained at the mp2 level binding energies (e and e) and enthalpies of formation (hf and hf) of the enflurane - water complexes, calculated at the mp2/6311++g(d, p) and ccsd(t)/cbs levels [all values in kcal mol ] enthalpy of formation under standard conditions zero - point vibrational energy and thermal correction to enthalpy obtained at the mp2 level table 2 also shows the values of the enthalpies of formation of the enflurane - water complexes, calculated at both levels of theory (under standard conditions in the gas phase). the ccsd(t)/cbs calculated enthalpies of formation are 4.35, -3.58, 3.29 and 3.22 kcal mol for the ia, ib, iia and iib complexes, respectively. the negative value of enthalpy implies that the formation of the enflurane - water complexes is the exothermic process. binding energies and dpes vary in a very small range and no correlation could be found between these two parameters as in the case of the halogenated ethers and water complexes. cooperative and anti - cooperative effects have been the subject of many studies [23, 2934 ]. table 3 collects the total binding energies, sum of the pairwise interaction energies and the three - body contribution (e3b) to the interaction energies of the two complexes of enflurane with two water molecules (ic and iic, shown in fig. 3), calculated at the mp2/6311++g(d, p) and ccsd(t)/cbs levels of theory. table 3total binding interaction energy (eint), sum of pairwise interaction energies (e2b), and the three - body contribution (e3b) of enflurane (enf) complexes with water (a and b) molecules. calculations performed at the mp2/6311++g(d, p) and ccsd(t)/cbs levels [all values in kcal mol]mp2ccsd(t)iciiciciiceint9.017.6011.419.56e2b8.947.7511.329.68e3b0.070.150.090.12corrected for bsse total binding interaction energy (eint), sum of pairwise interaction energies (e2b), and the three - body contribution (e3b) of enflurane (enf) complexes with water (a and b) molecules. calculations performed at the mp2/6311++g(d, p) and ccsd(t)/cbs levels [all values in kcal mol ] as follows from this table, the ccsd(t)/cbs absolute value of the total interaction energy of ic amounts to 11.41 kcal mol, and is larger (by 1.85 kcal mol) than that of the complex iic. for the ic complex, the value of e3b is negative and very small (0.09 kcal mol), which indicates that the cooperativity is negligible. in the case of the iic complex, the value of e3b is positive and small (0.12 kcal mol, about 1 % of eint) which implies the presence of a very weak anti - cooperative effect. examples of the cooperativity effects have been recently illustrated in the cyclic complexes between cycloethers and h2o where both ch ow and owhw o are strengthened. as expected, with regard to the ic complex (negligible cooperativity) there is no change in the intermolecular ch ow distances, in comparison to ia and ib, while in the iic complex (a small anticooperativity) the c1h5 o13 and c4h12 o16 distances are longer, by 0.05 and 0.02, than the corresponding distances in the iia and iib complexes, respectively. complex formation with water results in a contraction of the ch bond involved in the ch ow interaction along with a blue shift (between 18 and 26 cm) of the corresponding vibration. blue shifts of the same order of magnitude (between 19 and 25 cm) were predicted for the complexes between enflurane and acetone (i conformer, bound with water at the c1h5 and c4h12 sites). as seen in table 4, an ir intensity increase was predicted for the complexes formed at the c1h5 bond, while an ir intensity decrease was predicted for the complexes formed at the c4h12 bond. let us notice that the analogous variations of ir intensity have been observed experimentally in our earlier work on enflurane complexes with acetone. table 4c - h distances (r in), frequencies (in cm) and corresponding infrared intensities (a in km mol) of c - h stretching vibration in two conformers of enflurane and their complexes with water molecules. calculations performed at the mp2/6311++g(d, p) levelc1h5rraai1.09031855ia1.0890.0013204 + 1911 + 6ib1.0900.0003186 + 150ic1.0890.0013203 + 1811 + 6ii1.09031765iia1.0890.0013202 + 2612 + 7iib1.0900.000317516 + 1iic1.0890.0013199 + 237 + 2c4h12i1.089321012ia1.0880.0003215 + 5111ib1.0880.0013229 + 1975ic1.0880.0013233 + 2375ii1.089320514iia1.0890.0003205015 + 1iib1.0880.0013229 + 2468iic1.0880.0013226 + 21410the corresponding structures are shown in figs. 1 and 2,changes in the bond length in comparison to the isolated conformer, changes in the (c - h) frequency in comparison to the isolated conformer, changes in the ir intensity (a) c - h distances (r in), frequencies (in cm) and corresponding infrared intensities (a in km mol) of c - h stretching vibration in two conformers of enflurane and their complexes with water molecules. calculations performed at the mp2/6311++g(d, p) level the corresponding structures are shown in figs. 1 and 2, changes in the bond length in comparison to the isolated conformer, changes in the (c - h) frequency in comparison to the isolated conformer, changes in the ir intensity (a) the selected results from the nbo analysis are collected in table 5. as seen in this table, the contraction of the c1h5 and c4h12 bonds mainly results from the decrease in occupancy of the corresponding (ch) orbital. a small increase of the s - character of the c atom may also contribute to this contraction, which has been largely discussed in earlier works [3543 ]. the interaction with water also leads to a decrease of the positive charge on c and an increase of this charge on the h atom. table 5electron density in the (ch) and (ch) orbitals and the s - character of the valence orbital on the c atom (in %) in isolated i and ii conformers and their complexes with h2oc1h5% s - char% s - chari1.98600.029727.2ia1.98550.00050.02790.001828.31.1ib1.98600.00000.02960.000127.20ic1.98540.00060.02780.001928.21ii1.98710.029426.8iia1.98680.00030.02760.0018281.2iib1.98730.00020.02940.000026.80iic1.98690.00020.02760.001827.91.1c4h12i1.99420.034730.2ia1.99430.00010.03400.000730.30.1ib1.99440.00020.03310.001631.41.2ic1.99430.00010.03260.002131.61.4ii1.99420.035230.1iia1.99420.00000.0354 + 0.0002300.1iib1.99430.00010.03340.001831.41.3iic1.99430.00010.03340.001831.31.2changes of, and s - char, respectively, caused by interaction with water molecules electron density in the (ch) and (ch) orbitals and the s - character of the valence orbital on the c atom (in %) in isolated i and ii conformers and their complexes with h2o changes of, and s - char, respectively, caused by interaction with water molecules the values of the hyperconjugation energies (e) in the isolated conformers and their h2o complexes are collected in table 6. in all the systems, there is an intermolecular charge transfer from the lone pair orbital (lp) of the o atom of water (ow) to the (c1h5) or (c4h12) orbitals, as indicated by the corresponding second - order interaction energies (einter) in table 6. these energies are moderate, ranging from 1.8 to 3.6 kcal mol, and are somewhat larger for the complexes formed at the c4h12 bond. table 6intermolecular second - order interaction energies (e, kcal mol) in the i and ii complexes of enflurane with h2oiiaibiclpow (c1h5)1.941.84lpow (c4h12)3.613.54iiiiaiibiiclpow (c1h5)2.121.76lpow (c4h12)3.503.19 intermolecular second - order interaction energies (e, kcal mol) in the i and ii complexes of enflurane with h2o finally, it should be noted that the interaction between enflurane and water results in a small perturbation of the normal vibrational modes of water. for the ic(1) complex as for example, the and (oh) stretching frequencies are red - shifted, by 13 and 12 cm, respectively, while the (oh) bond frequency is blue - shifted by 12 cm. it is also worth stressing that in contrast to most of the oh o hydrogen bonds, the intensity ratio v(oh)/(oh) is larger than 1. studies of the electrostatic potentials of the halogen bonded systems show that the lone electron pairs of the halogen atom bonded to the carbon atom form a belt of negative electrostatic potential around its central part leaving the outermost region positive, the so called -hole [44, 45 ]. the halogen bonding was explained as a noncovalent interaction between a covalently bound halogen on one molecule and a negative site of another [4449 ]. the structures of the halogen bonded enfluraneoh2 complexes optimized at the mp2/6311++g(d, p) level are illustrated in fig.4. 4structures of halogen bonded complexes of enflurane with water molecule optimized at the mp2/6311++g(d, p) level. the dot lines indicate selected intermolecular distances (in angstroms), angles are in degrees structures of halogen bonded complexes of enflurane with water molecule optimized at the mp2/6311++g(d, p) level. the dot lines indicate selected intermolecular distances (in angstroms), angles are in degrees the c1-cl7 bond distance is equal to 1.748 in two complexes, thus, it is shorter by 0.004 relative to that in the enflurane monomers (1.752). the contraction of this bond is concomitant with an increase of the (c1cl7) stretching frequency (blue - shift) by + 2 and + 4 cm, in the i d and iid complexes, respectively. the infrared intensities of the corresponding stretching mode decrease by 6 and 12 km mol, respectively. as depicted in fig.4, the intermolecular cl7o13 distances in the i d and iid complexes are equal to 3.17 and 3.18, respectively. these values are smaller than the sum of the van der waals radii of the chlorine and oxygen atoms, 3.27. the analogous (clo) distance, in the halogen bonded enfluraneformaldehyde complex was found to be 3.30. in biological molecules with the halogen bond, the i d and iid complexes, the c1cl7o13 angles are 176.8 and 166.3, respectively. nbo analysis has revealed that in the halogen bonded enfluranewater complexes, the cl atom shows the largest change of the atomic charge, in comparison to isolated molecules. in i d and iid, the charge on cl increases by 0.026 and 0.023 e, respectively. as was mentioned earlier, the chlorine atom has three lone electron pairs which form a belt of negative electrostatic potential around the central part of this atom, leaving the outermost region positive (-hole). one of them (lp(2)o13) is involved in the formation of the halogen bond, and it overlaps with the (c1cl7) orbital of enflurane. in both the complexes considered, the second - order interaction energies (e) between the donor (lp(2)o13) and acceptor ((c1cl7)) orbitals are smaller than 0.5 kcal mol. the ccsd(t)/cbs stabilization energies for the i d and iid complexes are 1.81 and 1.89 kcal mol, respectively. thus, the halogen bonded enfluraneoh2 complexes are weaker than the hydrogen bonded enfluraneoh2 complexes, by more than 3 kcal mol. 1) in the enflurane complexes with one and two water molecules, the ch ow hydrogen bonds are formed, with the ch ow distances varying between 2.23 and 2.32. a weak interaction between one of the f atoms and the h atom of water is also possible, the hw f distances being longer (between 2.41 and 2.87). no stable owhw this is line with our earlier results on enflurane dimer, where we have shown that the o atoms of enflurane (oenf) do not participate in hydrogen bonding. 2) the ch bonds involved in the ch ow interaction are contracted with respect to those in isolated enflurane. this is accompanied by a blue shift (between 18 and 26 cm) of the corresponding (ch) stretching frequencies. for (ch) vibrations an increase of the ir intensity was predicted for the complexes formed at the c1h5 bond, while a decrease of the ir intensity was calculated for the complexes formed at the c4h12 bond. similar effects have been found in our earlier experimental and theoretical studies of the enflurane complexes with acetone. 3) the ccsd(t)/cbs stabilization energies of the hydrogen bonded enflurane - water complexes vary between 5.89 and 4.66 kcal mol. the values of the enthalpies of formation of these complexes, calculated at the same level of theory, range between 4.35 and 3.22 kcal mol. 4) the ccsd(t)/cbs calculated three - body contribution to the total binding energy of the hydrogen bonded enflurane complex with two water molecules shows that the cooperativity effects are very weak. 5) the cl halogen bonding has been found in two enflurane complexes with water. the intermolecular (clo) distances (3.17 and 3.18) are smaller than the sum of the corresponding van der waals radii. the ccsd(t)/cbs stabilization energies for these complexes are 1.81 and 1.89 kcal mol. this indicates that the halogen bonded enfluraneoh2 complexes are weaker than the hydrogen bonded enflurane - water complexes. | increase of the atmospheric concentration of halogenated organic compounds is partially responsible for a change of the global climate. in this work we have investigated the interaction between halogenated ether and water, which is one of the most important constituent of the atmosphere. the structures of the complexes formed by the two most stable conformers of enflurane (a volatile anaesthetic) with one and two water molecules were calculated by means of the counterpoise cp - corrected gradient optimization at the mp2/6311++g(d, p) level. in these complexes the ch ow hydrogen bonds are formed, with the h ow distances varying between 2.23 and 2.32. a small contraction of the ch bonds and the blue shifts of the (ch) stretching vibrations are predicted. there is also a weak interaction between one of the f atoms and the h atom of water, with the hw f distances between 2.41 and 2.87. the ccsd(t)/cbs calculated stabilization energies in these complexes are between 5.89 and 4.66 kcal mol1, while the enthalpies of formation are between 4.35 and 3.22 kcal mol1. the cl halogen bonding between enflurane and water has been found in two complexes. the intermolecular (clo) distance is smaller than the sum of the corresponding van der waals radii. the ccsd(t)/cbs stabilization energies for these complexes are about 2 kcal mol1.figurecomplex between enflurane and water molecules |
an overview of the triatominae species of suriname was generated based on the specimens and collection data available at the collections of the bureau of public health in suriname (bog) and the national zoological collection of suriname (nzcs), anton de kom university, on the information provided by the natural history museum of leiden (nhml) (the netherlands) and on a literature review. as flora and fauna specimens collected during the colonial years were often transported to the netherlands and stored at the nhml, the information on the triatominae collection of this museum was included in this study. the republic of suriname is situated on the caribbean coast between guyana and french guiana, north of brazil. 1) that cover three major ecological landscapes : the northern coastal area, the southern forested highlands and the savannah belt in between. the coastal area is mainly lowland with swamps and mangroves, but also has shell ridges ; it is the most populated part of the country and almost all national agriculture is performed that region. the highlands in the interior are almost completely covered with tropical rainforest ; however, deforestation, especially due to gold mining, is increasing significantly. this area has some inselbergs or tepuis and small savannah areas along the south - southeastern border. the savannah belt stretches from east to west and separates the coastal lowlands from the interior highlands (fig. 2). fig. 1 : map of suriname showing the 10 districts : 1 : nickerie ; 2 : coronie ; 3 : saramacca ; 4 : para ; 5 : sipaliwini ; 6 : brokopondo ; 7 : wanica ; 8 : paramaribo (capital) ; 9 : commewijne ; 10 : marowijne. fig. 2 : satellite image of suriname showing the coastal area (yellow), the savannah belt (light brown) and the forested highlands (green). another 25% live in small towns along the roads and rivers of the coastal area. the remaining 5% of the population live in small villages in the savannah belt and interior, mostly along the marowijne, suriname and saramacca rivers. in addition, there is a growing population of brazilian mineral prospectors (garimpeiros ; estimated to be at least 15,000 people) involved in the rapidly growing, small - scale gold mining activities in the interior. suriname s tropical rainforest climate, with an average temperature of 27c and an average humidity of approximately 80%, is advantageous for a number of triatominae species. active collection of triatominae was performed by the author as part of an nzcs project in 2002. field surveys were conducted in kwamalasamutu (south suriname, on the border with brazil) and in djoemoe and nieuw - aurora (central suriname, along suriname river) using live - bait traps [according to abad - franch. following this project and as a result of mutual interest, the author and two colleagues started opportunistic collection of the triatominae encountered in and around their residences. the current combined amount of triatominae specimens in the three collections (nhml, nzcs and bog) is 429 and represents seven species (table i) : 62.5% r. pictipes, 20.3% p. geniculatus and 9.6% r. robustus. the nzcs holds specimens collected from 1998 and the bog collections started in 2005. a vast majority of the nzcs and bog specimens conserved since 2002 originate from the opportunistic collection by the author and colleagues from two of the three residences. table ii provides an overview of these triatominae, which were found at a residence in rural surroundings in the district of wanica between 2002 - 2005 and at a residence, also in rural surroundings, in the district of saramacca between 2002 - 2012. at the wanica residence, a total amount of 58 triatominae specimens were collected within the four years (r. pictipes, p. geniculatus, p. rufotuberculatus, p. lignarius), mostly attracted to a light on the balcony. the saramacca residence yielded 133 triatominae in 11 years (r. pictipes, r. robustus, p. geniculatus). all these specimens were included in either the nzcs or the bog insect collections (table i). table itriatominae species of suriname specimens n (%) speciesnhmlbognzcstotal eratyrus mucronatus 12 (7.9)0 (0)1 (0.6)13 (3) microtriato trinidadensis 0 (0)0 (0)0 (0)0 (0) panstrongylus geniculatus 47 (30.9)0 (0)40 (25.8)87 (20.3) panstrongylus lignarius 2 (1.3)0 (0)1 (0.6)3 (0.7) panstrongylus mitarakaensis 0 (0)0 (0)0 (0)0 (0) panstrongylus rufotuberculatus 5 (3.3)0 (0)11 (7.1)16 (3.7) rhodnius pictipes 73 (48)103 (84.4)92 (59.4)268 (62.5) rhodnius robustus 12 (7.9)19 (15.6)10 (6.5)41 (9.6) triatoma maculata 1 (0.7)0 (0)0 (0)1 (0.2)a : lent and wygodzinsky (1979) refer to a m. trinidadensis specimen originating from suriname and stored at the national history museum at leiden (nhml) (the netherlands). this specimen no longer exists ; b : the single known specimen of p. mitarakaensis is in france (french guiana) (brenger & blanchet 2007). data on number of specimens collected and their relative abundance (%) in the collections (until august 2013) from the nhml, bureau of public health in suriname (bog) and the national zoological collection of suriname (nzcs). a : lent and wygodzinsky (1979) refer to a m. trinidadensis specimen originating from suriname and stored at the national history museum at leiden (nhml) (the netherlands). this specimen no longer exists ; b : the single known specimen of p. mitarakaensis is in france (french guiana) (brenger & blanchet 2007). data on number of specimens collected and their relative abundance (%) in the collections (until august 2013) from the nhml, bureau of public health in suriname (bog) and the national zoological collection of suriname (nzcs). table iinumber of triatomine specimens found in a residence in saramacca (s) between 2002 - 2012 and in a residence in wanica (w) between 2002 - 2005 as a result of opportunistic collection rhodnius pictipes rhodnius robustus panstrongylus geniculatus panstrongylus rufotuberculatus panstrongylus lignarius swswswswsw20022910190000200331960020500200475400103012005321001010020064 - 1 - 0 - 0 - 0 - 200710 - 2 - 0 - 0 - 0 - 200818 - 0 - 0 - 0 - 0 - 200921 - 10 - 0 - 0 - 0 - 201024 - 2 - 0 - 0 - 0 - 20112 - 0 - 0 - 0 - 0 - 20128 - 3 - 0 - 0 - 0- total102353001130901 total / species n (%) 137 (71.7)30 (15.7)14 (7.3)9 (4.8)1 (0.5) the active collection of triatominae in 2002 yielded very little. the dissection of palm trees resulted in one adult r. pictipes from kwamalasamutu and one r. robustus nymph from nieuw aurora, both from maripa palm (attalea maripa). the r. pictipes adult was found near an opossum (didelphidae) nest, where it most likely found its blood meals. the r. robustus nymph was reared to adulthood before incorporation into the collection.. confirmed species - six of the seven species of triatominae from suriname currently represented in the historical collection of the nhml were also found since 1998, which confirms their presence in the country. t. maculata, collected in colonial times, was not found recently. according to lent and wygodzinsky (1979), a specimen of m. trinidadensis, collected in paramaribo, used to be present at the nhml. however, this is no longer the case and the species was not found in the country during the recent collections. the triatominae species known to be present in suriname are e. mucronatus, p. geniculatus, panstrongylus mitarakaensis, p. rufotuberculatus, p. lignarius, r. pictipes and r. robustus. the presence of r. robustus, p. rufotuberculatus and p. mitarakaensis in the country was not reported previously. p. mitarakaensis (brenger & blanchet 2007) is a recently discovered species. it was obtained from a locality at the mitaraka mountain range, situated between the litani river and marowijne river, which is part of the southern border range between suriname and french guiana. species in need of confirmation - the presence of four species requires confirmation. nonetheless, its presence in suriname is entirely possible because a specimen was recently found in french guiana, less than 200 km from suriname (brenger. t. maculata was collected in colonial times, but has not been seen found since. 2009), where records of its presence (carcavallo. 1999) could not be confirmed. the species shows an inclination for occurrences in peridomestic or domestic environments (lent & wygodzinsky 1979, luitgards - moura. the fact that the species has not been found since its first recordings allows for speculation that it may no longer exist in the country or that previous identifications may have been incorrect. the presence of t. rubrofasciata in suriname was mentioned by lent (1943) based on a study by stoll in 1788. the distribution range of t. rubrofasciata extends from florida and caribbean islands to the northern and eastern atlantic coasts of south america (carcavallo. 1999) and the species is reported from port cities throughout its range (lent & wygodzinsky 1979, braga. t. rubrofasciata is known for its transmission of trypanosoma conorhini among rats (braga. its presence in suriname would be consistent with its known distribution and is possible, though the species is unlikely to be abundant. some specimens are known from cayenne (french guiana), collected in 1975, but the species has not been collected since (brenger. the previous inclusion of suriname in the distribution area of r. prolixus (lent & wygodzinsky 1979) is suspected due to misidentified r. robustus specimens. r. robustus is rather common and the two species are notoriously difficult to separate morphologically (miles. the distribution range of r. prolixus may in fact exclude the guiana shield (monteiro. 2003, pavan & monteiro 2007), which will make its presence in the country even more unlikely. species likely to be present - some triatomine species known from bordering regions or due to their currently known distribution range are likely to be present in suriname as well. c. pilosa, r. amazonicus and r. paraensis were collected from northern brazil (state of par) and french guiana (carcavallo. 1999, brenger. 2009) and are likely to be present in the country. of the seven confirmed triatominae species from suriname, only three can be considered relatively abundant : p. geniculatus, r. pictipes and r. robustus (table i). all three species are likely to contribute directly or indirectly [via contamination of food sources (nbrega. 2009) ] to the transmission of trypanosoma cruzi to the human population (lent & wydgonzinsky 1979, barrett 1991, oostburg. the collection data from the nzcs and bog reveal that, although there is no domestic colonisation, it is common for the adults of these three species to enter residences, which is as likely in the forest as it is in rural areas and in the capital (r. robustus excluded because it was not collected in the capital). it is thought that, depending on the peridomestic vegetation characteristics, these species, especially r. robustus and r. pictipes, may even establish large colonies near houses, surviving by opportunistic feeding on mammals (abad - franch. r. pictipes is the most common species in all three insect collections and was most often encountered during the opportunistic collections in and around the residences in wanica and saramacca (table ii) (71.7% of the total). p. geniculatus was the second most frequently encountered species in the nhml and nzcs collections, but is absent from the bog collection. its potential as a chagas disease vector is thought to be significant due to its broad ecological range and its frequent occurrence in peridomestic habitats and domiciliary invasion by adults (gurgel - gonalves. p. geniculatus was the second most common species collected from the wanica residence, but was encountered only once at the saramacca residence. in contrast, the saramacca residence had many r. robustus specimens, whereas no specimens of this species were encountered in or around the wanica residence (table ii). considering that both residences had an abundance of nearby vegetation (including palm trees) and a number of dogs and other domestic animals, which provide a blood source around the house, it is difficult to explain these differences. environmental issues, such as vegetation diversity and characteristics (abad - franch. 2005, 2010), the (resulting) diversity in the availability of wild blood sources and the availability of light sources as attractants (castro. 2010) may have played a role. in the forests of the interior, the maroon, amerindian and garimpeiro populations often live in thatch - roofed or zinc - roofed huts or houses with wooden walls. the relatively poor housing conditions, combined with the increased use of electric lights as an attractant for the vectors (castro. 2010), provide opportunity for the accidental entry of triatominae into houses. factors that may further promote the entry of triatominae into houses include land use changes (e.g., deforestation for gold mining) (barrett 1991, abad - franch. 2005) and the custom of keeping hunting dogs and chickens near sleeping quarters. taking into account that the common triatominae species found in suriname are palm - inhabiting species, chagas disease can be considered an occupational risk for thatch and palm fruit harvesters. in addition, palm fruit consumers can be considered at risk for oral transmission (roque. 2008, nbrega. beverages made from the fruit of euterpe luminosa (aai) are commercially available throughout the country. t. cruzi transmission among wild mammals includes opossum and armadillo (roque. opossums (didelphis spp) are common in all eco - habitats in suriname and bring the sylvatic cycle to domestic environments, thus adding to the transmission risk. armadillo (dasypodinae) and a number of rodents (especially dasyproctidae), also considered part of the t. cruzi wild reservoir (sols - franco. 2008), are regularly included in the diet of people living in the interior of the country, which results in the risk of oral transmission. the number of triatominae specimens collected from the two rural residences each year is surprisingly high [up to 31 specimens in one year (2009) to the saramacca residence ] (table ii). both residences are near high vegetation that includes palm trees and have some domestic animals (especially dogs) living outside the house. the risk of triatomine - to - person contact appears to be considerable in such environments and needs to be studied further. the residences in paramaribo are mostly well - built, one or two - story brick homes with small trees and palms in the surrounding yards and sometimes air - conditioning. entry into houses by triatominae appears to be a bit less common than in rural areas, though it is certainly not rare and may have been the source of the first case of acute chagasic cardiopathy in suriname (oostburg. the patient, living in a suburban residential area of paramaribo, had adult p. geniculatus in his yard. the actual risk of t. cruzi transmission, of course, depends largely on the infection rate of the vectors. unfortunately, this information is not yet available for suriname for any of the species found in the country. in comparison, a study in the brazilian amazon revealed an infection rate for r. pictipes of 65% (valente. determining the infection rate for the three most common species in the country will be one of the priorities of future studies and the determination of the seroprevalence of t. cruzi infection among the population of suriname is a priority as well. studies in guyana and french guiana indicate an overall t. cruzi seroprevalence of 0.5% for these countries (aznar. in contrast, information on the seroprevalence of t. cruzi in the animal reservoir of suriname does not exist. bolboderini usinger, 1944, m. trinidadensis (lent, 1951) - the inclusion of suriname in the distribution range of m. trinidadensis was based on a specimen collected in paramaribo and conserved at the nhml (lent & wygodzinsky 1979). the species is known from bromeliads and was collected under tree bark (lent & wygodzinsky 1979), but has also been discovered (in all developmental stages) in peridomestic environments (de la riva. rhodniini pinto, 1926, r. pictipes stl, 1872 - r. pictipes is a widespread silvatic species that is frequently attracted to light and is known to enter houses on occasion (lent & wygodzinsky 1979, torres & cabrera 2010). it is the most common species collected in suriname and was often collected in domestic habitats. distribution : districts of paramaribo, commewijne, wanica, para (mapane), brokopondo (sara creek), saramacca, coronie, marowijne (galibi) and sipaliwini (benzdorp, nieuw aurora, apoera, coeroeni - island, kaboeri creek, bakhuys, kwamalasamutu). r. robustus larrousse, 1927 - some of the r. robustus specimens from suriname were initially thought to be r. prolixus, but mt - dna sequence analysis of the suriname specimens confirms them as type 4 (2003), which conforms to the estimated distribution of genotypes in abad - franch and monteiro (2007) ]. distribution : districts of saramacca, brokopondo (klaaskreek), para (republiek), marowijne (galibi) and sipaliwini (nieuw aurora). triatomini jeannel, 1919, e. mucronatus stl, 1859 - e. mucronatus is a sylvatic species with little epidemiological significance (lent & wygodzinsky 1979). it can be found in a variety of habitats, including dry and wet tropical forests (cuba. the one specimen found by the nzcs was collected in a recreational room at brownsberg nature park, an ecotourist site situated at 500 m above sea level in a humid tropical forest. its role as a vector of chagas disease is considered insignificant (barrett 1991), but evidence of domestic capture exists (torres & cabrera 2010). distribution : districts of paramaribo, brokopondo (brownsberg) and para (zanderij). p. geniculatus (latreille, 1811) - p. geniculatus is a frequently encountered species in suriname and is believed to have been the vector responsible for the first acute case of chagas disease recorded in the country (oostburg. adults of this species are commonly attracted to light and encountered in peridomestic environments (lent & wygodzinsky 1979, torres & cabrera 2010). the species is thought to have the potential for domestication and was found breeding in pigsties near human dwellings in brazil (valente 1999). distribution : districts of paramaribo, commewijne, wanica, para (mapane), saramacca and sipaliwini (nieuw aurora, sipaliwini savannah). p. lignarius (walker, 1873) - the one specimen of p. lignarius found by the nzcs came from a peridomestic situation, again most likely attracted by an electric light. this species was originally described by walker, in 1873, but was then redescribed by lent (1943) based on a surinamese specimen provided by dc geijskes, a dutch entomologist. p. mitarakaensis brenger and blanchet, 2007 - p. mitarakaensis was described as a new species by brenger and blanchet (2007) based on a specimen collected from a locality in the southeast of the mitaraka mountains (tumakhumak mountain range at the border with brazil), which is part of the southern border of suriname with french guiana. p. rufotuberculatus (champion, 1899) - p. rufotuberculatus is also frequently attracted to electric light (lent & wygodnzinsky 1979, salomn. it is known mainly from low, dry areas, but may also be found in zones of humid premontane forests (abad - franch. the species has been found in domestic environments elsewhere (torres & cabrera 2010). as originally described by champion (1899), p. rufotuberculatus shows considerable morphological variation. the specimens encountered in suriname have a reddish connexivum with a rectangular dark spot in each segment, slightly biconcave and a thin black band close to the intersegmental suture. the reddish carinae, limiting the central depression of the scutellum, appear to be similar to those found in specimens from panama and colombia [as described by salomn. (1999) ] and distinct from specimens from costa rica, venezuela, peru, bolivia and brazil, which generally present the scutellum entirely black. all post - colonial specimens originate from one residence in the district of wanica. t. maculata (erichson, 1848) - one specimen of t. maculata was reportedly captured in paramaribo. this was in 1963, when the capital had greater abundance of vegetation, including palm trees. t. maculata is a species with sylvatic and (peri) domestic occurrences (luitgards. considering that the species is not commonly found in a humid coastal habitat, the record needs confirmation. | nine species of triatominae, representing three tribes and five genera, are currently known in suriname. an annotated list of the species based on the collections of the bureau of public health (suriname), the national zoological collection suriname and the national history museum leiden (the netherlands) is provided. additionally, the results of several years of opportunistic collection in two domestic environments are presented. the most common species are rhodnius pictipes stl, 1972, rhodnius robustus larrouse, 1972 and panstrongylus geniculatus (latreille, 1811). the significance of the species as vectors of chagas disease in suriname is discussed. |
primary hyperparathyroidism (phpt) is associated with an increased risk of premature death in malignant disorders.13 the prevalence of phpt is highest in postmenopausal women, ie, 3%4%, and the origin is most often a single parathyroid adenoma.4,5 certain malignant tumors are over - represented, and breast cancer is the most frequent, comprising 25% of the malignancies diagnosed after parathyroid adenomectomy in women.3,6 an increased frequency of parathyroid adenoma and significantly higher serum calcium and parathyroid hormone levels have been documented in patients treated for breast cancer compared with healthy controls.7 these findings were unrelated to clinical staging or antitumor therapy. causal relationships have been discussed, and various shared predisposing genetic and environmental risk factors have been hypothesized. the aim of this study was to evaluate factors predictive of prognosis and response to therapy in a cohort of breast cancer patients with a history of phpt and to search for a potential link between phpt and breast cancer. it is a well - validated register, where under - reporting is 3%4%.8 all malignant and a few benign tumors, including parathyroid adenomas, are reported to the register by both the treating physician and the pathologist making the diagnosis. the diagnoses are coded using the international classification of diseases 7th revision (icd-7). requisites for inclusion of cases in this study were parathyroid adenomectomy of a single parathyroid adenoma (icd-7 1951) and a subsequent diagnosis of invasive breast cancer (icd-7 170). to minimize confounding by diagnosis, we excluded all cases with a breast cancer diagnosis before primary hyperparathyroidism (n = 59). all males were excluded, as were all women with a diagnosis of breast carcinoma in situ. we identified 71 women with breast cancer and previous surgery for phpt during the period from january 1, 1992 to december 31, 2006. for each patient, five control subjects with breast cancer but no history of parathyroid surgery, matched for age and time period, were enrolled. using the national registration number, a unique identifier for each swedish resident made linkage possible to two of sweden s six regional breast cancer registers. the registers for the stockholm - gotland and uppsala - rebro regions cover a population of 3.9 million, or 43% of the swedish population. the american joint committee on cancer staging system for breast cancer was used.9 dates of death until december 31, 2009 and causes of death until december 31, 2008 were retrieved from the swedish cause of death register. the study was approved by the ethical committee at the karolinska institutet, stockholm, sweden. statistical analysis was performed with the pasw for windows statistical package (18.0;pasw inc., the student s two - tailed, unpaired t - test was used to compare mean tumor size between the cases and control subjects. the chi - square test was used to compare lymph node involvement, and receptor status. the distributions of tumor characteristics of cases and controls were compared by pearson chi - square test. when cells had expected counts less than 5, a corresponding exact test was applied. survival time was calculated as the number of months between the date of diagnosis and date of death, or date at end of follow - up (whichever occurred first). breast cancer survival is presented in a kaplan meier plot and tested with the logrank test. statistical analysis was performed with the pasw for windows statistical package (18.0;pasw inc., the student s two - tailed, unpaired t - test was used to compare mean tumor size between the cases and control subjects. the chi - square test was used to compare lymph node involvement, and receptor status. the distributions of tumor characteristics of cases and controls were compared by pearson chi - square test. when cells had expected counts less than 5, a corresponding exact test was applied. survival time was calculated as the number of months between the date of diagnosis and date of death, or date at end of follow - up (whichever occurred first). breast cancer survival is presented in a kaplan meier plot and tested with the logrank test. the mean age at diagnosis of breast cancer was 69 years, with a standard deviation (sd) of 11 years (95% confidence interval [ci ] : 6870) in both groups. the interval between the parathyroid adenoma operation and breast cancer registration ranged from 1 to 292 months (mean 91 months, sd 68 months, 95% ci : 72111). tumor size, stage, axillary lymph node status, and hormone receptor status are presented in table 2. none of the prognostic factors analyzed in this study differed between the women with and those without a history of phpt. the duration of follow - up ranged from 0 to 307 months (mean 80 months, sd 59 months, 95% ci : 7486). in december 31, 2009, 29 (41%) cases and 150 (44%) controls had died. there was no statistically significant difference between the two groups in cumulative breast cancer - specific survival (see figure 1). the mechanisms underlying the coexistence of phpt and certain malignancies, including breast cancer, are still unknown. to our knowledge, the prognosis of breast cancer in women with a history of phpt has not been studied systematically. the aim of our study was to investigate whether the prognosis for breast cancer associated with phpt differs from that for breast cancer in the background population. comparing tumor size, stage, hormone receptor status, and the most important prognostic factor, axillary lymph node status, we found no difference between women with and those without a history of phpt. data on the prognostic factor, and predictive factor for trastuzumab therapy, her-2/neu, were incomplete, and there were no data on the cell proliferation marker, ki-67. ellis tumor grade could not be properly analyzed due to too many missing data, particularly in the earlier periods when the grade was not registered prospectively. risk factors for breast cancer and data on calcium and vitamin d levels were not available in the registries. we can not exclude the presence of phpt in the control group but, because the prevalence of phpt in the population is low, it may affect only isolated cases.5 our study design does not allow for comparisons between different treatment modalities, because the registry does not contain such data. however, the bias induced by differences in treatment strategy is likely to have been negligible, because there was near to complete compliance with regional / national treatment guidelines, and also by matching of five controls per case from the same region. the strengths of the study are that the registers used are well validated and that two important prognostic factors, ie, tumor size and lymphatic involvement, were included.8,9 the risk of confounding by diagnosis was minimized by excluding all cases with a breast cancer diagnosis before the diagnosis of phpt. the coexistence of phpt and breast cancer, recognized in several case reports and confirmed in large population studies, has given rise to much speculation concerning possible etiologic links.1,3,6,7 it remains to be elucidated whether the association between phpt and breast cancer is due to predisposing genetic or environmental risk factors. abnormalities in calcium metabolism have been associated with breast cancer risk, but the results reported from different studies have not been consistent. although higher serum calcium levels have been reported from breast cancer cohorts, no correlation was found between calcium level and tumor stage.7,10,11 a causal relationship between hypercalcemia and malignancy seems unlikely, given that the risk of breast cancer remains unchanged at least 15 years after parathyroid adenomectomy.3 vitamin d may be a key factor, and there is evidence of potential links between vitamin d deficiency and the development and prognosis of breast cancer, as well as aggravated clinical presentation of phpt and increased parathyroid tumor growth.1216 a modestly reduced incidence of breast cancer associated with a higher intake of vitamin d was reported from a meta - analysis of observational studies.17 the results from a randomized clinical trial of calcium and vitamin d supplementation versus placebo among postmenopausal women for a mean of seven years showed no detectable effect on breast cancer risk.18 however, the supplementation dose was rather low (1000 mg of elemental calcium with 400 iu vitamin d3 daily), additional use of calcium and vitamin d supplements was allowed, and the discontinuation rate was quite high. comparing data on vitamin d levels from different observational studies is complicated by differences in definitions and diagnostic methods.19 furthermore, many factors may interfere with the interpretation of vitamin d status, such as age, body mass index, liver and kidney function, chronic illness, and sun exposure.19,20 overweight is another reported risk factor that has been coupled with increased risk of postmenopausal breast cancer, phpt, and vitamin d deficiency.11,2123 there has also been speculation about other factors, such as genetic predisposition, that may influence vitamin d levels. familial accumulation of hyperparathyroidism and breast cancer, as well as isolated cases with high penetrance cancer susceptibility genes, have been reported.24,25 hitherto, exposure to ionizing radiation is the only established risk factor with a confirmed dose - response relationship for both parathyroid adenoma and breast cancer.26,27 in this study, women diagnosed with breast cancer and having an earlier history of phpt had the same tumor risk factors and the same breast cancer - specific survival as women with breast cancer and no previous history of hyperparathyroidism. | background : primary hyperparathyroidism (phpt) is associated with an increased risk of developing breast cancer, but little is known about the underlying factors. the aim of this study was to compare women with a history of phpt and a reference population in terms of standard factors predictive of prognosis and response to therapy for breast cancer.methods:we analyzed data collected from the national swedish cancer register and from two regional oncologic center registries. seventy - one women with breast cancer and a history of parathyroid adenomectomy were compared with 338 matched controls with breast cancer only. tumor size, stage, hormone receptor status, lymph node status, cause of death, and cumulative survival were analyzed.results:the mean age was 69 11 years (95% confidence interval [ci ] : 6870) in both groups and the mean time interval between the parathyroid surgery and breast cancer diagnosis was 91 68 months (95% ci : 72111). there were no differences between the two groups regarding size, stage, lymph node metastases, or survival, but none of the cases with a history of phpt were found in stage iii or iv.conclusion:in conclusion, factors predictive of prognosis and response to therapy in women with a history of phpt and breast cancer are similar to those in breast cancer patients without phpt. |
evolutionary comparisons of primary sequence data rely on the generation of a multiple sequence alignment that maximizes the likelihood of positional homology between nucleotides or amino acids by introducing gaps (1). during the course of evolution, functional and structural constraints leave their footprint on sequences in the form of mutations, insertions and deletions. different regions of a molecule, depending on their functional or structural importance, are subject to different selective forces, which result in evolutionary rate heterogeneity (2). in those regions that are well - conserved, saturation is low, indels are rare and assigning positional homology is straightforward. however, in those regions experiencing faster substitution rates and more frequent indels, assessing positional homology is more problematic. available methods for producing multiple alignments of nucleic acids do not take account of the important fact that coding dna evolves as triplets of nucleotides or codons ; insertions and deletions in coding genes are expected to occur in sets of three nucleotides to avoid altering the coding reading frame. alignments of coding dna can also be improved by a consideration of the amino acid sequences that the dna codes for this is because amino acid sequences change more slowly than their nucleic acid counterparts and are therefore easier to align. the greater rapidity of change and corresponding difficulty aligning nucleic acids results principally from the degeneracy of the genetic code sequence added to this, the larger amino acid alphabet (20 amino acids versus 4 nucleotides) results in a higher likelihood of homoplasy (e.g. convergent evolution) between dna sequences compared to amino acid sequences. finally, the frequent substitutions that occur between physico - chemically similar amino acids are easily accounted for when aligning, yet these changes lead to less easily modelled substitutions in dna. due to the different evolutionary behaviour of nucleotide and amino acid sequences, and because selection acts most prominently at the protein level, amino acid translations of two orthologous protein - coding genes can share a higher percentage of identity than the corresponding nucleotide versions even if their alphabet is five times larger. consequently, evolutionary differences between dna and protein languages make the alignment of divergent nucleotide sequences considerably more difficult than of their corresponding amino acid translations. a straightforward approach to circumvent this limitation and to align nucleotide sequences accurately is to translate the dna sequences into amino acids, align these amino acids and then back - translate the alignment to the nucleotide alphabet. figure 1 shows a real example from a region of the nd5 mitochondrial gene, in which the limitations of the direct nucleotide alignment are manifest and avoided with the back - translation approach. figure 1.example illustrating the different performance of the direct and back - translated nucleotide alignments (multiple alignments were built with muscle with default parameters). example illustrating the different performance of the direct and back - translated nucleotide alignments (multiple alignments were built with muscle with default parameters). several tools have been developed based on this principle of back - translation, including stand - alone programs such as transalign (3), protal2dna (4), and tranalign (5), as well as web servers including revtrans (6), protogene (7) and pal2nal (8) ; each of these tools has different limitations. all these solutions, with the exception of revtrans, require that the user provide the amino acid alignment together with nucleotide sequences, some of the packages do not provide a complete list of available genetic codes (pal2nal) and, except for protal2dna, none of these tools allows the user to assign a different genetic code to each of the nucleotide sequences. finally, only pal2nal and transalign are designed to consider cases in which frame shifts occur (as e.g. in the case of pseudogenes). here, we present a new web server, translatorx, built on this principle of using the translated amino acid alignment to guide the alignment of nucleotide sequences. the new program is designed to avoid the limitations exhibited by previous related tools. translatorx offers a battery of different multiple alignment programs, automatic translation based on all documented genetic codes (more than one of which can be used simultaneously), automatic identification of the coding reading frame and nucleotide codon disambiguation according to iupac nomenclature (9). in addition, translatorx provides an information - rich output aimed at guiding subsequent analyses based on the resulting multiple alignments typically phylogenetic reconstruction or calculation of synonymous versus non - synonymous substitution rates. most sequence formats are supported, thanks to the readseq sequence format conversion tool (10). by default, alternative codes can be specified, either as a single alternative for all sequences in the alignment or as specific variants for each of the sequences. assigning multiple different genetic codes can be accomplished either through interactive menus that help the user to define the code of each species, or using a predefined text file that can be copied and pasted or uploaded from file. the format used to define the genetic code for each species is the name of the taxon (or sequence) plus the index of the corresponding genetic code separated by a tab or comma (e.g. bolinus brandaris, 4). all documented genetic codes are incorporated in translatorx ; the list includes those codes defined in ncbi and genbank plus two additional ones : the ancestral arthropod mitochondrial genetic code (11) and the hemichordate mitochondrial code (our unpublished data). several different multiple alignment programs including muscle (12), mafft (13), t - coffee (14), prank (15) and clustalw (16) can be chosen to align the amino acids. as an alternative,, translatorx expects the input nucleotide sequences to be in frame + 1, however, if multiple stop codons suggest that this is not the case, a warning is given and the server may be requested to determine the most likely coding frame automatically. this is done on the basis that the reading frame with the fewest stop codons (ideally none) is the most likely coding frame. in contrast to pal2nal and transalign (3,8), frameshifts can not be accommodated. programs such as gblocks (17) are designed to identify and remove highly variable regions of the alignment where positional homology is dubious. translatorx provides an innovative approach in the process of alignment cleaning that minimizes deleted regions : rather than cleaning the nucleotide alignment based on its intrinsic positional information, translatorx uses gblocks to analyse the amino acid alignment and removes columns from the nucleotide alignment based on this analysis. the resulting nucleotide alignment may retain highly variable (and informative) regions, but the user can be confident about their positional homology. the principal outputs of the program are alignments visualized within a jalview window (18). three outputs are presented : amino acids (aa), nucleotides (nt) and the same nucleotide alignment coloured according to the amino acids coded by each triplet. the jalview viewer has additional interesting features incorporated such as the ability to reconstruct neighbour - joining trees or to refine the alignment by manual editing (figure 2). if the user has selected the alignment cleaning option, two additional alignments will be displayed : the gblocks - cleaned amino acid alignment and the corresponding cleaned nucleotide alignment. the nucleotide back - translated alignment and the corresponding amino acid alignment are shown with jalview. the nucleotide back - translated alignment and the corresponding amino acid alignment are shown with jalview. for this reason, the final nucleotide alignments (either the complete or the cleaned alignment) are available divided into different alignments derived from different subsets of the three codon positions third codon positions are often left out of phylogenetic analyses due to substitutional saturation. the first, second, third and first + second codon positions alignments can be displayed and downloaded individually. additionally, the nucleotide compositional bias is calculated for each sequence and for each codon position such biases can cause systematic errors in phylogenetic analyses and use of these options can indicate if cleaning the alignment reduces biases, or if a particular sequence or codon position is strongly biased. in order to illustrate the benefits of using translatorx, we analysed a concatenated data set of 13 mitochondrial protein - coding genes from nine vertebrate species covering a diverse range of sequence similarity, including the following taxonomic groups : euarchontoglires and laurasiatheria (both placental mammals), metatheria (marsupials), monotremata (platypus), testudines (turtles), squamata (lizards and snakes), amphibia (frogs, salamanders and caecilians) and coelacanthimorpha (coelacanths). one species of actinopterygii (ray - finned fishes) was used as an outgroup. we aligned nucleotide sequences directly with mafft, muscle, clustalw and t - coffee. in addition, we built back - translated nucleotide alignments using translatorx with the amino acid alignment step performed using the same alignment programs. we compared each possible pair among the eight resulting alignments and determined how many positions varied between the two alignments compared. the results revealed a lower variance between the translatorx alignments (table 1), suggesting that using amino acid information results in a better alignment performance. in addition, the number of gap segments (equivalent to gap openings) and total number of gaps were lower in back - translated alignments than in direct nucleotide alignments (table 2). next, we tested the reliability of the different alignments by analysing their phylogenetic performance. phylogenetic trees were inferred using the maximum likelihood - based software phyml v3.0 (19) using the best - fit model gtr+i+g as identified by modeltest (20). in spite of the differences between alignments, the topology of tree recovered was stable. table 1.length of each alignment and number of positions whose alignments differ between each pair of methodslengthtrx + clustalwtrx + muscletrx + maffttrx + tcoffeeclustalwmusclemaffttcoffeetrx + clustalw11 51407808166841580126014912520trx + muscle11 55381905016331582124614552543trx + mafft11 56286451006931545124014482520trx + tcoffee11 52669660665701552120114502505clustalw11 56216281591154515880133813802434muscle11 60413501297128212791380013422487mafft11 67916561581156516031497141702574tcoffee13 77147774761472947504643465446660trx, translatorx the back - translation approach. table 2.number of gaps, gap segments and types of gap arrangements for the different alignmentsclustalwmusclemafftt - coffeesdalignment length11 56211 60411 679137711079.09total gaps18032181285621 6849711.77gap segments5364074312414979.60one gap236133941179515.82two gaps1469482579237.46three gaps42562086664492911.60trx + clustalwtrx + muscletrx + maffttrx + tcoffeesdalignment length11 51411 55311 56211 52622.50total gaps1371172218031479202.50gap segments16621323220627.77one gap00000.00two gaps00000.00three gaps45757460149367.50trx, translatorx the back - translation approach. length of each alignment and number of positions whose alignments differ between each pair of methods trx, translatorx the back - translation approach. number of gaps, gap segments and types of gap arrangements for the different alignments trx, translatorx the back - translation approach. to measure the benefits of translatorx further, for each alignment method, we extracted those positions whose alignment differed between the translatorx alignment (back - translated) and the direct alignments ; these sub - alignments contain those regions that are most variable and hence most difficult to align. each pair of these variable sub - alignments was used independently to reconstruct the phylogeny of these taxonomic groups. we compared each pair of trees to an optimal reference tree obtained with the portion of data that did not vary between translatorx and direct alignment methods. we found that, in the majority of cases, the back - translated subalignments produced trees more similar to the reference tree. in the case of mafft, the improvement was visible directly in the tree topology (figure 3a b). in the case of muscle, the topology did not vary, but two tree nodes had a higher bootstrap support with the translatorx alignment (figure 3c d) ; these two nodes correspond to expected clades (according to current knowledge). in contrast, two nodes obtained a lower bootstrap support with the translatorx method, and in both cases the nodes with reduced support correspond to clades of questionable validity : sauria + (testudines + mammals) and (metatheria + monotremata) + placentals. the phylogenetic trees obtained with the clustalw and t - coffee alignments are provided as supplementary data. these results conform with the expectation that the use of amino acids maximizes the correct interpretation of positional homology in variable regions resulting in better phylogenetic performance (higher support for good nodes and lower support for bad nodes). figure 3.comparison of the phylogenetic trees inferred from the sub - alignments that comprise positions whose alignment differed between the back - translated and direct mafft (a, b) and muscle (c, d) alignments. comparison of the phylogenetic trees inferred from the sub - alignments that comprise positions whose alignment differed between the back - translated and direct mafft (a, b) and muscle (c, d) alignments. with respect to the nucleotide compositional bias, translatorx calculated an overall gc content of 40.36% (ranging from 36.12% to 45.30% for different species). 0.001) reduced for all taxa after alignment cleaning (490 positions out of 3851 were discarded from the amino acid alignment), yielding an overall gc content of 40.83% (table 3). the gc content of the discarded positions was more biased (38.08%) indicating that the characteristic bias of metazoan mitochondrial genomes accumulates more strongly in variable regions (and third codon positions). when we compared the gc content of the alignment regions that varied between translatorx alignment and direct alignment against the gc content of the regions that did not vary, we detected that the bias accumulated more strongly in the former (37.47% versus 40.68%). with respect to the three codon positions, the bias was most significantly reduced for first positions after gblocks cleaning. interestingly, third positions, which initially display the most bias, were not significantly affected by the cleaning. a similar analysis was conducted for the subalignments obtained after comparing the translatorx and direct approaches (table 3). as expected, the differing sub - alignments are particularly variable and rich in gaps, and also encompass a particularly biased nucleotide composition compared to the positions whose alignment did not vary between the two approaches. interestingly, the average percentage identity was greater for the direct sub - alignment than for the translatorx one. table 3.statistics for the different alignments obtained using the muscle alignment programlengthaverage % idmin % idmax % idgc (%) gaps (%) translatorx complete alignment11 55367637140.361.65 gblocks accepted10 08369667340.830 gblocks discarded147046395736.6713.02translatorx versus direct muscle consensus (coinciding)10 23769657340.680.06 different in translatorx131645365837.4714.08 different in muscle136749435937.4717.29the first set of rows are comparisons of translatorx alignments before and after the gblocks cleaning. the second set of rows refers to the comparison between translatorx and direct nucleotide alignment approaches. average % i d, min % i d and max % i d : average / minimum / maximum percentage of identity between aligned sequences ; gc % : gc - content percentage ; gaps % : percentage of gaps in the multiple alignment. statistics for the different alignments obtained using the muscle alignment program the first set of rows are comparisons of translatorx alignments before and after the gblocks cleaning. the second set of rows refers to the comparison between translatorx and direct nucleotide alignment approaches. average % i d, min % i d and max % i d : average / minimum / maximum percentage of identity between aligned sequences ; gc % : gc - content percentage ; gaps % : percentage of gaps in the multiple alignment. positional homology is best established at the amino acid level due to the evolution of coding dna as triplets of nucleotides, the degeneracy of the genetic code and the larger alphabet of proteins that slow sequence similarity degradation and saturation phenomena. logic suggests that amino acid alignment information can be used to obtain a more reliable nucleotide sequence alignment. we have developed a web - based tool (translatorx) that generates back - translated alignments and compared their phylogenetic performance with respect to direct nucleotide alignments in recovering the phylogenetic relationships of a set of vertebrates. we find that, even when the nucleotide sequences were closely related and showed high similarity, important differences between the back - translated and direct approaches were seen at several levels : (i) alignment concordance between different aligning methods ; (ii) the number and arrangement of gaps ; and (iii) the evolutionary information content in the most variable regions. our web server also provides an innovative approach to clean nucleotide alignments based on initial gblocks cleaning of the corresponding amino acid alignment. as a result of using translatorx, the user can be more confident that variable positions in the back - translated alignment are properly aligned and positional homology is ensured. this approach also maximizes the retention of variable positions that otherwise would be removed by gblocks cleaning of the nucleotide alignment. our results also show that nucleotide compositional biases in this data set are concentrated in variable regions ; as represented either by the regions removed by gblocks or in the sites differently aligned by the two alternative approaches. second codon position bias was affected to a lesser extent, probably because second positions are the least variable. unexpectedly, third codon positions, the most variable and most biased, were not affected by alignment cleaning. this might be due to the fact that synonymous changes are frequent, and mutational saturation might have been reached both in variable and conserved regions of the alignment. the comparison of the direct and back - translated nucleotide alignments reveals that the direct approach usually results in alignments with higher percentages of identities and these alignments look better on casual inspection. our results indicate, however, that the increase in the percentage of identities is reached by introducing many more gaps and by misaligning homologous sites. this does not reflect a problem in the multiple alignment programs (in fact, the alignment score is higher on direct than on back - translated alignments). instead, the limitations of the direct alignment of nucleotide sequences arise from ignoring biological forces that affect coding dna. there is an open debate regarding whether nucleotide or amino acid characters should be preferred for phylogenetic inference (21). some authors argue that slowly evolving characters (e.g. amino acids) are preferable to fast evolving ones (nucleotides) for inferring deep evolutionary relationships. other authors have found that nucleotides, even if more saturated, might encompass a better phylogenetic signal (2123). although there is no consensus regarding this dilemma, it is clear that the alignment of nucleotide sequences is best accomplished when protein information is taken into account. | we present translatorx, a web server designed to align protein - coding nucleotide sequences based on their corresponding amino acid translations. many comparisons between biological sequences (nucleic acids and proteins) involve the construction of multiple alignments. alignments represent a statement regarding the homology between individual nucleotides or amino acids within homologous genes. as protein - coding dna sequences evolve as triplets of nucleotides (codons) and it is known that sequence similarity degrades more rapidly at the dna than at the amino acid level, alignments are generally more accurate when based on amino acids than on their corresponding nucleotides. translatorx novelties include : (i) use of all documented genetic codes and the possibility of assigning different genetic codes for each sequence ; (ii) a battery of different multiple alignment programs ; (iii) translation of ambiguous codons when possible ; (iv) an innovative criterion to clean nucleotide alignments with gblocks based on protein information ; and (v) a rich output, including jalview - powered graphical visualization of the alignments, codon - based alignments coloured according to the corresponding amino acids, measures of compositional bias and first, second and third codon position specific alignments. the translatorx server is freely available at http://translatorx.co.uk. |
indications include hemodynamic monitoring, total parenteral nutrition, renal replacement therapy and medication prescription, among others. it is estimated that 5,000,000 central venous lines (cvls) are placed each year in the usa. the rate of mechanical complications during the procedure ranges between 6% and 19%, representing between 250,000 and 1,000,000 mechanical complications per year. cvls are usually inserted in the internal jugular vein (ijv), the subclavian vein, and the femoral vein. subclavian access potentially presents an higher risk of pneumothorax while femoral cvl displays a higher risk of artery puncture [5, 6 ] and of infectious complications when compared to the jugular approach. anatomically, the ijv is in an anterolateral position with respect to the internal carotid artery (ica), covered by the sternocleidomastoid muscle (scm). it ends behind the internal edge of the clavicular bundle of the scm, near the medial end of the clavicle when it joins the subclavian vein to form the venous brachiocephalic trunk. traditionally, ijv catheterization has been performed taking these anatomical landmarks into account, particularly in relation with the scm. the first description of percutaneous access to the ijv in critical care dates back to 1966 ; different approaches have been described since : anterior, central and posterior. although the anatomical landmark techniques have been validated by the above - mentioned studies, they present mechanical complications during insertion, such as accidental ica puncture, local hematoma and pneumothorax, at an incidence of 3% to 10% for ica and/or local hematoma, and 0.8% to 2.4% for pneumothorax [3, 13,14,15 ]. other less frequent complications involve nerve injury, such as lesions of the recurrent laryngeal nerve, cervical sympathetic chain, and brachial plexus ; accidental deaths during the procedure have also been reported [13, 19 ]. additionally, the ijv approach by anatomical landmarks displays a variable incidence of failure, ranging from 2% to 35% [13, 15, 20, 21 ]. many studies have identified the factors associated with complications during cvl placement by anatomical landmarks, namely operator s experience, site of placement, number of attempts, patient s body mass index (bmi), or cvl placement in an emergency situation [13, 14, 22, 23 ]. in 1978, ullman. reported the advantages of localizing the ijv by means of doppler ultrasound before its catheterization. later on, legler. published a prospective randomized study on central venous catheterization with doppler ultrasound versus the technique by landmarks, reporting a higher success rate and lower rate of complications with the former.. gave an account of the first ijv catheterization with bi - dimensional ultrasound : through this technique, the neck structures and the advancement of the puncture needle can be directly visualized. mallory. published a prospective randomized study indicating a higher rate of success and a lower number of attempts and of immediate complications for ijv catheterization with bi - dimensional ultrasound versus the anatomical landmarks technique. additionally, they reported that patients in whom the cvl by anatomical landmarks failed could be catheterized under ultrasound through the same puncture site. these results have been confirmed by many consequent prospective randomized studies, in which a success rate of 98% to 100% has been reported, together with a rate of complications 0.05). in the non - expertgroup working with difficult necks (n = 33 the success rate was 89% with ultrasound (17 out of 19) and 64% without (9 out of 14). there were 3 complications with the ultrasound scanner (15.8%) and one without (7.1%) ; no significant differences were found in these cases neither for success nor for complications. several studies [31, 36,37,38 ] have demonstrated that the use of ultrasound guidance is clearly cost - effective, not only in terms of reduction of major complications, but primarily regarding the reduction of access time : therefore all operating rooms should have ultrasound guidance. nevertheless, unfortunately ultrasound is not routinely available in all operating rooms in many emerging countries. although this study focused on analyzing the advantages of ultrasound, its experimental design allowed the evaluation of the influence of other variables such as operators experience (operator - dependent variable) and the type of neck (patient - dependent variable) on the use of the above - mentioned technique. identification of a target population of patients and/or doctors with an increased benefit in using ultrasound guidance may help emerging countries (without universal availability) to prioritize the use of the technique in certain contexts. the effectiveness rate in the expert group was 83% with the landmark technique, improving to 95% with ultrasound use. these data are in agreement with previously published papers which show an effectiveness of 87% to 89% without ultrasound [3, 13 ] and of 97% to 100% with ultrasound [15, 27, 28, 39 ]. regarding non - expert operators, comparison with previous studies that include ultrasound scanner use is difficult because most prospective studies included operators that were experts in cvl. the study of this issue involving non - expert or in - training operators is one of the novelties of our work. it is noted that in the present study the puncture technique was performed using an ultrasound scanner in a mono - operator mode, i.e., the operator had to learn to perform both the ultrasound scan and the puncture simultaneously. reported on the efficiency of the ultrasound - guided technique when performed by two operators (one performing the puncture while the other performed the ultrasound scan). the study showed that the most important factor when performing a puncture under ultrasound guidance is the scanner operator s experience, since only when this operator was experienced the success rate was > 97.1% ; on the other hand, if only the operator performing the puncture was experienced or both operators were inexperienced, effectiveness was reduced to between 90.1% and 90.3%. in our study, non - expertoperators succeeded in 72% of the cases without ultrasound and improved to 86% with ultrasound use, which coincides with the above - mentioned results. published a prospective study with inexperienced operators, reporting a 76% effectiveness without ultrasound and 100% with ultrasound while using the two - operators technique with an experienced ultrasound scanner operator. with regards to complications in the ne group, we recorded an incidence of 24% without ultrasound, which is higher than that obtained by sznajder. the incidence of complications in this group decreased to 7.8%, which is similar to that obtained by mey., who reported an incidence of 10% to 17% for inexperienced ultrasound operators and puncture performers. in the case of expert operators, a similar rate of complications was observed both with and without an ultrasound scanner, namely 8.3% and 8.8%, respectively. the rate of complications without ultrasound is similar to that reported by karaktisos. (8.3%) ; however, we did not observe a decrease in the rate of complications with ultrasound use, as was observed in these studies. this might reflect a lack of experience in the use of ultrasound, since the 8.3% rate of complications can be compared to the 7.8% obtained by the ne group, and is in concordance with the study by mey. highlighting the importance of experience in the ultrasound scan. therefore, training in ultrasound scanning is essential to achieve higher benefits from the technique. the most frequently found complications [97% (29/30) ], were ica puncture and/or local hematoma. although the classical anatomical description of the vein in the anterolateral position with respect to the artery is the most usual, it does not apply to all cases. reported that the vein was found in anterolateral or lateral position in 72% of cases while in 22% and 5% of cases it was in an anterior position and inside with respect to the artery, respectively. troianos., in a study with over 1,000 patients, found that the vein was overlapping the artery over 75% of its circumference in 54% of the patients. the mere movement of head rotation in a contralateral direction relative to the puncture site, employed as part of the vascular access technique, increases the overlap between both vessels. it has also been observed that the vein is easily compressed by the puncture needle, sometimes going across this blood vessel ; along with the overlap observed between the ijv and the ica, this compression helps to explain the higher rate of arterial puncture when performing the maneuver blindly. further, we investigated if the absence of palpable landmarks had an influence on the results ; the e group was more successful with ultrasound (93% vs 65%), whereas the ne group did not show significant differences. in our opinion, the difficult neck situation posed an additional difficulty for the ne group. regarding complications in patients with necks considered difficult to puncture, we consider that the number of procedures analyzed might be insufficient to detect differences and that a more powerful study (higher patient numbers) may be necessary to detect them. a significant limitation of the current is the unequal number of patients included in the e and ne groups. the cutoff point was decided when half the number of patients estimated in the sample was reached (257 of 450) and the number of patients in each group (e and ne) was not considered in that decision. another limitation is the threshold of 70 procedures for inclusion of an operator in the e group. this limit may be too high, since an observation a posteriori of our data indicates that for an operator who performed the 70 procedures in the ne group, most complications occurred during the first 30 procedures (figure 2). most of the complications (10 of 12) were presented in the first 30 punctures. it is possible that an operator can be considered an expert with only more than 30 cvls placed ; if that is the case, the ne group would actually be a moderately trained group, with smaller differences between the two groups than expected. even though there is lack of a specifically delineated number of procedures to develop competence in ultrasound cvl cannulation, it has been suggested by experts that a minimum of 10 procedures are required. a recent paper by nguyen. in our study, the expert operators in cvl placement were probably not trained in ultrasound techniques well enough, which would explain the same percentage of complications with and without ultrasound in the expert group. nevertheless, this lack of a difference may also be attributed to the small sample size (the study was interrupted in 257 procedures). for a correct interpretation of this result, the study would need to be completed with the total number of patients that were initially calculated in the methods section of the study. finally, difficult neck with non - palpable landmarks due to obesity, subcutaneous cell tissue infiltration, previous cvl, tracheotomy, or intraluminal thrombus could be considered as exclusion criteria in order to avoid bias in the study, as they have not been evenly distributed between the two studied groups. if ultrasound is not available for cvl placement, we highly recommend that experienced operators insert the cvl. experience in ultrasound scanning has an influence on the results ; therefore, operators, no matter whether they are experienced in cvl placement or not, should receive training on ultrasound scanning to improve results. | introductioneven though advantages of ultrasound line placement seem obvious, many countries do not have easy access to such technology. this study aims to compare the degree of difficulty in central venous line placement with or without ultrasound and the incidence of complications, and to establish the effect of the operator s degree of training.methodsthe study included 257 patients that required central venous catheterization during the study period. patients were divided into groups according to the operator s experience : expert group (over 70 central accesses performed before the study) (n=152) and in - training or non - expert group. procedures were randomized to without ultrasound (n=80 expert and 54 non - expert) and with ultrasound " (n=72 expert and 51 non - expert).resultscatheter placements were more successful in the expert and in the with ultrasound than in the non - expert (88% vs 79% ; p=0.04) or in the without ultrasound groups (91% vs 78% ; p=0.005). incidence of complications was 11.7%, with no significant difference among with ultrasound (8.1%) and without ultrasound (14.9%) groups. however, the non - expert group had fewer complications with the use of ultrasound (7.8% vs 24%).conclusionsultrasound reduces the incidence of complications when placement is performed by inexperienced operators. centers with residents should emphasize the necessity of ultrasound for central line catheterization. training in ultrasound might be of paramount importance in the effectiveness of the technique. |
for older people who can no longer age in place, nursing homes provide an alternative place of residence where care and assistance are offered by professionals. nursing home residents no longer live in their own home. because a nursing home has a dual nature as an institution and as a home, many health care organizations try to provide living arrangements that focus on the good life and the creation of an environment that is like a home to its residents, instead of a health care facility in which they reside [2, 3 ]. at the same time, the prevalence of dementia and care dependency in nursing homes increases (e.g., schssler.). however, delivering both good (clinical) care and a homelike environment is challenging. in the near future, the demand for care of nursing home residents will increase as residents deal with the effects of dementia or severe physical limitations. at the same time, there is a trend towards small - scaled and homelike accommodations. to date, the exact elements that shape the physical, social, and organization contexts are largely unknown. health care organizations across the netherlands are responsible for providing the basic furnishing of a room within a nursing home. with all basic clinical requirements a room should fulfill [57 ], the question about how to provide residents of nursing homes with a sense and feeling of home remains. admission to a nursing home is a major life event, as most individuals do not wish to leave the home they have been living in for a long time in order to move to a nursing home. nevertheless, there seem to be good reasons to assert that living in an institution and being ' at home ' is not a contradiction in terms [9, p. 221 the quality of the nursing home building was often expressed in terms of technological, functional, and economic requirements. hence, requirements related to the personal preferences of the residents were given less attention. a more holistic vision of health care is currently emerging and considers the consequences of the built environment on the well - being of the residents. for instance, van steenwinkel. conducted a study focusing on how the built environment contributes to a sense of home of older people living in different contexts in belgium. van steenwinkel. investigated the sense of home among permanent and temporary residents of nursing homes in the netherlands. both studies concluded that a sense of home is a multifactorial phenomenon which is highly influenced not only by the (built) environment, but also by social and personal characteristics. a sense of home is related to personal experiences and emotions and does not come into existence overnight but is gradually developed by the person in whom independence, security, and the source of own identity, choice, and controls, as well as memories, are essential [1216 ]. fully understanding the experienced sense of home of nursing home residents from both the insider and a holistic perspective might have important implications for the development of policy of health care organizations and the innovations in nursing homes of the future. conceptual frameworks and constructs concerning a sense of home that have been developed and researched from these perspectives are assumed to be relevant to this effort. according to duyvendak, there are two situations that support the process of feeling at home : haven (a place that is secure, comfortable, and predictable ; a place where one can feel at ease) and heaven (a place where you can be who you are and feel connected with like - minded people). the objective of this study is to systematically review which factors contribute to a sense of home for older people living in residential care facilities. to date, a list of specific factors contributing to the sense of home experienced by nursing home residents is not yet available to nursing home organizations, family members, architects, and other stakeholders. an understanding of these factors is necessary to build and test hypotheses that may predict and eventually improve experiences of home in residential care facilities. a systematic literature search was performed in may and june 2015. in order to scan the literature for factors which contribute to the sense of home for older people living in nursing homes, five databases (cinahl, psycinfo, pubmed, scopus, and web of science) were searched using a combination of two groups of keywords : (1) meaning of home, sense of home, and synonyms for these terms ; (2) care home or nursing home and similar search terms. truncation was used when variations of the used nouns were commonly used in the literature. the full list was (at - homeness or meaning of home or sense of home or feeling of home or homelike or homeliness or experience of home) and (care home or nursing home or institutional care or long - term care or long term care or care institution or residential care or residential home or assisted living or small scale setting or small scale living or small scale facilit or shared housing arrangement or special care facilit or institutionali or sheltered housing or small scale group accommodation or elderly hous or elderly home or special care unit). furthermore, references of the included articles were checked for additional articles eligible for this review (snowball method). titles, abstracts, and full articles were subsequently screened by the principal investigator [m. d. rijnaard ] for the inclusion criteria mentioned in the following list. in case of doubt, three authors [m. d. rijnaard, e. j. m. wouters, and j. van hoof ] discussed the selection first and consulted the project group if consensus was not reached. inclusion and exclusion criteria inclusion criteria include the following : (i) original and peer - reviewed articles written in english. (ii) data collected from residents living in nursing homes and other stakeholders. (iii) aiming at investigating factors that influence the sense of home, meaning of home, at - homeness, or homelikeness. (iv) data collected from studies which aimed to find out what contributes to a sense of home for the residents through the eyes of residents, family, or care staff. (v) being qualitative, quantitative, and mixed - method studies. exclusion criteria include the following : (i) short stay in nursing home. inclusion criteria include the following : (i) original and peer - reviewed articles written in english. (ii) data collected from residents living in nursing homes and other stakeholders. (iii) aiming at investigating factors that influence the sense of home, meaning of home, at - homeness, or homelikeness. (iv) data collected from studies which aimed to find out what contributes to a sense of home for the residents through the eyes of residents, family, or care staff. (v) being qualitative, quantitative, and mixed - method studies. (iii) aiming at investigating factors that influence the sense of home, meaning of home, at - homeness, or homelikeness. (iv) data collected from studies which aimed to find out what contributes to a sense of home for the residents through the eyes of residents, family, or care staff. exclusion criteria include the following : (i) short stay in nursing home. note no exclusion criterion is based on country, continent, age of the study, residents ' age, and year of publication. no exclusion criterion is based on country, continent, age of the study, residents ' age, and year of publication. prior to the literature search, a meeting was held during which the strategy of the literature search was set out. choices were made about which databases to screen, which key terms to use, and what inclusion and exclusion criteria would be. one author [m. d. rijnaard ] read all articles and extracted data which described a relationship with sense of home. four other authors [j. van hoof, b. m. janssen, e. j. m. wouters, and h. verbeek ] each read part of the papers and also extracted data, which described a relationship with sense of home. next, m. d. rijnaard paired up with each of the four authors mentioned before, and they together reached consensus on the extracted data, that is, open codes. the data extraction identified a large number of quotes which are used in the results section as a presentation of the data to exemplify the meaning of a specific factor. after this open coding, multiple sessions the first meeting of axial coding involved four authors [m. d. rijnaard, b. m. janssen, w. pocornie, and h. verbeek ], and three subsequent meetings each involved two authors [m. d. rijnaard and j. van hoof ; m. d. rijnaard and w. pocornie ]. additionally, several sessions were held [m. d. rijnaard and j. van hoof ] and an additional session was held [m. d. rijnaard, j. van hoof, and w. pocornie ] to create a conceptual model as an expression of the thematic synthesis, which shows the relationships between themes. the search in five databases generated a total of 2,618 results (figure 1). the selection process initially led to the inclusion of 21 articles. after reading the full text, the snowball method added five articles, bringing the total number of articles included in this review to 17. six were conducted in the netherlands, four in usa, two each in sweden and norway, and one each in new zealand, ireland, and australia. from these studies, 15 factors were identified that impact the sense of home of nursing home residents (figure 2). some of these factors have a certain degree of overlap, as boundaries are not sharp but gradually blend into each other. as a consequence of the process of clustering of factors, three main themes emerged as follows : psychological aspects, which include behavioral, cognitive, and emotional components.social aspects, which include home as a place of connection and socialization.the built environment, which includes the layout of a space, its interior design, and the surroundings. social aspects, which include home as a place of connection and socialization. the built environment, which includes the layout of a space, its interior design, and the surroundings. among the factors constituting the psychological aspects of the sense of home are the sense of acknowledgement, the preservation of one 's habits and values, autonomy, and control, and coping. there are numerous factors within the theme of sense of acknowledgement that contribute to a sense of home among nursing home residents. identified a relationship with staff who really cared and having fun with staff and other residents among the relevant factors associated with at - homeness. 498 - 499 ] stated that knowing the person underneath ' the dementia and enhanced family access to staff as regular conversations occurred in the midst of everyday activities are important for the creation of a sense of home in small - scaled group accommodations for people with dementia. de veer and kerkstra also underlined the need for resident - centered attitudes of staff. these positive interactions with staff members and other residents were also mentioned by lewinson. [26, pp. feeling respected and feeling known by the people in a facility make it a home [26, p. 751 ]. in addition, the style of working of care professionals has an influence [25, p. 96].what the caregivers did change was their style of working. they provided the residents with more control and choice within the daily routines by listening more carefully and by consulting the residents.cooney [15, p. 192 the identity of residents was strongest when their sense of their own value and uniqueness and other people 's (particularly staff) actions that communicated their worth matched. they provided the residents with more control and choice within the daily routines by listening more carefully and by consulting the residents. engaging in domestic chores and trying to live in the same manner as one always had were experienced as moments of privacy imperative for feelings of being at home [21, p. 1002 ]. within the private sphere added that women in particular felt that their role had been uncomfortably altered when admitted in a nursing home, as the engagement in old habits was impaired. there seemed to be a tension between the necessary institutional routines and the residents ' personal habits, which resident should be able to continue. mentioned the positive effects of support in self - activation which could make a great difference to the resident, by exploiting one 's own strengths. ] found that there were competing demands for staff who were charged with creating a homely atmosphere in nursing home cottages, in which they had to choose between carrying out household activities and addressing serious health care needs. through respecting the residents ' wishes, the caregivers provide room for residents ' self - determination [25, p. 97 ]. items related to practicing a hobby are important even though many of the hobby activities were too complicated to carry out in the nursing home, because of impairments and limitations. ] found that the continuity in normal activities and day - to - day activities and rituals are important for experiencing a sense of home. this is illustrated by a quote about the route of a facility by cooney [15, p. 192].what was noticeable was that more residents with an inward gaze ' resided in settings where the [clinical ] routine was dominant.cooney [15, p. 191 ] stated that the degree to which participants could maintain personal routines mirrored the degree to which they were able to exert control over their day - to - day life. and bland stressed the negative impact of routines, rules, lack of control, and intrusions to privacy. ] continued by stating that residents ' life experiences, values, and expectations of long - term care shaped both their initial response to long - term care and their long - term experience. ] further added the engagement with one 's senses (sounds, sunshine, and scents) and spiritual engagement as a way of nurturing one 's core self to the aforementioned factors.. also concluded that it is important to respect a person 's dignity while carrying out care and that it is important for care professionals to see residents as unique individuals. what was noticeable was that more residents with an inward gaze ' resided in settings where the [clinical ] routine was dominant. autonomy and control are frequently mentioned factors in relation to having a sense of home in a nursing home environment [2, 16, 29, 30 ]. ] described autonomy as being able to do what you want to do, even though not everyone will develop a sense of home when given full autonomy.you feel like home when you can do whatever you want to do. grab your own belongings, or a book whenever you want to read. or play music when you want to listen to music. or paint a painting when you want to.perceptions of freedom and mobility were identified by molony. privacy, being able to do things for oneself, and being able to care for oneself were considered to be important factors by residents too [27, p. 511 ]. van hoof. also identified the freedom of placement as important, for instance, having access to a taxi service., some of the residents were unsure whether they were allowed to stay in the present room or whether they needed to move within the nursing home. these participants said that they were unsure whether they would ever develop a sense of home. grab your own belongings, or a book whenever you want to read. or play music when you want to listen to music. or paint a painting when you want to. in relation to decorating their own rooms, residents should be allowed to hang things on the walls and be allowed to drill holes. according to falk., being in charge is a dimension of attachment to place. being allowed to independently decide whom to include and to exclude is important too. inviting a coresident to one 's private room is equivalent to that of inviting someone into one 's home. residents should have the ability to find pride in managing even the smallest chores by themselves.george's private bedroom in the rest home wing provided him with little sense of sanctuary, especially as he was still unable to prevent other residents entering at will. 192 - 193 ] continued by stating that participants who created their own space usually considered the facility their home. george 's private bedroom in the rest home wing provided him with little sense of sanctuary, especially as he was still unable to prevent other residents entering at will. ] whether participants ' move to long - term care was voluntary or involuntary was a determining factor in whether they found a home or not [12, 15 ]. klaassens and meijering found that residents should be allowed to do as they wished, and there should be a shift away from risk avoidance to risk management. being able to lock one 's own door improves the sense of control and not being locked up. in the study by van dijck - heinen., the rules of nursing homes and the practices of care professionals were considered to be too steering. shared decision - making, for instance, about medication regime, can alleviate this situation. group living can lead to forced and sometimes unwanted relationships breaching the sense of autonomy of residents. in line with this factor, pieces of furniture that were easily moved provided residents with enhanced self - determination. it may lead to suffering and grieving losses or feelings of guilt for being unable to prevent placement, second guessing themselves with regard to the necessity of placement, and concern over the circumstances of care [29, p. 496 ]. connectedness to the future appeared to be entirely severe as many individuals spoke with resignation of dying in the nursing home [19, p. 35 ], participants stated that living in the nursing home will never be like living at home but that they have accepted the situation and are satisfied. in the study by van zadelhoff. ], residents were settled, at ease, restful, and accepting the situation and life as it was. ] see the acceptance of being together with people with problematic behavior as a strategy to cope with living in the nursing home. residents may use various strategies to cope with the move to long - term care, with strategies as not looking back, making yourself happy, and being good. if residents are unable to cope, they may actively refrain from personalizing the private room, which strengthens the notion that home was someplace else for them. one may either accept or reject being frail, look on the bright side of life, or give up and feel discarded. in addition, some residents are ashamed of their corporeal decay, which in turn contributes to isolation and strengthens feelings of being an outsider. negative self - conceptions about being a burden to others, including staff, can also hamper a sense of home [21, 28 ]. part of the coping may be emphasizing the advantages of living in a nursing home, such as safety and receiving prompt emergency help as the main advantages. among the factors constituting the social aspects of the sense of home are the interaction and relationship with staff, fellow residents, family and friends, pets, and activities. ] described that participants associated a feeling of belonging with feeling at home. belonging was defined as being part of the group and experienced as a sense of solidarity, companionship, relaxation, and fun. ] further added that connectedness with people was severely limited or completely lost in a nursing home. ] found that socializing with others made residents aware of their physical appearance, and the opportunity to dress up and to have one 's hair set was important to maintain continuity of sense of self - identity and personal values. in the following section, these relationships, interaction, and activities are described in greater detail. the most important category concerning interaction is that with members of staff, that is, the professional caregivers residents see and interact with on a daily basis. close interpersonal relationships with members of the staff who really cared are associated with at - homeness. the affectionate manner that residents are being cared for contributes to a sense of home.. explicitly stated that a disrespectful treatment by a member of staff and not being able to choose your own friends were hindrances to a sense of home. still, they preferred receiving help from a care professional instead of via technological solutions. a caregiver is a point of contact and provides a sense of privacy, safety, and security. miscommunication was also mentioned by lewinson. as a source of not feeling at home. an example of poor communication between staff and residents was slipping informational sheets under resident doors [26, p. 752 the practitioners ' use of language revealed embeddedness within institutional systems and processes and this was particularly evident when they referred to patients. ] also wrote that the language sometimes used by the staff connoted the powerlessness of residents that was related to feeling dismissed. moreover, respondents lacking trust in nursing staff felt reluctant to speak freely when they thought something was wrong. the social environment is a mix of residents ' interactions with each other and with staff, which is influenced by wider issues, for example, staff values and practices [15, p. 194 ]. klaassens and meijering found that that the presence of a care professional had an important effect on the atmosphere in the communal room and as a result of some simple measures. as staff in this study did not wear a uniform, there was no visual distance. interactions reshaped the relationships between caregivers and residents, closing the gap between them and balancing power relations, making them more equal parties. to increase residents ' participation in decisions about their treatment and care, residents were allowed to take part in the multidisciplinary meetings and to visit the nursing home doctor themselves. in the study by falk. for instance, sharing autobiographical memories and old photographs, to talk about day - to - day events and in - home, were important to maintain a sense of continuity of self - connecting with the past, as well as becoming acquainted and getting to know each other. in the study by nakrem. [28, p. 222 ], the residents referred to the staff as kind, pleasant, and clever, and many thought that the staff cared for them on a personal level. at the same time though, staff did not know the residents ' names and staff felt that they did not have the energy to get to know them. moreover, residents said that it was strenuous to repeatedly explain to new caregivers how to do the procedures. the quality of the staff was judged by their interest or motivation for doing something extra for the residents. some nurses only did tasks that were expected of them and they were not able to give emotional support. in the study by hauge and heggen [23, p. 464 ], the residents were eager to answer questions and to discuss everyday matters with the staff. this sometimes ended up in cheerful discussions with laughter and smiles what we have called golden moments. in order to experience these golden moments, there are numerous aspects related to staff that need to be fulfilled. according to robinson. [29, p. 497 ], a lack of adequate staff to provide attentive, individualized care is detrimental to the sense of home. nursing homes may become more like a hospital, and staff may be overloaded in terms of the number of residents they care for. in the same study, also family participants noticed that the quality of the home was significantly influenced by the workload, the personality and strengths of the professional caregiver, and the fit between the resident and the setting of care. in the study by nakrem. [28, p. 221 ], the residents thought that the staff were too busy to be able to provide attentive care.many felt and that they could not ask for more help because there was always someone else that needed to be prioritized. notion is also shared by practitioners, who were concerned about the lack of staff to provide sufficient care to their residents [22, p. 9 ] or who indicated that they would like to pay more attention to each individual resident [31, p. 2495, staff also indicated that it is important to know how the residents used to live and their personal biography. in this way, staff have a better understanding of residents ' behavior and this improves the interaction. staff are more perceptive and talk more about their private life than in a regular setting. they spend a part of their free time organizing and joining activities, which makes the connection with residents more intimate than in a regular setting [31, p. 2496 concluded that the dignity of the residents was violated when nursing staff made them wait for help or ignored their wishes. on this topic, ] made a remark at the level of individual staff members ; three key factors impacted on residents ' experience, that is, the availability, many felt and that they could not ask for more help because there was always someone else that needed to be prioritized. ] therefore, ideally, staff should be able to balance stability and predictability with flexible routines that matched the individual needs of the resident [29, p. 498 ]. apart from issues related to the organization of the work, there are also some personal staff characteristics believed to contribute to relational connection with the residents, such as well - developed observation skills, personal interest in each resident, a sense of humor, ability to take things in their stride, attention to details, caring, kindness, and respect for the residents as persons [29, p. 498 the individual staff member needs to be multitalented, have time to devote to their relationships with both residents and families, and be able to make informed decisions about the most effective manner of delivering individualized care [29, p. 504 ]. de veer and kerkstra [20, p. 432 ] stated that showing interest in the resident, providing a quick response to a request for help, and a friendly attitude were important. apart from the direct relationship between staff and residents, also the staff 's attention for family is of great value. ], which highlights the importance of a family - centered approach to care where there is strong recognition that illness is a family affair even when the ill member resides outside the family home. in the study by van zadelhoff. ], it was found that family feels that nursing staff can spend more time with individual residents in a relaxed way. the real relatives believed it was a staff responsibility to take a stand and be firm in inviting, encouraging, or leading the resident to engage in healthful daily activities. while supporting the belief that residents should not be forced, they did not believe the only alternative was letting the resident do what they preferred when it was clearly not in their best interest [29, p. 503 ]. transparent communication between staff and relatives, therefore, is of great importance to balance mutual expectations. an agreement on the use of keys also appears to be important in the relationship and respect of privacy and dignity between staff and residents. a locked door symbolized that no one was welcome to enter, and a breach of that rule was experienced as infringement. residents were disappointed that the consumption and quality of the meals and food were institutional and not homelike. as the staff did not have time to sit down with the residents during meals, they served ready - made sandwiches to save time. however, the residents felt they could not help themselves in the unit kitchen, mainly because the area was perceived as controlled by the staff. in the study by klaassens and meijering [25, p. 97 ], staff would also eat or drink coffee with the residents, besides cooking, which highly contributed to the homelike feeling. ] found that there was no role for residents, other than being the passive and grateful recipients of care. experiencing symmetric power relations to the nursing staff was an important dimension of feeling valued and was experienced as reliant and well inclined, which contributed to sense of self - worth [21, p. 1004 ]. this could be organized through having respondents to join homelike activities, such as setting the table and folding linen. ] stated that residents believed they should be involved by sharing their unique talents and hobbies with other residents. social relationships with and between fellow residents are very important to feeling at home in the nursing home [2, 27 ]. in the study by van hoof., a number of residents valued the dining atmosphere, especially in relation to being seated around a table together. van zadelhoff. found that residents are gathered together in the living room during the day. they talk with one another, drink coffee, or read a magazine. according to cooney, the social environment was a mix of residents ' interactions with each other and with staff. klaassens and meijering, too, stated that the residents shared their daily life with other residents. the participants in their study typically described their fellow residents as acquaintances rather than friends, though a small number of residents said that there were some fellow residents with whom they got along. the researchers ' observations showed that not much interaction occurred between the residents during their study. de veer and kerkstra also found that residents may feel disturbed, instead of being friends with, by other residents.. stated that spending time with the other residents was both an opportunity to be socially active and a source of irritation. in this study, an unbalanced mix of gender in the unit had made social relationships more superficial and some residents experienced that differences in interests sometimes resulted in disagreements. for instance, being the only cognitively intact resident in a unit could make it impossible to talk with the other residents [12, p. 7 ], closeness and involvement with family are associated with at - homeness in a nursing home environment. in the study by van hoof. ], a number of participants indicated that they valued their contact with relatives as most positive, in particular having close contacts and being visited on a regular basis. ] found that family members were considered the best caregivers for persons with dementia. both lewinson. and bland spoke of the importance of visits by friends and relatives, who should be incorporated into planned activities, and of occasional visits back home. both van dijck - heinen. and bland made remarks about living together with a spouse. in the dutch study, the residents stated that it should be possible to move into a nursing home with a partner. in the study from new zealand, having to live apart from a spouse was a source of concern. 2494 - 2495 ] found that relatives felt more involved in the group life in the context of small scale nursing homes than in a traditional nursing home. in small scale nursing homes, relatives were treated as group members instead of visitors. furthermore, family frequently joined dinner and drinks. despite their importance for the well - being of residents, relatives sometimes experienced tensions concerning the expected responsibilities and about their roles in relation to staff members. interaction with pets may complement the interaction with other human beings and may be a great source of distraction and joy during the day. van hoof., for instance, found in their study that in one of the living rooms in a gerontopsychiatric ward there was a wild crow, eating from a net of peanuts hanging in front of the window. residents considered these wild birds as pets. an animal gives a sense of consolation and warmth and makes a resident feel less lonely. in the study by fleming., social engagement was raised by several participants and included engaging pets and even dolls. activities can be conducted alone or with members of staff, relatives, fellow residents, and others. some residents engaged in activities arranged by the community, which help them preserve their continuity with the past and society, as well as reaching beyond the institution [21, p. 1004 lewinson. found that the inability to get out of the facility more frequently to enjoy a variety of community venues was a common complaint. at the facility itself, residents were able to engage in social activities that included bingo, group exercise classes, cookouts, book club discussions, and other planned events. but at the same time, residents reported that activity planning problems inhibited feeling at home. other activities mentioned by van hoof. were a cooking club, arts and crafts such as paint workshops, and reminiscence activities conducted in the activity space. several studies found that activities and stimulation should be appropriate to the residents ' needs, skills, education level, and abilities, including the need for customized activities or more private activities with relatives [2, 15, 22 ]. outings, for instance, with spouses, girlfriends, or children, are also important activities [2, 25, 27 ]. in the case of small scale group accommodation [25, 29, 31 ], scheduled activities have been incorporated into daily life, which enhanced satisfaction and evoked a sense of homeliness. residents actively engaged in meaningful activities, for instance, domestic tasks such as cooking. participants who for some reason were unable to participate or who found that the activities did not suit them were forced to fall back on their own resources [15, p. 192 ], having to organize their own activities and not being able to join in group activities. factors constituting the theme built environment include the private space and the (quasi-)public space, personal belongings, technology, look and feel, and the outdoors and location. the private space, whether it is a single - person room or a room shared with other residents, has an impact on the sense of home. in the study by nakrem. ], home was associated with having a private room in the nursing home. the desire for a private room may have a foundation in having opportunities to be on one 's own, wishing for privacy, and having personal belongings around oneself [15, p. 192 ]. central to nesting and the creation of attachment to place was spending time in one 's room or apartment and being engaged in domestic chores. both findings by klaassens and meijering and de veer and kerkstra stressed the need for being on your own and withdraw to the own room, the opportunity to create your own environment. the need for privacy seems to be a main driver for having a private room. private rooms govern the opportunity to talk with others in private or to withdraw from the communal living areas [16, 20, p. 432, 25 the spontaneous opening of doors of private rooms is one of the actions hindering having privacy. in this study, residents indicated that having a private room with private sanitary facilities was a must reported by all participants. another desire in this study was to have a separate bedroom or recess for sleeping [2, 16 ]. residents also indicated that having social interaction with the neighbors or coresidents should be facilitated through the design of the building. some of the residents asked for more spacious rooms, in particular the shower and kitchen areas. van hoof. found that residents with larger apartments indicated that they could have visitors when they wanted. there was also the wish for having multiple rooms, a spare room that can be used when guests are staying for the night, a room for tools, or a work corner with a desk. in contrast, klaassens and meijering found that the majority of the residents had no problem with the small size of the room. sanitary facilities are often mentioned as being important for residents, their comfort, and their feeling at home. the study by robinson. found that a private space including large private bathrooms with showers impeded a sense of home, because showers were unused as tub bathing was preferred by most residents. the private bathroom is also mentioned in other studies [22, 25, 30 ]. the bathroom can be a source of joy, if people can access it without difficulties, and they can wash and shower themselves. when having to share a bathroom with another resident, this may result in a lack of control around the use of the toilet. in the study by fleming., there were some differences in opinion on the necessity of ensuring privacy through having an ensuite or shared bathroom and a single bedroom or shared bedroom. many recommendations were made regarding the design of the public space, that is, the indoor space that resident shares with others. as some residents claim sections of this public space as their own, in this paper we describe this set of factors as quasi - public space. hauge and heggen, the boundaries between the public and private spheres are ambiguous and thereby differ from the comparatively sharp boundaries characterizing a home. in general, smaller residential density, including family - style dining, increased perceptions of belonging [27, p. 512 ]. in many facilities, residents may have their own place around the (dining) table [30, p. 6 ]. the spatial layout in shared spaces with lounge furniture and dining tables may create an inviting atmosphere to share a cup of coffee and some talk with nursing staff and coresidents [21, p. 1003 [22, p. 6 ] mentioned that residents should have to get out of their private room in order to engage with others. klaassens and meijering stated that residents may be easily distracted by other residents and by staff in communal rooms. hauge and heggen [23, p. 464 ] came up with set of findings that relate to the living room of nursing homes. interior symbols in the living room, such as family photographs, carpets, and tablecloths, should be clear and consistent and make the room feel like a living room instead of a waiting room. a similar description of nursing homes not feeling like home was also given by carboni [19, p. 35 ]. the living room was a difficult setting for engaging in private conversation with ten to twelve listeners sitting around all the time. maintaining a certain degree of privacy, therefore, required the residents to leave the living room and go into their own rooms or the corridor. ], who found that, to some residents, it is important to have the possibility to retire to one 's room or withdraw. an ideal design put forward by one participant in the study by fleming. would be a circle so that people would not arrive at a dead end. van hoof. further added that it is important that residents are able to reach all parts of a space from a wheelchair. fleming. found that wide corridors and wide doorways were seen as vital for easy access for those with wheelchairs. personal belongings seem essential elements in the development and maintenance of a sense of home [2, 15, 16, 19, 22, 23, 25, 30 ]. creating attachment to place consisted of two dimensions : nesting and being in charge. personal belongings help to create attachment to place in terms of in nesting and being in charge. personalizing the environment, making room for personal belongings with furniture, and memorabilia can transform a private room to a place of recognition and familiarity that symbolized and strengthened one 's self - identity, distilled from a lifetime of memories, experiences, and meanings attached to them [21, p. 1002 ]. ] stated that being able to bring personal histories into the space through beloved items and cherished furniture may contribute to feeling home. jonsson. found that certain pieces of furniture in their private rooms were only meant to accommodate significant others such as family or guests and therefore considered important. in addition, individual and unique pieces of furniture were a source of delight and were able to evoke memories. van hoof. [16, 30 ] researched the importance of personal possessions and found that there is a wide array of pieces of furniture or personal belongings that are present in the rooms of the residents. small items such as drawings of grandchildren meant a lot to the participants, because they represented memories of loved ones [30, p. 6 ]. among the items that were deemed most important were pictures, paintings, and pieces of furniture. in addition, paintings have a particular decorative value and make the room more homelike. some of the pieces of furniture were brought along at the time of admission for practical reasons, such as lift chairs. often, there is an emotional value attached to the pieces of furniture, because they remind people of their former home or because they were purchased together with a partner. also, residents value the freedom in the choice and positioning of furniture in order to make the room cozier. to some of the residents, the personal belongings do not (yet) contribute to a sense of home, because the new living situation is rather overwhelming. the small category of technology describes the facilitating role that modern (communication) technologies can play in relation to improving the ease of life and being in charge and, in an indirect manner, could facilitate a sense of home. according to the findings by de veer and kerkstra, easy access to one 's personal (i.e., patient) data contributed to feeling at home, and technology may play a role in this procedure. according to the study by van dijck - heinen., technological solutions, which are already used by the participants, are of a different league compared to assistive technologies used by care professionals. these technological solutions are necessary for mobility or to ask for help after a fall incident. some technologies which were already in use are considered to be acceptable, whereas future developments were approached with skepticism.. stated that there is a need to approach the use of technology, so that it is understandable and acceptable to the person regardless of one 's cognitive ability. in the field study by van hoof., the researchers found that the television sets were considered the most valued item in the private room. the factors constituting look and feel relate to architecture, interior design, and the general maintenance. in the study by robinson. and fleming., the authors stated that, in order to be counted as home, the facility needed to both look and feel like home or have a homely feel. the building should be homey, more organized, and more welcoming of family members. satisfaction was negatively influenced by concerns about the physical design, as well as cleanliness. cleaning tools and products, kept inside the private room, had a certain meaning in the study by van hoof. ; namely, there was a sense that the room was kept clean and tidy. the decor, color, warmth, and light of the facility were also important to residents in the study by cooney [15, p. 194 ].. further stated that a sense of home connected with warmth and coziness. some of the residents mentioned daylight access, color, and a a hospital - like environment is something all residents participating in the study wanted to avoid. furthermore, buildings with long corridors and nooks and crannies were deemed unsafe. fleming. also stressed the engagement with the senses, by mentioning ventilation and a window nearby as well as music in order to provide comfort right at the end of life. some residents may require an environment that is free of noise or free of excessive visual stimuli. finally, jonsson. stated that a physical environment that makes activities accessible and promotes pleasure and stimulation of all the senses with lighting and support of visual perception is especially important for those with limited mobility. also, the physical comfort was a major aspect stated by the residents in the shared rooms. a homelike appearance in the shared rooms was preferred to encourage a sense of home for the residents. descriptions of furniture - related factors with homelike characteristics included an old style and wood as a material. institutional environments with neutralized, single hue interiors without contrasts and natural lacquered wood furniture were not desirable. the outdoor environment constitutes the outdoor space belonging to the own premises and the neighborhood at large. in the study by de nursing homes located in large or very large cities had a higher proportion of residents not feeling at home in the nursing home. inaccessibility or loss of familiar places that provided the memories of past experiences is considered a negative factor in developing a sense of home. residents may also have a desire for going to shops and stores in the direct neighborhood for making small purchases. robinson. provided an example of the important role of the outdoor environment, as participants expressed their concerns about the lack of trees and walkways outdoors. for them, it was home - like indoors but not so outdoors [29, p. 500 landscaping should be done with care. in the study by robinson., many family members expressed dissatisfaction with the lack of connection to nature and the absence of a garden. in the study by van hoof., this did not mean that all residents could appreciate the landscape by going outside, but in such cases the view of nature was considered to be attractive and pretty. using outside spaces to facilitate engagement with the senses was seen as very important by caregivers. residents expressed a desire to go outside the facility more often in the study by klaassens and meijering. any type of view was appreciated, whether it was a park, traffic, a playground with children, a lively street, or a building [2, 30 ]. this is the first systematic review to identify factors that influence the sense of home of nursing home residents from their own perspective. the majority of the data was based on qualitative research investigating factors of the sense of home among nursing home residents. results show that the sense of home is influenced by 15 factors, divided into three themes : (1) psychological factors (including the sense of acknowledgement, preservation of one 's habits and values, autonomy and control, and coping) ; (2) social factors (including relationships and interaction with staff, residents, family and friends, and pets) and activities ; and (3) the built environment (including the private space and the (quasi-)public space, personal belongings, technology, the look and feel, and the outdoors and location) (figure 2). factors that were mentioned most often in the literature were the interaction with staff, autonomy and control, activities, the spaces, and role of personal belongings. the three themes identified in this study were consistent with the results of previous work by oswald and wahl, who categorized factors constituting the sense of home into the following three groups : physical, social, and individual factors. these themes also emerged in research by felix. on the everyday lived experience of the house in the netherlands, which was conducted with community - dwelling older people. the results also support earlier findings by percival on the uses and meanings of domestic spaces in the daily lives of older people in the united kingdom. in this british study, older people require adequate, accessible, and personalized domestic spaces in order to facilitate three objectives, namely, routines, responsibilities, and reflection. the study by rin found that home as a concept has different meanings for different older people, depending on various conditions. other indicators that emerged from her study included the circumstances of nursing home placement, previous experience with nursing homes, and the degree of continuity achieved after placement. it seems that older people residing in the community and in nursing homes broadly have the same needs. however, they may face different boundary conditions in the extent to which they are autonomous in their choices and actions. in this view, coping styles and being able to deal with living in a nursing home in general are important. residents who are not open to the new situation or environment may never be able to feel at home in a nursing home. mortenson. studied the impact novel surveillance technologies would have on the everyday experience of home in community - dwelling older people. they concluded that new technologies may alter the perceptions of home as surveillance technologies increase the permeability of the home by extending the power of observation into what was previously regarded as an intimate and private space. in the near future, novel care technologies may also pose an unknown influence to the development of a sense of home in the nursing home, which deserves attention in future studies and practice. the main challenge for future work is how to move from specifying themes to the identification and development of feasible and replicable evidence - based interventions that contribute to the sense of home. based on the themes and factors identified in this study, scales and questionnaires could be developed as a first step to objectively measure the aspects of a sense of home that nursing home residents experience. no studies, to our knowledge, have investigated these aspects in residents of nursing homes on a large scale. regarding the gathering of objective evidence of at - homeness, there is a need for conducting larger, longitudinal studies using a reliable and valid measure of at - homeness such as the experience of home scale. we need to examine predictors and sequelae of at - homeness in both small group homes that incorporate architectural qualities of home as well as social and care - related interventions. for instance, the u.s. model of the so - called green house nursing homes, which are created to be a real home, yet lacks clarity on the mediating role of the perceived or lived experience of at - homeness on the outcomes. in many dutch small group homes, homelikeness is propagated, whereas the sense of home may be more fitting and appropriate construct to consider. as the sense of home encompasses social, psychological, and architectural aspects, it remains to be determined whether these aspects should be addressed, in terms of interventions, separately or holistically. preliminary work shows that certain aspects of dutch small group homes are successful in providing a homelike atmosphere, such as privacy, own choice, and emphasizing autonomy. nursing staff and healthcare managers can create a sense of personal freedom in which residents can decorate their rooms according to personal preferences. in order to measure the impact of improvement efforts, there are more tools available within the domain of nursing sciences compared to the domain of architectural studies to measure effects. as for coping styles, this is an area not studied extensively in the context of nursing home residents [41, 42 ]. the factors identified in this study relate to the sense of home of nursing home residents. however, this review also elaborated further on aspects that have an indirect relationship to the sense of home. an example of this is the text about family involvement and large apartments to receive visitors. second, these additional aspects possibly mediate associations with the sense of some, for example, the need to feel known and valued as an individual. some studies describe that identity of residents is the strongest when their sense of their own value and uniqueness and other people 's actions that communicated their worth matched. the concept of dignity seems very relevant here, and it is not only just a part of a psychological theme, but also interactional and part of a larger social theme. all kinds of engagement identified in this study, for instance, the engagement with one 's senses and spiritual engagement, highlight the interaction within and across themes. some of the factors identified in this study, for instance, the sense of acknowledgement, describe that the identity of residents was the strongest when their sense of their own value and uniqueness and other people 's actions that communicated their worth matched. the concept of dignity seems very relevant here, and it is not only just a part of a psychological theme, but also interactional and part of a larger social theme. all kinds of engagement identified in this study, for instance, the engagement with one 's senses and spiritual engagement, highlight the interaction within and across themes. apart from these interrelationships, there are also tensions between factors. there may be tensions between resident preferences and family preferences, in relation to autonomy and control on the one hand and continuity of family relationships on the other hand. there may also be tensions that emerge when health and functional disability limit the ability to engage in behaviors, activities, rituals, or social interactions that limit the ability to preserve continuation of old life. not all nursing home organizations seem to be able to come up with adequate solutions in order to try to create a sense of home. in future studies, the prioritization of needs should be studied in order to gain a better understanding of such tensions and how these tensions can be resolved. this review 's strengths lie in its extensive search strategy, covering databases in the fields of social sciences, health care, and architecture. this systematic and multidisciplinary approach is also reflected in the extraction of factors from qualitative research, which was done by two independent reviewers from different backgrounds (psychology and engineering) and verified by several researchers with a background in medicine, health studies, architecture, and applied gerontology. another strength is the inclusion of all types of available evidence, regardless of the type of research method (qualitative, quantitative, or mixed methods). the qualitative data included in this study was rich and yielded many factors and illustrative quotes. first, moderating or mediating relationships between factors were not investigated in this review due to lack of available data. however, this review is one of the few studies that investigated the sense of home in a holistic manner, including both the social and care environments, as well as the architecture and interior design of the nursing home. another limitation to this study is that studies were not appraised in terms of their methodological strength. results of the included studies were treated equally. finally, the studies included in this review gathered data from western countries from three continents (north america, australasia, and europe). the results may reflect the sense of home as it is experiences in western contexts, and the findings could, therefore, be different if studies from asia would have been available. this review has identified 15 major and minor factors influencing the sense of home of nursing home residents. care professionals, for instance, can pay attention to their actions and attitudes towards the sense of home of nursing home residents. in addition, managers and policy makers are offered practical guidance on how to improve facility - related aspects that influence the sense of home, for example, the built environment. the findings of this study need to be viewed in the context of policy and practice. in every country, policies related to nursing home administration and financing, as well as care practices, differ, and so do national building codes, methods of construction, and architectural preferences. nevertheless, this review forms a basis for future studies which should help identify the exact needs of residents, within a national context or within certain financial constraints. nursing staff could start engaging with the residents and stimulate them in having social interaction with others and taking parts in activities which are meaningful and make the best use of remaining capabilities. relatives should be welcomed to give a helping hand and should also feel at home to some degree. this requires a different set of skills of nursing staff other than being qualified to provide care, for instance, empathetic, social, and communicative competences. the general attitude of a facility should be welcoming, not only on a social engagement level, but also in relation to being free in redesigning and decorating the private rooms and even the communal living rooms or corridors. being able to decorate a room enables residents to turn the nursing home space into a private room which has a connection to the previous life. residents, who wish to decorate their room, paint it in a different color, or put up artwork, should not be confronted with strict rules but should be invited to make changes and engage in a dialogue (supported by a loved one) to mutually explore the boundaries of their actions. architects should consider such needs when designing, retrofitting, or transforming nursing homes, for instance, by providing sufficient space for personal belongings. the outdoor environment. gardens and neighborhoods should be available to residents who are still able to enjoy a fitting degree of freedom., one needs to be aware that the development of a sense of home depends on a large number of factors that may vary for each individual. one solution to raise awareness among professional caregivers could be the provision of factsheets containing hints for improving the factors identified in this study. education and training may be other instruments to improve the living conditions in nursing homes. this study has shown that the sense of home of nursing home residents is influenced by a multitude of psychological and social factors, as well as the built environment of nursing homes. further research is needed to determine if and how the factors in this review are interrelated, if there are differences in perspectives between the various stakeholders involved, and how the factors can be implemented in practice as viable solutions to improve the sense of home. the built environment is an import theme which should be considered when trying to improve the sense of home of nursing home residents. these environmental factors are not always addressed in practice, as they are not considered a core item in the provision of health care. therefore, it should be stimulated to have architects, designers, and care professionals work together in the creation of optimal designs of nursing home environments. in relationship to the social and psychological factors, a person - centered approach in nursing home care seems important, and this person - centeredness should also include the relatives of the residents. the quality of the interaction with care staff and the activities that are being conducted deserve more attention in daily practice and offer a means for improving the sense of home. finally, we recommend addressing the interaction between the psychological, social, and environmental components of living in a nursing home in a holistic manner. to date, there is insufficient evidence on how to stimulate this interaction. in the end, the sense of home is centered on balancing these three aspects. in practice, the emphasis is either on quality of care and interaction or on the quality of the built environment. a better way forward may lie in stimulating empathic care professionals in how to use the building and its interior design to the full advantage of their professional task and the residents. | purpose. to provide an overview of factors influencing the sense of home of older adults residing in the nursing home. methods. a systematic review was conducted. inclusion criteria were (1) original and peer - reviewed research, (2) qualitative, quantitative, or mixed methods research, (3) research about nursing home residents (or similar type of housing), and (4) research on the sense of home, meaning of home, at - homeness, or homelikeness. results. seventeen mainly qualitative articles were included. the sense of home of nursing home residents is influenced by 15 factors, divided into three themes : (1) psychological factors (sense of acknowledgement, preservation of one 's habits and values, autonomy and control, and coping) ; (2) social factors (interaction and relationship with staff, residents, family and friends, and pets) and activities ; and (3) the built environment (private space and (quasi-)public space, personal belongings, technology, look and feel, and the outdoors and location). conclusions. the sense of home is influenced by numerous factors related to the psychology of the residents and the social and built environmental contexts. further research is needed to determine if and how the identified factors are interrelated, if perspectives of various stakeholders involved differ, and how the factors can be improved in practice. |
salt bridges are known to play an essential role in the thermodynamic stability of the folded conformation of many proteins, but their influence on the kinetics of folding remains largely unknown. here, we investigate the effect of glu - arg salt bridges on the kinetics of -helix folding using temperature - jump transient - infrared spectroscopy and steady - state uv circular dichroism. we find that geometrically optimized salt bridges (glu and arg+ are spaced four peptide units apart, and the glu / arg order is such that the side - chain rotameric preferences favor salt - bridge formation) significantly speed up folding and slow down unfolding, whereas salt bridges with unfavorable geometry slow down folding and slightly speed up unfolding. our observations suggest a possible explanation for the surprising fact that many biologically active proteins contain salt bridges that do not stabilize the native conformation : these salt bridges might have a kinetic rather than a thermodynamic function. |
|
this was a randomized, placebo - controlled, double - blind phase iii study conducted from july 2010 to february 2012 in 148 centers in 12 countries (canada, china, france, germany, india, korea, mexico, slovakia, slovenia, taiwan, turkey, and the u.s.). the clinical trial protocol was approved by the institutional review boards and independent ethics committees and competent authorities of the participating centers, and the trial complied with the declaration of helsinki, in accordance with the international conference on harmonization harmonized tripartite guideline for good clinical practice. this study enrolled patients (aged 18 years ; bmi 45 kg / m) with inadequately controlled type 2 diabetes (hba1c 7 to 10%) despite a diet and exercise program and a stable regimen (unchanged for 12 weeks prior to randomization) of metformin immediate release plus a sulfonylurea. patients with hba1c > 10% were eligible to participate in an open - label treatment arm. exclusion criteria included uncontrolled hyperglycemia (glucose level > 13.3 mmol / l) after an overnight fast, confirmed by a second measurement), acute coronary syndrome, stroke or transient ischemic attack within 3 months prior to consent, indication of liver disease, impaired kidney function (estimated glomerular filtration rate [egfr ] 13.3 mmol / l after an overnight fast or, between weeks 12 and 24, a patient had a glucose level > 11.1 mmol / l after an overnight fast or hba1c > 8.5%. the initiation, choice, and dosage of rescue medication were at the investigator s discretion, according to local prescribing information. in cases of hypoglycemia, rescue medication was reduced or discontinued. where hyper- or hypoglycemia could not be controlled, the patient was discontinued from the trial. key secondary end points were change from baseline to week 24 in body weight and mean daily glucose (mdg) using an 8-point blood glucose profile. exploratory end points included the following : percentage of patients with baseline hba1c 7.0% who had hba1c 5% reduction in body weight at week 24 ; and use of rescue medication. change from baseline in 2-h postprandial glucose (ppg) was assessed in a subset of patients based on a meal tolerance test (mtt) performed at baseline and week 24. safety end points included vital signs, clinical laboratory parameters, 12-lead electrocardiogram, and adverse events (aes ; preferred terms coded according to the medical dictionary for drug regulatory activities version 14.1). aes included all events with an onset after the first dose of trial medication up to a period of 7 days after the last dose. mmol / l and/or requiring assistance) and events consistent with urinary tract infection (uti) and genital infection. events consistent with uti and genital infection were identified from aes reported spontaneously by the investigator using prospectively defined search categories based on 67 and 87 preferred terms, respectively. efficacy analysis was performed on the full analysis set (fas), which included all randomized patients treated with one or more doses of study drug who had a baseline hba1c value. two - hour ppg was analyzed in the mtt set (patients in the fas with valid baseline and one or more on - treatment mtt measurements). safety and lipid parameters were analyzed in the treated set (patients treated with one or more doses of study drug). the last observation carried forward (locf) approach was used to impute missing continuous efficacy data. locf - ir imputation (i.e., locf without setting values after rescue therapy to missing) was used for analysis of lipid parameters. analyses of efficacy end points in the open - label set were based on oc. the primary end point was assessed using an ancova model, with treatment, region, and egfr at baseline as fixed effects and baseline hba1c as a linear covariate. key secondary and continuous exploratory end points were analyzed using the statistical model described for the primary end point, with the baseline value for the end point in question as an additional linear covariate. changes over time in hba1c, fpg, and blood pressure were analyzed using restricted maximum likelihood based mixed model repeated measures. categorical change in hba1c and the proportion of patients with > 5% weight loss were analyzed using logistic regression. treatment differences versus placebo in primary and key secondary end points were tested using a hierarchical testing approach for each dose at a significance level of 2.5% (two sided) to maintain the overall type i error at 5%. all other exploratory tests were two sided at a 5% level (no multiplicity adjustment). safety analyses and analyses of efficacy end points in the open - label group were descriptive. further details on statistical analysis including sample size calculation are given in supplementary section 1. this was a randomized, placebo - controlled, double - blind phase iii study conducted from july 2010 to february 2012 in 148 centers in 12 countries (canada, china, france, germany, india, korea, mexico, slovakia, slovenia, taiwan, turkey, and the u.s.). the clinical trial protocol was approved by the institutional review boards and independent ethics committees and competent authorities of the participating centers, and the trial complied with the declaration of helsinki, in accordance with the international conference on harmonization harmonized tripartite guideline for good clinical practice. this study enrolled patients (aged 18 years ; bmi 45 kg / m) with inadequately controlled type 2 diabetes (hba1c 7 to 10%) despite a diet and exercise program and a stable regimen (unchanged for 12 weeks prior to randomization) of metformin immediate release plus a sulfonylurea. patients with hba1c > 10% were eligible to participate in an open - label treatment arm. exclusion criteria included uncontrolled hyperglycemia (glucose level > 13.3 mmol / l) after an overnight fast, confirmed by a second measurement), acute coronary syndrome, stroke or transient ischemic attack within 3 months prior to consent, indication of liver disease, impaired kidney function (estimated glomerular filtration rate [egfr ] 13.3 mmol / l after an overnight fast or, between weeks 12 and 24, a patient had a glucose level > 11.1 mmol / l after an overnight fast or hba1c > 8.5%. the initiation, choice, and dosage of rescue medication were at the investigator s discretion, according to local prescribing information. in cases of hypoglycemia, rescue medication was reduced or discontinued. where hyper- or hypoglycemia could not be controlled, the patient was discontinued from the trial. key secondary end points were change from baseline to week 24 in body weight and mean daily glucose (mdg) using an 8-point blood glucose profile. exploratory end points included the following : percentage of patients with baseline hba1c 7.0% who had hba1c 5% reduction in body weight at week 24 ; and use of rescue medication. change from baseline in 2-h postprandial glucose (ppg) was assessed in a subset of patients based on a meal tolerance test (mtt) performed at baseline and week 24. safety end points included vital signs, clinical laboratory parameters, 12-lead electrocardiogram, and adverse events (aes ; preferred terms coded according to the medical dictionary for drug regulatory activities version 14.1). aes included all events with an onset after the first dose of trial medication up to a period of 7 days after the last dose. aes of special interest included confirmed hypoglycemic aes (plasma glucose 3.9 mmol / l and/or requiring assistance) and events consistent with urinary tract infection (uti) and genital infection. events consistent with uti and genital infection were identified from aes reported spontaneously by the investigator using prospectively defined search categories based on 67 and 87 preferred terms, respectively. efficacy analysis was performed on the full analysis set (fas), which included all randomized patients treated with one or more doses of study drug who had a baseline hba1c value. two - hour ppg was analyzed in the mtt set (patients in the fas with valid baseline and one or more on - treatment mtt measurements). safety and lipid parameters were analyzed in the treated set (patients treated with one or more doses of study drug). the last observation carried forward (locf) approach was used to impute missing continuous efficacy data. locf - ir imputation (i.e., locf without setting values after rescue therapy to missing) was used for analysis of lipid parameters. analyses of efficacy end points in the open - label set were based on oc. the primary end point was assessed using an ancova model, with treatment, region, and egfr at baseline as fixed effects and baseline hba1c as a linear covariate. key secondary and continuous exploratory end points were analyzed using the statistical model described for the primary end point, with the baseline value for the end point in question as an additional linear covariate. changes over time in hba1c, fpg, and blood pressure were analyzed using restricted maximum likelihood based mixed model repeated measures. categorical change in hba1c and the proportion of patients with > 5% weight loss were analyzed using logistic regression. treatment differences versus placebo in primary and key secondary end points were tested using a hierarchical testing approach for each dose at a significance level of 2.5% (two sided) to maintain the overall type i error at 5%. all other exploratory tests were two sided at a 5% level (no multiplicity adjustment). safety analyses and analyses of efficacy end points in the open - label group were descriptive. further details on statistical analysis including sample size calculation are given in supplementary section 1. a total of 669 patients were randomized, of whom 666 patients were treated double blind with study medication and comprised the fas. overall, 91.3% of randomized and treated patients completed the treatment period. a further 101 patients with hba1c > 10% were treated with open - label empagliflozin 25 mg, and 84.2% of these patients completed the treatment period. two - hour ppg was evaluated in a subset of 124 patients (placebo, n = 35 ; empagliflozin 10 mg, n = 43 ; empagliflozin 25 mg, n = 46). the mean (sd) age of randomized patients was 57.1 years (9.2) ; mean (sd) bmi was 28.2 kg / m (5.3). mean (sd) baseline hba1c in the randomized groups was 8.10% (0.83), 49.1% had a baseline hba1c 5% reduction in body weight at week 24 was significantly greater with empagliflozin 10 mg (27.6%) and empagliflozin 25 mg (23.6%) than with placebo (5.8% ; odds ratios vs. placebo were 6.36 [95% ci 3.3612.02 ] for empagliflozin 10 mg and 5.19 [2.729.91 ] for empagliflozin 25 mg ; p 10%) are given in fig. the mean (se) change from baseline in hba1c at week 24 was 2.89% (0.16). a total of 8.9% of patients achieved hba1c 5% reduction in body weight at week 24. changes (se) from baseline in sbp and dbp were 4.3 mmhg (1.2) and 3.4 mmhg (1.0), respectively. most (96%) of patients with one or more ae reported only events of mild or moderate intensity. one patient in the empagliflozin 10 mg group died during the study due to an acute myocardial infarction, which was assessed as not being related to the study drug by the investigator. confirmed hypoglycemic aes were reported by more patients in the empagliflozin 10 mg (n = 36 ; 16.1%) and 25 mg (n = 25 ; 11.5%) groups than with placebo (n = 19 ; 8.4%). events consistent with uti were reported in 8.0% of patients on placebo, similar to the proportion on empagliflozin 25 mg (8.3%) and slightly lower than the proportion on empagliflozin 10 mg (10.3%). the majority of events consistent with uti were mild in intensity, none was severe, and only one such event led to study discontinuation. most patients who reported any events consistent with uti reported just one event ; two patients in the empagliflozin 10 mg group and two patients in the empagliflozin 25 mg group reported two events. events consistent with uti were reported considerably more frequently in female patients (13.318.0%) than in male patients (0.02.7%). the proportion of patients who reported events consistent with genital infection was low, but higher with empagliflozin than with placebo (2.32.7 vs. 0.9%). all but one patient (in the placebo group) who reported any events consistent with genital infection reported just one event. events consistent with genital infection were reported more frequently in female patients (0.94.5%) than in male patients (0.9%). in the open - label group, confirmed hypoglycemic events were reported for seven patients (6.9%). events consistent with uti were reported for three patients (3.0%), and events consistent with genital infection were reported for two patients (2.0%). changes in laboratory values (electrolytes, hematocrit, and lipid parameters) are presented in supplementary table 5. there were small increases in hematocrit and small decreases in uric acid levels in the randomized empagliflozin groups. there was a small increase from baseline in hdl cholesterol with empagliflozin 10 and 25 mg (mean [se ], 0.05 mmol / l [0.01 ] for both doses) compared with placebo (0.02 no major differences in mean (se) changes from baseline in ldl cholesterol or triglycerides were noted between placebo and empagliflozin. a total of 669 patients were randomized, of whom 666 patients were treated double blind with study medication and comprised the fas. overall, 91.3% of randomized and treated patients completed the treatment period. a further 101 patients with hba1c > 10% were treated with open - label empagliflozin 25 mg, and 84.2% of these patients completed the treatment period. two - hour ppg was evaluated in a subset of 124 patients (placebo, n = 35 ; empagliflozin 10 mg, n = 43 ; empagliflozin 25 mg, n = 46). the mean (sd) age of randomized patients was 57.1 years (9.2) ; mean (sd) bmi was 28.2 kg / m (5.3). mean (sd) baseline hba1c in the randomized groups was 8.10% (0.83), 49.1% had a baseline hba1c 5% reduction in body weight at week 24 was significantly greater with empagliflozin 10 mg (27.6%) and empagliflozin 25 mg (23.6%) than with placebo (5.8% ; odds ratios vs. placebo were 6.36 [95% ci 3.3612.02 ] for empagliflozin 10 mg and 5.19 [2.729.91 ] for empagliflozin 25 mg ; p 10%) are given in fig. the mean (se) change from baseline in hba1c at week 24 was 2.89% (0.16). a total of 8.9% of patients achieved hba1c 5% reduction in body weight at week 24. changes (se) from baseline in sbp and dbp were 4.3 mmhg (1.2) and 3.4 mmhg (1.0), respectively. reductions in hba1c after 24 weeks were significantly greater in empagliflozin groups than in the placebo group, with adjusted mean (se) changes of 0.17% (0.05) for placebo, compared with 0.82% (0.05) for empagliflozin 10 mg and 0.77% (0.05) for empagliflozin 25 mg (differences of adjusted means vs. placebo were 0.64% [95% ci 0.77 to 0.51 ] for empagliflozin 10 mg and 0.59% [0.73 to 0.46 ] for empagliflozin 25 mg ; p 5% reduction in body weight at week 24 was significantly greater with empagliflozin 10 mg (27.6%) and empagliflozin 25 mg (23.6%) than with placebo (5.8% ; odds ratios vs. placebo were 6.36 [95% ci 3.3612.02 ] for empagliflozin 10 mg and 5.19 [2.729.91 ] for empagliflozin 25 mg ; p 10%) are given in fig. a total of 8.9% of patients achieved hba1c 5% reduction in body weight at week 24. changes (se) from baseline in sbp and dbp were 4.3 mmhg (1.2) and 3.4 mmhg (1.0), respectively. most (96%) of patients with one or more ae reported only events of mild or moderate intensity. one patient in the empagliflozin 10 mg group died during the study due to an acute myocardial infarction, which was assessed as not being related to the study drug by the investigator. confirmed hypoglycemic aes were reported by more patients in the empagliflozin 10 mg (n = 36 ; 16.1%) and 25 mg (n = 25 ; 11.5%) groups than with placebo (n = 19 ; 8.4%). events consistent with uti were reported in 8.0% of patients on placebo, similar to the proportion on empagliflozin 25 mg (8.3%) and slightly lower than the proportion on empagliflozin 10 mg (10.3%). the majority of events consistent with uti were mild in intensity, none was severe, and only one such event led to study discontinuation. most patients who reported any events consistent with uti reported just one event ; two patients in the empagliflozin 10 mg group and two patients in the empagliflozin 25 mg group reported two events. events consistent with uti were reported considerably more frequently in female patients (13.318.0%) than in male patients (0.02.7%). the proportion of patients who reported events consistent with genital infection was low, but higher with empagliflozin than with placebo (2.32.7 vs. 0.9%). all but one patient (in the placebo group) who reported any events consistent with genital infection reported just one event. events consistent with genital infection were reported more frequently in female patients (0.94.5%) than in male patients (0.9%). in the open - label group, events consistent with uti were reported for three patients (3.0%), and events consistent with genital infection were reported for two patients (2.0%). changes in laboratory values (electrolytes, hematocrit, and lipid parameters) are presented in supplementary table 5. there were small increases in hematocrit and small decreases in uric acid levels in the randomized empagliflozin groups. there was a small increase from baseline in hdl cholesterol with empagliflozin 10 and 25 mg (mean [se ], 0.05 mmol / l [0.01 ] for both doses) compared with placebo (0.02 mmol / l [0.01 ] ; p 5 years before the trial). significant reductions in body weight and waist circumference were observed with empagliflozin compared with placebo, and 2428% of patients on empagliflozin had a > 5% reduction in weight at week 24, compared with only 6% on placebo. weight control is important for patients with type 2 diabetes to help improve glycemic control (16,17) and improve cardiovascular risk factors (1,18,19), and is particularly pertinent for patients taking a sulfonylurea. treatment with sulfonylurea is associated with weight gain, a side effect that has been shown to reduce patient satisfaction and adherence to medication (20,21). hypertension is an important cardiovascular risk factor associated with type 2 diabetes (22,23). in this study, a significant reduction in sbp this may reflect osmotic diuresis associated with urinary glucose excretion (24), which may also explain the small increase in hematocrit. unexpectedly, no reduction in dbp was observed at week 24. as a limitation of the study, changes in antihypertensive medication were allowed, possibly diluting the effect of empagliflozin versus placebo on blood pressure. a reduction in uric acid levels was observed in patients treated with empagliflozin, compared with an increase in patients on placebo. in many epidemiological studies, lower uric acid levels empagliflozin was well tolerated when used as add - on therapy to metformin plus sulfonylurea for 24 weeks. more patients reported serious aes with placebo than empagliflozin, and the number of patients who discontinued due to aes was similar between the randomized empagliflozin groups and the placebo group. this suggests that empagliflozin in combination with sulfonylurea may increase the risk of hypoglycemia, whereas empagliflozin alone has a low risk of hypoglycemia (11). importantly, empagliflozin as add - on to on metformin plus sulfonylurea did not cause any hypoglycemic events that required assistance. patients with type 2 diabetes, particularly female patients, are at increased risk of utis (27,28) ; however, the reported incidence varies between trials due to different reporting methods. in this trial, the proportion of patients with events consistent with uti was slightly higher with empagliflozin 10 mg than with empagliflozin 25 mg or placebo, and the proportion of patients reporting genital infections was higher with empagliflozin than with placebo. this is consistent with data on other sglt2 inhibitors, which show that a higher proportion of patients report genital infections with the sglt2 inhibitor versus placebo, but the proportion of patients who report utis is similar or only slightly higher with sglt2 inhibitor versus placebo (29,30). empagliflozin 10 and 25 mg showed no difference in efficacy or tolerability in this trial, even though a dose - dependent increase in urinary glucose excretion and a dose - dependent decrease in hba1c have been reported in phase i / ii studies (11,12,31,32). dose dependency of empagliflozin will be evaluated based on the totality of data from phase iii trials comprising more than 10,000 patients. to conclude, in this trial, empagliflozin at doses of 10 and 25 mg led to clinically meaningful improvements in glycemic control in patients with inadequate control on metformin plus sulfonylurea, led to significant reductions in body weight and sbp, and was well tolerated over 24 weeks. these results demonstrate the potential of empagliflozin as a third - line therapy in patients inadequately controlled with metformin plus a sulfonylurea. | objectiveto investigate the efficacy and tolerability of empagliflozin as add - on to metformin and sulfonylurea in patients with type 2 diabetes.research design and methodspatients inadequately controlled on metformin and sulfonylurea (hba1c 7 to 10%) were randomized and treated with once - daily empagliflozin 10 mg (n = 225), empagliflozin 25 mg (n = 216), or placebo (n = 225) for 24 weeks. the primary end point was change from baseline in hba1c at week 24. key secondary end points were changes from baseline in weight and mean daily glucose (mdg) at week 24.resultsat week 24, adjusted mean (se) changes from baseline in hba1c were 0.17% (0.05) for placebo vs. 0.82% (0.05) and 0.77% (0.05) for empagliflozin 10 and 25 mg, respectively (both p < 0.001). empagliflozin significantly reduced mdg, weight, and systolic (but not diastolic) blood pressure versus placebo. adverse events were reported in 62.7, 67.9, and 64.1% of patients on placebo and empagliflozin 10 and 25 mg, respectively. events consistent with urinary tract infection were reported in 8.0, 10.3, and 8.3% of patients on placebo and empagliflozin 10 and 25 mg, respectively (females : 13.3, 18.0, and 17.5%, respectively ; males : 2.7, 2.7, and 0%, respectively). events consistent with genital infection were reported in 0.9, 2.7, and 2.3% of patients on placebo and empagliflozin 10 and 25 mg, respectively (females : 0.9, 4.5, and 3.9%, respectively ; males : 0.9% in each group).conclusionsempagliflozin 10 and 25 mg for 24 weeks as add - on to metformin plus sulfonylurea improved glycemic control, weight, and systolic blood pressure and were well tolerated. |
however, transplantation is limited not only by organ shortage but also by its unfavorable long - term success due to chronic allograft injury (cai) [1, 2 ]. chronic allograft vasculopathy (cav), glomerulosclerosis, and interstitial fibrosis and tubular atrophy (ifta) are the dominating histopathological findings in cai [1, 2 ]. its pathogenesis is still poorly understood, but acute rejection episodes were defined as an important risk factor and experimental data suggest that they play an important pathogenetic role [15 ]. transplantation of kidneys in fischer-344 (f344) to lewis rat strain combination is a well - established experimental model for human cai. we and others thoroughly characterized a variant of this model, where immunosuppression is omitted [710 ]. this model allows investigation of a severe but reversible acute rejection episode, which peaks 9 days after allogenic transplantation and precedes the development of cai. acute rejection of f344 to lewis renal allografts is characterized by a strong mononuclear infiltration of the allograft interstitium. at the same time, numerous leukocytes accumulate in the arterial, capillary, and venous blood vessels. after resolution of acute rejection, the number of intravascular leukocytes decreases but remains chronically elevated compared to healthy kidneys. a majority of blood leukocytes in day 9 allografts are monocytes displaying a unique state of partial activation regarding cell surface antigen and cytokine expression. these cells interact with graft endothelial cells and might trigger cav, which is characterized by intimal hyperplasia. to identify factors contributing to the pathogenesis of cai during reversible acute rejection, we compared the transcriptome of mononuclear leukocytes isolated from renal allografts to isografts 9 days after transplantation. in this gene array experiment, tissue transglutaminase (transglutaminase 2, tgm2) was found among the genes, which were upregulated by mononuclear leukocytes accumulating in the lumina of allograft blood vessels. transglutaminases catalyze posttranscriptional modifications of proteins, resulting in cross - linking of proteins such as cytoskeleton or extracellular matrix (ecm), as well as in modifications via amine incorporation into proteins and via deamidation [11, 12 ]. these modifications can have drastic consequences including increased mechanical stability, formation of autoantigens, and profound changes in protein function [11, 13, 14 ]. among the 9 transglutaminases present in humans, tgm2 is most intensively investigated and a bewildering functional diversity is described. it acts as classical ca - dependent transglutaminase, as g - protein, as disulfide isomerase, and as protein kinase [16, 17 ]. in addition, it interacts with a plethora of other proteins and is involved in numerous cellular processes such as apoptosis and cell survival, phagocytosis, cell adhesion and migration, and cell signaling. tgm2 is ubiquitously expressed and localizes to virtually all compartments of the cell including the cytoplasm, the nucleus, and mitochondria. in addition, tgm2 can be attached to the surface and is secreted into the extracellular space, where it can cross - link itself to extracellular proteins [15, 18 ]. we are interested in tgm2 in the context of reversible acute rejection and subsequent chronic deterioration of renal allografts. tgm2 might exert essential functions involved in rejection such as antigen presentation and t cell activation via dendritic cells, activation of the nfb pathway, and enabling the expression of proinflammatory factors, leukocyte adhesion to vascular endothelial cells, and leukocyte migration. during resolution of acute rejection, its role in apoptosis, phagocytosis, and release of tgf- may be of importance [21, 22 ]. finally, during the development of cai, tgm2 might protect graft blood vessels as already evidenced in the context of atherosclerosis. alternatively, tgm2 could contribute to vascular remodeling by increasing vascular stiffness and by promoting epithelial / endothelial to mesenchymal transition [24, 25 ], which was suggested to contribute to ifta. in this study, we investigate tgm2 mrna and protein expression by mononuclear blood leukocytes isolated from lewis to lewis isografts and f344 to lewis allografts and by respective renal tissue tgm2 expressions compared to activated caspase-3, a protease critically involved in apoptosis. leukocytes and grafts are studied during acute rejection on day 9 after transplantation and after resolution of acute rejection on day 42. furthermore, allograft recipients were treated with cystamine during the first month after transplantation to assess the role of early extracellular transglutaminase activity in the pathogenesis of cai. male lewis (rt1) (janvier, st. berthevin, france) and f344 (rt1) (harlan winkelmann, borchen, germany) rats weighing 270300 g were used for transplantation. animals were kept under conventional conditions and received humane care according to the german law on the protection of animals and the principles of laboratory animal care formulated by the national society for medical research as well as the nih guide for the care and use of laboratory animals. experiments were approved by the local authorities (permit number gi 20/10 number 23/2008 ; gi 20/27 number 51/2010). kidneys were transplanted orthotopically to totally nephrectomized lewis recipients as described previously, except that the ureter was anastomosed end to end. for allogenic transplantation, f344 rats and, for isogenic transplantation, 30 g ampicillin after surgery (ratiopharm, ulm, germany) ; no immunosuppressant was given. total ischemic times remained below 30 min. on day 9 or 42 after transplantation application of 60 mg / kg sodium pentobarbital (narcoren, merial, hallbergmoos, germany) and grafts were removed, cut in small pieces, and snap frozen in liquid nitrogen until use. allograft recipients were treated with the transglutaminase inhibitor cystamine dihydrochloride (sigma - aldrich, taufkirchen, germany) for 28 days starting at the day of transplantation. cystamine was diluted in sterile saline and delivered continuously using subcutaneously implanted osmotic minipumps (2ml4 alzet, cupertino, ca) at a concentration of 12 mg per day. animals were sacrificed 12 weeks after transplantation ; grafts were removed, fixed in 4% buffered paraformaldehyde, and embedded in paraffin. to study renal function, isolation of mononuclear blood cells was described previously in detail [28, 29 ]. injection of 200 u of heparin (liquemin n 5000, roche, basel, switzerland), and kidneys were intensively perfused with cold ca- and mg - free phosphate buffered saline (paa, pasching, austria), supplemented with 2.7 mm edta and 0.1% bovine serum albumin (serva, heidelberg, germany). to deplete erythrocytes and granulocytes total rna was isolated from 30 mg kidney tissue or from 5 10 mononuclear leukocytes harvested from the blood vessels of control kidneys, isografts, or allografts on day 9 or 42 after transplantation. rna extraction was performed using the rneasy mini kit (qiagen, hilden, germany) according to the instructions of the supplier. one g of total rna was reversely transcribed using the m - mlv h reverse transcriptase and 1 g of random hexamer primers (promega, mannheim, germany). the reaction was carried out at 40c for 1 h. real - time rt - pcr was used to assess the mrna gene expression of tgm2. reactions were performed in an abi 7900 sequence detection system (applied biosystems, foster city, ca) using platinum sybr green qpcr super mix - udg (invitrogen, karlsruhe, germany). the relative gene expression values were calculated by the equation 2, where ct is the difference in ct values between the porphobilinogen deaminase (pbgd) housekeeping gene and tgm2. data for each experimental group are expressed in relation to the expression in the healthy control, which was set to 1 arbitrary unit. all primers for real - time rt - pcr were synthesized by mwg biotech (ebersberg, germany). primer sequences are as follows : for tgm2, 5-cca gcg tgg aca gac tta ca-3 (sense), 5-ctg ctc cac atc gtc aga ca-3(antisense) and for pbgd, 5-ggc gca gct aca gag aaa gt-3(sense), 5-agc cag gat aat ggc act ga-3(antisense). pcr conditions included denaturation for 5 min at 95c, followed by 45 cycles of 20 s at 95c, 20 s at 60c, and 10 s at 72c. to confirm the production of a single amplicon with the expected molecular mass, in addition, each product was sequenced (seqlab, gttingen, germany) to confirm the specificity of the pcr. a negative control, where cdna was omitted, was included in every run. in negative controls, protein concentrations were determined using micro bca protein assay kit (pierce biotechnology, rockford, il). equal amounts of protein (40 g of tissue extract or 8 g of cellular extract) were resolved on 8% or 15% reducing sds - polyacrylamide gels and transferred onto polyvinylidene difluoride membranes (millipore, billerica, ma). membranes were blocked in 1x roti - block solution (roth, karlsruhe, germany) diluted in 50 mm tris - hcl, ph 7.6, and 0.9% nacl for 60 min at rt and then incubated overnight at 4c with mouse monoclonal antibodies (mabs) to tgm2 (clone tg100) (thermo fisher scientific, fremont, ca) diluted 1 : 4000 or 1 : 6000 for cellular extract or kidney tissue, respectively. optionally, membranes were incubated overnight with rabbit anti - active caspase-3 abs (abcam, cambridge, uk) diluted 1 : 1000 in roti - block solution. to ensure equal protein loading, membranes were blocked with 5% milk and incubated with mabs to gapdh (novus biologicals, littleton, co), 1 : 20000. bound antibodies were visualized with horseradish peroxidase - conjugated secondary abs (dako, glostrup, denmark), 1 : 5000, using the chemiluminescent reagent lumi - light western blotting substrate (roche, mannheim, germany). densitometric analyses were performed using a digital gel documentation system (biozym, hessisch oldendorf, germany). all data of individual samples were divided by the values obtained for gapdh on the same blot. the mean of the tgm2/gapdh or active caspase-3/gapdh ratio of the controls was set to 1 arbitrary unit and each individual value including control values was calculated accordingly. histological sections were stained with acidic orcein 12 weeks after transplantation to visualize the internal and external elastic lamina of arteries and to evaluate a possible effect of cystamine on arterial remodelling. at least 10 arteries of the muscular type were investigated per section. to estimate the relative thickness of arterial media and intima, the ratio of the total vessel diameter, including media and intima, and the diameter of the lumen of the artery were determined. additionally, the percentage of arteries exhibiting intimal hyperplasia was analyzed. histological sections were stained with azocarmine / aniline blue (azan) 12 weeks after transplantation and tunica adventitia was measured. to estimate relative thickness of the tunica adventitia, the diameter of outer arterial diameter (including tunica adventitia, media, intima, and lumen) was determined and divided by diameter of inner arterial diameter (including media, intima, and lumen). sections of 6 m were dewaxed and rehydrated. to unmask tgm2 immunoreactivity in the fixed tissue, antigen retrieval was performed in 0.01 m sodium citrate buffer (ph 6.0) for 15 min at 120c in a steamer. sections were pretreated with protease xiv (sigma - aldrich) for 15 min at rt for detection of cd163 or active caspase-3. after washing in pbs, ph 7.2, the paraffin sections were incubated for 30 min at rt with pbs supplemented with 1% bsa and 0.1% nan3. thereafter, mouse mabs to tgm2 diluted 1 : 1500 or ed2 (anti - cd163, serotec, oxford, uk) abs diluted 1 : 200 or polyclonal rabbit abs to active caspase-3 (abcam) diluted 1 : 100 in pbs supplemented with 1% bsa (serva) were applied and incubated at 4c overnight. bound, primary tgm2 abs were detected using rabbit anti - mouse immunoglobulin and goat anti - rabbit hrp labeled abs (dako) and 3,3-diaminobenzidine (dab) (sigma - aldrich). to amplify the signal for ed2 abs, additionally, anti - rabbit envision peroxidase system (dako) was applied according to the manufacturer 's instructions. to detect abs bound to active caspase-3, anti - rabbit envision peroxidase system (dako) was used. sections were weakly stained with hemalum and coverslipped with pertex (medite, burgdorf, germany). to detect tgm2-positive monocytes / macrophages, sections were first stained with mabs to tgm2 as described, followed by protease xiv treatment for 15 min at rt and overnight incubation at 4c with mab ed1 directed to a cd68-like antigen (serotec) diluted 1 : 500 in pbs supplemented with 1% bsa and 0.1% nan3. to detect bound primary abs, rabbit anti - mouse immunoglobulin and alkaline phosphatase anti - alkaline phosphatase (apaap) (both from dako) were used in combination with fast blue (sigma - aldrich) as chromogen. sections were evaluated with an olympus bx51 microscope and analysis software (olympus, hamburg, germany). data were analyzed, where applicable, by nonparametric kruskal - wallis test followed by the mann - whitney rank sum test using spss software (spss software, munich, germany). renal transplantation in the f344 to lewis rat strain combination results in accumulation of mononuclear leukocytes in allograft blood vessels [9, 31 ]. to isolate these cells, kidneys were intensively perfused on days 9 and 42 after transplantation. in agreement with the previously published data, we observed a strong increase in the number of mononuclear leukocytes accumulating in the vasculature of allografts on day 9 compared to isografts. furthermore, the number of intravascular leukocytes was reduced on day 42 ; however, it remained still increased compared to day 42 isografts. the difference in cell number was also observed between perfusates from control kidneys and isografts on days 9 and 42 (figure 1). the cellular composition of intravascular leukocytes obtained by perfusion on day 9 and day 42 was published before [9, 31 ]. the mrna expression of tgm2 was analyzed by real - time rt - pcr in mononuclear leukocytes isolated from renal blood vessels of control animals and isogenic and allogenic renal transplants. real - time rt - pcr led to a single amplicon of the expected molecular mass in all samples analyzed. in negative controls, where cdna was omitted, interestingly, an elevated level of tgm2 mrna was detected in cells collected from allografts on day 9, as well as on day 42 after transplantation, when compared to the respective isografts (figure 2(a)). tgm2 mrna expression was also increased in day 9 and day 42 allograft tissue compared to respective isografts. in contrast to graft blood leukocytes, where the expression was stronger on day 9 compared to day 42, tgm2 tissue expression did not differ between day 9 and day 42 (figure 2(b)). protein expression of tgm2 was investigated by immunoblotting of lysates of mononuclear intravascular leukocytes isolated from control animals and isogenic or allogenic renal transplants (figures 3(a) and 4(a)) as well as of total tissue lysates (figures 3(c) and 4(c)). expression of tgm2 was detected in all groups investigated as a major band with expected molecular mass of ~70 kda. on day 42 densitometrical analyses revealed elevated levels of tgm2 expression in blood mononuclear leukocytes isolated from isografts on day 9 compared to cells from control kidneys. furthermore, an elevated expression level of tgm2 was detected in perfusates from allografts on day 9 compared to respective isograft samples (figure 3(b)). in contrast to the results from real - time rt - pcr, no difference in the expression of tgm2 was detected in perfusates on day 42 after transplantation (figure 4(b)) as well as in total kidney tissue on day 9 and day 42 after transplantation (figures 3(d) and 4(d)). so far, the expression of tgm2 was analyzed in the total intravascular population of mononuclear leukocytes. to examine tgm2 expression by graft monocytes, we performed immunohistochemical staining on paraffin sections from control kidneys, isografts, and allografts explanted on day 9 after transplantation (figures 5(a)5(d)). in line with previously published data describing accumulation of blood leukocytes, tgm2-positive cells were most abundant in the vasculature of day 9 allografts (figure 5(c)). in addition to intravascular leukocytes, blood plasma exhibited tgm2 immunoreactivity, predominantly in allografts. to identify monocytes expressing tgm2, double - staining experiments with mab ed1 detecting cd68-like antigen were performed (figure 5(d)). in isograft tissue, tgm2 immunoreactivity was detected in the vascular endothelium of some arteries, veins, and capillaries. in the media of arteries, smooth muscle cells were immunopositive in the adventitia extracellular material and cells with a fibroblast - like shape. in the renal parenchyma, renal tubules, most probably proximal tubules, collecting ducts, and the outer layer of bowman 's capsule were stained with antibodies to tgm2. the staining was identical to the pattern seen in isografts but it was more intense all over. in the leukocytic infiltrate, no conspicuous additional staining was detected (data not shown). tgm2 was described as a marker for m2 macrophages ; we investigated if graft monocytes also express the classical m2 cell surface marker cd163. to detect cd163-positive cells, immunohistochemical staining with mab ed2 as expected, we detected a very low number of positive cells in isografts (figure 5(e)). in contrast, cd163-positive cells were more frequent in allografts (figure 5(f)). in both groups analyzed, no cd163-positive cells were detected in the lumina of blood vessels. therefore, we analyzed if caspase-3, a key protease directly involved in apoptosis, is also expressed by intravascular graft leukocytes. to examine activation of caspase-3 during reversible acute rejection, detection of active caspase-3 in renal mononuclear graft leukocytes as well as in graft tissue on days 9 and 42 after transplantation was performed by immunoblotting (figures 6(a), 6(c), 7(a), and 7(c)). the appearance of the active p19 (~19 kda) and p17 (~17 kda) fragments of caspase-3 was detected. densitometric analyses revealed increased levels of active caspase-3 in mononuclear blood leukocytes from allografts on day 9 (figure 6(b)). active caspase-3 was also detected in perfusates from day 42 isografts and allografts, but no difference was observed among them (figures 7(a) and 7(b)). also, in allograft tissue, elevated levels of active caspase-3 were measured on days 9 and 42 compared to respective isografts (figures 6(c) and 7(c)). furthermore, these results were corroborated by immunohistochemical staining of graft tissue on day 9 after transplantation. active caspase-3-positive cells were detected in the graft blood vessels predominantly in allografts veins, whereas caspase-3 immunoreactivity was less prominent in leukocytes accumulating in arteries (figure 6(d)). to examine the role of tgm2 in the pathogenesis of cai, renal allograft recipients were treated with cystamine, a general inhibitor of tgm, or placebo. creatinine clearance was monitored 4, 8, and 12 weeks after transplantation to determine renal function. no differences were observed between placebo- (3.4 1.5 at 4 weeks ; 5.1 0.7 at 8 weeks ; 3.0 0.7 at 12 weeks ; n = 6 per group ; data are given as mean standard deviation, ml / min) and cystamine - treated animals (3.9 1.2 at 4 weeks ; 4.4 0.6 at 8 weeks ; 3.5 0.5 at 12 weeks ; n = 6 per group ; data are given as mean standard deviation, ml / min) independent of the time point investigated. at the end of the study, at 12 weeks after transplantation, animals were sacrificed and relative thickness of arteries was quantified on sections stained with acidic orcein. no significant difference was observed between both experimental groups (figures 8(a), 8(c), and 8(d)). furthermore, arteries with intimal hyperplasia were detected in the sham - treated group, whereas cystamine treatment had no effect on intimal remodeling (figures 8(b), 8(c), and 8(d)). additionally, histological sections were stained with azocarmine / aniline blue (azan) 12 weeks after transplantation to detect interstitial fibrosis. we demonstrate in this study that tgm2 mrna and protein are overexpressed by mononuclear leukocytes, predominantly by activated monocytes, which accumulate in the vascular bed of rat renal allografts (f344 to lewis) on day 9 after transplantation. after resolution of acute rejection on day 42, tgm2 mrna levels are lower but still moderately increased compared to respective isografts, which is not reflected in increased protein levels. tgm2 mrna expression was also induced in graft tissue upon allogenic transplantation. on the protein level, however, no quantitative changes were detected. we focused on the well - characterized population of mononuclear leukocytes, which accumulate in large numbers in the blood vessels of experimental allografts during acute rejection. the number of leukocytes, which were isolated from control kidneys, isografts, and allografts 9 and 42 days after transplantation by intensively perfusing renal blood vessels, nicely corroborated data published previously [9, 31 ]. the acute rejection episode, which peaks at around day 9 after transplantation, is of major interest for the understanding of cai, since clinical and experimental data suggest that acute rejection is an important triggering factor [15 ]. as cav, a hallmark of cai, is characterized by arterial intimal hyperplasia, leukocytes interacting with allogenic endothelial cells were suggested to play a pivotal pathogenic role. the number of intravascular leukocytes decreases after reversion of acute rejection in the f344 to lewis rat strain combination but remains elevated for several weeks. first hints regarding the overexpression of tgm2 by mononuclear leukocytes isolated from the blood vessels of allografts on day 9 after transplantation came from gene array data. these data were confirmed by real - time rt - pcr and immunoblotting using antibodies, which detected a major band of the expected molecular mass. immunohistochemistry with the same antibodies revealed that intravascular leukocytes in renal allografts were strongly tgm2-immunoreactive. on tissue sections double - stained with mab ed1 directed to a cd-68-like antigen, an established marker for rat monocytes / macrophages, we identified graft monocytes as strongly tgm2-immunopositive. it might be argued that the increase in tgm2 expression in mononuclear blood leukocytes from day 9 allografts is due to the increase in the proportion of monocytes, which is indeed seen. however, isograft blood leukocytes contain about 50% monocytes and allografts about 70%, whereas tgm2 mrna expression levels increase by about 10-fold, suggesting that the increased proportion of monocytes is not the only explanation for the observed increase in tgm2 mrna levels. interactions of monocytes with graft endothelial cells, which is a prerequisite for intravascular accumulations, may induce tgm2 expression as described previously for monocytes adhering to endothelial cells in vitro. in addition, proinflammatory cytokines produced during acute rejection are known inducers of tgm2 expression [14, 15, 33, 34 ]. in graft tissue, which was investigated for comparison, mrna levels were elevated on both days 9 and 42. tgm2 protein was detected by immunoblotting but, in contrast to tgm2 mrna, no significant increase in protein signals was seen. however, some weak additional bands of lower molecular mass that were only detected in allograft perfusates and tissue would be compatible with an accelerated degradation of tgm2 in allografts. another explanation for the discrepancy between mrna and protein is based on reports in which tgm2 acts as a substrate of itself and forms insoluble cross - linked complexes, which are not detected in conventional immunoblots. for the detection of tgm2 covalently bound to extracellular matrix, unfixed cryostat sections should be stained in future studies. in line with this idea and with our mrna data, tissue sections of renal day the renal expression pattern of tgm2 was in line with other publications on rodent and human tgm2 expression. recently, shrestha. reported upregulation of tgm2 mrna, protein, and transglutaminase activity in cai kidneys. their model also is based on the f344 to lewis rat strain combination but, in contrast to our model, includes a 10-day course of suboptimal immunosuppression, which interferes with early acute rejection, followed by delayed contralateral nephrectomy. our study and the study by these authors complement each other, as they predominantly investigate end - stage cai, whereas we focus on the early phase posttransplantation. evidence increased mrna levels of tgm2 as well as increased tgm2 immunopositivity in allograft tissue sections compared to isografts. of note, these authors also demonstrate that, in addition to blood leukocytes investigated only in our study, renal tubules and glomeruli also overexpress tgm2 in allografts. during the pathogenesis of cai, urinary secretion of the transglutaminase cross - link product (-glutamyl)-lysine is increased. in end - stage cai, this product is detected more abundantly in allografts compared to isografts. from both studies, however, it is difficult to conclude if tgm2 is a marker of cai reflecting changes in the cellular composition of the graft or actively contributes to the pathogenesis of cai as shown for diverse models of experimental renal fibrosis [3740 ]. tgm2 was recently described to be a reliable marker of m2 macrophages, an anti - inflammatory subpopulation of differentiated macrophages. to the best of our knowledge, tgm2 expression by blood monocytes in vivo has not been described before, although, similarly to macrophages, blood monocytes can be activated and express cytokine patterns and cell surface molecules resembling proinflammatory m1 macrophages and anti - inflammatory m2 macrophages. we previously demonstrated that blood monocytes of f344 to lewis renal allografts are activated, acquire an intermediate state of differentiation, and express both cytokines, typical for m1 and for m2 macrophages, during acute rejection. we do not know, however, if this population is a mixture of m1- and m2-like monocytes or if individual monocytes are characterized by an intermediate phenotype. to further characterize these monocytes, we investigated expression of cd163, a typical m2 cell surface marker, which was not detected on graft monocytes during the peak of acute rejection. hence, we conclude that tgm2 can be expressed by activated monocytes but we can not decide if, similarly to macrophages, tgm2 expression is confined to m2-like monocytes. the functional relevance of tgm2 expression by m2 macrophages, however, is still elusive and similarly its role in monocytes is unclear. we described before that monocytes isolated from the blood vessels of renal allografts during fatal acute rejection undergo apoptosis when cultivated ex vivo. as tgm2 is more strongly expressed in apoptotic cells [11, 13, 44 ], we investigated if levels of activated caspase-3 correlate with expression of tgm2 in perfusate cells. indeed, a stronger induction of activated caspase-3 was seen in leukocytes isolated from day 9 allografts compared to respective isografts. this suggests that tgm2 expression by blood mononuclear cells might be linked to apoptosis. in line with the idea that tgm2 enhances apoptosis depending on a prolonged contact with endothelial cells in the inflamed allograft, activation of caspase-3 was more visible in veins compared to arteries. tgm2 plays a dual role in apoptosis : expression of tgm2 can induce apoptosis but it also stabilizes the cytoskeleton of dying cells, which prevents cell rupture and release of proinflammatory cytoplasmic components [13, 4446 ]. as a large number of monocytes accumulate in allograft vessels, their apoptosis might be a tremendous anti - inflammatory stimulus capable of reverting rejection. this issue certainly deserves further investigation. in the tissue of day 9 and day 42 allografts, immunohistochemistry, however, evidenced that tgm2 not only is present in the cytoplasm of graft blood monocytes but was also detected in the surrounding blood plasma. due to rejection - associated vascular damage and the high number of leukocytes accumulating in the blood vessels of allografts, we assume that blood flow slowed down considerably in allografts and that endothelial cells and underlying extracellular matrix are in intensive and prolonged contact with products secreted locally. in the context of hypertension, tgm2 and other active transglutaminases were shown to contribute to the pathogenesis of vascular remodeling [4750 ]. active transglutaminases were suggested to cross - link extracellular matrix proteins and to result in an increased rigidity of vascular walls, which precedes inward remodeling of arteries [4750 ]. in line with this idea, patients suffering from celiac disease, which typically form autoantibodies to tgm2, are less likely to have a diagnosis of hypertension. it is not known if tgm2 plays a similar role in the pathogenesis of cav. we performed animal experiments to investigate this hypothesis and chronically applied biologically meaningful concentrations of cystamine, an inhibitor of transglutaminase activity, for 4 weeks after transplantation. however, our hypothesis was not supported. within 84 days after surgery, allografts developed first hallmarks of cai, such as ifta, cav, and renal dysfunction, irrespective of cystamine treatment. we can, however, not exclude that extracellular transglutaminase activity is involved in both remodeling and re - remodeling of graft arteries as a protective effect of tgm2 was reported for experimental atherosclerosis [23, 53, 54 ]. the experimental rat model is characterized by a minor mismatch in the mhc class-1 locus and does not include immunosuppression, which is not typical for clinical transplantation. in spite of these disadvantages, it is a favorable, experimental model to investigate an acute rejection episode preceding cai. we investigate neither transglutaminase activity in the graft nor excretion of its products, and animal experiments were performed using a single dose of transglutaminase inhibitor, which was applied for just one month. we ignore if treatment with other concentrations of cystamine or later time - points would lead to allograft protection. to evaluate the effect of cystamine, we focus on renal function and graft remodeling within 84 days after transplantation. we do not know if, after longer periods of time, differences would have developed among the experimental groups. in addition, cystamine is a weak and rather unspecific inhibitor of tgm2 as it also inhibits other members of the transglutaminase family as well as certain proteases. more specific inhibitors for tgm2 are commercially available. finally, apart from its role in apoptosis, there is still a plethora of potential functions of tgm2 [11, 15 ], some of which are enumerated in the introduction, that are awaiting investigation in the context of acute and chronic allograft rejection. only a part of these functions are inhibited by exogenous cystamine. in conclusion, this is the first study to demonstrate expression of tgm2 by monocytes activated in vivo during a reversible acute rejection episode. potentially, the function of monocytic tgm2 is induction of apoptosis, which in turn might contribute to the reversion of acute rejection in this experimental model. our data do not support but also do not falsify the hypothesis that tgm2 expressed by graft monocytes during reversible acute rejection contributes to an early induction of cai. | acute rejection is a major risk factor for chronic allograft injury (cai). blood leukocytes interacting with allograft endothelial cells during acute rejection were suggested to contribute to the still enigmatic pathogenesis of cai. we hypothesize that tissue transglutaminase (tgm2), a multifunctional protein and established marker of m2 macrophages, is involved in acute and chronic graft rejection. we focus on leukocytes accumulating in blood vessels of rat renal allografts (fischer-344 to lewis), an established model for reversible acute rejection and cai. monocytes in graft blood vessels overexpress tgm2 when acute rejection peaks on day 9 after transplantation. concomitantly, caspase-3 is activated, suggesting that tgm2 expression is linked to apoptosis. after resolution of acute rejection on day 42, leukocytic tgm2 levels are lower and activated caspase-3 does not differ among isografts and allografts. cystamine was applied for 4 weeks after transplantation to inhibit extracellular transglutaminase activity, which did, however, not reduce cai in the long run. in conclusion, this is the first report on tgm2 expression by monocytes in vivo. tgm2 may be involved in leukocytic apoptosis and thus in reversion of acute rejection. however, our data do not support a role of extracellular transglutaminase activity as a factor triggering cai during self - limiting acute rejection. |
a 4-year - old female child presented with her third episode of fever, headache, and vomiting. her first such episode was at 3 years and 2 months of age for which she was treated elsewhere as pyogenic meningitis with antibiotics after a cerebrospinal fluid (csf) study which was culture negative. since she had recurrent meningitis, computed tomography (ct) of the head with contrast was done which was initially reported as her complement levels (c3 and c4) and immunoglobulin (including igg subclass) assays were normal and her retroviral status and vasculitis workup were negative. she was given pneumococcal vaccine and was discharged after which her third similar episode occurred. csf leak was thought of and ct myelocisternography was done which did not reveal any bony defect. reevaluation of the old ct showed a hypodense (2 - 20 hounsfield unit) cyst seen in front of the brain stem, with minimal flattening of the anterior surface of medulla which was initially missed [figure 1 ]. magnetic resonance imaging (mri) with spectroscopy confirmed the presence of an epidermoid cyst in the premedullary cistern [figure 2 ] with a prominent lipid peak. she underwent a near - total excision of the lesion and histopathology confirmed an epidermoid cyst. computed tomography shows a hypodense (2 - 20 hounsfield unit) cyst seen in front of the brain stem in the premedullary cistern lifting the basilar artery (arrow), with flattening of the anterior surface of medulla (arrow head) (a) a 30 23 39 mm well - defined t1 hypointense lesion (white arrow), with flattening of the anterior surface of medulla (arrow head). (b) its t2 hyperintense occupying the premedullary and prepontine cistern displacing medulla oblongata and inferior part of pons posteriorly. (c) flair images differentiate epidermoids from arachnoid cysts demonstrating lesion to be hyperintense to csf. (d) diffusion - weighted imaging show high signal intensity suggesting restricted diffusion with corresponding. recurrent meningitis is defined as two or more episodes of meningitis separated by a period of complete resolution of signs, symptoms, and laboratory findings. aseptic meningitis can be recurrent and is characterized by noninfective serous inflammation of the meninges. it presents as recurring bouts of fever, meningism, pleocytosis, and a failure to culture organisms from the csf. the reaction is sudden and striking but of short duration, and is often preceded and followed by symptom free intervals. epidermoid and dermoid cysts can cause recurrent, episodic aseptic meningitis by rupturing cyst contents into the subarachnoid space, which is thought to result in chemical irritation. epidermoid cysts originate from the inclusion of epidermal components within the neuraxis during the embryonic stage and can be located intracranially or intraspinally and present in the third or fourth decade of life. dermoids are midline often accompanied by persistent defects in the closure of the overlying bone and skin, while epidermoids are found more often in lateral positions, such as the cerebellopontine angles. the pathological reaction to the irritants ranges from mild leptomeningitis to widespread granulomatous meningitis, ependymitis, and posterior radiculitis. since chemical and bacterial meningitis may coexist, it is safer to start antibiotic therapy initially since the spinal fluid profiles in bacterial and chemical meningitis are similar. the exceptions are a csf white blood cell count > 7500/l and a glucose level of 39.4c bacterial meningitis in association with these tumors is most commonly related to a coexisting dermal sinus tract and the most common organism is staphylococcus aureus. the literature search identified 24 cases of recurrent meningitis associated with dermoid and epidermoid cysts. our case was unique because of its relatively early and rare presentation with aseptic meningitis and to highlight the fact that these lesions can be missed in cursory ct reading unless specifically looked for. identification of these lesions is important since patients can be spared expensive workup for recurrent meningitis and they can lead a symptom - free life once total excision is performed. | aseptic meningitis is characterized by noninfective serous inflammation of the meninges. it can occur in a recurrent fashion when associated with dermoid and epidermoid cysts due to rupture of cyst contents into subarachnoid space resulting in aseptic chemical meningitis. bacterial meningitis in association with these tumors is commonly related to a coexisting dermal sinus tract and the most common organism is staphylococcus aureus. |
thirty adults with parkinson 's disease and 30 neurologically healthy controls individually matched by chronological age (mean age : 52.03 years, sd = 9.7 ; range from 27 years to 70 years), gender (19 males and 11 females for both groups, and education (6.66% no diploma, 26.6% primary degree,39.9% secondary degree, and 26.66% undergraduate and higher) participated in this cross - sectional study. the pd patients were selected based on sample availability from neurology clinic of tehran university of medical sciences hospitals and were diagnosed by a neurologist. the severity of the disease for pd group was assessed with the unified parkinson 's disease rating scale (updrs), and ranged from mild to moderate. patients with dementia (scoring under the recommended cutoff point of 23 on the mmse)(14), patients who were illiterate, and those with other neurological disorders such as cva or history of epilepsy, psychiatric disorder (depression) based on medical files and neurologist assessment were excluded. in the current study, verbal fluency test included semantic fluency task and phonemic fluency tasks. onsemantic fluency tasks, participants were asked to name as many animals and fruits as possible. on phonemic tasks, subjects were allowed to generate as many words as possible that began with each of the letters / a/, /f /and /s/. both tasks were time limited to 60 s of word generation. responses were recorded on an audio tape for later analysis. repeated words or words with similar suffix were not counted. the total verbal fluency score was obtained by counting the total number of words. the independent t - test thirty adults with parkinson 's disease and 30 neurologically healthy controls individually matched by chronological age (mean age : 52.03 years, sd = 9.7 ; range from 27 years to 70 years), gender (19 males and 11 females for both groups, and education (6.66% no diploma, 26.6% primary degree,39.9% secondary degree, and 26.66% undergraduate and higher) participated in this cross - sectional study. the pd patients were selected based on sample availability from neurology clinic of tehran university of medical sciences hospitals and were diagnosed by a neurologist. the severity of the disease for pd group was assessed with the unified parkinson 's disease rating scale (updrs), and ranged from mild to moderate. patients with dementia (scoring under the recommended cutoff point of 23 on the mmse)(14), patients who were illiterate, and those with other neurological disorders such as cva or history of epilepsy, psychiatric disorder (depression) based on medical files and neurologist assessment were excluded. in the current study, verbal fluency test included semantic fluency task and phonemic fluency tasks. onsemantic fluency tasks, participants were asked to name as many animals and fruits as possible. on phonemic tasks, subjects were allowed to generate as many words as possible that began with each of the letters / a/, /f /and /s/. both tasks were time limited to 60 s of word generation. responses were recorded on an audio tape for later analysis. repeated words or words with similar suffix were not counted. for each task, the total numbers of correct words were determined. the total verbal fluency score was obtained by counting the total number of words. the independent t - test the means and standard deviations for letter fluency and semantic fluency were demonstrated in table 1. overall, participants in both groups generated more words in the semantic fluency task than in the phonemic fluency task. results indicated that normal subjects generated significantly more words in both tasks (semantic fluency task and letter - fluency task) than parkinson 's patients (p < 0.001). semantic, phonemic and verbal fluency performance in parkinson 's disease (pd) and normal control (nc) subjects a paired t test indicated significance difference between parkinson 's patients and normal subject in total number of words in verbal fluency task (p < 0.001).table 1. the main objective of this study was to investigate performance of non - demented pd patients on verbal fluency. our results showed that participants with parkinson 's disease have significant deficits on semantic and phonemic fluency measurement compared to the healthy group. these results are consistent with several previous studies indicating decline in verbal fluency tasks in parkinson 's patients. gurd (2000) reported parkinson 's patients have difficulty in semantic and phonemic fluency (10). however, auriacombe. (1993) found that pd patients did not differ from normal group in phonemic fluency (12). in contrast, ivory.(3) reported no significant difference between pd patients and normal subjects in verbal fluency. 1986) found that pd patients generated more words than control group on this task(12). the difference found in results of different studies may be due to the differences in the investigated languages, as the frequencies of words that start with a particular letter vary between languages. 1998) reported that spanish subjects produced fewer words than vietnamese participants, and this discrepancy might be due to differences in their languages because animal names in vietnamese are one - syllable words whereas most animal names in spanish are multisyllabic(15). the results of the present study that pd demonstrate deficit in verbal fluency could be viewed as consistent with language impairment in pd. crosson (1985) reported that basal ganglia damage could affect language formulation by their connections with the cortex(5). verbal fluency not only evaluates semantic and phoneme knowledge of lexical memory by searching specifics emanticor phonemes class, but subjects should also be able to track previous responses and prevent activation of other categories by executive skills. therefore, verbal fluency deficit in pd patients undoubtedly represents executive dysfunction. higginson (2003) reported that working memory and verbal fluency correlated with executive functions (16). (1992) have also suggested that poor performance in semantic fluency in these patients is associated with a specific deficit in semantic memory, whilst raskin. (2009) suggested that this problem is caused by a deficit in semantic retrieval and the ability to register, store intact(17, 18). (2012) reported that basal ganglia structures are associated with verbal fluency (19). however, a number of neuroimaging studies reported that left prefrontal cortex and subcortical regions correlate with verbal fluency (20, 21). on the other hand, there is much evidence of frontal dysfunction in parkinson patients (17). based on this reasoning, further studies are needed to investigate a possible relation between verbal fluency deficits with subcortical lesions in pd. in summary assessing language and executive function by verbal fluency test and early intervention may be effective. conclusion a high proportion of patients with mde also had a sub threshold hypomania or mania. findings suggest that bipolar features are more frequent than symptoms indicated by dsm - iv - tr, and exclusion criteria of mood disorders in this classification should be revised. dsm - iv classification appears to be too narrow or rigid to distinguish amore subtle and softer form of bipolar cases from pure unipolar cases. first, we did not assess the possible age - related changes in the cognitive and language abilities in our patients, although the previous research reported that aging does not affect the phonemic fluency. second limitation of the present study was that we were unable to match patients for duration and the time course of their disease, although we attempted to control the severity of parkinson in patients group according to unified parkinson 's disease rating scale. future efforts will be directed toward investigation of the time course of change in verbal fluency performance in pd. the present study revealsa significant deficit in non - demented pd that supports findings from previous studies. the deficit in verbal fluency in pd might be associated with cognitive impairment (executive and memory) and complex language disorders in pd. furthermore, a recent cross - sectional study on a small group of pd patients demonstrated that tests of memory, language processing and cognitive function are important in early stage in this group. neuropsychologists and speech language pathologists now routinely assess language and cognitive abilities of pd, and the data presented here illustrates the importance of developing neuropsychological instruments that are sensitive to cognitive deficit. finally, further research using functional brain imaging during verbal fluency tasks is necessary to evaluate the pathology underlying the verbal fluency deficit in pd. | objectivewhile parkinson 's disease (pd) has traditionally been defined by motor symptoms, many researches have indicated that mild cognitive impairment is common in non - demented pd patients. the purpose of this study was to compare verbal fluency performance in non - demented parkinson 's disease patients with healthy controls.methodin this cross - sectional study thirty non - demented parkinson 's disease patients and 30 healthy controls, matched by age, gender and education, were compared on verbal fluency performance. verbal fluency was studied with a phonemic fluency task using the letters f, a, and s, a semantic fluency task using the categories animals and fruits. the independent t - test was used for data analysis.resultsoverall, participants generated more words in the semantic fluency task than in the phonemic fluency task. results revealed significant differences between patients and controls in semantic fluency task (p<.05). in addition, pd patients showed a significant reduction of correctly generated words in letter fluency task. the total number of words produced was also significantly lower in the pd group (p<.05).conclusionverbal fluency disruption is implied in non - demented pd patients in association with incipient cognitive impairment. |
a retrospective cohort study was conducted using the electronic medical and pharmacy records from 1 january 2004 to 1 september 2010 in the veterans health administration (vha) veterans integrated service network 16 (visn 16) warehouse. data format and content were in compliance with the health insurance portability and accountability act requirements. approvals for this study protocol were obtained from the tulane and vha institutional review boards and the vha office of research and development. adult patients (age 18 years) with a diagnosis of type 2 diabetes (identified by icd-9-cm codes 250.xx, except for 250.x1 and 250.x3) in at least one inpatient record or in two outpatient records from 1 january 2004 to 1 september 2010 were included. a new antihyperglycemic medication, after a 6-month washout period, was defined as the index treatment, with its first dispense date defined as the index date. since at least a 1-year baseline (preindex) period and a 2-year follow - up (postindex) period were required for the analysis, the index treatments had to be initiated between 1 january 2005 and 1 september 2008. the hypoglycemia group was identified by a diagnosis of hypoglycemia (icd-9-cm codes 250.8, 251.0, 251.1, and 251.2) within the index treatment period, which was from the index date to the end of the last fill of the index treatment. other inclusion / exclusion criteria were as follows : patients with any diagnosis of cvd (icd-9-cm 410, 412, 430438, 428, 443.9, 785.4, and v43.4) and/or microvascular complications (icd-9-cm 250.4250.6) during the 1-year preindex period were excluded. finally, patients with the first recorded hypoglycemic episode beyond the index treatment period were excluded, as well as patients whose first recorded hypoglycemia occurred within the index treatment period but beyond 1 year after the index date. baseline sociodemographic characteristics, illness characteristics, the charlson comorbidity index (cci), tobacco use, vital signs, and hba1c levels were measured during a 1-year preindex period. clinical events over the whole follow - up period after the index date were studied, including cvd, microvascular complications, and all - cause death. cvd was defined as any of the following conditions diagnosed : myocardial infarction (icd-9-cm 410 and 412), stroke (icd-9-cm 430438), congestive heart failure (icd-9-cm 428), and peripheral vascular disease (icd-9-cm 441.x, 443.9, 785.4, and v43.4). microvascular complications were defined as diabetes with renal, ophthalmic, or neurologic manifestations (icd-9-cm 250.4250.6). propensity score matching using the greedy 5 to 1 method was applied to adjust for noncomparable baseline characteristics (heterogeneity of hypoglycemia and control groups) (19). through a logistic regression model on group membership, the best set of baseline variables predicting occurrence of hypoglycemia was used to produce the propensity score to construct a 1:1 matched sample. cox proportional hazards regression models were also used to compare time to clinical events, controlling for the covariates, including baseline demographic and illness characteristics, vital signs, prior medication use, and type of index drug. adult patients (age 18 years) with a diagnosis of type 2 diabetes (identified by icd-9-cm codes 250.xx, except for 250.x1 and 250.x3) in at least one inpatient record or in two outpatient records from 1 january 2004 to 1 september 2010 were included. a new antihyperglycemic medication, after a 6-month washout period, was defined as the index treatment, with its first dispense date defined as the index date. since at least a 1-year baseline (preindex) period and a 2-year follow - up (postindex) period were required for the analysis, the index treatments had to be initiated between 1 january 2005 and 1 september 2008. the hypoglycemia group was identified by a diagnosis of hypoglycemia (icd-9-cm codes 250.8, 251.0, 251.1, and 251.2) within the index treatment period, which was from the index date to the end of the last fill of the index treatment. other inclusion / exclusion criteria were as follows : patients with any diagnosis of cvd (icd-9-cm 410, 412, 430438, 428, 443.9, 785.4, and v43.4) and/or microvascular complications (icd-9-cm 250.4250.6) during the 1-year preindex period were excluded. finally, patients with the first recorded hypoglycemic episode beyond the index treatment period were excluded, as well as patients whose first recorded hypoglycemia occurred within the index treatment period but beyond 1 year after the index date. baseline sociodemographic characteristics, illness characteristics, the charlson comorbidity index (cci), tobacco use, vital signs, and hba1c levels were measured during a 1-year preindex period. clinical events over the whole follow - up period after the index date were studied, including cvd, microvascular complications, and all - cause death. cvd was defined as any of the following conditions diagnosed : myocardial infarction (icd-9-cm 410 and 412), stroke (icd-9-cm 430438), congestive heart failure (icd-9-cm 428), and peripheral vascular disease (icd-9-cm 441.x, 443.9, 785.4, and v43.4). microvascular complications were defined as diabetes with renal, ophthalmic, or neurologic manifestations (icd-9-cm 250.4250.6). propensity score matching using the greedy 5 to 1 method was applied to adjust for noncomparable baseline characteristics (heterogeneity of hypoglycemia and control groups) (19). through a logistic regression model on group membership, the best set of baseline variables predicting occurrence of hypoglycemia was used to produce the propensity score to construct a 1:1 matched sample. cox proportional hazards regression models were also used to compare time to clinical events, controlling for the covariates, including baseline demographic and illness characteristics, vital signs, prior medication use, and type of index drug. from the visn 16 data warehouse, 63,003 patients (96.5%) who had not experienced any hypoglycemia episode during the 2-year postindex period after the index date were identified as the control group and 2,187 patients (3.5%) who had experienced at least one hypoglycemic episode within the index treatment period were identified as the hypoglycemia group. patients (n = 20,929) who had preindex records of hypoglycemia, cvd, or microvascular complications were excluded. the analytical population consisted of 44,261 patients, including 761 patients in the hypoglycemia group and 43,500 in the control group. the matched study sample of 1,522 patients consisted of 761 patients in the hypoglycemia group and 761 patients in the control group. mean time from the index date to the occurrence of the first hypoglycemic episode was 143 days, and the median time was 123 days. before matching, more patients had poor glycemic control in the hypoglycemia group (91.4%) compared with the patients in the control group (87.8%) (p = 0.0043). the hypoglycemia group was generally sicker than the control group in terms of higher cci (2.44 1.37 vs. 2.18 1.24), higher percentages of patients with renal disease (6.2 vs. 2.5%), and higher percentages of mental disorder (25.4 vs. 17.9%), substance abuse (23.7 vs. 16.2%), and tobacco use (18.7 vs. 13.6%). a significantly higher percentage of african americans (25.8 vs. 19.6%) was found in the hypoglycemia group compared with the control group. there were fewer patients in the hypoglycemia group who had been married (52.8 vs. 62.3%, p < 0.0001). the proportion of patients who were on antihyperglycemic agents during the 1-year preindex period was significantly higher in the hypoglycemia group (62.5%) than in the control group (35.6%), with more patients on insulin at baseline in the hypoglycemia group (8.9%) than in the control group (2.9%). the mean (sd) age was 62.58 (10.99) years and the cci was 2.44 (1.37) in the matched sample. the baseline hba1c was 10.69% (2.61%) in the total sample, 10.70% (2.57%) in the hypoglycemia group, and 10.68% (2.66%) in the control group. in the total matched sample, 61.6% of patients had been taking oral antihyperglycemic agents and 9.6% had been taking insulin before the index date. in the total sample, 66.5% had used antihypertensive medications, including -blockers (27.5%), before the index date. use of statins did not statistically differ across groups (53.9 in the control group vs. 57.2% in the hypoglycemia group, p = 0.1972). baseline characteristics of the population by group the type of index drug used was also similar between groups after matching. overall, 31.3% of patients were initiated with biguanides on the index date, 32.3% with sulfonylureas, 11.6% with thiazolidinediones, and 21.7% with insulin. the corresponding percentages were 31.0 vs. 31.7%, 31.4 vs. 33.2%, and 22.1 vs. 21.3% between the hypoglycemia and control groups, respectively. there was no significant difference in treatment between patients with one episode and those with more than one episode. the cumulative incidence rate of cvd events was 30.65/100 patients during 3 years in the hypoglycemia group compared with 17.48/100 patients in the control group. patients in the hypoglycemia group were more likely to develop cvd than those in the control group (p < 0.0001). the other kaplan - meier survival analyses on subcategories of cvd events found that patients in the hypoglycemia group were at higher risks of having stroke, congestive heart failure, and peripheral vascular disease (all p < 0.05). the cumulative incidence rates during 3 years were 12.99 vs. 6.28, 9.99 vs. 6.15, and 13.42 vs. 5.12 per 100 patients for stroke, congestive heart failure, and peripheral vascular disease, respectively. however, the risk of myocardial infarction was not significantly different between the hypoglycemia and control groups (log - rank test p = 0.4612 ; cumulative incidence rate = 4.47 vs. 4.52 per 100 patients during 3 years). a : cumulative incidence rate of cvd events by group. log - rank test showed significance (both p < 0.0001) in risks of cvd events and microvascular complications between groups. (a high - quality color representation of this figure is available in the online issue.) in a similar manner, patients in the hypoglycemia group were more likely to develop microvascular complications (p < 0.0001) (fig. the cumulative incidence rate of microvascular complications was 34.46/100 patients during 3 years in the hypoglycemia group and 22.03 in the control group. furthermore, the cumulative incidence rate of any cvd events and microvascular complications was 50.38 during 3 years in the hypoglycemia group, which was significantly higher than the control group (cumulative incidence rate = 36.12/100 patients in 3 years). the mortality rates were not significantly different between these two groups (p = 0.1593 ; cumulative incidence rate = 9.37 vs. 7.22 per 100 patients in 3 years). controlling for confounding variables, patients in the hypoglycemia group had higher risk of cvd events than patients in the control group (hazard ratio [hr ] 2.00 [95% ci 1.632.44 ]). increased risks of subcategories of cvd events, except myocardial infarction, also were found among the hypoglycemia group, with the hrs varying from 1.81 to 2.58 (table 2). specifically, patients in the hypoglycemia group were 2.58 times more likely to have peripheral vascular disease (2.58 [1.813.67 ]) and 2.25 times more likely to have a stroke (2.25 [1.623.13 ]) than patients in the control group. the risk of congestive heart failure was 81% higher for the hypoglycemia group than the control group (1.81 [1.272.56 ]). compared with the control group, an increased risk of microvascular complications was shown in the hypoglycemia group (1.76 [1.462.11 ]). patients in the hypoglycemia group were 1.73 times as likely to have a vascular event (any cvd and microvascular complication) as those in the control group (1.73 [1.492.02 ]). it is notable that no significant effect of group membership on all - cause mortality was shown (1.29 [0.941.77 ]). cox proportional hazards regression models for vascular events and mortality : hypoglycemia group vs. control group furthermore, compared with patients with only one episode of hypoglycemia, those who experienced more than one episode were more likely to have vascular events. the adjusted hrs for vascular events in general were 1.53 (95% ci 1.101.66) ; for microvascular complications, 1.58 (1.242.02) ; and for peripheral vascular disease, 1.72 (1.162.56). hba1c levels during the 1-year postindex period remained similar in both the control group and the hypoglycemia group, at 10.35% (sd 2.79%) and 10.17% (2.66%), respectively. postindex hba1c levels decreased from baseline in both groups (by 0.42% in the total sample, with a decrease of 0.51 and 0.32% in the hypoglycemia and control groups, respectively). in this study, we found that patients who experienced hypoglycemia during the index treatment period after the administration of a new antihyperglycemic drug were at approximately twofold risk to have cvd compared with patients in the control group. a post hoc study using the advance data examined the association between severe hypoglycemia and the risks of macro- and microvascular events and death and found adjusted hrs of 3.45 (95% ci 2.345.08) for macrovascular events, 2.07 (1.323.26) for microvascular events, and 3.30 (2.314.72) for all - cause death (17). these findings are consistent with what was observed in our study, except that we did not find a significant increased risk of all - cause mortality. the post hoc analysis of the advance study also found higher risks of nonvascular events associated with hypoglycemia. furthermore, no dose - response relationship was found between repeated episodes of hypoglycemia and vascular events or death. therefore, the advance investigators concluded that hypoglycemia was likely to be a marker of vulnerability to these clinical events but argued that a direct causal relationship was still possible (17,18). although the causal relationship between hypoglycemia and cvd events can not be established from our study, future large prospective trials and mechanistic studies are needed to confirm the causal link between hypoglycemia and these vascular events. hypoglycemia induces several counterregulatory responses, including indirect changes such as inflammation, increased platelet and neutrophil activation, and epinephrine secretion (18). more important, it is also possible that the first hypoglycemic episode leads to further episodes that are asymptomatic (20) and associated with cardiovascular ischemic and proarrhythmic changes (21,22). moreover, hypoglycemia may not only precipitate ischemia but also induce changes in autonomic function that can lead to silent ischemia and arrhythmias (18). this may explain the observed difference in heart failure but not myocardial infarction between the groups in our study. in addition, myocardial infarction is a single event that is likely to be multifactorial, whereas heart failure is the end stage of multiple processes, some of which may be triggered by hypoglycemia. microvascular disease, on the other hand, has been shown to behave differently and may worsen in the short - term after improvement in glycemic control but improve in the long run (23,24). patients with long - standing poor antecedent control, as in our study, may be particularly susceptible. it is difficult to determine what role hypoglycemia plays in exacerbating these mechanisms. in the bonds. (16) analysis on accord data, more deaths among the patients who had experienced hypoglycemia were observed (hr 1.41 within the intensive glucose control arm and 2.30 within the standard glucose control arm), whereas in our study, a significantly different all - cause mortality rate was not found in the hypoglycemia group after controlling for the covariates. the lack of statistical significance may relate to the lack of a sufficient power of the sample. the numerical difference observed in this study can be interpreted into the number needed to harm for one additional death, which was estimated to be 108 patients. it is notable that some differences exist between the study populations of the clinical trials (advance and accord) and our retrospective study, in addition to the differences in study design. of import, our study population was required to have no record of cvd and microvascular disease during the 1-year preindex period. both trials targeted lower hba1c levels, while in our study, the hba1c levels were much higher at either baseline or after the index date. in this study, indeed, it is likely that poor glycemic control was the reason why patients were started on a new antihyperglycemic medication. the degree of improvement is compatible with the degree of effectiveness reported in clinical antihyperglycemic interventions. while there was a larger decrease in 1-year hba1c levels from baseline in the hypoglycemia group, the difference from the control group was not statistically significant. although a correlation between aggressive glycemic control (i.e., lower hba1c levels to 6.06.5% for type 2 diabetic patients) and higher risk of hypoglycemia has been found, hba1c itself may not be a good indicator of optimal glycemic management. in a post hoc epidemiological analysis of the accord study, a greater risk of hypoglycemia indeed, tight glycemic control may not be the best predictor of severe hypoglycemia, with several other factors, such as glucose variability, being more important (28,29). moreover, responses to intensive treatment targeting euglycemia may vary across patients with the underlying illness. two studies find increased risks of cvd and mortality among patients with either low or high hba1c (30,31). in our study, the mean hba1c was 10%, suggesting a group of patients with poor antecedent control. comparison of vascular outcomes among higher hba1c and lower hba1c groups is warranted for future studies. the results of this study should be interpreted in light of the limitations of the study design and the vha population. first, it is a retrospective study using existing vha electronic medical records data where clinical information is still limited. we can access only the information on medical records that have been processed through the vha. therefore, we could capture only severe episodes of hypoglycemia that were reported and recorded by the physicians or had required medical assistance from a clinical facility. moreover, the propensity score approach can match patients from the two groups on observed variables only. important factors related to hypoglycemia and health outcomes may be unobserved, unavailable, or inadequately captured in the data and, therefore, are not subject to control in the analysis. for example, duration of diabetes, duration and dose of insulin use, and timely self - monitored glucose levels were not available in the data warehouse. second, vha patients (predominantly male and elderly) are not representative of the u.s. population, nor does the vha system operate like other health care delivery systems. from this retrospective cohort study with an average follow - up period of 4 years, we identified a high - risk group of veterans with type 2 diabetes who developed hypoglycemia after the initiation of a new antihyperglycemic medication and were found to be at higher risks of cvd events and microvascular complications. physicians and patients in clinical practices should work together to prevent hypoglycemia after new medication initiation. identification of patients who develop hypoglycemia in such a clinical situation may help us develop strategies to prevent cvd events in such patients. in this study, we found that patients who experienced hypoglycemia during the index treatment period after the administration of a new antihyperglycemic drug were at approximately twofold risk to have cvd compared with patients in the control group. a post hoc study using the advance data examined the association between severe hypoglycemia and the risks of macro- and microvascular events and death and found adjusted hrs of 3.45 (95% ci 2.345.08) for macrovascular events, 2.07 (1.323.26) for microvascular events, and 3.30 (2.314.72) for all - cause death (17). these findings are consistent with what was observed in our study, except that we did not find a significant increased risk of all - cause mortality. the post hoc analysis of the advance study also found higher risks of nonvascular events associated with hypoglycemia. furthermore, no dose - response relationship was found between repeated episodes of hypoglycemia and vascular events or death. therefore, the advance investigators concluded that hypoglycemia was likely to be a marker of vulnerability to these clinical events but argued that a direct causal relationship was still possible (17,18). although the causal relationship between hypoglycemia and cvd events can not be established from our study, future large prospective trials and mechanistic studies are needed to confirm the causal link between hypoglycemia and these vascular events. hypoglycemia induces several counterregulatory responses, including indirect changes such as inflammation, increased platelet and neutrophil activation, and epinephrine secretion (18). more important, it is also possible that the first hypoglycemic episode leads to further episodes that are asymptomatic (20) and associated with cardiovascular ischemic and proarrhythmic changes (21,22). moreover, hypoglycemia may not only precipitate ischemia but also induce changes in autonomic function that can lead to silent ischemia and arrhythmias (18). this may explain the observed difference in heart failure but not myocardial infarction between the groups in our study. in addition, myocardial infarction is a single event that is likely to be multifactorial, whereas heart failure is the end stage of multiple processes, some of which may be triggered by hypoglycemia. microvascular disease, on the other hand, has been shown to behave differently and may worsen in the short - term after improvement in glycemic control but improve in the long run (23,24). patients with long - standing poor antecedent control, as in our study, may be particularly susceptible. it is difficult to determine what role hypoglycemia plays in exacerbating these mechanisms. in the bonds. (16) analysis on accord data, more deaths among the patients who had experienced hypoglycemia were observed (hr 1.41 within the intensive glucose control arm and 2.30 within the standard glucose control arm), whereas in our study, a significantly different all - cause mortality rate was not found in the hypoglycemia group after controlling for the covariates. the lack of statistical significance may relate to the lack of a sufficient power of the sample. the numerical difference observed in this study can be interpreted into the number needed to harm for one additional death, which was estimated to be 108 patients. it is notable that some differences exist between the study populations of the clinical trials (advance and accord) and our retrospective study, in addition to the differences in study design. of import, our study population was required to have no record of cvd and microvascular disease during the 1-year preindex period. both trials targeted lower hba1c levels, while in our study, the hba1c levels were much higher at either baseline or after the index date. indeed, it is likely that poor glycemic control was the reason why patients were started on a new antihyperglycemic medication. the degree of improvement is compatible with the degree of effectiveness reported in clinical antihyperglycemic interventions. while there was a larger decrease in 1-year hba1c levels from baseline in the hypoglycemia group, the difference from the control group was not statistically significant. although a correlation between aggressive glycemic control (i.e., lower hba1c levels to 6.06.5% for type 2 diabetic patients) and higher risk of hypoglycemia has been found, hba1c itself may not be a good indicator of optimal glycemic management. in a post hoc epidemiological analysis of the accord study, a greater risk of hypoglycemia indeed, tight glycemic control may not be the best predictor of severe hypoglycemia, with several other factors, such as glucose variability, being more important (28,29). moreover, responses to intensive treatment targeting euglycemia may vary across patients with the underlying illness. two studies find increased risks of cvd and mortality among patients with either low or high hba1c (30,31). in our study, the mean hba1c was 10%, suggesting a group of patients with poor antecedent control. comparison of vascular outcomes among higher hba1c and lower hba1c groups is warranted for future studies. the results of this study should be interpreted in light of the limitations of the study design and the vha population. first, it is a retrospective study using existing vha electronic medical records data where clinical information is still limited. we can access only the information on medical records that have been processed through the vha. therefore, we could capture only severe episodes of hypoglycemia that were reported and recorded by the physicians or had required medical assistance from a clinical facility. moreover, the propensity score approach can match patients from the two groups on observed variables only. important factors related to hypoglycemia and health outcomes may be unobserved, unavailable, or inadequately captured in the data and, therefore, are not subject to control in the analysis. for example, duration of diabetes, duration and dose of insulin use, and timely self - monitored glucose levels were not available in the data warehouse. other limitations of this study include a lack of formal diagnostic testing for hypoglycemia. second, vha patients (predominantly male and elderly) are not representative of the u.s. population, nor does the vha system operate like other health care delivery systems. from this retrospective cohort study with an average follow - up period of 4 years, we identified a high - risk group of veterans with type 2 diabetes who developed hypoglycemia after the initiation of a new antihyperglycemic medication and were found to be at higher risks of cvd events and microvascular complications. physicians and patients in clinical practices should work together to prevent hypoglycemia after new medication initiation. identification of patients who develop hypoglycemia in such a clinical situation may help us develop strategies to prevent cvd events in such patients. | objectivehypoglycemia is associated with failure to show cardiovascular benefit and increased mortality of intensive glycemic control in randomized clinical trials. this retrospective cohort study aimed to examine the impact of hypoglycemia on vascular events in clinical practice.research design and methodspatients with type 2 diabetes were identified by icd-9-cm codes (250.xx except for 250.x1 and 250.x3) between 1 january 2004 and 1 september 2010 from the veterans integrated service network 16. index date was defined as the first date of new antihyperglycemic medications (index treatment). patients with 1-year preindex records of hypoglycemia, cardiovascular, and microvascular diseases were excluded. the hypoglycemia group was identified by icd-9-cm codes (250.8, 251.0, 251.1, and 251.2) within the index treatment period. a propensity score matched group was used as control subjects. cardiovascular events, microvascular complications, and all - cause death were compared using kaplan - meier analysis and cox proportional hazards regression model.resultsamong the unmatched sample (n = 44,261), the hypoglycemia incidence rate was 3.57/100 patient - years. the matched sample (hypoglycemia group : n = 761 ; control group : n = 761) had a median follow - up of 3.93 years, mean age of 62.6 11.0 years, and preindex hba1c of 10.69 2.61%. the 1-year change in hba1c was similar (hypoglycemia group 0.51 vs. control group 0.32%, p = 0.7244). the hypoglycemia group had significantly higher risks of cardiovascular events (hazard ratio 2.00 [95% ci 1.632.44 ]) and microvascular complications (1.76 [1.462.11 ]) but no statistical mortality difference. patients with at least two hypoglycemic episodes were at higher risks of vascular events than those with one episode (1.53 [1.101.66]).conclusionshypoglycemia is associated with higher risks of incident vascular events. patients with hypoglycemia should be monitored closely for vascular events. |
this study is part of the ongoing finnish diabetic nephropathy (finndiane) study, with the aim to identify genetic, clinical, and environmental risk factors for diabetic nephropathy in patients with t1d. the study was initiated in 1997, and follow - up data have been collected since 2004 either by re - examination of the patients or review of the medical files. detailed description of the follow - up protocol has been described previously (11). t1d was defined as an onset of diabetes before the age of 40 years and permanent insulin treatment initiated within 1 year of diagnosis. for this study, outcomes were ascertained in patients in the finndiane prospective cohort recruited between 1997 and 2004, in whom serum opg was estimated on baseline samples (n = 1,939). furthermore, patients with end - stage renal disease (esrd ; dialysis or transplantation) at baseline were excluded from analysis, as risk factors for adverse outcomes are clearly different in these patients. written informed consent was obtained from each patient, and the study was performed in accordance with the declaration of helsinki as revised in the year 2000. at baseline, all patients also underwent a thorough clinical investigation in connection with a regular patient visit to their attending physician. data on medication and diabetes complications were registered with the use of a standardized questionnaire, which was completed by the physician based upon medical files. blood pressure was measured twice in the sitting position after a 10-min rest, and the average of these two measurements was used in the analysis. height, weight, and waist - to - hip ratio were recorded, and blood was drawn for the measurements of hba1c, lipids, and creatinine. hba1c and creatinine were determined by standardized assays at each center and glomerular filtration rate (gfr) estimated using the chronic kidney disease epidemiology collaboration formula (12,13). serum lipid and lipoprotein concentrations were analyzed centrally by automated enzymatic methods (hoffmann - la roche, basel, switzerland). urinary albumin was determined in one sample using an immunoturbidimetric method (hitachi 911 analyzer ; roche diagnostics, basel, switzerland). in addition, serum opg was measured by a sandwich time - resolved immunofluorometric assay using commercially available antibodies (r&d systems, minneapolis, mn), as previously described (14). renal status was defined based on the urinary albumin excretion rate (aer) in three overnight or 24-h urine collections. normal aer was defined as 140/90 mmhg). at baseline, 17% had a urinary aer in the microalbuminuric range, 13% had a urinary aer in the macroalbuminuric range, and 65% had a urinary aer in the normoalbuminuric range. a further 5% of study participants were unclassified because of an inadequate number of urine collections, and 12% of patients had an estimated gfr (egfr) 140/90 mmhg). at baseline, 17% had a urinary aer in the microalbuminuric range, 13% had a urinary aer in the macroalbuminuric range, and 65% had a urinary aer in the normoalbuminuric range. a further 5% of study participants were unclassified because of an inadequate number of urine collections, and 12% of patients had an estimated gfr (egfr) < 60 ml / min/1.73 m, most of whom also had macroalbuminuria. serum opg concentrations did not differ between patients with t1d and normoalbuminuria or microalbuminuria (table 1). however, patients with macroalbuminuria had higher opg concentrations than those with microalbuminuria or normal aer. patients with moderate to severe renal impairment (egfr < 60 ml / min/1.73 m) also had higher opg concentrations that those without renal impairment (1.9 0.1 vs. 1.4 0.1 g / ml ; p < 0.05). in addition, after adjusting for renal function, opg remained independently correlated with high - sensitivity c - reactive protein, a marker of systemic inflammation (p < 0.01), and hba1c, a marker of chronic glycemic control (p < 0.05 ; data not shown). notably age, sex, body mass, blood pressure, and lipid concentrations were not associated with opg after adjusting for renal function. patients with established cvd had higher opg concentrations than those without macrovascular disease (2.0 0.1 vs. 1.7 0.1 mg / l ; p < 0.001). however, the observed difference in serum opg in patients with t1d with or without cvd was attributable to an excess of patients with ckd and eliminated after adjusting for renal function. furthermore, patients with retinopathy requiring laser treatment had higher opg concentrations than those without severe retinal disease (1.9 0.1 vs. 1.6 0.1 mg / l ; p < 0.001). a total of 166 patients (9%, 0.8 per hundred person - years) died during follow - up (mean of 10.2 years). serum opg concentrations at baseline were higher in patients who died due to an all - cause mortality (2.0 0.1 vs. 1.6 0.1 mg / l ; p = 0.006). however, after adjusting for factors associated with serum opg concentrations, as well as other factors independently associated with all - cause mortality, opg was no longer associated with all - cause mortality on multivariate cox regression analysis (p not significant ; table 2). cox regression analysis for the predictive value of serum opg for all - cause mortality, after adjusting for factors associated with serum opg concentrations, as well as other factors independently associated with the studied event during the follow - up period (mean of 10.5 years), 190 patients experienced their first cv event ever (of 1,844 patients without prior cvd ; 1.0 per hundred patient - years). again, serum opg concentrations at baseline were higher in patients who had an incident cvd event (2.2 0.1 vs. 1.6 0.1 mg / l ; p < 0.001). after adjusting for factors associated with serum opg concentrations, as well as other factors independently associated with cvd, opg remained significantly associated with incident cvd on multivariate cox regression analysis (p = 0.03 ; table 3, fig. cox regression analysis for the predictive value of serum opg for incident cvd, after adjusting for factors associated with serum opg concentrations, as well as other factors independently associated with the studied event the relationship of serum opg concentrations (above and below the mean) with new - onset cvd (a) and amputation / leg revascularization (b), stratified according to the stage of albuminuria, and adjusted for other risk factors., patients with microalbuminuria and opg concentrations below median ; +, patients with microalbuminuria and opg concentrations above median ; m, patients with macroalbuminuria and opg concentrations below median ; m+, patients with macroalbuminuria and opg concentrations above median ; n, patients with normal aer and opg concentrations below median ; n+, patients with normal aer and opg concentrations above median. during the follow - up period (mean of 10.5 years), 152 patients experienced their first coronary event (of 1,868 patients without prior coronary heart disease [chd ] ; 0.8 per hundred patient - years). furthermore, serum opg concentrations at baseline were increased in patients who had an incident cvd event (2.2 0.1 vs. 1.3 0.1 mg / l ; p = 0.002). after adjusting for factors associated with serum opg concentrations, as well as other factors independently associated with chd, the association of opg with incident chd was of borderline significance on multivariate cox regression analysis (p = 0.07 ; table 4). cox regression analysis for the predictive value of serum opg for incident chd, after adjusting for factors associated with serum opg concentrations, as well as other factors independently associated with the studied event during a mean of 10.3 years of follow - up, 71 patients experienced their first stroke event (of 1,903 patients without a prior stroke ; 0.3 per hundred patient - years). again, serum opg concentrations at baseline were higher in patients who had an incident stroke (2.2 0.1 vs. 1.6 0.1 mg / l ; p = 0.02). after adjusting for factors associated with serum opg concentrations, as well as other factors independently associated with stroke, opg was not associated with stroke on multivariate cox regression analysis (p = 0.7 ; table 5). cox regression analysis for the predictive value of serum opg for incident stroke, after adjusting for factors associated with serum opg concentrations, as well as other factors independently associated with the studied event during a mean of 10.2 years of follow - up, 80 patients had a leg revascularization procedure or an amputation (any cause) as their first cv event (of 1,922 patients without prior cvd ; 0.4% per hundred patient - years). serum opg concentrations at baseline were higher in patients who had an incident leg revascularization procedure or amputation (2.0 0.1 vs. 1.6 0.1 mg / l ; p < 0.001). after adjusting for factors associated with serum opg concentrations, as well as other factors independently associated with pvd events, opg was independently associated with leg revascularization procedure or an amputation on multivariate cox regression analysis (p = 0.004 ; table 6, fig. cox regression analysis for the predictive value of serum opg for incident amputation or peripheral revascularization, after adjusting for factors associated with serum opg concentrations, as well as other factors independently associated with the studied event opg concentrations are positively correlated with coronary calcification (6), vascular stiffness (7), and the presence of unstable plaque (8) as well as all - cause and cv mortality in elderly women (22), as well as men with coronary artery disease (23). previous studies have suggested that opg concentrations are also associated with cv mortality in patients with diabetes (9,10,24). the current study extends these findings to show that opg predicted not only incident cvd and pvd events but was also associated with the risk of all - cause mortality in patients with t1d. although it has been suggested in small studies that children with t1d have increased opg concentrations compared with nondiabetic individuals (25), in our large adult cohort, opg concentrations were not directly elevated by t1d. elevation of the opg concentration was only observed in those with overt nephropathy or established macrovascular disease. the mechanisms by which opg concentrations are increased in these settings are unclear (26). the retention of peptides like opg and cystatin c associated with renal impairment provides part of the answer. in our study, opg levels were certainly higher in patients with moderate to severe renal impairment (egfr < 60 ml / min/1.73 m). however, after adjusting for renal function and albuminuria, opg levels remained a significant predictor of adverse outcomes. indeed, some of the risk attributable to renal disease may be medicated through accelerated vascular calcification. this may be one reason why egfr was eliminated as an independent predictor of adverse outcomes in this cohort. the independent association of opg with high - sensitivity c - reactive protein, a marker of systemic inflammation (p < 0.01), may also have contributed to elevated opg levels in patients with overt complications, as inflammation is also elevated in patients with complications and inflammation may also drive the expression of opg. it acts as a receptor for the receptor activator of nuclear factor-b ligand (rankl) and interferes in its binding to cell - surface rank (27). opg has been shown to block the differentiation of osteoclasts, the bone - resorbing cell type. opg also has an important regulatory role in endocrine function and the immune system (4). opg is present in blood vessels (4,28) and especially in the smooth muscle cells of the vascular media (29,30), which are thought to be the major source of opg in the arterial wall. consequently, the elevation of circulating opg concentrations in proatherogenic settings has been thought to represent a compensatory phenomenon to limit further vascular damage. however, by inhibiting the regulatory pathways signaled through the rank receptor, and particularly those of the atheroprotective ligand tumor necrosis factor-related apoptosis - inducing ligand (trail) (33), elevated opg concentrations may also have direct actions on vascular function, as well as the development and progression of vascular disease. indeed, it has been previously shown that human full - length opg induces the proliferation of rodent vascular smooth muscle cells and augments atherogenesis in diabetic apolipoprotein e knockout mice (34). in addition, it has been demonstrated that opg is able to initiate transforming growth factor-dependent changes in vascular smooth muscle cells, stimulating proliferation, inflammation, and fibrogenesis. such data suggest that the increases in adverse vascular outcomes associated with elevated opg concentration in our patients with t1d may be causally linked. vascular calcification is strongly associated with pvd in patients with diabetes, including the risk for amputation. vascular calcification score on plain radiographs of the feet is a predictor of peripheral arterial disease in patients with ckd. however, our study is the first to show an independent link between opg and peripheral vascular events (amputation or revascularization). although amputation may have multiple etiologies, we chose to use this more pragmatic outcome as it is often difficult to determine the relative contribution of infection, neuropathy, or vascular insufficiency as the cause of a foot ulcer or subsequent need for amputation. while opg was higher in those participants with severe retinal disease in our much larger patient cohort, after adjusting for the confounding effects of renal impairment, this difference was eliminated. similarly, no association between opg and diabetic retinopathy was reported in a cohort of 200 patients with t1d (35). by contrast, opg has previously been associated with maculopathy in patients with type 2 diabetes (t2d) (24). the reasons for this difference between t1d and t2d is unclear, although it may be due to confounding effects of renal impairment in older patients with t2d. in conclusion, we demonstrate that serum opg is independently associated with cv complications and mortality in adults with t1d. blocking the actions of opg consequently may therefore offer one potential intervention to slow the development and progression of vascular disease in diabetes. indeed, complete blockade of opg in mice causes early onset osteoporosis and arterial calcification (32). this suggests that a better target for the prevention of vascular disease may be to augment its ligands, trail and rankl. for example, studies using trail in apolipoprotein e knockout mice with t1d have shown promising reductions in atherogenesis (33), possibly by overcoming the inhibitory effects of its decoy - receptor opg. | objectiveosteoprotegerin (opg) is involved in the process of vascular calcification. we investigated whether opg is associated with the development and progression of diabetes complications in adults with type 1 diabetes (t1d).research design and methodsserum opg was measured in 1,939 adults with t1d participating in the finnish diabetic nephropathy (finndiane) study. patients with end - stage renal disease (dialysis or transplantation) at baseline were excluded from analysis. data on cardiovascular (cv) events and mortality during follow - up were verified from hospital discharge registries (icd codes) and the finnish national death registry, respectively. the follow - up time was 10.4 2.0 (mean sd) years.resultsonly patients with macroalbuminuria and/or renal impairment had elevated opg concentrations, when compared with participants without overt kidney disease. patients with retinopathy or cv disease also had higher opg concentrations, but this was attributable to their higher frequency of chronic kidney disease. opg predicted an incident cv event (hazard ratio 1.21 [95% ci 1.011.45 ] ; p = 0.035) and peripheral vascular disease / amputation events (1.46 [1.131.88 ] ; p = 0.004) during follow-up.conclusionswe showed that serum opg is an independent predictor of cv complications. opg may be directly involved in extraosseous calcification, resulting in stiffening of the arteries and subsequent vascular insufficiency in patients with t1d. |
central serous chorioretinopathy (csc) is characterized by an idiopathic serous detachment of the neurosensory retina at the macula resulting from deficient pumping and altered barrier function at the level of the retinal pigment epithelium (rpe). it is characterized by multifocal, irregularly distributed and often widespread rpe changes associated with varying degrees of low - grade leakage. chronic csc may be associated with persistent subretinal exudation, extensive rpe atrophy, cystoid macular degeneration, and choroidal neovascularization. these factors lead to a less favorable visual prognosis [3, 4 ]. vascular endothelial growth factor (vegf) anti - vegfs, through their antipermeability characteristics and hence leakage reduction, may be useful in the treatment of cases with refractory csc and may be helpful as an alternative management. early studies indicated that intravitreal injections of bevacizumab (avastin) appeared to be safe and effective for the management of chronic csc. however, clinical and experimental investigations have reported possible circulatory changes as a complication of intravitreal bevacizumab, consisting of significant depletion of choriocapillaries in primate eyes, progression of capillary nonperfused areas in rabbit eyes, and multiple retinal hemorrhages in eyes with diabetic retinopathy [6, 7 ]. here, we report a case of hemorrhagic macular infarction after intravitreal bevacizumab for chronic multifocal csc. a 56-year - old male presented with complaints of gradual loss of vision and distortion in the right eye which had started 2 years before. his best - corrected visual acuity (bcva) in the right eye was 20/40 on snellen 's chart and intraocular pressure was 10 mm hg. anterior segment findings on slit - lamp examination showed immature cataract in both eyes, the rest was within normal limits. dilated fundus examination (fig. 1) of the right eye showed presence of retinal pigmentary changes and absence of foveal reflex. oct showed a shallow rpe elevation, with reflectivity under the rpe layer suggestive of nonserous pigment epithelial detachment (ped), along with minimal subretinal fluid. 1) of the right eye revealed a 2.5-mm disc diameter of mottled hyperfluorescence increasing in size and intensity in the macular area diagnostic of chronic multifocal csc and the left eye showed mottled hyperfluorescence that was not increasing in size or intensity. after obtaining signed informed consent, the patient received an intravitreal injection of 0.05 ml bevacizumab under all aseptic precautions, and prophylactic antibiotic eye drops were given for 7 days subsequently. one - day and one - week follow - up visits showed stable fundus with a right - eye bcva of 20/40 on snellen 's chart. one month after the injection, the patient presented with a sudden diminution of vision in the right eye starting 1 week before. the bcva in the right eye was counting fingers at 1 m and intraocular pressure in the right eye was 10 mm hg. 2), there were multiple hemorrhages, ped and extensive hard exudates at the macula, inferior to the arcade as well as nasal to the disc. 2) showed an increase in the sensory detachment with fluid accumulation in the sensory retina and a small ped. small areas of blocked fluorescence were also noted, which was suggestive of hemorrhagic macular infarction. the reported case shows the clinical and angiographic findings of hemorrhagic macular infarction after intravitreal bevacizumab for chronic multifocal csc. bevacizumab is not currently approved by the fda for intravitreal injection ; however, several reports state that off - label intravitreal bevacizumab for chronic csc results in an overall improvement in visual acuity and macular anatomy and appears to be safe and effective in the short term. in recent years, choroidal hyperpermeability has been assumed to be the cause of csc based upon indocyanine green angiography and has been considered a basis of photodynamic treatment. an intraocular injection of anti - vegf bevacizumab may improve the symptoms of csc by blocking the activity of vegf. to date, however, no studies have demonstrated a correlation between hyperpermeability of the choroidal vessel and vegf.. showed that in cases with chronic csc, intravitreal bevacizumab injection improved bcva and reduced central macular thickness and recurrence did not occur in any case during the follow - up period. there are also case reports discussing hemorrhagic macular infarction after intravitreal bevacizumab for macular edema in vascular occlusions and age - related macular degeneration [8, 9, 10 ]. in all these cases, patients had one or more significant medical history (i.e. hypertension, diabetes, ihd, etc.) and they were on a number of medicines (i.e. aspirin, anticoagulants, other antiplatelet and antithrombotic agents, etc.), which, along with avastin, could increase the possibility of drug - induced hemorrhagic infarct. the peculiarity of our case is that our patient had had no significant ocular or medical history until the time he visited us for the first time. clinical trials for bevacizumab in the treatment of metastatic colon cancer demonstrated increased risk of arterial thromboembolic events, hypertension, proteinuria and congestive heart failure. even the fda has reported severe adverse events with avastin such as serious or fatal hemoptysis in patients with adenocarcinoma (4% incidence rate) and gastrointestinal perforation in patients with colorectal cancer (2% incidence rate). however, there is no substantial data on the safe use of intravitreal bevacizumab and it remains off - label for ocular use. to conclude, we have hereby reported a case of hemorrhagic macular infarction after intravitreal bevacizumab for chronic multifocal csc, which has not been reported before to the best of our knowledge. we urge clinicians to carefully evaluate their patients before giving bevacizumab for ocular indications, and we hope that the medical community will take time to report such events if they come across them in practice. we might find a warning sign, and we may prevent any unintended harm to our patients. | we hereby report a case of hemorrhagic macular infarction after intravitreal bevacizumab for chronic multifocal central serous chorioretinopathy (csc). issues regarding safety and adverse effects of bevacizumab are discussed. to the best of our knowledge, this is the first reported case of hemorrhagic macular infarction after intravitreal bevacizumab for chronic multifocal csc. |
the detection of early gastric cancer (egc) has been aided by increased upper endoscopy screening and the development of endoscopic technology. the mortality from gastric cancer has therefore decreased due to early detection, that is, increased diagnosis in the early stages. gastrectomy with lymph node dissection is a standard treatment for egc, and the presence of lymph node metastasis is an important prognostic factor for patient outcomes. currently, endoscopic mucosal resection (emr) or endoscopic submucosal dissection (esd) is performed for endoscopic resection of egc without evidence of lymph node metastasis. the expanded criteria provided by gotoda have been applied to endoscopic treatment of early gastric cancer. if the tumor is confined to the mucosa, lacks ulcers, and has differentiated histology, the success of endoscopic resection is independent of tumor size. this type of gastric cancer was first mentioned in 1949 by golden and stout, who described it as a superficial spreading carcinoma characterized by wide and superficial extension with a limited depth of vertical invasion. since then, this type of gastric cancer has been reported in many studies. recently although surgical resection is considered the standard treatment for superficial spreading egc, endoscopic treatment has been attempted for egc of any size that meets the criteria outlined by gotoda in limited conditions. however, few studies have investigated the safety of endoscopic treatment of superficial spreading egc with respect to the risk of lymph node metastasis. in this study, we aimed to investigate the rate of lymph node metastasis of superficial spreading egc to identify endoscopic and pathologic features of patients without lymph node metastasis in order to help develop criteria for the safe endoscopic resection for this type of cancer using surgical specimens. all patients who received radical gastrectomy in severance hospital, yonsei university college of medicine (seoul, korea), were enrolled in this study. the operation method for inclusion was radical subtotal gastrectomy or total gastrectomy with d2 lymph node dissection. generally, special immunohistochemical staining was not performed to discover submucosal invasion or lymphovascular invasion. the pathology reports of tumor diameter, histology, depth of invasion, lymphovascular invasion, and lymph node metastasis were reviewed. according to the criteria of the japanese gastric cancer association, patients with 4 types of pathology were included : well - differentiated adenocarcinoma, moderately differentiated adenocarcinoma, poorly differentiated carcinoma, and signet ring cell carcinoma. the exclusion criteria were a history of previous gastrectomy or endoscopic treatment and r1 and r2 resections. this study was approved by the institutional review board for human research of yonsei university college of medicine. superficial spreading egc was defined as egc with a tumor > 60 mm in diameter, in accordance with established japanese cancer criteria (figure 1). the diameter was measured from the resected specimen after operation and the longest diameter of the tumor was used. the differentiated and undifferentiated types were defined according to the criteria outlined by the japanese gastric cancer association. the differentiated type included well differentiated and moderately differentiated adenocarcinomas, whereas the undifferentiated type included poorly differentiated and signet ring cell carcinomas. on the greater curvature of the mid - body, large spreading nodular lesions were found after indigocarmine dye spray. categorical variables were compared using the chi - square test and continuous variables in 2 groups were compared using student 's t - test. results are expressed as odds ratios (or) and 95% confidence intervals (ci). all patients who received radical gastrectomy in severance hospital, yonsei university college of medicine (seoul, korea), were enrolled in this study. the operation method for inclusion was radical subtotal gastrectomy or total gastrectomy with d2 lymph node dissection. generally, special immunohistochemical staining was not performed to discover submucosal invasion or lymphovascular invasion. the pathology reports of tumor diameter, histology, depth of invasion, lymphovascular invasion, and lymph node metastasis were reviewed. according to the criteria of the japanese gastric cancer association, patients with 4 types of pathology were included : well - differentiated adenocarcinoma, moderately differentiated adenocarcinoma, poorly differentiated carcinoma, and signet ring cell carcinoma. the exclusion criteria were a history of previous gastrectomy or endoscopic treatment and r1 and r2 resections. this study was approved by the institutional review board for human research of yonsei university college of medicine. superficial spreading egc was defined as egc with a tumor > 60 mm in diameter, in accordance with established japanese cancer criteria (figure 1). the diameter was measured from the resected specimen after operation and the longest diameter of the tumor was used. the differentiated and undifferentiated types were defined according to the criteria outlined by the japanese gastric cancer association. the differentiated type included well differentiated and moderately differentiated adenocarcinomas, whereas the undifferentiated type included poorly differentiated and signet ring cell carcinomas. categorical variables were compared using the chi - square test and continuous variables in 2 groups were compared using student 's t - test. logistic regression analysis was used to evaluate the risk of lymph node metastasis. results are expressed as odds ratios (or) and 95% confidence intervals (ci). a total of 3989 patients with egc underwent gastrectomy with lymph node dissection between march 2000 and february 2010. of these, 176 were excluded due to previous treatment (n = 129) and unclassified pathology (n = 47). of the remaining 3813 patients, 140 (3.67%, 76 men and 64 women) were classified as superficial spreading egc (figure 2). the rate of superficial spreading egc was significantly higher than that of common egc (60 mm and with limited invasion depth are generally defined as superficial spreading type in japan and korea. although superficial spreading is typical of this type of egc, the pathophysiology of this feature has not been elucidated. similarly, the mechanism by which the invasion depth is limited has not been identified. the rate of superficial spreading egc is low, 6.5% to 11.0% of all egc cases, whereas the incidence of lymph node metastasis in superficial spreading egc ranges from 18% to 30%. in our study, superficial spreading egc accounted for 3.7% of all egc cases, with a lymph node metastasis rate of 15.7%. the overall prognoses of the superficial spreading and common types of egc appear to be similar. kim reported that the superficial spreading and common types of egc did not exhibit significant differences in their overall 5-year and 10-year survival rates. although lymph node metastasis was more prevalent in the superficial spreading egc group compared with the common egc group, the incidence was within the range reported in previous studies. a few studies have reported that superficial spreading egc (but not common egc) is significantly associated with lymph node metastasis ; however, these studies did not adjust for confounding variables. although the tumor behavior of superficial spreading egc is not well established, some studies have indicated that these tumors may display milder biological behavior than common egc. for example, reduced expression levels of epidermal growth factor and transforming growth factor - were observed in superficial spreading egc compared with common egc ; moreover, apoptosis was higher in superficial spreading egc than in common egc. this evidence might explain the lack of association between superficial spreading egc and lymph node metastasis. however, further studies of tumor behavior and investigations on the molecular level are needed to fully test this hypothesis. in this study, we sought to investigate the characteristics of patients with superficial spreading egc and no lymph node metastasis. in these patients, endoscopic treatment could be applied carefully. as subtotal gastrectomy and total gastrectomy with d2 lymph node dissection are relatively invasive procedures, the risk of adverse postoperative events is a serious concern. moreover, the quality of life (qol) is typically affected during the first 3 months after curative surgery, with 20% to 35% of all patients continuing to suffer from functional or symptomatic problems. the qol after endoscopic treatment is superior to that after surgery, because recovery is relatively fast and the preserved stomach functions properly. due to these advantages, however, kim reported that careful consideration is needed before endoscopic resection is applied to superficial spreading egc, due to the higher risk of submucosal invasion and lymph node metastasis. our study is consistent with the study by kim in that submucosal invasion and lymph node metastasis were more prevalent in superficial spreading egc than in common egc. we sought to identify the circumstances in which lymph node metastasis is absent, as these conditions are ideal for esd. to this end, we compared the clinicopathological findings of patients with intramucosal superficial spreading egc, intramucosal egc < 6 cm, and intramucosal egc < 2 cm without ulceration. although undifferentiated histology was more common in intramucosal superficial spreading egc without ulceration, lymph node metastasis was not significantly different between intramucosal superficial spreading egc and intramucosal common egc without ulceration. subgroup analysis of intramucosal superficial spreading egc identified 4 patients with lymph node metastasis and undifferentiated pathology. therefore, we suggest that esd is a potential alternative method for treating differentiated intramucosal superficial spreading egc without ulceration. the major strength of our study was the large number of patients with superficial spreading egc, which allowed for robust analysis, in contrast to previous studies. moreover, this may be the first study to investigate the conditions under which esd is considered to be a safe treatment modality. second, all subjects were enrolled at a single tertiary institution, which may have introduced a selection bias. for example, our rates of undifferentiated type egc were high, as compared with kim 's study (47.8% vs 38%). this might have been caused by endoscopic treatment in cases of small and differentiated egc in practice. in addition, d2 lymph node dissection was considered a standard procedure for lymph node dissection during the enrollment period for patients. was not associated with an increased risk of lymph node metastasis. in cases of mucosal cancer with differentiated pathology and no ulceration, superficial spreading egc these findings suggest that esd is a suitable option for a limited number of patients with superficial spreading egc. further large - scale prospective studies should be performed to definitively establish the safety and feasibility of esd in superficial spreading egc. | abstractsuperficial spreading early gastric cancer (egc) is a rare disease that is treated mainly by surgery. there are few studies on the safety of endoscopic treatment for patients with superficial spreading egc. the aims of this study were to (1) investigate the risk of lymph node metastasis of superficial spreading egc and (2) investigate the potential criteria for endoscopic treatment of superficial spreading egc using surgical specimens.between 2000 and 2010, patients who received curative surgery of r0 resection at severance hospital (seoul, korea) for early gastric cancer were enrolled. the superficial spreading egc was defined as cancer in which the longest tumor length was 6 cm. the medical records of the patients were reviewed retrospectively.of the 3813 patients with egc, 140 (3.7%) had lesions 6 cm, whereas 3673 (96.3%) had lesions < 6 cm. patients with superficial spreading egc had higher rates of submucosal cancer (59.3% vs 45.7%, p = 0.002), lymphovascular invasion (18.6% vs 9.8%, p < 0.001), and lymph node metastasis (15.7% vs 10.1%, p = 0.033) compared with patients with common egc (< 6 cm). multivariate analysis revealed that a tumor 6 cm was not strongly associated with lymph node metastasis in egc, as compared with a tumor < 6 cm, but submucosal invasion and lymphovascular invasion were strongly associated with lymph node metastasis in egc. in mucosal cancer without ulcers, tumors 6 cm had a higher rate of lymph node metastasis than tumors 2 cm ; however, this trend was not significant (7.7% vs 5.3%, p = 0.455).superficial spreading egc was not associated with an increased risk of lymph node metastasis compared with common egc. we suggest that differentiated intramucosal superficial spreading egc without ulceration can be treated by endoscopic submucosal dissection. |
throughout their tropical and subtropical range of distribution, primates occupy a wide variety of different habitats (fleagle 1999). few primate species seem to be confined to a single habitat type, e.g., theropithecus gelada to montane grasslands (kawai 1979). some others may require the presence of a specific habitat type in at least part of their home range, e.g., bamboo forest in callimico goeldii (porter and garber 2004). however, supposed habitat specialization may actually be the result of limited knowledge of a species that can be specified once additional information becomes available (defler 1994), and may also be the result of incorrect inference and ignorance of relevant literature. uakaris (cacajao), and particularly the peruvian red uakari (cacajao calvus ucayalii, previously included within cacajao calvus rubicundus : hershkovitz 1987), represent an example of the latter case. in a survey in the rio tapiche area in eastern peru, fontaine (1978, 1990) encountered cacajao calvus ucayalii on 3 occasions : 1) in swamp forest or aguajal (swamps dominated by the aguaje palm mauritia flexuosa) ; 2) on a restinga (strip of high - ground forest within a low - ground matrix) from where the uakaris fled into an aguajal ; and 3) on the edge of an aguajal. this perception of cacajao calvus ucayalii and of uakaris in general dominates in the primatological literature, despite accumulating evidence to the contrary. in many primatological textbooks and overview articles, uakaris in general the fact that the first detailed field study on any uakari species reported the closely related white uakari (cacajao calvus calvus) to be confined to vrzea (forest seasonally flooded by white - water rivers ; ayres 1986, 1989 ; cf. peres 1997) may have contributed to cementing this incorrect perception of red uakaris as a flooded - forest specialist. published evidence for the occurrence of cacajao calvus ucayalii in nonflooded forests seems to be largely ignored. to correct this bias, we reviewed the available information, both published and unpublished, about habitats where cacajao calvus calvus has been observed. we hope that this review will correct the perception of this taxon as a flooded - forest specialist. such a correction is necessary both for scientific reasons, e.g., for the interpretation of its morphological and behavioral adaptations, and for the sake of appropriate considerations on the conservation of peruvian red uakaris. table iexamples for statements on cacajao calvus ucayalii (or cacajao in general) as flooded - forest specialistsstatementsourcespecialized to flooded whitewater and blackwater forestsrobinson.1987, p. 47uakaris appear to be restricted to the amazonian inundation forest.preston-mafham and preston - mafham 1999, p. 60they red uakari occurs nearly always in blackwater flooded forest, while the white subspecies prefers whitewater flooded forest.janson 2001, p. 325found in the flooded forests of the white - water rivers of the upper amazondunbar and barrett 2000, p. 164uakaris... [uakaris... are specialized to live in seasonally flooded forests.]geissmann 2003, p. 162white and red uakaris (cacajao calvus) being associated with white - water forests (vrzeas)ferrari 2004, p. 109they inhabit flooded forests.nystrom and ashmore 2008, p. 57 examples for statements on cacajao calvus ucayalii (or cacajao in general) as flooded - forest specialists we studied the available literature and unpublished reports, and compiled personal observations or personal communications on the habitat of cacajao calvus ucayalii. for each area, we extracted information on the habitats where cacajao calvus ucayalii had been observed and categorized these as 1) terra firme forest, 2) flooded forest, and 3) aguajales. we also compiled the available data on population densities and encounter rates to determine whether habitat influences these variables. the majority of sites where cacajao calvus ucayalii has been recorded represent terra firme forest (table ii). this holds true even if 1) quebrada blanco and the estacin biolgica quebrada blanco, which are located on opposite banks of the same river only about 2 km apart, and the nearby sites at quebradas cuchara, palmichal, tahuaillo, tangarana, and tuncho ; and 2) agua negra and lago preto on the ro yavar are considered as nonindependent counts, perhaps harboring the same populations of cacajao calvus ucayalii. table iilocalities and habitats in peruvian amazonia where cacajao calvus ucayalii has been recordedlocality coordinateshabitataltitude [m a.s.l.]population density or encounter ratesourcero tapicheaguajaln.a.n.a.fontaine 1978, 1990ro tapiche 539s 7400wterra firme, flooded forest, aguajal1101) 0.47 grp / km, 7.4 ind / kmbennett. 20012) 0.78 grp / km, 25.8 ind / kmalto tapicheflooded forestn.a.0.23 grp / kmaquino 1988, 1990jenaro herreraterra firmen.a.0.07 grp / kmaquino 1978, 1988, 1990quebrada blancoterra firme, aguajal120n.a.ramirez 1989 ; bodmer and fang 1987estacin biolgica quebrada blanco (ebqb), 421s 7309wterra firme120n.a.bartecki and heymann 1987 ; siegel 1987 ; heymann 1989, 1990 ; castro coronado 1991 ; heymann. unpubl. dataheadwaters of quebrada blancoterra firmen.a.n.a.bodmer and fang 1987quebrada cuchara 424s 7310wterra firme, aguajaln.a.n.a.leonard and bennett 1995, 1996 ; aquino 1998quebrada tunchoterra firme, aguajaln.a.n.a.aquino 1998quebrada palmichalterra firme, aguajaln.a.n.a.aquino 1998quebrada tangarana 424s 7317wterra firmen.a.n.a.ward and chism 2003quebrada tahuaillo 433s 7319waguajaln.a.n.a.ward and chism 2003ro tahuayo area n.a.0.4 grp / kmbodmer. 1988 ; puertas and bodmer 19932.5 ind / kmro orosaterra firmen.a.0.4 grp / kmaquino 1988, 1990sierras de contamanaterra firme, aguajal>6006.1 grp/100 km, 479 ind/100 kmaquino. carolina 430s 7143wterra firme, flooded forest, aguajaln.a.n.a.aquino 1997, 1998 ; aquino and encarnacin 1999lago preto (agua negra), ro yavar 428s 7146wterra firme, flooded forest, aguajal90n.a.puertas and bodmer 1993 ; bowler 2007 ; bowler and bodmer 2009upper ro yavarterra 2009population density is given as per survey area (individuals : ind / km, groups : grp / km), encounter rates as per transect length (individuals : ind/100 km, groups : grp/100 km)n.a. : no data availablethese sources quote the site as ro blanco or blanco stream ; to avoid confusion with the proper ro blanco, a major affluent of the ro tapiche, the river was renamed quebrada blancothese sources also quote ro blanco, but actually refer to the estacin biolgica quebrada blanco ; see previous footnotethe habitats where cacajao calvus calvus were sighted are not mentioned by the authors, but the census area includes terra firme forest and aguajales, but not flooded forest localities and habitats in peruvian amazonia where cacajao calvus ucayalii has been recorded population density is given as per survey area (individuals : ind / km, groups : grp / km), encounter rates as per transect length (individuals : ind/100 km, groups : grp/100 km) n.a. : no data available these sources quote the site as ro blanco or blanco stream ; to avoid confusion with the proper ro blanco, a major affluent of the ro tapiche, the river was renamed quebrada blanco these sources also quote ro blanco, but actually refer to the estacin biolgica quebrada blanco ; see previous footnote the habitats where cacajao calvus calvus were sighted are not mentioned by the authors, but the census area includes terra firme forest and aguajales, but not flooded forest the highest encounter rates for cacajao calvus ucayalii stem from the sierras de contamana (table ii), a site that is not only a terra firme forest, but also has a much higher altitude (600700 m a.s.l.) than any of the other sites. we here provide clear evidence that cacajao calvus ucayalii occurs not only in flooded forests, but also in terra firme forests and in areas with a mixture of forest types. the terra firme forests (or bosques de altura in the terminology of encarnacin 1985) include a variety of vegetation types like high terrace forest (bosque de terraza), low hill forest (bosque de colina baja), high hill forest (bosque de colina alta), premontane forest, and aguajales de altura (see also malleux 1982, for terminology of peruvian forests) that are all nonflooded. therefore, one can not consider cacajao calvus ucayalii as a flooded - forest specialist, as is commonly reported in the literature. the highest encounter rate and thus probably the highest population density is found at a relatively high altitude (sierras de contamana), untypical for the major part of the amazon lowlands, suggesting that this habitat might be favorable to cacajao calvus ucayalii. however, because the sierras de contamana is an area with very little human disturbance (aquino. 2005), we can not distinguish whether this factor or favorable habitat accounts for the high encounter rate. cacajao calvus ucayalii have large daily ranging distances (> 6 km : bowler 2007 ; 7.3 km : leonard and bennett 1996) and they may migrate seasonally between different habitats, including flooded forests (bowler 2007). in the quebrada blanco area, 810 km away along the ro tahuayo and the lower parts of quebrada blanco. given the daily ranging distances quoted above, this forest is in the reach of cacajao calvus ucayalii. nevertheless, neither researchers and their field assistants nor local settlers have ever seen these animals in flooded forest along the ro tahuayo and lower quebrada blanco in the last 25 yr. aguajales, swamps dominated by aguaje palms (mauritia flexuosa), occur both in forests subject to inundation and in areas of terra firme (where they are called aguajales de altura ; encarnacin 1985). though mauritia flexuosa may represent an important food resource for cacajao calvus ucayalii in some areas (aquino and encarnacin 1999 ; bowler 2007), it is probably not essential for the existence of these uakaris, as indicated by their rarity in the sierras de contamana (aquino. 2005). altogether, we can reasonably conclude that cacajao calvus ucayalii is not a habitat specialist restricted to flooded forests. together with the report by peres (1997) of cacajao calvus calvus at a terra firme site, this indicates that habitat requirements and utilization in bald - headed uakaris are much more variable than previously appreciated. incorrect perceptions of or misconceptions on aspects of the biology of a primate taxon may have several implications. first, they may lead to erroneous interpretations of the behavioural, ecological, morphological, and physiological adaptations and the evolution of these adaptations. second, they may lead to bad conservation strategies, particularly when habitat preferences are concerned. though the first implication is mainly academic, the second one is of strong practical relevance. in a world, where primate habitats are constantly shrinking and an increasing number of primate taxa is getting closer to extinction, accurate knowledge of habitat requirements are amongst the most basic information needed for conservation efforts. | in the literature, particularly in primatological books, the peruvian red uakari (cacajao calvus ucayalii) is generally considered as a species that is specialized on living in flooded forest, despite existing evidence to the contrary. here we review all available information on habitats where cacajao calvus ucayalii have been observed. most sightings are from terra firme, including palm swamps, or from mixed habitats, including terra firme and flooded forest. therefore, we conclude that the species is not a flooded - forest specialist, but is flexible in its habitat requirements and generally uses terra firme forests or a mixture of habitats. proper recognition of habitat requirements is important for understanding the ecoethological adaptations of a species and for appropriate conservation measures. |
infectious diseases, especially blood - borne diseases, are major public health problems. the patients undergoing orthopedic surgery, specially orthopedic trauma procedures, as well as patients under other extensive surgeries, might have the chance of transmission of infections such as hepatitis b (hbv), hepatitis c (hcv), and human immunodeficiency viruses (hiv) to others and also reverse transmission of infections from others to them due to repeated injections, drain secretions, and blood transfusion (1). different studies have been performed to determine the prevalence of such diseases among thalassemia patients (1), pregnant women (2), blood donors (3), prisoners (4), hemodialysis patients (5), and subjects under surgery and invasive heart procedures (6). the transmission chance is reciprocal ; the virus - contaminated tools may transmit the disease to other patients and also health staff through needle stick injuries. use of harder instruments such as pins by orthopedic surgeons would increase the chance of transmission. however, the amount of imposed risk is different in various settings ; necessitating different studies in various regions. this would be relevant for decision - making about routine use of preoperative viral assessments in each hospital and each geographic region. regarding different transmission routes for hiv, hbv, and hcv, different studies have performed to determine the prevalence of these infections in different settings to predict the transmission risk. hence, this study was performed to determine the prevalence of these infections among patients who underwent orthopedic surgeries in a general training hospital in our country. in this descriptive cross - sectional study the prevalence of hbv, hcv, and hiv infections was determined among patients who underwent orthopedic trauma surgeries and the association of these rates with age, gender, marital status, residence location, substance abuse history, hospital admission history, previous surgery, blood transmission, dentistry procedures, and previous medical history was assessed. inclusion criterion was history orthopedics surgery and exclusion criteria were immunodeficiency and lack of possibility for monitoring the infections. totally, 320 patients undergone orthopedic surgeries in a general training hospital in tehran, iran since 2009 to 2011 were selected in a simple random manner. helsinki declaration was respected all over the study and it was approved by local ethical board committee. demographic data are demonstrated in table 1. mainly the patients were in age range from twenty - five to fifty years. totally 10 patients (3.2%), 2 subjects (0.6%), and 8 patients (2.5%) who underwent orthopedic trauma surgeries, had hcv, hiv, and hbv infections, respectively. there was no significant association between hbv, hcv, and hiv infection with other variables including age, gender, marital status, residence location, substance abuse history, hospital admission history, previous surgery, blood transmission, dentistry procedures, and previous medical history (tables 2, 3 and 4). however hiv - positive patients had no history of substance abuse, those with hbv and hcv infection had more positive history of addiction. ns : not significant (p > 0.05) ns : not significant (p > 0.05) ns : not significant (p > 0.05) addiction and substance abuse are also common transmission route for hiv, but the hiv - positive patients in this study had no addiction history. moreover, there was no significant assomoreover, there was no significant association between hospital admission history, dentistry procedures, and blood transmission in current study, in this cross - sectional study, higher rates of hiv, hbv, and hcv infections among patients demonstrate the necessity of routine viral studies before surgical procedures. mainly the patients were in age range from 25 to 50 years that is in congruence with the age range of subjects with hiv in iran ranging from 15 to 44 years. previous positive surgical history has also been mentioned as a risk factor for hiv and hcv infections in similar studies (7, 8) that was also approved in current study. also positive history of previous medical diseases in most patients with hepatitis was previously seen in other studies. in a study conducted in pakistan (7), it was seen that more than ten percent had hcv infection and nearly two percent had hbv infection and the authors concluded that preoperative evaluations should be performed as a routine manner. however current study would demonstrate this matter ; the prevalence rate of hcv infection was lower than that study. the report by american college of surgeons has shown multiple transmissions of hepatitis to patients and health care providers (8). previous studies in iran have higher infection rate among thalassemia patients (1) and similar rates among general population (9, 10). also in cardiac surgery cases in iran it was reported that less than two percent were positive for hbv and hcv infections and no case of hiv was seen (6) that shows the higher importance of preoperative assessments in orthopedics procedures (11, 12). a study by weiss demonstrated that hiv (26%), hepatitis b (4%), hepatitis c (35%), and co - infection with hiv and hepatitis c (17%) are common among hospital - admitted subjects in training setting (13). gaczak evaluated 100 orthopedics patients and reported that prevalence of anti - hcv and anti - hiv was 0% (95% ci 0 - 3.7%) ; as for hbv, one was hbsag positive (14). another study by gaczak showed that 4% (95% ci : 1.6 - 9.8%) were positive either with hbv or hcv : two were hbsag positive, two were anti - hcv positive (2% ; 95% ci : 0.6 - 7%) ; there were no hiv positive cases among their patients (15). although current data indicate that the risk of transmitting a blood borne pathogen in a health care setting is low, some risk is unavoidable. the danger can be greatly reduced by following the accepted recommendations of the cdc, phs, and other agencies. orthopedic surgeons should be familiar with these established guidelines (17). among the limitations in this study, we may mention the low available sample population that would result in less probability of generalization of acquired results. accordingly, further similar studies should be carried out with larger sample size. finally according to obtained results in this study it may be concluded that routine performance of diagnostic tests for infectious disease such as hiv and viral hepatitis is necessary and should be considered before operation (16). since standard testing strategies rely on enzyme immune - assays (eia), which require a critical and costly amount of infrastructure and human resources, its routine use would be impractical and costly.therefore, the implementation of a viable screening strategy to identify co - infected patients is crucial as an effective intervention. several point of care products for the detection of hbsagare currently available although their take - up has been limited so far. the practical evaluation of these rdt devices in hiv - positive patients can be a key in order to study the utility of including them in diagnostic routines (17). finally, according to the obtained results in this study, routine use of diagnostic tests for infectious disease such as hiv and viral hepatitis is recommended and should be considered before orthopedic trauma operations. | background : infectious diseases are major public health problems, among which blood - borne ones are the most important infections. patients who undergo orthopedic surgery are at higher risk of transmitting infectious diseases from and to others, due to repeated blood examinations and injection, drains secretion and receiving blood products. accordingly, in this study we determined prevalence of hepatitis b virus (hbv) hepatitis c virus (hcv) and human immunodeficiency virus (hiv) infections in patients who underwent surgery in a general training hospital. methods : in this cross - sectional study the prevalence of hbv, hcv, and hiv infections was determined among 320 patients under orthopedic trauma surgeries in a general training hospital in tehran, iran from 2009 to 2011. associations of these rates with age, gender, marital status, residence location, substance abuse history, hospital admission history, previous surgery, blood transfusion, dentistry procedures, and previous medical history were also assessed. results : a total of 320 patients (290 male, 30 female) were studied. ten patients (3.2%) had at least one of these three infections. totally 10 patients (3.2%), 2 subjects (0.6%), and 8 patients (2.5%) had hcv, hiv, and hbv infections, respectively. none of the evaluated variables had significant relationship with hcv, hbv, and hiv infections (p > 0.05). conclusion : according to the obtained results, routine use of diagnostic tests for infectious disease such as hiv and viral hepatitis is recommended and should be considered before orthopedic operations. |
gold(i) complexes are very active and selective catalysts for the addition of nucleophiles on 1,n - enynes. the most emblematic transformation in this area is the addition of alcohols and water on 1,6-enynes 1 (alkoxy- or hydroxycyclization), which occurs stereospecifically to form adducts 3 in the presence of gold(i) catalysts under much milder conditions than with other electrophilic metal catalysts (scheme 1). according to dft calculations, this reaction proceeds through intermediates 2, whose structures are intermediate between cyclopropyl gold(i) carbenes and gold(i)-stabilized homoallyl carbocations. it is interesting to note that the hydroxycyclization is usually much faster than the direct nucleophilic addition of water on the terminal alkyne to form the corresponding methyl ketone. enantioselective hydroxy- and alkoxycyclizations of 1,6-enynes have been achieved with moderate to good enantioselectivities with a variety of chiral phosphines or nhc - gold catalysts. the intermolecular reaction of 1,6-enynes with carbamates roconh2 (r = et, bn) and anilines also takes place using ph3paucl and agsbf6 (5 mol %). however, in the latter case, only less basic anilines bearing strongly electron - withdrawing groups (p - no2, o - cn, o - cf3, p - cl) were used as the nucleophiles. we decided to study the scope and limitations of the intermolecular amination of 1,6-enynes with a broader range of anilines using gold(i) complexes with johnphos and related bulky biphenyl - based phosphines (buchwald ligands), which are often the catalysts of choice in gold(i)-catalyzed reactions. the aminocyclization of enynes was initially studied with dimethyl 2-trans - cinnamyl-2-(prop-2-yn-1-yl)malonate (1a) as the substrate and a slight excess of the aniline using 25 mol % of the gold catalyst in ch2cl2 (table 1). the best result for the addition of aniline gold(i) catalyst a, leading to adduct 4a in excellent yield (table 1, entry 1). increasing the catalyst loading to 5 mol % was required for the addition of p - anisidine to form 4b in 58% yield after a 19 h reaction time (table 1, entry 2). this result with an electron - rich aniline is remarkable since this reaction had only been reported with deactivated amines. lower yields were obtained with gold(i) complexes with other phosphine, nhc, or phosphite ligands (table 1, entries 37). tetrahydrofuran was also evaluated as solvent in the reaction with aniline ; however, the yield was significantly reduced. it is important to note that the reaction of anilines and aliphatic amines with complex a forms complexes [(johnphos)au(nh2r)]sbf6 by ligand substitution, which have been characterized by x - ray diffraction and show diminished catalytic activity in the reaction of cyclopropenes with p - anisidine. however, in our system, these less active amino complexes presumably formed in situ under the amination reaction still undergo ligand exchange with the enynes at a sufficient rate so as to generate the catalytically active (-alkyne)gold(i) species. the substrate generality under these reaction conditions was tested with different enynes and a wide range of anilines (table 2). in general, moderate to excellent yields were obtained for the different combinations of 1,6-enynes and anilines examined (4298%). concerning the anilines, electron - rich as well as electron - poor anilines participated efficiently in this reaction without significant differences in the isolated yields. anilines substituted at the ortho - position also gave rise to the corresponding adducts 4c, 4e, 4h, 4o, 4w, and 4y in satisfactory yields. secondary anilines, such as n - methylaniline, n - allylaniline, indoline, or tetrahydroquinoline also reacted to give the corresponding adducts in moderate to good yields (4l, 4 t, 4ad ag). different substitution patterns on the enyne were also used, and all led efficiently to the desired product. the presence of a dimethyl or phenyl substituent on the alkene did not give significantly different results in terms of reactivity. the relative configuration of the aminocyclization products was assigned by determining the structures of compounds 4d, 4i, and 4x by x - ray crystallography analysis, confirming the anti - type addition of the nucleophile to the 1,6-enyne. to illustrate the synthetic potential of this gold(i) catalyzed reaction, additional transformations were carried out on several halogenated derivatives, in order to increase the molecular complexity. first, an intramolecular heck reaction was successfully applied for compounds bearing iodine in the ortho position (scheme 2, 4e g). under standard conditions, good yields of the desired cis - fused tricyclic structures 5e the use of o - br derivative 4c or dimethyl substituted compound 4y only led to the recovery of the starting material. it is interesting to note that the initial alkyl - palladium(ii) species of the heck reaction evolves by an intramolecular redox process presumably via -hydride elimination from the benzylic position of cationic intermediate int(45), followed by reductive elimination. then, we envisioned a second gold - catalyzed aminocyclization to form n - substituted indoles (scheme 2). the alkyne was introduced at the ortho position by sonogashira cross - coupling of the iodoarenes with trimethylsilylacetylene to form 6e g in near - quantitative yields, followed by deprotection of the tms - alkynyl compounds by methanolysis to give 7e the new gold(i)-catalyzed aminocyclization proceeded efficiently using catalyst d2 with ipr as the nhc ligand, leading to indole derivatives 8e g in good yields. the presence of chlorine or bromine atoms in 5f g and 8f g could allow their further functionalizations by cross - coupling reactions or other tranformations. although amines coordinate to lewis acidic gold(i) complexes, thus reducing their availability to activate alkynes and other substrates, robust cationic gold(i) complex [johnphosau(mecn)]sbf6 is the catalyst of choice for the broad - scope aminocyclization of 1,6-enynes. the reaction proceeds under mild conditions in moderate to excellent yields with a wide variety of substituted anilines, including electron - rich as well as secondary n - alkyl anilines to give the corresponding adducts, which can be further derivatized to form polycyclic compounds by palladium- and gold - catalyzed reactions. solvents were dried by passing through an activated alumina column on a solvent purification system. analytical thin layer chromatography was carried out using tlc - aluminum sheets with 0.2 mm of silica gel (merck gf254) using uv light as the visualizing agent or an acidic solution of vanillin in ethanol as the developing agent. purifications by chromatography were carried out using flash grade silica gel (sds chromatogel 60 acc, 4060 mm). preparative tlc was performed on 20 cm 20 cm silica gel plates (2.0 mm thick, catalogue number 02015, analtech). organic solutions were concentrated under reduced pressure on a rotary evaporator. unless otherwise stated, nmr spectra were recorded at 298 k on 300, 400, and 500 mhz devices. h and c chemical shifts () are given in ppm relative to tms, and coupling constants (j), in hz. the solvent signals were used as references, and the chemical shifts were converted to the tms scale. mass spectra were recorded employing tof mass analyzers (esi, ei, ci). melting points were determined by observation of the fusion of the solids placed in a capillary, through a magnifying glass. crystal structure determinations were carried out using a diffractomer equipped with an appex 2 4k ccd area detector, an fr591 rotating anode with mo k radiation, montel mirrors as the monochromator, and a kryoflex low temperature device (t = 173 c). programs used : data collection apex-2, data reduction bruker saint v/.60a and absorption correction sadabs. structure solution and refinement : crystal structure solution was achieved using direct methods as implemented in shelxtl and visualized using the program xp. missing atoms were subsequently located from difference fourier synthesis and added to the atom list. least - squares refinement on f2 using all measured intensities was carried out using the program shelxtl. gold complexes a, b, and c are commercialy available ; d1,d2, and e(2) were prepared according to literature procedures. lialh4 (461 mg, 12.1 mmol) was suspended in anhydrous thf (30 ml), and the slurry was cooled to 0 c. a solution of malonate 1a (1.58 g, 5.52 mmol) in anhydrous thf (2 ml) was added dropwise at 0 c. when effervescence had ceased, the mixture was allowed to warm to room temperature and was then heated at 45 c and stirred vigorously for 3.5 h. tlc (c - hexane / etoac 8:1 and 1:1) showed full consumption of the starting malonate and clean conversion. the mixture was diluted with wet diethyl ether (30 ml) and quenched by addition of sodium sulfate decahydrate (ca. 2 g) slowly, to control the effervescence. after stirring for 1 h at rt, a few drops of saturated aqueous nh4cl were added, until the suspension became white. the solids were filtered off over celite, and the cake was washed thoroughly with diethyl ether (200 ml). the filtrate was concentrated in vacuo, and the residue was purified by column chromatography on silica gel eluting with pentane / diethyl ether 1:1 to straight diethyl ether to afford 1.15 g of a colorless solid (90%). h nmr (500 mhz, cdcl3) 7.397.35 (m, 2h), 7.347.29 (m, 2h), 7.257.21 (m, 1h), 6.50 (d, j = 15.6 hz, 1h), 6.23 (dt, j = 15.6, 7.7 hz, 1h), 3.763.67 (m, 4h), 2.432.37 (m, 2h), 2.33 (dd, j = 7.7, 1.4 hz, 2h), 2.32 (d, j = 2.8 hz, 2h), 2.08 (t, j = 2.7 hz, 1h) ppm. c nmr (126 mhz, cdcl3) 137.2, 133.6, 128.5, 127.3, 126.1, 124.8, 80.9, 71.0, 67.5, 42.7, 35.2, 21.6 ppm. hrms - apci calcd for c15h19o2 [m + h ] : 231.1380 ; found : 231.1386. 2-cinnamyl-2-(prop-2-yn-1-yl)propane-1,3-diol (600 mg, 2.61 mmol) was dissolved in anhydrous acetone (2 ml) and ptsohh2o (25 mg, 0.13 mmol) was added, followed by addition of mgso4 (300 mg). the suspension was stirred vigorously at rt for 24 h. tlc showed clean conversion to a new product and only traces of starting material. acetone was removed under a stream of nitrogen, and the mixture was loaded on silica gel and purified by column chromatography eluting with pentane / diethyl ether 95:5 to 9:1 to afford 650 mg of a colorless oil (92%). h nmr (500 mhz, cdcl3) 7.397.35 (m, 2h), 7.357.30 (m, 2h), 7.267.21 (m, 1h), 6.51 (d, j = 15.8 hz, 1h), 6.19 (dt, j = 15.6, 7.7 hz, 1h), 3.73 (s, 4h), 2.42 (d, j = 2.8 hz, 2h), 2.37 (dd, j = 7.8, 1.3 hz, 2h), 2.08 (t, j = 2.7 hz, 1h), 1.46 (s, 3h), 1.44 (s, 3h) ppm. c nmr (126 mhz, cdcl3) 137.2, 133.9, 128.5, 127.3, 126.1, 124.0, 98.2, 80.6, 71.1, 66.7, 36.1, 36.0, 25.3, 22.5, 22.2 ppm. hrms - esi calcd for c18h22o2na [m + na ] : 293.1512 ; found : 293.1512. in a dry flask, 2-cinnamyl-2-(prop-2-yn-1-yl)propane-1,3-diol (200 mg, 0.87 mmol) was dissolved in anhydrous thf (2 ml), and nah (80 mg, 2 mmol), mei (135 ml, 2.17 mmol), and tbai (48 mg, 0.13 mmol) were added sequentially. the suspension was stirred vigorously at rt for 24 h. tlc showed full consumption of starting material and conversion to diprotected alcohol with traces of monoprotection. the mixture was quenched by careful addition of saturated aqueous nh4cl (30 ml) and extracted with diethyl ether (3 50 ml). the combined organic layers were washed with brine (2 15 ml), dried over mgso4, and filtered, and the solvent was removed under vacuum. the resulting mixture was purified by column chromatography on silica gel eluting with c - hexane / etoac 10:1 to afford 210 mg of a colorless oil (94%). h nmr (500 mhz, cdcl3) 7.397.35 (m, 2h), 7.347.29 (m, 2h), 7.257.20 (m, 1h), 6.47 (d, j = 15.8 hz, 1h), 6.23 (dt, j = 15.6, 7.7 hz, 1h), 3.36 (s, 6h), 3.343.28 (m, 4h), 2.34 (dd, j = 7.7, 1.3 hz, 2h), 2.27 (d, j = 2.7 hz, 2h), 2.02 (t, j = 2.7 hz, 1h) ppm. c nmr (126 mhz, cdcl3) 137.7, 133.1, 128.5, 127.0, 126.1, 125.7, 81.3, 74.3, 70.1, 59.3, 42.4, 35.4, 22.2 ppm. hrms - apci calcd for c17h23o2 [m + h ] : 259.1693 ; found : 259.1690. in a dry flask, 2-cinnamyl-2-(prop-2-yn-1-yl)propane-1,3-diol (200 mg, 0.87 mmol) was dissolved in anhydrous thf (2 ml), and nah (73 mg, 1.82 mmol), pmb - cl (0.26 ml, 1.91 mmol), and tbai (48 mg, 0.13 mmol) were added sequentially. the suspension was stirred vigorously at rt for 24 h. tlc showed full consumption of starting material and conversion to mono- and diprotected alcohols (diprotection major). the mixture was quenched by careful addition of saturated aqueous nh4cl (30 ml) and extracted with diethyl ether (3 50 ml). the combined organic layers were washed with brine (2 15 ml), dried over mgso4, and filtered, and the solvent was removed under vacuum. the resulting mixture was purified by column chromatography on silica gel eluting with c - hexane / etoac 10:1 to afford 230 mg of a colorless oil (64%). h nmr (500 mhz, cdcl3) 7.347.23 (m, 8h), 7.237.18 (m, 1h), 6.896.84 (m, 4h), 6.39 (d, j = 15.7 hz, 1h), 6.12 (dt, j = 15.6, 7.7 hz, 1h), 4.45 (s, 4h), 3.81 (s, 6h), 3.423.36 (m, 4h), 2.35 (dd, j = 7.7, 1.3 hz, 2h), 2.31 (d, j = 2.7 hz, 2h), 1.98 (t, j = 2.7 hz, 1h) ppm. c nmr (126 mhz, cdcl3) 159.0, 137.7, 132.9, 130.8, 129.1, 128.4, 126.9, 126.1, 125.9, 113.7, 81.4, 72.9, 71.4, 70.2, 55.2, 42.6, 35.4, 22.4 ppm. hrms - esi calcd for c31h34o4na [m + na ] : 493.2349 ; found : 493.2362. enyne (1 equiv) and aniline (1.1 equiv) were placed in a dry flask, and [johnphosau(mecn)]sbf6 (a) (2 mol %) was added as a solution in anhydrous ch2cl2 (overall 0.15 m). the solution was stirred vigorously at rt for 16 h. obtained using catalyst a (2.2 mg, 2.8 mol), enyne 1a (0.14 ml, 1.0 m in dry ch2cl2, 0.14 mmol), and aniline (0.30 ml, 0.5 m in dry ch2cl2, 0.154 mmol) as the nucleophile in ch2cl2 (0.6 ml) according to general procedure i. preparative tlc (c - hexane / etoac 5:1) yielded 49 mg (93%) of the aminated product as a colorless oil. h nmr (400 mhz, cdcl3) 7.417.40 (m, 2h), 7.397.36 (m, 2h), 7.26 (tt, j = 4.2, 1.5 hz, 1h), 7.10 (dd, j = 8.6, 7.4 hz, 2h), 6.67 (tt, j = 7.4, 1.2 hz, 1h), 6.54 (dd, j = 8.6, 1.2 hz, 2h), 5.105.08 (m, 1h), 4.804.78 (m, 1h), 4.57 (d, j = 5.0 hz, 1h), 4.34 (s, 1h), 3.78 (s, 3h), 3.71 (s, 3h), 3.163.07 (m, 2h), 3.012.96 (m, 1h), 2.392.33 (m, 1h), 2.282.24 (m, 1h) ppm. c nmr (101 mhz, cdcl3) 172.4, 171.8, 147.8, 147.2, 142.3, 129.0, 128.5, 127.0, 126.7, 117.5, 113.7, 109.1, 59.0, 58.2, 52.9, 52.8, 49.4, 42.0, 34.9 ppm. hrms - esi calcd for c23h26no4 [m + h ] : 380.1856 ; found : 380.1865. obtained using catalyst a (5.6 mg, 7.4 mol), enyne 1a (42 mg, 0.15 mmol) and p - anisidine (19 mg, 0.16 mol) as the nucleophile in ch2cl2 (1.0 ml) according to the general procedure i. purification by column chromatography (n - hexane / etoac 9:1) yielded 28 mg (47%) of the aminated product as a yellow oil. h nmr (400 mhz, cdcl3) 7.387.18 (m, 5h), 6.706.65 (m, 2h), 6.476.42 (m, 2h), 5.06 (br s, 1h), 4.77 (br s, 1h), 4.44 (d, j = 4.6 hz, 1h), 3.98 (s, 1h), 3.73 (s, 3h), 3.67 (s, 6h), 3.202.95 (m, 3h), 2.32 (dd, j = 13.6, 9.8 hz, 1h), 2.23 (dd, j = 13.6, 8.7 hz, 1h) ppm. c nmr (101 mhz, cdcl3) 172.4, 172.0, 152.2, 147.6, 142.6, 142.2, 128.7, 127.1, 126.9, 115.1, 114.8, 109.1, 60.0, 57.9, 55.8, 53.0, 52.9, 49.7, 42.1, 35.0 ppm. hrms - esi calcd for c24h28no5 [m + h ] : 410.1962 ; found : 410.1984. obtained using catalyst a (2.2 mg, 2.8 mol), enyne 1a (0.14 ml, 1.0 m in dry ch2cl2, 0.14 mmol), and 2-bromoaniline (26 mg, 0.15 mmol) as the nucleophile in ch2cl2 (0.85 ml) according to general procedure i. preparative tlc (c - hexane / etoac 5:1) yielded 56 mg (87%) of the aminated product as a colorless oil. h nmr (400 mhz, cdcl3) 7.41 (dd, j = 7.9, 1.4 hz, 1h), 7.357.31 (m, 4h), 7.277.24 (m, 1h), 6.99 (dt, j = 7.6, 1.4 hz, 1h), 6.53 (dt, j = 7.6, 1.4 hz, 1h), 6.36 (dd, j = 7.6, 1.4 hz, 1h), 5.09 (m, 1h), 4.80 (d, j = 4.7 hz, 1h), 4.72 (m, 1h), 4.52 (t, j = 5.3 hz, 1h), 3.74 (s, 3h), 3.71 (s, 3h), 3.183.16 (m, 1h), 3.03 (s, 2h), 2.45 (dd, j = 13.7, 8.2 hz, 1h), 2.29 (dd, j = 13.7, 9.9 hz, 1h) ppm. c nmr (101 mhz, cdcl3) 171.8, 171.7, 146.9, 144.3, 141.2, 132.2, 128.5, 128.2, 127.3, 126.8, 118.1, 112.9, 110.3, 109.9, 60.3, 58.1, 52.9, 52.8, 49.4, 42.1, 35.5 ppm. hrms - esi calcd for c23h25brno4 [m + h ] : 458.0961 ; found : 458.0969. obtained using catalyst a (5.7 mg, 7.4 mol), enyne 1a (42 mg, 0.15 mmol), and 4-bromoaniline (31 mg, 0.18 mol) as the nucleophile in ch2cl2 (1.0 ml) according to general procedure i. purification by column chromatography (pentane / diethyl ether 9:1 to 4:1) yielded 50 mg (74%) of the aminated product as a white solid, which was further crystallized from et2o / pentane. h nmr (400 mhz, cdcl3) 7.407.22 (m, 5h), 7.187.14 (m, 2h), 6.436.36 (m, 2h), 5.08 (br s, 1h), 4.78 (br s, 1h), 4.554.50 (m, 2h), 3.78 (s, 3h), 3.71 (s, 3h), 3.143.05 (m, 2h), 2.992.92 (m, 1h), 2.35 (dd, j = 14.0, 9.3 hz, 1h), 2.21 (dd, j = 14.0, 9.3 hz, 1h) ppm. c nmr (101 mhz, cdcl3) 172.7, 171.9, 147.2, 146.9, 141.9, 131.8, 128.8, 127.3, 126.7, 115.3, 109.2, 109.1, 58.9, 57.7, 53.1, 52.9, 49.3, 42.2, 34.7 ppm. hrms - esi calcd for c23h25brno4 [m + h ] : 458.0961 ; found : 458.0971. mp 124126 c. obtained using catalyst a (15 mg, 20 mol), enyne 1a (286 mg, 1 mmol), and 2-iodoaniline (234 mg, 1.07 mmol) as the nucleophile in ch2cl2 (4 ml) according to general procedure i. purification by column chromatography (pentane / diethyl ether 9:1 to 4:1) yielded 489 mg (98%) of the aminated product as a colorless solid. note : on 2.79 mmol scale, the reaction afforded the desired compound in 90% yield. h nmr (500 mhz, cdcl3) 7.64 (dd, j = 7.8, 1.5 hz, 1h), 7.367.30 (m, 4h), 7.287.22 (m, 1h), 7.00 (ddd, j = 8.2, 6.8, 1.5 hz, 1h), 6.39 (ddd, j = 7.8, 7.3, 1.5 hz, 1h), 6.27 (dd, j = 8.2, 1.5 hz, 1h), 5.10 (q, j = 2.2 hz, 1h), 4.76 (q, j = 2.2 hz, 1h), 4.61 (d, j = 4.6 hz, 1h), 4.52 (t, j = 5.1 hz, 1h), 3.73 (s, 3h), 3.70 (s, 3h), 3.16 (dtt, j = 12.3, 5.5, 2.3 hz, 1h), 3.112.99 (m, 2h), 2.42 (ddd, j = 13.7, 8.1, 1.4 hz, 1h), 2.28 (dd, j = 13.7, 10.1 hz, 1h) ppm. c nmr (126 mhz, cdcl3) 171.8, 171.7, 147.0, 146.4, 141.1, 138.8, 129.1, 128.6, 127.3, 126.8, 119.0, 112.2, 110.0, 86.2, 60.7, 58.2, 52.9, 52.8, 49.5, 42.1, 35.5 ppm. hrms - esi calcd for c23h24ino4na [m + na ] : 528.0642, found 528.0637. mp 129131 c. obtained using catalyst a (19 mg, 24 mol), enyne 1a (350 mg, 1.22 mmol), and 4-bromo-2-iodoaniline (401 mg, 1.35 mmol) as the nucleophile in ch2cl2 (8 ml) according to general procedure i. purification by column chromatography (pentane / et2o 9:1) yielded 644 mg (90%) of the aminated product as a white solid. h nmr (500 mhz, cdcl3) 7.72 (d, j = 2.3 hz, 1h), 7.357.21 (m, 5h), 7.07 (dd, j = 8.7, 2.3 hz, 1h), 6.11 (d, j = 8.7 hz, 1h), 5.10 (q, j = 2.2 hz, 1h), 4.74 (q, j = 2.2 hz, 1h), 4.61 (d, j = 4.5 hz, 1h), 4.47 (t, j = 5.0 hz, 1h), 3.72 (s, 3h), 3.69 (s, 3h), 3.183.11 (m, 1h), 3.03 (bs, 2h), 2.39 (dd, j = 13.7, 8.2 hz, 1h), 2.24 (dd, j = 13.7, 10.2 hz, 1h) ppm. c nmr (126 mhz, cdcl3) 171.9, 171.8, 147.1, 145.8, 140.7, 140.3, 132.0, 128.8, 127.7, 126.9, 113.3, 110.3, 109.4, 86.3, 60.9, 58.3, 53.1, 53.0, 49.5, 42.3, 35.6 ppm. hrms - esi calcd for c23h23brino4na [m + na ] : 605.9747 ; found : 605.9747. mp 123125 c. obtained using catalyst a (19 mg, 24 mol), enyne 1a (350 mg, 1.22 mmol), and 5-chloro-2-iodoaniline (341 mg, 1.35 mmol) as the nucleophile in ch2cl2 (8 ml) according to general procedure i. purification by column chromatography (pentane / et2o 9:1) yielded 562 mg (85%) of the aminated product as a white solid. h nmr (500 mhz, cdcl3) 7.51 (d, j = 8.3 hz, 1h), 7.377.29 (m, 4h), 7.287.23 (m, 1h), 6.39 (dd, j = 8.3, 2.3 hz, 1h), 6.24 (d, j = 2.3 hz, 1h), 5.09 (q, j = 2.1 hz, 1h), 4.73 (q, j = 2.2 hz, 1h), 4.68 (d, j = 5.0 hz, 1h), 4.49 (t, j = 5.3 hz, 1h), 3.72 (s, 3h), 3.69 (s, 3h), 3.203.12 (m, 1h), 3.052.99 (m, 2h), 2.42 (dd, j = 13.7, 8.1 hz, 1h), 2.23 (dd, j = 13.7, 10.1 hz, 1h) ppm. c nmr (126 mhz, cdcl3) 171.9, 171.8, 147.5, 147.0, 140.5, 139.4, 135.4, 128.9, 127.7, 126.9, 119.1, 112.2, 110.3, 83.2, 60.7, 58.3, 53.1, 53.0, 49.4, 42.3, 35.6 ppm. hrms - esi calcd for c23h23clino4na [m + na ] : 562.0253 ; found : 562.0262. mp 143145 c. obtained using catalyst a (2.2 mg, 2.8 mol), enyne 1a (0.14 ml, 1.0 m in dry ch2cl2, 0.14 mmol), and 2,4,6-trimethylaniline (0.31 ml, 0.5 m in ch2cl2, 0.15 mmol) as the nucleophile in ch2cl2 (0.6 ml) according to general procedure i. preparative tlc (c - hexane / etoac 5:1) yielded 48 mg (82%) of the aminated product as a colorless oil. h nmr (400 mhz, cdcl3) 7.217.14 (m, 5h), 6.68 (s, 2h), 4.86 (d, j = 1.7 hz, 1h), 4.36 (d, j = 1.7 hz, 1h), 4.22 (d, j = 8.4 hz, 1h), 3.77 (s, 3h), 3.75 (s, 3h), 3.45 (s, 1h), 3.293.25 (m, 1h), 2.982.87 (m, 3h), 2.42 (dd, j = 13.8, 9.5 hz, 1h), 2.16 (s, 3h), 2.10 (s, 6h) ppm. c nmr (101 mhz, cdcl3) 172.2, 172.0, 148.2, 142.8, 141.5, 130.2, 129.6, 128.4, 128.0, 127.4, 127.0, 110.0, 64.0, 58.1, 52.9, 52.8, 47.9, 42.2, 37.8, 20.4, 19.3 ppm. hrms - esi calcd for c26h32no4 [m + h ] : 422.2326 ; found : 422.2331. obtained using catalyst a (5.7 mg, 7.4 mol), enyne 1a (41 mg, 0.14 mmol) and 3,5-bistrifluoromethylaniline (25 l, 0.16 mol) as the nucleophile in ch2cl2 (1.0 ml) according to general procedure i. purification by column chromatography (c - hexane / etoac 12:1) yielded 67 mg (89%) of the aminated product as a white solid. h nmr (400 mhz, cdcl3) 7.367.30 (m, 4h), 7.307.23 (m, 1h), 7.07 (br s, 1h), 6.856.81 (m, 2h), 5.27 (d, j = 4.6 hz, 1h), 5.105.05 (m, 1h), 4.794.76 (m, 1h), 4.62 (dd, j = 4.6 hz, 1h), 3.78 (s, 3h), 3.69 (s, 3h), 3.203.13 (m, 1h), 3.133.08 (m, 1h), 2.932.86 (m, 1h), 2.39 (dd, j = 14.2, 8.5 hz, 1h), 2.18 (dd, j = 14.6, 10.4 hz, 1h) ppm. c nmr (101 mhz, cdcl3) 173.2, 171.7, 148.6, 147.0, 140.7, 132.2 (q, j = 32.9 hz), 129.1, 127.8, 126.6, 123.6 (q, j = 273.4 hz), 112.7, 110.3 (sept, j = 4.1 hz), 109.2, 58.4, 57.6, 53.4, 53.0, 48.8, 42.4, 34.4 ppm. f nmr (376.49 mhz, cdcl3) 63.0 ppm. hrms - esi calcd for c25h23f6no4na [m + na ] : 538.1423 ; found : 538.1437. mp 143145 c. obtained using catalyst a (2.2 mg, 2.8 mol), enyne 1a (0.14 ml, 1.0 m in dry ch2cl2, 0.14 mmol), and naphtalen-1-amine (20 mg, 0.14 mmol) as the nucleophile in ch2cl2 (0.8 ml) according to general procedure i. preparative tlc (c - hexane / etoac 5:1) yielded 31 mg (51%) of the aminated product as a colorless oil. h nmr (400 mhz, cdcl3) 8.10 (br d, j = 7.9 hz, 1h), 7.80 (dd, j = 7.6, 1.8 hz, 1h), 7.547.44 (m, 4h), 7.34 (t, j = 7.2 hz, 2h), 7.287.24 (m, 1h), 7.217.14 (m, 2h), 6.33 (dd, j = 7.2, 1.2 hz, 1h), 5.09 (d, j = 2.2 hz, 1h), 4.85 (d, j = 2.2 hz, 1h), 4.80 (d, j = 4.7 hz, 1h), 3.82 (s, 3h), 3.73 (s, 3h), 3.323.28 (m, 1h), 3.15 (d, j = 16.2 hz, 1h), 3.02 (dd, j = 16.2, 1.9 hz, 1h), 2.58 (dd, j = 14.0, 9.6 hz, 1h), 2.30 (dd, j = 14.0, 9.6 hz, 1h) ppm. c nmr (101 mhz, cdcl3) 172.5, 171.8, 147.2, 142.6, 141.9, 134.2, 128.6, 127.1, 126.6, 126.4, 125.6, 124.7, 123.9, 120.2, 117.5, 109.1, 106.4, 58.7, 57.6, 52.9, 52.7, 49.4, 42.3, 34.7 ppm. hrms - esi calcd for c27h28no4 [m + h ] : 430.2013 ; found : 430.2020. obtained using catalyst a (2.2 mg, 2.8 mol), enyne 1a (0.14 ml, 1.0 m in dry ch2cl2, 0.14 mmol), and quinolin-8-amine (20 mg, 0.14 mmol) as the nucleophile in ch2cl2 (0.8 ml) according to general procedure i. preparative tlc (c - hexane / etoac 5:1) yielded 28 mg (46%) of the aminated product as a colorless oil. h nmr (400 mhz, cdcl3) 8.79 (dd, j = 4.0, 1.6 hz, 1h), 8.05 (dd, j = 8.0, 1.6 hz, 1h), 7.43 (d, j = 8.4 hz, 2h), 7.38 (dd, j = 8.0, 4.0 hz, 1h), 7.32 (t, j = 7.2 hz, 2h), 7.247.19 (m, 2h), 7.01 (dd, j = 8.4, 0.8 hz, 1h), 6.78 (d, j = 6.0 hz, 1h), 6.45 (dd, j = 7.6, 0.8 hz, 1h), 5.01 (d, j = 2.0 hz, 1h), 4.62 (t, j = 6.4 hz, 1h), 4.58 (d, j = 2.0 hz, 1h), 3.74 (s, 3h), 3.73 (s, 3h), 3.293.25 (m, 1h), 3.13 (qd, j = 16.4, 2.4 hz, 1h), 3.01 (qd, j = 16.4, 2.4 hz, 1h), 2.63 (ddd. j = 14.0, 9.6, 1.6, hz, 1h), 2.39 (dd, j = 14.0, 9.6 hz, 1h) ppm. c nmr (101 mhz, cdcl3) 171.9, 171.8, 147.1, 147.0, 143.9, 142.0, 138.4, 135.9, 128.5, 128.4, 127.5, 127.2, 127.1, 121.3, 114.2, 109.9, 106.2, 60.3, 58.4, 52.8, 49.4, 41.9, 36.2 ppm. hrms - esi calcd for c26h27n2o4 [m + h ] : 431.1965 ; found : 431.1954. obtained using catalyst a (2.2 mg, 2.8 mol), enyne 1a (0.14 ml, 1.0 m in dry ch2cl2, 0.14 mmol), and n - methylaniline (0.3 ml, 0.5 m in dry ch2cl2, 0.15 mmol) as the nucleophile in ch2cl2 (0.6 ml) according to general procedure i. preparative tlc (c - hexane / etoac 5:1) yielded 50 mg (92%) of the aminated product as a colorless oil. h nmr (400 mhz, cdcl3) 7.277.23 (m, 7h), 6.896.86 (m, 2h), 6.75 (tt, j = 7.2, 1.0 hz, 1h), 4.864.81 (m, 2h), 4.22 (d, j = 2.1 hz, 1h), 3.79 (s, 3h), 3.70 (s, 3h), 3.603.57 (m, 1h), 3.24 (qd, j = 16.5, 2.1 hz, 1h), 3.01 (dd, j = 16.6, 2.1 hz, 1h), 2.74 (ddd, j = 13.5, 7.7, 1.5 hz, 1h), 2.67 (s, 3h), 2.12 (dd, j = 13.5, 9.9 hz, 1h) ppm. c nmr (101 mhz, cdcl3) 172.4, 171.9, 150.1, 148.6, 138.9, 129.2, 128.1, 128.0, 127.3, 117.3, 113.9, 109.8, 65.7, 57.6, 52.9, 52.8, 43.4, 41.8, 38.6, 31.8 ppm. hrms - esi calcd for c24h28no4 [m + h ] : 394.2013 ; found : 394.2026. obtained using catalyst a (1.9 mg, 2.5 mol), enyne 1b (0.12 ml, 1.0 m in dry ch2cl2, 0.12 mmol), and aniline (0.25 ml, 0.5 m in ch2cl2, 0.124 mmol) as the nucleophile in ch2cl2 (0.6 ml) according to general procedure i. preparative tlc (c - hexane / etoac 5:1) yielded 58 mg (94%) of the aminated product as a colorless oil. h nmr (400 mhz, cdcl3) 8.09 (dd, j = 6.4, 0.8 hz, 2h), 7.97 (dd, j = 5.6, 0.8 hz, 2h), 7.757.69 (m, 2h), 7.62 (t, j = 6.0 hz, 2h), 7.54 (t, j = 6.4 hz, 2h), 7.19 (dd, j = 6.8, 6.0 hz, 2h), 6.81 (t, j = 6.0 hz, 2h), 6.68 (dd, j = 7.2, 6.8 hz, 1h), 5.02 (br s, 2h), 3.63 (br s, 1h), 3.55 (qd, j = 14.0, 2.0 hz, 1h), 3.35 (dt, j = 14.0, 2.0 hz, 1h), 2.912.82 (m, 2h), 2.67 (ddd, j = 12.4, 7.2, 1.2, hz, 1h), 1.39 (s, 3h), 1.30 (s, 3h) ppm. c nmr (101 mhz, cdcl3) 146.6, 145.8, 137.2, 135.8, 134.7, 134.5, 131.0, 130.9, 129.2, 128.7, 128.6, 118.5, 116.8, 111.3, 91.7, 56.4, 50.2, 41.0, 33.6, 26.2, 25.4 ppm. hrms - esi calcd for c27h30no4s2 [m + h ] : 496.1611 ; found : 496.1638. obtained using catalyst a (1.9 mg, 2.5 mol), enyne 1b (0.12 ml, 1.0 m in dry ch2cl2, 0.12 mmol), and 4-methoxyaniline (15 mg, 0.12 mmol) as the nucleophile in ch2cl2 (0.8 ml) according to general procedure i. preparative tlc (c - hexane / etoac 5:1) yielded 59 mg (90%) of the aminated product as a colorless oil. h nmr (400 mhz, cdcl3) 8.10 (dd, j = 8.0, 0.8 hz, 2h), 7.99 (dd, j = 8.4, 1.2 hz, 2h), 7.757.71 (m, 2h), 7.62 (t, j = 8.0 hz, 2h), 7.55 (t, j = 8.0 hz, 2h), 6.78 (d, j = 9.2 hz, 2h), 6.72 (d, j = 9.2 hz, 2h), 5.08 (s, 1h), 5.04 (s, 1h), 3.80 (s, 3h), 3.56 (qd, j = 17.2, 2.4 hz, 1h), 3.16 (dt, j = 8.4, 2.0 hz, 1h), 2.922.83 (m, 2h), 2.69 (ddd, j = 16.8, 8.8, 1.2, hz, 1h), 1.27 (s, 3h), 1.20 (s, 3h) ppm. c nmr (101 mhz, cdcl3) 153.9, 146.8, 139.1, 137.2, 135.9, 134.6, 134.5, 131.0, 131.0, 128.7, 128.6, 121.4, 114.4, 111.4, 91.8, 57.0, 55.6, 51.3, 40.9, 33.8, 26.2, 25.3 ppm. hrms - esi calcd for c28h32no5s2 [m + h ] : 526.1716 ; found : 526.1726. obtained using catalyst a (1.9 mg, 2.5 mol), enyne 1b (0.12 ml, 1.0 m in dry ch2cl2, 0.12 mmol), and 2-bromoaniline (21 mg, 0.124 mmol) as the nucleophile in ch2cl2 (0.8 ml) according to general procedure i. preparative tlc (c - hexane / etoac 5:1) yielded 53 mg (74%) of the aminated product as a colorless solid. h nmr (400 mhz, cdcl3) 8.11 (dd, j = 8.8, 1.2 hz, 2h), 8.01 (dd, j = 8.8, 1.2 hz, 2h), 7.747.70 (m, 2h), 7.637.54 (m, 4h), 7.46 (dd, j = 7.6, 1.2 hz, 1h), 7.15 (dt, j = 8.4, 2.0 hz, 1h), 6.90 (dd, j = 8.4, 2.4 hz, 1h), 6.61 (dt, j = 8.0, 1.2 hz, 1h), 5.06 (s, 1h), 5.00 (s, 1h), 4.43 (br s, 1h), 3.61 (qd, j = 17.2, 2.4 hz, 1h), 3.47 (t, j = 7.6 hz, 1h), 2.84 (d, j = 17.6 hz, 1h), 2.73 (dd, j = 15.6, 8.4 hz, 1h), 2.58 (ddd, j = 15.6, 9.2, 1.6 hz, 1h), 1.49 (s, 3h), 1.34 (s, 3h) ppm. c nmr (101 mhz, cdcl3) 146.4, 142.7, 137.0, 135.7, 134.7, 134.6, 132.9, 131.1, 131.0, 128.7, 128.7, 128.2, 118.5, 114.5, 111.9, 111.5, 91.7, 56.7, 49.4, 40.7, 33.7, 26.2, 25.2 ppm. hrms - esi calcd for c27h28brno4s2na [m + na ] : 596.0535 ; found : 596.0566. mp 191192 c. obtained using catalyst a (1.9 mg, 2.5 mol), enyne 1b (0.12 ml, 1.0 m in dry ch2cl2, 0.124 mmol), and 4-bromoaniline (21.4 mg, 0.12 mmol) as the nucleophile in ch2cl2 (0.8 ml) according to general procedure i. preparative tlc (c - hexane / etoac 5:1) yielded 67 mg (93%) of the aminated product as a colorless foam. h nmr (400 mhz, cdcl3) 8.07 (dd, j = 8.4, 1.2 hz, 2h), 7.05 (dd, j = 8.4, 1.2 hz, 2h), 7.767.70 (m, 2h), 7.647.53 (m, 4h), 7.277.25 (m, 2h), 6.586.55 (m, 2h), 5.03 (s, 1h), 5.00 (s, 1h), 3.70 (br s, 1h), 3.53 (qd, j = 17.2, 2.4 hz, 1h), 3.32 (dt, j = 8.4, 2.4 hz, 1h), 2.87 (d, j = 17.2 hz, 1h), 2.79 (dd, j = 15.6, 8.8, hz 1h), 2.62 (ddd, j = 15.6, 8.8, 1.6 hz, 1h), 1.48 (s, 3h), 1.33 (s, 3h) ppm. c nmr (101 mhz, cdcl3) 146.5, 144.9, 137.1, 135.7, 134.7, 134.6, 132.0, 131.9, 131.0, 128.7, 128.6, 118.1, 116.7, 111.3, 91.6, 56.5, 49.9, 41.0, 33.5, 26.1, 25.3 ppm. hrms - esi calcd for c27h27brno4s2 [m h ] : 572.0570 ; found : 572.0593. mp 116118 c. obtained using catalyst a (1.9 mg, 2.5 mol), enyne 1b (0.12 ml, 1.0 m in dry ch2cl2, 0.12 mmol) and 3,5-bis(trifluoromethyl)aniline (0.25 ml, 0.5 m in ch2cl2, 0.12 mmol) as the nucleophile in ch2cl2 (0.6 ml) according to general procedure i. preparative tlc (c - hexane / etoac 5:1) yielded 38 mg (48%) of the aminated product as a colorless oil. h nmr (400 mhz, cdcl3) 8.09 (dd, j = 8.4, 1.2 hz, 2h), 7.98 (dd, j = 8.4, 1.2 hz, 2h), 7.777.69 (m, 2h), 7.647.61 (m, 2h), 7.567.52 (m, 2h), 7.21 (br s, 1h), 7.00 (br s, 2h), 5.02 (s, 1h), 4.93 (s, 1h), 4.20 (s, 1h), 3.54 (qd, j = 17.6, 2.4, hz, 1h), 3.24 (t, j = 9.2 hz, 1h), 2.97 (d, j = 17.6 hz, 1h), 2.83 (dd, j = 16.0, 8.4 hz, 1h), 2.67 (ddd, j = 16.0, 8.4, 1.6 hz, 1h), 1.45 (s, 3h), 1.38 (s, 3h) ppm. c nmr (101 mhz, cdcl3) 146.6, 146.1, 137.0, 135.8, 134.9, 134.7, 132.4 (q, j = 32.0 hz), 131.0, 130.9, 128.8, 128.7, 123.4 (q, j = 271.0 hz), 114.4 (q, j = 4.0 hz), 111.8, 110.8 (sept, j = 4.0 hz), 92.3, 56.7, 50.2, 41.0, 33.3, 25.9, 25.2 ppm. hrms - esi calcd for c29h26f6no4s2 [m h ] : 630.1213 ; found : 630.1215. obtained using catalyst a (1.9 mg, 2.5 mol), enyne 1b (0.12 ml, 1.0 m in dry ch2cl2, 0.12 mmol), and naphtalen-1-amine (18 mg, 0.12 mmol) as the nucleophile in ch2cl2 (0.8 ml) according to general procedure i. preparative tlc (c - hexane / etoac 5:1) yielded 50 mg (74%) of the aminated product as a colorless solid. h nmr (400 mhz, cdcl3) 8.07 (dd, j = 8.4, 1.2 hz, 2h), 7.98 (dd, j = 8.4, 1.2 hz, 2h), 7.847.80 (m, 2h), 7.717.66 (m, 2h), 7.567.47 (m, 6h), 7.367.31 (m, 2h), 6.87 (dd, j = 7.2, 1.6 hz, 1h), 5.04 (br s, 1h), 4.98 (br s, 1h), 4.39 (br s, 1h), 3.653.60 (m, 2h), 2.912.85 (m, 2h), 2.64 (ddd, j = 15.6, 8.8, 1.6 hz, 1h), 1.53 (s, 3h), 1.45 (s, 3h) ppm. c nmr (101 mhz, cdcl3) 146.7, 140.9, 137.2, 135.8, 134.7, 134.6, 134.5, 131.0, 130.9, 128.7, 128.6, 125.6, 125.0, 124.9, 119.9, 118.3, 111.4, 109.1, 91.7, 56.5, 49.7, 40.9, 33.7, 26.1, 25.4 ppm. hrms - esi calcd for c31h31no4s2na [m + na ] : 568.1587 ; found : 568.1591. mp 8992 c. obtained using catalyst a (1.9 mg, 2.5 mol), enyne 1b (0.12 ml, 1.0 m in dry ch2cl2, 0.12 mmol), and quinolin-8-amine (20 mg, 0.12 mmol) as the nucleophile in ch2cl2 (0.8 ml) according to general procedure i. preparative tlc (c - hexane / etoac 5:1) yielded slightly contaminated product. recrystallization from c - hexane / etoac yielded 49 mg (72%) of the pure aminated product as a pale yellow solid. h nmr (400 mhz, cdcl3) 8.77 (dd, j = 4.0, 1.6 hz, 1h), 8.07 (dd, j = 8.4, 2.0 hz, 1h), 8.04 (dd, j = 8.8, 1.2 hz, 2h), 7.98 (dd, j = 8.8, 1.2 hz, 2h), 7.717.41 (m, 6h), 7.38 (dd, j = 8.4, 4.4 hz, 1h), 7.34 (t, j = 8.4 hz, 1h), 7.08 (dd, j = 8.0, 0.8 hz, 1h), 6.89 (dd, j = 8.4, 0.8 hz, 1h), 6.66 (s, 1h), 5.04 (s, 1h), 4.97 (s, 1h), 3.693.59 (m, 2h), 2.862.77 (m, 2h), 2.53 (ddd, j = 15.6, 8.8, 1.6 hz), 1.57 (s, 3h), 1.45 (s, 3h) ppm. c nmr (101 mhz, cdcl3) 146.8, 146.7, 142.0, 138.6, 137.0, 136.2, 135.6, 134.7, 134.5, 131.0, 130.9, 130.8, 129.6, 129.1, 128.9, 128.7, 128.6, 128.5, 127.5, 121.4, 114.3, 111.2, 107.2, 91.6, 55.9, 48.4, 40.8, 33.6, 25.8, 25.0 ppm. hrms - esi calcd for c30h31n2o4s2 [m + h ] : 547.1720 ; found : 547.1720. mp 8285 c. obtained using catalyst a (1.9 mg, 2.5 mol), enyne 1b (0.12 ml, 1.0 m in dry ch2cl2, 0.12 mmol), and n - methylaniline (0.25 ml, 0.5 m in ch2cl2, 0.12 mmol) as the nucleophile in ch2cl2 (0.6 ml) according to general procedure i. preparative tlc (c - hexane / etoac 5:1) yielded 53 mg (83%) of the aminated product as a colorless solid. h nmr (400 mhz, cdcl3) 8.15 (dd, j = 7.6, 1.2 hz, 2h), 8.07 (dd, j = 7.6, 1.2 hz, 2h), 7.777.71 (m, 2h), 7.667.58 (m, 4h), 7.337.30 (m, 2h), 7.177.14 (m, 3h), 5.12 (s, 1h), 5.05 (s, 1h), 3.56 (qd, j = 17.2, 2.0 hz, 1h), 3.22 (t, j = 7.6 hz, 1h), 3.08 (dd, j = 15.6, 8.0 hz, 1h), 2.80 (d, j = 17.2 hz, 1h), 2.722.69 (m, 1h+3h), 1.18 (s, 3h), 0.85 (s, 3h) ppm. c nmr (101 mhz, cdcl3) 150.5, 147.3, 137.3, 135.9, 134.6, 134.5, 131.1, 131.0, 128.7, 128.6, 128.2, 128.1, 124.4, 111.3, 91.9, 60.4, 50.4, 40.9, 36.4, 34.0, 21.8, 20.7 ppm. hrms - esi calcd for c28h31no4s2na [m + na ] : 532.1587 ; found : 532.1586. mp 171172 c. obtained using catalyst a (2.2 mg, 2.8 mol), enyne 1c (35 mg, 0.15 mmol), and aniline (15 l, 0.16 mol) as the nucleophile in ch2cl2 (1.0 ml) according to general procedure i. purification by column chromatography (c - hexane / etoac 13:1) yielded 40 mg (83%) of the aminated product as a colorless oil. h nmr (400 mhz, cdcl3) 7.177.11 (m, 2h), 6.766.69 (m, 3h), 5.07 (br s, 1h), 4.97 (br s, 1h), 3.72 (s, 3h), 3.70 (s, 3h), 3.61 (br s, 1h), 3.233.19 (m, 1h), 2.942.84 (m, 2h), 2.63 (ddd, j = 13.5, 8.4, 1.2 hz, 1h), 2.05 (dd, j = 13.5, 9.4 hz, 1h), 1.31 (s, 3h), 1.29 (s, 3h) ppm. c nmr (101 mhz, cdcl3) 172.0, 171.9, 148.5, 146.3, 129.2, 118.3, 117.2, 111.1, 58.6, 56.3, 52.8, 49.1, 44.0, 36.4, 27.0, 25.9, 25.8 ppm. hrms - esi calcd for c19h26no4 [m + h ] : 332.1856 ; found : 332.1857. obtained using catalyst a (2.3 mg, 3.0 mol), enyne 1c (36 mg, 0.15 mmol), and p - anisidine (20 mg, 0.16 mmol) as the nucleophile in ch2cl2 (1 ml) according to general procedure i. purification by column chromatography (c - hexane / etoac 8:1) yielded 44 mg (81%) of the aminated product as a yellow oil. h nmr (400 mhz, cdcl3) 6.75 (br s, 4h), 5.10 (br s, 1h), 5.04 (br s, 1h), 3.75 (s, 3h), 3.73 (s, 3h), 3.71 (s, 3h), 3.16 (br s, 1h), 3.032.83 (m, 3h), 2.64 (ddd, j = 13.4, 8.5, 1.7 hz, 1h), 2.12 (dd, j = 13.4, 9.3 hz, 1h), 1.21 (s, 3h), 1.19 (s, 3h) ppm. c nmr (101 mhz, cdcl3) 172.1, 172.0, 154.0, 148.7, 139.4, 122.0, 114.4, 111.3, 58.7, 56.9, 55.6, 52.8, 50.4, 44.0, 36.4, 27.0, 25.9, 25.7 ppm. hrms - esi calcd for c20h27no5na [m + na ] : 384.1781 ; found : 384.1801. obtained using catalyst a (34 mg, 0.04 mmol), enyne 1c (525 mg, 2.20 mmol), and 2-bromoaniline (417 mg, 2.42 mmol) as the nucleophile in ch2cl2 (14 ml) according to general procedure i. purification by column chromatography (pentane / et2o 9:1) yielded 649 mg (72%) of the aminated product as a colorless oil. h nmr (500 mhz, cdcl3) 7.43 (dd, j = 7.9, 1.5 hz, 1h), 7.12 (ddd, j = 8.6, 7.4, 1.6 hz, 1h), 6.95 (dd, j = 8.3, 1.5 hz, 1h), 6.55 (ddd, j = 7.9, 7.3, 1.5 hz, 1h), 5.08 (t, j = 2.3 hz, 1h), 4.91 (ddt, j = 2.9, 1.8, 0.9 hz, 1h), 4.43 (s, 1h), 3.73 (s, 3h), 3.71 (s, 3h), 3.27 (ddd, j = 9.4, 8.5, 2.0 hz, 1h), 2.95 (dq, j = 15.3, 2.6 hz, 1h), 2.88 (ddt, j = 15.2, 1.9, 1.1 hz, 1h), 2.62 (ddd, j = 13.6, 8.6, 1.9 hz, 1h), 2.02 (dd, j = 13.6, 9.5 hz, 1h), 1.38 (s, 3h), 1.36 (s, 3h) ppm. c nmr (126 mhz, cdcl3) 172.0, 171.9, 147.9, 143.3, 133.0, 128.2, 118.1, 114.8, 112.1, 111.5, 58.7, 56.7, 52.9, 48.8, 44.1, 36.4, 25.7, 25.6 ppm. hrms - esi calcd for c19h24brno4na [m + na ] : 432.0781 ; found : 432.0785. obtained using catalyst a (2.3 mg, 3.0 mol), enyne 1c (35 mg, 0.15 mmol), and 4-bromoaniline (28 mg, 0.16 mmol) as the nucleophile in ch2cl2 (1.0 ml) according to general procedure i. purification by column chromatography (c - hexane / etoac 9:1) yielded 37 mg (62%) of the aminated product as a colorless solid. h nmr (400 mhz, cdcl3) 7.277.24 (m, 2h), 6.656.58 (m, 2h), 5.09 (br s, 1h), 4.95 (br s, 1h), 3.75 (s, 3h), 3.73 (s, 3h), 3.69 (br s, 1h), 3.233.17 (m, 1h), 2.90 (br s, 2h), 2.62 (dd, j = 13.5, 8.4 hz, 1h), 2.03 (dd, j = 13.5, 9.3 hz, 1h), 1.32 (s, 3h), 1.29 (s, 3h) ppm. c nmr (101 mhz, cdcl3) 172.0, 171.8, 148.3, 145.4, 132.0, 118.4, 111.2, 110.1, 58.6, 56.4, 52.9, 48.9, 44.0, 36.4, 25.8 ppm. hrms - esi calcd for c19h25brno4 [m + h ] : 410.0961 ; found : 410.0947. mp 116118 c. obtained using catalyst a (34.2 mg, 0.04 mmol), enyne 1c (500 mg, 2.1 mmol), and 2-iodoaniline (492 mg, 2.25 mmol) as the nucleophile in ch2cl2 (6.0 ml) according to general procedure i. purification by column chromatography (pentane / et2o 10:1 to 4:1) yielded 553 mg (58%) of the aminated product as a colorless oil. h nmr (500 mhz, cdcl3) 7.68 (dd, j = 7.9, 1.6 hz, 1h), 7.16 (ddd, j = 8.5, 7.2, 1.6 hz, 1h), 6.91 (dd, j = 8.4, 1.5 hz, 1h), 6.42 (ddd, j = 8.0, 7.3, 1.4 hz, 1h), 5.10 (br s, 1h), 4.92 (br s, 1h), 4.25 (s, 1h), 3.74 (s, 3h), 3.72 (s, 3h), 3.313.25 (m, 1h), 2.97 (dq, j = 15.2, 2.6 hz, 1h), 2.90 (d, j = 15.3 hz, 1h), 2.63 (ddd, j = 13.7, 8.6, 2.0 hz, 1h), 2.04 (dd, j = 13.6, 9.5 hz, 1h), 1.40 (s, 3h), 1.36 (s, 3h) ppm. c nmr (126 mhz, cdcl3) 171.7, 171.7, 147.7, 145.4, 139.6, 129.0, 118.8, 113.8, 111.4, 88.7, 58.5, 56.9, 52.7, 48.6, 43.9, 36.2, 25.6, 25.3 ppm. hrms - esi calcd for c19h24ino4na [m + na ] : 480.0642, found 480.0638. obtained using catalyst a (2.3 mg, 2.9 mol), enyne 1c (0.15 ml, 1.0 m in dry ch2cl2, 0.15 mmol), and 1-(4-aminophenyl)ethanone (20 mg, 0.15 mmol) as the nucleophile in ch2cl2 (0.8 ml) according to general procedure i. preparative tlc (c - hexane / etoac 5:1) yielded 40 mg (74%) of the aminated product as a colorless oil. h nmr (400 mhz, cdcl3) 7.877.85 (m, 2h), 6.696.66 (m, 2h), 5.09 (s, 1h), 4.91 (s, 1h), 4.31 (s, 1h), 3.75 (s, 3h), 3.73 (s, 3h), 3.37 (t, j = 9.2 hz, 1h), 2.92 (s, 2h), 2.65 (dd, j = 13.6, 8.8 hz, 1h), 2.51 (s, 3h), 2.00 (dd, j = 13.6, 8.8 hz, 1h), 1.41 (s, 3h), 1.39 (s, 3h) ppm. c nmr (101 mhz, cdcl3) 196.2, 171.8, 171.6, 150.5, 147.9, 130.7, 126.6, 113.7, 111.0, 58.4, 56.3, 52.8, 48.0, 43.9, 36.2, 26.0, 25.5, 25.4 ppm. hrms - esi calcd for c21h26no5 [m h ] : 372.1816 ; found : 372.1817. obtained using catalyst a (2.4 mg, 3 mol), enyne 1c (35 mg, 0.14 mmol), and 3,5-bis(trifluoromethyl)aniline (25 l, 0.16 mmol) as the nucleophile in ch2cl2 (1.0 ml) according to general procedure i. preparative tlc (c - hexane / etoac 15:1) yielded 28 mg (42%) of the aminated product as a colorless oil. h nmr (400 mhz, cdcl3) 7.16 (s, 1h), 7.04 (s, 2h), 5.155.12 (m, 1h), 4.994.96 (m, 1h), 4.17 (br s, 1h), 3.74 (s, 3h), 3.72 (s, 3h), 3.18 (dddd, j = 10.3, 8.6, 4.0, 2.0 hz, 1h), 2.94 (dq, j = 15.3, 1.2 hz, 1h), 2.88 (dq, j = 15.4, 2.6 hz, 1h), 2.62 (ddd, j = 13.6, 8.5, 1.8 hz, 1h), 2.04 (dd, j = 13.6, 9.6 hz, 1h), 1.40 (s, 3h), 1.36 (s, 3h) ppm. c nmr (101 mhz, cdcl3) 171.7, 171.5, 147.8, 147.0, 132.3 (q, j = 32.7 hz), 123.5 (q, j = 272.7 hz), 114.6 (app. d, j = 4.2 hz), 111.4, 110.5 (quintet, j = 3.7 hz), 58.3, 56.5, 52.8, 52.8, 49.0, 43.8, 36.1, 25.6, 25.3 ppm. hrms - esi calcd for c21h23f6no4na [m + na ] : 490.1423 ; found : 490.1430. obtained using catalyst a (2.3 mg, 2.9 mol), enyne 1c (0.15 ml, 1.0 m in dry ch2cl2, 0.15 mmol), and naphtalen-1-amine (21 mg, 0.15 mmol) as the nucleophile in ch2cl2 (0.8 ml) according to general procedure i. preparative tlc (c - hexane / etoac 5:1) yielded 44 mg (78%) of the aminated product as a colorless oil. h nmr (400 mhz, cdcl3) 7.827.78 (m, 2h), 7.487.43 (m, 2h), 7.34 (t, j = 8.0 hz, 1h), 7.26 (d, j = 8.0 hz, 1h), 6.97 (d, j = 7.6 hz, 1h), 5.10 (br s, 1h), 4.94 (br s, 1h), 4.41 (s, 1h), 3.75 (s, 3h), 3.74 (s, 3h), 3.48 (dt, j = 9.2, 1.6 hz, 1h), 3.032.92 (m, 2h), 2.72 (ddd, j = 13.6, 8.8, 1.6 hz, 1h), 2.14 (dd, j = 13.6, 8.8 hz, 1h), 1.47 (s, 3h), 1.46 (s, 3h) ppm. c nmr (101 mhz, cdcl3) 171.9, 171.8, 148.3, 140.9, 134.7, 128.9, 126.2, 125.5, 125.1, 124.8, 120.1, 117.9, 111.2, 109.3, 58.6, 55.5, 52.8, 48.7, 44.0, 36.4, 25.5 ppm. hrms - esi calcd for c23h28no4 [m + h ] : 382.2013 ; found : 382.2022. obtained using catalyst a (2.3 mg, 2.94 mol), enyne 1c (0.15 ml, 1.0 m in dry ch2cl2, 0.15 mmol), and quinolin-8-amine (21 mg, 0.15 mmol) as the nucleophile in ch2cl2 (0.8 ml) according to general procedure i. preparative tlc (c - hexane / etoac 5:1) yielded 45 mg (81%) of the aminated product as a pale yellow oil. h nmr (400 mhz, cdcl3) 8.71 (dd, j = 4.0, 1.6 hz, 1h), 8.05 (dd, j = 8.4, 1.6 hz, 1h), 7.387.33 (m, 2h), 7.05 (d, j = 8.0 hz, 1h), 6.98 (d, j = 8.4 hz, 1h), 6.65 (s, 1h), 5.05 (s, 1h), 4.89 (s, 1h), 3.73 (s, 3h), 3.72 (s, 3h), 3.593.55 (m, 1h), 3.01 (qd, j = 15.2, 2.0 hz, 1h), 2.92 (d, j = 15.2 hz, 1h), 2.66 (ddd, j = 13.6, 8.4, 1.6 hz, 1h), 2.07 (dd, j = 13.6, 8.4 hz, 1h), 1.57 (s, 3h), 1.53 (s, 3h) ppm. c nmr (101 mhz, cdcl3) 171.9, 171.8, 148.1, 146.6, 142.3, 138.7, 136.1, 128.9, 127.5, 121.2, 113.5, 110.9, 106.9, 58.6, 55.6, 52.7, 47.5, 44.0, 36.3, 30.9, 25.2, 25.0 ppm. hrms - esi calcd for c22h27n2o4 [m + h ] : 383.1965 ; found : 383.1975. obtained using catalyst a (3.2 mg, 4.2 mol), enyne 1c (0.21 ml, 1.0 m in dry ch2cl2, 0.21 mmol), and n - methylaniline (0.46 ml, 0.5 m in ch2cl2, 0.23 mmol) as the nucleophile in ch2cl2 (0.5 ml) according to general procedure i. preparative tlc (c - hexane / etoac 5:1) yielded 61 mg (85%) of the aminated product as a colorless oil. h nmr (400 mhz, cdcl3) 7.257.23 (m, 2h), 7.197.14 (m, 2h), 7.137.08 (m, 1h), 5.14 (br s, 1h), 5.08 (br s, 1h), 3.75 (s, 3h), 3.73 (s, 3h), 3.103.05 (m, 1h), 2.972.84 (m, 2h), 2.73 (s, 3h), 2.63 (ddd, j = 13.8, 8.6, 1.7 hz, 1h), 2.21 (dd, j = 13.8, 9.3 hz, 1h), 1.08 (s, 3h), 0.89 (s, 3h) ppm. c nmr (101 mhz, cdcl3) 171.9, 171.8, 150.9, 148.9, 128.3, 128.0, 124.1, 110.8, 60.0, 58.4, 52.7, 48.8, 44.0, 36.6, 36.3, 21.5, 20.8 ppm. hrms - esi calcd for c20h28no4 [m + h ] : 346.2013 ; found : 346.2015. obtained using catalyst a (11 mg, 15.0 mol), enyne 1c (0.29 ml, 1.0 m in dry ch2cl2, 0.29 mmol), and n - allylaniline (70 mg, 0.29 mmol) as the nucleophile in ch2cl2 (1.5 ml) according to general procedure i. flash column chromatography (c - hexane / etoac 5:1) yielded 54 mg (49%) of the aminated product as a colorless solid. h nmr (400 mhz, cdcl3) 7.25 (t, j = 8.0 hz, 2h), 7.16 (d, j = 8.0 hz, 2h), 7.11 (t, j = 8.0 hz, 1h), 5.665.58 (m, 1h), 5.16 (s, 1h), 5.11 (s, 1h), 4.98 (dd, j = 17.5, 1.5 hz, 1h), 4.85 (dd, j = 17.5, 1.5 hz, 1h), 3.79 (s, 3h), 3.773.76 (m, 3h + 2h), 3.133.07 (m, 1h), 2.962.87 (m, 2h), 2.66 (ddd, j = 14.0, 8.5, 1.5 hz, 1h), 2.30 (dd, j = 13.5, 9.0 hz, 1h), 1.11 (s, 3h), 0.88 (s, 3h) ppm. c nmr (101 mhz, cdcl3) 172.2, 172.1, 149.1, 147.9, 137.2, 130.0, 127.9, 124.8, 115.7, 110.9, 60.4, 58.5, 52.7, 52.6, 50.6, 49.2, 44.1, 36.7, 22.2, 21.9 ppm. hrms - esi calcd for c22h30no4 [m + h ] : 372.2169 ; found : 372.2156. mp 7577 c. obtained using catalyst a (11 mg, 15.0 mol), enyne 1c (0.29 ml, 1.0 m in dry ch2cl2, 0.29 mmol), and indoline (0.29 ml, 1.0 m in dry ch2cl2, 0.29 mmol) as the nucleophile in ch2cl2 (1.5 ml) according to general procedure i. flash column chromatography (c - hexane / etoac 5:1) yielded 92 mg (87%) of the aminated product as a colorless oil. h nmr (400 mhz, cdcl3) 7.06 (dd, j = 7.5, 0.5 hz, 1h), 7.01 (t, j = 8.0 hz, 1h), 6.80 (d, j = 8.0 hz, 1h), 6.63 (dd, j = 7.5, 0.5 hz, 1h), 5.07 (br s, 2h), 3.76 (s, 3h), 3.75 (s, 3h), 3.60 (t, j = 10.0 hz, 1h), 3.523.41 (m, 2h), 2.93 (br s, 2h), 2.88 (t, j = 8.5 hz, 2h), 2.63 (ddd, j = 13.5, 8.5, 1.5 hz, 1h), 2.10 (dd, j = 13.5, 9.0 hz, 1h), 1.37 (s, 3h), 1.27 (s, 3h) ppm. c nmr (101 mhz, cdcl3) 172.0, 171.9, 149.8, 148.5, 131.6, 126.9, 124.4, 116.6, 110.6, 109.8, 58.7, 58.3, 52.8, 52.7, 49.6, 48.5, 44.0, 36.2, 28.1, 21.4, 21.0 ppm. hrms - esi calcd for c21h28no4 [m + h ] : 358.2013 ; found : 358.2025. obtained using catalyst a (11 mg, 15.0 mol), enyne 1c (0.29 ml, 1.0 m in dry ch2cl2, 0.29 mmol), and 1,2,3,4-tetrahydroquinoline (0.29 ml, 1.0 m in dry ch2cl2, 0.29 mmol) as the nucleophile in ch2cl2 (1.5 ml) according to general procedure i. washing with 10% aqueous solution of naoh to remove excess 1,2,3,4-tetrahydroquinoline, flash column chromatography (c - hexane / etoac 5:1), and subsequent preparative tlc (ch2cl2/c - hexane 1:2) yielded 56 mg (51%) of the aminated product as a colorless oil. h nmr (400 mhz, cdcl3) 7.067.04 (m, 2h), 7.01 (d, j = 7.5 hz, 1h), 6.74 (dt, j = 6.5, 2.5 hz, 1h), 5.06 (s, 1h), 4.98 (s, 1h), 3.75 (s, 3h), 3.72 (s, 3h), 3.62 (dt, j = 10.0, 2.0 hz, 1h), 3.333.28 (m, 1h), 3.233.18 (m, 1h), 2.972.89 (m, 2h), 2.65 (t, j = 6.5 hz, 2h), 2.55 (ddd, j = 13.6, 8.0, 1.5 hz, 1h), 2.06 (dd, j = 13.5, 9.5 hz, 1h), 1.89 (quin, j = 6.5 hz, 2h), 1.43 (s, 3h), 1.32 (s, 3h) ppm. c nmr (101 mhz, cdcl3) 172.1, 171.9, 148.9, 145.9, 131.1, 128.4, 125.4, 119.8, 118.3, 110.5, 60.8, 58.4, 52.8, 52.7, 48.8, 44.3, 44.1, 36.6, 28.0, 25.3, 24.3, 23.6 ppm. hrms - esi calcd for c22h30no4 [m + h ] : 372.2169 ; found : 372.2162. obtained using catalyst a (4.6 mg, 0.006 mmol), enyne 1d (81 mg, 0.30 mmol), and 4-bromoaniline (57 mg, 0.33 mmol) as the nucleophile in ch2cl2 (0.9 ml) according to general procedure i (stirred vigorously at rt for 5 h). purification by column chromatography (pentane / et2o 95:5 to 9:1) yielded 125 mg of colorless gum (94%, contains ca. 35% impurities) that was further crystallized from 0.4 ml of diethyl ether layered with 1.2 ml of pentane (sonication initiated the crystallization) to yield 110 mg of colorless crystals (84%). d, j = 4.3 hz, 4h), 7.25 (ddd, j = 8.7, 4.9, 3.9 hz, 1h), 7.177.12 (m, 2h), 6.406.35 (m, 2h), 5.07 (br s, 1h), 4.77 (q, j = 2.1 hz, 1h), 4.43 (d, j = 5.2 hz, 1h), 4.02 (br s, 1h), 3.72 (d, j = 11.2 hz, 1h), 3.66 (d, j = 11.4 hz, 1h), 3.553.48 (m, 2h), 2.99 (dddt, j = 10.6, 7.9, 5.2, 2.2 hz, 1h), 2.53 (dq, j = 16.5, 1.6 hz, 1h), 2.18 (dq, j = 16.4, 2.4 hz, 1h), 1.67 (dd, j = 13.6, 8.2 hz, 1h), 1.50 (dd, j = 13.6, 10.3 hz, 1h), 1.40 (s, 3h), 1.38 (s, 3h) ppm. c nmr (126 mhz, cdcl3) 149.0, 146.7, 141.7, 131.7, 128.5, 127.2, 126.8, 115.5, 109.5, 109.5, 97.9, 69.4, 67.5, 59.9, 48.8, 41.7, 39.4, 34.0, 24.7, 22.8 ppm. hrms - esi calcd for c24h28brno2na [m + na ] : 464.1196 ; found : 464.1197. mp 110112 c. obtained using catalyst a (3.9 mg, 0.005 mmol), enyne 1f (64.6 mg, 0.25 mmol), and 4-bromoaniline (47 mg, 0.275 mmol) as the nucleophile in ch2cl2 (1.0 ml) according to general procedure i (stirred vigorously at r.t. for 5 h). purification by column chromatography (pentane / et2o 95:5 to 85:15) yielded 80 mg (74%) of the aminated product as a colorless oil. h nmr (500 mhz, cdcl3) 7.357.28 (m, 4h), 7.257.20 (m, 1h), 7.157.11 (m, 2h), 6.376.32 (m, 2h), 4.98 (q, j = 2.1 hz, 1h), 4.75 (q, j = 2.1 hz, 1h), 4.504.46 (m, 2h), 3.41 (s, 3h), 3.32 (s, 2h), 3.27 (s, 3h), 3.12 (s, 2h), 3.02 (t, j = 8.2 hz, 1h), 2.40 (dq, j = 16.3, 2.3 hz, 1h), 2.31 (d, j = 16.2 hz, 1h), 1.75 (dd, j = 13.9, 9.1 hz, 1h), 1.51 (dd, j = 13.9, 9.3 hz, 1h) ppm. c nmr (126 mhz, cdcl3) 151.2, 147.0, 142.3, 131.6, 128.5, 126.9, 126.7, 115.1, 108.7, 107.7, 77.7, 76.2, 60.4, 59.3, 59.3, 49.7, 45.4, 40.5, 32.2 ppm. hrms - esi calcd for c23h28brno2na [m + na ] : 452.1196 ; found : 452.1197. obtained using catalyst a (2.0 mg, 0.0026 mmol), enyne 1e (61 mg, 0.13 mmol), and 4-bromoaniline (57 mg, 0.143 mmol) as the nucleophile in ch2cl2 (0.6 ml) according to general procedure i (stirred vigorously at rt for 5 h). purification by column chromatography (pentane / et2o 95:5 to 85:15) yielded 61 mg (73%) of the aminated product as a colorless oil. h nmr (500 mhz, cdcl3) 7.347.21 (m, 7h), 7.187.13 (m, 2h), 7.107.06 (m, 2h), 6.926.88 (m, 2h), 6.876.83 (m, 2h), 6.206.15 (m, 2h), 4.97 (q, j = 2.1 hz, 1h), 4.74 (q, j = 2.1 hz, 1h), 4.49 (s, 2h), 4.47 (t, j 3.0 hz, 1h), 4.37 (s, 2h), 4.34 (br s, 1h), 3.83 (s, 3h), 3.82 (s, 3h), 3.463.39 (m, 2h), 3.233.17 (m, 2h), 2.99 (dddt, j = 9.3, 6.9, 4.5, 2.2 hz, 1h), 2.46 (dq, j = 16.4, 2.3 hz, 1h), 2.35 (d, j = 16.2 hz, 1h), 1.78 (dd, j = 14.0, 9.2 hz, 1h), 1.52 (dd, j = 13.9, 9.3 hz, 1h) ppm. c nmr (126 mhz, cdcl3) 159.2, 159.0, 151.5, 146.9, 142.3, 131.5, 130.6, 129.3, 128.9, 128.4, 126.9, 126.6, 115.1, 113.8, 113.7, 108.7, 107.5, 74.9, 73.3, 73.1, 72.8, 60.3, 55.3, 55.2, 49.7, 45.5, 40.6, 32.1 ppm. hrms - esi calcd for c37h40brno4na [m + na ] : 664.2033 ; found : 664.2030. a solution of compound 4e (40 mg, 0.08 mmol) in degassed dmf (0.5 ml) was treated with pd(oac)2 (1.8 mg, 8 mol), pph3 (4.2 mg, 16 mol), and k2co3 (22 mg, 0.16 mmol) under a n2 atmosphere, and the solution was heated at 110 c for 7 h. purification by flash column chromatography (pentane / et2o 9:1) provided product 5e (20 mg, 67%) as a colorless oil. h nmr (500 mhz, cdcl3) 8.128.07 (m, 2h), 7.547.45 (m, 4h), 7.38 (dd, j = 7.5, 1.6 hz, 1h), 7.28 (td, j = 7.5, 1.6 hz, 1h), 7.23 (td, j = 7.4, 1.5 hz, 1h), 3.79 (s, 3h), 3.50 (s, 3h), 3.45 (d, j = 14.2 hz, 1h), 3.31 (dd, j = 12.4, 7.8 hz, 1h), 2.66 (dd, j = 13.8, 7.8 hz, 1h), 2.54 (d, j = 14.2 hz, 1h), 2.17 (dd, j = 13.8, 12.4 hz, 1h), 1.20 (s, 3h) ppm. c nmr (126 mhz, cdcl3) 173.4, 171.4, 165.8, 142.4, 138.7, 131.7, 130.8, 128.8, 128.6, 127.9, 127.7, 127.0, 125.7, 58.5, 53.2, 52.9, 46.9, 46.5, 44.5, 38.8, 28.7 ppm. hrms - esi calcd for c23h24no4 [m + h ] : 378.1700 ; found : 378.1697. a solution of compound 4f (60 mg, 0.11 mmol) in degassed dmf (0.7 ml) was treated with pd(oac)2 (2.3 mg, 10 mol), pph3 (5.4 mg, 21 mol), and k2co3 (28 mg, 0.21 mmol) under a n2 atmosphere, and the solution was heated at 110 c for 4 h. purification by flash column chromatography (pentane / et2o 9:1) provided product 5f (34 mg, 73%) as a colorless oil. h nmr (500 mhz, cdcl3) 8.158.04 (m, 2h), 7.527.45 (m, 4h), 7.427.35 (m, 2h), 3.78 (s, 3h), 3.58 (s, 3h), 3.33 (d, j = 14.3 hz, 1h), 3.28 (dd, j = 12.2, 8.1 hz, 1h), 2.63 (dd, j = 13.9, 8.1 hz, 1h), 2.58 (d, j = 14.3 hz, 1h), 2.21 (dd, j = 13.9, 12.2 hz, 1h), 1.20 (s, 3h) ppm. c nmr (126 mhz, cdcl3) 173.1, 171.2, 166.4, 141.6, 138.3, 133.9, 131.1, 130.9, 130.2, 128.8, 128.8, 127.0, 120.9, 58.5, 53.3, 53.1, 46.8, 46.1, 44.7, 38.9, 28.4 ppm. hrms - esi calcd for c23h23brno4 [m + h ] : 456.0805 ; found : 456.0798. a solution of compound 4 g (60 mg, 0.11 mmol) in degassed dmf (0.75 ml) was treated with pd(oac)2 (2.5 mg, 11 mol), pph3 (5.8 mg, 22 mol), and k2co3 (31 mg, 0.22 mmol) under a n2 atmosphere, and the solution was heated at 110 c for 4 h. purification by flash column chromatography (pentane / et2o 9:1) provided product 5 g (33 mg, 72%) as a colorless oil. h nmr (500 mhz, cdcl3) 8.128.06 (m, 2h), 7.577.44 (m, 4h), 7.31 (d, j = 8.2 hz, 1h), 7.20 (dd, j = 8.2, 2.3 hz, 1h), 3.79 (s, 3h), 3.53 (s, 3h), 3.42 (d, j = 14.3 hz, 1h), 3.32 (dd, j = 12.4, 7.7 hz, 1h), 2.68 (dd, j = 13.8, 7.7 hz, 1h), 2.50 (d, j = 14.4 hz, 1h), 2.10 (dd, j = 13.8, 12.4 hz, 1h), 1.18 (s, 3h) ppm. c nmr (126 mhz, cdcl3) 173.2, 171.3, 167.3, 143.7, 138.2, 133.0, 131.2, 130.3, 128.8, 128.4, 127.6, 127.1, 127.0, 58.4, 53.3, 53.0, 46.7, 46.4, 44.4, 38.9, 28.6 ppm. hrms - esi calcd for c23h23clno4 [m + h ] : 412.1310 ; found : 412.1320. a dry 10 ml mw vial was charged with pdcl2(pph3)2 (56 mg, 0.079 mmol), cui (38 mg, 0.20 mmol), and 2-iodoaniline 4e (500 mg, 0.99 mmol), and the mw vial was sealed and left under argon. degassed et3n (7 ml) and degassed dmf (3 ml) were added followed by trimethylsilylacetylene (0.68 ml, 4.95 mmol, 5 equiv) at 25 c. the resulting mixture was stirred at 25 c for 1.5 h (complete conversion monitored by gc - ms). the dark brown mixture was partitioned between water (50 ml) and diethyl ether (20 ml). the aqueous layer was re - extracted with diethyl ether (2 20 ml). the title product was obtained after purification by chromatography on silica gel eluting with pentane / et2o 9:1 to 4:1 as a pale brown crystalline solid (451 mg, 96%). h nmr (500 mhz, cdcl3) 7.387.22 (m, 6h), 6.99 (ddd, j = 8.6, 7.4, 1.6 hz, 1h), 6.56 (td, j = 7.5, 1.0 hz, 1h), 6.30 (d, j = 8.3 hz, 1h), 5.14 (d, j = 4.9 hz, 1h), 5.08 (q, j = 2.6 hz, 1h), 4.72 (q, j = 2.5 hz, 1h), 4.51 (t, j = 5.4 hz, 1h), 3.70 (s, 3h), 3.70 (s, 3h), 3.183.10 (m, 1h), 3.04 (dq, j = 16.4, 1.6 hz, 1h), 2.95 (dq, j = 16.5, 2.6 hz, 1h), 2.43 (ddd, j = 13.6, 7.8, 1.7 hz, 1h), 2.22 (dd, j = 13.5, 10.4 hz, 1h), 0.30 (s, 9h) ppm. c nmr (126 mhz, cdcl3) 171.7, 171.4, 148.6, 146.6, 141.5, 132.1, 129.9, 128.5, 127.2, 126.9, 116.6, 111.1, 110.0, 108.0, 102.0, 100.2, 59.8, 58.0, 52.8, 52.7, 49.3, 41.8, 35.4, 0.1 ppm. hrms - esi calcd for c28h34no4si [m + h ] : 476.2252 ; found : 476.2247. according to the procedure for 6e, with 4f (440 mg, 0.753 mmol), pdcl2(pph3)2 (42 mg, 0.06 mmol), and cui (29 mg, 0.15 mmol) in degassed dfm / et3n (1:2, 6.75 ml) to which was added tms - acetylene (208 l, 1.51 mmol, 2 equiv), followed by stirring at 25 c for 1.5 h. obtained as a pale yellow oil after purification by column chromatography on silica gel eluting with pentane / et2o 9:1 to 4:1 (400 mg, 96%). h nmr (500 mhz, cdcl3) 7.387.31 (m, 4h), 7.307.24 (m, 1h), 7.19 (d, j = 8.2 hz, 1h), 6.53 (dd, j = 8.2, 2.0 hz, 1h), 6.29 (d, j = 1.9 hz, 1h), 5.19 (d, j = 5.3 hz, 1h), 5.07 (dq, j = 2.5, 1.5 hz, 1h), 4.714.68 (m, 1h), 4.48 (t, j = 5.6 hz, 1h), 3.70 (s, 3h), 3.69 (s, 3h), 3.193.09 (m, 1h), 3.02 (dq, j = 16.4, 1.6 hz, 1h), 2.91 (dq, j = 16.5, 2.6 hz, 1h), 2.43 (ddd, j = 13.5, 7.8, 1.7 hz, 1h), 2.16 (dd, j = 13.5, 10.4 hz, 1h), 0.31 (s, 9h) ppm. c nmr (126 mhz, cdcl3) 171.7, 171.4, 149.4, 146.5, 140.7, 135.7, 132.9, 128.6, 127.5, 126.8, 116.7, 111.1, 110.2, 106.6, 101.2, 100.9, 59.7, 58.0, 52.8, 52,8, 49.1, 41.8, 35.8, 0.0 ppm. hrms - esi calcd for c28h32brno4sina [m + na ] : 576.1176 ; found : 576.1196. prepared according to the procedure for 6e, with 4 g (550 mg, 1.02 mmol), pdcl2(pph3)2 (57.2 mg, 0.08 mmol), cui (39 mg, 0.20 mmol) in degassed dfm / et3n (1:2, 7.5 ml) to which was added tms - acetylene (282 l, 2.04 mmol, 2 equiv), followed by stirring at 25 c for 1.5 h. obtained as a yellow oil after purification by column chromatography on silica gel eluting with pentane / et2o 9:1 to 4:1 (502 mg, 97%). h nmr (500 mhz, cdcl3) 7.39 (d, j = 2.4 hz, 1h), 7.367.30 (m, 4h), 7.287.23 (m, 1h), 7.05 (dd, j = 8.8, 2.3 hz, 1h), 6.16 (d, j = 8.8 hz, 1h), 5.11 (d, j = 4.8 hz, 1h), 5.08 (q, j = 2.5 hz, 1h), 4.71 (q, j = 2.5 hz, 1h), 4.47 (t, j = 5.3 hz, 1h), 3.70 (s, 3h), 3.69 (s, 3h), 3.13 (dddd, j = 10.4, 8.0, 5.6, 2.3 hz, 1h), 3.03 (dq, j = 16.5, 1.6 hz, 1h), 2.92 (dq, j = 16.5, 2.6 hz, 1h), 2.40 (ddd, j = 13.6, 7.8, 1.7 hz, 1h), 2.18 (dd, j = 13.5, 10.5 hz, 1h), 0.30 (s, 9h) ppm. c nmr (126 mhz, cdcl3) 171.7, 171.4, 147.5, 146.5, 140.9, 134.2, 132.5, 128.6, 127.4, 126.8, 112.7, 110.1, 110.0, 107.8, 101.7, 100.3, 59.8, 58.0, 52.8, 52,8, 49.2, 41.8, 35.7, 0.0 ppm. hrms - esi calcd for c28h32clno4sina [m + na ] : 532.1681 ; found : 532.1693. substrate 6e (150 mg, 0.32 mmol) was suspended in methanol (1 ml) at 25 c, and k2co3 (131 mg, 0.95 mmol) was added. the mixture was stirred vigorously at 25 c for 3 h (disappearance of starting material monitored by gc - ms). the volatiles were then removed under a stream of nitrogen, and the residue was purified by column chromatography on silica gel eluting with pentane / et2o 4:1 to afford 120 mg of colorless oil (94%). note : alternatively the deprotection of the tms group can be carried out on the crude mixture after sonogashira coupling to afford the title alkyne in 81% yield over 2 steps (1 g scale of iodoaniline substrate [1.98 mmol ], 650 mg [1.61 mmol ] of alkyne obtained). h nmr (500 mhz, cdcl3) 7.387.29 (m, 5h), 7.277.22 (m, 1h), 7.03 (ddd, j = 8.6, 7.4, 1.6 hz, 1h), 6.58 (td, j = 7.5, 1.0 hz, 1h), 6.31 (d, j = 8.4 hz, 1h), 5.14 (d, j = 5.1 hz, 1h), 5.07 (q, j = 2.1 hz, 1h), 4.73 (q, j = 2.1 hz, 1h), 4.55 (t, j = 5.4 hz, 1h), 3.72 (s, 3h), 3.70 (s, 3h), 3.52 (s, 1h), 3.223.13 (m, 1h), 3.082.96 (m, 2h), 2.45 (dd, j = 13.7, 8.2 hz, 1h), 2.26 (dd, j = 13.7, 9.9 hz, 1h) ppm. c nmr (126 mhz, cdcl3) 171.8, 171.7, 148.8, 147.0, 141.4, 132.3, 130.1, 128.5, 127.2, 126.8, 116.5, 111.0, 110.0, 106.8, 83.2, 80.7, 60.0, 58.2, 52.8, 49.3, 42.1, 35.4 ppm. hrms - esi calcd for c25h25no4na [m + na ] : 426.1676 ; found : 426.1681. prepared according to the procedure for 7e, with 6f (115 mg, 0.21 mmol) and k2co3 (86 mg, 0.62 mmol) in methanol (0.7 ml), followed by stirring at 25 c for 1.5 h. obtained as a colorless oil after purification by column chromatography on silica gel eluting with pentane / et2o 9:1 to 4:1 (72 mg, 72%). h nmr (500 mhz, cdcl3) 7.41 (d, j = 2.4 hz, 1h), 7.357.29 (m, 4h), 7.277.23 (m, 1h), 7.09 (dd, j = 8.8, 2.4 hz, 1h), 6.17 (d, j = 8.9 hz, 1h), 5.13 (d, j = 5.1 hz, 1h), 5.07 (q, j = 2.1 hz, 1h), 4.71 (q, j = 2.1 hz, 1h), 4.49 (t, j = 5.4 hz, 1h), 3.72 (s, 3h), 3.70 (s, 3h), 3.54 (s, 1h), 3.193.12 (m, 1h), 3.052.95 (m, 2h), 2.42 (dd, j = 13.7, 8.2 hz, 1h), 2.21 (dd, j = 13.8, 9.8 hz, 1h) ppm. c nmr (126 mhz, cdcl3) 171.7, 171.7, 147.8, 146.9, 140.9, 134.4, 132.9, 128.6, 127.4, 126.7, 112.6, 110.0, 108.7, 107.7, 84.3, 79.2, 60.0, 58.1, 52.9, 52.8, 49.2, 42.2, 35.4 ppm. hrms - esi calcd for c25h24brno4na [m + na ] : 504.0781 ; found : 504.0778. prepared according to the procedure for 7e, with 6 g (135 mg, 0.27 mmol) and k2co3 (110 mg, 0.79 mmol) in methanol (1 ml), followed by stirring at 25 c for 2.5 h. obtained as a pale yellow oil after purification by column chromatography on silica gel eluting with pentane / et2o 9:1 to 4:1 (78 mg, 67%). h nmr (500 mhz, cdcl3) 7.367.31 (m, 4h), 7.297.24 (m, 1h), 7.22 (d, j = 8.1 hz, 1h), 6.55 (dd, j = 8.2, 2.0 hz, 1h), 6.29 (d, j = 1.9 hz, 1h), 5.21 (d, j = 5.5 hz, 1h), 5.07 (q, j = 2.1 hz, 1h), 4.71 (q, j = 2.1 hz, 1h), 4.51 (t, j = 5.6 hz, 1h), 3.72 (s, 3h), 3.70 (s, 3h), 3.54 (s, 1h), 3.203.12 (m, 1h), 3.042.94 (m, 2h), 2.44 (dd, j = 13.7, 8.3 hz, 1h), 2.20 (dd, j = 13.8, 9.8 hz, 1h) ppm. c nmr (126 mhz, cdcl3) 171.7, 171.7, 149.6, 146.8, 140.6, 136.0, 133.1, 128.7, 127.5, 126.7, 116.7, 111.0, 110.1, 105.3, 84.0, 79.8, 59.9, 58.2, 52.8, 49.2, 42.2, 35.4 ppm. hrms - esi calcd for c25h24clno4na [m + na ] : 460.1286 ; found : 460.1286. in a dry vial, 7e (100 mg, 0.25 mmol) was dissolved in dry ch2cl2 (2.5 ml) and iprauntf2 (d2) (10.7 mg, 12 mol) was added in one portion. the mixture was stirred at 25 c for 8 h (monitored by gc - ms). the solvent was removed under a stream of nitrogen, and the crude mixture was loaded on silica gel and purified by column chromatography on silica gel eluting with pentane / et2o 9:1 to 4:1 to afford the title product as a colorless solid (78 mg, 78%). h nmr (500 mhz, cdcl3) 7.62 (d, j = 7.9 hz, 1h), 7.477.42 (m, 2h), 7.407.34 (m, 2h), 7.327.18 (m, 4h), 7.09 (ddd, j = 7.9, 7.0, 1.0 hz, 1h), 6.60 (d, j = 3.2 hz, 1h), 5.29 (d, j = 11.0 hz, 1h), 4.90 (q, j = 2.0 hz, 1h), 4.184.14 (m, 1h), 3.873.78 (m, 1h), 3.75 (s, 3h), 3.63 (s, 3h), 3.23 (dq, j = 16.3, 2.4 hz, 1h), 2.97 (dq, j = 16.3, 1.5 hz, 1h), 2.66 (ddd, j = 13.9, 7.9, 1.6 hz, 1h), 1.88 (dd, j = 13.8, 8.2 hz, 1h) ppm. c nmr (126 mhz, cdcl3) 171.9, 171.7, 146.7, 139.8, 136.4, 128.4, 128.3, 127.8, 127.6, 124.6, 121.7, 120.9, 119.6, 111.6, 109.7, 102.5, 63.4, 58.1, 52.9, 52.8, 46.3, 41.7, 38.4 ppm. hrms - esi calcd for c25h26no4 [m + h ] : 404.1856 ; found : 404.1853. according to the procedure for 8e, with 7f (61 mg, 0.13 mmol) and iprauntf2 (d2) (5.5 mg, 6.3 mol) in ch2cl2 (1.2 ml), followed by stirring at 25 c for 8 h. obtained as a colorless foamy solid after purification by column chromatography on silica gel eluting with pentane / et2o 9:1 to 4:1 (47 mg, 77%). h nmr (500 mhz, cdcl3) 7.71 (d, j = 1.6 hz, 1h), 7.40 (d, j = 3.3 hz, 1h), 7.347.21 (m, 7h), 6.51 (d, j = 3.5 hz, 1h), 5.22 (d, j = 10.9 hz, 1h), 4.89 (q, j = 1.9 hz, 1h), 4.16 (q, j = 1.7 hz, 1h), 3.813.74 (m, 1h), 3.73 (s, 3h), 3.63 (s, 3h), 3.19 (dq, j = 16.3, 2.3 hz, 1h), 2.96 (dq, j = 16.4, 1.5 hz, 1h), 2.59 (ddd, j = 13.8, 7.9, 1.5 hz, 1h), 1.84 (dd, j = 13.8, 8.2 hz, 1h) ppm. c nmr (126 mhz, cdcl3) 171.8, 171.7, 146.6, 139.4, 135.0, 130.0, 128.6, 128.1, 127.5, 125.9, 124.5, 123.4, 112.9, 111.7, 111.2, 102.1, 63.7, 58.0, 52.9, 52.9, 46.3, 41.6, 38.3 ppm. hrms - esi calcd for c25h25brno4 [m + h ] : 482.0961 ; found : 482.0959. according to the procedure for 8e, with 7 g (62 mg, 0.14 mmol) and iprauntf2 (d2) (6.1 mg, 7.1 mol) in ch2cl2 (1.3 ml), followed by stirring at 25 c for 8 h. obtained as a colorless foamy solid after purification by column chromatography on silica gel eluting with pentane / et2o 9:1 to 4:1 (42 mg, 68%). h nmr (500 mhz, cdcl3) 7.49 (d, j = 8.4 hz, 1h), 7.417.39 (m, 2h), 7.367.33 (m, 2h), 7.327.28 (m, 2h), 7.277.22 (m, 1h), 7.04 (dd, j = 8.4, 1.8 hz, 1h), 6.55 (dd, j = 3.3, 1.8 hz, 1h), 5.18 (d, j = 11.0 hz, 1h), 4.89 (q, j = 2.0 hz, 1h), 4.14 (dd, j = 2.7, 1.5 hz, 1h), 3.813.75 (m, 1h), 3.74 (s, 3h), 3.64 (s, 3h), 3.20 (dq, j = 16.4, 2.4 hz, 1h), 2.96 (dq, j = 16.3, 1.5 hz, 1h), 2.61 (ddd, j = 13.8, 7.9, 1.6 hz, 1h), 1.83 (dd, j = 13.8, 8.2 hz, 1h) ppm. c nmr (126 mhz, cdcl3) 171.8, 171.6, 146.5, 139.4, 136.8, 128.6, 128.1, 127.8, 127.6, 126.8, 125.3, 121.7, 120.3, 111.7, 109.7, 102.8, 63.6, 58.1, 52.9, 52.9, 46.3, 41.6, 38.3 ppm. hrms - esi calcd for c25h24clno4na [m + na ] : 460.1286 ; found : 460.1281. | a practical aminocyclization of 1,6-enynes with a wide variety of substituted anilines, including n - alkyl anilines, has been achived by using cationic [johnphosau(mecn)]sbf6 as a general purpose catalyst. the resulting adducts can be easily converted into polycyclic compounds by palladium- and gold - catalyzed reactions. |
hyperbaric oxygen (hbo) improves outcome in experimental cerebral ischemia and is therefore emerging as a possible co - treatment for acute ischemic stroke in addition of tissue plasminogen activator (tpa), whose recombinant form is considered the best approved treatment for acute brain ischemia to date (peplow, 2015). thus, despite controversial results that have shown that hbo enlarges ischemic brain damage by blocking autophagy (lu., 2014) and further produces vasoconstriction (stirban., 2009), a condition thought to be deleterious in stroke disease, numerous investigations have reported beneficial effects of hbo on infarct size and neurological deficits (veltkamp., 2000, 2005 ; eschenfelder., 2008 ; yang. although the mechanisms of action of hbo are not well established and are still lively under discussion, hbo has been shown to induce neurogenesis (lee., 2013), to improve the decrease in tissue oxygenation induced by ischemia (sun., 2008), to promote thrombolysis through activation of endogenous tpa (chazalviel., 2016b), and to reduce the decrease in regional glucose metabolism (lou., 2007). likewise, interestingly, normobaric oxygen (nbo) has also been shown to reduce infarct size (singhal., 2002 ; henninger., 2007 ; david., 2012), to induce neurogenesis (wagenfuhr., 2016), to promote endogenous tpa - induced thrombolysis (david., 2012), to increase cerebral blow flow and to improve the decrease in tissue oxygenation induced by ischemia (liu., 2004, 2006 ; shin., 2007 2011), thereby questioning the interest of hbo compared to nbo in the treatment of acute brain ischemia. therefore, in the present study, we investigated and compared the effects of a post - insult treatment with nbo (partial pressure of oxygen (po2) = 1 atmospheres absolute (ata) = 0.1 mpa) or hbo (po2 = 2.5 ata = 0.25 mpa) on the release of lactate dehydrogenase (ldh) used as a marker of cell injury in acute brain slices exposed to oxygen and glucose deprivation (ogd), an ex vivo model of brain ischemia. brain slices were drawn from male adult sprague - dawley rats (n = 15 ; janvier, le genest saint - isle, france) weighing 250 - 280 g according to an animal use procedure approved by the university of caen ethics committee in accordance with the declaration of helsinki and the framework of the french legislation for the use of animals in biomedical experimentation. rats were sacrificed by decapitation under anesthesia, and the brains were carefully removed and placed in ice - cold freshly prepared artificial cerebrospinal fluid (acsf) containing 120 mm nacl, 2 mm kcl, 2 mm cacl2, 26 mm nahco3, 1.19 mm mgso4, 1.18 mm kh2po4, 11 mm d - glucose, and 30 mm hepes (ph = 7.4). coronal brain slices of 400-m thickness including the striatum (anteriority : from 1.2 mm to + 2 mm from bregma) were cut using a tissue chopper (mickie laboratory engineering co., gomshall, surrey, uk), and allowed to recover at room temperature for 45 minutes. after recovery at room temperature, brain slices were incubated individually in a home made 16-vials versatile normobaric - hyperbaric chamber (blatteau., 2014) that was placed in an oven at 36 0.5c. each vial contained 1.3 ml of freshly prepared acsf, saturated, and continuously bubbled with 100% oxygen (25 ml / min per vial). after a 30-minute period of stabilization, acsf was renewed with oxygenated acsf, and the slices were then incubated for an additional 1-hour period to allow recording basal ldh levels. whereas sham slices were incubated for an additional 20-minute period in the same conditions, those corresponding to the ischemic groups were incubated in a glucose - free solution, saturated, and continuously bubbled with 100% nitrogen (ogd slices). after this 20-minute period of ogd, the medium was replaced in all groups with freshly prepared acsf, and the slices were treated and continuously bubbled for a 3-hour period with either normobaric medical air composed of 75% nitrogen and 25% oxygen (control slices) or with normobaric 100% oxygen (nbo - treated slices). hbo treated slices were pressurized at a compression rate of 1 ata / min with 100% oxygen up to 2.5 ata. after a 3-hour period at 2.5 ata, during which increased oxygen level was provided to the slices through oxygen diffusion and equilibrium between air and saline, decompression was performed at a slow decompression rate of 0.1 ata / min shown to induce no cell injury (baskerville., 2011 ; blatteau., acsf was not replaced and served as a pool throughout the 3-hour period of treatment with medical air, nbo or hbo. ogd - induced neuronal injury was quantified by the amount of ldh released in the incubation solution samples. ldh activity was measured using a spectrophotometer at 340 nm in 50 l of incubation medium by following the oxidation (decrease in absorbance) of 100 ml of nicotinamide adenine dinucleotide (nadh) (3 mg in 10 ml of pbs) in 20 l of sodium pyruvate (6.25 mg in 10 ml of pbs) using a microplate reader. ogd - induced ldh effluxes were expressed as the amount of ldh measured in the incubation solution and as a percentage of pre - ogd control value. the number of animals and the number of slices was respectively n = 4 - 6 and n = 24 - 32 per condition. data are expressed as the mean standard error of the mean, and were analyzed using parametric statistics. between - group comparisons on total ldh release were performed using parametric anova. following a significant f value, post - hoc analysis was performed using the tukey 's honestly significant difference method for samples of different size (online software : http://statistica.mooo.com/oneway_anova_with_tukeyhsd). brain slices were drawn from male adult sprague - dawley rats (n = 15 ; janvier, le genest saint - isle, france) weighing 250 - 280 g according to an animal use procedure approved by the university of caen ethics committee in accordance with the declaration of helsinki and the framework of the french legislation for the use of animals in biomedical experimentation. rats were sacrificed by decapitation under anesthesia, and the brains were carefully removed and placed in ice - cold freshly prepared artificial cerebrospinal fluid (acsf) containing 120 mm nacl, 2 mm kcl, 2 mm cacl2, 26 mm nahco3, 1.19 mm mgso4, 1.18 mm kh2po4, 11 mm d - glucose, and 30 mm hepes (ph = 7.4). coronal brain slices of 400-m thickness including the striatum (anteriority : from 1.2 mm to + 2 mm from bregma) were cut using a tissue chopper (mickie laboratory engineering co., gomshall, surrey, uk), and allowed to recover at room temperature for 45 minutes. after recovery at room temperature, brain slices were incubated individually in a home made 16-vials versatile normobaric - hyperbaric chamber (blatteau., 2014) that was placed in an oven at 36 0.5c. each vial contained 1.3 ml of freshly prepared acsf, saturated, and continuously bubbled with 100% oxygen (25 ml / min per vial). after a 30-minute period of stabilization, acsf was renewed with oxygenated acsf, and the slices were then incubated for an additional 1-hour period to allow recording basal ldh levels. whereas sham slices were incubated for an additional 20-minute period in the same conditions, those corresponding to the ischemic groups were incubated in a glucose - free solution, saturated, and continuously bubbled with 100% nitrogen (ogd slices). after this 20-minute period of ogd, the medium was replaced in all groups with freshly prepared acsf, and the slices were treated and continuously bubbled for a 3-hour period with either normobaric medical air composed of 75% nitrogen and 25% oxygen (control slices) or with normobaric 100% oxygen (nbo - treated slices). hbo treated slices were pressurized at a compression rate of 1 ata / min with 100% oxygen up to 2.5 ata. after a 3-hour period at 2.5 ata, during which increased oxygen level was provided to the slices through oxygen diffusion and equilibrium between air and saline, decompression was performed at a slow decompression rate of 0.1 ata / min shown to induce no cell injury (baskerville., 2011 ; blatteau., acsf was not replaced and served as a pool throughout the 3-hour period of treatment with medical air, nbo or hbo. ogd - induced neuronal injury was quantified by the amount of ldh released in the incubation solution samples. ldh activity was measured using a spectrophotometer at 340 nm in 50 l of incubation medium by following the oxidation (decrease in absorbance) of 100 ml of nicotinamide adenine dinucleotide (nadh) (3 mg in 10 ml of pbs) in 20 l of sodium pyruvate (6.25 mg in 10 ml of pbs) using a microplate reader. ogd - induced ldh effluxes were expressed as the amount of ldh measured in the incubation solution and as a percentage of pre - ogd control value. the number of animals and the number of slices was respectively n = 4 - 6 and n = 24 - 32 per condition. data are expressed as the mean standard error of the mean, and were analyzed using parametric statistics. between - group comparisons on total ldh release were performed using parametric anova. following a significant f value, post - hoc analysis was performed using the tukey 's honestly significant difference method for samples of different size (online software : http://statistica.mooo.com/oneway_anova_with_tukeyhsd). brain slices were exposed to experimental ischemia in the form of ogd to determine the effect of nbo and hbo on ogd - induced neuronal injury as assessed by the release of ldh. figure 1 illustrates the effects of a 3-hour treatment with of nbo (po2 = 1 ata) or hbo (po2 = 2.5 ata) on ldh release induced by ogd. exposure to ogd led to an increase in ldh release compared with sham slices (tukey hsd value = 0.0010053 ; p < 0.01). post - insult treatment with nbo showed no significant effect on ogd - induced ldh release compared to control slices treated with air (tukey hsd value = 0.8975409). in contrast, post - insult treatment with hbo led to a significant reduction in ldh release compared to both control slices and nbo - treated slices (tukey hsd value = 0.0010053 ; p < 0.01). exposure to oxygen and glucose deprivation (ogd) results in an increase of lactate dehydrogenase (ldh) release compared to sham (shm) slices taken as a 100% value. note : hyperbaric oxygen (hbo), but not normobaric oxygen (nbo), reduces ldh release in brain slices exposed to ogd compared to control air - treated slices (air). # p < 0.01, vs. sham slices ; p < 0.01, vs. control air - treated slices. first, acsf was used as a pool for brain slices and was not replaced throughout the experiment, conditions that could have lead to ldh decay or accumulation. however, we used this protocol to avoid multiple compression and decompression in the hbo experiment, conditions that would have led to ldh release induced by decompression stress (blatteau., 2014, 2015) and therefore to experimental bias second, no hyperbaric experiment was performed with 10% oxygen to investigate the possible effect of pressure per se. however, support for an effect of hbo rather than pressure per se is previous data performed with the same device in our laboratory in in vitro models of thrombolysis (abraini, 2013 ; chazalviel., 2016b). in addition, from a clinical perspective, this point is not of major critical importance since such a procedure with 10% oxygen is not current therapeutic practice. however, we have previously shown using pharmacological and neurochemical approaches measuring carrier - mediated- and kcl - evoked dopamine release that acute brain slices exposed to similar control and ogd conditions that those used in the present report remained functional (david., 2008). that said, both nbo and hbo have been shown to reduce infarct size (veltkamp, 2000, 2005 ; singhal., 2002 ; henninger., 2007 ;, 2008 ; yang., 2010 ; david., 2012 ; xu., 2016), to promote endogenous tpa - induced thrombolysis (david, 2012 ; chazalviel., 2016b), to improve ischemia - induced decrease in tissue oxygenation (liu., 2004, 2006 ; shin., 2007 ; sun., 2008 ; baskerville., 2016), thereby questioning the interest of hbo compared to nbo in stroke. in the present study, to investigate this question, we compare the oxygen diffusion effects of nbo and hbo in acute brain slices exposed to ogd, an ex vivo model of brain ischemia that allows investigating the acute effects of nbo and hbo on tissue (parenchyma) oxygenation independently of their facilitating action on cerebral blood flow and thrombolysis at the vascular level and of their long term effects on neurogenesis. we found that hbo, but not nbo, reduced ogd - induced cell injury, thereby indicating that to be fully efficient oxygen diffusion - induced tissue oxygenation of the brain parenchyma requires oxygen partial pressure higher than 1 ata. consistent with our findings of a lack of significant effect of nbo through passive - mediated oxygen transport is the fact that both nbo and hbo, administered 1 hour before thrombolysis, have been shown to reduce infarct size in rats subjected to transient thromboembolic brain ischemia, but that only hbo but not nbo has been further demonstrated to decrease infarct volume in permanent thromboembolic middle cerebral artery occlusion - induced ischemia (sun., 2010). the apparent discrepancy between our finding of a lack of effect of nbo at reducing cell injury in brain slices exposed to ogd and the beneficial effect of nbo at reducing infarct size in rats subjected to transient brain ischemia (sun., 2010) could be due to the fact that this latter study was performed in vivo, conditions in which microvasculature could play a major role in oxygen transport (chazalviel. indeed, interestingly, as a possible mechanism for the facilitating action of nbo on cerebral blood flow, nbo has been demonstrated to promote endogenous tpa - induced thrombolysis (david., 2012), effect that could maintain the microvasculature of the ischemic areas opened despite ischemia - induced thrombin generation and blood platelet aggregation (chazalviel. alternatively and in contrast with these beneficial effects, there is a growing number of evidence highlighting potential harmful effect of hyperoxia in acute ischemic events such as stroke and cardiac arrest (austin., 2016 ; sepehrvand and ezekowitz, 2016). these effects are suggested to be gauged by the increased production of reactive oxygen species and the related oxidative stress resulting from hyperoxia - induced vasoconstriction in the cerebral, coronary, and systemic vasculature. as a consequence, targeting oxidative stress and inflammation in addition of excitotoxicity has been suggested as a promising strategy (chamorro., 2016)., 2000, 2005 ; singhal., 2002 ; henninger., 2007 ;, 2008 ; yang., 2010 ; david., 2012 ; xu., 2016), but not during reperfusion (mickel., 1987 2011), has been repeatedly shown to be a safe and effective therapy in animal models of acute brain ischemia. consistent with these data, recent findings have shown that very brief exposure to hbo of 5-minute duration reduced ischemic brain damage probably by promoting thrombolysis, while in contrast longer exposure to hbo of 25-minute duration increases brain damage (chazalviel., 2016b). therefore, it is likely that hyperoxia could have dual effects : on one hand, inducing benefits when administered during ischemia by promoting thrombolysis (david., 2012) thereby avoiding blood platelet aggregation and coagulation (chazalviel., 2016a) and increasing oxygen tension in the ischemic penumbra (liu., 2004, 2006 ; shin., 2007 ; sun., 2008 ; baskerville., so far hbo is concerned passive - mediated oxygen transport as shown in the present study, and on the other hand by inducing adverse responses through oxidative stress and free radical formation that would overturn the benefits of hyperoxia and particularly hbo when administered in a prolonged fashion after ischemia (mickel., 1987 ; aronowski., 1997 ; austin., 2016 ; chamorro., 2016 ; sepehrvand and ezekowitz, 2016). in conclusion, this study provides evidence that hbo, but not nbo, can induce passive - mediated oxygen diffusion (i.e. without vascular support) of the brain parenchyma. this indicates that tissue oxygenation through oxygen diffusion requires oxygen partial pressures higher than 1 ata. this highlights one of the mechanisms by which hbo, in addition of other multiple processes, seems to be efficient at reducing brain damage in acute stroke models. | normobaric oxygen (nbo) and hyperbaric oxygen (hbo) are emerging as a possible co - treatment of acute ischemic stroke. both have been shown to reduce infarct volume, to improve neurologic outcome, to promote endogenous tissue plasminogen activator - induced thrombolysis and cerebral blood flow, and to improve tissue oxygenation through oxygen diffusion in the ischemic areas, thereby questioning the interest of hbo compared to nbo. in the present study, in order to investigate and compare the oxygen diffusion effects of nbo and hbo on acute ischemic stroke independently of their effects at the vascular level, we used acute brain slices exposed to oxygen and glucose deprivation, an ex vivo model of brain ischemia that allows investigating the acute effects of nbo (partial pressure of oxygen (po2) = 1 atmospheres absolute (ata) = 0.1 mpa) and hbo (po2 = 2.5 ata = 0.25 mpa) through tissue oxygenation on ischemia - induced cell injury as measured by the release of lactate dehydrogenase. we found that hbo, but not nbo, reduced oxygen and glucose deprivation - induced cell injury, indicating that passive tissue oxygenation (i.e. without vascular support) of the brain parenchyma requires oxygen partial pressure higher than 1 ata. |
tarantula is a large spider which usually be found in tropical and subtropical areas, but recently has become as pets in worldwide (1). consequently, it is more likely that emergency physicians encounter with patients that hurt with these spiders. they are nonaggressive arthropods that if to be forced to defend themselves, flick their needle - like abdominal hair at the target and may rarely bite (2). though tarantulas may look scary, most of their species are relatively harmless, just a few cases may be dangerous to humans (1). their attacks generally do not cause general manifestation, however there are some case reports in this regard (3, 4). here, an unusual presentation of tarantula bite was reported. a 40-year - old man referred to the emergency department (ed) with severe colicky periumbilical pain, which was non - positional and radiated to both legs. the patient did not have recent trauma history, except heavy lifting, and also any positive past medical history. on admission time, tachycardia of 110/minute revealed a sinus tachycardia on 12 lead electrocardiogram (ecg) and hypertension of 220/110 mmhg in the right arm and 190/100 mmhg in the left arm. on physical examination, straight leg raising (slr) test did not aggravate the pain and all other systems were normal too. with suspicion of large vessel insult abdominal sonography, chest radiography (cxr) and double contrast enhanced computed tomography (ct) were performed, all reported as normal. after ruling out above - mentioned critical impressions, with attention to the history of heavy lifting, herniated disk was suspected so that magnetic resonance imaging (mri) was requested in which no abnormalities were found. during all these examinations, despite palliative treatments, the patient had severe pain without improvement. unfortunately, the patient was discharged against medical advice and admitted again after 24 hours with right leg swelling and erythema. in this time, the patient was exposed and several bite - like sites were surprisingly found on his right leg. tarantulas usually flick their hair at the target, so the most clinical presentations of biting are local allergic reactions including irritation, pruritus, edema, and erythema. if the flicked hair takes place in eye, can result in redness and keratitis. their bite usually sense as mild pain similar to a pinprick, but can cause severe pain, muscle spasms, local swelling, and numbness or even arthritis (3, 4). in spite of all above - mentioned, there is no properly documented case of permanent deficit or death following the tarantula bite (5). such severe symptoms almost always belong to other spiders like black widow spider (6). surprisingly, our case had some of these symptoms in spite of being bitten by tarantula. therefore, we would consider that tarantula bite can mimic symptoms of black widow spider envenomation. laboratory tests and imaging studies are not helpful for evaluation and management (7). in the case of tarantula bite, washing the site with soap and water and applying a cool compress or even an ice cube can reduce the local symptoms. treatment in the ed is usually conservative and involves administration of antihistamines, corticosteroids, and analgesics (8). although no specific treatment exists, it has been suggested that calcium supplements may be beneficial to relieve the muscle spasms (4). there is no report of recurrent or delayed reaction yet, so except for rare cases of anaphylaxis, all patients can be discharged after symptom resolution. all authors passed four criteria for authorship contribution based on recommendations of the international committee of medical journal editors. | tarantulas have recently become as pets in most parts of the world that increased the probability of encountering emergency physicians with patients hurt with these spiders. their attacks usually do not cause general manifestation, however there are some case reports in this regard. here, a 40-year - old man was reported who was referred to the emergency department with severe periumbilical pain that radiated to both legs and diagnosed as a victim of tarantula bite. such symptoms usually are belonging to other spiders like black widow spider, but it seems that tarantula can mimic them in some cases, too. |
anecdotal evidence suggests that metformin titration instructions are not being updated and refill requests are approved without modification of the titration instructions such that the titration instruction is continued for patients newly initiated on metformin.we found a high rate of patients with at least one titration instruction continuation (3-year incident rate = 60.3 % [95 % ci 58.362.3 ]) ; however, such continuation did not negatively affect clinical outcomes.our analysis highlights a potential risk of electronic prescribing and likely patient non - adherence to directions printed on prescription labels. metformin (glucophage), an oral biguanide, is first - line pharmacotherapy for the management of type 2 dm and is one of the most widely prescribed medications overall. while metformin is effective, its adverse effects (aes) include gastrointestinal disorders, which can lead to poor adherence and, subsequently, reduced glycemic control. upward dose titration is recommended when metformin therapy is initiated to decrease the potential for aes and identify the minimum dose for adequate glycemic control. for example, a patient s initial metformin prescription can have instructions that direct a patient to take one tablet by mouth twice daily for 1 week, increase to two tablets in the morning and one tablet in the evening, and then increase to two tablets twice daily. patients often reach their target maintenance dose after 1 month. after completing the dose titration phase, patients should receive a new prescription with updated instructions that reflect the maintenance dosing directions. however, with the increased use of electronic prescribing (e - prescribing) in the usa, there is a potential for unforeseen errors when providing new prescriptions. recent studies have drawn attention to some of the concerns associated with e - prescribing. these studies have focused on discrepancies in patient instructions that could potentially place individuals at risk for medication errors [6, 7 ]. kaiser permanente colorado (kpco) uses an electronic medical record (emr) system for its information management and care delivery infrastructure. the emr integrates inpatient, outpatient, and clinic medical records with appointments, registration, pharmacy, and billing information. anecdotal evidence at kpco suggested that metformin titration instructions were not being updated and refill requests may have been approved without modification of the titration instructions. so, instead of updated instructions directing a patient to take two tablets twice daily, titration instructions were perpetuated during e - prescribing with titration directions. re - initiating titration may leave patients susceptible to decreased glycemic control but, conversely, less likely to report an ae. the purpose of this analysis was to assess the incidence rate and effect of continued metformin titration instructions in a population of patients being initiated on metformin therapy. this was a retrospective cohort analysis of adult patients who received newly initiated metformin pharmacotherapy between 1 january 2011 and 31 december 2013. outcomes were assessed during the time period between patients second and third metformin purchases, as this was hypothesized as the time period during which the effects of inappropriate titration were most likely to manifest. this analysis was conducted at kpco, an integrated healthcare delivery system with over 580,000 members and 27 ambulatory care clinics in colorado at the time of the analysis. kaiser permanente colorado utilizes an emr that provides e - prescribing capabilities and captures coded and free - text medical, pharmacy, laboratory, emergency department (ed), hospitalization, membership, and death information internally from within the health system, as well as from other contracted and affiliated facilities. kaiser permanente colorado owns and operates its pharmacies where its members can purchase subsidized prescription medications. information on such purchases is captured in the electronic kpco administrative pharmacy database. the proposal for this analysis was reviewed by the kpco institutional review board and determined to not be human subjects research, as defined by federal regulations and institutional policies, since it was conducted as a quality assurance project. patients included in this analysis : (1) had purchased a new 500-mg metformin prescription at a kpco pharmacy between 1 january 2011 and 13 december 2013 ; (2) were 18 years of age on the purchase date (index date) ; (3) had no metformin purchase in the 180 days prior to index date (pre - period) ; (4) had at least two additional metformin purchases in the 180 days after the initial (index) purchase ; (5) had continuous kpco health plan membership with pharmacy benefit during the pre - period and through the third metformin purchase ; and (6) had a type 2 dm or pre - diabetes diagnosis (icd-9 codes available upon request) during the pre - period. exposure patients (titration continued group) had titration instructions on the index purchase with the titration instructions repeated (i.e., continued) on at least the second metformin purchase. control patients (titration limited group) had titration instructions on their index purchase but the titration instructions were not continued on the second metformin purchase. the primary outcome was the 3-year incidence rate (with 95 % confidence interval [ci ]) of metformin prescription purchase with titration instructions continued on the subsequent metformin purchase. secondary outcomes included assessments of the proportion of patients with at least one gastrointestinal ae, hyperglycemic glucose laboratory measurement, all - cause hospitalization, ed visit, and insulin / sulfonylurea purchase during follow - up. the analysis cohort and patient characteristics and outcomes were identified through queries of kpco s electronic administrative databases, including the emr. outcome aes included dyspepsia (icd-9 code 536.8), diarrhea (icd-9 code 787.91), nausea (icd-9 code 787.02), vomiting (icd-9 code 787.03), and nausea and vomiting (icd-9 code 787.01) recorded during a telephone or medical office visit encounter. a hyperglycemic glucose laboratory measurement was defined as an a1c 7.0 %, a fasting blood glucose (fbg) 126 mg / dl, or a random glucose (rg) 200 mg / dl recorded in a medical office laboratory. information on co - morbidities diagnosed during telephone / medical office encounters during the pre - period included dementia, heart failure, hepatic disorders, hypertension, polycystic ovarian disease, and renal insufficiency (icd-9 codes available upon request). additionally, information on the index metformin provider, metformin dose, count of unique prescription purchases and elevated glucose measurements during the pre - period (i.e., the 180 days prior to the index purchase) was collected. furthermore, a chronic disease score (cds), a validated measure of a patient s burden of chronic illness, was calculated using ambulatory prescription medication purchases during the pre - period. the cds ranges from 0 to 36 with increasing values indicating a higher burden of chronic illness. incident rate of titration instructions continuation was calculated by dividing the count of patients who purchased a new metformin prescription during the analysis period with continued titration instructions by the count of all patients with a new metformin prescription purchased during the analysis period. the glucose measurements used were those recorded during the pre - period and most proximal to, but before, the index date and after the second purchase, but before the third purchase date. patient characteristics and outcomes were reported as means (standard deviations [sds ]) for interval - level variables and percentages for categorical variables. wilcoxon rank - sum tests and t tests, as applicable, and chi - square tests of association or fisher s exact tests, as applicable, were used to assess differences between groups for interval - level and categorical variables, respectively. multivariate logistic regression analysis was performed for each outcome (except gastrointestinal aes as the incidence was too low to perform adjustments). the titration limited group was the referent category and adjustment was made for all baseline patient characteristics with a p value 0.05). titration - limited patients were more likely to have had an insulin / sulfonylurea purchase (19.4 % vs. 13.0 %, p 60 %) of patients experienced continuation of titration instructions, suggesting that, while e - prescribing may allow for quicker and more convenient prescribing, such benefits can come with unintended consequences (e.g., refill request approvals by the prescriber without proper assessment of prescription details) [6, 7 ]. nevertheless, we found that continuation of titration instructions did not negatively affect clinical outcomes, as patients with continuation of titration instructions were less likely to have had poorly controlled glucose and no more likely to have had a gastrointestinal ae compared to patients without continuation of titration instructions. the exposure group would be expected to have worse glycemic control, but fewer aes, if they had re - initiated their titrations as directed on their prescription s instructions. the reason for the lower proportion of patients with poorly controlled glucose in the exposure group during follow - up is difficult to pinpoint. the control group was initiated on a higher metformin dose, presumably to achieve more rapid glycemic control, but had worse glycemic control during the pre - period. in addition, the control group had a numerically lower rate of renal insufficiency such that they may have had better clearance of metformin. since metformin is primarily cleared renally, any insufficiency could lead to accumulation of metformin and, perhaps, an increased risk of metformin - related aes that hindered glycemic control [11, 12 ]. furthermore, the control group may have had more severe dm / pre - diabetes as they were more likely to have received insulin or a sulfonylurea during follow - up. this is countered by the fact that the control patients were less likely to have been prescribed their index metformin by a specialist (e.g., an endocrinologist). this finding suggests that specialists were less likely to correct titration instructions for subsequent prescription fills. while clinicians report perceived efficiencies in processing refills with e - prescribing, we identified no other studies of continuation of titration instructions with which to compare our findings. turchin and colleagues modified the user interface in an emr prescription ordering module to provide alerts to discrepancies. theoretically, a functionality could be built into an emr to alert prescribers to modify titration instructions once maintenance doses of certain medications have been achieved. we were unable to assess if patients in the titration continued group were told by their prescribers to continue taking the target maintenance dose, regardless of the directions printed on their prescription labels. however, the pharmacist would likely only have counseled the patient to see if she / he was at her / his maintenance dose and not otherwise altered the prescription. we were unable to measure the severity of our patients dm / pre - diabetes at baseline. some patients may have tried and failed metformin prior to our 180-day pre - period. but in order to achieve the largest sample size possible, we included such patients as they were likely to experience the same effects as truly nave metformin users. a limited number of prescriptions could have been initiated outside the kpco e - prescribing system (e.g., during an inpatient stay / emergency room visit, transferred from a non - kpco prescriber), but all prescriptions would have been renewed with e - prescribing. we did not assess metformin adherence such that those patients with an elevated glucose during follow - up may have been less adherent, regardless of the directions given. however, patients in our analysis had to have had at least two additional metformin purchases in the 180 days after index purchase indicating, at least, a modest level of adherence. this analysis was conducted in one health plan where titration instructions are printed on the prescription bottle and its results may not be generalizable to all health plans (e.g., where titration instructions are provided verbally to a patient). however, we had a relatively large cohort of patients to assess the impact of continuation of metformin titration instructions and other health plans with e - prescribing may find similar results. in conclusion, we found a high rate of continuation of titration instructions during e - prescribing for patients newly initiated on metformin. our analysis ultimately highlights a potential risk of e - prescribing and likely patient non - adherence to directions printed on prescription labels. while an alert in an emr to modify instructions may attenuate the continuation of titration instructions, patient non - adherence to prescribers directions may portend serious consequences in the long term. future research should assess patient - reported adherence to the directions for use on prescription labels and evaluate ways to systematically alert prescribers to inappropriate refilling practices. this analysis was reviewed by the kpco institutional review board and determined to not be human subjects research, as defined by us federal regulations and institutional policies, since it was conducted as a quality assurance project. nevertheless, it was performed in accordance with the ethical standards laid down in the 1964 declaration of helsinki and its later amendments. due to the retrospective nature of the analysis, informed consent of patients however, details that might disclose the identity of any patient in the analysis have been omitted. | backgroundanecdotal evidence suggests that metformin titration instructions are not being updated and refill requests are approved without modification of the titration instructions such that the titration instructions is continued for patients newly initiated on metformin.methodsthis was a retrospective cohort analysis of adult patients who received newly initiated metformin pharmacotherapy. patients were followed from their initial metformin purchase through two subsequent metformin refill purchases. outcomes, including the 3-year incidence rate of patients with at least one set of continued titration instructions and proportions of patients with at least one gastrointestinal adverse effect (ae) and those with an elevated glucose measurement at follow - up, were assessed during the time period between patients second and third metformin purchases. analyses were performed comparing the exposure (i.e., patients with continued instructions) group to the control (i.e., patients without continued instructions) group.resultsthe exposure group had a higher mean age and chronic disease score but lower metformin starting dose than the control group (all p 0.05). control patients (48.7 % of patients with a measurement) were more likely to have had poorly controlled glucose than exposure patients (35.7 % of patients with a measurement) (p < 0.001).conclusionsa high rate of continuation of titration instructions for patients newly initiated on metformin was observed ; however, such continuation did not negatively affect clinical outcomes. |
primary mouse astrocytes cultures were prepared from newborn c57bl/6jolahsd mice brains as previously described. after removing meninges and large blood vessels, brains cells were cultivated in dulbecco 's modified eagle medium supplemented with 10% fetal bovine serum, 100 u / ml penicillin and 100 g / ml streptomycin at 37 c in a humidified atmosphere containing 5% co2. the culture medium was changed after three days, and cultures reached confluence after 1014 days. then, glial cells were separated by a magnetic cell sorting (macs) method according to the manufacturer 's protocol (miltenyi biotec, the netherlands). briefly, glial cultures were trypsinized and microglia, the cd11b - positive cells present in the astrocyte monolayer, were collected by a positive selection. astrocyte - enriched cultures were obtained by platting the cells in 75 cm flasks. after 3 days, the culture medium was replaced and after 7 days, when cultures reached confluence, the macs procedure was repeated in order to reduce the residual microglial contamination in our astrocyte population. after additional 7 days, cultures of primary mouse astrocytes were treated with tnf (50 ng / ml ; r&d systems, united kingdom) during 24 h. total rna was extracted using rna now reagent (ozyme, france) according to the manufacturer 's instructions. to determine the effects of tnf on primary astrocytes, all samples were of high purity and integrity and were assessed by the agilent 2100 bioanalyzer and rna 6000 nano labchip kits (agilent technologies). microarray gene expression data was normalized using the gc - rma procedure with default parameters for background correction, quantile normalization, and probe replicate summarization. differentially expressed genes between control and tnf conditions were then determined using the empirical bayes moderated t - statistic (ebayes). p - value significance scores for these genes were adjusted for multiple hypotheses testing according to the benjamini a heat map and dendrogram cluster visualization for the top 150 most significant known genes (fig. 1) was obtained using standard hierarchical average linkage clustering with a euclidean distance metric. a volcano plot for the analysis of differential gene expression between tnf and control samples the negative decadic logarithm of the adjusted p - value significance score was plotted against the logarithm of the fold change. several genes (green dots) are significantly altered (adjusted p < 0.05) and display an absolute log fold change above 1 in expression (fig. alterations in known cellular pathways and processes were identified and visualized by applying the metacoretm genego software onto the differential expression statistics obtained from the ebayes analysis. the genes were pre - filtered using a significance threshold (adjusted p - value < 0.05) before applying the default genego pathway analysis. pathway analysis with genego revealed that pathways related to glial differentiation, immune response and apoptosis were modulated (fig. primary mouse astrocytes cultures were prepared from newborn c57bl/6jolahsd mice brains as previously described. after removing meninges and large blood vessels, brains cells were cultivated in dulbecco 's modified eagle medium supplemented with 10% fetal bovine serum, 100 u / ml penicillin and 100 g / ml streptomycin at 37 c in a humidified atmosphere containing 5% co2. the culture medium was changed after three days, and cultures reached confluence after 1014 days. then, glial cells were separated by a magnetic cell sorting (macs) method according to the manufacturer 's protocol (miltenyi biotec, the netherlands). briefly, glial cultures were trypsinized and microglia, the cd11b - positive cells present in the astrocyte monolayer, were collected by a positive selection. astrocyte - enriched cultures were obtained by platting the cells in 75 cm flasks. after 3 days, the culture medium was replaced and after 7 days, when cultures reached confluence, the macs procedure was repeated in order to reduce the residual microglial contamination in our astrocyte population. after additional 7 days, cultures of primary mouse astrocytes were treated with tnf (50 ng / ml ; r&d systems, united kingdom) during 24 h. total rna was extracted using rna now reagent (ozyme, france) according to the manufacturer 's instructions. to determine the effects of tnf on primary astrocytes, mrna samples were analyzed by affymetrix genechip mouse gene 1.0 st arrays. all samples were of high purity and integrity and were assessed by the agilent 2100 bioanalyzer and rna 6000 nano labchip kits (agilent technologies). microarray gene expression data was normalized using the gc - rma procedure with default parameters for background correction, quantile normalization, and probe replicate summarization. differentially expressed genes between control and tnf conditions were then determined using the empirical bayes moderated t - statistic (ebayes). p - value significance scores for these genes were adjusted for multiple hypotheses testing according to the benjamini hochberg procedure. a heat map and dendrogram cluster visualization for the top 150 most significant known genes (fig. 1) was obtained using standard hierarchical average linkage clustering with a euclidean distance metric. a volcano plot for the analysis of differential gene expression between tnf and control samples the negative decadic logarithm of the adjusted p - value significance score was plotted against the logarithm of the fold change. several genes (green dots) are significantly altered (adjusted p < 0.05) and display an absolute log fold change above 1 in expression (fig. alterations in known cellular pathways and processes were identified and visualized by applying the metacoretm genego software onto the differential expression statistics obtained from the ebayes analysis. the genes were pre - filtered using a significance threshold (adjusted p - value < 0.05) before applying the default genego pathway analysis. pathway analysis with genego revealed that pathways related to glial differentiation, immune response and apoptosis were modulated (fig.. these expression data could be useful to describe the effect of the nfb activation on primary astrocyte cultures devoid of microglia. taking advantage of the macs technology, in contrast to the main studies reported in the literature, we were able to characterize pure populations of astrocytes under inflammatory conditions. we show that tnf increases the expression of genes associated with the nfb pathway and induces the re - expression of genes implicated in glial developmental processes. these data highlight the importance of the nfb pathway during the conversion of astrocytes into reactive cells and, particularly, its active role in the dedifferentiation process. | astrocytes, the most abundant glial cell population in the central nervous system, have important functional roles in the brain as blood brain barrier maintenance, synaptic transmission or intercellular communications [1 ], [2 ]. numerous studies suggested that astrocytes exhibit a functional and morphological high degree of plasticity. for example, following any brain injury, astrocytes become reactive and hypertrophic. this phenomenon, also called reactive gliosis, is characterized by a set of progressive gene expression and cellular changes [3 ]. interestingly, in this context, astrocytes can re - acquire neurogenic properties. it has been shown that astrocytes can undergo dedifferentiation upon injury and inflammation, and may re - acquire the potentiality of neural progenitors [4 ], [5 ], [6 ], [7].to assess the effect of inflammation on astrocytes, primary mouse astrocytes were treated with tumor necrosis factor (tnf), one of the main pro - inflammatory cytokines. the strength of this study is that pure primary astrocytes were used. as microglia are highly reactive immune cells, we used a magnetic cell sorting separation (macs) method to further obtain highly pure astrocyte cultures devoid of microglia.here, we provide details of the microarray data, which have been deposited in the gene expression omnibus (geo) under the series accession number gse73022. the analysis and interpretation of these data are included in gabel. (2015). analysis of gene expression indicated that the nfb pathway - associated genes were induced after a tnf treatment. we have shown that primary astrocytes devoid of microglia can respond to a tnf treatment with the re - expression of genes implicated in the glial cell development. |
diagnostic pathology has shown remarkable improvement in recent years, and routine use of immunohistochemistry and electron microscopy has enabled more precise diagnoses. the availability of improved pathological methods for diagnosis of neuroendocrine tumors has also resulted in the recent recognition that these neoplasms have a wider spectrum. the incidence of unknown primary neuroendocrine tumors has not been determined ; however, they have been estimated to account for approximately 3% of all malignancy of unknown primary sites. these tumors, which represent a subset of unknown primary carcinomas, have a relatively favorable prognosis. however, poorly differentiated neuroendocrine carcinoma (pdnec) has an aggressive biology and the median survival duration is only 10 months [1 - 3 ]. most of these patients had several sites of metastasis, often with predominant tumor in bones, liver, and lymph nodes (particularly the retroperitoneal and mediastinal nodes). however, involvement of a single lymph node (ln) is very rare. here, we present a case of pdnec in a perigastric ln only with no identifiable primary site. a 52-year - old male patient was diagnosed as having early gastric cancer at the lesser curvature of the antrum by routine esophagogastroduodenoscopy in june 2008. results of a subsequent endoscopic biopsy resulted in a histological diagnosis of well - differentiated adenocarcinoma. computed tomography (ct) of the abdomen showed no evidence of ln enlargement or distant metastases. he was diagnosed as having type iic early gastric cancer, which met the indications for endoscopic submucosal dissection (esd). 1a), and the resected specimen confirmed the presence of well differentiated adenocarcinoma, with negative resection margins, and the absence of lymphovascular or perineural invasion by hematoxylin and eosin (h&e) staining (fig. however, six months later, a ln enlargement measuring 2.0 cm at the lesser curvature side of the stomach was observed on a routine abdominal and pelvic ct scan (fig. he had no symptoms, and physical examination failed to reveal evidence of peripheral lymphadenopathy, and a meticulous skin examination revealed no suspicious lesions. he underwent subtotal gastrectomy and regional ln dissection under a suggestive preoperative diagnosis of gastric adenocarcinoma with perigastric ln metastasis. microscopically, no residual tumor was found in the stomach, and the pathologic findings of the single perigastric ln differed completely from those of gastric adenocarcinoma. 3a). results of immunohistochemical staining showed that tumor cells were positive for cytokeratin 20 (1 : 200, leica, newcastle - upon - tyne, uk), cd56 (1 : 150, leica) (fig. 3b), synaptophysin (1 : 200, neomarkers, fremont, ca) (fig. 3d), but negative for cytokeratin 7 (1 : 600, neomarkers), thyroid transcription factor-1 (1 : 300, leica), s-100 (1 : 800, dako, glostrup, demark), and human melanoma black 45 (1 : 150, leica). therefore, based on histological and immunohistochemical findings we performed immunohistochemistry in order to rule out neuroendocrine differentiation in previous well - differentiated adenocarcinoma from the esd specimen ; according to the results, all of the tumor cells were negative for cd56, synaptophysin, and chromogranin. in addition, when the esd specimen and the specimen resected after subtotal gastrectomy were mapped, no other primary site was identified in the stomach specimen. in our search for the primary site, we also performed chest ct, bronchoscopy, colonoscopy, and a positron emission tomography - ct scan. after an extensive work up, no primary site was identified and no further metastatic lesions were found. he has remained disease - free for more than two years after surgical resection. written informed consent this report described a case of pdnec in a single perigastric ln from a presumed unknown primary site. there are two models of tumor progression for these nodal neuroendocrine carcinomas from an unknown primary site : nodal neuroendocrine carcinoma originates from the ln via formation of malignant precursor cells ; and it originates from a spontaneously regressed primary lesion. according to a study reported by kuwabara., primary nodal neuroendocrine carcinoma follows a less aggressive course than its metastatic nodal involvement. if nodal neuroendocrine carcinoma is the primary disease, wide surgical resection is the treatment of choice for localized disease. on the other hand, if nodal neuroendocrine carcinoma is formed by systemic metastasis from an unknown primary site, in view of the aggressive behavior of this tumor, platinum - based adjuvant chemotherapy is required after surgical resection. however, determination of whether nodal neuroendocrine carcinoma is primary or metastatic at initial presentation is difficult, thus, localized therapy combined with chemotherapy and regular close follow - up is essential. first, a perigastric ln involvement is unique. in a recent update that included 99 patients with pdnec with an unknown primary site, the majority of patients had multiple sites of metastasis, and commonly involved sites included the retroperitoneum in 20.2%, peripheral ln in 14.1%, mediastinum in 12.1%, liver in 12.1%, and bone in 11.1%. second, in almost all previous reports, only chemotherapy (usually platinum - based) was administered, whereas, given the unusual setting and a tumor limited to a single site, we adopted surgical resection followed by chemotherapy. a small number of previous case reports reported two cases of pdnec of unknown primary origin in an inguinal and a pancreaticoduodenal ln, respectively, which were treated by surgical resection alone. considering the fact that both patients achieved long - term disease - free survival with ln dissection only, their cases probably could have originated from the affected ln itself. however, in general, pdnec is highly aggressive, with a high rate of metastases and recurrence. in addition, this disease group represents a favorable subset of unknown primary carcinomas that are sensitive to platinum - based combination chemotherapy. therefore, aggressive treatment of pdnec of unknown origin following guidelines similar to those for small cell lung cancer is advised and if possible, a platinum - base adjuvant chemotherapy should be considered. neuroendocrine carcinoma of unknown primary origin is very rare, and its diagnosis is difficult. in this unusual setting, because a minority of patients could enjoy long - term and disease - free survival, we recommend treatment of patients with a single or localized pdnec from an unknown primary site with an aggressive local therapy. in addition to definitive local therapy, the authors believe that these patients should also receive either neoadjuvant or adjuvant chemotherapy. | neuroendocrine carcinomas from an unknown primary site are uncommon. the authors report on a case of neuroendocrine carcinoma in a perigastric lymph node (ln) with no primary site. a 52-year - old male patient with early gastric adenocarcinoma underwent treatment by endoscopic submucosal dissection, and, six months later, findings on a computed tomographic scan of the abdomen revealed a ln enlargement measuring 2.0 cm in the perigastric region. the patient underwent subtotal gastrectomy and regional ln dissection under a suggestive preoperative diagnosis of gastric adenocarcinoma with ln metastasis. however, microscopically, no residual tumor was found in the stomach, and the perigastric ln showed poorly differentiated neuroendocrine carcinoma (pdnec). after an extensive workup, no primary site was identified. the patient also received four cycles of etoposide and cisplatin. despite its extremely rare incidence, this case suggests that pdnec of an unknown primary site is limited to a single site, and that resection should be considered in combination with chemotherapy. |
the estimated new thyroid cancer cases in the united states in 2012 are 56,460 and there are around 1780 deaths from thyroid cancer. this could be related to the earlier detection of thyroid cancer with the current use of imaging and the use of fna of all suspicious thyroid nodules. it is important to note that the overall 10-year mortality for dtc is low at about 7% but the recurrence rate occurrence is higher, causing considerable anxiety among patients and treating physicians. the current paper focuses on the controversies in the initial management and subsequent followup of well - differentiated thyroid cancer. papillary and follicular thyroid carcinomas are the two histological subtypes of differentiated thyroid cancer. both are indolent and have good prognosis overall. the biological behavior of these two carcinomas differ significantly, where papillary thyroid carcinoma is known to frequently metastasize to regional lymph nodes, whereas follicular thyroid carcinoma more frequently metastasizes to distant organs such as the lung, bone, and brain. pathogenesis of differentiated thyroid carcinoma is multifactorial with both genetic and environmental factors playing an important role. for unknown reasons previous exposure to ionizing radiation including external irradiation of the neck would increase the incidence of thyroid cancer especially the papillary type. it was noted that there is a five- and two - fold increase of thyroid cancer incidence in obese men and women, respectively. in areas with adequate iodine intake differentiated thyroid carcinoma accounts for more than 80% of cases of thyroid cancer with the papillary type being the most common. in iodine deficient area there is a relative increase in the incidence of follicular and anaplastic thyroid cancer. in recent years, braf mutations account for 45% of the cases with a higher prevalence in the tall cell differentiated forms. ret / ptc rearrangement was also found to account for 2530% of papillary thyroid carcinoma cases. point mutations of ras gene and pax 8/ppar rearrangement account for the majority of follicular thyroid carcinomas. distant metastasis at the time of diagnosis was the most important prognostic factor for both papillary and follicular thyroid carcinomas. extrathyroidal extension and lymph node metastasis were important prognostic factors for papillary thyroid carcinoma while the grade of invasiveness and carcinoma differentiation were important to evaluate the biological behavior of follicular thyroid cancer. the most currently used is the 6th edition tnm (tumor, node, and metastasis) staging, proposed by the american joint committee on cancer (ajcc) and the international union against cancer committee (uicc). patients whose age is less than 45 years can be either stage i or ii with the only difference between the two stages is the absence or presence of metastasis. however, in older patients, nodal metastasis would classify those patients as stage iii patients while distant metastasis would classify them as stage iv [6, 7 ]. it is important to note that the ajcc tnm classification to define thyroid cancer was recently criticized because it was considered that it may be too optimistic to classify younger patients this way. effect of age and disease extent on mortality was examined in the ajcc staging system using survival data obtained from seer program from 1973 to 2005, with the aim of determining whether risk stratification did portray outcomes of dtc for young patients specifically. in multivariate analysis, 50% increased mortality was found for every decade from age 40 to 90, with this effect being more pronounced in women. when tnm staging applied for those above, the age of 45 years was applied to those less than 45 years and it was noted that there was an increased mortality for those now reclassified as stage iii or iv based on ln involvement and tumor spread outside the thyroid but without distant metastases. however, the limitations of this study was that it did not analyze recurrence which is, of course, something more frequent than mortality in dtc. other important staging systems include the ages (age, grade, extent, size), the macis (metastasis, age, completeness of resection, invasion, size), both proposed by the mayo clinic, and both stratify patients into four risk groups, and the ames (age, metastasis, extension, size) proposed by the lahey clinic, in addition to many other important staging systems as well. it was shown that after 20 years of diagnosis of differentiated thyroid cancer, the two most important prognostic factors were male gender and having the follicular type of thyroid cancer. initial management of differentiated thyroid cancer consists of thyroidectomy and, in certain cases, radioactive iodine therapy to ablate remnant remaining tissue and perhaps metastatic cancer. these are generally followed by long - term therapy with thyroxine with the aim of reducing circulating levels of thyrotropin (thyroid stimulating hormone, tsh) below normal. revised american thyroid association guidelines were published in 2009 that looked at optimal management and follow up of differentiated thyroid cancer. however, there are still controversies involving the optimal extent of initial surgery, the indications for prophylactic central lymph node dissection, the need for radioiodine therapy and the dose required, the degree of tsh suppression and its importance, and the aid of molecular markers to determine the risk of malignancy especially for indeterminate fna samples. extent of disease does affect outcome in patients with papillary thyroid carcinoma. conflicting data exists in the literature regarding the optimal surgical approach for patients with differentiated thyroid cancer due to the fact that there are still no prospective, randomized studies addressing the issue specifically. ata revised guidelines in 2009 stated that for patients with thyroid cancer > 1 cm, the initial surgical procedure should be a near - total or total thyroidectomy unless there are contraindications to this surgery. thyroid lobectomy alone may be sufficient treatment for small (8.0 cm. for those patients whose tumor size was less than 1 cm extent of surgery had no impact on recurrence or survival, while for those patients with tumor size more than 1 cm lobectomy resulted in higher risk of recurrence and death (p = 0.04). another retrospective review of 289 patients, selected for either thyroid lobectomy (n = 72) or total thyroidectomy (n = 217), without radioactive iodine remnant ablation, and followed by a single experienced endocrinologist with modern disease detection tools, in a tertiary referral center, was developed at the memorial sloan- kettering cancer center (mskcc). after a 5-year followup, disease recurrence was detected in 2.3% (5/217) of patients treated with total thyroidectomy, without radioactive iodine remnant ablation, and in 4.2% (3/72) of patients treated with thyroid lobectomy alone. size of the primary tumor, presence of cervical lymph node metastases and american thyroid association risk category were all statistically significant predictors of recurrence. changes in serum thyroglobulin were not helpful in identifying persistent / recurrent structural disease presence. in addition it was found that 88% (7/8) of patients who had recurrent disease were rendered clinically disease - free with additional therapies. a recent study, utilizing the surveillance, epidemiology, and end results program database of the national cancer institute, questioned the validity of the most recent ata guidelines regarding the extent of surgery for papillary thyroid cancer. this study included 22,724 patients with papillary thyroid cancer, of which 5964 patients underwent lobectomy with a median followup of 9 years. multivariate analysis showed no survival difference between patients who underwent total thyroidectomy versus lobectomy for all tumor sizes (4 cm. it was also shown that increased age, increased tumor size, extrathyroidal extent, and positive nodal status displayed significantly worse disease specific survival and overall survival (p 4 cm, and lymph node metastasis did significantly have predicted poor outcome. overall survival at 14 years was 82 per cent for patients with node negative as opposed to 79 per cent for node positive patients (p 1 cm were only analyzed, the recurrence rate following total thyroidectomy without rai remained low at 4%. with regards to the dose of rai needed, larger doses of rai therapy (100200 mci) are considered appropriate, if residual microscopic disease is suspected, or aggressive tumor histology detected. as for distant metastatic, fixed - dose regimen is the most widely used, with 150 mci for cervical and higher doses in the range of 200250 mci for pulmonary metastases or skeletal metastases. as for the optimal dose of rai therapy needed in those patients at low risk, a recent randomized phase 3 trial compared two thyrotropin stimulation methods (thyroid hormone withdrawal and the use of recombinant human thyrotropin) and two different radiodine doses (i131) (1.1 gbq and 3.7 gbq), in a 2-by-2 design, in 752 patients with low - risk differentiated thyroid cancer, where patients were included if they had pt1 (tumor diameter 1 cm) and n1 or nx, pt1 (with tumor diameter > 1 to 2 cm) and any n stage, or pt2n0 with absent distant metastasis. another recent study showed the same outcome as the previous study where patients aged 16 to 80 with t1 to t3 tumor size, with possible spread to ln, but no metastasis, underwent low- versus high - dose rai, in combination with either tsh alfa or th withdrawal prior, and it was shown that the success rates were comparable in all groups of patients ranging between 85 and 89%. the expansion of knowledge regarding genetic mutations in thyroid cancers has led to the use of molecular markers as an indicator of prognosis and for the malignancy diagnosis especially in indeterminate fna samples (braf, ras, ret / ptc, and pax8/ppar). recent large prospective studies have emphasized the ability of genetic markers (braf, ras, ret / ptc, and pax8/ppar) and protein markers (galectin-3) to significantly improve and affect the preoperative diagnostic accuracy especially for patients who have indeterminate thyroid nodules [3034 ]. moreover, the use of such molecular markers was further recommended by the 2009 revised ata guidelines where the sensitivity of malignant diagnosis in fna thyroid nodules was found to be increased from 44% to 80%, when comparing cytology alone to cytology combined with molecular testing for the markers in most of those studies. one of those studies showed that the sensitivity of malignant diagnosis in fna increased from 60%, with cytology alone, to 90% with cytology and molecular testing for braf, ras, ret, trk, and ppar mutations. it can be concluded that the best current preoperative tool for thyroid cancer is the cytological examination of molecular markers of fna biopsies from indeterminate thyroid nodules. thyroid hormone suppression is now a recognized treatment for patients with differentiated thyroid cancer. in 2002, the first meta - analysis was published regarding tsh suppressive therapy but included 10 studies with small series of patients. this meta - analysis concluded that treatment with high thyroxine doses was effective in decreasing recurrence but it had little importance with regards to the overall survival. then in 2006, a study stratified the effect of this therapeutic approach and found that this approach had no effect on survival in stage i low - risk patients, but patients staged ii, iii, and iv did have worse survival when tsh level was maintained more than 3 the revised ata guidelines state that in patients with persistent disease, the serum tsh should be maintained below 0.1 mu / l indefinitely in the absence of specific contraindications. they also added that in patients who are clinically and biochemically free of disease but who presented with high - risk disease, consideration should be given to maintaining tsh suppressive therapy to achieve serum tsh levels of 0.10.5 mu / l for 510 years but in patients free of disease, especially those at low risk for recurrence, the serum tsh may be kept within the low normal range (0.32 mu / l). they further mentioned that in patients who have not undergone remnant ablation who are clinically free of disease and have undetectable suppressed serum tg and normal neck us, the serum tsh may be allowed to rise to the low normal range (0.32 mu / l). moreover, british guidelines recommended that in those patients being treated with 131i, levothyroxine therapy should be added three days later, with the aim of suppressing serum thyroid - stimulating hormone (tsh) to 1 ng / ml, increased stimulated thyroglobulin > 10 ng / ml with cervical lns > 1 cm, positive radioiodine scan, and positive other imaging modalities including ct, mri, or pet, should be referred for additional therapies. on the other hand, based on expert opinion, british guidelines mentioned that serum thyroglobulin should be checked in all postoperative patients with differentiated thyroid cancer six weeks after surgery and stimulated thyroglobulin indicated 6 months after 131i ablation. they also added that postablation whole - body scan, done after stopping levothyroxine for four weeks, should be considered 310 days after 131i ablation. however, in low - risk patients, the measurement of stimulated thyroglobulin without a diagnostic 131i wbs may be adequate. in such cases, it was recommended that ultrasonography of the neck 612 months after thyroidectomy is indicated. as for the long - term recurrence, proposed by the british guidelines, annual clinical examination, annual measurement of serum tg and tsh, diagnostic imaging and fna as indicated are required. surgery in advanced thyroid carcinomas is the best modality used for recurrent neck metastases, since most recurrences are seen in the thyroid bed or regional lymph nodes. this is usually followed by further radioactive iodine, especially if the recurrence is radioiodine avid, along with thyroid hormone suppression. if the gross tumors are not radioactive iodine avid then further postoperative radioactive iodine will be of limited benefit. external beam radiotherapy (ebrt) may be an effective adjuvant therapy in patients with locally invasive papillary carcinoma who are 45 years of age and older [45, 46 ]. british guidelines noted that external beam radiotherapy can occasionally be used in patients with pt4 tumours (tnm staging) who have residual disease in the neck not amenable to surgery, especially in tumours not taking up 131i. in addition it was found to have a possible role as a palliative measure in patients with advanced local or distant disease. patients who are found to have brain metastasis can be treated with surgery which was found in one study to improve median survival from four to 22 months in patients who had 1 or more brain metastases. radioiodine therapy and/or external beam radiotherapy should be considered after surgical resection with the concomitant use of steroids. external beam radiation therapy (ebrt) or gamma knife radiosurgery and iv bisphosphonates has also been used for patients with painful bony metastasis [47, 48 ]. clinical trials should be considered the first - line therapy for patients who are considered to have nonavid radioactive iodine response. systemic chemotherapy has been tried in widespread progressive disease that is radioiodine resistant but has not been shown to be effective to date. several tyrosine kinase inhibitors have been tried until now with a partial response ranging between 13% and 50% [5052 ]. | thyroid cancer is among the most common endocrine malignancies. genetic and environmental factors play an important role in the pathogenesis of differentiated thyroid cancer. both have good prognosis but with frequent recurrences. cancer staging is an essential prognostic part of cancer management. there are multiple controversies in the management and followup of differentiated thyroid cancer. debate still exists with regard to the optimal surgical approach but trends toward a more conservative approach, such as lobectomy, are being more favored, especially in papillary thyroid cancer, of tumor sizes less than 4 cm, in the absence of other high - risk suggestive features. survival of patients with well - differentiated thyroid cancer was adversely affected by lymph node metastases. prophylactic central ln dissection did improve accuracy in staging and decrease postop tg level, but it had no effect on small - sized tumors. conservative approach was more applied with regard to the need and dose of radioiodine given postoperatively. there have been several advancements in the management of radioiodine resistant advanced differentiated thyroid cancers. appropriate followup is required based on risk stratification of patients postoperatively. many studies are still ongoing in order to reach the optimal management and followup of differentiated thyroid cancer. |
the consultation cases are stored in a web - based medical advisory service system (http://jamoon.pathology.or.kr) that revealed 1,950 cases sent to the mac from 2003 to 2014 (fig. we obtained the following specific information for each case : person who submitted the case, date on which the case was sent, assigned consulting pathologist, tissue of origin for the submitted case, and final diagnosis. after 46 cases with missing data were excluded from the review, 1,904 cases were reviewed and analyzed for this study. this study was approved by the institutional review board of konkuk university hospital (kuh1210045). although various institutions and individuals were allowed to use the services, all but nine consultations were requested by private health insurance companies or insurance adjustment companies. the major contents of the consultations were the same in most of the cases : what is the precise pathologic diagnosis of the patient s illness ? and which classification code should be given considering the biologic nature and behavior of the illness ? to obtain answers to these questions, the submitters asked that the surgical pathology or cytopathology slides and original pathologic reports be reviewed, and that the consulting pathologist clarify the degree of malignancy using an accurate disease classification code based on the international classification of diseases for oncology (icd - o) or the korean classification of diseases (kcd). the number of submitted cases between 2003 and 2014 is presented in fig. 2a. although there was some fluctuation between 2007 and 2013, the number of submitted cases has been significantly increasing over the 12 study years, from four cases in 2003 to 296 cases in 2014. the distributions of tissues of origin were slightly different throughout the years (fig. 2a, electronic supplementary table s1). the three most common tissues of origin from 2003 to 2014 were the colon and rectum (767, 40.3%), the urinary bladder (271, 14.2%), and the stomach (132, 6.9%). cases with these three tissues of origin comprised more than half of the entire set of submitted cases. the next most common tissues of origin included the breast, ovary, thyroid, and uterus. 2b shows the organ distribution of the 1,904 cases submitted from 2003 to 2014. among the 1,904 cases, the requests for 22 cases were not for a review of specific slides or pathologic reports. the contents of these consultations were questions about definition, biologic behaviors, or diagnostic methods for specific diseases. in 42 cases, submitters asked for a review of the cytopathologic diagnosis : two provided cervicovaginal smear slides, and 40 provided fine - needle aspiration slides of the thyroid. thus, we excluded these 64 cases. in 37 of the remaining 1,840 cases, advisors could not provide a conclusive diagnosis because submitters did not provide appropriate information such as adequate pathology slides, slides with sufficient tissue, or complete clinical information. we analyzed these cases based on tissue of origin (table 1, electronic supplementary table s2s21). for convenient presentation, we unified the diagnostic terms of neoplasms according to the most recently updated world health organization (who) classifications of tumors of each system. the two main diagnoses in this category were adenocarcinoma and neuroendocrine tumor (net), accounting for 42.5% (321 of 755) and 50.7% (383 of 755) of cases, respectively. the other 38.0% were early - stage tumors with only mucosal or submucosal invasion. in terms of net most of the cases in this category were urothelial carcinoma (from non - invasive papillary urothelial carcinoma to invasive urothelial carcinoma). the single most common entity was non - invasive papillary urothelial carcinoma, low grade, and it accounted for 70.7% (186 of 263) of the urinary bladder cases. the second - most common (29 of 263, 11.0%) was papillary urothelial neoplasm with low malignant potential. as a single entity, adenocarcinoma was the most common diagnosis of the cases in this category (46 of 127, 36.2%). adenocarcinoma in situ was also a frequent diagnosis (12 of 46, 26.1%), followed by gastrointestinal stromal tumor (gist) and net (40 of 127, 31.5% and 15 of 127, 11.8%, respectively). we were able to obtain the risk classification of 37 submitted gists based on the national institutes of health (nih) consensus criteria, including tumor size and mitotic activity. based on these criteria, tumors in the low risk group were the most common (13 of 40, 32.5%). electronic supplementary table s2s21 details the specific diagnoses of the remaining tissues of origin. for breast as the tissue of origin, the diagnoses varied from benign ductal epithelial lesions such as columnar cell change to invasive ductal carcinoma (electronic supplementary table s2). as a single entity, phyllodes tumor comprised the largest portion of the category (30 of 100, 30.0%). among these, borderline phyllodes tumor (19 of 30, 63.3%) based on the who classification was the most common diagnosis. female genital tissues, the ovary and uterus, were also common tissues of origin. in the ovary, surface epithelial neoplasm was the most common lesion (electronic supplementary table s3). forty of 95 cases (42.1%) were epithelial tumors, and half of these were borderline tumors. granulosa cell tumor was also a common neoplasm (33 of 95, 34.7%), with the ovary as the tissue of origin. in cases with the uterus as the tissue of origin, those of the cervix were slightly more common than those of the corpus (43 vs 33). among cases with the cervix as the tissue of origin, squamous cell carcinoma in situ (14 of 43) and microinvasive squamous cell carcinoma (12 of 43) together accounted for 60.5% of cases. among cases with the corpus as the tissue of origin, in particular, cases of smooth muscle neoplasm of uncertain malignant potential were more commonly submitted than other entities in this category (electronic supplementary table s5). the thyroid was the fifth most common tissue of origin, followed by the ovary. while the main intent of the consultation in cases with other organs as the tissue of origin was confirmation of the original diagnosis or classification of the disease based on classification system, the content of consultation in cases of thyroid origin was questions regarding methods for diagnosing papillary carcinoma. one of the main questions in these cases was whether a pathologist could provide a definite diagnosis of papillary carcinoma with only a fine - needle aspiration cytology (fnac) specimen. this question was included in the consultation of 34 cases. in 15 of these 34 cases, the consulting pathologists answered that experienced pathologists could confirm the diagnosis of papillary carcinoma without additional histologic confirmation. in the other 19 cases, the consultants replied that additional histologic confirmation was needed to confirm the diagnosis because of the possible discrepancies between the cytology reports and the surgical pathology reports. however, in the thyroid category, 46.0% of the users (40 of 87) provided cytology slides of fnac specimens. according to the bethesda system for reporting thyroid cytopathology, 31 of 40 cases belonged to category vi (malignant), and all of them were initially diagnosed as papillary carcinoma. nine of the 40 cases belonged to category v (suspicious for malignancy), and most of them were initially diagnosed as bone, soft tissue, and central nervous system were also common tissues of origin. in these categories, there was no predominant diagnosis, but a variety of rare tumors were submitted to confirm the original diagnosis (electronic supplementary tables s6, s7). most of the minor categories of tissues of origin such as head and neck, skin, kidney, and gallbladder included several minor diagnoses, without one predominant diagnosis. however, the mediastinum, small intestine, appendix, and pituitary gland had predominant diagnoses. most of the cases with the mediastinum as the tissue of origin were thymomas (26 of 30, 86.7%), and pituitary adenoma was the only diagnosis in cases with the pituitary gland as the tissue of origin (5 of 5, 100%). in the small intestine category, gist (13 of 24, 54.2%) and net (9 of 24, 37.5%) comprised most of the diagnoses. all submitted cases with the appendix as the tissue of origin were either net (7 of 10, 70.0%) or low - grade appendiceal mucinous neoplasm (3 of 10, 30.0%). across the entire dataset, regardless of tissue of origin, net of the digestive system was the most common diagnosis. adenocarcinoma of the digestive system was the next most common diagnosis (20.6%, 372 of 1,803). non - invasive papillary urothelial carcinoma from the urinary system was also frequently diagnosed, representing the third most frequent diagnosis and accounting for 20.0% (198 of 1,803) of the entire set of cases. the number of submitted cases between 2003 and 2014 is presented in fig. 2a. although there was some fluctuation between 2007 and 2013, the number of submitted cases has been significantly increasing over the 12 study years, from four cases in 2003 to 296 cases in 2014. the distributions of tissues of origin were slightly different throughout the years (fig. 2a, electronic supplementary table s1). the three most common tissues of origin from 2003 to 2014 were the colon and rectum (767, 40.3%), the urinary bladder (271, 14.2%), and the stomach (132, 6.9%). cases with these three tissues of origin comprised more than half of the entire set of submitted cases. the next most common tissues of origin included the breast, ovary, thyroid, and uterus. among the 1,904 cases, the requests for 22 cases were not for a review of specific slides or pathologic reports. the contents of these consultations were questions about definition, biologic behaviors, or diagnostic methods for specific diseases. in 42 cases, submitters asked for a review of the cytopathologic diagnosis : two provided cervicovaginal smear slides, and 40 provided fine - needle aspiration slides of the thyroid. thus, we excluded these 64 cases. in 37 of the remaining 1,840 cases, advisors could not provide a conclusive diagnosis because submitters did not provide appropriate information such as adequate pathology slides, slides with sufficient tissue, or complete clinical information. we analyzed these cases based on tissue of origin (table 1, electronic supplementary table s2s21). for convenient presentation, we unified the diagnostic terms of neoplasms according to the most recently updated world health organization (who) classifications of tumors of each system. the two main diagnoses in this category were adenocarcinoma and neuroendocrine tumor (net), accounting for 42.5% (321 of 755) and 50.7% (383 of 755) of cases, respectively. the other 38.0% were early - stage tumors with only mucosal or submucosal invasion. in terms of net most of the cases in this category were urothelial carcinoma (from non - invasive papillary urothelial carcinoma to invasive urothelial carcinoma). the single most common entity was non - invasive papillary urothelial carcinoma, low grade, and it accounted for 70.7% (186 of 263) of the urinary bladder cases. the second - most common (29 of 263, 11.0%) was papillary urothelial neoplasm with low malignant potential. as a single entity, adenocarcinoma was the most common diagnosis of the cases in this category (46 of 127, 36.2%). adenocarcinoma in situ was also a frequent diagnosis (12 of 46, 26.1%), followed by gastrointestinal stromal tumor (gist) and net (40 of 127, 31.5% and 15 of 127, 11.8%, respectively). we were able to obtain the risk classification of 37 submitted gists based on the national institutes of health (nih) consensus criteria, including tumor size and mitotic activity. based on these criteria, tumors in the low risk group were the most common (13 of 40, 32.5%). electronic supplementary table s2s21 details the specific diagnoses of the remaining tissues of origin. for breast as the tissue of origin, the diagnoses varied from benign ductal epithelial lesions such as columnar cell change to invasive ductal carcinoma (electronic supplementary table s2). as a single entity, phyllodes tumor comprised the largest portion of the category (30 of 100, 30.0%). among these, borderline phyllodes tumor (19 of 30, 63.3%) based on the who classification was the most common diagnosis. female genital tissues, the ovary and uterus, were also common tissues of origin. in the ovary, surface epithelial neoplasm was the most common lesion (electronic supplementary table s3). forty of 95 cases (42.1%) were epithelial tumors, and half of these were borderline tumors. granulosa cell tumor was also a common neoplasm (33 of 95, 34.7%), with the ovary as the tissue of origin. in cases with the uterus as the tissue of origin, those of the cervix were slightly more common than those of the corpus (43 vs 33). among cases with the cervix as the tissue of origin, squamous cell carcinoma in situ (14 of 43) and microinvasive squamous cell carcinoma (12 of 43) together accounted for 60.5% of cases. among cases with the corpus as the tissue of origin, in particular, cases of smooth muscle neoplasm of uncertain malignant potential were more commonly submitted than other entities in this category (electronic supplementary table s5). the thyroid was the fifth most common tissue of origin, followed by the ovary. while the main intent of the consultation in cases with other organs as the tissue of origin was confirmation of the original diagnosis or classification of the disease based on classification system, the content of consultation in cases of thyroid origin was questions regarding methods for diagnosing papillary carcinoma. one of the main questions in these cases was whether a pathologist could provide a definite diagnosis of papillary carcinoma with only a fine - needle aspiration cytology (fnac) specimen. this question was included in the consultation of 34 cases. in 15 of these 34 cases, the consulting pathologists answered that experienced pathologists could confirm the diagnosis of papillary carcinoma without additional histologic confirmation. in the other 19 cases, the consultants replied that additional histologic confirmation was needed to confirm the diagnosis because of the possible discrepancies between the cytology reports and the surgical pathology reports. however, in the thyroid category, 46.0% of the users (40 of 87) provided cytology slides of fnac specimens. according to the bethesda system for reporting thyroid cytopathology, 31 of 40 cases belonged to category vi (malignant), and all of them were initially diagnosed as nine of the 40 cases belonged to category v (suspicious for malignancy), and most of them were initially diagnosed as bone, soft tissue, and central nervous system were also common tissues of origin. in these categories, there was no predominant diagnosis, but a variety of rare tumors were submitted to confirm the original diagnosis (electronic supplementary tables s6, s7). most of the minor categories of tissues of origin such as head and neck, skin, kidney, and gallbladder included several minor diagnoses, without one predominant diagnosis. however, the mediastinum, small intestine, appendix, and pituitary gland had predominant diagnoses. most of the cases with the mediastinum as the tissue of origin were thymomas (26 of 30, 86.7%), and pituitary adenoma was the only diagnosis in cases with the pituitary gland as the tissue of origin (5 of 5, 100%). in the small intestine category, gist (13 of 24, 54.2%) and net (9 of 24, 37.5%) comprised most of the diagnoses. all submitted cases with the appendix as the tissue of origin were either net (7 of 10, 70.0%) or low - grade appendiceal mucinous neoplasm (3 of 10, 30.0%). across the entire dataset, regardless of tissue of origin, net of the digestive system was the most common diagnosis. adenocarcinoma of the digestive system was the next most common diagnosis (20.6%, 372 of 1,803). non - invasive papillary urothelial carcinoma from the urinary system was also frequently diagnosed, representing the third most frequent diagnosis and accounting for 20.0% (198 of 1,803) of the entire set of cases. the two main diagnoses in this category were adenocarcinoma and neuroendocrine tumor (net), accounting for 42.5% (321 of 755) and 50.7% (383 of 755) of cases, respectively. the other 38.0% were early - stage tumors with only mucosal or submucosal invasion. in terms of net most of the cases in this category were urothelial carcinoma (from non - invasive papillary urothelial carcinoma to invasive urothelial carcinoma). the single most common entity was non - invasive papillary urothelial carcinoma, low grade, and it accounted for 70.7% (186 of 263) of the urinary bladder cases. the second - most common (29 of 263, 11.0%) was papillary urothelial neoplasm with low malignant potential. as a single entity, adenocarcinoma was the most common diagnosis of the cases in this category (46 of 127, 36.2%). adenocarcinoma in situ was also a frequent diagnosis (12 of 46, 26.1%), followed by gastrointestinal stromal tumor (gist) and net (40 of 127, 31.5% and 15 of 127, 11.8%, respectively). we were able to obtain the risk classification of 37 submitted gists based on the national institutes of health (nih) consensus criteria, including tumor size and mitotic activity. based on these criteria, tumors in the low risk group were the most common (13 of 40, 32.5%). electronic supplementary table s2s21 details the specific diagnoses of the remaining tissues of origin. for breast as the tissue of origin, the diagnoses varied from benign ductal epithelial lesions such as columnar cell change to invasive ductal carcinoma (electronic supplementary table s2). as a single entity, phyllodes tumor comprised the largest portion of the category (30 of 100, 30.0%). among these, borderline phyllodes tumor (19 of 30, 63.3%) based on the who classification was the most common diagnosis. female genital tissues, the ovary and uterus, were also common tissues of origin. in the ovary, surface epithelial neoplasm was the most common lesion (electronic supplementary table s3). forty of 95 cases (42.1%) were epithelial tumors, and half of these were borderline tumors. granulosa cell tumor was also a common neoplasm (33 of 95, 34.7%), with the ovary as the tissue of origin. in cases with the uterus as the tissue of origin, those of the cervix were slightly more common than those of the corpus (43 vs 33). among cases with the cervix as the tissue of origin, squamous cell carcinoma in situ (14 of 43) and microinvasive squamous cell carcinoma (12 of 43) together accounted for 60.5% of cases. among cases with the corpus as the tissue of origin, in particular, cases of smooth muscle neoplasm of uncertain malignant potential were more commonly submitted than other entities in this category (electronic supplementary table s5). the thyroid was the fifth most common tissue of origin, followed by the ovary. while the main intent of the consultation in cases with other organs as the tissue of origin was confirmation of the original diagnosis or classification of the disease based on classification system, the content of consultation in cases of thyroid origin was questions regarding methods for diagnosing papillary carcinoma. one of the main questions in these cases was whether a pathologist could provide a definite diagnosis of papillary carcinoma with only a fine - needle aspiration cytology (fnac) specimen. this question was included in the consultation of 34 cases. in 15 of these 34 cases, the consulting pathologists answered that experienced pathologists could confirm the diagnosis of papillary carcinoma without additional histologic confirmation. in the other 19 cases, the consultants replied that additional histologic confirmation was needed to confirm the diagnosis because of the possible discrepancies between the cytology reports and the surgical pathology reports. however, in the thyroid category, 46.0% of the users (40 of 87) provided cytology slides of fnac specimens. according to the bethesda system for reporting thyroid cytopathology, 31 of 40 cases belonged to category vi (malignant), and all of them were initially diagnosed as nine of the 40 cases belonged to category v (suspicious for malignancy), and most of them were initially diagnosed as bone, soft tissue, and central nervous system were also common tissues of origin. in these categories, there was no predominant diagnosis, but a variety of rare tumors were submitted to confirm the original diagnosis (electronic supplementary tables s6, s7). most of the minor categories of tissues of origin such as head and neck, skin, kidney, and gallbladder included several minor diagnoses, without one predominant diagnosis. however, the mediastinum, small intestine, appendix, and pituitary gland had predominant diagnoses. most of the cases with the mediastinum as the tissue of origin were thymomas (26 of 30, 86.7%), and pituitary adenoma was the only diagnosis in cases with the pituitary gland as the tissue of origin (5 of 5, 100%). in the small intestine category, gist (13 of 24, 54.2%) and net (9 of 24, 37.5%) comprised most of the diagnoses. all submitted cases with the appendix as the tissue of origin were either net (7 of 10, 70.0%) or low - grade appendiceal mucinous neoplasm (3 of 10, 30.0%). across the entire dataset, regardless of tissue of origin, net of the digestive system was the most common diagnosis. adenocarcinoma of the digestive system was the next most common diagnosis (20.6%, 372 of 1,803). non - invasive papillary urothelial carcinoma from the urinary system was also frequently diagnosed, representing the third most frequent diagnosis and accounting for 20.0% (198 of 1,803) of the entire set of cases. the first type is the so - called institutional pathology consultation or second opinion of pathologic slides. this type of consultation is common in cases where a pathological diagnosis is made at one hospital, and subsequent therapy is provided at another. in such a situation, the pathologists at the new hospital are usually asked to review the original pathologic reports and slides to confirm the diagnosis. another type of consultation is usually requested by pathologists who encounter difficult cases. in such cases, this type of consultation is usually termed as an extra - departmental pathology consultation or a personal consultation. the ultimate purpose of these consultations is to improve diagnostic accuracy and provide the best treatment to patients. in general, first, we discovered the existence of another type of consultation for the accurate classification and coding of diseases for insurance reimbursement. except for nine cases, all consultation cases in the current study were submitted by private health insurance companies or insurance adjustment companies who were hired by patients or insurance companies. the main purpose of these consultations seemed to be adjustment of insurance payments based on the new disease codes. however, those studies were examining institutional or personal pathologic consultations with a medical purpose [10,11,13 - 15 ]. most prior studies have focused on the quality of consultations and diagnostic discrepancy between the primary pathologist and consulting pathologist. thus, this is the first study on pathologic consultation for the purpose of reimbursement of health insurance. in korea, the public sector of national health insurance covers only part of the entire medical expenditure ; therefore, most citizens purchase supplementary private health insurance. the national statistical office reported that more than 64% of individuals purchased private health insurance in 2010. as a result of this demand, the private health insurance market is growing rapidly. both public and private forms of coverage for medical expense reimbursement are based on the disease classification code assigned by clinicians based on the pathologic reports. regardless of the tissue of origin, net of the digestive system was the most common diagnosis (419 of 1,803). many doctors still use different guidelines in classifying nets, which might result in confusion in the clinical setting and coding.. used an internet - based survey and reported coding discrepancy among endoscopists when diagnosing nets in the lower gastrointestinal tract. when given the same pathology report of a g1 net of 1.5 cm size, with submucosal invasion, no lymphovascular invasion, a ki-67 index less than 1%, and a clear resection margin, 29.2% of endoscopists classified the tumor as malignant (-/3), 61.5% classified it as having uncertain behavior (-/1), and 8.9% classified it as benign (-/0). our study demonstrates that the disagreement of coding of tumors due to a lack of a unified and clear classification system could eventually affect insurance reimbursement and became a social issue. adenocarcinoma in situ of the colon and rectum and non - invasive urothelial carcinoma of the urinary bladder were two of the most common diagnoses in the consulted cases. in addition, the main request was determining the behavior codes of these tumors. in korea, the kcd is the standard disease coding system and was established after the translation of the icd by statistics korea to allow communication in a common language across clinical settings. the icd - o is a fundamental classification system for tumors, the coding of which constitutes a dual classification system for both topography (site) and morphology (histology, behavior, and grading of malignancy). the icd - o was originally developed for cancer registration, but it is also used by healthcare providers for quality control and by researchers for clinical trial recruitment, among other purposes. the revised icd - o-3 added a last fifth digit that represents the biologic behavior of tumors (table 2). the two most important characteristics of a malignant tumor are local invasion and distant metastasis. in actual practice, neoplasms with uncertain behavior (-/1) or carcinoma in situ (-/2) also exist. some malignant tumors can evolve from a pre - invasive stage referred to as carcinoma in situ, which means that the cancer cells display the cytologic features of malignancy without invasion of the basement membrane. the -/2 (in situ) tumors show more favorable behavior than the -/3 (malignant) tumors. based on this finding, private health insurances usually only reimburse 10% to 20% of the amount of reimbursement to patients with -/3 (malignant) tumors. however, the underlying concepts of these tumors can not be easily understood by patients because -/2 (in situ) tumors are also referred to as cancer in general. thus, in this kind of situation, patients should perhaps seek medical or legal advice to ensure that they are reimbursed correctly. the icd - o is a useful system for the purposes of an internationally unified principal of disease coding. however, it is difficult to ensure that doctors assign an identical code to the same tumor. this seems to be due to numerous co - existing classification systems and synonyms for the same tumor, and doctors have their own classification preferences. physicians also have their own viewpoints on the prognosis and biologic behavior of tumors based on experiences, and research, but these viewpoints could be changed. new forms of tumors and new opinions about tumor behavior are continuously being proposed. because the icd - o-3 was created for the statistical analysis of tumor prevalence and death rates sometimes it makes doctors confused when they give a code to the disease and causes coding discrepancies. these coding discrepancies between doctors might give rise to conflicts between patients and health insurance providers. even with the same condition, patients can receive different payments from insurance providers depending upon the code chosen by the clinician or that of the pathologist reporting the diagnosis. many patients and private health insurance providers recognize the possibility of discrepancies and therefore use advisory services such as the ksp or individual pathologists to obtain a more profitable diagnosis or classification code. we expect that this kind of situation will increase as the private health insurance market expands. through this review of 12 years of mas provided by the ksp, we have recognized that consultations associated with reimbursement of private health insurance account for a large proportion of pathologic advisory services, and that the coding of tumors is an important issue in korean society. in particular, the complex coding systems and coding discrepancies among clinicians and/or pathologists are problems that need to be solved. the best solution is to establish a better tumor classification and coding system that is able to reflect the biologic nature of tumors and is easily understood by non - experts. in order to accomplish this, pathologists must play a role, because the classification of tumors should be based on cytopathologic characteristics that best reflect the biologic nature of tumors. korean pathologists have been actively working toward this goal. in collaboration with the national cancer center, the ksp has participated in the confirmation of diagnostic terms ; standardization of diagnostic formats ; and clarification and assessment of multiple primaries, primary sites, icd - o codes, and education of pathologists. several study groups of the ksp have proposed behavior codes for several tumors with controversies regarding classification and coding [21 - 23 ]. thanks to these efforts, there were only a few discrepancies in coding of the same tumor among different subspecialty pathologists in this review (data not shown). however, a small proportion of coding discrepancies existed in certain tumors such as net and granulosa cell tumor of the ovary. these cases were mostly diagnosed and consulted before the unified guidelines were proposed by the ksp. we therefore presume that the effort of the ksp in proposing and presenting a simplified and unified classification and coding system is having a positive effect. nevertheless, this review of the mas of the ksp reveals that there are still problems with the classification and coding systems for neoplasms, and that they will continue to be important issues. therefore, we should persist in our efforts to focus attention on and further improve these areas. | background : since 2003, the korean society of pathologists (ksp) has been officially providing medical advisory services (mas). we reviewed the cases submitted to the ksp between 2003 and 2014.methods:in total, 1,950 cases were submitted, most by private health insurance companies. the main purposes of the consultations were to clarify the initial diagnoses and to assign a proper disease classification code. we comprehensively reviewed 1,803 consultation cases with detailed information.results:in spite of some fluctuations, the number of submitted cases has been significantly increasing over the 12 study years. the colon and rectum (40.3%), urinary bladder (14.2%), and stomach (6.9%) were the three most common tissues of origin. the most common diagnoses for each of the three tissues of origin were neuroendocrine tumor (50.7%), non - invasive papillary urothelial carcinoma (70.7%), and adenocarcinoma (36.2%). regardless of the tissue of origin, neuroendocrine tumor of the digestive system was the most common diagnosis (419 of 1,803).conclusions : in the current study, we found that pathologic consultations associated with private health insurance accounted for a large proportion of the mas. coding of the biologic behavior of diseases was the main issue of the consultations. in spite of the effort of the ksp to set proper guidelines for coding and classification of tumors, this review revealed that problems still exist and will continue to be an important issue. |
atherosclerotic lesions are the leading cause of ischemic stroke worldwide.1) the primary factor in the pathogenesis of atherosclerosis is inflammation. development and progression of an atherosclerotic plaque is mainly regulated by inflammatory and immune mechanisms.2) the risk of rupture of atherosclerotic plaques is more serious than the severity of stenosis caused by plaques.3) detection of early neutrophil infiltration in the atherosclerotic plaques allows prediction of the risk of plaque rupture.4) histopathological examinations of carotid artery plaques demonstrated that the rupture - prone lesions are associated with higher neutrophil count.5) in a study investigating the carotid endarterectomy (cea) specimens, coexistence of neutrophil infiltration and hemorrhage into the plaque was demonstrated particularly in the culprit zone of the carotid plaque.6) previous studies have shown that lymphopenia is one of the early markers that develop secondary to stress - related cortisol release in patients who have experienced a myocardial infarction.7) there is a negative correlation between lymphocyte count and cardiovascular prognosis.8)9) currently, neutrophil / lymphocyte ratio (nlr) is considered to be a good marker that simultaneously shows the negative effects of neutrophil elevation as an indicator of acute inflammation and lymphocyte depletion as an indicator of physiological stress, as well as it helps prediction of mortality and prognosis of stroke patients.10)11) plaque morphology is an independent risk factor for prognosis in coronary artery disease patients. after 78-months of follow - up, mortality rate among patients with calcified coronary plaques, mixed plaques and non - calcified plaques was shown to be 1.4%, 3.3% and 9.6%, respectively.12)13) coronary computed tomography angiography can provide reliable information on plaque morphology.14) embolism and stroke risks associated with calcified and non - calcified plaques in the carotid artery are different. histopathological examinations performed after cea have demonstrated that calcified plaques are more stable, and they carry a lower risk of rupture and thromboembolism.15) on the other hand, non - calcified and ulcerous plaques are more fragile and they carry a higher risk of rupture ; therefore they are associated with increased risk of embolism and stroke.16) severity of a carotid artery lesion is an important parameter that affects the risk of stroke. the risk of stroke increases with the severity of carotid artery lesion.17) in order to perform carotid artery intervention, the level of stenosis should angiographically be at least 50% in symptomatic patients and at least 70% in asymptomatic patients.18) in symptomatic patients, a plaque that causes 50% stenosis in the carotid artery may pose a risk of recurrent stroke and requires surgical intervention or placement of a stent. there is currently no test that can be used to predict the risk of stroke in asymptomatic patients with intermediate (50 - 70%) carotid artery stenosis. we believe that non - calcified plaques that cause asymptomatic intermediate carotid artery stenosis are more active in terms of inflammation and subsequent atherothrombosis ; therefore they may be associated with a higher risk of stroke than calcified plaques. the present study compares calcified and non - calcified plaques that cause asymptomatic intermediate carotid artery stenosis with respect to total neutrophil count, lymphocyte count and nlr. twenty - five patients were excluded from the study due to various reasons and the analyses were performed on the data obtained from 139 patients (fig. the patients were divided into two groups, as those having calcified (73 patients) and non - calcified (66 patients) plaques. patients with 50 - 70% stenosis of the carotid artery were included in the study. initially carotid doppler ultrasound (cdus) and then computed tomography angiography (cta) were performed in all patients. the study cohort consisted of patients who had been assessed by a team that included a neurologist, a cardiologist, a radiologist and a cardiovascular surgeon and who had been confirmed to be asymptomatic with respect to the carotid artery lesion. symptomatic patients were defined as those who experienced an ischemic cerebrovascular event with or without a sequel, a transient ischemic attack or amaurosis fugax within the last 6 months, and they were excluded from the study. patients with diabetes mellitus were examined by an endocrinologist and they were included in the study after their blood glucose levels had been regulated. patients were included in the study at least two months after initiation of antiaggregant, antihyperlipidemic and antihypertensive therapies. laboratory parameters that have been analyzed in this study represent the mean value of two measurements taken at different time points by using the same device. patients with a history of ischemic or non - ischemic stroke, systemic inflammatory disease, cancer, acute coronary syndrome, previous myocardial infarction, heart failure, significant valvular disease, chronic obstructive pulmonary disease, renal or liver failure, an hematological disease ; patients whose body temperature was 37 ; patients who had an active infection, white blood cell count (wbc) > 12.000 per l ; and patients who were using anti - inflammatory drugs or antibiotics were excluded from the study. fasting blood samples were drawn from a large antecubital vein of each patient for determination of biochemical and haemostatic parameters. total cholesterol, low - density lipoprotein, triglyceride and high - density lipoprotein levels were measured by colorimetric method (abbott laboratories, abbott park, il, usa). hypertension was defined as a systolic / diastolic blood pressure of 140/90 mmhg ; or patients using antihypertensive medications. diabetes mellitus was defined as a fasting plasma glucose level of 126 mg / dl or patients actively using oral antidiabetics and/or insulin. coronary artery disease was defined angiographically as the presence of a plaque resulting in 50% or more stenosis in a major coronary artery. body mass index (bmi) was calculated by dividing the body weight (kg) to the square of the height (m). cdus examination was performed using esaote s.p.a mylabclass c (florence - italy) device and a linear arrayed probe that allows selection of frequencies between 3 - 11 mhz. cta was performed using a ct device with the philips brilliance 64 detector (holland). after venous access was established through the antecubital vein and 80 ml non - ionic contrast agent was administered at a rate of 4.5 ml / sec, axial - plane ct images of the carotid and cerebral arteries were obtained using the tracking method. acquired slices were transferred to the work - station (philips intellispace portal) and multi - plane images, maximum intensity projection and volume rendering 3-dimensional images were developed by post - processing the original slices via appropriate software (ava). the stenosis caused by plaques as observed using cdus was assessed according to the criteria developed by the internal carotid artery stenosis criteria consensus committee. internal carotid artery plaque characteristics were evaluated by a 64 slice ct and plaque burden was evaluated according to the thickness of the plaque. the measurement of the stenotic arterial lumen was performed where it was the narrowest and in the thicker region of the plaque. the level of stenosis based on cta was evaluated according to the nascet (north american symptomatic carotid endarterectomy trial) criteria. based on the cdus and cta examinations, plaques that were fully soft and calcified less than 50% were categorized as non - calcified plaques whereas those that were fully hard and calcified more than 50% were categorized as calcified plaques. in other words, hyperdense plaques (containing more than 50% calcific component and a measured plaque density of more than 120 hounsfield units [hu ]) were regarded as calcified plaques, and hypodense plaques (containing less than 50% calcific component and a measured plaque density of less than 120 hu) were considered as non - calcified plaques.19) data were analyzed by the spss software version 15.0 for windows (spss inc., categorical variables were presented as frequency and percentage. the test and fisher 's exact test student 's t - test was used for variables with normal distribution and the values were presented as meansd. continuous variables without normal distribution were analyzed using mann - whitney u test and obtained values were presented as median (50) values and interquartile ranges (25 and 75). receiver - operating characteristic (roc) curves were drawn with sensitivity and specificity analyses. multivariate logistic regression analysis was used to evaluate the independent associates of the risk of non - calcified plaque. the odds ratios (or) and 95% confidence intervals (ci) were calculated. twenty - five patients were excluded from the study due to various reasons and the analyses were performed on the data obtained from 139 patients (fig. the patients were divided into two groups, as those having calcified (73 patients) and non - calcified (66 patients) plaques. patients with 50 - 70% stenosis of the carotid artery were included in the study. initially carotid doppler ultrasound (cdus) and then computed tomography angiography (cta) were performed in all patients. the study cohort consisted of patients who had been assessed by a team that included a neurologist, a cardiologist, a radiologist and a cardiovascular surgeon and who had been confirmed to be asymptomatic with respect to the carotid artery lesion. symptomatic patients were defined as those who experienced an ischemic cerebrovascular event with or without a sequel, a transient ischemic attack or amaurosis fugax within the last 6 months, and they were excluded from the study. patients with diabetes mellitus were examined by an endocrinologist and they were included in the study after their blood glucose levels had been regulated. patients were included in the study at least two months after initiation of antiaggregant, antihyperlipidemic and antihypertensive therapies. laboratory parameters that have been analyzed in this study represent the mean value of two measurements taken at different time points by using the same device. patients with a history of ischemic or non - ischemic stroke, systemic inflammatory disease, cancer, acute coronary syndrome, previous myocardial infarction, heart failure, significant valvular disease, chronic obstructive pulmonary disease, renal or liver failure, an hematological disease ; patients whose body temperature was 37 ; patients who had an active infection, white blood cell count (wbc) > 12.000 per l ; and patients who were using anti - inflammatory drugs or antibiotics were excluded from the study. fasting blood samples were drawn from a large antecubital vein of each patient for determination of biochemical and haemostatic parameters. total cholesterol, low - density lipoprotein, triglyceride and high - density lipoprotein levels were measured by colorimetric method (abbott laboratories, abbott park, il, usa). hypertension was defined as a systolic / diastolic blood pressure of 140/90 mmhg ; or patients using antihypertensive medications. diabetes mellitus was defined as a fasting plasma glucose level of 126 mg / dl or patients actively using oral antidiabetics and/or insulin. coronary artery disease was defined angiographically as the presence of a plaque resulting in 50% or more stenosis in a major coronary artery. body mass index (bmi) was calculated by dividing the body weight (kg) to the square of the height (m). cdus examination was performed using esaote s.p.a mylabclass c (florence - italy) device and a linear arrayed probe that allows selection of frequencies between 3 - 11 mhz. cta was performed using a ct device with the philips brilliance 64 detector (holland). after venous access was established through the antecubital vein and 80 ml non - ionic contrast agent was administered at a rate of 4.5 ml / sec, axial - plane ct images of the carotid and cerebral arteries were obtained using the tracking method. acquired slices were transferred to the work - station (philips intellispace portal) and multi - plane images, maximum intensity projection and volume rendering 3-dimensional images were developed by post - processing the original slices via appropriate software (ava). the stenosis caused by plaques as observed using cdus was assessed according to the criteria developed by the internal carotid artery stenosis criteria consensus committee. internal carotid artery plaque characteristics were evaluated by a 64 slice ct and plaque burden was evaluated according to the thickness of the plaque. the measurement of the stenotic arterial lumen was performed where it was the narrowest and in the thicker region of the plaque. the level of stenosis based on cta was evaluated according to the nascet (north american symptomatic carotid endarterectomy trial) criteria. based on the cdus and cta examinations, plaques that were fully soft and calcified less than 50% were categorized as non - calcified plaques whereas those that were fully hard and calcified more than 50% were categorized as calcified plaques. in other words, hyperdense plaques (containing more than 50% calcific component and a measured plaque density of more than 120 hounsfield units [hu ]) were regarded as calcified plaques, and hypodense plaques (containing less than 50% calcific component and a measured plaque density of less than 120 hu) were considered as non - calcified plaques.19) data were analyzed by the spss software version 15.0 for windows (spss inc., chicago, il, usa). student 's t - test was used for variables with normal distribution and the values were presented as meansd. continuous variables without normal distribution were analyzed using mann - whitney u test and obtained values were presented as median (50) values and interquartile ranges (25 and 75). receiver - operating characteristic (roc) curves were drawn with sensitivity and specificity analyses. multivariate logistic regression analysis was used to evaluate the independent associates of the risk of non - calcified plaque. the odds ratios (or) and 95% confidence intervals (ci) were calculated. a two - tailed p value of 2.54 was found for calcified - non calcified plaque discrimination among carotid arteries plaques which caused intermediate stenosis (area under curve [auc ] : 0.699, ci 95% 0.611 - 0.787, p 2.54, had 53% sensitivity and 84% specificity in calcified - non calcified plaque discrimination (fig. the multivariate logistic regression analysis including age, hypertension, diabetes mellitus, coronary artery disease, hyperlipidemia, statin use, bmi, acetylsalicylic acid (asa) use and nlr showed that the nlr was independently associated with non - calcified carotid plaques (or 5.686, 95% ci 2.498 - 12.944, p 2.54 was found in our study) may reflect a higher risk of stroke and such cases should be closely monitored. hemoglobin level was significantly lower in the non - calcified plaque group compared to the calcified plaque group. the reason for such a difference between the two groups with respect to hemoglobin levels is not clear. we believe this may be due to the higher rate of asa use in the non - calcified plaque group and the associated non - clinical gastrointestinal bleeding events. nlr can be affected by coexisting comorbidities and concomitant medical therapies, particularly by statins. in the present study, blood samples were obtained from all the analyzed patients after their comorbidities had been stabilized and they had regularly used medical therapy for at least 2 months. mean values of the parameters measured in the blood samples drawn at two different time points were analyzed. arrangements have been made to ensure that the hematological markers that are evaluated as the endpoints of this study reflect the actual values. an important factor that distinguishes the present study from previous studies is that in this study, carotid stenosis and plaques were assessed by both cdus and cta. cta is a more convenient method than magnetic resonance angiography and doppler ultrasonography for assessing the severity of carotid artery stenosis.29) occasionally, the degree of stenosis as demonstrated by cdus and by cta may be different. cta is a particularly reliable method to evaluate the nature of a plaque and extent of plaque calcification in carotid arteries.30) one of the limitations of this study is the lack of comparison between neutrophil and lymphocyte counts and the levels of other inflammatory markers. all of the comorbidities and environmental factors that might have affected the inflammatory markers were not taken into account. also, our findings may not reflect the outcomes in female patients since the majority of the study cohort was male. additional limitations of this study may be listed as it being a single - center study and its relatively small sample size. nlr is increased in the presence of non - calcified carotid artery plaques that cause asymptomatic intermediate stenosis. nlr may be used as a marker of the level of inflammation in carotid artery plaques, and consequently as a predictor of stroke risk. one of the limitations of this study is the lack of comparison between neutrophil and lymphocyte counts and the levels of other inflammatory markers. all of the comorbidities and environmental factors that might have affected the inflammatory markers were not taken into account. also, our findings may not reflect the outcomes in female patients since the majority of the study cohort was male. additional limitations of this study may be listed as it being a single - center study and its relatively small sample size. nlr is increased in the presence of non - calcified carotid artery plaques that cause asymptomatic intermediate stenosis. nlr may be used as a marker of the level of inflammation in carotid artery plaques, and consequently as a predictor of stroke risk. | background and objectivesnon - calcified carotid plaques are more unstable than calcified plaques, and they are associated with a higher risk of rupture, thromboembolism, and consequently, stroke. the purpose of the present study is to compare calcified and non - calcified plaques that cause intermediate carotid artery stenosis with respect to neutrophil / lymphocyte ratio (nlr).subjects and methodsa total number of 139 asymptomatic patients with 50 - 70% stenosis of the carotid artery were included in this study. carotid doppler ultrasound imaging and computed tomography angiography were performed to divide the carotid artery plaques into two groups as calcified and non - calcified. patients included in the calcified (n=73) and non - calcified (n=66) plaque groups were compared with respect to total neutrophil count, lymphocyte count and nlr.resultstotal lymphocyte count was statistically significantly lower in the non - calcified plaque group compared to the calcified plaque group (total lymphocyte count in non - calcified / calcified plaque groups [103/mm3 ] : 2.1/2.3, respectively) (p=0.002). nlr was statistically significantly higher in the non - calcified plaque group compared to the calcified plaque group (nlr in non - calcified / calcified plaque groups : 2.6/2.1, respectively) (p 2.54. multivariate regression analysis showed that nlr was independently associated with non - calcified carotid artery plaques (odds ratio 5.686, 95% ci 2.498 - 12.944, p<0.001).conclusionsnlr is increased in the presence of non - calcified carotid artery plaques that cause asymptomatic intermediate stenosis. increased nlr can be used as a marker to assess the risk of rupture of non - calcified carotid artery plaques. |
pyometra is a rare complication of in vitro fertilization and embryo transfer. in this paper a 30-year - old female, married for 7 years presented to our clinic with primary subfertility. she had a history of recurrent ovarian cyst on the left ovary for which both laparoscopic cystectomy and laparotomy had been done. a day 2 transvaginal ultrasound showed an antral follicle count of seven on the right side. six fertilized and three 8 cell embryos were transferred on the 3 day after egg collection. the sonologist reported a cystic mass in the left adnexa, which was suggestive of hydrosalpinx. eight eggs were retrieved, seven fertilized and three 8 celled embryos were transferred (day 3). twelve days after embryo transfer (et) she complained of pain in the lower abdomen and orange colored, odorless discharge per vaginum. on transvaginal ultrasound scan, the uterine cavity appeared to be distended with fluid and the endometrium was bright and echogeneic. the total white blood cell count was 4000 and the differential count was also within normal limits. a single intrauterine gestation was seen 5 days later and the fetal heart was documented a week later. the catheter was removed at this stage as there was minimal pus in the drain. the patient was discharged from the hospital and resumed antenatal care on the outpatient basis. she underwent regular first trimester screening for down 's syndrome, which was reported as low risk. she had impaired glucose tolerance at 20 weeks and was advised a diabetic diet, which she followed throughout her pregnancy. she had an elective cesarian at 39 weeks and delivered a healthy boy baby weighing 3.2 kg. it has been reported previously in patients after egg collection. at the time of diagnosis, the endometrium seemed bright and echogenic and the beta hcg was positive. a conservative approach was considered to be the patient was otherwise asymptomatic and there were no systemic features of infection (the blood counts were normal and blood culture was negative). the source of the collection was unknown. whether the recurrent cyst aspiration was contributory or was it due to fresh inoculation during et remained a mystery. there was a plan to perform a laparoscopy to identify the source and perform corrective surgery if there was no spontaneous reduction within a week or if systemic features were to manifest earlier. in view of the early viable pregnancy, however, as the pus was sterile and the patient parameters were stable a conservative approach was considered acceptable. there were suggestions to terminate the pregnancy as there were concerns if the pyometra could adversely affect the fetus and the mother. as the pregnancy was progressing well as assessed by serial ultrasound, no active interventions were thought necessary. however, orange colored vaginal discharge seemed out of place and she was called in for examination and ultrasound scan. this case also tells us those patients concerns however strange should not be summarily dismissed without proper evaluation. specific signs should be looked for, such as fever and masses with fluid levels on ultrasound in the uterus, adnexa or pelvis. the mechanism of post - ivf / et infection apart from direct inoculation of vaginal microorganisms by puncture through the nonsterile vagina, could also be due to reactivation of an old pelvic inflammatory disease, or through inadvertent direct puncture of the bowel with spillage. the most probable source of pus in this case was drainage of the hydrosalpinx and therefore an iatrogenic problem. if drainage of the pus is not adequate to eradicate the focus of infection, removal of the affected organ (salphingooopherectomy or hysterectomy) might be necessary. review of published literature showed case reports of pyometra in postmenopausal women ; and there are only two case reports of nontuberculous pyometra in the reproductive age group after ovum retrieval for ivf. biopsy in one of the cases revealed endometritis, while the other was negative for it. it has also been reported that early and reliable diagnosis of genital tuberculosis involving state of the art technology, such as dna polymerase chain reaction (pcr) and/or mrna - based reverse transcription - pcr (rt - pcr) ; and treatment before development of the fulminant genital tuberculosis has resulted in higher pregnancy rates. genital tuberculosis should thus be considered for differential diagnosis of pyometra in young infertile patients as it may aggravate the disease ; and resultant peritonitis, which may be life - threatening. a rare case of tuberculous pyometra in a young infertile female confirmed by mrna - based rt - pcr they concluded that a combination of high degree of clinical suspicion and high precision gene detection methods (e.g. mrna) in culture - negative cases may be useful in diagnosis of genital tuberculosis. most cases described in the literature are associated with failed ivf, and even if the procedure is successful, the rate of pregnancy loss is high. therefore if the condition is detected prior to et, consideration should be given to cryopreserving the embryos and treating the infection first, followed by a frozen et cycle. successful pregnancies have been reported following treatment cycles complicated by infection, even when surgical drainage has been required for resolution. the couple should be adequately counseled about the condition and should be involved in the decision making process. the fact that successful term pregnancy is possible after diagnosis of pyometra tells us that there is a role for conservative management in pregnancy as long as the maternal condition is stable. | a 30 year old woman presented 12 days after embryo transfer with lower abdominal pain and orange vaginal discharge. she was diagnosed to have pyometra. a conservative management with drainage of the pyometra was followed by an uneventful pregnancy and term delivery. conservative management in a case of pregnancy with pyometra needs close supervision to ensure maternal and fetal well being. |
the tongue plays a major role in swallowing and is essential to ensure normal swallowing function. the primary functions of the tongue include food mastication, bolus formation, manipulation, and propulsion into the pharynx1. moreover, it also contributes to respiration and speech functions2. during the oral stage of swallowing, the tongue squeezes food against the hard palate of the mouth, and moves the bolus from the anterior to the posterior region of the tongue for propulsion into the pharynx3. neurogenic disorders, such as a stroke or parkinson s disease, can lead to deficits in the sensory and motor functions of the tongue. this can further lead to dysphagia in both the oral and pharyngeal stages of swallowing, such as difficulties with the mastication and manipulation of food, vallecular and pharyngeal residues, and aspiration4, 5. therefore, sufficient tongue muscle strength is a determining factor for safe swallowing. pushing the tongue against the hard palate or against an external resistance, such as a tongue depressor, has been described as a basic strengthening exercise for the tongue6. however, in this basic approach for strength training of the tongue, the level of resistance and the volume of training stimulus parameters necessary to optimize strength outcomes are not systematically controlled. the iowa oral performance instrument (iopi medical llc, redmond, wa) is a standardized portable device that can be used to quantify tongue muscle strength, thus allowing the clinician to set the level of resistance necessary to achieve optimal gains in strength, and also providing visual feedback of performance to the patients to guide training7. in the present study, we aimed to evaluate the effectiveness of a resistance training program for the tongue in order to improve swallowing function in stroke patients with dysphagia. fifty stroke patients with dysphagia were eligible for this study, which was conducted from april 2015 to july 2015. the inclusion criteria for participation were as follows : 1) dysphagia from a stroke that was confirmed by a videofluoroscopic swallowing study (vfss), 2) onset duration > 6 months, 3) mini - mental state examination (mmse) score 24. the exclusion criteria were as follows : 1) previous stroke ; 2) severe orofacial pain including trigeminal neuropathy ; 3) significant malocclusion or facial asymmetry ; 4) severe communication disorder, such as severe aphasia. all participants provided written informed consent, and the study protocol was approved by the institution review board. this study was designed as a 6-week, single - blind, randomized controlled study. each eligible participant was randomly allocated to the experimental training or control group using opaque envelopes that contained codes specifying his or her group membership. both groups received traditional dysphagia therapy for 30 min per day, and the experimental group additionally received strength training for the tongue using the iopi. when we measured the pressure of the anterior tongue region, the bulb was positioned on the hard palate immediately behind the upper gingiva and touched the anterior 10 mm of the tongue dorsum. the subjects were instructed to press the bulb toward the hard palate with the tongue as hard as possible for 2 s. for the posterior tongue region, the bulb was placed on the anterior aspect of the posterior hard palate and the subjects were instructed to press the bulb in the same manner as described above. please press the bulb as hard as possible for 2 s. next, i will move it backwards a little further. the 1-repeated maximum contraction (i.e., 1 rm) for anterior and posterior elevation of the tongue was measured using the iopi. the training protocol of the experimental group was similar to that for the measurement of tongue strength, and resistance was set at the 80% level of maximal isometric tongue pressure. training was performed for 6 weeks at a frequency of 5 times per week and an intensity of 5 sets of 10 trials per day, amounting to a total daily volume of 50 repetitions each for the anterior and posterior regions of the tongue. a minimum rest period of 30 s was provided between sets, with longer durations considered to accommodate patients fatigue. trials in which the target training level was not reached were repeated to standardize the volume of resistance training. the effectiveness of the training was evaluated by comparing pre- and post - training measures. the iopi was used to determine baseline 1 rms of the anterior and posterior regions of the tongue for patients in both the experimental and control groups. the 1 rms were re - evaluated at the end of the 6-week training program. swallowing function was also evaluated at baseline and following the 6-week training intervention using the videofluoroscopic dysphagia scale (vds) based on videofluoroscopic swallowing study (vfss). the vds consists of 14 items, which can largely be categorized into an oral phase (7 items : lip closure, bolus formation, mastication, apraxia, tongue to palate contact premature bolus loss, and oral transit time) and a pharyngeal phase (7 items : pharyngeal triggering, vallecular residues, pyriform sinus resides, laryngeal elevation, pharyngeal wall coating, pharyngeal transit time, and aspiration). the score ranges from 0 to 100, and a higher score indicates a higher severity of dysphasia9. participant characteristics were analyzed using a statistical software program (spss statistics 20, ibm, armonk, ny), and descriptive statistics are presented as mean standard deviation. the shapiro - wilk test was used to check the normality of the outcome variables. to evaluate the effects of training, paired t - test independent t - test was used to compare the changes in outcome measures between the two groups. there were no significant differences between the baseline characteristics in the two groups (table 1table 1.characteristics of participantscharacteristicsexperimental group (n=15)control group (n=14)age (years) meansd (range)67.310.6 (5182)65.811.5 (5280)gender, male / female6/97/7etiologyhemorrhage86infarction78time since onset of stroke, weeks, mean sd (range)25.377.43 (1945)26.386.81 (1743)sd : standard deviation). the experimental group showed significant improvements from 18.93 6.75 to 20.73 6.61 for the anterior region, and from 16.2 4.69 to 18.47 4.09 for the posterior region. on the other hand, the control group showed improvements from 22 5.74 to 22.86 5.36 for the anterior region, and from 17.29 4.3 to 17.71 4.36 for the posterior region. however, the change in the control group was only statistically significant for the anterior region. no statistically significant difference in either the anterior or the posterior region scores was observed between the two groups after the intervention (table 2table 2.comparison of results between experimental group and control groupregionexperimental groupcontrol groupbefore treatmentafter 4-week treatmentbefore treatmentafter 4-week treatmentanterior region18.93 6.7520.73 6.6122 5.7422.86 5.36posterior region16.2 4.6918.47 4.0917.29 4.317.71 4.36the values are mean standard deviation. unit : pressurep<0.05, p<0.01 by paired t test between initial and final scores in the group). sd : standard deviation the values are mean standard deviation. unit : pressure p<0.05, p<0.01 by paired t test between initial and final scores in the group regarding the vds evaluation based on vfss, the experimental group showed statistically significant differences in both the oral and pharyngeal stages, as well as in the total score. on the other hand, the control group showed significant improvements in the vds score for the oral stage of swallowing and in the total score. no statistically significant difference in vds scores was observed between the two groups after the intervention (table 3table 3.comparison of results between experimental group and control groupitemsexperimental groupcontrol groupbefore treatmentafter 4-week treatmentbefore treatmentafter 4-week treatmentoral phase16.274.7214.674.4516.824.1116.644.13pharyngeal phase42.876.8540.776.1241.756.841.56.84total score59.1310.7455.439.3558.579.7558.149.83the values are mean standard deviation.p<0.05, p<0.01 by paired t test between initial and final scores in the group). p<0.05, p<0.01 by paired t test between initial and final scores in the group consequently, it has been considered as a remedial approach for improving swallowing functions. in this study, we aimed to confirm the effects of tongue resistance training on tongue muscle strength and overall swallowing function. our 6-week protocol involved a training resistance of 80% 1 rm and a volume of 50 repetitions each for the anterior and posterior regions of the tongue. the protocol yielded significant gains in strength in the anterior and posterior regions of the tongue, and improved function in both the oral and pharyngeal stages of swallowing. in general, the functional recovery of skeletal muscle increases rapidly within the first 6 months after a stroke10. a training intensity of 6080% 1 rm has been shown to be effective in improving the strength of skeletal muscles11. a very low resistance intensity will not provide sufficient loading of the muscle to stimulate increases in strength, whereas a very high resistance intensity will lead to fatigue and an inability to complete the volume of repetitions that is necessary to optimize strength gains. robbins.4 reported increases in tongue strength and volume / area in stroke patients following an 8-week resistance training program for the tongue, involving a training resistance between 60% and 80% 1 rm. based on these results, we assumed that a training stimulus of 80% 1 rm would be adequate when designing the present study. the effectiveness of the resistance - training program in improving the oral and pharyngeal stages of swallowing is an important and novel finding of our study. in the oral stage of swallowing, further, tongue strength and function are essential to squeeze food against the hard palate, both for movement of the bolus from the anterior to the posterior regions of the tongue and for propulsion into the pharynx. tongue strength is also important for creating a sufficiently high pressure within the oral cavity, to reduce the oral and pharyngeal transit time, vallecular residues, and risk of aspiration as a result of improved airway protection. steele.12 also suggested that tongue resistance training is an effective method for reducing aspiration and penetration. thus, increased tongue strength has a positive effect on the swallowing - related quality of life of stroke survivors. the effectiveness of resistance training for the tongue results from both a central (neural) and peripheral (muscle mass) effect13. in the present study, we confirmed that a structured resistance - training program was effective for producing gains in strength (1 rm) in the tongue. robbins.4 proposed that improvements in swallowing function with resistance training are the result of both the direct effects of training on strength and the effects of resistance training on the neuroplasticity of the neural circuits for swallowing, including collateral sprouting to areas affected by the stroke. first, the sample size was small ; future studies with larger sample sizes are therefore needed to generalize the results. second, the recruited participants included patients with relatively mild dysphagia who actively cooperated during training., our study provides evidence supporting the inclusion of resistance training of the tongue muscle in rehabilitation programs for stroke patients with dysphagia. the administration of this resistance training can improve tongue strength and general swallowing function. | [purpose ] the aim of this study was to evaluate the effectiveness of a structured program of resistance training for the tongue in order to improve swallowing function in stroke patients with dysphagia. [subjects and methods ] twenty - seven stroke patients with dysphagia were randomly divided into two groups. the experimental group participated in a resistance - training program involving a 1-repetition maximum, with an intensity of 80%, along with 50 repetitions per day each for the anterior and posterior regions of the tongue. both groups received conventional therapy for dysphagia for 30 min per day, 5 times per week, for 6 weeks. [results ] the experimental group showed statistically significant improvements in both, the anterior and posterior regions of the tongue. in contrast, the control group showed significant improvements only in the anterior region of the tongue. in the videofluoroscopic dysphagia scale evaluation, improvement was noted at both, the oral and pharyngeal stages in the experimental group, whereas significant improvements were only noted in the oral stage and total score in the control group. [conclusion ] our study confirmed that tongue resistance training is an effective intervention for stroke patients with dysphagia, offering improved tongue muscle strength and overall improvement in swallowing. |
after copii vesicles bud from the er, sar1p is released from vesicles when gtp is hydrolyzed, but the inner and outer shells of the coat are largely retained (fig s1)7. to define the events that occur after trappi binds to sec23p, we immobilized trappi on beads and asked when copii vesicles lose their ability to bind. for these studies, the binding of pro--factor - containing vesicles formed with cytosol, was considered to be 100% (fig. we observed that vesicles formed in the presence of golgi lost their ability to bind trappi (fig. since the binding of vesicles to trappi is mediated by the copii coat, this experiment suggests that copii vesicles lose their ability to bind trappi because the golgi contains a factor that either releases or modifies the coat. to determine if vesicles must tether to the golgi to lose their ability to bind to trappi, we formed vesicles with bet3 - 1 mutant fractions. the bet3 - 1 mutant, which harbors a mutation in the bet3p subunit of trappi, is defective in vesicle tethering6. the defect in this mutant is partially complemented in vitro by the addition of purified recombinant trappi (fig. vesicles formed from bet3 - 1 donor cells and cytosol, with or without golgi, bound equally well to the trappi - containing beads (fig. these findings suggest that the vesicles must tether to the golgi to lose their ability to bind to trappi. copii vesicle tethering requires trappi, ypt1p and uso1p5, 6. to determine when copii vesicles lose their ability to bind to trappi, we blocked vesicle tethering and fusion at several different steps in vitro in the presence of golgi membranes. the pro--factor - containing membranes, formed during these blocks, were then tested for their ability to bind to trappi. the transport incompetent vesicles that formed, when ypt1p function was blocked with anti - ypt1p antibody, bound efficiently to trappi (fig. disrupting ypt1p function should also block the recruitment to vesicles of the long coiled - coil tether uso1p (yeast ortholog of p115), a ypt1p effector that links donor and acceptor membranes to each other in vitro5. when we formed vesicles with fractions from the uso1 - 1 mutant, transport incompetent vesicles retained their ability to bind trappi at 27c and 17c (fig. we also blocked fusion in vitro with antibody directed against sec22p (snare) or sly1p, a sec1-like protein that binds to snares8. in vitro, neutralizing antibody to sly1p blocks trans - snare complex formation8. binding to trappi decreased when vesicles were formed in the presence of anti - sec22p or anti - sly1p antibodies (fig. these findings suggest that copii vesicles lose their ability to bind trappi after uso1p functions, but before trans - snare complex formation. uso1p does not appear to play a role in vesicle uncoating, as the membrane and soluble pools of sec23p were unaltered in the uso1 - 1 mutant in vivo (fig s3a) and uso1p / p115 did not release sec23 from membranes in vitro (see figs. together, these findings indicate that copii vesicles retain their coat until they reach the golgi. despite the fact that only 36 + / 0.65% of wild type vesicles uncoat in vitro in the presence of golgi membranes (fig. s3d), 61 + /4% of the vesicles lose their ability to bind to trappi (fig. this observation suggests that the inability of copii vesicles to bind trappi is not just a consequence of vesicle uncoating. because the copii coat inner shell is known to be phosphorylated in mammalian cells9, we considered the possibility that phosphorylation of sec23p may block the ability of copii vesicles to bind trappi. to identify a kinase that could phosphorylate sec23p only one kinase, hrr25p, was found to have an ortholog (cki, human ortholog of casein kinase i) that localizes at the golgi and er - golgi interface in mammalian interphase cells10. inhibiting cki function was reported to block er - golgi traffic11, and a mutation that reduced the kinase activity of hrr25p was shown to suppress the temperature - sensitive copii vesicle budding defect in the sec12 - 4 mutant12. while these results implicated hrr25p / cki in er - golgi traffic, its role in membrane traffic is not well defined. hrr25p is known to reside in the nucleus in g1 arrested cells and, like cki, it is found at the spindle pole body (spb) in nocodazole treated (m - phase) cells10, 13. when we visualized hrr25p - rfp (tagged genomic copy) in asynchronously grown cells, however, the majority (> 95%) was found on punctate structures that largely colocalize with early (vrg4p) and late golgi (sec7p) markers (figs. occasionally, we observed hrr25p - rfp in the nucleus, at puncta along the nuclear envelope (presumably the spb), and at the bud neck and cortex, as previously reported13, 14. consistent with its golgi localization, all of the ha - hrr25p co - fractionated with membranes in differential fractionation experiments (fig. 2b, s3f, compare lanes 1 and 2), but not catalytically inactive his6-hrr25p - k38a in vitro (figs. mutant, ha - tagged hrr25 was placed behind the inducible gal promoter as the sole copy of the gene. when this strain is grown in galactose, ha - hrr25p is expressed. in the presence of glucose, however, the expression of ha - hrr25p ceases and the protein is rapidly degraded. after 10 hr in glucose, when a delay in trafficking of carboxypeptidase y between the er - golgi was observed, most of the hrr25p was degraded (not shown). lysates prepared from the hrr25 mutant grown with galactose (+ hrr25p) or glucose (hrr25p) (fig. 2c, lanes 1 and 3), or igg (lanes 2 and 4). western blot analysis of the immunoprecipitates with anti - phospho ser / thr antibody revealed that phospho - sec23p and phospho - sec24p could only be detected in vivo when hrr25p was expressed (fig 2c, lane 1). since sec23p binds to both trappi and hrr25p, we determined if trappi and hrr25p compete for binding to sec23p. to do this, the 6 subunits of the trappi complex were co - expressed in bacteria and purified from bacterial lysates as described before6. when similar amounts of purified his6-hrr25p and trappi were incubated together, hrr25p effectively competed with trappi for binding to purified gst - sec23p (fig. binding was not dependent on kinase activity, as his6-hrr25p - k38a bound as efficiently as his6-hrr25p (not shown). since his6-hrr25p binds with higher affinity to gst - sec23p (kd= 0.043 + /0.009 m, fig. s4c), we determined if it displaces trappi that is pre - bound to gst - sec23p. increasing amounts of his6-hrr25p were mixed with gst - sec23p beads pre - incubated with saturating amounts of trappi (fig. when the concentration of hrr25p was increased (lanes 25), trappi was released from the beads (top panel, lanes 25) into the supernatant (bottom panel, lanes 25) as his6-hrr25p bound to gst - sec23p (middle panel). these findings show that hrr25p and trappi compete for binding to sec23p, and suggest that hrr25p could displace trappi from sec23p when copii vesicles tether to the golgi. consistent with the possibility that phosphorylation of the coat blocks the binding of trappi to sec23p, we observed a decrease in the binding of trappi to gst - sec23p that contained phosphomimetic mutations at two phospho sites (see below and fig. because hrr25p phosphorylates sec23p more efficiently than sec24p, we focused on sec23p for subsequent studies. three hrr25p phosphorylation sites were identified in sec23p by mass spectrometry : t555, s742 and t747. two of these phospho residues, s742 and t747, are conserved from yeast to man and were analyzed further (fig. the t747 residue is a known sar1p contact site, while s742 is within a disordered loop in the established structure of sec23p complexed with 23-sar1p - gtp (pdb : 2qtv)15. initially, we used computational modeling to predict the consequences of phosphorylation at these sites. we added phosphates on s742 and t747 of sec23p using molsoft - icm software and modified their orientations by several rounds of monte carlo optimization. phosphorylation at t747 presented significant steric clashes with the surface of sar1p in all possible orientations and was deemed incompatible with sec23p binding to sar1p - gtp (fig. phosphorylated s742 is also located at the sec23p - sar1p interface, but its location within a flexible loop limited our ability to predict consequences (fig 3a, bottom)15. s5a), and failed to bind gst - sec23p harboring the phosphomimetic s742d, t747e or s742d / t747e (st - de) mutations (fig. binding of his6-sec24p to gst - sec23p was unaffected by the phosphomimetic mutations (fig. if hrr25p phosphorylates sec23p at sar1p contact sites, the addition of his6-hrr25p to the transport assay should disrupt the binding of sec23p to sar1p - gtp and inhibit vesicle budding in vitro. when his6-hrr25p was added to the assay at the beginning of the reaction, budding was inhibited as the concentration of his6-hrr25p was increased (fig. inhibition was dependent on kinase activity, as no effect was seen with catalytically inactive his6-hrr25p - k38a (fig 3c). consistent with this observation, a yeast strain harboring the s742d / t747e mutations disrupted vesicle budding and fusion in vitro (fig. the defect in fusion may be the consequence of blocking the cycling of sec23p on and off membranes (see fig. 5a). since hrr25p phosporylates sec23p at sar1p contact sites, and hrr25p competes with trappi for binding to sec23p, we wanted to address if trappi also competes with his6-23-sar1p - gtps for binding to sec23p. when we incubated a constant amount of his6-23-sar1p - gtps with increasing amounts of trappi, trappi effectively competed with 23-sar1p - gtps for binding to sec23p (fig. similar results were obtained when increasing amounts of his6-23-sar1p - gtps were incubated with a constant amount of trappi (fig. these results imply that trappi and sar1p - gtp bind to the same or overlapping site(s) on sec23p. consistent with this hypothesis, we found a decrease in the binding of trappi to gst - sec23p harboring the s742d / t747e mutations (fig. s5b). together, these findings imply that trappi binds to sec23p after sar1p - gtp is released from membranes. 4b) since we could only detect bet3 on immuno - isolated tagged mammalian copii vesicles (vsv - g - myc) formed in vitro with gtp (sar1), but not gmp - pnp (+ sar1) or control vesicles that lacked vsv - g - myc. to address the role of hrr25p phosphorylation in er - golgi traffic in vitro, we used the atp competitive inhibitor ic261, which selectively inhibits the highly conserved kinase domain of ck111, 16. 4c, increasing concentrations of ic261 inhibited fusion. to address if ic261 inhibits membrane fusion or vesicle tethering, we formed vesicles in the presence of golgi with or without inhibitor, and then fractionated the reaction product on a sucrose velocity gradient that separates free vesicles (fig. most of the vesicles bound to the golgi in the presence of ic261, indicating that the inhibitor largely blocks fusion and not tethering (fig. interestingly, when the transport assay was performed with concentrations of ic261 that inhibited fusion, a stimulation in vesicle budding was observed (fig. this finding suggests that dephosphorylation is needed for budding and is consistent with an earlier report showing that phosphorylated mammalian sec24 can not form a pre - budding complex9. a prediction of this result is that loss of kinase activity should stimulate cargo release in vivo (see below) and could explain why a kinase loss of function mutation was identified as a suppressor of the sec12 - 4 mutant12. we were unable to address the role of ck1 in vitro because the mammalian copii vesicle tethering assay did not work robustly at the lower atp concentrations needed to test the inhibitor. to address if phosphorylation and dephosphorylation alter the distribution of sec23p on membranes in vivo, a differential fractionation experiment was performed with the conditional hrr25 mutant after growth in galactose or glucose containing medium. this analysis revealed the presence of a soluble pool of sec23p when ha - hrr25p was expressed (fig 5a, lanes 13). in the absence of ha - hrr25p, however, all of the sec23p was membrane - bound (fig. 5a, lanes 46). although hrr25p activity appears to play a role in releasing sec23p from membranes in vivo, we found it was not sufficient to uncoat the vesicles in the absence of golgi membranes in vitro (data not shown). in mammalian cells, copii vesicles fuse to each other or with copi (golgi) vesiclesto form a pre - golgi compartment that matures into a golgi17. to address the role of cki in vivo, we accumulated ts o45 vsv - g - gfp in the er of nrk cells at 40c and then shifted the cells in the presence and absence of ic261 to 15c, a temperature that selectively slows traffic at the pre - golgi compartment step18. in the presence of inhibitor, the pre - golgi (marked by rbet1) but not early golgi (marked by gpp130)was dramatically dispersed (fig. consistent with the observation that inhibiting ck1 function stimulates copii vesicle budding and blocks fusion, vsv - g - gfp was more rapidly depleted from the er and concentrated at peripheral sites of the pre - golgi compartment (figs. the vsv - g - gfp remained at the peripheral sites in the ic261-treated cells and failed to concentrate in the peri - golgi region (figs. together, these findings imply that the events we describe here are conserved in higher cells. the cki family of kinases represents a unique group of highly conserved serine / threonine kinases that regulate a variety of cellular processes, including membrane traffic11,12. here we report that sec23p, a component of the inner shell of the copii coat, sequentially interacts with three different binding partners, sar1p, trappi and hrr25p, to control the direction of er - golgi traffic. these interactions define three different stages in vesicle traffic : budding, tethering and a pre - fusion step. since sar1p is required for fission19,20, our findings imply that trappi can only bind to sec23p after vesicle fission and the release of sar1p from membranes (fig. this ensures that copii vesicle tethering is only initiated after a vesicle buds from the er. subsequently, trappi activates ypt1p on the vesicle (fig. 6, 2.). genetic studies and a kinetic analysis of gef activity have revealed that trappi is more than a gef21. trappi, however, forms a relatively stable ternary complex (trappi - ypt1p - nucleotide) with the rab21, implying that it is also a ypt1p effector. in parallel, the pool of ypt1p - gtp that is released from trappi can then recruit the long coiled - coil tether uso1p (fig. when uso1p bends, the vesicle comes into proximity with the golgi, triggering the release of trappi from the vesicle (fig 6, 3.). phosphorylation of the sec23p / sec24p complex by hrr25p may be required, but is not sufficient for copii vesicle uncoating. another kinase could also be involved in this event as sec31p, a known phosphoprotein22, appears to be phosphorylated by a different kinase12 and hrr25p can not uncoat copii vesicles in vitro. fusogenic snare motifs that bind to the coat must be unmasked before trans - snare complex formation can proceed at the target membrane3. phosphorylation of sec24p by hrr25p / cki could play a role in disengaging the snares from the coat at the golgi. as the copii coat only acts in anterograde traffic4, the compartmentalization of a kinase that regulates membrane fusion at the golgi, ensures an er - golgi v - snare will only pair with its cognate t - snare. the directionality imposed by this cycle also prevents the back - fusion of a copii vesicle with the er. the findings we report here describe a new role for hrr25p / cki that may extend to other cki family members and coats. yeast copii vesicles were formed in vitro with donor cells, cytosol, + / golgi for 90 min at 20c or 27c or 120 min at 17c as described before6. additional information is provided in the methods protein and antibody purifications were performed as before6. mass spec analysis, in vitro bindings assays, kinase and immunoprecipitation assays, microscopy, the construction of phosphomimetic mutations and all studies with mammalian cells are described in the methods. | how the directionality of vesicle traffic is achieved remains an important unanswered question in cell biology. the sec23p / sec24p coat complex sorts the fusion machinery (snares) into vesicles as they bud from the endoplasmic reticulum. vesicle tethering to the golgi begins when the tethering factor trappi binds to sec23p. where the coat is released and how this event relates to membrane fusion is unknown. here we use a yeast transport assay to demonstrate that an er - derived vesicle retains its coat until it reaches the golgi. a golgi - associated kinase, hrr25p (ck1 ortholog), then phosphorylates the sec23p / sec24p complex. coat phosphorylation and dephosphorylation are needed for vesicle fusion and budding, respectively. additionally, we show that sec23p interacts in a sequential manner with different binding partners, including trappi and hrr25p, to ensure the directionality of er - golgi traffic and prevent the back - fusion of a copii vesicle with the er. these events are conserved in mammalian cells. |
malakoplakia is a rare, chronic, granulomatous inflammatory disease that was first described by michaelis and gutmann in 1902. the name " malakoplakia " was derived from the greek " malakos " (soft) and " plakos " (plaque) in 1903 by von hansemann. malakoplakia is most commonly found in the urinary tract, but has been reported in the gastrointestinal tract, lung, brain, lymph node, adrenal, tonsil, conjunctiva, skin, bone, abdominal wall, pancreas, retroperitoneum, and female genital tract. malakoplakia is associated with many coexisitng conditions, such as organ transplantation, tuberculosis, sarcoidosis, allergic conditions, cytotoxic chemotherapy, acquired immunodeficiency syndrome, malignancies, steroid use, alcohol abuse, poorly controlled diabetes, ulcerative colitis, and malnutrition., we report a case of malakoplakia in an otherwise healthy 19-year - old female with a review of the literature. a 19-year - old female was referred to our hospital following the discovery of multiple polyps in the rectum with sigmoidoscopy. her clinical symptoms were recurrent low abdominal pain and loose stool with blood and foul odor 4 to 5 times a day for 3 months. when the patient was admitted, she was in relatively good condition with no specific past medical history and did not complain of fever, chill, anorexia, weight loss, or cold sweating. on physical examination, there were no definite abnormal findings except for mild epigastric tenderness and slightly increased bowel sounds. blood pressure was 110/76 mmhg, pulse rate 106 beats per minute, body temperature 36.3. laboratory tests revealed hemoglobin at 9.0 g / dl, white blood cell (wbc) count at 9,050/l with 26.6% neutrophils, 27.2% lymphocytes, 15.2% monocytes, and 0.8% eosinophils. a peripheral blood smear showed normocytic normochromic anemia, fe of 18 g / dl, total iron binding capacity of 286 g / dl, 0.8% reticulocytes, and stool occult blood over 1,000 ng / ml. inflammatory markers such as c - reactive protein (crp) and erythrocyte sedimentation rate (esr) were mildly elevated to 3.03 mg / dl and 42 mm / hr, respectively. urine analysis with microscopic exam showed no abnormality. stool acid - fast bacillus and tuberculosis polymerase chain reaction were negative, and gram stain showed wbc 10 to 25 and a number of gram - positive cocci and gram - negative bacilli. in the stool culture, salmonella or shigella was not isolated and blood cultures were negative. serum igg, ige, and hemolytic complement 50 (ch50) complement levels were slightly elevated to 1,800 mg / dl, 236 iu, and 54.2 u / ml, respectively. colonoscopy revealed very diverse circular or flat elevated mucosal lesions up to 10 cm in size from the cecum to the descending colon, small nodules, mass - like lesions, and erosive small polypoid lesions throughout the colon, particularly in the sigmoid colon (fig. after colonoscopy, we initially suspected atypical lymphoma or malignancy. however, lactate dehydrogenase and tumor markers such as carcinoembryonic antigen, ca 125, ca 19 - 9, and -fetoprotein were within normal range and an abdominopelvic computed tomography scan revealed no other abnormal findings, except for localized multiple small reactive lymph node enlargements along the mesentery. histological examination of colon lesion biopsies revealed dense histiocyte infiltration with round inclusions of varying sizes in the cytoplasm. many of these inclusions had round laminated structures with a central dark area and peripheral pale halo. these structures were stained with periodic acid - schiff (pas), alcian blue, prussian blue, and gomori methenamine silver stains to confirm the presence of michaelis - gutmann bodies with pathognomonic features of malakoplakia (fig. these diagnostic tests confirmed the diagnosis of malakoplakia. during antibiotic treatment, diarrhea and abdominal pain improved so she was discharged with instructions to take 500 mg ciprofloxacin twice a day, 25 mg bethanecol three times a day, and 60 mg ascorbic acid once a day by mouth. after the treatment started, the symptoms of abdominal pain and diarrhea disappeared in a week. after 2 months, crp, esr, and hemoglobin were nearly normal with values of 0.32 mg / dl, 2 mm / hr, and 12.5 g / dl, respectively. the patient remained on this regimen for 6 months. during the treatment period, no drug side effects were observed. previous abnormal colonoscopy findings were remarkably improved after 6 months of follow - up, and returned to normal after the end of 12 months (fig. the gastrointestinal tract is the second most common site of involvement by malakoplakia, and most of these cases involve the rectum and colon. clinical manifestation of colonic malakoplakia is very diverse, from asymptomatic to diarrhea, abdominal pain, rectal bleeding, intestinal obstruction, vomiting, malaise, fever, and constipation. endoscopically, malakoplakia commonly presents in the early stages as soft yellow to tan mucosal plaques or in the late stages as raised, grey to tan lesions in various sizes with peripheral hyperemia and a central depressed area. malakoplakia can be diagnosed by histology with the presence of the mineralized basophilic structures and michaelis - gutmann bodies. the etiology and pathogenesis of malakoplakia is still not fully understood, but multiple possible mechanisms have been suggested. the involvement of microorganisms is supported by reports of patients with malakoplakia who have chronic infections with various organisms such as escherichia coli, proteus, mycobacterium tuberculosis, and staphylococcus aureus. infections induced by the microorganisms mentioned above are much more common than malakoplakia ; therefore, other factors must contribute. malakoplakia may also be caused by a defect in lysosomal processing of microorganisms undergoing phagocytosis by macrophages or monocytes. therefore, incompletely digested microorganisms accumulate in lysosomes and lead to mineralization of calcium and iron salts on residual microorganism glycolipids. these michaelis - gutmann bodies can be intracellular or extracellular when stained with pas, prussian blue for iron, and von kossa for calcium. the assembly of microtubules is stimulated by cyclic guanosine monophosphate (cgmp) and inhibited by cyclic adenosine monophosphate (camp). both low cgmp level and reduced -glucuronidase activity have been reported in patients with malakoplakia. in this patient, we initially suspected atypical lymphoma, familial adenomatous polyposis, or other uncommon cancers because of a wide variety of mucosal lesions throughout the colon. we performed multiple random colonic biopsies to verify the diagnosis and, in all biopsies, michaelis - gutmann bodies characteristic of malakoplakia were observed. no definite infectious signs were checked, as the patient did not have any specific infectious disease such as pneumonia or otitis media in her childhood. we could not measure polymorphonuclear leukocyte function through stimulation by cgmp and inhibition by camp. there may also be a corrlation between immunosuppression or chronic prolonged iellness and malakoplakia because immunodeficient individuals and patients receiving chemotherapy or immmunosuppressive therapy for transplantation constitute a considerable portion of malakoplakia cases. furthermore, malakoplakia seems to be correlated with malignant neoplasms and systemic diseases, such as systemic lupus erythematosis, mycotic infections, liver diseases, sarcoidosis, ulcerative colitis, cachexia, and drug addiction. some authors hypothesized that the coincidence of malakoplakia with colonic and rectal adenocarcinoma might begin with local alteration of gut flora and advised physicians to carefully search for a colorectal neoplasm when malakoplakia appears histologically. however, the patient in this study was not immunocompromised and did not have any suspicious findings of autoimmune disease. generally, malakoplakia should be differentiated from crohn 's disease, military tuberculosis, sarcoidosis, whipple disease, chediak - higashi syndrome, and malignancies such as colon cancer and lymphoma. to rule out a particularly serious malignant disease and evaluate the response to treatment, follow - up colonoscopies with random biopsies were performed four times at 3, 6, and 12 months, and at 6 months after the end of treatment for a total follow - up period of 18 months. the first strategy is to increase the intracellular cgmp to camp ratio using cholinergic agonists such as bethanechol and ascorbic acid to improve lysosomal function. the second therapeutic strategy is to treat the presumed microorganism infection within the colon by antibiotics. the antibiotics trimethoprim / sulphamethoxazol, rifampicin, and particularly ciprofloxacin have all been used in the treatment of malakoplakia, because these are able to enter macrophages and contribute to intracellular microorganism death. the duration of treatment is not fixed, but long - term treatment is advised, although its efficacy still remains debated. according to the report, an underlying condition is the most crucial factor affecting malakoplakia mortality, and significant morbidity is related to the chronic underlying condition, which can resist local and systemic therapy. in this case, the patient 's symptoms improved very quickly after antibiotic treatment. since her symptoms and clinical results improved without aggravation after medical treatment, we speculated that she suffered from malakoplakia without coexisting disease and that immune maturation with aging might play a role. the etiology of colonic malakoplakia in this patient was unclear since there were no microorganisms in the stool and blood culture. the patient had no specific past medical history and was not immunodeficient, did not have a malignancy or any chronic illness, and was not in the most frequently affected age group. in korea, three cases of malakoplakia have been reported [8 - 10 ]. one of these cases was treated surgically, another treated by endoscopic polypectomy, and the last one treated medically. this is the first case of malakoplakia with very diverse mucosal lesions throughout the entire colon in a healthy young female with no associated disease. our case illustrates that when very diverse and atypical mucosal lesions are detected on colonoscopy, physicians should consider malakoplakia. | malakoplakia is a rare granulomatous disease that occurs commonly in the urinary tract and secondarily in the gastrointestinal tract. most reported cases of malakoplakia are associated with immunosuppressive diseases or chronic prolonged illness. here, we report a rare case of malakoplakia in a young healthy adolescent without any underlying disease. a 19-year - old female was referred to our hospital following the discovery of multiple rectal polyps with sigmoidoscopy. she had no specific past medical history but complained of recurrent abdominal pain and diarrhea for 3 months. a colonoscopy revealed diverse mucosal lesions including plaques, polyps, nodules, and mass - like lesions. histological examination revealed a sheet of histiocytes with pathognomonic michaelis - gutmann bodies. we treated the patient with ciprofloxacin, the cholinergic agonist bethanechol, and a multivitamin for 6 months. a follow - up colonoscopy revealed that her condition was resolved with this course of treatment. |
a practical catalytic method for enantioselective addition of an allene unit to aldimines is disclosed. transformations are promoted by an in - situ - generated b - based catalyst that is derived from a simple, robust, and readily accessible (in multigram quantities) chiral aminoalcohol. a range of aryl-, heteroaryl-, and alkyl - substituted homoallenylamides can be obtained in 6691% yield and 84:16 to > 99:1 enantiomeric ratio through reactions performed at ambient temperature and in the presence of 0.13.0 mol% of the chiral catalyst and a commercially available allenylboron reagent. the catalytic protocol does not require strict anhydrous conditions, can be performed on gram scale, and promotes highly selective addition of an allenyl unit (vs a propargyl group). the utility of the approach is demonstrated through development of succinct approaches to syntheses of anisomycin and epi - cytoxazone. |
|
a 48-year - old man presented with radiating pain to lower thoracic region for two years. a physical examination was unremarkable and he had no significant past medical history. plain radiographs of the thoracic spine revealed a lobulated geographic osteolytic lesion with a partially sclerotic border involving the left side of the t10 vertebral body, which continued up to involve the left side of the t9 vertebral body. the t9 - 10 disk space was narrow, suggesting disease involvement. also observed was a permeative osteolytic lesion involving the posterior part of the left 10th rib at the costo - vertebral junction, associated with a soft tissue mass (fig. the radiographic findings of the permeative osteolytic lesion and involvement of more than two bones, raised the possibility of malignancy, particularly the metastatic deposit. a ct scan revealed a well - defined osteolytic lesion with cortical expansion involving the left side of the t10, which continued up through the narrow t9 - 10 disk, and also involved the left side of the t9 vertebral body. the lesion caused spinal cord compression and involved almost the entire t10 vertebral body, mainly the posterior portion, along with the posterior part of the left 10th rib adjacent to the costo - vertebral junction. the soft tissue component also formed an extrapleural mass posterior to the thoracic aorta (fig. 1c - g). in this clinical setting, either infectious process, especially tuberculosis which is rather common in thailand or metastatic deposits was suspected. as a result, tests were performed to identify primary cancer. an ultrasound of the abdomen showed a normal sized liver without evidence of a mass or intrahepatic ductal dilatation. no remarkable finding was revealed after examining the pancreas, spleen, and both kidneys. the patient 's psa level was within normal limits (1.31 ng / l) and a transurethral prostatectomy specimen revealed benign prostatic hyperplasia. a peripheral blood examination revealed the following : wbc 8.2 - 15 k / ul (4.8 - 10.8), rbc 2.9 - 5.2 m/l (4.2 - 6.1), neutrophils 30 - 86% (40 - 74), eosinophils 23% (0 - 7), basophils 2% (0 - 1.5). excisional biopsies performed on the t9 and t10 vertebrae revealed multiple pieces of bone tissue and grey brown soft tissue (measuring 1.50.90.4 cm in t9 and 1054.5 cm in t10 in aggregate). microscopically, the lesion showed a circumscribed lobular lesion made up of a different sized gland - like or tubular structure lined with plump cuboidal cells and occasional hop - nail projections into luminal space. in addition, tall and enlarged endothelial cells imparting so - called ' tombstone - like features ' were seen projected into the lumen (fig. the lesion also illustrated the transition from solid cords to tubules forming lumens containing blood recapitulating vessel - formations. the immunostains of the lining cells showed strong immuno - reactivity for cytokeratin (ae1/ae3) and vascular markers cd31, cd 34, and factor viii - related antigen (fig. the epithelioid hemangioma should be considered as part of the differential diagnoses. a laminectomy and spinal fusion was performed and found that the disease was still stable after three years. according to the 2000 who classification, epithelioid hemangioma is recognized as a benign entity and separated from hemangioendothelioma which was considered a borderline or malignant lesion (1). the literature indicates that an epithelioid hemangioma of bone is rare and about one - fifth of cases showed multiple lesions, most of which were not located in contiguous bone (2). our case appears to be the first case showing continuous lesions involving three contiguous bones and may make it difficult to exclude malignancy and chronic infectious disease, especially tuberculosis which is quite common and can cause severe destruction of contiguous vertebral bone (3). as described by o'connell. (4), five out of 10 cases of epithelioid hemangioma showed complete osteolytic lesions with well - defined sclerotic borders ; the remaining five cases showed a mixed lytic and sclerotic appearance with partial cortical destruction and thick periosteal reactive bone formation. ben romdhane. (5) and rosai. (6) also reported well - defined lesions with sclerotic margins, while ling. our case is distinct from others because 1) the lesion involves three bones in contiguity : the t10 and t9 vertebral bodies including the left 10th rib, 2) two patterns of bone destruction were detected from a plain radiograph : the geographic (in the vertebral bodies) and the permeative osteolytic lesion (of the 10th rib), and 3) our case showed cortical bone destruction accompanied by a soft tissue component, but without a definite periosteal reaction. the differential diagnosis in the plain radiograph included a giant cell tumor, an aneurysmal bone cyst, a brown tumor, an infectious spondylitis, and metastatic deposits. the permeative osteolytic lesion that involved the left 10th rib included the possibility of an infection and metastasis which was more concerning. however, in the plain radiographs, we could not demonstrate that the lesions in the spine and the rib were continuous. it was the subsequent ct scan that showed the continuity and narrowed the differential diagnosis in our case to only include a chronic infectious process and metastatic deposits. although this imaging sign was absent in our case, spinal tuberculosis can not be entirely excluded due to the fact that 85% of the patients showed this sign, while the other 15% did not (8). we included metastasis in our differential diagnosis because of the permeative osteolytic lesion at the posterior portion of the left 10th rib in the plain radiograph. the rib lesion continued with the spinal lesion, and as a result, considered them as the same entity and proposed that metastasis might be included in the differential list, even though it is unlikely for metastasis to involve the intervertebral disk. regarding the findings of epithelioid hemangioma by ct scan, ling. (7) reported that a contrast - enhanced ct scan revealed an expanding lytic lesion involving the right anterolateral aspect of the t7 vertebral body. the lesion had a thin ossification rim at its extraosseous periphery, and also contained scattered calcifications and residual trabeculae. the remainder of the vertebral body exhibited generalized diffuse reactive sclerosis which was most prominent at the interface with the lesion. in our case, the findings differ in that the lesion did not have thin rim of ossification at its extraosseous periphery (fig. 1c - g). however, our lesion contained scattered tiny calcifications and internal trabeculations consistent with the findings in ling. the remainder of the vertebral body in our case showed normal vertebral density, which differed from the report by ling., it was unlikely for our case to be a paravertebral soft tissue lesion involving two adjacent vertebrae and a rib. 1e - g), that the bones showed expansion at the left posterior aspect of the t10 vertebral body and the posterior portion of the left 10th rib. these findings indicated that the lesions were originally intraosseous that expanded the bones, subsequently broke the cortex and formed the extraosseous component. the patient in this case study was followed up for about three years and found that the lesion was still stable. similar to other authorities, we believe that epithelioid hemangiomas can elicit bone resorption and cause local destruction in spite of being a benign lesion (6). since the lesion in our case appeared rather aggressive, it is noteworthy to be aware of a falsely malignant diagnosis to avoid unnecessary aggressive treatments. our case showed peripheral blood eosinophilia and it was also found in about half of the reported cases (2). this may provide a clue to clinicians to include this entity in the differential diagnosis when they encounter patients with coexisting blood eosinophilia and bone lesions. histologically, the lesion can mimic adenocarcinomas and other malignant vascular tumors including angiosarcomas and hemangioendotheliomas. both adenocarcinomas and epithelioid hemangiomas can yield positive immunoreactivity for cytokeratins, which are usual markers for epithelial tumors. however, in our case, in addition to showing positive for epithelial marker (ae1/ae3), they also exhibited a positive result for vascular markers (cd31 and cd34), which should not be positive in the case of an adenocarcinoma. the misleading diagnosis of this lesion as a case of adenocarcinoma is possible since the plump endothelial cells look quite similar to epithelial cells of an adenocarcinoma and this diagnostic pitfall might occur if only immuno - stainings for epithelial markers were performed. the rather well circumscribed lesion including the reactive phenomenon of markedly eosinophilic infiltration and lymphoid follicle formations in the surrounding tissue may be an additional feature to stimulate the awareness of this entity and to further prove it with aforementioned immunostains. some histologic viewpoints were considered in differentiating between an epithelioid hemangioma and a hemangioendothelioma (9 - 12) : 1) epithelioid hemangiomas tends to show circumscribed lesions, while hemangioendotheliomas often show infiltrative borders, 2) the cells in epithelioid hemangiomas tend to show a lumen formation imparting tubular structure whereas hemangioendothelioma often arrange in clusters, nests, and cord - like structure, 3) epithelioid hemangiomas often show an inflammatory reaction which is an especially prominent eosinophilic infiltration, while hemangioendotheliomas lack this feature, 4) hemangioendotheliomas often possess myxoid or hyalinized stroma, and 5) hemangioendotheliomas often lack plump endothelial cells protruding into the lumen imparting a ' tombstone - like ' feature. our present case lacks all of these features and therefore, the diagnosis of angiosarcoma is very unlikely (4, 9, 12). in conclusion, we report a case of an epithelioid hemangioma involving three contiguous bones and mimicked malignancy or chronic infectious disease in the plain film and ct imagings. the familiarity and awareness of such an entity also helps pathologists to make a correct diagnosis. | an epithelioid hemangioma involving three contiguous bones in continuity has, to the best of our knowledge, not been reported in the literature. a case of a 48-year - old man presented with radiating pain to the lower thoracic region for two years. a radiograph and ct scan revealed both permeative osteolytic and multiple trabeculated lesions involving the left posterior part of the 10th rib as well as the 9th and 10th vertebral bodies in continuity and was misled as a malignant or infectious lesion. the histopathology and immuno - histochemistry of the lesion confirmed the diagnosis of an epithelioid hemangioma. the lesion was still stable as of three years after surgery. |
the ability to develop and maintain highly functional memory t cells after infection or immunization is a hallmark of the adaptive immune response. however, the human memory t - cell pool is heterogeneous, and comprises distinct populations that can be distinguished based on homing markers and effector functions. cytokines have been shown to be essential for the long - term maintenance of functional cd8 and cd4 memory t cells. yet, cytokine - induced signaling can modulate phenotypic and functional characteristics of memory t cells [47 ]. in addition, chronic viral infections and autoimmune diseases have been shown to induce distinct phenotypic and functional changes within the memory t - cell pool. thus, antigens and cytokines dynamically shape the memory t - cell pool throughout life. so far, the role of the transmembrane glycoprotein cd5 in the process of memory t - cell differentiation and maintenance has not been addressed. cd5 surface expression is tightly regulated during t - cell development, with low levels expressed on immature, double negative cd4cd8 thymocytes, followed by an approximately sixfold increase in cd5 at the double positive cd4cd8 stage and a further three- to fivefold increase in cd5 expression on mature, single positive cd4 and cd8 thymocytes. all mature t lymphocytes and a subset of b cells, b-1a cells, express cd5. data from cd5/ mice indicate that cd5 acts as a negative regulator of cellular activation by being recruited into lipid rafts and dephosphorylating signaling molecules [1316 ]. recently, it has been demonstrated in mice that the level of cd5 on naive t cells does not correlate only with the strength of tcr - mediated signaling but also with the strength of responsiveness to cytokines, such as interleukin (il)15. furthermore, the level of the inhibitory molecule cd5 on naive t cells could be downregulated by cytokines, such as il-7 and il-21, which rendered the cytokine - primed naive t cells more responsive to antigenic stimulation. in this study we demonstrate that the expression of the inhibitory molecule cd5 is decreased during human memory t - cell differentiation and is associated with the strength of responsiveness to il-15. in addition, we show which environmental cues may be involved in regulating cd5 expression on post - thymic human memory t cells. all participants had given their informed written consent, and the study was approved by the ethics committee of the medical university innsbruck. cytomegalovirus (cmv) seropositivity was determined by enzyme - linked immunosorbent assay (elisa) using enzygnost (dade behring, vienna, austria). peripheral blood mononuclear cells (pbmc) were isolated by ficoll - hypaque density gradient centrifugation (amersham biosciences). paired blood and bone marrow (bm) samples were obtained from individuals who had given informed written consent and the study was approved by the ethics committee of the medical university innsbruck. bone from the iliac crest, which otherwise would have been discarded based on necessary bone molding / recontouring before insertion into other areas of the body, in particular facial regions was harvested at the department of cranio - maxillofacial and oral surgery at the medical university, innsbruck. exclusively bone biopsies from systemically healthy individuals who did not receive immunomodulatory drugs or who had diseases known to influence the immune system, including autoimmune diseases and cancer, were used. the bone biopsy samples were washed with complete mem (invitrogen, lofer, austria), fragmented, and treated with highly purified collagenase (worthington, lakewood, nj ; 20 u / ml) for 1 h at 37c. thereafter, collagenase - treated cells were centrifuged and bm mononuclear cells (bmmc) were purified by density gradient centrifugation (ficoll - hypaque ; amersham biosciences, vienna, austria). peripheral blood samples were obtained from 10 individuals who fulfilled the american college of rheumatology (acr) classification criteria for ra. median disease duration was 18 years (range 525 years), and 80% of the patients were positive for rheumatoid factor. the ra patients had moderate clinical disease activity (median disease activity score (das)-28 4.3 ; range 1.76.6) and were treated with methotrexate (n = 5), other conventional disease - modifying antirheumatic drugs (dmards) (n = 3), or tumor necrosis factor (tnf) blocking agents (n = 2). immunofluorescence surface staining was performed by adding a panel of directly conjugated mabs to freshly prepared pbmc and bmmc. the antibodies used were cd3 (pe - cy7 and apc - cy7), cd4 (percp), cd5 (pe and apc), cd28 (apc), cd45ra (apc), cd62l (apc - cy7), cd69 (pe), cd122 (pe), cd132 (pe), and tcr (pe) (all bd pharmingen, san diego, ca), cd8 (percp) (biolegend, san diego, ca), and ccr7 (fitc) (r&d systems, minneapolis, mn). the labeled cells were measured by a facscanto ii (bd biosciences, san diego, ca), and the data were analyzed using facsdiva software (bd biosciences, san diego, ca). cell culture experiments were performed with rpmi 1640 (invitrogen, lofer, austria) supplemented with 10% fcs (sigma - aldrich, vienna, austria) and 1% kanamycin sulfate (invitrogen, lofer, austria). to analyze the responsiveness of memory t - cell subsets to il-15, peripheral blood t cells were stimulated with il-15 (50 ng / ml ; sigma - aldrich, vienna, austria) for 4 days and cd69 was measured on cd8 and cd4 memory t - cell subsets. low expression of cd5 was defined by gating on the lower third of cd5-expressing t cells and the gating was confirmed by additional cd45ra and cd28 staining. thus, cd5 t cells had a cd45racd28 phenotype. to determine the regulation of cd5 expression, peripheral blood cd8 and cd4 t cells were labeled with the fluorescent dye carboxyfluorescein diacetate succinimidyl ester (cfse) as described previously and stimulated with il-15, 50 ng / ml for 7 days in the presence of irradiated autologous pbmc. by using flow - cytometric analysis, we could demonstrate that cd5 was highly expressed on central - memory cd8 t cells, whereas its expression was downregulated in cd45raccr7 and cd45raccr7 effector - memory cd8 t cells (fig. similarly, when using cd45ra and cd28 to characterize memory t - cell subsets, cd45racd28 effector - memory t cells displayed the lowest level of cd5 expression (figs. s1a and s1b). however, the expression of cd3 and tcr were not downregulated during cd8 memory t - cell differentiation (fig. the expression of cd5 was also downregulated during post - thymic memory t - cell differentiation (fig. s1c and s1d), whereas the expression of cd3 and tcr was not (fig. these results indicate that the expression of cd5 is not only regulated during thymic development, but highlight a role for cd5 during post - thymic cd8 and cd4 memory t - cell differentiation in human beings. cd5 has been shown to act as a negative regulator of cellular activation by dephosphorylating signaling molecules and to modulate cytokine responsiveness of naive cd8 t cells. we thus analyzed whether memory t cells with distinct cd5 levels differ in their responsiveness to il-15, which is known to be an important cytokine for memory t - cell survival and proliferative renewal. although memory t - cell subsets did not express cd69 in the absence of il-15 (data not shown), il-15 led to the upregulation of the activation molecule cd69 on cd8 and cd4 memory t cells and was inversely associated with the level of cd5 (figs. one explanation for the hyper - responsiveness of cd5 cd8 and cd4 memory t cells to il-15 could be that these cells have a higher number of cytokine receptors. however, this is unlikely, because there were no marked differences in the expression of the signaling chains cd122 (il-2r) and cd132 (c) between memory t cells with different levels of cd5 (figs. interestingly, a high expression of monosialotetrahexosylganglioside (gm) 1containing lipid rafts was associated with a high responsiveness to il-2 and il-15 in naive cd8 t cells and was directly correlated with the expression of cd5. accordingly, a recent study in human subjects demonstrated that central - memory cd4 t cells expressed a high membrane lipid order (gm1), whereas effector - memory cd4 t cells expressed an intermediate membrane lipid order (gm1). this indicates that the gm1 content directly correlates with the responsiveness to il-15 in memory t - cell subsets but inversely correlates with the level of cd5. we next analyzed which factors may contribute to the downregulation of cd5 on human t cells. we therefore stimulated purified, cfse - labeled cd8 and cd4 t cells with il-15 for 7 days. although cd8 and cd4 t cells did not proliferate in the absence of il-15 (data not shown), cd5 was progressively downregulated in proliferating cd8 and cd4 t cells stimulated with il-15 (fig. comparison of cd5 levels between cd8 t cells that have not proliferated (cfse) and cells that have undergone four or more cell divisions (cfse) demonstrated that il-15mediated signaling decreased the cd5 mean fluorescence intensity (mfi) by 21% (fig. similarly, cd5 was downregulated in proliferating cd4 t cells stimulated with il-15 and il-15mediated signaling decreased the cd5 mfi by 36% (fig. the bm has been shown to be a preferred site for il-15mediated proliferation of memory t cells and a higher expression of il-15 was identified in bmmc compared with pbmc. (moreover, cd4 and cd8 t cells were in close contact with il-15producing cells in the human bm. we therefore determined the expression of cd5 on memory t cells in the human bm. our results demonstrate that a higher number of cd5 cd8 and cd4 memory t cells accumulated in the human bm compared with peripheral blood (fig., our results highlight a so far unappreciated role for il-15mediated signaling in modulating the expression of the inhibitory molecule cd5, which is associated with the strength of responsiveness to il-15. intriguingly, as memory t - cell homeostasis is critically dependent on il-15dependent signaling, increased sensitivity of cd5 memory t cells to il-15 may explain the selective survival and/or expansion of cd5 memory t cells in the human bm. we next examined whether persistent infection with cmv, which is known to drive the accumulation of highly differentiated t cells, may alter the frequency of cd5 memory t cells in human beings. indeed, the number of cd5 cd8 and cd4 memory t cells was increased in cmv seropositive compared with cmv seronegative persons (fig., a higher percentage of cd5 cd4 memory t cells was identified in the peripheral blood of patients with ra compared with age- and cmv - matched healthy individuals (fig. our results indicate that persistent infection with cmv and pro - inflammatory autoimmune diseases, such as ra, characteristically shape the functional composition of the human memory t - cell pool by driving the accumulation of cd5 memory t cells. the lower expression level of cd5 on these highly differentiated memory t cells is also associated with an increased responsiveness to the homeostatic cytokine il-15, which may represent a survival advantage and may drive their accumulation in the bm. in the case of ra, il-15 is increased in the synovium and bm and may decrease the activation threshold of highly differentiated, il-15sensitive cd5 memory t cells, thereby contributing to increased t - cell activation and inflammation. | immunologic memory is a critical feature of the adaptive immune system to fight recurrent infections. however, the mechanisms that shape the composition and function of the human memory t - cell pool remain incompletely understood. we here demonstrate that post - thymic human t - cell differentiation was associated with the downregulation, but not loss, of the inhibitory molecule cd5. the sensitivity of human cd8 + and cd4 + memory t cells to interleukin (il)15 was inversely associated with the level of cd5 expression. cd5 expression was downregulated by il-15mediated signaling in vitro and cd5lo memory t cells accumulated in the bone marrow. persistent antigenic stimulation, as in the case of cytomegalovirus infection and rheumatoid arthritis (ra), was also associated with an increased number of cd5lo memory t cells. in conclusion, cd5 may be a useful marker to identify memory t - cell subsets with distinct responsiveness to the homeostatic cytokine il-15. |
tobacco use is one of the main factors that can lead to cancers of the oral cavity and pharynx. there are many types of smokeless tobacco products such as chew, chewpoos, chits, chewsky, dip, smokeless tobacco keratosis, flab, chowers, snuff dipper, guy, snus or nass, which can be used by placing and chewing a small amount of the substance between the cheek and gum or teeth. in europe and north america, chewing tobacco and snuff are two major products. both, moist and dry snuff exists in this area, such that moist snuff is usually used in scandinavia and the usa. it is generally placed under the upper lip, lower lip or kept in the buccal gingival area, but dry snuff is placed in the oral cavity or administered through the nose. snus (called nass in iran, afghanistan and pakistan) or swedish snuff is used by placing it under the lip for extended periods of time. it is a moist powder tobacco product produced from a variant of dry snuff in the early nineteenth century in sweden. this material is a mixture of pan prague, coarse grains and red trees along with tobacco leaf, lime, ash aromatic spices, saccharin and various oils. during recent decades, the use of smokeless tobacco has increased in the middle east, particularly among teenagers and young adults. the prevalence of smokeless tobacco in relation to age reflects major changes over the decades in the use of smokeless tobacco. in 1970, 2.2% of white male adults aged 18 to 24 years used chewing tobacco or snuff. the prevalence was higher at successively older ages, peaking at 11.8% among white men 65 years or older. in 1991, the age trends were reversed, with 10.4% of 18 - 24 year - olds using the products and fewer older persons using them : 7.9% of 25 - 34 year - olds, 5.4% of 35 - 44 year - olds, 3.8% of 45 - 64 year - olds, and 5.5% of individuals 65 years of age and older. the relation between use of smokeless tobacco and cancer was noted as early as 1761, when a british physician described nasal polyposes, probably nasal cancer in several of his patients, which he attributed to the use of snuff through the nose. the cancers often occurred precisely where tobacco had routinely been placed in the lower half of the mouth and in the buccal mucosa or gums. here we report a series of cases of squamous cell carcinoma and verrucous carcinoma occurring in the users of snus, who referred to the department of oral medicine in kerman dental school. a 78-year - old iranian female was referred to the department of oral medicine, kerman dental school, by her dentist for evaluation of an exophytic lesion on the right buccal mucosa, which had been noticed 2 months previously. in addition, the patient had a snus habit for the past 15 years in the right mandibular vestibule but no alcohol consumption. on examination, there was a tender firm exophytic lesion with induration, measuring 8 cm by 4 cm, on the right buccal mucosa. the surface of the lesion was verrucous with a white color and no associated lymphadenopathy [figure 1 ]. a exophytic lesion with measuring 8 cm by 4 cm at the right of the buccal mucosa. the surface of lesion is verrucous a diagnosis of verrucous carcinoma with differential diagnosis of a squamous cell carcinoma was made. under local anesthesia, histological examination of the excised tissue showed features of a poorly differentiated verrucous carcinoma. in view of the diagnosis of verrucous carcinoma, further investigations including chest radiography and hematological and biochemical blood tests yielded negative results. further, histological examination of the main specimen confirmed the presence of a verrucous carcinoma with parakeratin and the wide and elongated rete ridges that appear to push into the underlying connective tissue [figure 2 ]. a year later, the patient passed away despite removal of the lesion and a relatively good response to treatment. a verrucous carcinoma with parakeratin and the wide and elongated rete ridges that appear to push into the underlying connective tissue a 53-year - old female presented for routine examinations with his general dental practitioner, complaining of a sore area on the right side of the buccal mucosa, present for about 4 weeks. the patient had hypertension for the past 10 years and had become addicted to opium 15 years previously. she had a snus habit from 5 year ago in the right mandibular vestibule with no alcohol consumption. the practitioner diagnosed a leukoplakia and the patient was referred to the dental school for biopsy. in the intraoral examination, a 5 cm - diameter white verrucous area extended from the right buccal mucosa into the alveolar ridge, which was tender to palpation. the tissue proximal to the lesion was erythematous and atrophic in appearance with indurations [figure 3 ]. a verrucous area extended from the right buccal mucosa into the alveolar ridge, which tender to palpation. the tissue proximal to the lesion is erythematous and atrophic in appearance with indurations the lesion was biopsied and histological examination of the excised soft tissue showed features of a early squamous cell carcinoma with some cell degeneration, keratin pearls, nests and cords of malignant epithelial cells with wide cytoplasm, round or oval nuclei, with prominent nucleoli and mitotic figures [figure 4 ]. a early squamous cell carcinoma with some cell degeneration, keratin pearls, nests and cords of malignant epithelial cells with wide cytoplasm, round or oval nuclei, with prominent nucleoli and mitotic figures the patient underwent total excision of the lesion with reconstruction using a split skin graft. a 35-year - old female was referred urgently having presented to her general medical practitioner complaining of an ulcer on her tongue of about 2-month duration. the patient was complaining of an ulcer on the right side of her tongue, which had previously been asymptomatic but had begun to cause occasional discomfort as it increased in size. previous medical history revealed that the patient was suffering from hyperthyroidism. otherwise, her medical history was clear, and the patient had a snus habit for the previous 3 years in the right mandibular lingual vestibule. intraorally, there was evidence of a crater - like ulcer (prominent border and depressed base) on the right lateral border of the tongue extending into the dorsal surface of the tongue with a diameter of 6 cm, which was tender and indurated [figure 5 ]. a crater like ulcer on the right lateral border of the tongue that extending into dorsal surface of the tongue an incisional biopsy was performed, which revealed poorly differentiated squamous cell carcinoma histopathologically. ct revealed two abnormal nodes in the right submandibular region, which were needle - biopsied ; metastatic squamous cell carcinoma was detected. following surgery and radiotherapy an 82-year - old female, from zahedan province, was referred by her general dental practitioner in relation to a complaint of a growth in the lower right alveolar left region since 3 months previously. the patient had smoked up to 5 cigarettes per day for the past 20 years and had the habitual use of snus 4 - 5 times a day for the past 20 years in the left mandibular vestibule. a solitary submandibular lymph node was palpable on the left side, measuring 4 cm in size, which was tender and hard boney in consistency and fixed. intraorally, an ulcero - proliferative lesion was evident on the left mandibular ridge area, measuring about 4 5 cm in size. it was irregular in shape with rolled - out edges extending to the floor of the mouth. the lesion was tender on palpation with an indurated base ; in addition, there was evidence of a crater - like ulcer on the left vermilion border of the lip [figures 6 and 7 ]. an ulcero - proliferative lesion in the left mandibular ridge area a crater like ulcer on the left vermilion border of lip incisional biopsy of the lesion was performed, which provided a histopathological diagnosis of poorly differentiated squamous cell carcinoma. a 78-year - old iranian female was referred to the department of oral medicine, kerman dental school, by her dentist for evaluation of an exophytic lesion on the right buccal mucosa, which had been noticed 2 months previously. in addition, the patient had a snus habit for the past 15 years in the right mandibular vestibule but no alcohol consumption. on examination, there was a tender firm exophytic lesion with induration, measuring 8 cm by 4 cm, on the right buccal mucosa. the surface of the lesion was verrucous with a white color and no associated lymphadenopathy [figure 1 ]. a exophytic lesion with measuring 8 cm by 4 cm at the right of the buccal mucosa. the surface of lesion is verrucous a diagnosis of verrucous carcinoma with differential diagnosis of a squamous cell carcinoma was made. under local anesthesia, histological examination of the excised tissue showed features of a poorly differentiated verrucous carcinoma. in view of the diagnosis of verrucous carcinoma, further investigations including chest radiography and hematological and biochemical blood tests yielded negative results. further, histological examination of the main specimen confirmed the presence of a verrucous carcinoma with parakeratin and the wide and elongated rete ridges that appear to push into the underlying connective tissue [figure 2 ]. a year later, the patient passed away despite removal of the lesion and a relatively good response to treatment. a verrucous carcinoma with parakeratin and the wide and elongated rete ridges that appear to push into the underlying connective tissue a 53-year - old female presented for routine examinations with his general dental practitioner, complaining of a sore area on the right side of the buccal mucosa, present for about 4 weeks. the patient had hypertension for the past 10 years and had become addicted to opium 15 years previously. she had a snus habit from 5 year ago in the right mandibular vestibule with no alcohol consumption. the practitioner diagnosed a leukoplakia and the patient was referred to the dental school for biopsy. in the intraoral examination, a 5 cm - diameter white verrucous area extended from the right buccal mucosa into the alveolar ridge, which was tender to palpation. the tissue proximal to the lesion was erythematous and atrophic in appearance with indurations [figure 3 ]. a verrucous area extended from the right buccal mucosa into the alveolar ridge, which tender to palpation. the tissue proximal to the lesion is erythematous and atrophic in appearance with indurations the lesion was biopsied and histological examination of the excised soft tissue showed features of a early squamous cell carcinoma with some cell degeneration, keratin pearls, nests and cords of malignant epithelial cells with wide cytoplasm, round or oval nuclei, with prominent nucleoli and mitotic figures [figure 4 ]. a early squamous cell carcinoma with some cell degeneration, keratin pearls, nests and cords of malignant epithelial cells with wide cytoplasm, round or oval nuclei, with prominent nucleoli and mitotic figures the patient underwent total excision of the lesion with reconstruction using a split skin graft. a 35-year - old female was referred urgently having presented to her general medical practitioner complaining of an ulcer on her tongue of about 2-month duration. the patient was complaining of an ulcer on the right side of her tongue, which had previously been asymptomatic but had begun to cause occasional discomfort as it increased in size. previous medical history revealed that the patient was suffering from hyperthyroidism. otherwise, her medical history was clear, and the patient had a snus habit for the previous 3 years in the right mandibular lingual vestibule. intraorally, there was evidence of a crater - like ulcer (prominent border and depressed base) on the right lateral border of the tongue extending into the dorsal surface of the tongue with a diameter of 6 cm, which was tender and indurated [figure 5 ]. a crater like ulcer on the right lateral border of the tongue that extending into dorsal surface of the tongue an incisional biopsy was performed, which revealed poorly differentiated squamous cell carcinoma histopathologically. ct revealed two abnormal nodes in the right submandibular region, which were needle - biopsied ; metastatic squamous cell carcinoma was detected. following surgery and radiotherapy an 82-year - old female, from zahedan province, was referred by her general dental practitioner in relation to a complaint of a growth in the lower right alveolar left region since 3 months previously. the patient had smoked up to 5 cigarettes per day for the past 20 years and had the habitual use of snus 4 - 5 times a day for the past 20 years in the left mandibular vestibule. a solitary submandibular lymph node was palpable on the left side, measuring 4 cm in size, which was tender and hard boney in consistency and fixed. intraorally, an ulcero - proliferative lesion was evident on the left mandibular ridge area, measuring about 4 5 cm in size. it was irregular in shape with rolled - out edges extending to the floor of the mouth. the lesion was tender on palpation with an indurated base ; in addition, there was evidence of a crater - like ulcer on the left vermilion border of the lip [figures 6 and 7 ]. an ulcero - proliferative lesion in the left mandibular ridge area a crater like ulcer on the left vermilion border of lip incisional biopsy of the lesion was performed, which provided a histopathological diagnosis of poorly differentiated squamous cell carcinoma. the present study presented 4 cases of oral cancer occurring in the users of snus. oral carcinoma in these patients had occurred at anatomic locations where this material is routinely placed. a recent evaluation by the international agency for research on cancer (iarc) has confirmed that smokeless tobacco is also carcinogenic. a recent meta - analysis showed a two - fold increase in risk of oral cancer with the use of smokeless tobacco in the united states and canada, a five - fold risk increase for india and other asian countries and a seven - fold risk increase in sudan. no risk increase for oral cancer was shown with smokeless tobacco use in the nordic countries. in the uk and europe (with the notable exception of sweden) the use of smokeless tobacco is rare except in minority ethnic groups. in the usa, it is a major problem with 6% of the adult male population as regular users. in some areas, particularly the southern states, the prevalence is much higher with up to one - third of young men using smokeless tobacco. the primary cause of the very high incidence of oral cancer in south asia is the widespread habit of chewing betel quid (or paan) and related areca nut use (areca nut is the seed of the fruit of the oriental palm, areca catechu). chewing betel is thought to date back to at least 2000 years and worldwide an estimated 200 - 400 million people practice the habit. the components of the betel quid vary between different populations but the main ingredients are the leaf of the vine, piper betel, areca nut, slaked lime (calcium hydroxide) and spices. areca nut is carcinogenic to humans and the risk of oral cancer is increased with chewing of paan without tobacco, although the risk is higher for paan - containing tobacco. as with smoking tobacco, the risk is dependent on dose and duration of use. among asian communities in the uk, bangladeshis are the most likely to retain the habit of betel quid chewing with 9% of men and 16% of women using smokeless tobacco. therefore, smokeless tobacco use occurs in many cultures throughout the world, resulting in the incidence of oral cancers in these countries. for example, in india and other asian countries, smokeless tobacco in combination with areca nut, piper betel leaf, lime, and other ingredients has been strongly linked to oral cancer risk. recent carefully conducted studies outside of the us continue to indicate that tobacco used in a variety of unsmoked forms confers an oral cancer risk on the user. the extent of cancer risk might depend on the products or combinations of products used or the way the user takes the product. therefore, the risk of oral cancer increases with an increase in the product dose. snus (nass) or swedish snuff, is a moist tobacco powder product extracted from a variant of dry snuff in the early nineteenth century in sweden ; it is consumed by placing it under the lip for extended periods of time. nass is a mixture of tobacco, ash, cotton oil, and lime. in some areas where nass is taken orally, such as in the central asia, the prevalence of leukoplakia is high, and oral cancer incidence is moderately high relative to other former soviet republics. three studies were identified that have attempted to understand the cellular mechanisms involved in snuff - induced epithelial changes using oral tissues or cells. these studies examined the effect of swedish snuff on indicators of cellular proliferation (e.g., ki-67) and on tumor suppressor and differentiation markers (e.g., p53 tumor suppressor gene). this study shows overexpression of ki-67 protein and mutant tumor suppressor p53 protein in the biopsy samples from the snus users and no expression in the control biopsies. also, merne and colleagues evaluated the expression of proteins involved in cell proliferation (ki-67, pcna), cell cycle regulation (p53, p21), and keratins in biopsy specimens from 14 men with sil to 12 biopsy specimens from normal buccal mucosa of men who had never used any type of tobacco products. loose non - fermented scandinavian moist snuff and three were also using portion - packed snuff. in addition, in the assessment of the epidemiologic evidence on carcinogenicity of smokeless tobacco, it is of interest to consider some local effects in the oral cavity. oral leukoplakia is a common finding in snuff users and is sometimes referred to as snuff dipper 's lesion. there is a close correlation between exposure (duration and intensity) and prevalence, as well as severity of lesions. the prevalence of micronuclei and other nuclear anomalies is increased in the oral mucosa of snuff users, and the tumor suppressor gene p53 appears to accumulate in oral leukoplakias of snuff users. a large number of case reports have described oral carcinomas in smokeless tobacco users, occurring at anatomic locations where tobacco is routinely placed. in the mid-1980s, it was concluded from a large number of literature reviews that smokeless tobacco is a cause of oral cancer in humans. these evaluations relied on case reports and epidemiologic studies in humans and on laboratory studies demonstrating that n - nitrosamine compounds are present in high levels in smokeless tobacco and that these compounds produce cancer in laboratory animals. based on evidence from smokeless tobacco manufacturing statistics, the renewed popularity of smokeless tobacco among youth started in the late 1960s and early 1970s. concern has been expressed that this trend could lead to an epidemic of oral cancers among young men. a total of 6 case - control studies are available from sweden and the usa on oral snuff use and oral cancer. one early swedish study indicated an increased risk of buccal and gum cancer in snuff users. three of the us studies provided evidence of an association between snuff use and oral cancer. cohort studies on the use of snuff and oral cancer provide inconclusive evidence, but the interpretation is often difficult because of limited statistical power. the data from scandinavia and the us on smokeless tobacco and cancer of sites other than the oral cavity are relatively sparse. for carcinoma of the upper digestive tract and pancreas, excess risks have been reported, but the evidence is not conclusive. in india, afghanistan and pakistan, relative risks exceeding 10 may be observed in regular users, indicating that a substantial proportion of the oral cancers are attributed to the exposure in populations where the habits are widespread. in addition, two of their patients had other risk factors similar to smoked tobacco consumption and addicted to opium, which might probably cause oral cancer. although, cancer in these patients had occurred at anatomic locations where this material is routinely placed, oral cancer most commonly involves the tongue and floor of the mouth. evidence from human population shows that smokeless tobacco users have risks of cancer several times higher than those of nonsmokers. finally, preliminary work on cancers in other anatomic sites suggests that smokeless tobacco may also be related to other upper digestive tract cancers. | snus (nass) is a form of snuff used in a similar manner to american dipping tobacco, but it does not typically result in a need for spitting. possible hazards associated with this material include malignant and premalignant lesions in the oral cavity and gastrointestinal tract. the use of smokeless tobacco has increased in the middle east in recent decades, particularly among teenagers and young adults. therefore, practitioners must be able to recognize malignant and premalignant lesions. although, an estimated 10 - 25% of the world 's population uses smokeless tobacco, this practice is virtually unknown in iran. the aim of this study is to report a series of cases of squamous cell carcinoma and verrucous carcinoma occurring in the users of snus, who referred to the department of oral medicine in kerman dental school. |
no one is likely to argue with the belief that prompt and appropriate treatment is effective and should be the standard of care. back in 2001, emmanuel rivers and colleagues published their landmark study of early goal directed therapy (egdt). perhaps the central concept behind egdt is that of oxygen debt and the secondary inflammatory insult inflicted by tissue hypoxia, which is modifiable with timely and aggressive cardiovascular support. firstly, rivers and colleagues have published the results of a study of serum biomarkers of systemic inflammation from the majority of patients from their original study. second, the whole patient population has been stratified into three groups by severity of admission global dysoxia (serum lactate and central venous oxygen saturations) and compared. unfortunately, no third analysis of these three groups separated into those in the protocol and standard care groups was performed. although this post hoc separation would have yielded statistically small groups, the results may well have provided useful hypothesis generation rather than statistically significant results. the results of the treatment comparison analysis demonstrate a statistically significant reduction in the level of all markers in the protocol group. however, the time course and magnitude of this difference is markedly different between the substrates. egdt appears to obtund the early peak in interleukin 1 receptor antagonist and tumour necrosis factor alpha (although the baseline level was significantly higher in the protocol group). perhaps the most striking difference however was in caspase-3, a marker of cellular apoptosis, the level of which fell dramatically in the protocol group and remained at a much lower level throughout the 72 hours, suggesting that egdt reduced the secondary insult of oxygen debt. in the second analysis, unsurprisingly, the most dysoxic group at baseline had the highest and most persistently elevated levels of all the markers. also noteworthy is the late (after 24 hours) but dramatic rise in caspase-3 in the middle group. overall, this study provides additional and valuable biological plausibility to the oxygen debt hypothesis. since the original egdt trial, and following the advent of the surviving sepsis campaign, there have been a number of published studies demonstrating the benefits of early protocolised care in patients with severe sepsis and septic shock., they collected data for one year, on patients with septic shock attending their emergency department, then instituted egdt and collected data for a further year. they observed 79 patients in the data capture group and 77 in the egdt group. their patient population differed significantly from the original study, being not as sick at presentation, but despite this, they found a mortality reduction from 27% to 18%. protocolising care resulted in earlier administration of antibiotics, nearly twice as much crystalloid administration, a four times increase in the intubation rate and a doubling of vasopressor use in the first six hours. of note, 40% of the egdt group also received corticosteroids as compared to just 6% of the non egdt group. though no doubt, the criticism will be levelled at this study that the observed group received suboptimal care, what this, and all of the other studies in this area have demonstrated, is that raising the profile of sepsis and implementing a time critical approach to care improves outcomes. arguments about the elements of the protocol will no doubt continue as well, however, those with strong pro or con views would be best served by expending their time and energy designing and conducting clinical trials to provide an evidence base upon which to base future guidelines. with regard to one such debate, the choice of vasopressor in septic shock, annane and colleagues have published a prospective, multicentre, double blind, randomised control trial of epinephrine versus norepinephrine with dobutamine. this study found no difference between the groups in mortality at 7, 14, 28 and 90 days, or indeed, serial sequential organ failure assessment (sofa) score or a variety of haemo - dynamic end points. the study was prompted by limited evidence, and a physiological rationale, that norepinephrine, with dobutamine in the presence of a low cardiac index, is superior to epinephrine. firstly, they recruited and randomised patients, on average, two days after intensive care unit (icu) admission, during which crucial time period, a wide variety of supportive therapies had been used. secondly, the investigators were only able to recruit one third of eligible patients, as always, raising the issue of the representative nature of the study sample. thirdly, the power calculation for the study was based upon a mortality rate that far exceeded that observed in the study, thereby creating a significant chance of a type ii error. added to this, 95% of the study sample were intubated and ventilated with no agreed protocol on ventilation strategy, sedation or weaning, or indeed any other aspect of care with 19 units participating. mmol / l at study entry (after two days of icu care), no information regarding cardiac index except the somewhat arbitrary target of > 2.5 l / min / mand the decision to target a mean arterial pressure of 70 mmhg. given all of these concerns, the only hypothesis this study supports is that both inopressor strategies are equally effective at achieving the haemodynamic goals set. to add further evidence to the egdt strategy, sennoun and colleagues have published a study comparing different resuscitation strategies in a rat endotoxic shock model. they compared no treatment to fluid only, norepinephrine only, fluid and delayed norepinephrine and fluid with immediate norepinephrine. perhaps unsurprisingly, the fluid plus immediate norepinephrine group faired best, followed by the fluid plus delayed norepinephrine. both fluid alone and norepinephrine alone significantly ameliorated the endotoxic shock but to far less a degree than combined therapy. the model falls short of the complexities and heterogeneity of the clinical arena but supports two important ideas. secondly, conventional teaching that volume resuscitation should precede vasopressor support may, in fact, be bad dogma. continuing with the oxygen debt theme, much attention has fallen on the relative contributions of microcirculatory and mitochondrial failure in sepsis. with regard to the latter, piel and colleagues have published the first trial of a successful mitochondrial therapy in a mouse caecal ligation and puncture model. using a complex experimental design, the authors successfully replenished cytochrome c levels and activity in the mitochondria of mouse myocardium by exogenous administration of bovine ferrocytochrome c. the most compelling data comes from the left ventricular monitoring which demonstrated a > 45% increase in left ventricular work 30 minutes after injection of ferrocytochrome c in animals subjected to caecal ligation and puncture 24 hours previously. how long before this and related work reaches clinical trials in humans is unknown but might mitochondrial therapies yet prove to be the therapies that end the optimal inopressor debate ? staying in the realm of novel therapies, hydrogen may also be in icus in the future. my personal interest in hydrogen as a therapeutic gas was ignited (pardon the pun) by a paper by gharib and colleagues, who five weeks after infecting mice with schistosomiasis subjected half to two weeks of breathing a hydrogen oxygen atmosphere and half to nitrogen oxygen. the impracticality of repeating this study in any clinical setting, due to the explosive risk, relegated it to a fascinating but essentially irrelevant curiosity. however, it appears that hydrogen therapy can be safely administered and with impressive effects. a japanese group have published two papers demonstrating the therapeutic potential of hydrogen in ameliorating cellular injury caused by ischaemia and reperfusion. the rationale is that hydrogen is a potent scavenger of oxygen free radicals (considered major players in cellular damage) and, as the authors state, " unlike most known antioxidants, which are unable to successfully target organelles, it has favourable distribution characteristics : it can penetrate biomembranes and diffuse into the cytosol, mitochondria and nucleus. " in the first study, they performed a series of experiments starting with cell cultures and moving onto rats, whom they subjected to surgical occlusion of the middle cerebral artery for 90 minutes followed by reperfusion for 30 minutes. the groups received 0, 1, 2 or 4% hydrogen with the balance made up by nitrous oxide. the animals exposed to 2 and 4% hydrogen had dramatically reduced infarct volumes compared to the others, though interestingly the 2% group appeared to fair best. of note, hydrogen was only effective if administered during reperfusion. the authors helpfully state that hydrogen presents no risk of explosion at concentrations below 4.7%. to make it even more user - friendly they suggest an alternative method of administration by dissolving hydrogen in normal saline and giving it intravenously. the same group, in a separate paper, report an experiment in which they subjected mice to an ischaemic reperfusion injury to the left lobe of the liver. the results are equally dramatic with a marked reduction in cellular injury with increasing doses of hydrogen. this gentleman, who has been teaching clinical medicine for more than 30 years, has been inspired by the recent and widely discussed al gore global warming documentary. the inconvenient truths that dr reilly wishes to publicise surround the demise of clinical teaching. he offers some excellent advice, not only on how to talk the talk but also walk the walk, and for once i applaud the inventive use of stolen acronyms. egdt = early goal directed therapy ; icu = intensive care unit ; sofa = sequential organ failure assessment. | this issue 's recently published papers concentrates on early goal directed therapy, starting with new data from the original study through to new studies that may have a major bearing on the treatment of septic shock in years to come. a timely reminder about talking, walking and teaching clinical medicine completes the roundup. |
although pervasively widespread in the world, iron is the nutrient with a most pronounced deficiency in humans 1, 2 many remedial actions have been undertaken ; nevertheless, the problem persists for a number of reasons : unspecific diet supplements, poor dietary food combinations and low bioavailability in the iron - bearing products consumed 3 - 5 dietary iron occurs in two forms : 1) non - heme iron ; derived mainly from vegetable products, and 2) heme iron ; only found in products of animal origin 5, 6. heme iron is more easily absorbed in the diet than inorganic iron ; because the absorption process is different for each 7. there are experiences on the use of bovine and pig blood to exploit their high nutritional value and coincidentally eliminate a highly polluting effluent 8. these experiences show that a base product can be obtained with a high heme iron concentration and good bioavailability for direct consumption or food supplements 5, 9 - 11. for example, in 1993 walter 12, achieved this with biscuits ; pallares 13 added bovine blood to a cereal with milk ; aznar and gonzlez 14, developed a protein - mineral food supplement (trofin), using dried whole blood with hydrolyzed proteins as a base. many techniques are available for studying iron bioavailability, which can be classified as : in vitro studies and live studies depending on the model used the latter in either animals or humans 6. the in vitro studies are cheaper and permit a greater control over the experimental variables. the main limitation of these methods is that they can not simulate physiological states or some physical and chemical properties and adaptive responses that influence the bioavailability of iron 15. although recent methods have been developed attempt to correct these limitations and approach the absorption conditions in the small intestine 16. absorption studies in humans continue to be the gold standard in estimating the bioavailability of iron ; nevertheless, animals tests are often more practical for the prediction of nutrient bioavailability 6,17. the pig is considered a model that shares more human structure and function similarities than other animals. more variables can be measured, such as those related to the diet or growth rate. for these reasons, was chosen as the model for this study 18. the objective of this work was to evaluate the bioavailability of a heme iron concentrate product incorporated into a chocolate flavor biscuit filling. all analyses were performed by two replicates. a previous study (data not shown) used a factor - by - factor procedure 19, to evaluate several ingredients and formulas (hydrocolloids among them) ; from this the definitive one was selected, consisting of 9 ingredients (table 1). by means of the researchers ' direct observation and using an arbitrary scale (from 0 to 5), the spreadability, flow, colour, smell, flavor, adhesion, gumminess, firmness, cutting effort and radiance characteristics were measured. microbiological checks were applied during the process and to the end product, making measurements of total counts, enterobacteria, moulds and yeasts, salmonella spp. and the heme iron used for the fortification is a dark colour dust, obtained from animal blood from healthy pigs that have passed veterinary inspections satisfactorily in registered slaughter houses and hygienically collected after the addition of an appropriate anticoagulant. after the separation of the corpuscular fraction by centrifuging, a pressure pump is used to liberate the hemoglobin contained in the erythrocytes. the hemoglobin is later enzymatically hydrolyzed by a proteolytic enzyme (alcalase ; novo - nordisk. denmark) working within its specific conditions (ph 8,5 and 50c). afterwards, globin peptones were separated from the heme group enriched concentrate by ultrafiltration. protein, fat, humidity and ash were analyzed following the methodology proposed in the aoac 20 ; iron and zinc were measured by flame atomic absorption photospectrometer in a perkin - elmer photospectrometer, 2100 model 21. the sample size calculation and the study itself was made with 20 common pigs (sus scrofa domesticus), belgian pietrain ; females, 4 weeks old, with an average weight of 7 kg, that only received 100 mg of dextrane iron administration at birth with the intention of producing a slight iron deficiency at weaning. by means of random selection two groups of 10 piglets each this group was fed a low iron diet (452.7 mg / kg) and sandwich biscuits with a chocolate flavor filling with added heme iron. this group was fed normal food, which contained ferrous sulphate (537.1 mg / kg). the iron supplement was given during 20 weeks, making daily inspections, taking their weight and blood samples every fortnight, applying antiparasitic treatment as required and a veterinary check - up monthly. the blood samples were extracted from the superior cave vein after the pigs were tranquilized with azaperone (stresnil). 7 ml of blood was extracted, of which 3 ml was put in a tube with edta to make the red series analyses ; the rest of the blood (4 ml) was emptied into a tube with separating serum gel to make the biochemical analyses. the samples were transported from the farm to the laboratory refrigerated and they were immediately processed. the hematological measurements were made with an advia (tm) 120 (bayer diagnostics europe sl, 22, and the biochemical measurements with an cobas mira 89 (roche) chemical analyzing system, using the ferrozine iron a11a00091 abx commercial kit. the measurement of iron in the liver was made by atomic absorption spectrophotometer with perkin - elmer equipment, model 2100, using a sample taken immediately after slaughtering and deep frozen to -20 c until the analysis 15 days later. the end - point criteria for the experiment was either the existence of incapacitating or incurable disease or the completion of study (20 weeks) ; in both cases, slaughtering was done by administering sodium pentobarbital on the same pig farm 23,24. the statistical analysis was done with the spss 13.0 software. first, descriptive analysis was performed, using duplicate determination of initial and final values, and comparing independent averages of the results of both groups. a previous study (data not shown) used a factor - by - factor procedure 19, to evaluate several ingredients and formulas (hydrocolloids among them) ; from this the definitive one was selected, consisting of 9 ingredients (table 1). by means of the researchers ' direct observation and using an arbitrary scale (from 0 to 5), the spreadability, flow, colour, smell, flavor, adhesion, gumminess, firmness, cutting effort and radiance characteristics were measured. microbiological checks were applied during the process and to the end product, making measurements of total counts, enterobacteria, moulds and yeasts, salmonella spp. and escherichia coli. the heme iron used for the fortification is a dark colour dust, obtained from animal blood from healthy pigs that have passed veterinary inspections satisfactorily in registered slaughter houses and hygienically collected after the addition of an appropriate anticoagulant. after the separation of the corpuscular fraction by centrifuging, a pressure pump is used to liberate the hemoglobin contained in the erythrocytes. the hemoglobin is later enzymatically hydrolyzed by a proteolytic enzyme (alcalase ; novo - nordisk. denmark) working within its specific conditions (ph 8,5 and 50c). afterwards, globin peptones were separated from the heme group enriched concentrate by ultrafiltration. protein, fat, humidity and ash were analyzed following the methodology proposed in the aoac 20 ; iron and zinc were measured by flame atomic absorption photospectrometer in a perkin - elmer photospectrometer, 2100 model 21. the sample size calculation and the study itself was made with 20 common pigs (sus scrofa domesticus), belgian pietrain ; females, 4 weeks old, with an average weight of 7 kg, that only received 100 mg of dextrane iron administration at birth with the intention of producing a slight iron deficiency at weaning. by means of random selection two groups of 10 piglets each this group was fed a low iron diet (452.7 mg / kg) and sandwich biscuits with a chocolate flavor filling with added heme iron. this group was fed normal food, which contained ferrous sulphate (537.1 mg / kg). the iron supplement was given during 20 weeks, making daily inspections, taking their weight and blood samples every fortnight, applying antiparasitic treatment as required and a veterinary check - up monthly. the blood samples were extracted from the superior cave vein after the pigs were tranquilized with azaperone (stresnil). 7 ml of blood was extracted, of which 3 ml was put in a tube with edta to make the red series analyses ; the rest of the blood (4 ml) was emptied into a tube with separating serum gel to make the biochemical analyses. the samples were transported from the farm to the laboratory refrigerated and they were immediately processed. the hematological measurements were made with an advia (tm) 120 (bayer diagnostics europe sl, 22, and the biochemical measurements with an cobas mira 89 (roche) chemical analyzing system, using the ferrozine iron a11a00091 abx commercial kit. the measurement of iron in the liver was made by atomic absorption spectrophotometer with perkin - elmer equipment, model 2100, using a sample taken immediately after slaughtering and deep frozen to -20 c until the analysis 15 days later. the end - point criteria for the experiment was either the existence of incapacitating or incurable disease or the completion of study (20 weeks) ; in both cases, slaughtering was done by administering sodium pentobarbital on the same pig farm 23,24. first, descriptive analysis was performed, using duplicate determination of initial and final values, and comparing independent averages of the results of both groups. table 2 shows the composition of the filling formulated ; it may be observed that heme contribution of iron is 2,6 mg for each gram of filling, so a single biscuit containing 5 grams of product will contribute up to 13 mg of iron, covering 100% of the recommended iron intake for humans 25. the 14.1% protein content, being of hemoglobin and milk serum, is of high biological quality 26. the filling obtained was directly observed to have a creamy appearance, chocolate smell and flavor and appropriate spreadability. the expected values column 27 in table 3 gives some hematological reference parameters for piglets of similar ages and weights and, despite a relatively high variation coefficient, can be used as a guide to verify that the results obtained for most of the parameters studied were within the norm. we observed a high weight variation (variation coefficient 0.23), indicating a quite heterogeneous study group. given the heterogeneousness of the group, care was exercised to ensure randomness in the separation into groups. some differences can be noted ; nevertheless in all cases these were not statistically significant, therefore we can assume that the groups were not different and that the splitting process was satisfactory. of the total number of pigs when the study began, 6 died during the trial, 5 from control group (50%) and 1 from heme group (10%). there was a risk that the pigs that died shared a common differentiating characteristic compared to the survivors, thereby slanting the results. however, comparing the values of variables of both groups, we observed that although there were slight differences in some variables they had no statistical significance, leading us to consider that there was no factor which influenced mortality differentially in the study groups, since both were subjected to the same treatment and therefore the same stress, probably the cause of the high mortality 28 - 30. figure 1 shows the behavior of both study groups ' weights ; there was a slight not statistically significant difference between them from week 8 until week 13 (p>0,05) ; from which point the heme supplement group increasingly took off until the end of the study in week 20. both groups started with an average weight of 6.9 (1.6) kg ; but the increase was much greater in the heme group, their final weight being 56.7 kg, an increase of 49.8 kg. in contrast, the control group, whose final weight average reached 43.9 kg, an increase of 37 kg, giving a statistically significant (p<0.05) difference of 12.8 kg between the groups, and agreeing with the results obtained by perestrelo and perestrelo 31, who used amino - quelated iron in their supplement and concluded that it reduces mortality and improved growth. on average, the heme group pigs consumed 10.5 kg of sandwich biscuits (498 pieces), a total of 46,737 kcal, which, when converted to animal weight at the rate of 9,200 kcal per kg 32, gives a total of 5.1 kg of weight attributable to biscuit consumption. therefore, the actual difference exclusively due to the heme iron source were 7.7 kg (17.2%) in favor of the heme iron supplement group. table 4 shows the iron measured in tissues and subsequently calculated for each tissue, as well as the sum of each and the percentage relative to the total iron consumed by the pigs throughout the study, according to the supplement group they belonged to. we can observe significant differences between the groups with respect to iron in the blood, but not in the other body parts, although the heme group showed values higher than the ferrous sulphate supplement group as regards both the liver and hemoglobin. the difference in absorption percentage between the groups was significant (p<0.05) ; the absorption of heme iron was shown to be 23% superior to ferrous sulphate. in conclusion, the adverse characteristics of heme iron (dark colour, blood smell and flavor) can be transformed and exploited by its incorporation into a suitable base, which in this case was a chocolate flavored biscuit filling. mortality was less in the heme iron supplement group of pigs ; the weight also was greater in this group and there was a clear difference in favor of the heme iron group in the total measured iron averages ; although the heme group pigs consumed less iron ; therefore, we can conclude that the measured bioavailability of heme iron was greater than that of ferrous sulphate. | the objective of this work was to evaluate the bioavailability of heme iron added to biscuit filling. it comprised two stages : first, the development of the heme iron enriched biscuit filling ; second, the evaluation of the bioavailability of the mineral in fattening piglets. two groups were selected randomly and fed : a) low iron feed and biscuits with heme iron supplemented filling ; b) normal feed (with ferrous sulphate). weight and blood parameters were measured every fifteen days. averages were compared after duplicate analyses. the filling had a creamy appearance, chocolate taste and smell, appropriate spreadability, heme iron content of 2.6 mg per gram and a shelf - life of a month. the heme iron supplemented pigs registered a greater (p<0.05) weight gain (27.8% more than the control group). mortality in the heme iron group was 10%, compared to 50% in the control group. the amount of iron measured in the different compartment was greater in the heme group (3315 mg) than in the control group (2792 mg). however, the amount of iron consumed in the latter was greater. we show that an acceptable product with high heme iron content can be formulated, suitable for use as biscuit filling. the heme iron supplement produced better weight increase and lesser mortality in fattening pigs. the bioavailability of heme iron was 23% greater (p<0.05) compared to ferrous sulphate. |
as a service to our authors and readers, this journal provides supporting information supplied by the authors. such materials are peer reviewed and may be re - organized for online delivery, but are not copy - edited or typeset. technical support issues arising from supporting information (other than missing files) should be addressed to the authors | we describe a new platform to identify structure - switching dna beacon aptamers, which detect small molecules in a specific manner. by clonally amplifying a dna library designed to fluoresce in response to binding events onto microbeads, aptamer beacons can be selected by stringent fluorescence - assisted sorting. we validated this method by isolating known and novel anti - steroid aptamers from two separate dna libraries that were structurally enriched with three - way junctions. importantly, aptamers were retrieved in only a few (three) rounds of selection by this approach and did not require further optimization, significantly streamlining the process of beacon development. |
p - glycoprotein (abcb1/p - gp) is a member of the atp binding cassette (abc) superfamily and is able to transport a broad range of uncharged and cationic compounds. the apical localization of p - gp in renal proximal tubule epithelial cells is consistent with its importance in excretory transport into urine. in agreement with the detoxifying role of p - gp, we recently found an upregulation of p - gp in rat kidney during endotoxemia and in mouse kidney after ischemia reperfusion injury. p - gp is likely to be regulated by nitric oxide (no) produced by renal inducible no - synthase (inos), because co - administration of an inos - inhibitor attenuated the endotoxin - induced effects on its expression in rats. an upregulation of important efflux pumps, like p - gp, may diminish the accumulation of toxic compounds and serves a protective function in acute kidney injury. using killifish renal proximal tubules, we found previously that no has a regulatory role in the transport activity of multidrug resistance protein 2 (abcc2/mrp2) via an intracellular signaling pathway in response to the in vitro action of several nephrotoxic chemicals. this pathway involved at least endothelin (et) release, binding to the basolateral etb receptor, and activation of nos, soluble guanylyl cyclase (sgc) and protein kinase c (pkc). a similar regulatory pathway was found for p - gp in rat brain capillaries, where it was recently shown to be correlated with an innate immune response [7, 8 ]. the inflammatory mediator, tumor necrosis factor alpha (tnf-) signalled through the tnf - receptor 1 (tnfr1) to increase p - gp expression and transport activity by triggering the et - nos - pkc pathway, finally activating the nuclear factor kappab, nf-b. as nf-b was previously shown to be involved in p - gp increase during renal toxicity [2, 3, 9 ], we hypothesized that the same signaling pathway is responsible for the upregulation of p - gp in the kidney during endotoxemia and that no is the central player in the field. to test this hypothesis, we used a spontaneously immortalized rat kidney proximal tubular cell line and determined p - gp expression and activity after treating cells with endotoxin (lipopolysaccharide ; lps) or the most important pro - inflammatory cytokine, tnf-. our findings indicate that exposure to tnf- in combination with lps increases p - gp activity in renal proximal tubule cells under influence of no produced by inos. upon exposure to tnf- alone, p - gp upregulation seems to involve tlr4 activation and nf-b translocation, a pathway that is likely independent of no. these findings indicate that at least two different pathways regulate p - gp expression during endotoxemia. dulbecco 's modified eagle 's medium (dmem), hanks ' balanced salt solution (hbss), insulin - transferrin - selenium, and trizol reagent were from invitrogen life sciences (breda, the netherlands), fetal calf serum from mp biomedicals (asse - relegum, belgium), 4-(2-hydroxyethyl)-1-piperazine ethanesulfonic acid (hepes) from roche diagnostics (almere, the netherlands), calcein - acetoxymethylester (calcein - am) from molecular probes (eugene, or), bisindolylmaleimide (bim, bruschwig chemie, amsterdam, the netherlands), h398 from alexis (lausen, switzerland), antihuman toll - like receptor (tlr)4 cd284/md complex from biolegend (san diego, usa), and 1h-[1,2, 4]oxadiazolo[4,3, -a]quinoxalin-1-one (odq) and sn50 from calbiochem (nottingham, u.k.). the p - gp inhibitor, psc-833, was a gift from novartis pharma (valspodar, arnhem, the netherlands). all other chemicals were of analytical grade and purchased from sigma - aldrich (zwijndrecht, the netherlands) or merck (darmstadt, germany). the spontaneously immortalized epithelial cell line isolated from rat kidney proximal tubule (gerp cells) was a kind gift of the department of veterinary pharmacology, pharmacy and toxicology of the university of utrecht, the netherlands. these cells (passages 53201374) were cultured in collagen coated culture flasks in dmem supplemented with 5% fetal calf serum and 1% insulin - transferrin - selenium. we previously demonstrated that p - gp activity in these cells was highest just after reaching confluency and decreased with culturing time. cells were plated at a density of 40,00060,000 cells / well for 3 days in a 24-well plate. culture medium was replaced for medium alone (control group) or medium supplemented with the tested compounds : lipopolysaccharide (10100 g / ml lps, escherichia coli 0127:b8), or tnf- (1100 ng / ml), or the no - donor sodium nitroprusside (0.10.5 mm snp), or to a combination of lps and tnf-, with the no - scavenger 2-phenyl-4,4,5,5-tetramethylimidazoline-1-oxyl 3-oxide (0.010.5 mm ptio). the concentration tnf- relates to plasma levels that can be reached in patients with septic conditions. cells were also exposed to tnf- in combination with an inhibitor of sgc, odq, (0.01 mm), an inhibitor of pkc, bim, (100 nm), an inhibitor of tnfr1, h398, (10 g / ml), the anti - human tlr4, cd284)/md complex, (5 g / ml), the selective i kappa b kinase (ikk) inhibitor, imd-0354, (1050 m), or the peptide inhibitor for nf-b nuclear translocation sn50 (11.8 m). after treatment the transport activity of p - gp was determined with the calcein accumulation assay, as previously described. the activity was determined by calculating the ratio of cellular accumulation of fluorescent calcein in the presence and absence of the p - gp inhibitor, psc 833, and control cells were set to 100%. cells were exposed to medium (control), lps, tnf- or to a combination of lps and tnf- for various time periods (2, 6, 24 hours) and were, subsequently, harvested for rna isolation (for 5 minutes at 1300 g at room temperature). cell pellets were transferred in ice cold trizol reagent (invitrogen, breda, the netherlands) and rna was isolated as described previously. quantitative real time - pcr (rq - pcr) on cdna was performed according to the taqman protocol in optical tubes using either the abi prism 7700 single reporter sequence detection system (n = 6, applied biosystems, zwijndrecht, the netherlands) or the abi prism 7900ht gene expression micro fluidic card sequence detection system (3 pooled samples from 9 different rats, applied biosystems) according to the manufacturer 's instructions. all experiments were performed in triplicate. in rodents, two genes (abcb1a and abcb1b) encode for p - gp, however, during endotoxemia only abcb1b was found to be differentially expressed. different rat genes (gapdh : (rn99999916_s1), abcb1b : (rn00561753_m1), nosii : (rn00561646_m1), or ednrb / endothelin receptor b : rn00569139_m1) were amplified with a pre - developed gene expression assay, provided by applied biosystems. the relative expression of genes in control cells were normalized for the average cycle threshold (ct) value for the housekeeping gene, gapdh (ct = 15.9 1.0) and set to 1. for the analysis of tnf- receptor 1 (tnfr1), tnfr2, and toll - like receptor-4 (tlr4) mrna expression in gerp cells exposed for 24 hours to tnf-, pcr amplification was performed as previously described. gene - specific primers were purchased from biolegio (nijmegen, the netherlands) : rat tnfr1 (m63122 ; nt.983 - 1382), forward primer : gggattcagctcctgtcaaa, reversed primer (atgaactccttccagcgtgt ; (m63122, nt.704 - 1902) forward primer : tcccctgtaaggagaaacagaa, reversed primer : gctttttctccacaatcacctc. 579 - 1034), forward primer : gttctctgacaccacatcatcc, reversed primer : gtcaataggtgctgctgttcaa ; (af498039, nt.541 - 1242), forward primer : aatggaaacgtgatatgcagtg, reversed primer : gctacagacgttcacgatgc. rat tlr4 : (nm_019178, nt.2418 - 2546), forward primer : gagccggaaagttattgtgg, reversed primer : agcaaggacttctccactttct. the expected pcr products are : tnfr1-primer set 1 : 400 bp, tnfr1-primer set 2 : 1199 bp, tnfr2-primer set 1 : 456 bp, tnfr2-primer set 2 : 702 bp, tlr4 : 129 bp. the expression of the housekeeping gene -actin was measured as a control for the performed pcr reaction. cells were harvested after exposure to different inflammatory mediators and lysed with 0.1% triton x-100 supplemented with protease inhibitors (1 mm pmsf, 10 m e64, 1 g / ml pepstatin, 5 g / ml leupeptin and 1 g / ml aprotinin) during 30 minutes on ice. the amount of protein in cell lysates was determined with the bio - rad protein assay (bio - rad laboratories, hercules, ca) using bovine serum albumin as standard and samples were subjected to western blotting as described previously. samples were separated on a 6% sodium dodecylsulfate polyacrylamide gel and transferred to hybond - c pure nitrocellulose membrane (amersham, buckinghamshire, uk). the membrane was incubated overnight at 4c with the primary antibodies against inos (1 : 1000, according to), abcb1/p - gp (1 : 200, c219, dakocytomation, denmark), or -actin (1 : 10000, sigma - aldrich) in tris - buffered saline supplemented with 0.1% tween-20 (tbs - t) and 1% non - fat dried milk. subsequently, the membranes were washed three times in tbs - t, blocked in tbs - t containing 5% non - fat dried milk, washed three times in tbs - t again, and incubated with affinity - purified horseradish peroxidase - conjugated goat antirabbit igg (sigma - aldrich) for inos or goat antimouse igg (sigma - aldrich) for p - gp and -actin diluted 1 : 5000 in tbs - t for 1 hour at room temperature. the washing steps were repeated, after which the membranes were visualized with enhanced chemiluminescence (pierce chemical, rockford, il). for semiquantification, the pixel intensity of the bands was measured using scion image version beta 4.02 for windows (scion corporation, frederick, md)., san diego, ca, usa) and spss (version 12.0.1 for windows, chicago, il). differences between the experimental groups were tested using one - way anova with bonferroni 's correction or two - way repeated measurements anova. treatment of gerp cells with 10 g / ml lps and/or 10100 ng / ml tnf- for 24 hours resulted in an increase in p - gp activity (figures 1(a)1(c), p <.05). as 10 ng / ml is a clinically relevant concentration and a 10-fold higher tnf- concentration or combination of tnf- and lps did not further increase p - gp activity, we used a concentration of 10 ng / ml tnf- for additional experiments. in accordance, we also observed an upregulation in abcb1b expression after exposure to tnf-, lps, or a combination of tnf- and lps (figure 1(d)), which was accompanied by an increase in p - gp protein expression (figure 1(e)), suggesting de novo p - gp synthesis. this finding is in agreement with previous studies in mice and rats in which the upregulation of renal p - gp was demonstrated after in vivo lps exposure [2, 19, 20 ]. we previously suggested that p - gp is likely to be regulated by no produced by inos, as coadministration of aminoguanidine reversed the induction in inos, reduced renal damage and attenuated the endotoxin - induced effects on its expression in rats. in agreement, we show here that both inos mrna (figure 2(a), p <.001) and protein (figure 2(b)) are upregulated when cells are exposed to lps, either alone or in combination with tnf-. treatment with tnf- alone, however, only marginally induced nosii mrna, but had no effect on inos protein (figures 2(a), and 2(b)). to determine the no - dependency of the upregulation of p - gp, gerp cells were co - treated with the no - scavenger ptio or exposed to the no donor snp. indeed, the p - gp efflux activity was not significantly different from control anymore after co - treatment with ptio (figure 2(c)). remarkably, snp, did not affect abcb1b (data not shown) and p - gp protein expression (figure 2(d)) and its activity was slightly, though not significantly, upregulated after 1 hour exposure and 5 hours recovery (figure 2(e)). this is in contrast with previous findings demonstrating that no, released by the no donor s - nitroso - n - acetylpenicillamine, was able to upregulate p - gp expression in the human caco2 cell line. however, snp produces besides no also iron and cyanide, so it is not clear whether only effects of no on p - gp expression and activity were measured. in contrast to lps, our findings indicate that p - gp signaling seems largely no - independent after exposure to tnf-. in addition, this signaling pathway may be dependent on the type of cytokine as no mediated increased p - gp activity after stimulation with interferon-. furthermore, it was recently demonstrated that in vivo inhibition of nos and subsequent no production with l - name did not affect blood - brain barrier p - gp function during endotoxemia, which contradicts with previous in vitro findings in isolated rat brain capillaries [7, 8 ]. to dissect the signaling pathway through which exposure to tnf- increased p - gp expression and activity we used various pharmacological agents. since no is a well - known activator of sgc, which is in turn involved in the pkc signalling pathway, the effects of the sgc inhibitor odq (figure 3(a)) and the pkc inhibitor bim (figure 3(b)) on p - gp activity were examined. importantly, none of the two substances could prevent the upregulation of p - gp caused by tnf-, suggesting that a novel pathway mediates p - gp activity in gerp cells and/or that the no - sgc - pkc pathway is not activated in our cell line. this finding is in contrast with previous studies using killifish renal proximal tubules and brain capillary membranes [47 ]. lps signals through toll - like receptor-4 (tlr-4) and tnf- mediates their effect by binding to tnfr1 (p55) and tnfr2 (p75), which are known to be expressed in the kidney and their expression patterns are modulated during immune - mediated and ischemic renal injury [24, 25 ]. figure 4(a) shows that tnfr1 and tlr4 are expressed in the gerp cell line, whereas tnfr2 expression could not be detected. to confirm the results of the pcr analysis, we used inhibitors of and/or antibodies against tnfr1 (h398, figure 4(b)) and tlr4 (anti - tlr4, figure 4(c)) and determined p - gp activity. exposure to h398 could not prevent the upregulation of p - gp by tnf-, suggesting that although tnfr1 is expressed in gerp cells it may not be involved in p - gp regulation (figure 4(b)). many cell types require cooperation between tnfr1 and tnfr2 to generate tnf responses, and the absence of tnfr2 in our cells could explain why tnfr1 did not affect the regulation of p - gp activity by tnf-. on the other hand, inhibition of tlr4 resulted in an attenuation in p - gp activity (figure 4(c)), and an involvement of this toll - like receptor is in agreement with previous findings in brain capillaries. since the transcription factor nf-b is the downstream effector of tnf- signalling in brain capillaries, we wondered whether the same holds true for the regulation of p - gp activity by tnf- in this proximal tubular cell line. gerp cells were exposed for 24 hours to the selective i kappa b kinase (ikk) inhibitor, imd-0354 (figure 5(a)), or sn50 (figure 5(b)). remarkably, imd-0354 alone gave a significant upregulation of p - gp activity compared to control cells (figure 5(a), p <.01), indicating that the compound itself has an effect on p - gp. an alternative explanation would be that imd-0354 may have potentiated the responses to tnf- and, therefore, nf-b inhibits p - gp activity and blockade of nuclear translocation of this transcription factor leads to enhancement of tnf- induction. exposing the cells to the combination of sn50, a cell - permeable inhibitor peptide that interferes with nf-b nuclear translocation, and tnf- slightly reversed the increase in p - gp activity upon tnf- treatment (figure 5(b) ns), suggesting a role for the transcription factor. although higher sn50 concentrations have been used before this was not feasible in our cell system due to solubility problems. showed that an upregulation of p - gp by nf-b is potentially important for protecting renal proximal tubule cells from apoptosis induced by cadmium- and reactive oxygen species (ros). in addition, an increase in p - gp expression and/or activity by tnf- was reported for primary rat hepatocytes, a rat hepatoma cell line and mouse liver, which are also nf-b dependent. furthermore, an nf-b binding site was found in the promoter region of the abcb1 gene. therefore, we suggest that nf-b might have a central role in the signal transduction mechanism and could be involved in two distinct signalling pathways of p - gp. this nuclear factor is probably activated directly by proinflammatory cytokines and no, and indirectly via tlr4. however, more research is needed to further unravel the regulation mechanism of p - gp in the gerp cell line and the inflammatory response on the activity of the efflux pump. in accordance with previous rat endotoxemia studies, the upregulation of p - gp expression and activity after exposure to lps in combination with tnf- in the cultured renal proximal tubule cells are under influence of no produced by inos. on the other hand, the signaling pathway of tnf- alone leading to p - gp upregulation seems to involve tlr4 activation and nf-b translocation, which results in de novo synthesis of p - gp. our findings indicate that at least two different pathways regulate p - gp in renal proximal tubule cells during endotoxemia. | during endotoxemia, the atp - dependent drug efflux pump p - glycoprotein (abcb1/p - gp) is upregulated in kidney proximal tubule epithelial cells. the signaling pathway through which lipopolysaccharide (lps) or tumor necrosis factor- (tnf-) regulates p - gp expression and activity was investigated further in the present study. exposure of rat kidney proximal tubule cells to tnf- alone or tnf- and lps increased p - gp gene and protein expression levels and efflux activity, suggesting de novo p - gp synthesis. upon exposure to tnf- in combination with lps, p - gp activity in renal proximal tubule cells is increased under influence of nitric oxide (no) produced by inducible no synthase. upon exposure to tnf- alone, p - gp upregulation seems to involve tlr4 activation and nuclear factor kappab (nf-b) translocation, a pathway that is likely independent of no. these findings indicate that at least two pathways regulate p - gp expression in the kidney during endotoxemia. |
recent studies of individuals with bipolar disorder suggest that np impairment is prevalent, and intermediate in severity between patients with schizophrenia and healthy comparison participants. np impairments, particularly deficits in attention, processing speed, episodic memory, and executive functions (eg, set - shifting, complex problem - solving), are thought to persist during euthymic states between episodes (table i). hiv infection is characterized by an acute, often febrile, phase lasting days or weeks, a prolonged medically asymptomatic period, and a symptomatic phase of multisystem disease caused by immunosupression. hiv is also known to cause neuropsychological (np) impairments, particularly in the areas of attention / working memory, motor coordination, processing speed, learning, and attention (table i). np impairment tends to worsen with disease severity, with the greatest np impairments observed among individuals with aids. hiv enters the central nervous system soon after infection, and mild cognitive impairment has been observed in approximately 30% of medically asymptomatic hivinfected patients, whereas some form of np impairment is observed in over 50% of individuals in later - stage hiv disease. although antiretroviral treatments have greatly improved the longevity and quality of life for persons living with hiv infection, the prevalence of hiv - associated neurocognitive disorders (hand) has not declined. persons with bipolar disorder and individuals with hiv are at increased risk for both alcohol and other substance abuse and dependence the np impairments associated with various drugs of abuse differ ; however, most illicit substances and alcohol, when used in significant quantities or over a substantial period of time, are likely to produce measurable neurocognitive deficits that may persist for extended periods, even after abstinence is achieved. here, we focus on the neuropsychological difficulties associated with methamphetamine use disorders because : (i) its use is on the rise in the united states ; (ii) cognitive impairments are common and substantial among abusers ; and (iii) it is the most frequently abused substance, aside from marijuana and alcohol, worldwide. a recent review and meta - analysis showed that methamphetamine abuse or dependence resulted in neuropsychological impairments of medium effect size in the domains of episodic memory, executive functioning, information processing speed, motor skills, language, and visuoconstructive abilities. the cognitive domains with the largest effect sizes are listed in table i. furthermore, evidence suggests that when methamphetamine abuse or dependence is combined with hiv infection, there is additive neuropsychological impairment : we recently began prospective research studies in order to understand better the neuropsychological and everyday functioning (eg, medication adherence) difficulties among persons with bipolar disorder and hiv infection. although these studies are ongoing and final results are not available, we show some of the descriptive data (table ii) for a group of hiv - positive (hiv+) bipolar disorder (bd) participants (hiv+/bd+) as compared with hiv+ persons without bipolar disorder (hiv+/bd-). prospective bipolar participants were recruited for participation if they reported a previous diagnosis of bipolar disorder and were currently taking medications to treat their bipolar disorder and hiv infection. a diagnosis of bipolar i or it was assigned by administering the gold standard psychodiagnostic assessment (structured clinical interview for dsm - iv) ; alcohol and substance abuse and dependence diagnoses were determined via the composite international diagnostic interview. no other restrictions were placed on recruitment. demographically similar (eg, age, education, ethnicity, sex, socioeconomic status) hiv+ comparison participants were recruited if they were taking a medication to treat their hiv illness. demographic, psychiatric, and substance dependence information from these two groups are presented (table ii). by design, participants were similar in terms of demographic characteristics including age, education, ethnicity, and sex. twelve of the participants had a diagnosis of bipolar i, and an additional 3 participants had a diagnosis of bipolar ii. half (9/18) of the participants in the hiv+ group without bipolar disorder met criteria for a lifetime diagnosis of major depressive disorder (mdd) ; however, only 11% (2/18) met criteria for a current depressive episode. twenty - seven percent (4/15) of participants in the bipolar group met criteria for a current depressive episode and an equivalent amount (27% ; 4/15) met criteria for a current manic episode (2 manic episodes, 1 hypomanic episode, 1 extreme irritability episode). also as anticipated, participants in the bipolar group tended to take a greater number of psychotropic medications ; 93% (14/15) in bipolar group were taking more than one psychotropic medication as compared with 33% (6/18) in the group without bipolar disorder. the bipolar group also had higher scores on both the young mania rating scale and the beck depression inventory - ii, and lower scores on global assessment, of functioning. the rates of current alcohol, marijuana, and methamphetamine dependence were relatively low in both groups ; however, rates of lifetime marijuana and methamphetamine dependence were elevated among participants with bipolar disorder and hiv infection as compared with those with hiv alone, and rates of lifetime alcohol dependence were elevated in both groups (table ii). when examining abuse or dependence of methamphetamine instead of focusing exclusively on dependence, 65% (9/15) of the bipolar group met criteria for lifetime methamphetamine abuse or dependence as compared with 28% (5/18) in the group without bipolar disorder. detailed neuropsychological test results arc pending larger sample sizes ; however, with the cognitive impairments found in both bipolar disorder and persons with methamphetamine dependence, we anticipate significant neuropsychological impairments among our participants with both bipolar disorder and hiv infection, and possibly even greater impairments among those with bipolar disorder, hiv infection, and methamphetamine dependence. cognitive impairment, appears to be one of the strongest predictors of everyday functioning difficulties in several populations including bipolar disorder and hiv infection. medication adherence, an extremely important daily activity for persons with significant, medical or psychiatric problems, appears to be consistently related to cognitive abilities among individuals with hiv infection and persons with bipolar disorder. specific deficits in the np domains of executive functioning, attention, and memory have been shown to be associated with poor medication adherence. therefore, the convergence of risk for cognitive impairment, among persons with comorbid hiv, bd, and methamphetamine abuse or dependence may make persons with these multiple risk factors particularly susceptible to nonadherence and other everyday functioning difficulties (figure 1). persons with bipolar disorder are at risk for medical and psychiatric comorbidities, including those known to independently cause neuropsychological impairment (eg, hiv infection, methamphetamine dependence). we suggest that these conditions may confer additional risk for the development of neuropsychological impairment among persons with bipolar disorder. we speculate that cognitive difficulties in bipolar hiv+ patients may impact medication adherence and other everyday functioning tasks. poor adherence to psychotropics may lead to mood destabilization, whereas inconsistent adherence to antiretroviral medications may lead to the development of treatment - resistant strains of hiv. substance abuse may further destabilize the care of these individuals and may additionally contribute to cognitive impairments. additional research is needed to better understand the neuropsychological abilities of patients with bipolar disorder and other serious comorbidities, including the extent of impairment, its features, likelihood for progression, relationship to hiv exposure, and impact on everyday functioning abilities among the multiply affected. the exact relationship between bipolar disorder and methamphetamine abuse and dependence also warrants further investigation. finally, targeted interventions for complex cases at risk for neuropsychological impairment, are needed (see depp in this issue, p 239) ; improving medication adherence seems to be one area for intervention that, is important and attainable. | clinicians and clinical neuroscientists are aware that individuals with bipolar disorder are at greater risk for developing serious medical, psychiatric, and substance - use comorbidities as compared with the general population.1,2 less widely appreciated, however, is the observation that hiv infection appears to be more prevalent among persons with bipolar disorder and that both conditions pose significant risk for cognitive impairment.3 higher rates of hiv infection among persons with bipolar disorder should not be surprising, given that infection and transmission of hiv involves risk factors that converge with bipolar disorder (eg, impulsivity, substance abuse). these factors likely also worsen adherence to treatment for both bipolar and hiv illness, and may adversely impact health - related quality of life and therapeutic outcomes. the public health consequence may be that nonadherence to antiretroviral therapy could lead to higher rates of transmission of treatment - resistant strains of hiv that can evolve with sporadic adherence. the intersection of bipolar disorder and hiv therefore merits discussion by clinicians, researchers, and policy makers. |
pancreatic necrosis complicating severe acute pancreatitis is a challenging scenario in contemporary critical care practice. patients are often relatively young (the median age was 55 years [range 1974 years ] in a recent cohort report) and postrecovery quality of life should be good, and so there is much to strive for. however, length of stay can be prolonged, and the evidence guiding treatment is limited and contradictory in nature. crucially, care for these patients involves close multidisciplinary cooperation because the margin for therapeutic error in decision making in relation to the timing and nature of intervention is small. it is generally accepted that death from acute pancreatitis has a bimodal temporal distribution ; early deaths are related to multiple organ failure and may in particular affect elderly patients, in whom decisions on thresholds for intervention may influence treatment and outcome. death from infected necrosis or the sequelae of peri - pancreatic sepsis management of this group of patients is complex, but there has been a recent increase in the scope of available therapeutic options. recent developments can be categorized into those directed at diagnosing infected necrosis, new pharmacological interventions and recent surgical trends. the path finding study conducted by beger and coworkers showed that the proportion of patients with pancreatic necrosis with evidence of bacterial colonization increased as the disease progressed. infection of peripancreatic necrosis is relatively uncommon during the first 10 days of illness, and accordingly there is little to be gained by attempts at radiologically guided aspiration of fluid at this stage. fine - needle aspiration of peripancreatic necrosis to look for evidence of infection comes into play between days 10 and 14 of the illness and, if negative, aspirates should be repeated at regular intervals thereafter. the area to be targeted requires specific attention to detail. in the study conducted by beger and coworkers, fine - needle aspiration was directed at peripancreatic necrosis rather than at intra - abdominal fluid collections. if patients have both, then they should be separately sampled and labelled as such. newer methods used for detection of infected necrosis include measurements of biochemical markers such as calcitonin precursors. procalcitonin is the 116 amino acid precursor of calcitonin ; it is released from neuroendocrine cells and detected in high concentrations in serum during severe bacterial or fungal infections. elevated levels of procalcitonin correlate with disease severity, and there is some evidence of an association between procalcitonin levels and infection of necrosis. use of genetic analytical techniques to quantify circulating bacteria derived gene products in plasma is interesting but not an established method. patients receiving critical care are at high risk for developing infected necrosis and require serial imaging and aspiration of necrosis. it should be borne in mind that radiological (computed tomographic) findings such as the presence of gas can indicate infection. it should also be remembered that a clinical diagnosis of infected necrosis based on fever, leucocytosis and other markers of sepsis without substantive proof of infection of necrosis can frequently be incorrect, and in turn may lead to potentially unnecessary surgery. there remains no specific pharmacological treatment for infected necrosis, and the mainstay of treatment is drainage or debridement. more recently, based on the results of the prowess (recombinant human protein c worldwide evaluation in severe sepsis) trial, drotrecogin alfa (recombinant human activated protein c) has been used in patients with sepsis. in an experimental model of acute pancreatitis, more pragmatically, when criteria for use of drotrecogin alfa are met in a patient with pancreatitis, it could be argued that the thrust of treatment should be to find and treat any intra - abdominal focus of infection [10 - 12 ]. although these issues remain controversial, some consensus regarding the timing of surgical intervention is emerging. early surgery for pancreatic necrosis is unprofitable because areas of necrosis will not yet have ' demarcated ' and the risk for haemorrhage is high. in practice, early laparotomy in severe acute pancreatitis can be justified in those individuals in whom there is concern about coexisting pathological processes, such as colonic ischaemia. thus, a practical management plan emerges ; early pancreas - directed intervention is unprofitable, and surgery has a role to play only when it is needed to rule out coexisting disease. at the risk of adding complexity to this algorithm, we must consider the current trend toward measurement of intra - abdominal compartment pressure. an observational study of 293 patients with severe acute pancreatitis demonstrated that early onset of organ dysfunction (within 72 hours of onset of symptoms) was associated with intra - abdominal hypertension (defined as intra - abdominal pressure > 15 mmhg) in 78% of patients. this led to speculation about whether there is a role for early surgical intervention in the form of a ' decompressing ' laparotomy for raised intra - abdominal pressure. a practical compromise is required here. ' decompressing ' laparotomy in patients without prior surgery carries a high risk for postoperative evisceration, intra - abdominal infection and colonization of previously sterile pancreatic necrosis, and can not be generally recommended. intra - abdominal hypertension is due to fluid sequestration as a result of capillary endothelial injury, and thus there will be interstitial fluid in addition to free intra - peritoneal fluid. however, in selected cases, in particular where diaphragmatic splinting may compromise ventilation, an argument can be made for decompression. our group demonstrated that ' traditional ' surgical open necrosectomy, involving a long bisubcostal incision, extensive intra - abdominal mobilization and multiple drains, was a major surgical undertaking and associated with a worsening in organ failure scores during the immediate postoperative period. in light of this the glasgow group pioneered minimally invasive necrosectomy following a radiologically placed guide wire (under general anaesthesia) with a urological scope to effect debridement under irrigation. various permutations of this procedure have been reported, and there is as yet no consensus on descriptive terminology or technique. infected necrosis in which there is a predominance of solid and semisolid tissue in the peripancreatic area requires surgical debridement. the available evidence suggests that ' less drastic ' surgery (i.e. a mildine laparotomy, debridement, drainage and placement of a feeding jejunostomy) is a safe and adequate option. to maintain a balanced perspective, it must be acknowledged that the minimally invasive procedures may be equally effective, but these are critically dependent on the expertise of the operator. equally importantly, in those patients with pancreatic necrosis with a predominantly liquid collection, a pancreatic abscess can often be managed by radiological drainage (which adheres to the principles outlined above) and thus avoid surgery. in all cases repeated intervention may be indicated, and the minimum requirement for contemporary care is the availability of radiological, critical care and pancreatic surgical expertise. contemporary critical care management of the patient with pancreatic necrosis complicating acute pancreatitis is an area of relatively rapid change. newer methods for detecting infection, new pharmacological interventions and more sophisticated surgery are all changing the face of care for this complex disease. these developments should not obscure the importance of the underlying principle that patients with infected necrosis require debridement / drainage of their intra - abdominal focus of sepsis. | pancreatic necrosis complicating severe acute pancreatitis is a challenging scenario in contemporary critical care practice ; it requires multidisciplinary care in a setting where there is a relatively limited evidence base to support decision making. this commentary provides a concise overview of current management of patients with infected necrosis, focusing on detection, the role of pharmacologic intervention, and the timing and nature of surgical interventions. fine - needle aspiration of necrosis remains the mainstay for establishment of infection. pharmacological intervention includes antibiotic therapy as an adjunct to surgical debridement / drainage and, more recently, drotrecogin alfa. specific concerns remain regarding the suitability of drotrecogin alfa in this setting. early surgical intervention is unhelpful ; surgery is indicated when there is strong evidence for infection of necrotic tissue, with the current trend being toward ' less drastic ' surgical interventions. |
analysis of a complete population of individuals with a defined cancer diagnosis over a prolonged time period is needed to assess whether new therapeutic strategies have affected the whole population 's survival outcome. cancers arising from the epithelial lining of the intrahepatic, perihilar, and extrahepatic bile ducts are a heterogeneous group of malignancies. two major diagnoses are identified by location : the intrahepatic cholangiocellular cancer (ihc) and the perihilar carcinoma (phc) or klatskin tumour at the confluence or bifurcation of the left and right hepatic duct proximal to the cystic duct. there is not a clear - cut border between an advanced phc and an ihc. an analysis of netherlands cancer registry record for ihc found a three - year survival rate of 8%, but a steady increase over the past decades. this change could be the result of developments in surgery, transplantation, and the introduction of new ablative and molecular targeted therapies. bile duct resection with or without liver resection is the hallmark of potentially curative treatment for patients with phc and 5-year survival is reported among 2040% after surgical resection. most of these reports describe highly selective materials subjected to surgery in referral centres and it is difficult to assess if these results affect the whole population with the disease [35 ]. for with stringent inclusion criteria liver transplantation according to the mayo protocol has shown impressing long - term results, in phc, even in multi - institutional setting [6, 7 ]. the combination of gemcitabine and cisplatinum has demonstrated a survival advantage over treatment with gemcitabine alone, suggesting that certain chemotherapies add to survival. survival for a complete population of patients with a malignant disease is improving thanks to advancements in diagnostic procedures, patient managements, surgical procedures, and emergence of effective chemotherapeutic agents and molecular target drugs. the hypothesis of this study was that there is a continuous improvement in survival for the total population of patients with cholangiocellular carcinoma in this millennium. the study 's goal was further to analyse whether staging and/or therapy options used during the first decade of this century have had an impact on the outcome. the population studied consisted of all individuals diagnosed as having ihc or phc served by the western regional cancer centre (rcc) in sweden. the hypothesis that there is an improvement in survival for patients with cholangiocarcinoma was formulated before data collection. the region served by the rcc has a population of 1.6 million. in this region there is one referral university hospital having a complete liver cancer service, including liver transplantation. all patients in whom a diagnosis is clinically established are also reported to the register. included in report data is the stage of the cancer based on clinical and imaging findings, which are translated into tnm criteria (tnm 6 or higher). in this study 's analysis, when several therapeutic procedures were described the most important therapy was ranked as the instituted therapy. data on pre- and postoperative adjuvant therapy was not collected. active palliative treatment (apt) included chemotherapy, tace (transarterial chemotherapy), sirolimus, sorafenib, and cox-2 inhibitors. bile duct drainage and radiation therapy of skeleton metastases were considered as best supportive care (bsc). all curative and active palliative treatments were handled by the liver surgery service at the university hospital. cholangiocarcinomas located distally in the bile duct were not included in the analysis. between 2000 and 2011 a total of 627 individuals were reported to the rcc as having cancers originating in the epithelial lining of the bile ducts. the 49 individuals, where a diagnosis was not established until the postmortem examination, were also excluded. available information about the clinical staging, treatment, and survival on the remaining 578 individuals was reviewed. morphologic diagnosis of cholangiocarcinoma was established when an image of adenocarcinoma was present in the specimen, in combination with immunochemical markers typical for cholangiocarcinoma, including cd7 and cd17. differentiation between ihc and phc was based on the location of the tumour within the liver. a number of patients were at an advanced stage when diagnosed with the cancer and in these patients only minor diagnostic procedures were motivated. these patients were registered under the diagnosis of unspecified primary liver cancer (n = 65) or unspecified bile duct cancer (n = 117) (table 1). the diagnosis of unspecified primary liver cancer supposedly cholangiocellular (mainly icd-10 : c22.9) used by the register was based on the following : (1) no evidence of a previous or concomitant cancer of no hepatic origin, (2) no underlying liver disease, and (3) no signs of hepatocellular cancer were found. the diagnosis of unspecified bile duct cancer (mainly icd-10 : c24.9) was based on the dominant symptom of stricture(s) in the extra hepatic bile tree above the gallbladder duct that was causing jaundice. these two diagnoses inevitably included mainly cases of ihc and phc where only best supported care (bsc) was administered and median survival was less than two months. if there was a continuous progress in the outcome, the material was divided into three equal time cohorts : period a 20002003, period b 20042007, and period c 20082011. no planned changes in the organization of hepatobiliary surgery occurred in the region during 20002012, but there was an increased awareness of the disease, which led to more referrals (table 1). survival time was calculated from the date of the report to the rcc, that is, the date a diagnosis was established histopathologically or clinically. survival estimates were made using the kaplan - meier method and compared using the log - rank test. all statistics were calculated using spss 22 statistical software (spss, chicago, il) and at a significance level of 5%. the analyses were done at transplant institute, section for liver surgery, sahlgrenska university hospital, gothenburg, sweden, and regional cancer centre of west sweden, gothenburg, sweden. overall survival for all individuals with cholangiocarcinoma (n = 578) improved over time (p = 0.0013). the survival curves for the ihc and phc are shown in figure 1. the median survival for patients with phc was 6.8 months and for those with ihc 3.0 months (p = 0.0003). the age and sex distribution did not change between the three time periods for neither ihc nor phc. 74% of the individuals with ihc were between 50 and 79 years of age when diagnosed, with an equal number younger (13%) and older (13%) than these age groups. the clinical staging for the 233 individuals with ihc in the three time periods is depicted in table 1(a). one patient was staged as t0 and was transplanted for primary sclerosing cholangitis and ihc was identified in the explanted liver. over time an increasing number of patients were clinically staged (63% in period a versus 94% in period c). among the staged patients with ihc overall survival for individuals with ihc was 3.2 months and 6.6% survived more than three years. a significant improvement in overall survival over time was registered for those diagnosed as having ihc (p = 0.034) (figure 2). the one - year survival was significantly higher in the last time period compared to the first period (p = 0.038). seventeen of 233 patients (7.3%) had a liver resection and five had a liver transplantation. the three - year overall survival after liver resection was 29% and after liver transplantation 60%. there was a nonsignificant increase in the number of liver resections and transplantations between periods a and c (p = 0.064) (table 1(b)). a trend towards a more active palliative therapy was seen with more patients being treated with chemotherapy over time among the three cohorts (p = 0.06). when comparing the impact on survival for those treated with chemotherapy, mainly gemcitabine (n = 45), the curves for period a + b (n = 20) versus period c (n = 25) were superimposed (p = 0.96) and median survival was six months. a transcatheter arterial chemoembolization, or tace, was administered during the last period to six patients. a it was 69%, in b it was 66%, and in c it was 49% (p = 0.02). for these three cohorts, the survival curves were worse for period c versus period a + b (p = 0.04). the diagnosis of phc was histomorphologically established by brush cytology through an endoscopy or by biopsy in 80% of the patients. in the remaining 20% it was based on radiological findings. fifteen percent of patients with phc were above 79 years of age and 8% were below 50 years. no significant stage migration was identified over time in the 163 patients with phc (table 2(a)). the use of bismuth criteria for staging the cancers in the confluence of the hepatic ducts increased over time from 49% in period a to 85% in period c (table 2(a)). the median survival for the whole phc - population was 6.8 months and 11% survived more than three years. fifteen percent of the patients had curatively aiming bile duct resection with a concomitant liver resection and 5.5% without liver resection. three were transplanted according to the mayo protocol, two of them had survived more than 3 years and three were transplanted outside the protocol and the longest survival was 23 months (table 2(b)). there was no increase in number of patients who received active palliative treatment (apt). in the first two periods there were 11 who were given miscellaneous palliative therapy (cox-2 inhibitor n = 9, sirolimus n = 2). median survival from date of diagnosis for the 34 patients that received apt was 8.8 months. the advanced stage of those with phc is evident as approximately 50% were given best supportive care (bsc) in all periods. biliary malignancies or cholangiocarcinomas are most often asymptomatic until late in the course of the disease and in an advanced stage when the diagnosis is established. in this analysis a great number of patients had their first doctor 's consultation when their disease was at such an advanced state that only minor diagnostic procedures were motivated. even in patients with advanced disease efforts to get a diagnosis were improved and, consequently, there was a decline over time in the number of individuals for whom diagnosis was established at a postmortem examination. during the study period ct and magnetic resonance imaging (mri) improved differentiation between hepatocellular carcinoma and ihc. for patients with phc high - resolution magnetic resonance imaging (mri) has enabled staging of a cancer in the bile duct confluence according to bismuth 's criteria and is the current preoperative standard to assess phc with an accuracy around 50%. mri cholangiography is the golden standard used to delineate the localization and extent of a cancer and the possibility of curative surgery. it has a positive predictive value of 86%, but in a recent meta - analysis, bismuth 's criteria had a lower accuracy rate and were of no prognostic value in cases of phc undergoing resection. the decreasing number of individuals subjected to bsc over time mirrored the increased active therapeutic strategy for patients with ihc. the migration of patients to curative and active palliative therapy explains why survival for bsc patients in period c was worse than in period a + b. the improvement in survival over time for patients with icc could be explained by the fourfold increase in number of patients, from 3 to 12, who had curative surgery (liver resection and liver transplantation) from period a to period c contributing in total to 8 patients surviving more than 3 years and 6 to more than five years. if these patients subjected to curative surgery are excluded, there is no significant impact on the survival curves over time (p = 0.10). the three - year survival rate after curative surgery was thus 45%, a figure in agreement with what appears in recent reports. an explanation could be that in this study we study the whole cohort of patients not only those referred to the surgical clinic. more patients underwent curative surgery over time but the outcome for ihc patients who had curative surgery did not improve between periods a and b (n = 10) versus period c (n = 12). the improvement in survival in the last time period was only observed in those surviving longer than one year. ihc was considered to be a contraindication for liver transplantation during the whole study period. in the 5 cases where liver transplantation was performed diagnosis a multi - institutional analysis in the nordic countries reported a 5-year survival rate of 58% among those with ihc staged t1n0 and a ca 19 - 9 of less than 100 who underwent liver transplantation. based on this figure it has to be asked if there are more patients with ihc who could benefit from liver transplantation. as a recent meta - analysis shows that elevated ca 19 - 9-levels are associated with a worse prognosis independent of treatment, elevated ca 19 - 9-levels will remain a contraindication to transplantation ; even the criteria were expanded. in this material, preoperatively discovered lymph node metastases beyond the hepatoduodenal ligament were a contraindication for surgery. even if lymph node metastases are a strong predictor of survival, the survival of ihc patients with lymph node involvement can be prolonged with hepatectomy and these cases should not be prematurely deemed noncurative. there was a fourfold increase in number of patients with ihc who were treated with chemotherapy, mainly with gemcitabine. the survival outcome of this therapy did not change over time in this study ; this is consistent with others ' findings [17, 18 ]. among patients selected for tace in the last period of this study the median survival was 18 months. in comparison, this difference could be explained by a better clinical stage in patients selected for tace. for those with phc there was no improvement in the survival over the three time periods studied (figure 3). there was no increase in the number treated with curative surgery (27% in period a to 30% in period c) and there was no increase in the number of individuals given active palliative treatment between the first and last periods. despite progress with different treatment options, that is, liver transplantation and chemotherapy, the number of patients who benefitted from these treatments was so small that it did not affect the survival rate of the entire population. based on the present findings it seems reasonable to speculate that progress in treatment of phc by surgical methods alone is limited. the mayo protocol with irradiation and chemotherapy and consequent transplantation is reporting a five - year survival of 76% for individuals with phc. it also raises the question as to whether downsizing phc and also ihc can increase the number of patients who can benefit from curatively aiming surgery. the role of adjuvant chemotherapy is still debated ; a recent meta - analysis did not show any benefit, while a registry analysis identified that adjuvant chemotherapy was associated with significant survival benefits among patients with positive nodes or positive margins. a more liberal use of chemotherapy during the last four - year period did not transfer into better outcomes. the presently used drug combinations that are considered effective were not fully adopted even in the last time period ; so there may be survival benefit still to be achieved. new protocols with innovative neoadjuvant and adjuvant therapies are needed to further improve long - term outcome following surgery or transplantation for patient with cholangiocarcinoma. in conclusion, this analysis from a well - defined population in sweden who had ihc or phc has found an improvement in survival for patients with ihc. more individuals with ihc were over time treated with curative surgery or chemotherapy. despite improvements in different treatment options, no changes in outcome | background. cholangiocarcinoma is a cancer with a poor prognosis. in this millennium there are new diagnostic and therapeutic strategies for these patients. aim. the aim of this study was to find if these changes influenced survival of individuals with proximal cholangiocarcinoma. material. 627 individuals with a diagnosis of cholangiocarcinoma (not including distal common duct cancer) during the period from 2000 to 2011 were registered in sweden 's western region. the material was divided into three consecutive time periods. results. the overall survival curves for individuals with cholangiocarcinoma improved over the three time periods (n = 627) (p = 0.0013). median survival increased from 2.6 months in the first period (20002003) to 3.6 months in the final four years (20082011). patients with perihilar cholangiocarcinoma (phc) had longer median survival than those with intrahepatic cholangiocarcinoma (ihc) : 6.8 versus 3.2 months (p = 0.0003). an improvement in the survival curves over time was seen for those with ihc (p = 0.034) but not for patients with phc (p = 0.38). nine percent of the patients with ihc had potential curative surgical therapy. the three - year survival rate after liver resection for patients with ihc was 35% and 60% after liver transplantation. among patients with phc, 15.3% had potential curative bile duct resection with a concomitant liver resection and 6.1% bile duct resection alone. the three - year survival rate for these two groups was 32% and 20%, respectively. conclusion. overall survival for individuals with phc was better than for those with ihc. over time survival in ihc patients improved but not in those with phc. |
ajellomyces capsulatus is the holomorphic name for histoplasma capsulatum, the etiological agent of histoplasmosis, a systemic mycosis. this thermo - dependent dimorphic fungus is soil - borne and in organic nitrogen rich soils fungal growth and sporulation are accelerated. therefore, places where bird and bat droppings enrich the soil with organic nitrogen, represent a potential environment for proliferation of the fungus and increases the risk of infection. in this environment, the fungus exists in mycelial form, whereas in the host it exists as a yeast - like form. commonly, exposure occurs when histoplasma spores become airborne and are inhaled, less frequently, ingestion and infection via open wounds can occur [4,810 ]. in its most severe form (disseminated) histoplasmosis can affect almost any part of the body ; which depends strongly on the genetic predisposition of the subject, according to recent experimental evidence. severe clinical disease can result from high doses of infectious spores or if the infected host is immunocompromised (10). h. capsulatum is distributed worldwide with certain evidence of its origin in latin america. despite this knowledge, there are still few reports published about histoplasmosis in domestic animals in this region [9,1315 ], considering that it is common in latin america for domestic animals to live in backyards with poultry where the potential risk of infection is higher. here, we report a case of histoplasmosis with multifocal lymphadenopathy, skin and gingival lesions in a dog that lived in close proximity to bird guano, used as fertilizer. a 4-year - old female sterilized dog (schnauzer) presented initially mild gastrointestinal problems (mucous diarrhea) and respiratory affections (sneezing), which were treated with oral hydration (day 0) after veterinary evaluation. in day + 20, the patient returned to the veterinary hospital because several dermatological problems appeared. these consisted of multiple crusted papules located over lips, back of head, neck, thorax and lumbar region (fig. furthermore, the dog presented swelling of submandibular and popliteal lymph nodes and left maxillary gingiva (fig. cytological examination using diff - quick staining method of a fine needle aspiration of papules and submandibular and popliteal lymph nodes, showed mixed cellularity represented by lymphocytes, plasma cells, neutrophils, eosinophils and epithelioid histiocytes in the background inflammatory component. the latter contained numerous rounded to oval yeast - like structures in their cytoplasm, 24 m in diameter, surrounded by a thin clear halo and an eccentric purple core of crescent shape, compatible with h. capsulatum (fig. excisional biopsy of a skin nodule located in the dorsal neck was submitted for histopathology. macroscopic examination revealed that the sample consisted of crusted papules composed of a well - defined, solid, yellow and firm granuloma (fig. microscopy showed a partially delimited non - encapsulated pyogranuloma inside the epidermis, dermis and adipose tissues (fig. 2c). the inflammatory cells were mainly comprised of neutrophils (many degenerated), epithelioid macrophages (some binucleated) and a few reactive lymphocytes. inside the macrophages cytoplasm, numerous yeast - like structures (24 m in diameter) were present, with shapes from round to oval, and surrounded by a clear thin halo, and an eccentric nucleus, compatible with yeast - like structures of h. capsulatum. fungal samples obtained by fine needle aspiration of submandibular and popliteal lymph nodes were cultured in potato dextrose agar (pda) and brain heart agar (bha)+5% human blood ; both media were supplemented with antibacterial agents, amoxicillin / clavulanate 5 g / ml, tobramycin 2 g / ml and chloramphenicol 5 g / ml. in order to obtain the filamentous form of the fungus and yeast - like structures, pda and bha plates were 28 days incubated at 25 c (fig. pda plates showed the filamentous form of the fungus and bha plates the yeast - like form, as expected. microscopic structures of filamentous growth were examined with an optical microscope, the slide was prepared by placing a drop of methylene blue over the culture sample (fig. genomic dna of filamentous and yeast - like forms was extracted using the high pure pcr template preparation kit (roche). the amplification and sequencing of the internal spacer (its) region was carried out with universal primers its1 (5-tccgtaggtgaacctgcgg-3) and its4 (5-tcctccgcttattgatatgc-3). the amplification protocol consisted of 1 cycle of initial denaturation for 5 min at 95 c, 30 cycles of denaturation for 1 min at 95 c, annealing for 30 s at 52 c, and extension for 1 min at 72 c, and a final extension for 5 min at 72 c. the mz&zudla1 its sequence was analyzed using blast, then compared with previously described sequences via an upgma analysis (geneious 5.6.4. after histochemical confirmation of initial diagnosis (day + 33), the treatment plan included cephalexin : 25 mg / kg taken orally every 12 h for 21 days, and ketoconazole : 10 mg / kg taken orally every 12 h for 60 days. during examination at day + 140 the dog exhibited a 95% skin lesion recovery (fig. it was unnecessary to proceed with further examinations due to the dog s full recovery and discharge. during the first veterinary evaluation (day 0), the patient showed mild digestive and respiratory problems. as these symptoms are not specific to histoplasmosis, the first diagnosis was missed. in the second medical evaluation (day + 20), the patient presented lymphadenopathy (submandibular and popliteal), cutaneous and gingival lesions and thrombocytopenia. it is known that disseminated histoplasmosis usually presents dermatological problems and thrombocytopenia may be observed in up to half of dogs with histoplasmosis (10) ; thus, at the second examination there were signs indicating the disease. furthermore, the data provided by the dog s owner revealed that they lived in the valley around quito where the weather is warm and humid, suitable conditions for h. capsulatum. the owner also revealed that bird guano is used to fertilize her garden and, as reported previously, this material enhances the growth and sporulation of this fungus, suggesting that infection was via inhalation or ingestion of h. capsulatum spores. results of cytological, histopathological and histochemical tests were compatible with disseminated histoplasmosis, due to the presence of intracellular yeast - like structures in lymph nodes and skin. in addition to biochemical analyses, molecular tools provided important information about the pathogen genotype. the its region has been used successfully in the identification of pathogenic and non - pathogenic fungal species. in our study although itraconazole is the recommended treatment for histoplasmosis due to its effectiveness and lesser secondary effects, ketoconazole was used having the advantage of being less expensive, not nephrotoxic and excreted in low amounts by the kidneys and proved just as effective in treatment. in conclusion, the current case report describes a case of histoplasmosis in a female canine diagnosed via cytology and culture of h. capsulatum from the lesions. it is widely accepted that the use of itraconazole is the treatment of choice for histoplasmosis in dogs ; however, the use of ketoconazole, in this case, proved to be an adequate treatment option. this sreport mainly helps veterinarians, but also doctors and researchers, to better understand the epidemiology, symptoms and laboratory diagnosis of this disease. finally, we suggest that histoplasmosis should be considered for diagnosis in cases with mild symptoms, especially in areas with identified environmental risk factors. | histoplasmosis is a zoonotic systemic mycosis caused by histoplasma capsulatum. we report a case of a female canine, 4 years old, presenting multifocal lymphadenitis and skin and gingival lesions, in ecuador. based on cytological, histopathological, histochemical analyses, fungal culture and dna sequencing of the its region of the fungus, the diagnosis confirmed the presence of h. capsulatum as the agent of infection. the treatment plan included ketoconazole with a satisfactory outcome. |
evaluation of students competencies is one of the essential tools for assessing success of education programs in accomplishment of its objectives. on the other hand, evaluation is a major determinant of students learning patterns. in other words some believe that ethical evaluation of medical students should emphasize on ethical knowledge and moral reasoning while some others think that in addition to these objectives, compassion, respect and altruism are essential moral competences which need to be evaluated (3). it means that although moral reasoning is an important goal, this competency does not necessarily end to ethical and professional practice of students. the other challenge in moral evaluation is that how it is possible to evaluate students ` attitude and values and ethical practice in a valid and reliable way (4). in published literatures there are so many papers introducing and discussing different tools for evaluation of ethical attitude, reasoning and behavior (2, 57). defining issue test (dit), sociomoral reflection measure (srm), and moral judgment interview (mji) have been developed for evaluation of moral reasoning, not being enough specific they are used generally for research purpose though (8). in practice, for evaluation of students medical ethics competency, methods such as multiple choice questions, short essay, portfolio, objective structured clinical examination (osce), faculty evaluation and 360 degree evaluation are being used (2, 7). although there is no consensus among ethicists on the best evaluation method, they all agree that different methods should be used (7). this method not only evaluates trainee s ethics knowledge but also assesses their moral reasoning and ethical behavior. nowadays increasing number of medical ethics osce stations are including in comprehensive exams in different educational phases in medical schools around the world (2, 911). in iran, there is a consensus about the necessity of evaluation of graduate s ethical competency among medical education leaders and they have mandated adding some medical ethics multiple choice questions (mcq) to pre - internship comprehensive exam, residency entrance exam, annual residency and board exam. since multiple choice question method alone is not enough for moral competency evaluation, we decided to assess practicality of evaluation of ethical competency by designing and conducting an osce station for medical ethics. success of this method could convince educational leaders to use other methods for evaluation of graduate s ethical competency. in this paper we present our experience of including one medical ethics station in seven endocrinology osce stations of endocrinology board exam. we used bioethics osce experience of toronto center for bioethics to design one station on truth telling. the scenario is about an inoperable pancreatic cancer patient whose wife asks physician not to tell the diagnosis to the patient. a standardized patient played the role of the patent s wife in this station and talked to examine physicians. we also used two global rating questions using likert scale to score their ethical decision making and communication skill. this station was pilot tested in a medical ethics education workshop in may 2009 which the standardized patient was trained for. in pilot conduct of this station one of workshop attendees participated as the examinee and other six participants rated his performance. all scores were very close to each other, indeed 5 out of six participants gave the same mark to the examinee and the reliability of station was 0.83. participants also evaluated the face and content validity of the checklist. based on their suggestion the finalized station included in the osce part of the endocrinology board exam in september 2009. time for each physician s interview with simulated patient in ethics station was 5 minutes. one rater (first author) was present in the station to fill checklists and rate examinees. most participants had good to excellent communication skill and only one participant did not communicate with the standardized patient and easily accepted her request (table 1). in their ethical decision making, % 26 (5) of participants had poor performance and only 3 of them had good or acceptable ethical encounter. most participants asked for the patient s wife reason for her request (15 people) and almost all of them (18 people) mentioned that patient had right to know about his condition. the most prevalent mentioned justification for patient s right was the need to plan for the rest of life (12 people). two people told that patient might ask about his condition and one participant gave several different reasons for refusing her request such as she is not telling lie to patient because it is unprofessional, finally patient would find out they were hiding something form him, also if he heards about his condition he would lose his trust on physicians and would be affected by a worse emotional stress. nine participants refused to withhold the truth from patient, however no one acknowledged the patient s right not to know. all of them believed that they had to give information to the patient in any case. there was a significant correlation between participant s score of communication skill and score of their ethical decision making (r=0.48, p=0.03). although the mean score of board osce for those with good ethical performance was higher, this correlation was not significant (table 2). a positive correlation has been observed between participants osce score and their communication skill score but it was not significant. mean ethical performance score of female participants (2, 17) was significantly higher than male ones (1.43 out of 5) (p=0.01), however there was no significant difference between their communication skill. small though, this experiment showed practicability of conducting and including an osce ethics exam in evaluation of trainees. low score of participant s ethical performance was due to lack of training in their educational course and we could not expect them to show good ethical competency just by reading ethics text books. osce is a good method for integrated evaluation of trainees knowledge and skills in facing with ethical dilemmas. if we just use multiple choice questions for evaluation of ethics competency, students learning will be limited to knowledge while using methods that could evaluate their moral judgment and behavior will encourage them to learn practical ethics competencies. moreover standardized patient could be used as a teaching method. in teaching medical ethics besides reflection and discussion on ethical dilemmas, students need to practice their ethical skills and receive feedbacks on their practice (13). we should notice that osce method alone is not enough for precise evaluation of ethical practice. since the pattern of all ethics station could be recognized by students and they could get ready for showing good competency in those stations, being able to have ethical performance is not equal to having ethical practice (5). in other words, thus other evaluation methods such as 360 degree evaluation are needed to assess this dimension of educational objectives in medical ethics (2). furthermore osce method is very costly and having enough number of ethics station will pose logistical difficulties. in a study conducted by singer, 46 ethics station had internal consistency reliability (cronbach s) of 0.28 to 0.46. they estimated that at least 41 ethical stations are needed in an osce test for achieving acceptable internal consistency of 0.8 (12). although inter - rater reliability of our station in its pilot phase was good, because of small sample size in the pilot study, we should have evaluated its reliability in the main study. unfortunately due to logistical problems we were not able to have two raters, so we did not evaluate inter - rater reliability of the station. the other important pitfall of our study was that one station has not content validity for assessing ethical performance. in other words, we could not be sure of ethical competency of physicians in encountering with different types of ethical problems in their professional life through watching their conduct in facing with just one ethical problem. this study showed that it is practical to develop an ethics station in comprehensive medical exams in different phase of medical education course and this method could motivate medical students to learn ethical practice. despite all straight points of this evaluation method, it should be noticed that conducting one or two osce station in graduate comprehensive exam is not enough for evaluation of their ethical practice and other complementary evaluation methods such as continuous peer and faculty evaluation of students during their educational course are necessary. | in this study we discuss our experience of including an ethics objective structured clinical examination (osce) station in endocrinology board exam.one osce station on truth telling was developed and a standardized patient was trained for role playing in this station. based on a pilot study, the evaluation checklist got modified. then the finalized station added into the osce phase of endocrinology board exam.based on this experience, adding ethics station in board exams is practical and reasonable. since osce method could evaluate students ethical decision making and communication skill it could be used in combination with other kinds of evaluation in assessing ethics competency of graduates. using this method could push the ethics learning approach toward more practical and skill based ones. |
the third - generation aromatase inhibitors (ais), letrozole, anastrozole and exemestane, are now widely accepted as alternatives to tamoxifen as first - line therapy in postmenopausal women with estrogen receptor (er)-positive advanced breast cancer, because of their improved clinical effectiveness (nabholtz 2000 ; bonneterre 2001 ; mouridsen 2001). despite the fact that tamoxifen remains an effective drug, ais appear to be superior to this agent as first - line endocrine therapy for metastatic breast cancer also according to a pooled analysis of 8 randomized studies (carlini 2005). the favorable efficacy and safety profile in the advanced disease has encouraged the evaluation of third - generation ais in the adjuvant setting. several phase iii randomized, adjuvant trials have assessed third - generation ais in comparison with tamoxifen or placebo after 5 years or less of tamoxifen therapy. the results of these studies in terms of disease - free survival are summarized in table 1. the big 198 (big international group) trial addressed whether letrozole in the treatment of postmenopausal women with er positive breast cancer is more effective if used as an initial adjuvant therapy or as sequential therapy following adjuvant tamoxifen (thurlimann 2005). five years after randomization, 84.0% of patients in the letrozole group and 81.4% in the tamoxifen group were disease - free, corresponding to a 19% relative or 2.9% absolute treatment difference. the absolute reduction in cumulative breast cancer relapses also significantly favored letrozole over tamoxifen at the fifth year (10.2% vs 13.6%, p = 0.0002) (thurlimann 2005 ; coates 2007). the atac (arimidex, tamoxifen alone or in combination) trial compared adjuvant anastrozole with tamoxifen : more than 9,000 postmenopausal women were randomly assigned to receive anastrozole plus placebo, or tamoxifen plus placebo, or anastrozole plus tamoxifen. with a median follow - up of 47 months, in comparison to the tamoxifen arm, anastrozole resulted in a statistically significant reduction in breast cancer events and an improvement in disease free survival (baum 2002). after completion of 5 years adjuvant treatment anastrozole significantly prolonged disease - free survival and significantly reduced distant metastases and controlateral breast cancers (atac trialists group 2005). recently the atac trialists group has reported findings from an analysis of 100-month follow - up data. this analysis showed that in hormone - receptor positive populations the improvement in disease control with anastrozole with respect to tamoxifen was maintained for over three years after treatment cessation (atac trialists group 2008). the intergroup exemestane study (ies) randomly assigned 4742 women who had received 2 to 3 years of tamoxifen to continue tamoxifen for a total of 5 years or to receive exemestane in order to complete a 5-year course of hormonal therapy. after a median follow - up of 55.7 months, the trial demonstrated a significant reduction in events (recurrence, contralateral breast cancer, or death) in favor of the exemestane arm (coombes 2007). in the italian tamoxifen anastrazole (ita) study, women who had received 2 to 3 years of tamoxifen were randomly assigned to either continue treatment with tamoxifen for a full 5 years or to receive anastrozole. a total of 448 patients were enrolled : at a median follow - up time of 64 months, 63 events had been reported in the tamoxifen group compared with 39 in the anastrozole group (hr 0.57, 95% ci 0.380.85, p = 0.005). relapse - free and overall survival were also significantly longer in the anastrozole group (boccardo 2006). the arno (arimidex - nolvadex) study reported that postmenopausal women who have taken tamoxifen for 2 years as adjuvant therapy are less likely to experience a recurrence of breast cancer and have an improved possibility of survival if they switch to anastrozole (kaufmann 2007). a combined analysis of data from two randomized trials with almost identical inclusion criteria was performed in the abcsg / arno study. postmenopausal women who had completed 2 adjuvant years of oral tamoxifen (20 or 30 mg daily) were randomized to receive 1 mg oral anastrozole or tamoxifen (20 or 30 mg daily) for the remainder of their adjuvant therapy. a total of 3224 patients were included in the analyses : at a median follow - up of 28 months, there was a 40% decrease in the risk of an event in the anastrozole group as compared with the tamoxifen group (hr 0.60, 95% ci 0.440.81, p = 0.0008) (jakesz 2005). the ma-17 trial randomly assigned postmenopausal women who were completing 5 years of tamoxifen treatment, to receive either letrozole or a placebo for an additional 5 years after adjuvant tamoxifen. after a median follow - up of 2.4 years, the study was halted by the data safety monitoring board because of significant reduction in breast cancer events in the letrozole group (goss 2005). similar results have been reported in the analysis of the austrian breast colorectal cancer study group (abcsg)-6a open label trial of extended adjuvant therapy with anastrozole for 3 years after completion of 5 years of adjuvant tamoxifen, with or without aminoglutethimide. at a medium follow - up of 62.3 months the women who received anastrozole had a significantly reduced risk of recurrence compared with women who received no further treatment (jakesz 2007). a recent meta - analysis evaluated the benefit in event - free and overall survival of ais after 2 to 3 years of tamoxifen, and revealed that the early switch strategy improves survival over the standard tamoxifen 5-year treatment. the risk of any event is reduced with ais by 23%, with an absolute benefit of 3.8% (bria 2006). therefore, the available data from randomized adjuvant trials in early breast cancer recommend that the optimal adjuvant treatment for postmenopausal women with early breast cancer should now include ais as either initial therapy or sequential therapy after tamoxifen treatment. recent modeling data suggest that using ais as upfront adjuvant treatment is better than using ais in sequence after 2 or more years of tamoxifen (cuzick 2003). finally when used as preoperative (neoadjuvant) treatment, ais showed greater efficacy than tamoxifen with regard to breast conservation rate but not to clinical response rate (cataliotti 2006). a comprehensive description of the mechanism of action of hormone therapies for breast cancer is present in two recent reviews (jordan 2007 ; journ 2008). although tamoxifen is an inhibitor of breast cancer growth, its effects throughout the human body vary and could be characterized as having mixed estrogenic properties. most of the estrogenic properties are desirable, eg, preservation of bone mineral density in postmenopausal women or decreases of low - density lipoproteins, but these partial estrogen agonist effects may also be detrimental and a likely cause of the increased risk of some toxicities such as thromboembolic events and endometrial cancer (ganz 2001). in contrast, fulvestrant is a new estrogen - receptor antagonist, with no known agonist (estrogenic) effects, which has recently been licensed for treatment of advanced breast cancer in post - menopausal women (journ 2008). recent studies have reported that about 30% of postmenopausal women with advanced breast cancer who had progressed following prior antiestrogen therapy, gained clinical benefit with fulvestrant therapy thus delaying the need for chemotherapy (journ 2008 ; neven 2008). available data suggest that fulvestrant, given intermusculary, is well tolerated, with a low incidence of treatment - related adverse events and injection - site reactions (neven 2008). another recent endocrine treatment is represented by third - generation ais which block the estrogen receptor by reducing the levels of its ligand, endogenous estrogen. they target the aromatase enzyme (a p-450 cytochrome enzyme), which converts testosterone and adrenal androgens to estradiol and other estrogens (smith and dowsett 2003). ais are categorized in two types, non - steroidal and steroidal, and differ in their modes of interaction with the aromatase - enzymatic complex and its inactivation. non - steroidal ais, anastrozole and letrozole, are imidazole - based and compete with endogenous substrates for access to the cytochrome p-450 moiety of aromatase, where they form a reversible co - ordinate bond. the steroidal ai exemestane is an analogue of androgens which competes with the endogenous androstenedione and testosterone for access to the cytochrome p450 moiety of aromatase and causes irreversible enzyme inhibition. molecular differences between anastrozole, letrozole and exemestane affect their selectivity for the aromatase enzyme and thus their capability in the inhibition of total - body - aromatization and, as a result, plasma estrogen suppression (budzar and howel 2001 ; smith and dowsett 2003). these differences among the different ais may explain the partial non - cross - resistance between steroidal and non steroidal ais which allows the possibility of using exemestane after non - steroidal ais (ponzone 2008). the shift from tamoxifen to an ai in both the advanced and adjuvant setting has challenged the status of tamoxifen as the gold standard treatment for postmenopausal women with hormone - receptor - posistive breast cancer. therefore, the expanding use of ais in the treatment of early breast cancer means that individual patients will be exposed to these agents for longer durations, making it increasingly important to establish their long - term safety. the aim of this review was to focus on the possible different effects of tamoxifen and ais on bone metabolism, lipid profile, and cardiovascular disease in postmenopausal patients with early breast cancer. estrogens play a crucial role in maintaining both normal bone turnover and normal bone mass, and therefore long - term estrogen deprivation may be associated with the development of osteoporosis and increased susceptibility to bone fractures. the better efficacy of ais with respect to tamoxifen in breast cancer patients is usually explained by the fact that they reduce peripheral estrogen concentrations to extremely low levels, while tamoxifen has partial agonist activity. the profound estrogen suppression achievable with the third - generation ais could also explain some unfavorable effects on bone (brufsky 2008). nevertheless, it has been reported that the reduction of the low residual levels of serum estradiol to virtually undetectable levels in healthy late postmenopausal women is associated with further increases in bone resorption rate (heshmati 2002). moreover, the lower levels of serum estradiol are associated with the higher rates of bone loss and the greater risk of fractures in late postmenopausal women (cummings 1998). the complete estrogen deprivation may lead to an increased production of the cytokine rankl by stromal cells and increased activity of rank, thus leading to increased numbers of osteoclastic precursors and osteoclastogenesis. this, along with the reduction in circulating levels of osteoprotegerin, results in an increase in the number of mature osteoclasts and consequently increased bone breakdown (mccloskey 2006). despite the effects of the third generation ais on bone turnover having been reported in several studies, it is difficult to assess the difference between the three available agents in the absence of head - to - head comparisons. a small study performed in postmenopausal women with advanced breast cancer described significant increases in markers of bone formation and bone resorption after 3 months of anastrozole (bajetta 2002). the bone substudy of the atac trial has reported that postmenopausal women with early breast cancer, treated for 5 years with anastrozole, presented losses of bone mineral density (bmd) both at lumbar spine and total hip, at year 1 (2.3% and 1.5%, respectively) at year 2 (4.0% and 3.9%, respectively) and at year 5 (6.0% and 7.2%, respectively) (eastell 2008). on the other hand the treatment with tamoxifen was associated to significant increases in both lumbar spine bmd (1.4% at year 1, 2.1% at year 2 and 2.8 at year 5) and total hip bmd (0.8 % at year 1, 1.2% at year 2 and 0.7% at year 5) (eastell 2008). in this study one - year treatment with anastrazole significantly increased both bone formation markers (bone alkaline phosphatase [bone - alp ] 20% and procollagen type - i n terminal propeptide [pnp ] 18% respectively) and bone resorption markers (c - telopeptide of type - i collagen [ctx ] 26% and n - telopetide of type - i collagen [ntx ] 15% respectively). on the contrary tamoxifen induced a marked decrease in both bone resorption markers (ctx : 56% and ntx : 52%) and bone formation markers (pinp : 72% and bone alp : 16%). the withdrawal of tamoxifen was followed by a tendency of bone markers to return towards baseline values in a period of time ranging from a few weeks to several months (eastell 2006). in the adjuvant atac trial, although the anastrozole safety profile was better than that of tamoxifen overall, there was an incidence of fractures significantly higher in the anastrozole arm as compared to that in the tamoxifen arm (11.0% vs 7%) after a median follow - up of approximately 33 months (baum 2002). a recent article by the atac trialists group has reported the findings from an analysis of 100-month follow - up data. this analysis showed that fracture rates were higher in patients receiving anastrozole than in those receiving tamoxifen during active treatment [incidence rate ratio (irr) 1.55 (1.311.83), p 65 years, age 6064 years with other risk factors (eg, family history, body weight < 70 kg, prior non - traumatic fracture) postmenopausal women of any age receiving ais, premenopausal women with therapy associated premature menopause. all women with breast cancer at high risk, independently of bmd results at baseline, need to repeat the bmd measurement after 1 year. therefore, all postmenopausal women treated with ais can be considered at high risk and evaluated for bmd annually. in the presence of osteoporosis (bmd t score < 2.5) although there is currently no approved treatment or any prevention therapy for the aromatase - inhibitor induced bone loss, clinical trial evidence indicates that intravenous and oral bisphosphonates are effective in maintaining bone density in breast cancer patients on hormone therapy and with therapy - associated premature menopause. in particular iv bisphosphonate zoledronic acid has shown clinical benefits in the treatment of bone metastases among patients with solid tumors. in a cochrane review that assessed all approved oral and iv bisphosphonates for breast cancer treatment, zoledronic acid produced a greater reduction in the risk of skeletal related events with respect to both placebo (41%) and ibandronate, clodronate and pamidronate (ranging from 14% to 23%) (pavlakis 2005). a recent substudy of the austrian breast and colorectal cancer study group (abcsg) has demonstrated that zoledronic acid (4 mg iv every 6 months over 3 years) was effective in counteracting bone loss in premenopausal women receiving adjuvant endocrine therapy (goserelin plus anastrozole) for hormone - responsive breast cancer (gnant 2007). in the zometa - femara adjuvant synergy trial (z - fast), zoledronic acid also appeared to prevent bone loss in postmenopausal women with stage i - iiia estrogen and/or progesterone - receptor positive breast cancer receiving adjuvant letrozole (n = 602) (brufsky 2007). three hundred and one of those patients received upfront zoledronic acid (4 mg iv every 6 months), whereas the other 301 women in the delayed arm of the trial received zoledronic acid only if their t - score at lumbar spine or total hip decreased below 2.0 sd or if they had a clinical fracture. after 1 year of zoledronic acid treatment (4 mg iv every 6 months), the lumbar spine and total hip bmd increased by 2.0% and 1.4% respectively. in contrast, among women in the delayed arm of the trial, bmd decreased substantially by 2.6% and 2.1% at lumbar spine and total hip, respectively (brufsky 2007). despite these promising data, the use of an aggressive preventive strategy using iv bisphosphonates needs to be validated by larger randomized studies. in fact in recent years there has been an increasing number of reports which suggest that the prolonged use of intravenous bisphosphonates may be associated with osteonecrosis of the jaw (onj), an uncommon manifestation characterized by the presence of exposed bone in the oral cavity (weitzam 2007 ; brufsky 2008). a retrospective analysis in australia (20042005) reported a 0.88% to 1.15% frequency of onj among patients with malignant bone disease from cancer and a frequency of only 0.01% to 0.04% among patients with osteoporosis receiving a bisphosphonate. therefore, the frequency of onj appears to be lower among patients with no malignant bone disease compared with patients who have advanced cancer (mavrokokki 2007). a possible alternative in the prevention of bone loss in breast cancer women is represented by oral bisphosphonates, which are less commonly associated with the development of osteonecrosis of the jaw than intravenous bisphosphonates. it has recently been reported that oral bisphosphonate risedronate prevents anastrozole induced bone loss with an increase of bmd at lumbar spine and a decrease of bone turnover markers (confavreux 2007). in conclusion the negative effects of ais on bone have to be taken into account and all women should receive lifestyle advice. aromatase inhibitor - associated bone loss may represent a preventable and curable condition, and in high risk women a treatment with antiresorptive agents, such as bisphosphonates, should be considered. large - scale epidemiological studies have shown that high serum levels of total cholesterol (tc) and ldl - cholesterol (ldl - c) are important risk factors for the development of cardiovascular diseases (cvd), and that low serum levels of hdl - cholesterol (hdl - c) and hypertriglyceridemia (tg) are associated with increased coronary heart diseases (chd), morbidity and mortality. new emerging risk factors for chd, including insulin resistance, glucose intolerance and prothrombotic state, are an issue of growing interest in cvd prevention. estrogens have a protective effect on the lipid profile in human subjects, and high levels of hdl - c and low levels of ldl - c are associated with high estrogen levels. therefore, the reduction of estrogen levels which occur during adjuvant therapy for breast cancer may lead to a more atherogenic lipid profile and increased chd risk. the rates of chd in women after the menopause are 2 to 3 times those of premenopausal women of the same age and the dramatic decline in estrogen levels during the menopause is associated with unfavorable changes in lipid profile (rosano 1996). estrogen replacement therapy is known to have a mixed effect on serum lipids, resulting in a significant decrease in tc and ldl - c, a favorable increase in hdl - c, but an unfavorable increase in tg. randomized controlled trials have demonstrated that estrogen replacement therapy causes either no benefit or an increased cardiovascular risk (manson 2003). tamoxifen has demonstrated a favorable effect on lipid profile in postmenopausal women with a reduction in tc and ldl - c levels. after 5 years of treatment with tamoxifen there was a significant change in lipid profile in node - negative post - menopausal women compared with untreated patients : tc, ldl - c and lipoprotein(a) decreased, while hdl - c remained unchanged (love 1994). an adjuvant study showed that after 15 months of tamoxifen treatment there was a significant increase in serum tg levels compared with baseline levels (liu and yang 2003). with regard to ais, current data do not allow the drawing of any clear conclusions about the effect of these drugs on lipid metabolism. data on lipid profile were not systematically collected in the atac trial ; however, the prevalence of low grade hypercholesterolemia was reported to be 2.6 fold higher in patients receiving anastrozole than in those taking tamoxifen (atac trialists group 2005). most studies on anastrozole in postmenopausal women with early breast cancer have shown beneficial increases in hdl - c and favorable decreases in tg, while variable effects on the levels of tc or ldl - c were described (sawada and sato 2003). in the ita trial, the switching to anastrozole after 23 years of tamoxifen was also associated with an increased incidence of lipid metabolism disorders (9.3% vs 4.0%, p = 0.04) with respect to patients receiving 5 years of tamoxifen treatment (boccardo 2006). even the arno 95/abscg-8 combined analysis did not report hypercholesterolemia in women switching to 3 years of anastrozole after 2 years of tamoxifen compared to the standard 5 years of tamoxifen (jakesz 2005). with regard to letrozole, this agent caused a deterioration of lipid profile with an increase of atherogenic risk ratios tc / hdl - c and ldl - c / hdl - c in postmenopausal women with metastatic breast cancer previously treated with tamoxifen (elisaf 2001). instead the ma-17 trial did not document any detrimental effect of letrozole on lipid levels, and similar frequencies of hypercholesterolemia were observed in the placebo and letrozole groups (goss 2005). the big 198 trial reported a greater than two - fold increase in the incidence of hypercholesterolemia with letrozole therapy compared with the tamoxifen (43.6% vs 19.2%, respectively) ; however, over 80% of these were mild and did not require treatment (thurlimann 2005). notably, these data were based on single, non - fasting measurement of blood cholesterol, and any single event at any time during the study resulted in a positive report. for this reason, the other ai exemestane has shown a significant reduction of tc and tg, and an unfavorable decrease in hdl - c in a small study on postmenopausal women with advanced breast cancer (engan 1995). another study showed only a significant reduction in hdl - c (p < 0.001) and apolipoproteina a1 (p = 0.004) in women assigned to exemestane with respect to the placebo group (lonning 2005). exemestane has also been shown to have no detrimental effects on serum lipids or atherogenic risk in postmenopausal women with metastatic breast cancer (atalay 2004). more recently, a comparison of the effect of exemastane versus tamoxifen on the lipid profile of postmenopausal early breast cancer patients was reported in the preliminary results of the team greeck substudy at a 12 month follow - up (markopoulos 2005). in this study, although mean ldl - c levels were higher in the exemestane versus the tamoxifen group, triglyceride levels were lower, while no difference was reported in total cholesterol or in hdl cholesterol. these data seem to suggest that exemestane may have a less unfavorable effect on lipids with respect to the non - steroidal aromatase inhibitors. in contrast, a recent adjuvant study compared postmenopausal women switched to exemestane treatment after 23 years of tamoxifen with the women who continued the 5-year tamoxifen therapy. the exemestane treated patients presented a significant (p < 0.01) decrease in hdl - c and tg and a significant increase in serum ldl - c, whereas the women who continued tamoxifen did not show any significant changes in lipid parameters (montagnani 2007). in this latter study, however, the increase in ldl - c could mainly be explained by the loss of the positive action of tamoxifen ; in fact in the second year of the study, no further increase in ldl - c was observed (montagnani 2007). the effects of ais on body composition in postmenopausal women with breast cancer, switched from adjuvant tamoxifen to adjuvant exemestane, were also investigated : fat mass significantly decreased by month 12 in the exemestane group, but not in the tamoxifen group ; the between - group difference was statistically significant (p < 0.01) (francini 2006). in this latter study the fat free - mass / fat mass ratio significantly (p < 0.05) increased in the exemestane group, but not in the tamoxifen group. these findings suggest that switching patients to adjuvant exemestane treatment after at least two years of tamoxifen may be associated with an advantage over continuing adjuvant tamoxifen in terms of body composition. since it is known that exemestane and the other ais reduce circulating estrogen levels, and estrogens have direct effects on adipocytes, the authors suggested there may be an association between exemestane use, reduced circulating estrogen levels and body weight changes (francini 2006). overall, the available studies suggest that the differences in lipid profile between tamoxifen and ais may be due to the lipid - lowering capacity of tamoxifen rather than to increases in lipid levels due to ais. however, the true difference in changes of lipid parameters between patients receiving tamoxifen and ais still has to be defined and therefore no exact recommendation concerning the monitoring of lipid metabolism may at present be given. as a general guideline, patients should perform a baseline and periodic monitoring of the fasting lipid profile before starting adjuvant hormonal therapy, maintain a correct lifestyle with a healthy diet and regular exercise, and assume medications useful for the treatment of pre - existing hypercholesterolemia. even though lipids are important risk factors, the relationship between hormone related changes in lipid profile and the development of cvd events is unclear. although most of the studies demonstrated that tamoxifen has a favorable effect on lipid profile, this did not seem to translate into a beneficial effect on the development and progression of cvd. a meta - analysis reported that tamoxifen significantly decreased myocardial infarction deaths but did not significantly reduce the myocardial infarction incidence (braithwaite 2003). the 15-year survival update from the early breast cancer trialists collaborative group meta - analysis found a borderline significance regarding reduced mortality from heart disease in breast cancer patients receiving tamoxifen compared with a control group (120 vs 132 p = 0.06) (clarke 2006). the effect of ais on cardiovascular risk is less defined, since long - term studies are needed to evaluate the development of cardiovascular events as a consequence of treatment with these agents. some data have been drawn from studies using anastrozole and letrozole in the advanced setting. in fact anastrozole - treated patients showed a significant decrease in thromboembolic events, including venous thromboembolism, coronary ischemic and cerebrovascular events compared with tamoxifen (nabholtz 2000 ; mouridsen 2001). in the atac study, anastrozole resulted in a clinically significant reduction in the incidence of cerebrovascular events (2.0% vs 2.8%) and thromboembolic events (2.0% vs 4.5%) in comparison with tamoxifen (atac trialists group 2005). in the same study a non significant increase in ischemic cardiovascular diseases was associated with anastrozole therapy. data on cardiovascular diseases were not reported in detail in the abcsg / arno trial, but there was no difference in the incidence of myocardial infarction between the anastrozole arm and the tamoxifen arm (jakesz 2005). the overall reported incidence of cardiovascular events in big 198 was similar in the two groups (5.5% and 5% for letrozole and tamoxifen respectively) (coates 2007). however, in big 198 there was an excess of severe events (grades 35) of both heart failure and ischemic heart disease in the letrozole arm with respect to the tamoxifen arm (1.0% vs 0.6% and 2.2% vs 1.7%, respectivaly) (coates 2007). a recent reanalysis of the cardiovascular adverse events of big 198 trial has reported that at a median follow - up time of 30.1 months there was a similar overall incidence of cardiac adverse events (letrozole 4.8% ; tamoxifen 4.7%) but more grade 3 to 5 cardiac adverse events on letrozole (letrozole 2.4% ; tamoxifen 1.4% ; p < 0.001) and more overall tromboembolic events on tamoxifen (tamoxifen 3.9% ; letrozole 1.7% ; p < 0.001) (mouridsen 2007). the effect of prolonging letrozole treatment beyond 5 years is currently being addressed in the ma.17r rerandomization study in which patients who remain disease - free after completing 5 years of letrozole extended adjiuvant therapy are randomized to letrozole or placebo for a further 5 years. this study will provide further data on safety issues associated with long - term use of letrozole (goss 2003 ; goss 2005). a non - significant increase in the incidence of cardiovascular disease was also reported in patients switching to exemestane in the ies trial, including a 2.5-fold increase in the number of myocardial infarctions (coombes 2007). however, in this trial, as well as other postadjuvant or switching studies, it is difficult to deduce whether the cardiovascular adverse events observed may be attributed, at least in part, to the effects of prior tamoxifen or whether these events are a true effect of the ais. overall, the current available findings suggest that the impact on cvd of the long - term use of ais is still to be clarified. nevertheless, in the above mentioned trials definitions of cardiac and ischemic disease were not consistently defined, follow - up was short (< 10 years), and risk factors for coronary disease (including lipid profiles) were not systematically documented. however, when starting a treatment with ais it is important to determine the presence of associated comorbidities, such as diabetes mellitus, hypertension, smoking, and/or the use of anthracycline - based chemotherapy, which may increase the risk of developing cardiomyopathy and symptomatic heart failure or other cardiovascular events. therefore, when treating breast cancer patients, oncologists should correct cardiovascular risk factors as is done with patients who do not have breast cancer. moreover, physicians should assess cardiovascular risk, monitor and treat patients already diagnosed at risk for coronary heart disease, according to established guidelines (winer 2004 ; ponzone 2008). another point to consider is that the relationship between lipid profiles, hormonal status, and cardiovascular risk is not always clear. lipids, as risk factors, are intermediate end points and may not correlate with the clinically relevant end points of the incidence of cardiovascular events in long - term studies. to sum up, ais are associated with lower thrombotic risk when compared with tamoxifen, while the possible unfavorable balance of ais on cardiovascular risk needs to be confirmed. clinical experience suggests that the treatment with ais is associated with a novel musculoskeletal side effect consisting of an arthralgia syndrome which sometimes can be a reason for discontinuation of ais treatment. arthralgia is defined as pain or stiffness in the joints, which in patients treated with ais is not caused by arthritis, the typical onset of ais associated arthralgia is within 2 months of treatment initiation (burstein 2007). all the major adjuvant trials of ais have reported the incidence of musculoskeletal symptoms or asked directly about arthralgia. therefore, the reported incidence of arthralgia syndrome reflects different definitions of symptoms and is markedly different in individual studies. in fact in the atac trial there was a significant increase in arthralgias in the anastrozole arm when compared to the tamoxifen arm (35.6% vs 29.4% ; p < 0.001) (atac trialists group 2005). also, ma 17 trial reported an increased frequency of arthralgias in women treated with letrozole with respect to those in the placebo arm (25.3% vs 20.6% ; p < 0.001) (goss 2005). finally, the ies study confirmed that arthralgias were more frequent in the exemestane group (20.6%) (coombes 2007). even though the true etiology of ais - associated arthralgia syndrome is not known, several studies have shown a link between low serum levels of estrogen and arthralgias. the natural hypoestrogenemia of menopause is also associated with arthralgia, which can be ameliorated with hormone replacement therapy (hrt) or exacerbated with ais treatment. moreover, it is known that estrogens regulate inflammatory cytokines and enhance nociception at the level of the central nervous system. although it is clear that ais worsen arthralgias compared with either placebo or tamoxifen, the overall impact on quality of life and associated morbidity still needs to be determined (burstein 2007 ; coleman 2008). the third - generation aromatase inhibitors (ais), letrozole, anastrozole and exemestane, are now widely accepted as optimal adjuvant treatment for postmenopausal women with early breast cancer. this means that individual patients will be exposed to these agents for longer durations, making it increasingly important to establish their long - term safety. this review focused on the effects of ais on bone metabolism, lipid profile, and cvd. despite the lack of comparative studies, current data suggest that all the third generation ais may have adverse effects on bone, with reduction in bmd and an increase in the rate of bone fractures. however, aromatase inhibitor - associated bone loss may represent a preventable and curable condition, and a treatment with antiresorptive agents, such as bisphosphonates, should be considered in high risk women. with respect to tamoxifen ais present lower thrombotic risk but a less favorable impact on lipid profile. however, the true impact on cvd of the long - term use of ais still remains to be clarified. even though experimental and clinical data suggest that different ais may have a different impact on fracture and cardiovascular risk, at present, no consensus exists as to whether the best ai for individual patients could be chosen. to sum up, as a general guideline, it may be recommended that patients undergo bmd and lipid profile evaluation before and during adjuvant therapy with ais, maintain a correct lifestyle with a healthy diet and regular exercise, and assume medications useful for managing pre - existing osteoporosis and hypercholesterolemia. | the third - generation aromatase inhibitors (ais), letrozole, anastrozole and exemestane, are becoming the first choice endocrine drugs for post - menopausal women with breast cancer, since they present greater efficacy when compared with tamoxifen in both adjuvant and metastatic setting. in particular, several large and well designed trials have suggested an important role for ais in the adjuvant treatment of postmenopausal women with estrogen - receptor positive breast cancer either in the upfront, sequential or extended adjuvant mode. overall, ais are associated with a small but significant improvement in disease free survival. the expanding use of ais in the treatment of early breast cancer means that individual patients will be exposed to the agents for longer durations, making it increasingly important to establish their long - term safety. this review focused on the effects of ais on bone metabolism, serum lipids and cardiovascular risk. ais have adverse effects on bone turnover with a reduction of bone mineral density and an increase in the rate of fragility fractures. with respect to tamoxifen ais present lower thrombotic risk and a less favorable impact on lipid profile, whereas the true effects on cardiovascular risk still remain to be clarified. an adequate monitoring of bone mineral density (bmd) and lipid profile could be recommended for post - menopausal women candidate to ais. |
the dorsal lateral geniculate nucleus (lgn) of the thalamus is a small, bi - lateral structure that accepts input from each eye representing the contralateral half of the visual field and projects to the primary visual cortex (see fig. the structure comprises six laminae with associated inter - laminar structures that macroscopically segregate the magno-, parvo-, and koniocellular visual streams originating in the anatomically ipsi- and contralateral eyes. the lgn receives input that originates at the retina, passes through the optic nerves, continues to the optic chiasm where signals from the two eyes are shuffled into the two visual hemifields, then courses along the optic projection to the lgn. the lgn, in turn, sends its output along a projection to primary visual cortex (area v1) via the optic radiation. cells in the lgn respond to small, well - defined regions of visual space that are called visual receptive or response fields (rfs), much like those found in the ganglion cell layer of the retina (rgc). the typical rf can be thought of as a spatio - temporal differentiator that responds best to highly local changes in visual contrast (see fig. 2 and discussed in section 2 below). changes can be either spatially or temporally expressed, with cells largely falling into one of two categories, those that respond to either focal increases (on cells) or decreases (off cells) of luminance. there is nearly a one - to - one anatomical mapping from retina to lgn in the cat (hamos., 1987) and evidence for similarly high anatomical specificity in primates (conley and fitzpatrick, 1989). in addition, there is a nearly one - to - one functional mapping in cats (cleland., 1971) and primates (kaplan., 1987 ; lee., 1983 ; sincich., 2009b) from ganglion cell output to lgn cell input, so the close matching of rf characteristics between rgcs and lgn neurons is perhaps not surprising. and, like those found in rgcs, responses in lgn are adapted by luminance and contrast at a larger spatial scale than the rf. the standard conceptual framework that partitions visual receptive fields into a smaller classical receptive field (crf) and a larger modulatory extra - classical receptive fields (ecrfs) was established by hubel and wiesel (hubel and wiesel, 1962, 1961, 1959) a half - century ago. in this paper we will use rf to indicate the entirety of the response field in all of its aspects, crf to indicate just the classical, small center - surround structure, and ecrf for any parts of the rf that extend beyond the crf in either space or time, reflecting common usage in the literature. in this paper we review recent crf / ecrf studies of the lateral geniculate nucleus of the thalamus. the focus of this review is on the primate lgn and we will frequently cite studies in other species such as cats that serve as points of reference for work in primates. with a growing body of knowledge about rfs in the primate early visual pathway, it is now clear that the ecrf is an important part of lgn rfs in primate, and that the functional impact of the lgn ecrf may be important for subsequent processing (webb., 2005 ; angelucci and bressloff, 2006). the strength and source of the ecrf in lgn neurons is less clear although ecrfs can be identified in rgcs, additional processing within the lgn, including feedback from cortical areas, may also be important. in the present work, we review some of the studies that have been successful at defining crfs and/or ecrfs in the lgn. as many of the reported results hinge upon stimulus choice, a second topic of review in this paper is the stimuli used to map lgn responses, in particular natural scenes and noise that statistically imitates natural scenes (often called 1/f noise as its power spectrum mimics that of natural scenes, although it lacks phase information that characterizes shapes in natural scenes). using natural stimuli is important in a neuroethological context, especially if the aim is translational as clinical tools that interact with the lgn may need to do so in a natural environment (bourkiza., 2013 ; pezaris and eskandar, 2009 ; pezaris and reid, 2007). a variety of methods have been used in the studies included here ; we will, in particular, examine the different animal models (i.e. cat and monkey) used and touch upon the resulting biases that may exist in the literature. hubel and wiesel s original work was with both cats and primates, but much of the later work in the field has been done only in cats. while the cat visual system has proven to be a robust and capable experimental model, there are some fundamental differences between cat and primate visual pathways which make comparative studies important. significant work with naturalistic stimuli (e.g. natural scenes and 1/f noise) has been performed in the cat lgn (butts., 2007 ; lesica and stanley, 2004 ; simoncelli and olshausen, 2001 ; stanley., 1999), but natural scene statistics have rarely been employed in studying the primate visual system. we conclude the review by highlighting a need for further experiments to detail rf properties of lgn with an emphasis on using the alert primate preparation. early studies established that rfs have extent in both space and time, and thus a complete characterization requires spatio - temporal information. this realization led to the eventual application of white noise analysis and reverse correlation, derived from linear systems analysis, for the generation of accurate neuronal rf maps (deangelis., 1995). the groundbreaking work of kuffler followed by hubel and wiesel determined the basic characteristics of crfs in the retina and the lgn (hubel and wiesel, 1961 ; kuffler, 1953), demonstrating an approximately circular center / surround organization. they described on - center cells, neurons that have increased firing when bright stimuli are placed in center of the rf and off - center cells, neurons that have increased firing when relatively dark stimuli are placed in center of the rf (see fig. insightfully, kuffler also described the presence of factors that were indirectly involved in rgc output, perhaps the earliest mention of ecrf - like effects, factors that may well involve areas which are somewhat remote from a ganglion cell and by themselves do not setup discharges (kuffler, 1953). nevertheless, the fundamental characteristics of receptive fields have been substantially refined by later investigation. some lgn cells are achromatic, responding only to luminous intensity, while others are modulated by specific colors, typically classified as belonging to one of three wavelengths : short, medium and long (wiesel and hubel, 1966). later work has shown a rich set of color- opponent pairs in crfs (reid and shapley, 2002). we refer the reader to solomon and lennie for a review of color vision physiology (solomon and lennie, 2007). selectivity for long wavelengths in the lgn is most common, in agreement with the large number of cones that are selective for long wavelengths (wiesel and hubel, 1966). krger determined that color - specific cells made up 90% of the population (krger, 1977). the visual path is segregated into three major divisions at the lgn, magnocellular (m), parvocellular (p), and koniocellular (k), with functional differences between divisions largely consistent across species (derrington and lennie, 1984 ; okeefe., 1998 ; usrey and reid, 2000 ; white. m cells are typically achromatic, respond to higher temporal frequencies, and have large crf centers. p cells have color - opponent structure in primates with input from two cone classes at middle and long wavelengths (jacobs, 2008), respond to lower temporal frequencies, and have small crf centers. most k cells that have been described have strong input from short wavelength cones and have blue - on or blue - off crf structure (hendry and reid, 2000 ; martin., 1997 ; tailby.,, a much larger portion of k cells, 34%, can not be driven by drifting gratings, compared to only 9% of m cells and 6% of p cells recent work in primates has shown the presence of k cells with orientation selectivity that might help explain the findings of weak responses to grating stimuli (cheong., 2013). k cell characteristics also vary across k layers, suggesting that there might be several classes of k cells, and appear to be more heterogeneous across species (hendry and reid, 2000). (1998), looked only at owl monkeys but their combined findings agree with what usrey and reid found in both owl and squirrel monkeys, and with what norton and casagrande found in the pro - simian galago (norton and casagrande, 1982). both xu. and usrey and reid s studies found that spatial summation was linear for all lgn cells that fit the linearity - testing criterion of responding well to drifting gratings (subsequently some of the recorded k cells were not tested for linearity). xu. focused on the properties of k cells while okeefe. the characteristics of m and p cells that okeefe. found in owl monkeys, and usrey and reid found in owl and squirrel monkeys are consistent with what characteristics maunsell. found in macaques (maunsell., 1999). in all three species, m cells respond faster than p cells, suggesting that the division of pathways serves the same function : m cells encode spatial information and p cells encode color information. the only difference that usrey and reid found between owl and squirrel monkeys was that overall, visual responses in owl monkeys were slower, which they speculated may be due to the nocturnal nature of the species. between owl and squirrel monkeys, the receptive field surrounds were equally strong for m and p neurons. based on these studies, it appears there are more similarities than differences between primate species in the early visual system, although a full, detailed analysis is beyond the scope of the present work. compared to the crf, less is known about the presence of an ecrf in the primate lgn. indirect inhibitory input to the thalamus has been shown by babadi and colleagues to modulate lgn responses in cats (babadi., 2010). by identifying retinal input through s - potentials, they were able to exclude the retina as the source of the inhibitory modulation they observed, suggesting a non - retinal source as a likely candidate for extra - classical suppression. (kaplan., 1987), who described nonlinear contrast gain control in both the cat and monkey lgn through simultaneous s - potential and lgn single unit recordings (i.e. the retinal input could not explain the nonlinear pattern in the lgn output). solomon, white and martin (solomon., 2002) looked extensively at the suppressive effects of ecrf stimulation, or extra - classical inhibition (eci), in the primate lgn and found that more was present in the m and k pathways than the p pathway. interestingly, while the strength of eci increased as contrast increased in the ecrf, it also showed a dependence on the contrast of the rf, supporting their speculation that the ecrf might extend through the crf as well. webb and colleagues investigated the spatial distribution, both fine and coarse, of the ecrf for m and p cells (webb., 2005). their findings show that the ecrf is larger than the crf, consistent with other reports (alitto and usrey, 2008 ; solomon., 2002), but found that the ecrf is often asymmetric, concluding that there is no systematic spatial distribution to the ecrf. webb. agree with solomon. in the suggestion that the ecrf has different sources than the crf, e.g. different retinal or thalamic sources, citing the correspondence between varying spatial configurations of lgn interneuron receptive fields and the asymmetric nature of eci to also hypothesize that thalamic interneurons are involved in the ecrf. in contrast, alitto and usrey (2008) suggest that eci arises too quickly after visual stimulation for its source to be cortical feedback and thus conclude it must result from feedforward suppression from the retina. in their study, the level of response suppression in the lgn was found to be similar to the level found in the retina, confirming previous observations that the characteristics of extra - classical inhibitory effects in the retina are similar to those in lgn (solomon., 2006). like in the lgn (solomon., 2002), only retinal ganglion m cells, and not p, have an extra - classical surround present, with greater suppression at higher contrasts. this surround must be from ecrf activity and not crf activity because it was found to occur in response to stimuli that had not elicited a response in the crf (solomon., 2006). another study concluded that eci may originate in the retina because contrast adaptation in the lgn was not tuned to orientation, spatial frequency, or temporal frequency, which would not be expected if the suppression originated in the visual cortex (camp., 2009). while there are convincing arguments for both lgn interneurons and retinal ganglion cells as ecrf sources, there may be also as - yet unobserved influences from corticothalamic feedback. most studies have been performed with an anesthetized preparation, with therefore reduced levels of cortical activity (haider., 2013 ; lamme., 1998 ; niell and stryker, 2010) in addition, the timescale of cortical influence on thalamic activity may be longer than what has been investigated, especially for anesthetized preparations (uhl., 1980), or may be evident only in transient stimuli. the effect may alternately be too subtle to have been found easily, or a vital input to lgn may have been missing, like attention as seen in human fmri by oconnor. (2002), or other behaviorally driven action, like eye motion as seen in peri - saccadic influences on thalamic activity by reppas. the current evidence suggests that corticothalamic feedback does not contribute to extra - classical suppression but the possibility of an excitatory extra - classical influence remains. the presence of extra - classical suppression was found in geniculocortical afferents of anesthetized primates with a muscimol - inactivated visual cortex (sceniak., 2006). another study has compared surround suppression observed in anesthetized and alert primates and found that anesthesia does not reduce suppression (alitto and usrey, 2008). while alitto and usrey made only a qualitative comparison of the two conditions, with evidence of excitatory ecrfs in v1 (fitzpatrick, 2000) the effects of which could be communicated through the cortico - thalamic projection, we might expect to see globally balanced excitation and inhibition from the full - voiced influence of the awake cortex. one report did in fact describe weakened ec suppression following ablation of v1 in primates, suggesting that excitatory v1 feedback may somehow be balanced by other inhibitory input to lgn neurons (webb., 2002). two different functions have been proposed for the role of the ecrf (mante., 2008 ; firstly, the inhibitory effects from the ecrf may be the source of contrast gain control in relay cells within lgn, which could also account for the contrast - dependent nature of retinogeniculate transmission rates (bonin., 2005). secondly, eci may lead to contrast - dependent aperture tuning, as also seen in v1 (sceniak., 1999). as contrast increases, the summation field of lgn and v1 cells decreases in extent, and thus becomes more spatially localized. interestingly, p cells, as primary input to the temporal visual pathway or what stream (goodale and milner, 1992 ; ungerleider and mishkin, 1982), do not exhibit ecrf - driven inhibition ; precise spatial localization is less necessary in determining identity features. following parallel reasoning, m cells, as primary input to the parietal where stream, exhibit strong extra - classical inhibition ; contrast - dependent aperture tuning allows for improved spatial precision under more ideal viewing conditions. the studies done to define primate crfs and ecrfs have used artificial stimuli, leaving the question hanging of whether rf properties change when more naturalistic stimuli are used. some investigators have addressed this question with intriguing results, but all of the work has been done in the cat model, as briefly summarized in the next few paragraphs. in a classic paper studying the responses of cat lgn neurons to natural scenes, stanley. (1999) mapped the crf of 177 cells using white noise stimuli, then recorded the neural responses to three different natural scene movies, and finally performed a video reconstruction by convolving the computed crfs with the spike trains corresponding to the natural stimuli. the results were fuzzy but recognizable reproductions of the original movies, with the distribution of per - pixel correlation between the two videos peaking at 0.60.7, demonstrating that rfs from white noise stimuli were at least similar to those expected from natural scenes. building on that work, lesica and stanley (2004) examined the difference in tonic and burst spiking in responses to natural scene movies. responses were predicted using an integrate - and - fire framework and then compared with observed responses, with the finding that there was more bursting in response to the natural scene movies than to the white noise. bursting was especially strong when a long inhibitory stimulus preceded an excitatory stimulus moving into the receptive field ; moreover, bursting was found to represent a nonlinear component of the response. the more robust lgn responses to natural scenes indicate that white noise stimuli may not be as desirable when mapping rfs, especially when investigating more subtle or nonlinear effects. further support for this idea comes from work by talebi and baker in a downstream part of the visual system, cat area 18, comparing the predictive robustness of rfs generated from artificial and natural stimuli (talebi and baker, 2012). rf models generated from each were tested for predictive accuracy with matching - type and cross - type stimuli. white noise stimuli elicited weak neural responses, resulting in noisy models, whereas bars and natural images elicited stronger responses and more accurate models. natural image based models performed better in cross - type validation than models from the two artificial stimuli, again suggesting that artificial stimuli may be poor probes for rf mapping. tan and yao examined the power spectra of natural scenes, and found that lgn neurons have spatio - temporal frequency tuning that acts as an optimal linear filter to maximize information transmission of natural scenes (tan and yao, 2009). they found that the power spectra vary significantly across different scenes and speculated that the spatiotemporal frequency characteristics of lgn neurons may be tuned to the frequencies of largest variability in natural scene spectra in order to assist in discrimination of natural stimuli. proposed a model which, using the same parameters that apply to simple stimuli, predicts most of the firing rate responses to complex stimuli like natural scenes (mante., 2008), including an important role for ecrf suppression in contrast gain control. they combined a standard center - surround crf with fast - adapting gain control factors driven by local luminance and local contrast in the ecrf, and found excellent predictive power for the model, except for bursting. for further information on the topic of natural scenes, we refer the reader to simoncelli and olshausen (2001) review on the statistical methods available to analyze natural scene responses. they present an in - depth discussion of the efficient coding hypothesis and its applications, including single and multiple neuron encoding. simoncelli also offers a concise review of natural scene statistics (simoncelli, 2003), including more efficient coding hypothesis discussion that includes some criticisms of the method and proposals of how to experimentally test its validity. much of the early work in rf mapping used drifting bars or gratings with analysis techniques such as static maps created by line - weighting functions (baker and cynader, 1986 ; field and tolhurst, 1986) and response - plane maps (palmer and davis, 1981 ; stevens and gerstein, 1976). more recently the techniques of reverse correlation (ringach and shapley, 2004) driven by white noise (chichilnisky, 2001) or m - sequence (reid., 1997 ; sutter, 1991) visual stimuli to map and analyze receptive fields have been developed. 3 where a black - and - white checkerboard stimulus is presented over a putative rf location in the visual field while neural responses are recorded. 4 where a spike - triggered average (sta) is created by taking the mean of the instantaneous frames present at each observed spike. when the stimuli are spectrally white, and the sta is generalized to taking the average for multiple frame delays prior to each spike, the computation becomes equivalent to determining the average preferred stimulus of a given neuron, or the first order weiner kernel (marmarelis and marmarelis, 1978 ; victor and knight, 1979) and thus is a description of the linear part of the neuron s transfer function. the requirement for spectral whiteness is met by the use of carefully - constructed stimuli such as m - sequences that have been used to map rfs in the primate retina (benardete and kaplan, 1997a, 1997b), lgn (reid and shapley, 2002 ; usrey and reid, 2000), v1 (cottaris and de valois, 1998), and higher order visual areas (bair., 2002). in the primate lgn in particular, reid and shapley (2002) used m - sequences to investigate functional differences between cell types in the different lgn laminae, including examining the specific retinal cone contribution to thalamic responses by shifting the black - and - white luminance axis in their checkerboards to cone - isolating colors. they found that m cell responses were transient, red - green p cell responses were relatively sustained, and blue k cell responses were the most sustained (reid and shapley, 2002). (1997) also performed a similar experiment to examine the linear receptive field properties of y cells with high temporal resolution. most m and p cells in the primate lgn have linear firing properties that can be explained by linearly weighting the stimulus light pattern by a crf map (see fig. 2), however, as described in section 4, nonlinear properties such as ec suppression of m cells have been found. these nonlinear rf properties can be examined using spike - triggered covariance (stc) analysis. 2010) used flickering uniform fields to stimulate primate lgn neurons, and stas and stcs to derive estimates of the linear and second - order nonlinear receptive fields. the authors arrived at the interesting conclusion that there is a class of nonlinear cells in the lgn that encode contrast energy. thus future investigations will benefit from taking into account nonlinearities in experimental design and analysis. chichilnisky presents an analysis of the advantages and disadvantages of random white noise stimuli (chichilnisky, 2001). the benefits include minimizing the effects of adaptation, the ability to compute model - free linear responses easily, and model - free nonlinear ones with sufficient data, or, by the inclusion of a simple model, the ability to compute standard nonlinear responses quickly. while m - sequences have exact statistics when presented in entirety, they produce artifact - laden results if the sequence is not completed (chichilnisky, 2001) ; moreover if a stimulus is repeated, in general, lgn responses will be almost exactly the same for each presentation (reinagel and reid, 2000) and thus repeating an m - sequence to extend data collection does not serve to refine measurements appreciably as the stimuli are not independent and lgn responses are precise. in contrast, random noise has more flexibility in stimulus duration, as indefinitely long stimuli can be pre - computed, arbitrary segments of which can be shown during data collection without adversely affecting stimuli statistics. 2009a) found that neither correlated gaussian nor random white noise were as effective at driving neurons as luminance flicker that resembled natural scene temporal fluctuations with 1/f properties. their observations suggest that work using other and currently more common noise techniques could be sampling a limited portion of the neuronal response range. methodological advances have brought about the possibility of independently stimulating single retinal photoreceptors for extraordinarily fine - grained control over retinal input to lgn. (2000) showed that retinothalamic circuitry can be probed in monkeys using a clever laser interferometry technique that bypasses the optics of the eye to form grating stimuli directly on the retina. in a similarly technically impressive effort, sincich. (2009b) were able to reliably evoke activity from macaque lgn cells by stimulating single retinal cone cells using micron - scale spots of light targeted at the lgn crf center with a scanning laser stimulus. although neither study explored the ecrf, both were able to quantify the contribution of each of multiple cones spanning the crf for a set of example thalamic cells. as the technique of adaptive optics is relatively new, we might well expect to see additional, high - input precision visual mapping results in the near future, as suggested in the recent review by roorda (2011). 2012) discuss recent advances in information theory such as maximally informative dimensions (mid). mid allows for the use of reverse correlation techniques with stimuli other than gaussian white noise. sharpee s review (sharpee, 2013) discusses the various models that exist to define the receptive field, specifically for use in conjunction with natural stimuli. the review is a good resource for information on linear models and their expansions, stas, stcs, mids, multidimensional feature selectivity, maximally informative subspace, and maximally informative quadratic models, as well as all of these models best suited applications and the assumptions that go along with each. these methods are particularly useful for relating neural responses even when many stages of nonlinear processing are involved. in the future, such methods could be applied to higher order visual areas where responses have complex, and sometimes unknown, invariances that characterize neural feature selectivity. combining the information presented here thus far reveals a gap in current knowledge of ecrfs in the primate lgn. the work that has been done in cats shows that natural scenes and 1/f noise are better at revealing nonlinearities in neuronal responses than white noise. moreover, a commonly proposed model of ecrf effect is nonlinear, underscoring the potential importance of method selection. however, there is currently a lack of work in primates to examine these issues. the cat visual system, although similar to the primate visual system, has significant differences that should give pause when generalizing findings in cats to those for primates, especially when looking for the potential influence of corticothalamic feedback. inter- species differences can be found at the molecular level, such as when levitt and colleagues compared neuronal properties in visually- deprived macaques (levitt., 2001), in an attempt to extend guimaraes.s previous study in cats (guimaraes., sutured one eye shut shortly after birth in five macaques and compared anatomical and functional differences with four macaques which had been reared with normal vision in both eyes. the authors found that immunoreactivity for a monoclonal antibody that labels magnocellular laminae (cat-301) was uniformly reduced in laminae corresponding to the deprived eye. in cats, the cat-301 antibody specifically labels y cells, which are lost after deprivation (guimaraes., this result provides structural evidence to suggest that primates do not possess a visual pathway strictly analogous to the y cell pathway of cats, as had been earlier asserted by shapley and perry based on functional characteristics alone (shapley and perry, 1986). differences are also evident at the systems level in the early visual stream. in the cat, lgn projects to two areas of the visual cortex, brodmann areas 17 and 18, unlike the single projection to visual cortex in primates. lesioning either one of area 17 or 18 has limited effect on the functioning of the unlesioned area, and specifically does not induce profound blindness (dreher and cottee, 1975). in primates, the lgn projects almost solely to v1 and lesions of that area eliminate conscious sight entirely in the affected part of the visual field (brindley., 1969). in addition to the problems of generalizing across species, almost all work classifying rfs and ecrfs has been done in anesthetized animals, cats and primates alike, with some important exceptions. examined the differences in visual responses of alert and anesthetized macaques (alitto., 2011). they found that lgn neurons in alert animals responded with higher firing rates and the neurons had an increased ability to follow stimuli drifting at higher spatial and temporal frequencies. 2002) found saccadic eye movements modulated lgn responses to flickering fields of uniform intensity in awake, behaving macaques. in a similar study, saul (saul, 2010) found that saccades changed the response times of neurons. these results show that anesthetizing the animal changes the nature of neuronal responses, especially how they might respond to natural scenes and naturalistic noise. in a similar technical convention that has constrained results, nearly all experiments have used annular stimuli (alitto and usrey, 2008 ; babadi., 2010 ; solomon., 2006, 2002) with a limited ability to fully examine the detailed spatial structure and extent of the ecrf. non - uniformity of an annular structure in the ecrf has been reported (webb., 2005), but a rigorous, definitive mapping has not yet been performed. contemporary stimulus generation systems are able to present full - field arbitrary stimuli at high refresh rates, and contemporary computers are readily capable of analyzing large volumes of data (alivisatos., 2012 ; briggman and bock, 2012) created by extensive stochastic stimuli. further experiments in alert primates responding to natural stimuli that address these gaps in the current body of work are needed to better understand the visual system and its properties, and the technical and analytic tools to do so are now available. in this paper we have gathered current knowledge of primate lgn receptive fields, classical and extra - classical, to illuminate the areas that need more work to achieve a better understanding. much less is known about ecrfs, their source, shape, and how they behave in response to stimuli, than crfs. most of the studies that have involved lgn mapping concentrate on the crf, and few have examined the ecrf. just as there is more known about crfs than ecrfs, there is more work done using artificial stimuli than with natural stimuli. because most of the work done has been with artificial stimuli, it is hard to know if the field is inadvertently missing important factors involved in visual processing that are present when natural stimuli are used. technological advancement in stimulus generation and data analysis provide the opportunity to study the ecrf and the crf in greater detail. coupled with the growing appreciation of the importance of conscious influence on early sensory processing, the field could see a shift toward using natural stimuli in awake animals for a fuller understanding of the visual system. despite the tremendous advances in the half - century since hubel and wiesel s initial work | mapping neuronal responses in the lateral geniculate nucleus (lgn) is key to understanding how visual information is processed in the brain. this paper focuses on our current knowledge of the dynamics the receptive field (rf) as broken down into the classical receptive field (crf) and the extra - classical receptive field (ecrf) in primate lgn. crfs in the lgn are known to be similar to those in the retinal ganglion cell layer in terms of both spatial and temporal characteristics, leading to the standard interpretation of the lgn as a relay center from retina to primary visual cortex. ecrfs have generally been found to be large and inhibitory, with some differences in magnitude between the magno-, parvo-, and koniocellular pathways. the specific contributions of the retina, thalamus, and visual cortex to lgn ecrf properties are presently unknown. some reports suggest a retinal origin for extra - classical suppression based on latency arguments and other reports have suggested a thalamic origin for extra - classical suppression. this issue is complicated by the use of anesthetized animals, where cortical activity is likely to be altered. thus further study of lgn ecrfs is warranted to reconcile these discrepancies. producing descriptions of rf properties of lgn neurons could be enhanced by employing preferred naturalistic stimuli. although there has been significant work in cats with natural scene stimuli and noise that statistically imitates natural scenes, we highlight a need for similar data from primates. obtaining these data may be aided by recent advancements in experimental and analytical techniques that permit the efficient study of nonlinear rf characteristics in addition to traditional linear factors. in light of the reviewed topics, we conclude by suggesting experiments to more clearly elucidate the spatial and temporal structure of ecrfs of primate lgn neurons. |
we retrospectively enrolled 24 cognitively normal subjects, 45 patients with amnestic mild cognitive impairment (amci), 40 with ad, 38 with parkinson s disease - mild cognitive impairment (pd - mci), 31 with pdd, and 22 with dlb from patients seen in the movement disorders and dementia outpatient clinic at a university hospital. information on the patients cognitive deficits was obtained from a caregiver - based interview. to determine cognitive subsets in the diagnosis of mci or dementia type, we used the seoul neuropsychological screening battery (snsb).17 the snsb covers attention, language, praxis, four elements of gerstmann syndrome, visuoconstructive function, verbal and visual memory, and frontal / executive function. the quantifiable tests used were the digit span (forward and backward), the korean version of the boston naming test,18 the rey complex figure test (copying, immediate and 20-minute delayed recall, and recognition), the seoul verbal learning test (three learning - free recall trials of 12 words, 20-minute delayed recall trial for these 12 items, and a recognition test), the phonemic and semantic controlled oral word association test, and the stroop test (word and color reading of 112 items during a 2-minute period). age-, sex-, and education - specific norms for each test based on 447 normal subjects are available.17 the scores of these quantifiable cognitive tests were classified as abnormal when they were below the sixteenth percentiles of the norms for the age-, sex-, and education - matched normal subjects. a patient was diagnosed with amci when at least one of the five cognitive domains, including the memory domain, was abnormal, and the patient did not meet the criteria for dementia. using the concept of mci suggested by petersen.19 the diagnosis of mci in patients with pd was made if at least one of the five cognitive domains was abnormal. all the amci and pd - mci patients had scores on the korean version of the mmse (k - mmse) above the sixteenth percentile for the age- and educational - appropriate norm and showed no evidence of deficits in activities of daily living. the clinical diagnosis of probable ad followed the national institute of neurological and communicative disorders and stroke / alzheimer s disease and related disorders association guidelines.20 patients were assigned to pdd when dementia occurred in the context of well - established pd (according to the uk parkinson disease society brain bank criteria) with a time interval of at least 1 year after the onset of the motor syndrome.21,22 probable dlb was diagnosed according to the consensus guidelines of the third report of the dlb consortium.23 exclusion criteria were evidence of focal brain lesions, diffuse white matter hyperintensities, or multiple lacunae in the basal ganglia on mri. possible medical comorbidities were excluded by laboratory tests, including thyroid function tests, vitamin b12 and folic acid levels, and the vdrl test. healthy age- and gender - matched elderly volunteers were used as controls for the mri - based volumetric analysis. they were recruited by advertisements about the project or were healthy relatives of patients with movement disorders or dementia (n = 24, age = 72.0 years). all scans of healthy controls and patients with ad, pdd, and dlb were acquired using a philips 3.0-t scanner (philips intera ; philips medical system, best, the netherlands) with a sense head coil (sense factor = 2). a high - resolution t1-weighted mri volume dataset was obtained for all subjects using the 3d t1-tfe sequence configured with the following acquisition parameters : axial acquisition with a 224 256 matrix ; 256 256 reconstructed matrix with 182 slices in the coronal plane ; 1-mm - thick sections ; 220-mm field of view ; 0.98 0.98 1.2 mm voxels ; te, 4.6 ms ; tr, 9.6 ms ; flip angle, 8 ; slice gap, 0 mm. the delineation of the si on mri was based on the method reported by george.1 the si volume was measured on three consecutive coronal sections using the following demarcation. for the first section at the level of the crossing of the anterior commissure, the ventral aspect of the globus pallidus demarcated the dorsal border of the si, and the ventral border was the base of the brain containing the anterior perforated space. the medial border of the si was defined by a vertical line extending from the ventrolateral border of the bed nucleus of the brain. the second section was between the first and third sections, and the third section was at the level of the emergence of the anterior commissure from the temporal lobe. to correct for individual brain size, the volumes were normalized by dividing by the total intracranial volume derived from sagittally formatted 10-mm slices. the normalized si volume was defined by the following formula : total si volume (mm)/total intracranial volume (mm) 10,000. the intra- and inter - rater reliability were 0.82 and 0.80, respectively. one - way analysis of variance followed by post hoc comparisons was used to compare group differences in age, duration of education, total intracranial volume, normalized si volume, and the k - mmse and clinical dementia rating scores. pearson s correlation analysis was used to analyze the relationship between si volume and the k - mmse score. we retrospectively enrolled 24 cognitively normal subjects, 45 patients with amnestic mild cognitive impairment (amci), 40 with ad, 38 with parkinson s disease - mild cognitive impairment (pd - mci), 31 with pdd, and 22 with dlb from patients seen in the movement disorders and dementia outpatient clinic at a university hospital. information on the patients cognitive deficits was obtained from a caregiver - based interview. to determine cognitive subsets in the diagnosis of mci or dementia type, we used the seoul neuropsychological screening battery (snsb).17 the snsb covers attention, language, praxis, four elements of gerstmann syndrome, visuoconstructive function, verbal and visual memory, and frontal / executive function. the quantifiable tests used were the digit span (forward and backward), the korean version of the boston naming test,18 the rey complex figure test (copying, immediate and 20-minute delayed recall, and recognition), the seoul verbal learning test (three learning - free recall trials of 12 words, 20-minute delayed recall trial for these 12 items, and a recognition test), the phonemic and semantic controlled oral word association test, and the stroop test (word and color reading of 112 items during a 2-minute period). age-, sex-, and education - specific norms for each test based on 447 normal subjects are available.17 the scores of these quantifiable cognitive tests were classified as abnormal when they were below the sixteenth percentiles of the norms for the age-, sex-, and education - matched normal subjects. a patient was diagnosed with amci when at least one of the five cognitive domains, including the memory domain, was abnormal, and the patient did not meet the criteria for dementia. using the concept of mci suggested by petersen.19 the diagnosis of mci in patients with pd was made if at least one of the five cognitive domains was abnormal. all the amci and pd - mci patients had scores on the korean version of the mmse (k - mmse) above the sixteenth percentile for the age- and educational - appropriate norm and showed no evidence of deficits in activities of daily living. the clinical diagnosis of probable ad followed the national institute of neurological and communicative disorders and stroke / alzheimer s disease and related disorders association guidelines.20 patients were assigned to pdd when dementia occurred in the context of well - established pd (according to the uk parkinson disease society brain bank criteria) with a time interval of at least 1 year after the onset of the motor syndrome.21,22 probable dlb was diagnosed according to the consensus guidelines of the third report of the dlb consortium.23 exclusion criteria were evidence of focal brain lesions, diffuse white matter hyperintensities, or multiple lacunae in the basal ganglia on mri. possible medical comorbidities were excluded by laboratory tests, including thyroid function tests, vitamin b12 and folic acid levels, and the vdrl test. healthy age- and gender - matched elderly volunteers were used as controls for the mri - based volumetric analysis. they were recruited by advertisements about the project or were healthy relatives of patients with movement disorders or dementia (n = 24, age = 72.0 years). all scans of healthy controls and patients with ad, pdd, and dlb were acquired using a philips 3.0-t scanner (philips intera ; philips medical system, best, the netherlands) with a sense head coil (sense factor = 2). a high - resolution t1-weighted mri volume dataset was obtained for all subjects using the 3d t1-tfe sequence configured with the following acquisition parameters : axial acquisition with a 224 256 matrix ; 256 256 reconstructed matrix with 182 slices in the coronal plane ; 1-mm - thick sections ; 220-mm field of view ; 0.98 0.98 1.2 mm voxels ; te, 4.6 ms ; tr, 9.6 ms ; flip angle, 8 ; slice gap, 0 mm. the delineation of the si on mri was based on the method reported by george.1 the si volume was measured on three consecutive coronal sections using the following demarcation. for the first section at the level of the crossing of the anterior commissure, the ventral aspect of the globus pallidus demarcated the dorsal border of the si, and the ventral border was the base of the brain containing the anterior perforated space. the medial border of the si was defined by a vertical line extending from the ventrolateral border of the bed nucleus of the brain. the second section was between the first and third sections, and the third section was at the level of the emergence of the anterior commissure from the temporal lobe. to correct for individual brain size, the volumes were normalized by dividing by the total intracranial volume derived from sagittally formatted 10-mm slices. the normalized si volume was defined by the following formula : total si volume (mm)/total intracranial volume (mm) 10,000. the intra- and inter - rater reliability were 0.82 and 0.80, respectively. one - way analysis of variance followed by post hoc comparisons was used to compare group differences in age, duration of education, total intracranial volume, normalized si volume, and the k - mmse and clinical dementia rating scores. pearson s correlation analysis was used to analyze the relationship between si volume and the k - mmse score. no significant difference in age, gender, education level, or total intracranial volume was found among the control, amci, pd - mci, ad, pdd, and dlb groups. compared with the control subjects (2.05 0.52), the mean normalized si volume was significantly smaller in the patients with amci (1.70 0.39, p = 0.006), pd - mci (1.70 0.35, p = 0.008), ad (1.65 0.41, p < 0.001), pdd (1.36 0.32, p < 0.001), and dlb (1.30 0.33, p < 0.001). compared with the patients with amci, the normalized si volume was significantly smaller in the patients with pdd (p = 0.003) and dlb (p = 0.001) ; however, the volume did not differ significantly from those with ad. compared with the patients with pd - mci, the normalized si volume was significantly smaller in the patients with pdd (p = 0.003) and dlb (p = 0.001). on comparison among dementia subjects, the normalized si volume did not differ between patients with pdd and dlb. however, the normalized si volume was significantly decreased in subjects with pdd (p = 0.029) and dlb (p = 0.011) compared with ad subjects (figure 1). in patients with ad - related cognitive impairment (amci or ad), there was no significant correlation between the si volume and general cognitive function, as measured using the k - mmse score (r = 0.045, p = 0.685) (figure 2b). in contrast, the si volume in subjects with pd - related cognitive impairment (pd - mci, pdd, or dlb) showed a significant positive correlation with general cognitive function (r = 0.366, p < 0.001) (figure 2a). no significant difference in age, gender, education level, or total intracranial volume was found among the control, amci, pd - mci, ad, pdd, and dlb groups. compared with the control subjects (2.05 0.52), the mean normalized si volume was significantly smaller in the patients with amci (1.70 0.39, p = 0.006), pd - mci (1.70 0.35, p = 0.008), ad (1.65 0.41, p < 0.001), pdd (1.36 0.32, p < 0.001), and dlb (1.30 0.33, p < 0.001). compared with the patients with amci, the normalized si volume was significantly smaller in the patients with pdd (p = 0.003) and dlb (p = 0.001) ; however, the volume did not differ significantly from those with ad. compared with the patients with pd - mci, the normalized si volume was significantly smaller in the patients with pdd (p = 0.003) and dlb (p = 0.001). on comparison among dementia subjects, however, the normalized si volume was significantly decreased in subjects with pdd (p = 0.029) and dlb (p = 0.011) compared with ad subjects (figure 1). in patients with ad - related cognitive impairment (amci or ad), there was no significant correlation between the si volume and general cognitive function, as measured using the k - mmse score (r = 0.045, p = 0.685) (figure 2b). in contrast, the si volume in subjects with pd - related cognitive impairment (pd - mci, pdd, or dlb) showed a significant positive correlation with general cognitive function (r = 0.366, p < 0.001) (figure 2a). this study evaluated whether degeneration of the si and its relationship to general cognitive performance differ in ad- and pd - related cognitive impairments. the major findings of this study were 1) the mean normalized si volume was significantly smaller in patients with either amci or pd - mci, 2) the loss of si volume was greater in pd - related dementia (pdd or dlb) than in ad, and 3) si volume was significantly correlated with general cognitive decline only in patients with pdd or dlb. a few studies have examined si volume using mri in patients with mci ; however, the results are conflicting. muth.24 and grothe.25 reported that the si volume was significantly decreased in mci compared with normal elderly controls, whereas george.1 showed that the si volume in mci did not differ from that in controls. in patients with pd, we previously reported that the si volume was significantly decreased in pd - mci compared with the controls.26 in the present study, we found that the si volume was significantly decreased in amci and pd - mci, suggesting that cholinergic degeneration occurs with mci status regardless of the ad or pd prototypes. studies that compared the si atrophy in ad and dlb by measuring the si length12,13 have shown that the thickness of the si was significantly greater in ad than in dlb, which concurs with our si volume analysis. our data showed that the normalized si volume was significantly smaller not only in subjects with dlb but also in subjects with pdd compared with ad. because a study showed that cortical cholinergic activity is more severely affected in parkinsonian dementia than in alzheimer disease,14 our result suggests that the degeneration of the cholinergic system arising from the nucleus basalis of meynert is more closely coupled with pd - related dementia than with ad - related dementia. on comparing subjects with alpha - synuclein - related dementia, the normalized si volume did not differ between patients with pdd and dlb. this result is in line with a functional pet imaging study that showed that the cholinergic activity did not differ between pdd and dlb.8 accordingly, previous data and ours support the concept that pdd and dlb lie on a common disease spectrum with respect to cholinergic pathophysiology. contrary to previous reports,1 in the subjects with ad - related cognitive impairment (amci or ad), there was no significant correlation between the si volume and general cognitive function. in contrast, there was a significant positive correlation between the si volume and general cognitive function in the subjects with pd - related cognitive impairment (pd - mci, pdd, or dlb). this suggests that cognitive performance is closely dependent on the cholinergic system in pd - related cognitive impairment, whereas this relationship is weak in ad - related cognitive impairment. furthermore, this finding in our study is supported by a previous clinical study indicating that the response to cholinesterase inhibitors is greater in dlb than in ad.2729 in summary, our data suggest that the si volume loss is greater in alpha - synucleinopathy - related dementia (pdd or dlb) than in ad, and the contribution of the si to cognitive performance is greater in alpha - synucleinopathy - related cognitive impairments than in ad. | background and purposethe substantia innominata (si) contains the nucleus basalis of meynert, which is the major source of cholinergic input to the cerebral cortex. we hypothesized that degeneration of the si and its relationship to general cognitive performance differs in amyloidopathy and synucleinopathy.methodswe used magnetic resonance imaging (mri)-based volumetric analysis to evaluate the si volume in patients with amnestic mild cognitive impairment (amci), alzheimer s disease (ad), parkinson s disease - mild cognitive impairment (pd - mci), pd with dementia (pdd), dementia with lewy bodies (dlb), and healthy elderly controls. the correlation between si volume and general cognitive performance, measured using the korean version of the mini - mental state examination (k - mmse), was examined.resultscompared to control subjects, the mean normalized si volume was significantly decreased in all of the other groups. the normalized si volume did not differ between the subjects with pdd and dlb, whereas it was significantly smaller in subjects with pdd (p = 0.029) and dlb (p = 0.011) compared with ad. in subjects with pd - related cognitive impairment (pd - mci, pdd, or dlb), there was a significant positive correlation between the si volume and k - mmse score (r = 0.366, p < 0.001), whereas no correlation was seen in subjects with ad - related cognitive impairment (amci or ad).conclusionsour data suggest that the si loss is greater in synucleinopathy - related dementia (pdd or dlb) than in ad and that the contribution of the si to cognitive performance is greater in synucleinopathy than in amyloidopathy. |
the need for novel approaches to treat infectious diseases at a time of increasing drug resistance and the emergence of new pathogens is obvious and urgent. in recent decades the problem of drug resistance has been compounded by the emergence of many new infectious diseases like hiv. simultaneously the population of patients in whom current antimicrobial therapies are not effective because of their low immune status is expanding and these include hiv - infected individuals, cancer patients undergoing chemotherapy, and recipients of organ transplants. in addition, there is a threat of biological agents specifically engineered to be lethal even in immunocompetent population. this situation has renewed interest in using monoclonal antibodies (mabs) in therapy of infectious diseases. radioimmunotherapy (rit) relies on antibodies to deliver cytotoxic alpha- or beta radiation to tumor cells. radiolabeled mab zevalin and bexxar are fda approved for untreated, refractory, and recurrent lymphomas. several years ago we introduced rit into the realm of infectious diseases, showing prolonged survival in mice systemically infected with cn and treated after infection with radiolabeled mab specific for cn polysaccharide capsule. during the last 7 years we have successfully adapted rit for the treatment of experimental fungal, bacterial, and viral infections [47 ]. as our model organism for studying the efficacy, mechanisms, potential toxicity, and radioresistance to rit, as well as for comparison of rit with the existing antimicrobial therapies we have chosen the encapsulated yeast cryptococcus neoformans (cn). cn has a worldwide distribution and is a major fungal pathogen in immunocompromised hosts responsible for nearly one million serious infections annually and 600,000 deaths. although the burden of disease is disproportional in individuals with hiv infection, there remains a major risk for cryptococcosis in transplant patients or individuals receiving immunosuppressive drugs, as well as in patients with cancer, cirrhosis, and a variety of other medical conditions. its major virulence factors are polysaccharide and melanin pigment in the cell wall. over the past decade, cryptococcus gattii has gained significant public attention as the causative agent of devastating pulmonary and central nervous system infections in immunocompetent individuals principally in the northwestern usa and canada. humoral immunity to cn has been extensively studied by casadevall 's laboratory for almost 20 years. two mabs generated by his laboratory18b7 mab to cn capsular polysaccharide antigen and 6d2 mab to melanin have been used in clinical trials : trial of naked 18b7 in patients with cryptococcal meningitis has been completed ; and in collaboration with dadachova 188-rhenium - labeled 6d2 is currently undergoing trial in patients with metastatic melanoma [10, 11 ]. cn provides an excellent model for a chronic infection and advantages of the cn system include (1) animal models including those for pulmonary, meningeal, and latent infection ; (2) the availability of very well - characterized mabs to cn that can be developed into rit agents ; (3) the availability of anti - idiotypic reagents that can be used to study the fate of labeled mabs ; (4) well - understood pathogenesis of infection and immune response. here we will present the summary of the therapeutic efficacy of rit of cn, its toxicity and potential for radioresistance, radiobiological mechanisms, and comparison with the standard antifungal therapy and we will outline future perspective for developing rit into the universal anti - fungal modality in immunocompromised patients. we initially explored the potential efficacy of rit against a systemic cn infection in partially complement deficient aj / cr mice (national cancer institute, frederick, md). we radiolabeled cn polysaccharide capsule - specific mab 18b7 with alpha - particle emitting 213-bismuth (bi) or the beta - particle emitting 188-rhenium (re). mice treated with radiolabeled 18b7 mab lived significantly longer than mice given irrelevant labeled igg1 or pbs. we used a labeled irrelevant mab (bi- or re - labeled igg1 mopc21) to control for the possibility that fc receptor binding by the radiolabeled igg to phagocytes at the site of infection might result in nonspecific killing of cn cells. remarkably, 60% of mice in 100 ci bi group were alive on day 75 after therapy (p.05) (figure 3(c)). survival of mice treated with bi-18b7 mab was longer (p =.04) than with re-18b7 (figure 3(c)), probably due to the higher killing power of alpha particles from bi, compared to electrons from re. overall, the treatment of cn with particulate radiation leads to loss of the ability of the cells to replicate [3, 19 ], which would explain the absence of radiation - resistant phenotypes after rit. the residual cells which replicate after rit most likely were protected from radiolabeled antibodies by a biofilm, an abscess, or a host cell. given that rit of infectious diseases is a relatively young field, the mechanisms by which rit is effective are uncertain. even in oncology where the antineoplastic effects of rit have been investigated for more than 25 years the cytotoxic mechanisms are still debated. the major radiobiological mechanisms of cancer rit are considered to be direct hit (when a cell is killed by radiation emanating from the same cell) and cross - fire effects (when a cell is killed by radiation emanating from a distant cell), both of which can promote apoptosis and cell cycle redistribution. we investigated the radiofungicidal effects of external gamma radiation and bi- or re - labeled mabs on cn cells by evaluating the effect of radiofungicidal doses on cell membrane permeability, induction of apoptosis, and cellular metabolism. an increased membrane permeability to the dye propidium iodide (pi) is considered to be a marker of cell death since viable cells with intact membranes are able to exclude the dye. pi staining correlates with loss of colony forming units (cfus) in a variety of microorganisms including cn treated with antifungal agents. the permeability increased with time between 1 and 3 hr following gamma irradiation, indicating that it was probably secondary to cell death, not a cause of death (figure 4(a)). it seems likely that the cells in this 20% of the population are metabolically dead and unable to maintain membrane integrity. cells stained 3 hr after irradiation showed dose - dependent pi staining up to 300 gy (25% pi positive), with a decrease to 10% pi positive at the highest dose (figure 4(a)). this observation suggests that membrane damage is not the primary lethal event, as 80% of the cells had lost the ability to replicate at these doses. the decrease in pi positive cells at the highest dose may be due to radioprotective effects from the shed capsule. treatment of cn with re-18b7 did not make the cells pi permeable (figure 4(b)). treatment with bi-18b7 mab led to about 7% of the cells becoming pi permeable, at a dose that caused 80% loss of cfus (figure 4(c))., we investigated whether radiation increased levels of fungal caspase, as measured by flica (fluorochrome labeled inhibitor of caspase) binding a membrane permeable substrate that binds to caspases induced during early apoptosis. earlier, we validated this technique for use with cn by comparing the flica results with those obtained using apo - brdu tunel apoptosis detection kit. gamma - irradiated cells were about 10% flica positive at 3 hr (figure 4(d)) while 20 and 5% of cn cells exposed to re-18b7 or bi-18b7 mabs, respectively, became flica positive (figures 4(e) and 4(f)). the number of flica positive bi-18b7 mab - treated cells staining was higher at 17 hrs than at 3 hrs, indicating an ongoing process of apoptosis induction. apoptosis is a dynamic process, and cells pass through several stages, not staying at any one stage for a long time. the decrease seen at 21 hrs for the gamma - radiation treated cells may indicate that at that time the cells have finished the stage of apoptosis during which the caspases are available to bind the fluorescent inhibitors. this is in contrast to the increase with time observed for bi-18b7 mab treated cells and may reflect a difference in pathways of cell death induced by the different forms of radioactivity. we concluded that gamma, beta, and alpha radiation affected cells via different pathways. all forms of radiation stimulated apoptosis - like cell death with gamma radiation and re-18b7 mab having more pronounced effect than bi-18b7 mab. bi-18b7 mab delivered directly decreased the metabolic activity of fungal cells, while the other forms of radiation did not. clonogenic survival proved to be the most practical measure of assessing rit efficacy, by virtue of reflecting a combination of multiple mechanisms leading to fungal cell death. cells which are alive after rit treatment, but not replicating, may or may not contribute to the disease. to elucidate the contribution of direct hit and cross - fire effects to rit of cn we compared the fungicidal activity of a mab radiolabeled with bi or re isotopes with different emission ranges in tissue 5080 m for bi versus 10 mm for re. in cancer rit, bi is assumed to kill by direct hit, while re, through cross - fire. in principle, every cell with bound radiolabeled mab molecules can be killed by a direct hit and simultaneously serve as a source of cross - fire radiation. by measuring the killing of the cells in rit and in cross - fire experiments, we can calculate contribution of direct hit towards cell killing by subtracting percentage of cells killed by cross - fire from percentage of cells killed by rit. the results discussed below are published in. to observe cross - fire we had to ensure that the cells that served as the sources of cross - fire radiation could not be killed themselves by direct hit. consequently, we used heat killed cn cells as the sources of cross - fire radiation., cross - fire effect also contributed to the fungicidal effect of rit (figure 4(g)). cross - fire effect was responsible for most of cn killing (figure 4(h)). this system permits experiments to elucidate precise mechanisms of cell killing in rit that have not been performed either for microbial or cancer cells. in rit targeting of cancer cells the antibody is often internalized after binding, adding significant complexity to the experiment. one of the advantages of the cn system is that the capsule is outside the cell wall and that antibody is not internalized, thus allowing exploration of this fundamental problem in radiobiology. one minor limitation of this system is that the antibody could be internalized by phagocytes that ingest the antibody - labeled cn. knowledge of the radiobiological mechanisms of rit will allow creation of more effective protocols for rit of opportunistic fungal infections. as an important step towards bringing rit of fungal diseases into the clinic, we compared the efficacy of rit versus amphotericin against systemic experimental cn infection. we hypothesized that 18b7 mab radiolabeled with bi or with re would be able to kill both melanized and nonmelanized cn cells in vivo better than standard antifungal therapy. we also investigated whether the combination of rit and amphotericin treatment produced different results from either therapy alone. for this melanized and nonmelanized 24067 cn cells were incubated with increasing activities of re- and bi-18b7 mab. incubation of melanized and nonmelanized cells with re- or bi-18b7 mab killed 90% of the cells and delivered cellular radiation doses of 0.1 krad for re-18b7 and 0.04 krad for bi-18b7 (figures 5(a) and 5(b)). bi or re conjugated to the irrelevant isotype - matching antibody mopc killed neither type of cell (figures 5(a) and 5(b)). the difference in susceptibility of melanized and nonmelanized cells to antibody - delivered radiation became obvious when we attempted to achieve 99.9% elimination of cells. sixteen ci (0.8 krad dose) of re-18b7 mab eliminated 99.9% of nonmelanized cells, while that degree of cell killing was not achieved for melanized cells in the investigated range of activity. bi-18b7 mab killed 99.7% of nonmelanized cells with 0.4 ci (0.17 krad dose) but again that level of cell killing was not observed for melanized cells. as approximately 10 times less bi than re radioactivity was required to eliminate the bulk of either melanized or nonmelanized cells we selected bi - mabs for in vivo comparison with amphotericin. one g / ml amphotericin reduced cn cfus by more than two log units (figure 5(c)). considering published mic for melanized 24067 cn being higher than for nonmelanized ; we selected a dose of 1 g / gram of mouse body weight (~17g / mouse), allowing a transient blood concentration of 8.5 g / ml, for in vivo experiments. subsequently we compared the efficacy of rit alone to that of amphotericin and combined therapy in vivo. one day after infection mice were divided into groups of 5 that were either untreated ; or given ip 100 ci bi-18b7 ; or treated at 24, 48, and 72 h with amphotericin as deoxycholate at 1 g / g body weight ; or received both treatments. analysis of lungs and brains at 60 days after infection showed that amphotericin did not significantly decrease cfus in the lungs and the brains in either nonmelanized (figure 5(d)) or melanized cn groups (figure 5(e)) (p >.05). rit had significantly decreased fungal burdens compared to untreated or amphotericin - treated mice (p.05). in fact, rit - treated nonmelanized cn group almost completely cleared fungus from the brain (the lower limit of detection was 50 cfus), while rit - treated melanized cn group almost completely cleared the infection from both brain and lungs. our most important observation is that rit was more effective in reducing fungal burden in lungs and brains than amphotericin at a high dose of 1 g / g, with most rit - treated mice almost completely clearing the infection. the inability of amphotericin to reduce the fungal burden in the organs of partially complement deficient ajcr mice after 3 days of treatment was explained by the follow - up study with a trend towards reduction of cfus in brains and lungs manifesting itself only on the 14th day of treatment (figure 5(f)). these observations are in concert with literature showing that even in intact robust mice as cd-1 or balb / c amphotericin as deoxycholate was also only able to produce 11.5 log reduction in cfus and all mice died around day 24 [27, 28 ]. it is also in concert with the data from clinical studies showing that a short course of amphotericin does not sterilize cerebrospinal fluid or blood, and that the rate of sterilization correlates with survival. our observation underlines the advantages of rit which produces microbicidal effects in vivo just after one injection when compared to prolonged treatment with amphotericin. when combined rit and amphotericin treatment was used combination treatment was more effective than amphotericin alone for both nonmelanized and melanized cn groups. in melanized cn group the combination treatment was less effective than rit which could be due to inflammation and renal toxicities associated with amphotericin at this dose in mice. interestingly, for nonmelanized cn the combination treatment did produce some synergy in reducing cfus in the lungs. it is possible to suggest that if rit is administered much later during the course of treatment with amphotericin ; some synergistic effects could be observed. the success of rit of cn in laboratory studies combined with earlier nuclear medicine experience on preclinical and clinical studies showing the utility of radiolabeled organism - specific antibodies for imaging of infections (reviewed in) provides encouragement for feasibility of therapeutically targeting microbes with labeled antibodies. in fact, the ability of a specific antibody to localize to a site of infection indicates the feasibility of using the antibody - antigen interaction to deliver microbicidal radiation to sites of infection, which in turn provides strong support for the potential usefulness of this technique as a broad antimicrobial strategy. as microbial cells are foreign to the human body ; they contain antigens that are not expressed by human tissues and this provide a major contrast to cancer rit since tumor - associated antigens are also expressed on normal tissues. consequently, the theoretical therapeutic index of rit for microbial diseases should be significantly higher than for neoplastic diseases. this exquisite specificity promises exclusivity of targeting which should translate into high efficacy of treatment and low toxicity. it might be possible to create a so - called pan - antibody which would recognize an antigen shared by a particular class of human pathogens such as fungi, for example. example of such panantibodies is a mab 6d2 initially developed against fungal melanin which also binds to synthetic, invertebrate (cuttlefish), murine and human melanin ; mabs to heat shock protein 60 (hsp60) and beta - glucans which bind to all major human pathogenic fungi. the experiments on developing rit with such panantibodies are currently ongoing in our laboratories (bryan the availability of such antibodies would eliminate the necessity of having antibodies specific for each particular microorganism and would enormously enhance the development of rit of infectious diseases. | there is an obvious and urgent need for novel approaches to treat infectious diseases. the use of monoclonal antibodies in therapy of infectious diseases is now experiencing renewed interest. during the last 5 years radioimmunotherapy (rit), a modality previously developed only for cancer treatment, has been successfully adapted for the treatment of experimental fungal, bacterial, and viral infections. as our model organism for studying the efficacy, mechanisms, potential toxicity, and radioresistance to rit, as well as for comparison of rit with the existing antimicrobial therapies we have chosen the encapsulated yeast cryptococcus neoformans (cn). the success of rit approach in laboratory studies provides encouragement for feasibility of therapeutically targeting microbes with labeled antibodies. in addition, the creation of panantibodies for rit which would recognize antigens shared by the whole class of pathogens such as fungi, for example, would facilitate the introduction of rit into the clinic. |
desmoid tumours (dts), also known as fibromatoses, are rare soft tissue tumours that result from the abnormal proliferation of fibroblasts in musculo - aponeurotic structures. they account for 0.03% of all neoplasms and can occur in mesenchymal structures of the limb and limb girdle, intra - abdominally or within the abdominal wall,. although they are thought to lack metastatic capacity, dts can cause significant morbidity and even mortality due to size, compression and invasion of adjacent structures. aetiological factors associated with dts are female gender especially of reproductive age, a history of abdominal surgery or trauma, and a family history of fibromatoses. intra - abdominal dts are more commonly associated with familial adenomatous polyposis (fap), an autosomal dominant inherited disorder that arises from mutations of the apc tumour suppressor gene. desmoid tumours localized in the abdomen have a worse prognosis as they can cause intestinal bleeding, obstruction and perforation. we report a rare case of a patient presenting in an acute confusional state who was found to have small bowel obstruction and perforation due to two large intra - abdominal dts arising from the small bowel mesentery. a 54-year old nigerian man presented to the emergency department in an acute confusional state. he had a background of three weeks of colicky abdominal pain which was associated with intermittent vomiting, hiccupping and polydipsia. he had been opening his bowels daily and there was no history of weight - loss, haematemesis or rectal bleeding. he was scheduled to have an abdominal ultrasound scan and on the day prior to presenting to hospital he had an oesophago - gastro - duodenoscopy (ogd). this showed gastritis and a gastric ulcer in gastric antrum and pre - pyloric region, respectively, as well as a large volume of gastric content despite a 10-h fast. a tissue biopsy was taken. his abdomen was mildy distended and tender with no signs of peritonism or palpable masses. laboratory tests revealed a mild normocytic anaemia (haemoglobin count 11.5 g / dl), raised inflammatory markers (white cell count 29.5 10 9/l, c reactive protein 238 mg / l), impaired renal function (urea 23.4 mmol / l, creatinine 233, estimate gfr 25 ml / min/1.73), a significant hyponatraemia (na 104 mmol / l) and a raised serum lactate (3.4 mmol / l). serum osmolality, urinary sodium and urinary osmolality were all decreased (244 mosmol / kg, 27 mmol / l and 206 mosmol / kg, respectively). however, a ct of the abdomen and pelvis revealed two soft tissue masses in the abdomen ; the largest measuring 6.8 cm in the mid abdomen appeared to be causing proximal small bowel obstruction, and separate mass of similar tissue density measuring 5 cm adjacent to the ileocaecal region surrounded by a small amount of free fluid (fig. he was admitted into the intensive care unit for support and monitoring. at laparotomy the next day he was found to have a necrotic 7 cm mass arising from the mesentery of the distal jejunum / proximal ileum invading the contiguous small bowel, causing obstruction and perforation (fig. 2). a second mass measuring 6 cm was found arising from the mesoappendix and infiltrating into the ileocaecal region (fig. ileal and ileocaecal resections were carried out but due to the poor general condition of the patient four blind ending loops were left in the abdomen. a planned re - look laparotomy was undertaken 48 h later with formation of jejuno - ileal and ileo - colic anastomosis. five days later he had a third laparotomy for suspected anastomotic dehiscence and was found to have a defect in the jejuno - ileal anastomosis. a controlled enterostomy using a foley catheter was formed, and the abdomen was managed as a laparostomy for 10 days after which an abdominal vac dressing was applied to facilitate abdominal wall closure microscopically, both lesions involved the walls of each bowel segment and formed a mesenteric mass, involving the serosal surface, which was coated in acute inflammatory exudates. the lesions were formed of bland, uniform spindle cells and partially replaced muscularis propria. the lesional spindle cells in each mass expressed smooth muscle actin, beta - catenin and vimentin. other immunomarkers were negative (alk-1, bcl-2, cd117, cd34, cd45, desmin, ema, mnf116, p63 and s100). a diagnosis of desmoid type fibromatoses / synchronous dts was made and confirmed by an external expert sarcoma hitopathologist. the immunohistochemical profile excluded differential diagnoses of gastrointestinal stromal tumour (gist), inflammatory myofibroblastic tumour, leiomyoma, peripheral nerve sheath tumour, spindle cell carcinoma, peripheral nerve tumour and metastatic spindle cell melanoma. the patient s post - operative recovery was slow with a 49-day stay in the intensive care unit and multiple theatre sessions for change of abdominal vac dressing. he was an inpatient for a total of 57 days and was eventually discharged with an abdominal vac dressing, with planned community follow - up. he was seen in outpatients 6 weeks following discharge and was referred for a colonoscopy which did not show any evidence of colonic polyposis. as there was no family history of or clinical evidence for fap he was referred to a specialist sarcoma centre for follow up. only 5% of sporadic dts are intra - abdominal. in contrast, 80% of patients with familial adenomatous polyposis (fap)-associated desmoid tumours develop intra - abdominal disease. the majority of intra - abdominal dts (85%) arise from the mesentery, and can cause significant morbidity and mortality due to their locally infiltrative behaviour which can result in bowel obstruction, perforation or fistula formation. the subject of this case report presented to the physicians in an acute confusional state with a history of polydipsia and finding of profound hyponatraemia (na 104 mmol / l). the collateral history then revealed three weeks of abdominal pain and intermittent vomiting but there was no report of constipation. the patient had no prior history of surgery or trauma to the abdomen, and no family history of fibromatoses or fap. the final diagnosis of bowel obstruction was not established until a ct scan of the abdomen and pelvis revealed the two intra - abdominal masses which were thought to represent gist or lymphoma. his demographics and lack of risk factors and/or family history made this diagnosis all the more unlikely. the final diagnosis was established after histological analysis of the specimens and further confirmation by an external expert sarcoma hitopathologist. the overall presentation was atypical for bowel obstruction and perforation from synchronous, mesenteric dts. the confirmation of the non - fap status of the disease was made after the patient, who was in his mid - fifties, had a follow - up colonoscopy which revealed no colonic polyposis. it is essential to exclude fap and investigate for attenuated fap (afap) in all patients presenting with abdominal dts since these two conditions carry a very high risk of development of colorectal cancer,,,,. attenuated afp (afap), where the mutation occurs at the extreme ends of the apc gene, is defined by the presence of three and 99 adenomas. histological assessment is mandatory for differentiating dts from other neoplasms such as gastrointestinal stromal tumours, lymphoma, pleomorphic sarcoma and fibrosarcoma. microscopically they are composed of spindle- or stellate - shaped fibroblastic cells embedded in a collagenous stroma. genetic testing for fap or afap was not performed as up to 30% of patients with a clear fap phenotype and 75% with afap have no identifiable apc gene mutation. ultrasonography (uss), computed tomography (ct) and magnetic resonance imaging (mri) can and have all been used to establish the nature, extension and anatomical relationship of dts. on uss dts appear as lesions of variable echogenicity and on ct scanning they are homogenously enhanced with well - defined margins. desmoid tumours appear hypo - intense on t1-weighted mri and predominantly hyper - intense on t2-weighted mri, reflecting the proliferation of fibroblasts,. due to the rarity of these tumours there are no clear guidelines on their management and this is instead based on small case series from specialist centres,. before consideration of surgery, in the non - acute setting, patients should be fully investigated for fap, afap and other hereditary polyposis syndromes with a family history, full colonoscopy with dye spray (chromoendoscopy), random biopsies to identify microadenomas, and ogd to look for cystic gland polyps in the stomach and duodenal adenomas. the management of desmoid tumours is then dependent on whether they are sporadic or not. in the presence of fap or other polyposis syndrome the patient instead medical therapies such as non - steroidal anti - inflammatory drugs, tamoxifen and chemotherapy are trialled as first and often second line therapy. this contrasts with the management of sporadic intra - abdominal dts, which should be managed in a specialist sarcoma unit by a multidisciplinary team. they are thought to have low recurrence rates after resection and therefore surgery is recommended as the first - line treatment for amenable tumours. emergent presentations such as in this case require emergency laparotomy in suitable surgical candidates. in our patient, the treatment of choice was small bowel and ileocaecal resections as resection of the mesenteric tumours alone would have interrupted the mesenteric blood supply to the bowel, resulting in bowel ischaemia. some studies suggest that margins are significant for predicting recurrence but others have demonstrated that they do not add prognostic value,. this is a rare case of sporadic, synchronous intra - abdominal dts presenting with atypical symptoms. the patient made a good recovery following emergency surgery. in non - emergency settings it is essential to exclude fap, afap and other hereditary polyposis syndromes since this affects treatment and subsequent follow - up. written informed consent for publication of this case report and any accompanying images was obtained from | highlightsintra - abdominal desmoid tumours have a poor prognosis as they can cause intestinal bleeding, obstruction and perforation.the authors report a rare case of small bowel obstruction and perforation secondary to sporadic, synchronous intra - abdominal desmoid tumours.in non - emergency presentations of desmoid tumours, it is essential to exclude hereditary polyposis syndromes.sporadic intra - abdominal desmoid tumours should be managed in a specialist sarcoma unit.in the presence of polyposis syndromes patients with desmoid tumours should be managed at a specialist colorectal unit. |
it is characterized by a burning, prickling or unpleasant sensation that is usually felt in the hands, arms, or legs but can also occur in other parts of the body, which sometimes leads to sleep disturbance. paresthesia of limbs may occur from abnormalities in the peripheral nervous system, from direct compression of the peripheral nerve, or in the central nervous system. lumbar spinal stenosis and lumbar disc herniation (ldh), or spondylosis may also occur when nerves were irritated, causing abnormal sensation in the legs. hence, patients with leg discomforts visit spine clinics for identifying their spine problems. the restless legs syndrome (rls) is also a common disorder affecting up to 5% to 15% of the general population, in which the incidence increases with age5,11,33,44), and includes paresthesia in the legs, that occurs at rest, and worsens in the evening, but improved by movements. hemmer.21) reported rls associated with myelopathy in one patient with a borrelia induced myelitis and zwartbol.51) presented patients with an acute acceleration of rls due to cervical cord ischemia. in our experience, many patients with rls are sent to neurosurgeons or neurologists for evaluation of their spine or brain conditions, not sleep specialists for their sleep fragmentation. and, there are no clinical studies on patients diagnosed with rls visiting spine clinics. the purpose of this study is to investigate the incidence of rls in spine clinics, its relation to neural compromises using lumbar mri and to review clinical approaches of this syndrome and its recent treatments. from january 2012 to december 2012, a total of 639 patients with leg discomforts had undergone spine magnetic resonance imaging (mri) to determine whether they had certain spine problems. among them, a retrospective medical record review was performed on patients with rls who were diagnosed by national institutes of health with four essential clinical criteria based solely on symptoms in 2003 : 1) an urge to move the limbs with or without sensations ; 2) improvement with activity. many patients find relief when moving and the relief continues while they are moving ; 3) worsening at rest. patients may describe being the most affected when sitting for a long period of time, such as when traveling in a car, attending a meeting, or watching a tv ; and 4) worsening in the evening or night. patients with mild or moderate rls show a clear circadian rhythm to their symptoms, with an increase in sensory symptoms and restlessness in the evening and into the night. affected limbs were classified as five types according to analysis of enrolled subjects ; a) below knees to feet, b) from proximal thigh to feet, c) both feet, d) both lower arms and lower legs, and e) asymmetric severity with unusual localization. sensory innervations of lower limbs were related to lumbosacral spinal nerves, especially common peroneal nerve and tibial nerve by l4, l5, s1. therefore, two grading systems, based on the morphology of the dural sac in an axial mri (grade 0 : normal, 1 : moderate, 2 : severe, and 3 : extreme) and foraminal stenosis on a sagittal mri (grade 0 : normal, 1 : mild, 2 : moderate, and 3 ; severe), were used in the evaluation of neural compromises on l4-l5, l5-s1 (table 1)27,39). further, we investigated the demographic data, clinical characteristics, such as symptom duration, affected limbs, mri grades, and aggravating factors and reviewed previous reports on etiology, prognosis and treatment of rls. all investigations were performed in accordance with our institutional guidelines that comply with all international laws and policies (hallym university institutional review board, # 2013 - 10). over a period of a year, the incidence of rls was 5.00% (32/639). the median age at diagnosis was 55.4 years (range, 25 - 93 years). the median duration of symptoms (from onset to diagnosis) was 14 months (range, 0.5 - 72 months). the exact cause of rls is unknown, but 12 patients have noted the beginning of their symptoms weeks or months after the procedures (epidural steroid injection : 2 patients, spinal anesthesia : 1 patient, lumbar microdiscectomy : 6 patients, percutaneous coronary artery stent insertion : 1 patient, subtotal gastrectomy : 2 patients). twenty patients did not remember when they first noticed the discomfort, but 12 patients had underlying diseases (essential hypertension : 4 patients, diabetes mellitus : 4 patients, renal failure : 2 patients, hypothyroidism : 2 patients). there were 26 patients with the affected limbs on the symmetrical and bilateral lower extremities (type a : 20 patients, type b : 3 patients, type c : 3 patients). four patients (type d) were affected with symmetrical and bilateral on both lower and upper extremities and 2 patients on asymmetrical and bilateral lower extremities (type e) (fig. several degenerative changes in the lumbar spine mri have been observed in 21 patients (spinal stenosis : 13 patients, bulging disc : 7 patients, degenerative spondylolisthesis 1 patient). in all patients except for type e, there are no correlation between the affected limbs of rls and neural compromises on the lumbar spine (fig. however, in only 2 patients with bilateral but asymmetric leg discomforts, we found ldhs on left side of l4 - 5 and l5-s1, and also could not explain the opposite side symptoms on radiologic images. these patients were considered as mixed conditions ; neural compromise due to ldh and rls. six patients were referred for uncontrolled bilateral legs ' paresthesia from local clinics having microdiscectomy. prior to surgery, they were presented with asymmetric and bilateral leg discomforts, and were diagnosed as herniated lumbar disc. though surgery has been found helpful in diminishing ruptured side radiculopathy, they were still suffering from restless legs (type a : 4 patients, type b : 1 patient, type c : 1 patient). mirapex (pramipexole : dopamine agonist ; boehringer ingelheim, ingelheim, germany) was used alone or with lyrica (pregabalin, pfizer, freiburg, germany) and these medications can be effective in decreasing unpleasant feeling in the limbs without sleep disturbance. all patients ' conditions have become noticeably better on the following day after medication. during treatment a 68-year - old woman was presented with severe paresthesia in the left leg and tingling sensation in the right lower leg (type e). spine mri shows left l4 - 5 foraminal ldh with grade 3 foraminal stenosis (fig. she felt much improvement on left l5 paresthesia, but still had unpleasant sensation on both lower legs with aggravation during night time. a 68-year - old woman was presented with severe paresthesia in the left leg and tingling sensation in the right lower leg (type e). spine mri shows left l4 - 5 foraminal ldh with grade 3 foraminal stenosis (fig. she felt much improvement on left l5 paresthesia, but still had unpleasant sensation on both lower legs with aggravation during night time. rls was first described by thomas willis in 1685 and has been introduced as a well - defined and common distressing entity since ekbom 's clinical description in 1945. prevalence analyses reported over the past decade have demonstrated that up to 5% to 15% of adults in western countries are likely to have rls. lower incidences of rls are found in asian populations when patients are clinically assessed with a specific questionnaire11,14,15,33,35,43). however, in a survey of korean adults, the prevalence of rls is comparable to that of western countries13). although, this study was not for the incidence of rls in the general population, over one year, 32 of 639 patients (5.0%) who had undertaken lumbar mri were diagnosed with rls in accordance to the essential four criteria by irlsg. the prevalence of rls was generally higher for women, almost twice than men in a survey of the general population13,33,44). however, in a survey of population diagnosed with rls, there was no gender difference in the prevalence of rls20,36) and we obtained similar results. the occurrence of rls increases to a peak at age 60 years and then decreases in western countries and reaches a peak prevalence of 9.1% in the 6th decade of life of korean adults13). in this study, 17 patients (53%) were in their fifties. in a systematic survey of rls in koreans, 373 of the 5000 respondents (7.5%) met the criteria for rls13). despite a relatively high prevalence although there are limited data on under - diagnosis of rls, cho.13) reported that approximately 12.4% of rls were not treated. in this study, 50% of patients have suffered from rls over 12 months without proper diagnosis and treatment. the diagnostic criteria reported by irlsg6,7) lack the support of definitive electrophysiological data, and polysomnography change, like as periodic leg movements30,32). the pathogenesis of rls still remains unclear, but several neuroimaging studies in patient with rls have been performed using a functional mri, single photon emission computed tomography and positron emission tomography. these radiologic studies suggest that rls is related to dopamine d2-receptor dysfunction in the central nervous system, involving the brain and spinal cord. zwartbol.51) presented a patients with an acute exacerbation of rls because of cervical cord ischemia and this report supported the speculation that disturbance of spinal cord pathways are part of the etiology of rls. as first described by ekbom17), nearly all patients were presented with unpleasant sensation in their legs, we assumed sensory dermatomes of l4, l5, s1 were most affected areas in patients with rls. in this study, we had only two patients caused by mixed conditions and thirty patients with rls had no correlation with the degree of compromise of the spinal nerve. this result also supported rls is considered to be a central nervous system related disorder. levodopa, as the precursor of dopamine, as well as dopamine agonists, plays an essential role in the treatment of rls leading to the assumption of a key role of dopamine function in the pathophysiology of rls. iron, as a cofactor in dopamine production, plays a central role in the etiology of rls3,5,18,26,38,42,45,48). erikson.19) reported that there is a significant correlation between serum iron concentration and d2 receptor densities in the striatum, but not in other brain regions, leading to a selective d2 receptor loss (but not d1 receptor loss) with iron deficiency. the most common clinical presentations of rls are sleep disturbance, in addition to aggravated leg discomfort during night time leading to a significantly reduce quality of life. in a rat study, circadian patterns of neurotransmitter related gene expression has been shown in the brain regions involved in motor regulation. during daytime, mrna levels for tyrosine hydroxylase were up - regulated in the substantia nigra and ventral tegmental area ; whereas, in the caudate nucleus and putamen, expression level of dopamine d2 receptors were lower during daytime. however, the expression of dopamine d1 receptors remained stable over day and night7,46). though degeneration of the spine is a common problem that generally advances with age, about 20% of asymptomatic patients before 60 years of age further studies have found that the degree of disc herniation or nerve root compression on mri scans did not always correlate with patients ' subjective legs symptoms9,25). we confirmed degenerative changes of the lumbar spine on 21 of 32 rls patients by mri. however, these mri results including grades of neural encroachment could not completely explain their problems. in only 2 patients with mixed conditions, we understood the reason why the unilateral legs are experienced more extended and severe pain than the opposite side. michaud.29) studied the incidence of arm restlessness assessed by a questionnaire in 230 patients diagnosed with rls and it was reported by 48.7% of the subjects. winkelmann analyzed clinical characteristics of the rls in 300 patients and independently the following result was seen ; arm discomforts in 26.1%, thigh symptoms in 46.8%, feet symptoms in 56.5%, and calves discomfort in 87%. in this study, 3 patients presented with paresthesia from the proximal thigh to the feet and both limbs were involved in 4 patients. causes related with a higher incidence of rls include pregnancy, iron deficiency, renal failure, diabetes mellitus, uremia, neuro - degenerative disease and medications. acute or transient rls can be observed in spinal lesions and following spine surgery or spinal anesthesia8,22). in this study, 9 patients have announced leg discomforts with sleep disturbance, following spine procedures, and 12 patients had underlying diseases. hoque and chesson23) reviewed thirty - two literatures on pharmacologically induced rls with five groups ; antidepressant, histamine antagonist, anti - psychotic, antiepileptic, and other ; and reported that the strongest evidence available for drug induced rls are for the following drugs ; escitalopram ; fluoxetine ; levodopa and pergolide ; l - thyroxine ; mianserin ; mirtazapine ; olanzapine ; tramadol, and amitriptyline. without strong evidence, antiepileptic drugs (phenytoin, methosuximide, zonisamide), cimetidine and caffeine are also considerable factors that induce rls. among these medications, we thought that tramadol, amitriptyline, fluoxetine, cimetidine, and phenytoin were commonly prescribed by neurosurgeon. because rls and its symptoms can be caused by various conditions, obtaining an accurate diagnosis is crucial for management and treatment. in pure peripheral neuropathy such as ldh, spinal stenosis, and dm neuropathy, patients do not have the compelling need to move to relieve leg discomfort and the symptoms are not consistently worse at rest or at night. though most surgeons are not familiar with rls, it can be treated quite easily with avoidance of aggravating factors and some medications. a generally accepted hypothesis on the pathogenesis of this disorder is a circadian alteration of the dopamine metabolism in the nervous system, leading to diminishing intra - cortical inhibition and supra - spinal inhibition1,18,19,37,47,50). as a logical consequence, dopaminergic agents are considered to be the first - line therapy in the management of rls and several studies are being conducted to establish the efficacy of these substances. levodopa can lead to a directly increase in the dopamine level in the brain1,34,47,50). however, because of its short half - life, which can be partially prolonged by the extended release formulation, and the augmentation effect, levodopa is not frequently used in rls4). the frequent side effects also restrict the use of the ergotamine dopamine agonists such as bromocriptine, pergolide, and cabergoline. for this reason, in the last two decades, the non - ergotamine dopamine agonists, such as pramipexole and ropinirole, have become the most used treatments in rls due to their effectiveness, half - life and safety with very low dosages28,40). ropinirole, and pramipexole were approved by the us food and drug administration for the treatment of rls and the clinical efficacy of these two medications can be considered similar28). clearly, levodopa or dopamine agonists are valuable for treating and subsiding rls but these dopaminergic agents may give rise to " augmentation effect " in some patients. clinical features of the augmentation effect show that rls symptoms become more severe, and occur earlier in the daytime as well as extend to other parts of the body, several months after start of treatment. the mechanism of this complication was not clear, but proposed in a hyperdopaminergic state, the dopamine d1 receptor response may be predominated with increased dopamine tone4,49). in a preliminary study, montplaisir described the results of 2 open label studies of ropinirole and noted that augmentation developed in 4% of rls patients31). winkelman and johnston49) assessed the augmentation rates of patients treated by pramipexole and augmentation developed in 32%. hence, there is a need for alternative medications without the interaction with dopamine metabolism. several studies have supported that gabapentin enacarbil and pregabalin were effective for treating rls and also improved sleep hygiene2,24,41). we initially prescribed pramipexole alone for rls patients or if a patient complained of severe paresthesia on their legs, additional pregabalin was prescribed. only 9 patients were still taking these medications past 6 months, and 71% of patients were considered to be completely cured. the rls is a clearly common central nervous system related disorder of the limbs, usually the legs. however, the rls does not occurr by the mechanical abnormality of the lumbar spinal nerve. we suggest that the awareness of this syndrome can help reduce diagnostic error ; thereby, avoiding the morbidity and expense associated with unnecessary evaluations or inappropriate treatments in rls patients. | objectivethe restless legs syndrome (rls) is a common disorder affecting up to 5% to 15% of the general population, in which the incidence increases with age, and includes paresthesia in the legs. the purpose of this study is to investigate the incidence of rls in spine center and to review clinical manifestations of this syndrome and its current treatments.methodsover a period of a year, retrospective medical record review and lumbar magnetic resonance images were performed on 32 patients with rls in spine clinic who were diagnosed by national institutes of health criteria. affected limbs were classified as five. two grading systems were used in the evaluation of neural compromises.resultsthe incidence of rls was 5.00% (32/639). there were 16 males (50%) and 16 females (50%). the median age at diagnosis was 55.4 years (range, 25 - 93 years). there are no correlation between the affected limbs of rls and neural compromises on the lumbar spine.conclusionthe rls is a clearly common neurologic disorder of the limbs, usually the legs. the awareness of this syndrome can help reduce diagnostic error ; thereby, avoiding the morbidity and expense associated with unnecessary studies or inappropriate treatments in rls patients. |
using dental implants for prosthetic rehabilitation of the edentulous maxilla has become a routine dental procedure. however, low quality of the posterior maxillary bone and a highly pneumatised maxillary sinus can compromise an implant 's survival12. implant migration into the maxillary sinus can be caused by inexperienced practitioners, unexpected perforations during sinus floor elevation, application of heavy force during implant insertion, and dental implant placement without sinus floor elevation of an excessively pneumatised maxillary sinus3. if this condition is inadequately treated, the implants can displace to deeper craniofacial cavities, causing infection, tissue necrosis, and adverse reactions to foreign bodies4. treatment of implant migration into the maxillary sinus includes the classic caldwell - luc operation and the endoscopic approach via the nose5. in this case report, we will discuss a dental implant that disappeared following its migration into the left maxillary sinus. a 53-year - old male patient was referred to us for retrieval of a displaced dental implant that had migrated into his left maxillary sinus. three months before his referral, the patient underwent a surgical procedure where eight dental implants were inserted to rehabilitate his fully edentulous maxilla. 1) using sinus floor elevation, implants placed in the left and right first molar areas were inserted simultaneously. three months postoperatively, the patient 's dentist administered a panoramic radiograph and discovered that one of the implants had migrated into the patient 's left antrum.(fig. 2) the patient 's medical and family history was not remarkable, and intraoral examination showed no signs or symptoms of oroantral fistula. after administering computed tomography imaging to localize the implant, we discovered no foreign body in the maxillary sinus.(fig. 3) due to the small size of the migrated implant (3.4 mm in diameter and 8 mm in length) and the absence of oroantral fistula, we believe that the implant left the maxillary sinus via the ostium. thoracic and abdominal radiographs were taken for aspiration risk of the implant but no radiopaque objects within the patient 's body were detected. similarly, a six - month follow - up of the patient proved to also be uneventful.(fig. although complications are uncommon, dental implant migration into the maxillary sinus can occur due to inexperienced operators, high pneumatisation of the sinus, and low bone density in the posterior maxilla6. although implant migration into the maxillary sinus is usually symptomless, it can cause infections that affect the paranasal sinuses and oroantral communications. implants that have migrated into the paranasal sinuses may also cause sinusitis and adverse reactions to foreign bodies7. migrated dental implants can primarily be diagnosed using three - dimensional computed tomography but can also be observed on panoramic radiographs and lateral or frontal cephalograms. retrieval of migrated implants can be achieved via standard caldwell - luc operations, transoral functional endoscopic sinus surgeries (fess), and transnasal fess4. some advantages of endoscopic removal of foreign bodies from the atrium include low morbidity, rapid recovery periods, and possible treatment of the affected paranasal cavities4. for instance, kitamura and zeredo6 describe a case report where a migrated dental implant was removed endoscopically via semilunar hiatus. in their report, access to the maxillary sinus via semilunar hiatus was cited to be undemanding. to our knowledge, this is the first report of a dental implant that migrated into the maxillary sinus and left the sinus cavity without further treatment. because the patient claimed to have experienced no sensation of swallowing the implant, we believe that the dental implant may have left the antrum via the ostium while the patient was sleeping. therefore, this complication may create the risk of foreign body aspiration and life - threatening conditions. in conclusion, foreign bodies in the maxillary sinus should be retrieved as soon as possible to avoid infections, maxillary sinusitis, and the potential risk of foreign body aspiration. | migration of dental implants into the maxillary sinus is uncommon. however, poor bone quality and quantity in the posterior maxilla can increase the potential for this complication to arise during implant placement procedures. the aim of this report is to present a dental implant that migrated into the maxillary sinus and disappeared. a 53-year - old male patient was referred to us by his dentist after a dental implant migrated into his maxillary sinus. the displaced implant was discovered on a panoramic radiograph taken five days before his referral. using computed tomography, we determined that the displaced dental implant was not in the antrum. there was also no sign of oroantral fistula. because of the small size of the displaced implant, we think that the implant may have left the maxillary sinus via the ostium. |
autoimmunity refers to the immunological destruction of the own cells and tissues due to the failure of the organism to recognize these as self. autoimmune diseases cover a great variety of symptoms reaching from diffuse inflammatory symptoms involving components of the innate immune system to highly antigen - specific t- and b - lymphocyte responses. both types of autoimmunity can appear restricted to defined structures in local tissues or systemically (mcgonagle and mcdermott 2006). genetic predisposition to overshooting immunity either by a loss of tolerance to self - antigens (e.g. by deficit of thymic selection, regulatory t cells) or increased sensitivity thresholds (e.g. by increased immune receptor signaling) may explain why some but not all individuals develop autoimmunity at one point of their life time. however, it can not explain why the symptoms start at a certain time point. therefore, additional environmental factors such as noxes, injury or infections have been discussed to trigger the loss of self - tolerance and thereby the onset of disease (bach 2005 ; chervonsky 2010). the same recognition system responsible to initiate anti - microbial immune responses against foreign antigens may then be triggered in a bystander fashion against harmless auto - antigens or the infectious environment may modify auto - antigens into chemically altered self - antigens that then appear as foreign antigens. evolutionarily conserved pathogen - associated molecular patterns (pamps) on microbes or danger - associated molecular patterns (damps) released after tissue damage are recognized by different families of immune receptors, summarized under the name pattern recognition receptors (prrs), with the toll - like receptors (tlrs) as their most prominent representatives (mills 2011). first, genetic alterations in such receptors or other immune - related genes could lower the threshold for immune activation against harmless self - antigens. second, cross - reactivity of microbial structures with self - antigens (molecular mimicry) may occur (chastain and miller 2012) and, finally, exogenous noxes or infections by viruses (bianchi. 2007 ; ferri. 2008 ; lunemann and munz 2007 ; munz. 2009), bacteria (root - bernstein. 2009) or fungi (romani 2008) may be responsible for chronic inflammatory processes promoting auto - aggression via bystander activation or epitope - spreading (delogu. more recent data indicate that proteins may in fact represent only a minor source of antigens that contribute to molecular mimicry. with the increasing identification of c - type lectin receptors as prrs for sugars and lipids, their role as auto - antigens turned into the center of attention (buzas. antibodies against campylobacter jejuni gangliosides cross react with some human gangliosides, mostly gm1 and gd1 (hughes and cornblath 2005 ; nores. 2008). the antibodies found are igg type produced only after the isotype switch of b cells (yuki and odaka 2005), which strictly require cd4 t - cell help. t - cell activation of dendritic cell (dc) can occur by c. jejuni gangliosides, but presentation of the glycolipids on mhc class ii molecules is not possible (kuijf. 2010). how can igg antibodies then be generated against glycolipids that are not presented on mhc ii molecules to differentiate t helper cells ? nkt cells recognize glycolipids and can produce similar cytokine patterns as cd4 t cells that are involved in b - cell cytokine switches (brigl and brenner 2004). they may be substitute the classical cd4 t - helper cells as shown after injection of mice with -galactosylceramide, a prototype glycolipid antigen for nkt cells (lang. 2006) and thereby help to generate glycolipid - specific igg antibodies without antigen - specific cd4 t - cell help. alternatively, soluble factors present in the supernatant of the glycolipid - activated dcs may directly be able to circumvent both t cell and nkt cell help (kuijf. despite the fact that the cns is the target organ for auto - reactive t cells in multiple sclerosis (ms), the t - cell priming event is postulated to occur in peripheral tissues (goverman 2009). whether these primed t cells and subsequently b cells have been primed directly against cns antigens it is also conceivable that they responded to a virus infection, where specific viruses gained access to the cns. especially for ebv, higher igg antibody titers had been measured in cerebrospinal fluid as compared to peripheral blood (haahr and hollsberg 2006), potentially indicating that a cerebral infection would be for a t - cell response. the intrathecal demonstration of oligoclonal igg bands from ms patients by electrophoretic profiling can be used for diagnosis. however, the simultaneous increase of iggs against different viruses may rather indicate a generalized inflammatory reponse, because infections enhance only monospecific iggs directed against the pathogen (boucquey. in fact, binding of these antibodies to viral target structures in the cns has not been demonstrated. nevertheless, indirect microbial promotion of autoimmunity is highly evident, as, for example, impressively shown by clear influence of intestinal tract commensals on experimental autoimmune encephalomyelitis (eae), a murine model for the early inflammatory stages of ms (berer. together, a definitive proof, which directly links virus infections with cns autoimmunity, is still lacking. more recent data indicate that cerebrospinal fluid of ms patients also contains increased levels of selected glycolipids such as sulfatide and, interestingly, oxidized cholesterol and phosphocholine as well as asialo gm1 when compared to healthy controls (kanter. sulfatide has been shown to associate with cd1d antigen - presenting molecules of mice (zajonc. thus, also in ms rather glycolipids than proteins might represent targets of autoimmune attack, especially when oxidation of glycolipids converts them to altered self - antigens. more recent data indicate that proteins may in fact represent only a minor source of antigens that contribute to molecular mimicry. with the increasing identification of c - type lectin receptors as prrs for sugars and lipids, their role as auto - antigens turned into the center of attention (buzas. antibodies against campylobacter jejuni gangliosides cross react with some human gangliosides, mostly gm1 and gd1 (hughes and cornblath 2005 ; nores. 2008). the antibodies found are igg type produced only after the isotype switch of b cells (yuki and odaka 2005), which strictly require cd4 t - cell help. t - cell activation of dendritic cell (dc) can occur by c. jejuni gangliosides, but presentation of the glycolipids on mhc class ii molecules is not possible (kuijf. 2010). how can igg antibodies then be generated against glycolipids that are not presented on mhc ii molecules to differentiate t helper cells ? nkt cells recognize glycolipids and can produce similar cytokine patterns as cd4 t cells that are involved in b - cell cytokine switches (brigl and brenner 2004). they may be substitute the classical cd4 t - helper cells as shown after injection of mice with -galactosylceramide, a prototype glycolipid antigen for nkt cells (lang. 2006) and thereby help to generate glycolipid - specific igg antibodies without antigen - specific cd4 t - cell help. alternatively, soluble factors present in the supernatant of the glycolipid - activated dcs may directly be able to circumvent both t cell and nkt cell help (kuijf. despite the fact that the cns is the target organ for auto - reactive t cells in multiple sclerosis (ms), the t - cell priming event is postulated to occur in peripheral tissues (goverman 2009). whether these primed t cells and subsequently b cells have been primed directly against cns antigens it is also conceivable that they responded to a virus infection, where specific viruses gained access to the cns. especially for ebv, higher igg antibody titers had been measured in cerebrospinal fluid as compared to peripheral blood (haahr and hollsberg 2006), potentially indicating that a cerebral infection would be for a t - cell response. the intrathecal demonstration of oligoclonal igg bands from ms patients by electrophoretic profiling can be used for diagnosis. however, the simultaneous increase of iggs against different viruses may rather indicate a generalized inflammatory reponse, because infections enhance only monospecific iggs directed against the pathogen (boucquey. in fact, binding of these antibodies to viral target structures in the cns has not been demonstrated. nevertheless, indirect microbial promotion of autoimmunity is highly evident, as, for example, impressively shown by clear influence of intestinal tract commensals on experimental autoimmune encephalomyelitis (eae), a murine model for the early inflammatory stages of ms (berer. together, a definitive proof, which directly links virus infections with cns autoimmunity, is still lacking. more recent data indicate that cerebrospinal fluid of ms patients also contains increased levels of selected glycolipids such as sulfatide and, interestingly, oxidized cholesterol and phosphocholine as well as asialo gm1 when compared to healthy controls (kanter. sulfatide has been shown to associate with cd1d antigen - presenting molecules of mice (zajonc. thus, also in ms rather glycolipids than proteins might represent targets of autoimmune attack, especially when oxidation of glycolipids converts them to altered self - antigens. dcs are heterogenous antigen - presenting cells of the immune system that play an important role in the initiation of innate and adaptive immune responses. from one side, dcs are being considered as inflamers of immune response against microbial pathogens but also unwanted organ graft rejection and autoimmunity, on the other side they are supposed to induce and even maintain tolerance to antigens (morelli and thomson 2007 ; steinman and nussenzweig 2002). tolerogenic or immunogenic functions of dcs depend on their stage of differentiation / maturation but are independent of hematopoietic origin or subset classification (thomson and robbins 2008). some authors claim that the endogenous environment itself may generate factors, which decide for an immune response initiated by the dcs or the maintenance of tolerance (matzinger 2002). although immature mdcs capture and process antigens to present them to nave t cells to low extends, effector t cells are not generated by them and rather tolerogenic mechanisms such as t - cell anergy or induction of regulatory t cells dominate to downregulate immune responses. these dcs can inhibit alloantigen - specific t - cell responses, reverse autoimmune diseases in murine models and induce antigen - specific t - cell tolerance (thomson and robbins 2008). in contrast, following a powerful immunological stimulus (such as contact with transplants or allergens, products associated with microbes or inflammation) immature dcs become mature and migrate to the respective lymph node, prime and stimulate expansion of antigen - specific t cells, and present intact proteins to b cells for their activation and subsequent antibody production (cravens and lipsky 2002). activated t cells and antibodies are carried by blood to affected tissues. in autoimmune responses, these attack host proteins. dendritic cells also regulate immune responses against self - antigens via mechanisms such as differentiation of t - regulatory cells, t - cell anergy and clonal deletion of effector t cells which are specific for such antigens (platt and randolph 2010). autoimmunity happens in environments where these regulatory mechanisms fail to control t - cell responses directed against the self - antigens. whereas subclinical forms of autoimmunity are frequent processes, prolonged activation of autoreactive lymphocytes is requested for the development of an autoimmune disease and accompanies ongoing tissue damage (ludewig. although genetic components predispose people or animals for autoimmune diseases, trauma or tissue injury further contributes to promote autoimmunity through damps (manfredi., however, is associated with viral and bacterial infections (regner and lambert 2001), which either trigger (miller. manifested autoimmunity may also depend on the number of dcs presenting self - antigens and the duration of antigen presentation by dcs, suggesting a crucial role of dcs for the development of clinical autoimmune diseases (ludewig. the involvement of dcs in autoimmune diseases includes hashimoto thyroiditis and grave s disease, psoriasis, sjgren s syndrome, rheumatoid arthritis and multiple sclerosis (cravens and lipsky 2002). the presence of dcs in the healthy cns is restricted to the vascular - rich compartments such as the choroid plexus and meninges (mcmenamin 1999). 2001). upon local inflammation of the cns due to infection, cell death or autoimmunity, there is so far no consensus on whether dcs in the cns parenchyma come from the periphery (lande. 2008 ; zozulya. 2010) or may arise from resident microglia (fischer and reichmann 2001) and monocytes (randolph. 1998) or whether they migrate from immature dc in the choroid plexus and meninges. the problem arises from the common surface markers on macrophages, microglia and dc subpopulations as well as that they all require the same survival factors in cultures (mcmahon., it has been shown that dcs recruited to the inflammation sites in cns maintain their ability to migrate to the periphery with cns autoantigens and prime nave t cells (de vos. involvement of dcs has been described in rodents with eae, an animal model that resembles ms in humans, where they are discussed as the likely candidate for the initiation and progression of autoimmune reactions by t cells (mcmahon. studies showed that an expansion of dcs following flt3-ligand treatment (flt3l / cd135, a growth factor that regulates proliferation of early hematopoietic cells) is associated with enhancement of clinical symptoms and increase of t cell and dcs infiltrates in cns (greter. 2005). on the other hand, a reduction of dcs after flt3-l inhibition has been shown to correlate with reduction of severity of disease (whartenby. elevated numbers of dcs that secreted pro - inflammatory cytokines were found in peripheral blood of humans suffering from ms (huang. also in csf, increased numbers of dcs were observed and correlated with common factors of cns inflammation (pashenkov. although active recruitment and accumulation of dcs into cns lesions of ms patients (lande. 2008) as well as alterations in the interaction between dcs and t cells in ms patients have been reported (stasiolek. 2006), details in the involvement of dcs in ms are so far unknown. the destruction of dopaminergic neurons in pd has been connected to a variety of factors, including genetic, environmental and immunologic conditions. genetic factors have been identified in familiar forms of pd, which contribute to about 10 % of pd cases (lesage and brice 2009 ; rosner. 2008), and pesticides have been identified as environmental risk factors in pd pathogenesis (liu. 2003 ; uitti and calne 1993). moreover, intravenous drug abuse with meperidine - related substances contaminated with 1-methyl-4-phenyl-1,2,5,6-tetrahydropyridine (mptp) triggers acute destruction of dopaminergic neurons and pd (langston., evidence for an immunologic background of pd has been accumulated, on which we will focus here. several studies show that pd pathogenesis is associated with neuroinflammation (mcgeer and mcgeer 2004), which is the prerequisite for the maturation of dcs and their migration to the respective sites in the brain. following these steps, dcs could be able to trigger an autoimmune response by transferring brain antigens into the cervical lymph nodes and presenting them to t- and b - cells. early experimental evidence in favor of an autoimmune background of pd came from chen. (1998) who reported that the transfer of plasma antibodies isolated from pd patients to the substantia nigra of rats induced a marked loss of dopaminergic neurons. in contrast, animals treated with antibodies from healthy controls exhibited much lower neuronal damage, suggesting that autoantibodies that recognize dopaminergic cells are present in patients with pd (chen. 1998). in the last decade, several autoantibodies directed at antigens associated or related to pd pathogenesis have been identified in pd patients, including antibodies directed at melanin (double. reversible parkinsonian syndrome together with the presence of anti - neuronal antibodies has been observed in an ebv - infected patient (roselli. autoreactive antibodies associated with pd have not only been found in plasma but also in brain : post - mortem analysis of brains from pd patients and controls showed binding of igg to dopaminergic neurons in tissues from patients with pd (orr. one potential target structure for an immune attack against dopaminergic neurons is the pigment neuromelanin (nm) that accumulates in dopaminergic neurons as a byproduct of catecholamine metabolism from oxidative polymerization of dopamine and norepinephrine to quinones (graham 1979). we described recently that nm triggers maturation of dcs in vitro and that this maturation is functional as nm - treated dcs were able on their turn to trigger a proliferative t response. these experiments demonstrate that the first necessary criteria for dcs to initiate an adaptive autoimmune response directed against nm - associated structures are fullfilled. as depicted in fig. 1, we hypothesize that activated dcs migrate from the brain into the cervical lymph node where they present the potential (auto-) antigens to t and b cells. the recognition of nm as a pathogen or dangerous molecule and its uptake by dcs would allow dc migration and its presentation in the cervical lymph nodes, thereby triggering an adaptive autoimmune response if nm - reactive t or b cells are present. this autoimmune response against nm would be directed against nm - rich cells in the brain, leading to dopaminergic cell death (fig. 1). this auto - aggressive loop would be enhanced by a nm - triggered activation of microglia, which has been described before (wilms. 2011), resulting in an amplification of the adaptive immune response against nm and the local reactivation of immigrating effector t cells (fig. 1). there is accumulating evidence for an immunogenic role of nm in pd pathogenesis : in sera from pd patients antibodies directed at catecholamine - based melanins have been detected (double. 2009). moreover, post - mortem analysis of brains from pd patients reveals the opsonization of nm with complement c1q (depboylu. 2011), indicating that nm is recognized by the classical complement pathway as a target structure and shows the capacity to cause neuroinflammation (mcgeer and mcgeer 2004). opsonization with c1q is either mediated by previous antibody coating of the target structure followed by recruitment of c1q to the fc - part of the antibody or by direct binding to c1q ligands (kojouharova. it remains to be elucidated whether c1q - binding of nm is antibody - dependent or independent and to what extend this complement binding contributes to neuronal cell death. danger transmitters to evoke immune responses following danger signals has been discussed thoroughly elsewhere (kohl 2006). in addition to an immune response directed at nm itself, the high protein affinity of nm (zecca. 2000), together with the efficient phagocytosis of nm by dcs (oberlander. 2011) would allow a dc - mediated presentation of neuronal proteins to the adaptive immune system that are primarily unrelated to nm. in this scenario, nm would act like a trojan horse, providing access of otherwise unrecognized brain proteins to the dc - triggered adaptive immune response.fig. contact of dcs with nm triggers maturation of these cells that subsequently migrate from the brain into the cervical lymph nodes where they present nm to b- and t - lymphocytes. if nm - reactive lymphocytes are present, they get activated (primed) and secrete nm - specific antibodies (b cells) or exert nm - specific cytotoxic functions (t cells). activation of microglia by nm would result in a proliferation of nm - specific t cells after contact with nm - presenting microglia. nm - specific antibodies and t cells may recognize nm - positive neurons and trigger their degradation how activation of dcs by nm could trigger autoimmunity directed at dopaminergic neurons. contact of dcs with nm triggers maturation of these cells that subsequently migrate from the brain into the cervical lymph nodes where they present nm to b- and t - lymphocytes. if nm - reactive lymphocytes are present, they get activated (primed) and secrete nm - specific antibodies (b cells) or exert nm - specific cytotoxic functions (t cells). activation of microglia by nm would result in a proliferation of nm - specific t cells after contact with nm - presenting microglia. nm - specific antibodies and t cells may recognize nm - positive neurons and trigger their degradation the past decade has provided accumulating evidence for a significant role of the immune system in pd pathogenesis, be it either through inflammation or by an autoimmune response. thus, immunomodulating therapy strategies aiming to attenuate pd disease progression become an attractive option and warrant further investigation. | innate and adaptive immune responses in neurodegenerative diseases have become recently a focus of research and discussions. parkinson s disease (pd) is a neurodegenerative disorder without known etiopathogenesis. the past decade has generated evidence for an involvement of the immune system in pd pathogenesis. both inflammatory and autoimmune mechanisms have been recognized and studies have emphasized the role of activated microglia and t - cell infiltration. in this short review, we focus on dendritic cells, on their role in initiation of autoimmune responses, we discuss aspects of neuroinflammation and autoimmunity in pd, and we report new evidence for the involvement of neuromelanin in these processes. |
during the past 30 years, research in the theory of black holes in general relativity has brought to light strong hints of a very deep and fundamental relationship between gravitation, thermodynamics, and quantum theory. the cornerstone of this relationship is black hole thermodynamics, where it appears that certain laws of black hole mechanics are, in fact, simply the ordinary laws of thermodynamics applied to a system containing a black hole. indeed, the discovery of the thermodynamic behavior of black holes achieved primarily by classical and semiclassical analyses has given rise to most of our present physical insights into the nature of quantum phenomena occurring in strong gravitational fields. the purpose of this article is to provide a review of the following aspects of black hole thermodynamics : at the purely classical level, black holes in general relativity (as well as in other diffeomorphism covariant theories of gravity) obey certain laws which bear a remarkable mathematical resemblance to the ordinary laws of thermodynamics. the derivation of these laws of classical black hole mechanics is reviewed in section 2.classically, black holes are perfect absorbers but do not emit anything ; their physical temperature is absolute zero. however, in quantum theory black holes emit hawking radiation with a perfect thermal spectrum. this allows a consistent interpretation of the laws of black hole mechanics as physically corresponding to the ordinary laws of thermodynamics. the status of the derivation of hawking radiation is reviewed in section 3.the generalized second law (gsl) directly links the laws of black hole mechanics to the ordinary laws of thermodynamics. a discussion of entropy bounds is also included in this section.the classical laws of black hole mechanics together with the formula for the temperature of hawking radiation allow one to identify a quantity associated with black holes namely a/4 in general relativity as playing the mathematical role of entropy. the apparent validity of the gsl provides strong evidence that this quantity truly is the physical entropy of a black hole. a major goal of research in quantum gravity is to provide an explanation for and direct derivation of the formula for the entropy of a black hole. a brief survey of work along these lines is provided in section 5.although much progress has been made in our understanding of black hole thermodynamics, many important issues remain unresolved. primary among these are the black hole information paradox and issues related to the degrees of freedom responsible for the entropy of a black hole. these unresolved issues are briefl discussed in section 6. at the purely classical level, black holes in general relativity (as well as in other diffeomorphism covariant theories of gravity) obey certain laws which bear a remarkable mathematical resemblance to the ordinary laws of thermodynamics. the derivation of these laws of classical black hole mechanics is reviewed in section 2. classically, black holes are perfect absorbers but do not emit anything ; their physical temperature is absolute zero. however, in quantum theory black holes emit hawking radiation with a perfect thermal spectrum. this allows a consistent interpretation of the laws of black hole mechanics as physically corresponding to the ordinary laws of thermodynamics. the generalized second law (gsl) directly links the laws of black hole mechanics to the ordinary laws of thermodynamics. a discussion of entropy bounds is also included in this section. the classical laws of black hole mechanics together with the formula for the temperature of hawking radiation allow one to identify a quantity associated with black holes namely a/4 in general relativity as playing the mathematical role of entropy. the apparent validity of the gsl provides strong evidence that this quantity truly is the physical entropy of a black hole. a major goal of research in quantum gravity is to provide an explanation for and direct derivation of the formula for the entropy of a black hole. although much progress has been made in our understanding of black hole thermodynamics, many important issues remain unresolved. primary among these are the black hole information paradox and issues related to the degrees of freedom responsible for the entropy of a black hole., we shall set g = = c = k = 1, and we shall follow the sign and notational conventions of. although i have attempted to make this review be reasonably comprehensive and balanced, it should be understood that my choices of topics and emphasis naturally reflect my own personal viewpoints, expertise, and biases. in this section, i will give a brief review of the laws of classical black hole mechanics. in physical terms, a black hole is a region where gravity is so strong that nothing can escape. in order to make this notion precise, one must have in mind a region of spacetime to which one can contemplate escaping. for an asymptotically flat spacetime (m ; gab) (representing an isolated system), the asymptotic portion of the spacetime near infinity is such a region. the black hole region, b, of an asymptotically flat spacetime, (m ; gab), is defined as (1)\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\mathcal{b } \equiv m - { i^ - } \left ({ { \mathcal{i}^ + } } \right),$$\end{document } where i denotes future null infinity and i denotes the chronological past. similar definitions of a black hole can be given in other contexts (such as asymptotically anti - desitter spacetimes) where there is a well defined asymptotic region. the event horizon, h, of a black hole is defined to be the boundary of b. thus, h is the boundary of the past of i. consequently, h automatically satisfies all of the properties possessed by past boundaries (see, e.g., or for further discussion). in particular, h is a null hypersurface which is composed of future inextendible null geodesics without caustics, i.e., the expansion,, of the null geodesics comprising the horizon can not become negatively infinite. note that the entire future history of the spacetime must be known before the location of h can be determined, i.e., h possesses no distinguished local significance. if einstein s equation holds with matter satisfying the null energy condition (i.e., if tabkk 0 for all null k), then it follows immediately from the raychauduri equation (see, e.g.,) that if the expansion,, of any null geodesic congruence ever became negative, then would become infinite within a finite affine parameter, provided, of course, that the geodesic can be extended that far. if the black hole is strongly asymptotically predictable i.e., if there is a globally hyperbolic region containing i(i) h it can be shown that this implies that 0 everywhere on h (see, e.g., [55, 99 ]). it then follows that the surface area, a, of the event horizon of a black hole can never decrease with time, as discovered by hawking. it is worth remarking that since h is a past boundary, it automatically must be a c embedded submanifold (see, e.g.,), but it need not be c. however, essentially all discussions and analyses of black hole event horizons implicitly assume c or higher order differentiability of h. recently, this higher order differentiability assumption has been eliminated for the proof of the area theorem. the area increase law bears a resemblance to the second law of thermodynamics in that both laws assert that a certain quantity has the property of never decreasing with time. it might seem that this resemblance is a very superficial one, since the area law is a theorem in differential geometry whereas the second law of thermodynamics is understood to have a statistical origin. nevertheless, this resemblance together with the idea that information is irretrievably lost when a body falls into a black hole led bekenstein to propose [14, 15 ] that a suitable multiple of the area of the event horizon of a black hole should be interpreted as its entropy, and that a generalized second law (gsl) should hold : the sum of the ordinary entropy of matter outside of a black hole plus a suitable multiple of the area of a black hole never decreases. the remaining laws of thermodynamics deal with equilibrium and quasi - equilibrium processes. at nearly the same time as bekenstein proposed a relationship between the area theorem and the second law of thermodynamics, bardeen, carter, and hawking provided a general proof of certain laws of black hole mechanics which are direct mathematical analogs of the zeroth and first laws of thermodynamics. these laws of black hole mechanics apply to stationary black holes (although a formulation of these laws in terms of isolated horizons will be briefly described at the end of this section). in order to discuss the zeroth and first laws of black hole mechanics, we must introduce the notions of stationary, static, and axisymmetric black holes as well as the notion of a killing horizon. if an asymptotically flat spacetime (m ; gab) contains a black hole, b, then b is said to be stationary if there exists a one - parameter group of isometries on (m ; gab) generated by a killing field t which is unit timelike at infinity. the black hole is said to be static if it is stationary and if, in addition, t is hypersurface orthogonal. the black hole is said to be axisymmetric if there exists a one parameter group of isometries which correspond to rotations at infinity. t- orthogonality property if the 2-planes spanned by t and the rotational killing field are orthogonal to a family of 2-dimensional surfaces. the t- orthogonality property holds for all stationary - axisymmetric black hole solutions to the vacuum einstein or einstein - maxwell equations (see, e.g.,). a null surface, k, whose null generators coincide with the orbits of a one - parameter group of isometries (so that there is a killing field normal to k) is called a killing horizon. there are two independent results (usually referred to as rigidity theorems) that show that in a wide variety of cases of interest, the event horizon, h, of a stationary black hole must be a killing horizon. the first, due to carter, states that for a static black hole, the static killing field t must be normal to the horizon, whereas for a stationary - axisymmetric black hole with the t- orthogonality property there exists a killing field of the form (2)\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$${\xi ^a } = { t^a } + \omega { \phi ^a}$$\end{document } which is normal to the event horizon. the constant defined by eq. carter s result does not rely on any field equations, but leaves open the possibility that there could exist stationary black holes without the above symmetries whose event horizons are not killing horizons. the second result, due to hawking (see also), directly proves that in vacuum or electrovac general relativity, the event horizon of any stationary black hole must be a killing horizon. consequently, if t fails to be normal to the horizon, then there must exist an additional killing field,, which is normal to the horizon, i.e., a stationary black hole must be nonrotating (from which staticity follows [84, 85, 37 ]) or axisymmetric (though not necessarily with the t- orthogonality property). note that hawking s theorem makes no assumptions of symmetries beyond stationarity, but it does rely on the properties of the field equations of general relativity. now, let k be any killing horizon (not necessarily required to be the event horizon, h, of a black hole), with normal killing field. since (b) also is normal to k, these vectors must be proportional at every point on k. hence, there exists a function,, on k, known as the surface gravity of k, which is defined by the equation (3)\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$${\nabla ^a}\left ({ { \xi ^b}{\xi _ b } } \right) = - 2\kappa { \xi ^a}.$$\end{document } it follows immediately that must be constant along each null geodesic generator of k, but, in general, can vary from generator to generator. it is not difficult to show (see, e.g.,) that (4)\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\kappa = \lim \left ({ va } \right),$$\end{document } where a is the magnitude of the acceleration of the orbits of in the region off of k where they are timelike, v (-a) is the redshift factor of, and the limit as one approaches k is taken note that the surface gravity of a black hole is defined only when it is in equilibrium, i.e., stationary, so that its event horizon is a killing horizon. there is no notion of the surface gravity of a general, non - stationary black hole, although the definition of surface gravity can be extended to isolated horizons (see below). in parallel with the two independent rigidity theorems mentioned above, there are two independent versions of the zeroth law of black hole mechanics. the first, due to carter (see also), states that for any black hole which is static or is stationary - axisymmetric with the t- orthogonality property, the surface gravity, must be constant over its event horizon h. this result is purely geometrical, i.e., it involves no use of any field equations. the second, due to bardeen, carter, and hawking states that if einstein s equation holds with the matter stress - energy tensor satisfying the dominant energy condition, then must be constant on any killing horizon. thus, in the second version of the zeroth law, the hypothesis that the t- orthogonality property holds is eliminated, but use is made of the field equations of general relativity. a bifurcate killing horizon is a pair of null surfaces, ka and kb, which intersect on a spacelike 2-surface, c (called the bifurcation surface), such that ka and kb are each killing horizons with respect to the same killing field. it follows that must vanish on c ; conversely, if a killing field,, vanishes on a two - dimensional spacelike surface, c, then c will be the bifurcation surface of a bifurcate killing horizon associated with (see for further discussion). an important consequence of the zeroth law is that if 0, then in the maximally extended spacetime representing a stationary black hole, the event horizon, h, comprises a branch of a bifurcate killing horizon. this result is purely geometrical involving no use of any field equations. as a consequence, the study of stationary black holes which satisfy the zeroth law divides into two cases : extremal black holes (for which, by definition, = 0), and black holes with bifurcate horizons. the first law of black hole mechanics is simply an identity relating the changes in mass, m, angular momentum, j, and horizon area, a, of a stationary black hole when it is perturbed. to first order, the variations of these quantities in the vacuum case always satisfy (5)\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\delta m = \frac{1}{{8\pi } } \kappa \delta a + \omega \delta j.$$\end{document } in the original derivation of this law, it was required that the perturbation be stationary. furthermore, the original derivation made use of the detailed form of einstein s equation. subsequently, the derivation has been generalized to hold for non - stationary perturbations [84, 60 ], provided that the change in area is evaluated at the bifurcation surface, c, of the unperturbed black hole (see, however, for a derivation of the first law for non - stationary perturbations that does not require evaluation at the bifurcation surface). more significantly, it has been shown that the validity of this law depends only on very general properties of the field equations. specifically, a version of this law holds for any field equations derived from a diffeomorphism covariant lagrangian, l. such a lagrangian can always be written in the form (6)\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$l = l\left ({ g_{ab } ; r_{abcd }, \nabla _ a r_{bcde }, \;... ;\psi, \nabla _ a \psi, \ ;... } \right),$$\end{document } where a denotes the derivative operator associated with gab, rabcd denotes the riemann curvature tensor of gab, and denotes the collection of all matter fields of the theory (with indices suppressed). an arbitrary (but finite) number of derivatives of rabcd and are permitted to appear in l. in this more general context, the first law of black hole mechanics is seen to be a direct consequence of an identity holding for the variation of the noether current. the general form of the first law takes the form (7)\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\delta m = \frac{\kappa } { { 2\pi } } \delta s_{bh } + \omega \delta j + \;...,$$\end{document } where the... denote possible additional contributions from long range matter fields, and where (8)\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$${s_{bh } } \equiv - 2\pi \int_c { \frac{{\delta l}}{{\delta { r_{abcd}}}}{\eta _ { ab}}{\eta _ { cd. } } } $ $ \end{document } here nab is the binormal to the bifurcation surface c (normalized so that nabn = 2), and the functional derivative is taken by formally viewing the riemann tensor as a field which is independent of the metric in eq. (6). for the case of vacuum general relativity, where \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$l = r\sqrt { - g } $ $ \end{document }, a simple calculation yields (9)\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$s_{bh } = a/4,$$\end{document } and eq. (7) reduces to eq. the close mathematical analogy of the zeroth, first, and second laws of thermodynamics to corresponding laws of classical black hole mechanics is broken by the planck - nernst form of the third law of thermodynamics, which states that s 0 (or a universal constant) as t 0. the analog of this law fails in black hole mechanics although analogs of alternative formulations of the third law do appear to hold for black holes since there exist extremal black holes (i.e., black holes with = 0) with finite a. however, there is good reason to believe that the planck - nernst theorem should not be viewed as a fundamental law of thermodynamics but rather as a property of the density of states near the ground state in the thermodynamic limit, which happens to be valid for commonly studied materials. indeed, examples can be given of ordinary quantum systems that violate the planck - nernst form of the third law in a manner very similar to the violations of the analog of this law that occur for black holes. as discussed above, the zeroth and first laws of black hole mechanics have been formulated in the mathematical setting of stationary black holes whose event horizons are killing horizons. the requirement of stationarity applies to the entire spacetime and, indeed, for the first law, stationarity of the entire spacetime is essential in order to relate variations of quantities defined at the horizon (like a) to variations of quantities defined at infinity (like m and j). however, it would seem reasonable to expect that the equilibrium thermodynamic behavior of a black hole would require only a form of local stationarity at the event horizon. for the formulation of the first law of black hole mechanics, one would also then need local definitions of quantities like m and j at the horizon. such an approach toward the formulation of the laws of black hole mechanics has recently been taken via the notion of an isolated horizon, defined as a null hypersurface with vanishing shear and expansion satisfying the additional properties stated in. (this definition supersedes the more restrictive definitions given, e.g., in [5, 6, 7 ].) the presence of an isolated horizon does not require the entire spacetime to be stationary a direct analog of the zeroth law for stationary event horizons can be shown to hold for isolated horizons. in the einstein - maxwell case, one can demand (via a choice of scaling of the normal to the isolated horizon as well as a choice of gauge for the maxwell field) that the surface gravity and electrostatic potential of the isolated horizon be functions of only its area and charge. the requirement that time evolution be symplectic then leads to a version of the first law of black hole mechanics as well as a (in general, non - unique) local notion of the energy of the isolated horizon. these results also have been generalized to allow dilaton couplings and yang - mills fields [38, 9 ]. in comparing the laws of black hole mechanics in classical general relativity with the laws of thermodynamics, it should first be noted that the black hole uniqueness theorems (see, e.g.,) establish that stationary black holes i.e., black holes in equilibrium are characterized by a small number of parameters, analogous to the state parameters of ordinary thermodynamics. in the corresponding laws, the role of energy, e, is played by the mass, m, of the black hole ; the role of temperature, t, is played by a constant times the surface gravity, of the black hole ; and the role of entropy, s, is played by a constant times the area, a, of the black hole. the fact that e and m represent the same physical quantity provides a strong hint that the mathematical analogy between the laws of black hole mechanics and the laws of thermodynamics might be of physical significance. however, as argued in, this can not be the case in classical general relativity. the physical temperature of a black hole is absolute zero (see subsection 4.1 below), so there can be no physical relationship between t and. consequently, it also would be inconsistent to assume a physical relationship between s and a. as we shall now see, this situation changes dramatically when quantum effects are taken into account. in 1974, hawking made the startling discovery that the physical temperature of a black hole is not absolute zero : as a result of quantum particle creation effects, a black hole radiates to infinity all species of particles with a perfect black body spectrum, at temperature (in units with g = c = = k = 1) (10)\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$t = \frac{\kappa } { { 2\pi } }.$$\end{document } thus, /2 truly is the physical temperature of a black hole, not merely a quantity playing a role mathematically analogous to temperature in the laws of black hole mechanics. in this section, we review the status of the derivation of the hawking effect and also discuss the closely related unruh effect. the original derivation of the hawking effect made direct use of the formalism for calculating particle creation in a curved spacetime that had been developed by parker and others. hawking considered a classical spacetime (m, gab) describing gravitational collapse to a schwarzschild black hole. he then considered a free (i.e., linear) quantum field propagating in this background spacetime, which is initially in its vacuum state prior to the collapse, and he computed the particle content of the field at infinity at late times. this calculation involves taking the positive frequency mode function corresponding to a particle state at late times, propagating it backwards in time, and determining its positive and negative frequency parts in the asymptotic past. his calculation revealed that at late times, the expected number of particles at infinity corresponds to emission from a perfect black body (of finite size) at the hawking temperature (eq. it should be noted that this result relies only on the analysis of quantum fields in the region exterior to the black hole, and it does not make use of any gravitational field equations. first, one may consider a spacetime representing an arbitrary gravitational collapse to a black hole such that the black hole settles down to a stationary final state satisfying the zeroth law of black hole mechanics (so that the surface gravity, of the black hole final state is constant over its event horizon). the initial state of the quantum field may be taken to be any nonsingular state (i.e., any hadamard state see, e.g.,) rather than the initial vacuum state. finally, it can be shown that all aspects of the final state at late times (i.e., not merely the expected number of particles in each mode) correspond to black body thermal radiation emanating from the black hole at temperature (eq. it should be noted that no infinities arise in the calculation of the hawking effect for a free field, so the results are mathematically well defined, without any need for regularization or renormalization. the original derivations [54, 98 ] made use of notions of particles propagating into the black hole, but the results for what an observer sees at infinity were shown to be independent of the ambiguities inherent in such notions and, indeed, a derivation of the hawking effect has been given which entirely avoids the introduction of any notion of particles. however, there remains one significant dificultly with the hawking derivation : in the calculation of the backward - in - time propagation of a mode, it is found that the mode undergoes a large blueshift as it propagates near the event horizon, but there is no correspondingly large redshift as the mode propagates back through the collapsing matter into the asymptotic past. indeed, the net blueshift factor of the mode is proportional to exp(t), where t is the time that the mode would reach an observer at infinity. thus, within a time of order 1/ of the formation of a black hole (i.e., 10 seconds for a one solar mass schwarzschild black hole), the hawking derivation involves (in its intermediate steps) the propagation of modes of frequency much higher than the planck frequency. in this regime, it is difficult to believe in the accuracy of free field theory or any other theory known to mankind. an approach to investigating this issue was first suggested by unruh, who noted that a close analog of the hawking effect occurs for quantized sound waves in a fluid undergoing supersonic flow. a similar blueshifting of the modes quickly brings one into a regime well outside the domain of validity of the continuum fluid equations. unruh suggested replacing the continuum fluid equations with a more realistic model at high frequencies to see if the fluid analog of the hawking effect would still occur. more recently, unruh investigated models where the dispersion relation is altered at ultra - high frequencies, and he found no deviation from the hawking prediction. a variety of alternative models have been considered by other researchers[28, 39, 62, 79, 97, 40, 63 ]. again, agreement with the hawking effect prediction was found in all cases, despite significant modifications of the theory at high frequencies. the robustness of the hawking effect with respect to modifications of the theory at ultra - high frequency probably can be understood on the following grounds. one may view the backward - in - time propagation of modes as consisting of two stages : a first stage where the blueshifting of the mode brings it into a wkb regime but the frequencies remain well below the planck scale, and a second stage where the continued blueshifting takes one to the planck scale and beyond. in the first stage on the other hand, after the mode has entered a wkb regime, it seems plausible that the kinds of modifications to its propagation laws considered in [93, 28, 39, 62, 79, 97, 40, 63 ], should not affect its essential properties, in particular the magnitude of its negative frequency part. indeed, an issue closely related to the validity of the original hawking derivation arises if one asks how a uniformly accelerating observer in minkowski spacetime perceives the ordinary (inertial) vacuum state (see below). the outgoing modes of a given frequency as seen by the accelerating observer at proper time along his worldline correspond to modes of frequency ~ exp(a) in a fixed inertial frame. therefore, at time 1/a one might worry about fieldtheoretic derivations of what the accelerating observer would see. however, in this case one can appeal to lorentz invariance to argue that what the accelerating observer sees can not change with time. it seems likely that one could similarly argue that the hawking effect can not be altered by modifications of the theory at ultra - high frequencies, provided that these modifications preserve an appropriate thus, there appears to be strong reasons for believing in the validity of the hawking effect despite the occurrence of ultra - high - frequency modes in the derivation. there is a second, logically independent result namely, the unruh effect and its generalization to curved spacetime which also gives rise to the formula (10). although the unruh effect is mathematically very closely related to the hawking effect, it is important to distinguish clearly between them. in its most general form, the unruh effect may be stated as follows (see [64, 101 ] for further discussion) : consider a classical spacetime (m, gab) that contains a bifurcate killing horizon, k = ka kb, so that there is a one - parameter group of isometrics whose associated killing field, is normal to k. consider a free quantum field on this spacetime. then there exists at most one globally nonsingular state of the field which is invariant under the isometrics. furthermore, in the wedges of the spacetime where the isometrics have timelike orbits, this state (if it exists) is a kms (i.e., thermal equilibrium) state at temperature (10) with respect to the isometrics. note that in minkowski spacetime, any one - parameter group of lorentz boosts has an associated bifurcate killing horizon, comprised by two intersecting null planes. the unique, globally nonsingular state which is invariant under these isometrics is simply the usual (inertial) vacuum state, |0. in the right and left wedges of minkowski spacetime defined by the killing horizon, the orbits of the lorentz boost isometrics are timelike, and, indeed, these orbits correspond to worldlines of uniformly accelerating observers. if we normalize the boost killing field, b, so that killing time equals proper time on an orbit with acceleration a, then the surface gravity of the killing horizon is = a. an observer following this orbit would naturally use b to define a notion of time translation symmetry. consequently, by the above general result, when the field is in the inertial vacuum state, a uniformly accelerating observer would describe the field as being in a thermal equilibrium state at temperature (11)\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$t = \frac{a}{{2\pi } } $ $ \end{document } as originally discovered by unruh. a mathematically rigorous proof of the unruh effect in minkowski spacetime was given by bisognano and wichmann in work motivated by entirely different considerations (and done independently of and nearly simultaneously with the work of unruh). furthermore, the bisognano - wichmann theorem is formulated in the general context of axiomatic quantum field theory, thus establishing that the unruh effect is not limited to free field theory. although there is a close mathematical relationship between the unruh effect and the hawking effect, it should be emphasized that these results refer to different states of the quantum field. we can divide the late time modes of the quantum field in the following manner, according to the properties that they would have in the analytically continued spacetime representing the asymptotic final stationary state of the black hole : we refer to modes that would have emanated from the white hole region of the analytically continued spacetime as up modes and those that would have originated from infinity as in modes. in the hawking effect, the asymptotic final state of the quantum field is a state in which the up modes of the quantum field are thermally populated at temperature (10), but the in modes are unpopulated. this state (usually referred to as the unruh vacuum) would be singular on the white hole horizon in the analytically continued spacetime. on the other hand, in the unruh effect and its generalization to curved spacetimes, the state in question (usually referred to as the hartle - hawking vacuum) is globally nonsingular, and all modes of the quantum field in the left and right wedges are thermally populated. the differences between the unruh and hawking effects can be seen dramatically in the case of a kerr black hole. for the kerr black hole, it can be shown that there does not exist any globally nonsingular state of the field which is invariant under the isometrics associated with the killing horizon, i.e., there does not exist a hartle - hawking vacuum state on kerr spacetime. however, there is no dificultly with the derivation of the hawking effect for kerr black holes, i.e., the it should be emphasized that in the hawking effect, the temperature (10) represents the temperature as measured by an observer near infinity. for any observer following an orbit of the killing field, a normal to the horizon, the locally measured temperature of the up modes is given by (12)\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$t = \frac{\kappa } { { 2\pi v}},$$\end{document } where v = (a). in other words, the locally measured temperature of the hawking radiation follows the tolman law. now, as one approaches the horizon of the black hole, the up modes dominate over the in modes. (4) into account, we see that t a/2 as the black hole horizon, h, is approached, i.e., in this limit eq. (12) corresponds to the flat spacetime unruh effect. equation (12) shows that when quantum effects are taken into account, a black hole is surrounded by a thermal atmosphere whose local temperature as measured by observers following orbits of becomes divergent as one ap proaches the horizon. as we shall see in the next section, this thermal atmosphere produces important physical effects on quasi - stationary bodies near the black hole. on the other hand, it should be emphasized that for a macroscopic black hole, observers who freely fall into the black hole would not notice any important quantum effects as they approach and cross the horizon. in this section, we shall review some arguments for the validity of the generalized second law (gsl). we also shall review the status of several proposed entropy bounds on matter that have played a role in discussions and analyses of the gsl. even in classical general relativity, there is a serious difficulty with the ordinary second law of thermodynamics when a black hole is present, as originally emphasized by j.a. wheeler : one can simply take some ordinary matter and drop it into a black hole, where, according to classical general relativity, it will disappear into a spacetime singularity. in this process, one loses the entropy initially present in the matter, and no compensating gain of ordinary entropy occurs, so the total entropy, s, of matter in the universe decreases. one could attempt to salvage the ordinary second law by invoking the bookkeeping rule that one must continue to count the entropy of matter dropped into a black hole as still contributing to the total entropy of the universe. as already mentioned in section 2, after the area theorem was proven, bekenstein [14, 15 ] proposed a way out of this difficulty : assign an entropy, sbh, to a black hole given by a numerical factor of order unity times the area, a, of the black hole in planck units. define the generalized entropy, s, to be the sum of the ordinary entropy, s, of matter outside of a black hole plus the black hole entropy (13)\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$s ' \equiv s + s_{bh }.$$\end{document } finally, replace the ordinary second law of thermodynamics by the generalized second law (gsl) : the total generalized entropy of the universe never decreases with time, (14)\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\nabla s ' \geqslant 0.$$\end{document } although the ordinary second law will fail when matter is dropped into a black hole, such a process will tend to increase the area of the black hole, so there is a possibility that the gsl will hold. bekenstein s proposal of the gsl was made prior to the discovery of hawking radiation. when hawking radiation is taken into account, a serious problem also arises with the second law of black hole mechanics (i.e., the area theorem) : conservation of energy requires that an isolated black hole must lose mass in order to compensate for the energy radiated to infinity by the hawking process. indeed, if one equates the rate of mass loss of the black hole to the energy flux at infinity due to particle creation, one arrives at the startling conclusion that an isolated black hole will radiate away all of its mass within a finite time. during this process of black hole evaporation, a will decrease. such an area decrease can occur because the expected stress - energy tensor of quantum matter does not satisfy the null energy condition even for matter for which this condition holds classically in violation of a key hypothesis of the area theorem. however, although the second law of black hole mechanics fails during the black hole evaporation process, if we adjust the numerical factor in the definition of sbh to correspond to the identification of /2 as temperature in the first law of black hole mechanics so that, as in eq. (9) above, we have sbh = a/4 in planck units then the gsl continues to hold : although a decreases, there is at least as much ordinary entropy generated outside the black hole by the hawking process. thus, although the ordinary second law fails in the presence of black holes and the second law of black hole mechanics fails when quantum effects are taken into account, there is a possibility that the gsl may always hold. if the gsl does hold, it seems clear that we must interpret sbh as representing the physical entropy of a black hole, and that the laws of black hole mechanics must truly represent the ordinary laws of thermodynamics as applied to black holes. thus, a central issue in black hole thermodynamics is whether the gsl holds in all processes. it was immediately recognized by bekenstein (see also) that there is a serious difficulty with the gsl if one considers a process wherein one carefully lowers a box containing matter with entropy s and energy e very close to the horizon of a black hole before dropping it in. classically, if one could lower the box arbitrarily close to the horizon before dropping it in, one would recover all of the energy originally in the box as work at infinity. no energy would be delivered to the black hole, so by the first law of black hole mechanics, eq. (7), the black hole area, a, would not increase. however, one would still get rid of all of the entropy, s, originally in the box, in violation of the gsl. indeed, this process makes manifest the fact that in classical general relativity, the physical temperature of a black hole is absolute zero : the above process is, in effect, a carnot cycle which converts heat into work with 100% efficiency. the difficulty with the gsl in the above process can be viewed as stemming from an inconsistency of this fact with the mathematical assignment of a finite (non - zero) temperature to the black hole required by the first law of black hole mechanics if one assigns a finite (non - infinite) entropy to the black hole. bekenstein proposed a resolution of the above difficulty with the gsl in a quasi - static lowering process by arguing [14, 15 ] that it would not be possible to lower a box containing physically reasonable matter close enough to the horizon of the black hole to violate the gsl. as will be discussed further in the next sub - section, this proposed resolution was later refined by postulating a universal bound on the entropy of systems with a given energy and size. however, an alternate resolution was proposed in, based upon the idea that, when quantum effects are taken into account, the physical temperature of a black hole is no longer absolute zero, but rather is the hawking temperature, /2. since the hawking temperature goes to zero in the limit of a large black hole, it might appear that quantum effects could not be of much relevance in this case. however, despite the fact that hawking radiation at infinity is indeed negligible for large black holes, the effects of the quantum thermal atmosphere surrounding the black hole are not negligible on bodies that are quasi - statically lowered toward the black hole. the temperature gradient in the thermal atmosphere (see eq. (12)) implies that there is a pressure gradient and, consequently, a buoyancy force on the box. this buoyancy force becomes infinitely large in the limit as the box is lowered to the horizon. as a result of this buoyancy force, the optimal place to drop the box into the black hole is no longer the horizon but rather the floating point of the box, where its weight is equal to the weight of the displaced thermal atmosphere. the minimum area increase given to the black hole in the process is no longer zero, but rather turns out to be an amount just sufficient to prevent any violation of the gsl from occurring in this process. the analysis of considered only a particular class of gedankenexperiments for violating the gsl involving the quasi - static lowering of a box near a black hole. of course, since one does not have a general proof of the ordinary second law of thermodynamics and, indeed, for finite systems, there should always be a nonvanishing probability of violating the ordinary second law it would not be reasonable to expect to obtain a completely general proof of the gsl. however, general arguments within the semiclassical approximation for the validity of the gsl for arbitrary infinitesimal quasi - static processes have been given in [105, 90, 101 ]. these arguments crucially rely on the presence of the thermal atmosphere surrounding the black hole. related arguments for the validity of the gsl have been given in [48, 82 ]. in, it is assumed that the incoming state is a product state of radiation originating from infinity (i.e., in modes) and radiation that would appear to emanate from the white hole region of the analytically continued spacetime (i.e., up modes), and it is argued that the generalized entropy must increase under unitary evolution. in, it is argued on quite general grounds that the (generalized) entropy of the state of the region exterior to the black hole must increase under the assumption that it undergoes autonomous evolution. indeed, it should be noted that if one could violate the gsl for an infinitesimal quasi - static process in a regime where the black hole can be treated semi - classically, then it also should be possible to violate the ordinary second law for a corresponding process involving a self - gravitating body. namely, suppose that the gsl could be violated for an infinitesimal quasi - static process involving, say, a schwarzschild black hole of mass m (with m much larger than the planck mass). this process might involve lowering matter towards the black hole and possibly dropping the matter into it. however, an observer doing this lowering or dropping can probe only the region outside of the black hole, so there will be some r0 > 2 m such that the detailed structure of the black hole will directly enter the analysis of the process only for r > r0. now replace the black hole by a shell of matter of mass m and radius r0, and surround this shell with a real atmosphere of radiation in thermal equilibrium at the hawking temperature (10) as measured by an observer at infinity. then the ordinary second law should be violated when one performs the same process to the shell surrounded by the (real) thermal atmosphere as one performs to violate the gsl when the black hole is present. indeed, the arguments of [105, 90, 101 ] do not distinguish between infinitesimal quasi - static processes involving a black hole as compared with a shell surrounded by a (real) thermal atmosphere at the hawking temperature. in summary, there appear to be strong grounds for believing in the validity of the gsl. as discussed in the previous subsection, for a classical black hole the gsl would be violated if one could lower a box containing matter sufficiently close to the black hole before dropping it in. indeed, for a schwarzschild black hole, a simple calculation reveals that if the size of the box can be neglected, then the gsl would be violated if one lowered a box containing energy e and entropy s to within a proper distance d of the bifurcation surface of the event horizon before dropping it in, where (15)\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$d 2e) and which violated the bound (18), so that s > a/4 = r. but the entropy of such a black hole is a/4, so the generalized entropy will decrease in this process. i am not aware of any counter - argument in the literature to the argument given in the previous paragraph, so i will take the opportunity to give one here. if there were a system which violated the bound (18), then the above argument shows that it would be (generalized) entropically unfavorable to collapse that system to a black hole. i believe that the conclusion one should draw from this is that, in this circumstance, it should not be possible to form a black hole. in other words, the bound (18) should be necessary in order for black holes to be stable or metastable states, but should not be needed for the validity of the gsl. consider a massless gas composed of n species of (boson or fermion) particles confined by a spherical box of radius r. then (neglecting self - gravitational effects and any corrections due to discreteness of modes) we have (19)\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$s \sim n^{1/4 } r^{3/4 } e^{3/4 }.$$\end{document } we wish to consider a configuration that is not already a black hole, so we need e r. this means that we need to consider a model with n r. for such a model, start with a region r containing matter with s > r but with e < r/2. if we try to collapse a shell upon the system to form a black hole of radius r, the collapse time will be r. but the hawking evaporation timescale in this model is th r / n, since the flux of hawking radiation is proportional to n. since n r, we have th r, so the hawking evaporation time is shorter than the collapse time ! consequently, the black hole will never actually form. rather, at best it will merely act as a catalyst for converting the original high entropy confined state into an even higher entropy state of unconfined hawking radiation. as mentioned above, the proposed bound (18) is ill defined in a general (non - spherically - symmetric) curved spacetime. there also are other difficulties with (18) : in a closed universe, it is not obvious what constitutes the inside versus the outside of the bounding area. in addition, (18) can be violated near cosmological and other singularities, where the entropy of suitably chosen comoving volumes remains bounded away from zero but the area of the boundary of the region goes to zero. however, a reformulation of (18) which is well defined in a general curved spacetime and which avoids these difficulties has been given by bousso [25, 26, 27 ]. bousso s reformulation can be stated as follows : let l be a null hypersurface such that the expansion,, of l is everywhere non - positive, 0 (or, alternatively, is everywhere non - negative, 0). in particular, l is not allowed to contain caustics, where changes sign from to +. let b be a spacelike cross - section of l. bousso s reformulation conjectures that (20)\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$${s_\mathcal{l } } \leqslant { a_b}/4,$$\end{document } where ab denotes the area of b and sl denotes the entropy flux through l to the future (or, respectively, the past) of b. in it was argued that the bound (21) should be valid in certain classical regimes (see) wherein the local entropy density of matter is bounded in a suitable manner by the energy density of matter. furthermore, the following generalization of bousso s bound was proposed : let l be a null hypersurface which starts at a cross - section, b, and terminates at a cross - section b. suppose further that l is such that its expansion,, is either everywhere non - negative or everywhere non - positive. then (21)\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$${s_\mathcal{l } } \leqslant \left| { { a_b } - { a_{b ' } } } \right|/4.$$\end{document } although we have argued above that the validity of the gsl should not depend upon the validity of the entropy bounds (16) or (18), there is a close relationship between the gsl and the generalized bousso bound (21). namely, as discussed in section 2 above, classically, the event horizon of a black hole is a null hypersurface satisfying 0. thus, in a classical regime, the gsl itself would correspond to a special case of the generalized bousso bound (21). this suggests the intriguing possibility that, in quantum gravity, there might be a more general formulation of the gsl perhaps applicable to an arbitrary horizon as defined on p. 134 of, not merely to an event horizon of a black hole which would reduce to (21) in a suitable classical limit. the considerations of the previous sections make a compelling case for the merger of the laws of black hole mechanics with the laws of thermodynamics. in particular, they strongly suggest that sbh (= a/4 in general relativity see eqs.(8) and (9) above) truly represents the physical entropy of a black hole. now, the entropy of ordinary matter is understood to arise from the number of quantum states accessible to the matter at given values of the energy and other state parameters. one would like to obtain a similar understanding of why a/4 represents the entropy of a black hole in general relativity by identifying (and counting) the quantum dynamical degrees of freedom of a black hole. in order to do so, it clearly will be necessary to go beyond the classical and semiclassical considerations of the previous sections and consider black holes within a fully quantum theory of gravity. in this section, we will briefly summarize some of the main approaches that have been taken to the direct calculation of the entropy of a black hole. the first direct quantum calculation of black hole entropy was given by gibbons and hawking in the context of euclidean quantum gravity. they started with a formal, functional integral expression for the canonical ensemble partition function in euclidean quantum gravity and evaluated it for a black hole in the zero loop (i.e, classical) approximation. as shown in, the mathematical steps in this procedure are in direct correspondence with the purely classical determination of the entropy from the form of the first law of black hole mechanics. a number of other entropy calculations that have been given within the formal framework of euclidean quantum gravity also can be shown to be equivalent to the classical derivation (see for further discussion). thus, although the derivation of and other related derivations give some intriguing glimpses into possible deep relationships between black hole thermodynamics and euclidean quantum gravity, they do not appear to provide any more insight than the classical derivation into accounting for the quantum degrees of freedom that are responsible for black hole entropy. it should be noted that there is actually an inconsistency in the use of the canonical ensemble to derive a formula for black hole entropy, since the entropy of a black hole grows too rapidly with energy for the canonical ensemble to be defined. (equivalently, the heat capacity of a schwarzschild black hole is negative, so it can not come to equilibrium with an infinite heat bath.) another approach to the calculation of black hole entropy has been to attribute it to the entanglement entropy resulting from quantum field correlations between the exterior and interior of the black hole [24, 31, 57 ]. as a result of these correlations across the event horizon, the state of a quantum field when restricted to the exterior of the black hole is mixed. indeed, in the absence of a short distance cutoff, the von neumann entropy, tr[ln ], of any physically reasonable state would diverge. if one now inserts a short distance cutoff of the order of the planck scale, one obtains a von neumann entropy of the order of the horizon area, a. thus, this approach provides a natural way of accounting for why the entropy of a black hole is proportional to its surface area. however, the constant of proportionality depends upon a cutoff and is not (presently) calculable within this approach. (indeed, one might argue that in this approach, the constant of proportionality between sbh and a should depend upon the number, n, of species of particles, and thus could not equal 1/4 (independently of n). however, it is possible that the n - dependence in the number of states is compensated by an n - dependent renormalization of g and, hence, of the planck scale cutoff.) more generally, it is far from clear why the black hole horizon should be singled out for a such special treatment of the quantum degrees of freedom in its vicinity, since similar quantum field correlations will exist across any other null surface. it is particularly puzzling why the local degrees of freedom associated with the horizon should be singled out since, as already noted in section 2 above, the black hole horizon at a given time is defined in terms of the entire future history of the spacetime and thus has no distinguished local significance. finally, since the gravitational action and field equations play no role in the above derivation, it is difficult to see how this approach could give rise to a black hole entropy proportional to eq. (8) (rather than proportional to a) in a more general theory of gravity. similar remarks apply to approaches which attribute the relevant degrees of freedom to the shape of the horizon or to causal links crossing the horizon. a closely related idea has been to attribute the entropy of the black hole to the ordinary entropy of its thermal atmosphere). if we assume that the thermal atmosphere behaves like a free, massless (boson or fermion) gas, its entropy density will be (roughly) proportional to t. however, since t diverges near the horizon in the manner specified by eq. (12), we find that the total entropy of the thermal atmosphere near the horizon diverges. it arises because, on account of arbitrarily large redshifts, there now are infinitely many modes of arbitrarily high locally measured frequency that contribute a bounded energy as measured at infinity. to cure this divergence, it is necessary to impose a cutoff on the locally measured frequency of the modes. if we impose a cutoff of the order of the planck scale, then the thermal atmosphere contributes an entropy of order the horizon area, a, just as in the entanglement entropy analysis. indeed, this calculation is really the same as the entanglement entropy calculation, since the state of a quantum field outside of the black hole is thermal, so its von neumann entropy is equal to its thermodynamic entropy (see also). note that the bulk of the entropy of the thermal atmosphere is highly localized in a skin surrounding the horizon, since the attribution of black hole entropy to its thermal atmosphere is essentially equivalent to the entanglement entropy proposal, this approach has essentially the same strengths and weaknesses as the entanglement entropy approach. on one hand, it naturally accounts for a black hole entropy proportional to a. on the other hand, this result depends in an essential way on an uncalculable cutoff, and it is difficult to see how the analysis could give rise to eq. (8) in a more general theory of gravity. the preferred status of the event horizon and the localization of the degrees of freedom responsible for black hole entropy to a planck length skin surrounding the horizon also remain puzzling in this approach. to see this more graphically, consider the collapse of a massive spherical shell of matter. then, as the shell crosses its schwarzschild radius, the spacetime curvature outside of the shell is still negligibly small. nevertheless, within a time of order the planck time after the crossing of the schwarzschild radius, the skin of thermal atmosphere surrounding the newly formed black hole will come to equilibrium with respect to the notion of time translation symmetry for the static schwarzschild exterior. thus, if an entropy is to be assigned to the thermal atmosphere in the manner suggested by this proposal, then the degrees of freedom of the thermal atmosphere which previously were viewed as irrelevant vacuum fluctuations making no contribution to entropy suddenly become activated by the passage of the shell for the purpose of counting their entropy. a momentous change in the entropy of matter in the universe has occurred, even though observers riding on or near the shell see nothing of significance occurring. another approach that is closely related to the entanglement entropy and thermal atmosphere approaches and which also contains elements closely related to the euclidean approach and the classical derivation of eq. (8) attempts to account for black hole entropy in the context of sakharov s theory of induced gravity [47, 46 ]. in sakharov s proposal, the dynamical aspects of gravity arise from the collective excitations of massive fields. constraints are then placed on these massive fields to cancel divergences and ensure that the effective cosmological constant vanishes. sakharov s proposal is not expected to provide a fundamental description of quantum gravity, but at scales below the planck scale it may possess features in common with other more fundamental descriptions. in common with the entanglement entropy and thermal atmosphere approaches, black hole entropy is explained as arising from the quantum field degrees of freedom outside the black hole. however, in this case the formula for black hole entropy involves a subtraction of the (divergent) mode counting expression and an (equally divergent) expression for the noether charge operator, so that, in effect, only the massive fields contribute to black hole entropy. more recently, another approach to the calculation of black hole entropy has been developed in the framework of quantum geometry [3, 10 ]. in this approach, if one considers a spacetime containing an isolated horizon (see section 2 above), the classical symplectic form and classical hamiltonian each acquire an additional boundary term arising from the isolated horizon. (it should be noted that the phase space considered here incorporates the isolated horizon boundary conditions, i.e., only field variations that preserve the isolated horizon structure are admitted.) these additional terms are identical in form to that of a chern - simons theory defined on the isolated horizon. classically, the fields on the isolated horizon are determined by continuity from the fields in the bulk and do not represent additional degrees of freedom. however, in the quantum theory where distributional fields are allowed these fields are interpreted as providing additional, independent degrees of freedom associated with the isolated horizon. one then counts the surface states of these fields on the isolated horizon subject to a boundary condition relating the surface states to volume states and subject to the condition that the area of the isolated horizon (as determined by the volume state) lies within a squared planck length of the value a. this state counting yields an entropy proportional to a for black holes much larger than the planck scale. unlike the entanglement entropy and thermal atmosphere calculations, the state counting here yields finite results and no cutoff need be introduced. however, the formula for entropy contains a free parameter (the immirzi parameter), which arises from an ambiguity in the loop quantization procedure, so the constant of proportionality between s and a is not calculable. the most quantitatively successful calculations of black hole entropy to date are ones arising from string theory. it is believed that at low energies, string theory should reduce to a 10-dimensional supergravity theory (see for considerable further discussion of the relationship between string theory and 10-dimensional and 11-dimensional supergravity). if one treats this supergravity theory as a classical theory involving a spacetime metric, gab, and other classical fields, one can find solutions describing black holes. on the other hand, one also can consider a weak coupling limit of string theory, wherein the states are treated perturbatively. in the weak coupling limit, there is no literal notion of a black hole, just as there is no notion of a black hole in linearized general relativity. nevertheless, certain weak coupling states can be identified with certain black hole solutions of the low energy limit of the theory by a correspondence of their energy and charges. (here, it is necessary to introduce d - branes into string perturbation theory in order to obtain weak coupling states with the desired charges.) now, the weak coupling states are, in essence, ordinary quantum dynamical degrees of freedom, so their entropy can be computed by the usual methods of statistical physics. remarkably, for certain classes of extremal and nearly extremal black holes, the ordinary entropy of the weak coupling states agrees exactly with the expression for a/4 for the corresponding classical black hole states ; see and for reviews of these results. recently, it also has been shown that for certain black holes, subleading corrections to the state counting formula for entropy correspond to higher order string corrections to the effective gravitational action, in precise agreement with eq. (8). since the formula for entropy has a nontrivial functional dependence on energy and charges, it is hard to imagine that the agreement between the ordinary entropy of the weak coupling states and black hole entropy could be the result of a random coincidence. furthermore, for low energy scattering, the absorption / emission coefficients (gray body factors) of the corresponding weak coupling states and black holes also agree. this suggests that there may be a close physical association between the weak coupling states and black holes, and that the dynamical degrees of freedom of the weak coupling states are likely to at least be closely related to the dynamical degrees of freedom responsible for black hole entropy. however, it remains a challenge to understand in what sense the weak coupling states could be giving an accurate picture of the local physics occurring near (and within) the region classically described as a black hole. the relevant degrees of freedom responsible for entropy in the weak coupling string theory models are associated with conformal field theories. recently carlip [33, 34 ] has attempted to obtain a direct relationship between the string theory state counting results for black hole entropy and the classical poisson of general relativity. after imposing certain boundary conditions corresponding to the presence of a local killing horizon, carlip chooses a particular subgroup of spacetime diffeomorphisms, generated by vector fields. the transformations on the phase space of classical general relativity corresponding to these diffeomorphisms are generated by hamiltonians h. however, the poisson of these hamiltonians is not isomorphic to the lie of the vector fields but rather corresponds to a central extension of this algebra. now, it is known that the asymptotic density of states in a conformal field theory based upon a virasoro algebra is given by a universal expression (the cardy formula) that depends only on the virasoro algebra. for the virasoro algebra obtained by carlip, the cardy formula yields an entropy in agreement with eq. since the hamiltonians, h, are closely related to the corresponding noether currents and charges occurring in the derivation of eqs. (8) and (9), carlip s approach holds out the possibility of providing a direct, general explanation of the remarkable agreement between the string theory state counting results and the classical formula for the entropy of a black hole. the results described in the previous sections provide a remarkably compelling case that stationary black holes are localized thermal equilibrium states of the quantum gravitational field, and that the laws of black hole mechanics are simply the ordinary laws of thermodynamics applied to a system containing a black hole. although no results on black hole thermodynamics have been subject to any experimental or observational tests, the theoretical foundation of black hole thermodynamics appears to be sufficiently firm as to provide a solid basis for further research and speculation on the nature of quantum gravitational phenomena. in this section, i will briefly discuss two key unresolved issues in black hole thermodynamics which may shed considerable further light upon quantum gravitational physics. in classical general relativity, the matter responsible for the formation of a black hole propagates into a singularity lying within the deep interior of the black hole. suppose that the matter which forms a black hole possesses quantum correlations with matter that remains far outside of the black hole. then it is hard to imagine how these correlations could be restored during the process of black hole evaporation unless gross violations of causality occur. in fact, the semiclassical analyses of the hawking process show that, on the contrary, correlations between the exterior and interior of the black hole are continually built up as it evaporates (see for further discussion). indeed, these correlations play an essential role in giving the hawking radiation an exactly thermal character. as already mentioned in subsection 4.1 above if the correlations between the inside and outside of the black hole are not restored during the evaporation process, then by the time that the black hole has evaporated completely, an initial pure state will have evolved to a mixed state, i.e., information will have been lost. in a semiclassical analysis of the evaporation process, such information loss does occur and is ascribable to the propagation of the quantum correlations into the singularity within the black hole. a key unresolved issue in black hole thermodynamics is whether this conclusion continues to hold in a complete quantum theory of gravity. on one hand, arguments can be given that alternatives to information loss such as the formation of a high entropy remnant or the gradual restoration of correlations during the late stages of the evaporation process seem highly implausible. on the other hand, it is commonly asserted that the evolution of an initial pure state to a final mixed state is in conflict with quantum mechanics. for this reason, the issue of whether a pure state can evolve to a mixed state in the process of black hole formation and evaporation is usually referred to as the black hole information paradox. there appear to be two logically independent grounds for the claim that the evolution of an initial pure state to a final mixed state is in conflict with quantum mechanics : i.such evolution is asserted to be incompatible with the fundamental principles of quantum theory, which postulates a unitary time evolution of a state vector in a hilbert space.ii.such evolution necessarily gives rise to violations of causality and/or energy - momentum conservation and, if it occurred in the black hole formation and evaporation process, there would be large violations of causality and/or energy - momentum (via processes involving virtual black holes) in ordinary laboratory physics. such evolution is asserted to be incompatible with the fundamental principles of quantum theory, which postulates a unitary time evolution of a state vector in a hilbert space. such evolution necessarily gives rise to violations of causality and/or energy - momentum conservation and, if it occurred in the black hole formation and evaporation process, there would be large violations of causality and/or energy - momentum (via processes involving virtual black holes) in ordinary laboratory physics. with regard to (1), within the semiclassical framework, the evolution of an initial pure state to a final mixed state in the process of black hole formation and evaporation can be attributed to the fact that the final time slice fails to be a cauchy surface for the spacetime. in fact, a closely analogous evolution of an initial pure state to a final mixed state occurs for a free, massless field in minkowski spacetime if one chooses the final time to be a hyperboloid rather than a hyperplane. (here, the information loss occurring during the time evolution results from radiation to infinity rather than into a black hole.) indeed, the evolution of an initial pure state to a final mixed state is naturally accommodated within the framework of the algebraic approach to quantum theory as well as in the framework of generalized quantum theory. the main arguments for (2) were given in (see also). however, these arguments assume that the effective evolution law governing laboratory physics has a markovian character, so that it is purely local in time. as pointed out in, one would expect a black hole to retain a memory (stored in its external gravitational field) of its energy - momentum, so it is far from clear that an effective evolution law modeling the process of black hole formation and evaporation should be markovian in nature. furthermore, even within the markovian context, it is not difficult to construct models where rapid information loss occurs at the planck scale, but negligible deviations from ordinary dynamics occur at laboratory scales. for the above reasons, i do not feel that the issue of whether a pure state evolves to a mixed state in the process of black hole formation and evaporation should be referred to as a paradox. nevertheless, the resolution of this issue is of great importance : if pure states remain pure, then our basic understanding of black holes in classical and semiclassical gravity will have to undergo significant revision in quantum gravity. on the other hand, if pure states evolve to mixed states in a fully quantum treatment of the gravitational field, then at least the aspect of the classical singularity as a place where information can get lost must continue to remain present in quantum gravity. in that case, rather than smooth out the singularities of classical general relativity, one might expect singularities to play a fundamental role in the formulation of quantum gravity. thus, the resolution of this issue would tell us a great deal about both the nature of black holes and the existence of singularities in quantum gravity. the calculations described in section 5 yield a seemingly contradictory picture of the degrees of freedom responsible for black hole entropy. in the entanglement entropy and thermal atmosphere approaches, the relevant degrees of freedom are those associated with the ordinary degrees of freedom of quantum fields outside of the black hole. however, the dominant contribution to these degrees of freedom comes from (nearly) planck scale modes localized to (nearly) a planck length of the black hole, so, effectively, the relevant degrees of freedom are associated with the horizon. in the quantum geometry approach, the relevant degrees of freedom are also associated with the horizon but appear to have a different character in that they reside directly on the horizon (although they are constrained by the exterior state). finally the string theory calculations involve weak coupling states, so it is not clear what the degrees of freedom of these weak coupling states would correspond to in a low energy limit where these states may admit a black hole interpretation. however, there is no indication in the calculations that these degrees of freedom should be viewed as being localized near the black hole horizon. the above calculations are not necessarily in conflict with each other, since it is possible that they each could represent a complementary aspect of the same physical degrees of freedom. nevertheless, it seems far from clear as to whether we should think of these degrees of freedom as residing outside of the black hole (e.g., in the thermal atmosphere), on the horizon (e.g., in chern - simons states), or inside the black hole (e.g., in degrees of freedom associated with what classically corresponds to the singularity deep within the black hole). the following puzzle may help bring into focus some of the issues related to the degrees of freedom responsible for black hole entropy and, indeed, the meaning of entropy in quantum gravitational physics. as we have already discussed, one proposal for accounting for black hole entropy is to attribute it to the ordinary entropy of its thermal atmosphere. if one does so, then, as previously mentioned in section 5 above, one has the major puzzle of explaining why the quantum field degrees of freedom near the horizon contribute enormously to entropy, whereas the similar degrees of freedom that are present throughout the universe and are locally indistinguishable from the thermal atmosphere are treated as mere vacuum fluctuations which do not contribute to entropy. but perhaps an even greater puzzle arises if we assign a negligible entropy to the thermal atmosphere (as compared with the black hole area, a), as would be necessary if we wished to attribute black hole entropy to other degrees of freedom. consider a black hole enclosed in a reflecting cavity which has come to equilibrium with its hawking radiation. surely, far from the black hole, the thermal atmosphere in the cavity must contribute an entropy given by the usual formula for a thermal gas in (nearly) flat spacetime. however, if the thermal atmosphere is to contribute a negligible total entropy (as compared with a), then at some proper distance d from the horizon much greater than the planck length, the thermal atmosphere must contribute to the entropy an amount that is much less than the usual result (t) that would be obtained by a naive counting of modes. if that is the case, then consider a box of ordinary thermal matter at infinity whose energy is chosen so that its floating point would be less than this distance d from the horizon. let us now slowly lower the box to its floating point. by the time it reaches its floating point, the contents of the box are indistinguishable from the thermal atmosphere, so the entropy within the box also must be less than what would be obtained by usual mode counting arguments. it follows that the entropy within the box must have decreased during the lowering process, despite the fact that an observer inside the box still sees it filled with thermal radiation and would view the lowering process as having been adiabatic. furthermore, suppose one lowers (or, more accurately, pushes) an empty box to the same distance from the black hole. the entropy difference between the empty box and the box filled with radiation should still be given by the usual mode counting formulas. i believe that in order to gain a better understanding of the degrees of freedom responsible for black hole entropy, it will be necessary to achieve a deeper understanding of the notion of entropy itself. even in flat spacetime, there is far from universal agreement as to the meaning of entropy particularly in quantum theory and as to the nature of the second law of thermodynamics. the situation in general relativity is considerably murkier, as, for example, there is no unique, rigid notion of time translations and classical general relativistic dynamics appears to be incompatible with any notion of ergodicity. it seems likely that a new conceptual framework will be required in order to have a proper understanding of entropy in quantum gravitational physics. | we review the present status of black hole thermodynamics. our review includes discussion of classical black hole thermodynamics, hawking radiation from black holes, the generalized second law, and the issue of entropy bounds. a brief survey also is given of approaches to the calculation of black hole entropy. we conclude with a discussion of some unresolved open issues. |
electrical impedance myography (eim) is a four - electrode impedance measurement technique based on the fundamental principle of ohm 's law. in this technique low intensity high frequency alternating current is injected through the muscle or muscle group of interest via the outer two electrodes and the inner two electrodes record the potential difference from which the basic parameters of alternating current, resistance, reactance, and phase, are assessed [13 ]. abnormal muscle conditions can be identified from the deviation of these parameters from normal condition [3, 4 ]. because of its noninvasive nature, eim measurement also includes the electrical response of other body tissues like subcutaneous fat thickness, muscle thickness variation [58 ], and also some nonanatomic factors like electrode surface area, interelectrode distance, and ambient temperature. studies prove that, out of different eim parameters, reactance at a specific frequency is the desired parameter that is least affected by above - mentioned anatomic factors and is also the most effective parameter to detect muscle abnormal conditions successfully. the goal of this study is to propose optimized electrode configuration for this four - electrode method so that effect of muscle variation on eim measurement is minimized. in this study, to analyse the variation of eim parameters in different condition, a finite element model of human upper arm was developed. finite element method (fem) has been established as an appropriate approach for analysis of nonsymmetrical shape like muscle tissue for assessing alternations of muscle in disease - induced changes through elm [11, 12 ]. the normal tissue properties were obtained from published resources and used in this fem model. the abnormal muscle electrical properties were obtained from sciatic crush data of rat studies [11, 14 ]. the optimization problem was designed to minimize the effect of different muscle thickness on desired eim parameter, that is, reactance at 50 khz in normal condition. to simulate the optimization, the fem model described above based on the properties of the fem study, different parameters on genetic algorithm (ga) tool such as population, selection function, mutation, and crossover were set accordingly so that the problem converges to its global minima. the three basic parameters that are assessed easily from eim experimentation are resistance (r), reactance (x), and phase (). the study is conducted over a large range of frequencies (typically ranges from some hz to 1/2 mhz). deviation from the normal profile of each eim parameters occurs due to changes in muscle electrical properties during disease progression. the methodology that is implemented in eim is expressed by ohm 's law : (1)v = iz, where v is voltage, i is current flow, and z is the impedance, which are explored in eim for disease detection. = r+jx.so, the complex admittance becomes(3)y=1z = g+jwc, where g is the conductance and c is capacitance. here,(4)g = rr2+x2,c = xr2+x2w.so the muscle 's internal electrical property, conductivity, and relative permittivity depend on conductance, capacitance, and geometric factor. so the conductivity, = k g. and the relative permittivity, r = (k c)/. the fem model of human upper arm used in this study incorporates the governing equations of eim technique. the model was developed and analysed using the ac / dc module, electric currents physics, in comsol multiphysics software (comsol, inc., 4.2a burlington, ma). based on the cross - sectional view of human upper arm (figure 1), the model was designed to have 4 different body tissue layers, that is, bone marrow, muscle, subcutaneous fat, and skin layer portrayed by four concentric cylinders with a fixed length of 14.6 cm. for nonelectrode boundaries, the normal component of the electric current was assumed to be continuous. electrodes were modelled as potential surfaces, the boundaries of which had either the excitation or zero current, except for the ground electrode, the potential of which was fixed at zero volts., longitudinal and transverse conductivities and permittivities were obtained from the rat studies and were incorporated into the model with rat data substituting for the normal human muscle. fat, cortical bone, and marrow data were obtained over the frequency spectrum from gabriel 's dielectric survey. the skin - subcutaneous fat, cortical bone, and marrow were all assumed to be isotropic but muscle is anisotropic. the corresponding fem model used for this study is illustrated in figure 1. as will be discussed shortly in the results, the model quite successfully follows the natural characteristics of human body to some extent. but, as mentioned above, to make eim as an established tool for neuromuscular disease diagnosis, an optimized electrode configuration must be proposed that has least variance in accordance to other anatomic or nonanatomic factors other than muscle electrical properties. in this study, we used genetic algorithm as our optimization tool since it is one of the most effective means to find good solutions to the problems that are computationally intractable. genetic algorithm imitates the selection process found in nature by creating a random population of samples at the beginning. then it delivers a successor population by completing a process of fitness - based choice and recombination. during recombination, first generation samples are chosen and their genetic material is recombined to produce the second generation., a set of successive generation evolves and the average fitness of the samples tends to converge to an optimized solution. the fitness function used in this study was the slope of the linear regression equation obtained from the reactance at 50 khz as a function of muscle thickness in normal condition (discussed in detail in appendix). the population size was set at 100, a number obtained from trial and error procedure so that the solution space is more thoroughly searched and the algorithm does not run too slow. selection function for this specific study was chosen stochastic uniform since it samples all the solutions at evenly spaced intervals, thus minimizing the probability to pick up a local minimum rather than the global minimum. the fitness function value differs slightly from the previous one with same condition due to different correlation coefficient at times. crossover function was set as arithmetic in which the next generation populations are weighted arithmetic mean of two parents. initially, we have performed the study on varying subcutaneous fat and muscle thickness to observe the dependency of eim parameters on these anatomic factors. as depicted in figures 2(a) and 2(b), the percentage change of resistance in both cases is significantly larger than the percentage change of reactance for variation in fat or muscle thickness. percentage change was determined by normalizing the desired parameter difference using change in muscle or fat thickness : that is, % change = (new value previous value)/change in thickness. however, change in muscle thickness appears to have more prominent effect on percentage change of reactance than the change of subcutaneous fat. one interesting finding is, in case of large subcutaneous fat thickness, the reactance profile shows deviation from normal condition, particularly in very high frequency range. the explanation remains within the simplified circuit model of human body tissue. in case of very high frequency, both the extracellular and intracellular resistance become highly conductive. so, in case of small fat thickness the isotropic sf resistance is not that prominent as in case of larger sf thickness which also contributes to larger reactance value in high frequencies. the electrode separation used for figure 2 was 75 mm between the excitation electrodes and 30 mm between the sense electrodes and the electrodes were 65 mm long and 7 mm in width. figure 2(c) illustrates how the variation in interelectrode distance affects the eim parameters. as can be seen, placing the sense electrodes far away from each other causes the reactance profile to shoot higher at frequencies around 40 khz. the setup for varying interelectrode distance between the sense electrodes was implemented using constant 15 mm distance between the sense and excitation electrode on both sides. separation between the excitation electrodes affects the eim parameters in opposite manner ; that is, reactance value shoots up when the excitation electrodes gets closer. that is why, we have considered the interelectrode spacing and electrode surface area as variables in our optimization problem. the goal was to minimize the alteration of eim parameters with respect to muscle or fat thickness variation. considering the total length of the model, the range of the interelectrode spacing was set in between 3 mm and 33 mm. the electrode surface area was designed as a variable by considering its angular coverage over the muscle model and the range was from 90 to 3 degrees on both side of the symmetry. as best fitness and best individual plots depict, the optimized electrode spacing is 87 mm between the excitation electrodes and 7 mm between the sense electrodes. the solution converges when the excitation electrodes are at their maximum limit and the sense electrodes are at their minimum limit. since the fem model geometry was designed using cylindrical shapes, variation in electrode surface area was incorporated as variation in angular coverage (i.e., angular coverage of 360 would refer to electrode shape that will cover the whole muscle region). variables 1 and 2 depict the angle of coverage for which optimization occurs which were varied from 3 to 180 on both sides of the symmetry. the variation in eim parameters also depend significantly on the area covered by the electrodes. best individual score for surface area covered by the electrodes is also at its minimum limit. the differences between the first two variables in the best individual plot of figure 3 are the angular coverage of the optimized electrode configuration. the third variable is the distance between sense electrodes and the fourth variable is the distance the excitation electrode should be located away from the sense electrode from optimized configuration., the conventional configuration is 15 mm-30 mm-15 mm spacing between the electrodes with 65 mm 7 mm surface area. the optimized configuration is 7 mm 7 mm surface electrodes with 33 mm-7 mm-33 mm spacing between them. only reactance at 50 khz has been highlighted in this figure because it has been stated in previous studies that reactance at 50 khz is the parameter which is least affected by sf thickness alteration and the best parameter to diagnose the disease effectively. as can be depicted from the figure, this parameter is less prone to change in case of optimized configuration than the conventional configuration. figure 4(a) depicts a reduction of 83% in the reactance variation with respect to muscle thickness for the proposed optimized configuration. figure 4(b) shows a 63% reduction in resistance variation with respect to fat thickness alteration. figures 4(a) and 4(b) illustrate two different eim parameters in two different cases because reactance is more prone to vary in case of muscle thickness variation and resistance is the parameter that is mostly affected during fat thickness change. besides having least dependency over other anatomic and nonanatomic factors, our major goal is to diagnose abnormal muscle condition. as can be seen from figure 5 the proposed optimized configuration can successfully distinguish the normal muscle from the atrophied one. based on the finding of the optimization problem, we carried out a more concentrated study on the electrode separation and surface area. the profile of the regression line shown in figure 6 shows that keeping the excitation electrodes apart from each other for a larger distance than the optimized configuration and making the electrode surface area smaller make the desired eim parameter even less variant with muscle thickness alteration. the slope of the linear regression line is 0.17, which is even smaller than the slope we got from the optimized configuration 0.48. based on the results of this study, it can be suggested that the less the surface area covered by the electrode the more is the stability of eim parameters. although the amount of injected current is the same, decreasing the surface area of electrodes results in a higher current density and larger penetration depth through body tissues especially through the subcutaneous fat thickness layer. to prove this hypothesis, we have performed another simulation with 1 mm 1 mm electrodes placed in the same separation as the conventional electrode placement. as can be summarized from figure 7, with the same separation between the electrodes, the objective of this study was to propose an optimized electrode configuration for which the eim parameters are less variant with the alteration of muscle and subcutaneous fat thickness and can also detect abnormal muscle conditions. as muscle thickness increases the resistance and reactance decrease. again, with the increment of subcutaneous fat thickness the resistance and reactance increase. and, the change in resistance due to subcutaneous fat thickness is much more prominent than the change in resistance for muscle thickness alteration and vice versa in case of reactance. so, as it seems, the resistance of the model is profoundly dominated by the isotropic property of the skin fat tissue whereas the reactance depends mostly on the anisotropic property of muscle tissue. so increasing muscle thickness while keeping the skin fat layer constant provides a more conductive path to the injected current. the whole muscle fibre can be visualized as a distributed collection of infinitesimal impedance block. with larger separation between the excitation electrodes, the current is more likely to be distributed along the muscle fibre and henceforth the anisotropic property of the muscle tissue is more highlighted. keeping the sense electrodes close enough includes a substantial part of the whole muscle membrane, thus minimizing the base value of impedance. in practice, eim is used as a noninvasive tool for neuromuscular disease detection and to observe the muscle condition during therapy over certain muscle group of interest. but, the anatomical diversity between subjects makes the diagnosis difficult and unreliable since there is no such eim parameter that can distinguish different disease condition universally. the finding of this study suggests that, placing the excitation electrodes at the far end of the muscle group and the sense electrodes closer to each other up to a practical limit and more importantly, keeping the surface area of the electrodes as small as possible can eliminate the variation caused by different fat or muscle thickness for different individuals. it was also verified later in the result section that this propose setup has the ability to distinguish normal and abnormal muscle condition which drives our motivation to present this setup modification to be introduced in eim measurement for effective implementation of the technique as a novel clinical tool. the electrode placement and shape were considered symmetrical over the whole study. from theoretical point of view, the surface area of sense electrodes was not supposed to have any impact on the eim parameters. but, there was deviation from the expected value as we tried to keep the sense electrodes area same as conventional configuration. the scope of this study was only limited to simulation and our future plan is to extend this study by implementing it in practical experiment. it is also of concern that the optimized setup eim parameters are considerably lower than the conventional setup value which raises the possibility of the eim parameters being more affected by noises. | electrical impedance myography (eim) is a noninvasive neurophysiologic technique to diagnose muscle health. besides muscle properties, the eim measurements vary significantly with the change of some other anatomic and nonanatomic factors such as skin fat thickness, shape and thickness of muscle, and electrode size and spacing due to its noninvasive nature of measurement. in this study, genetic algorithm was applied along with finite element model of eim as an optimization tool in order to figure out an optimized eim electrode setup, which is less affected by these factors, specifically muscle thickness variation, but does not compromise eim 's ability to detect muscle diseases. the results obtained suggest that a particular arrangement of electrodes and minimization of electrode surface area to its practical limit can overcome the effect of undesired factors on eim parameters to a larger extent. |
from march 2001 to february 2005, we performed us in 58 patients, mri in 24 patients, and both mri and us in 10 patients for a total of 72 patients (63 women and 9 men, age range : 19 - 70 years, average age : 50 years) who were clinically suspected of having morton neuroma. by review of the pathologic and surgical reports on the medical records, the final study group of this report was comprised of twenty confirmed morton neuromas in 17 patients among the 72 patients : 12 neuromas (in 11 patients) were pathologically confirmed by partial neurectomy ; the remaining eight neuromas (in 6 patients) were confirmed by gross inspection at the time of surgery, and these were remedied by neurolysis. all the surgery was performed by one experienced orthopedic surgeon. the surgical decision for surgery was based on the clinical findings and the pre - operative mri and/or us reports. patients were asked to access their satisfaction with the operation results according to the system advocated by johnson. (14) as follows : 1) completely satisfied (essentially pain free, no restrictions in activity and only minor restrictions in footwear), 2) satisfied with minor reservations (occasional mild pain, minor restrictions in activity and minor restrictions in foot wear), 3) satisfied with major reservations (mild or moderate pain, moderate restrictions in activity and major restrictions in footwear, but overall improvement), 4) dissatisfied (no improvement in pain or worse pain, major restrictions in activity and footwear, or worse symptoms). the grades of the patients ' satisfaction and the difference of the grades according to the methods of treatment were analyzed. the us evaluation was performed by one of four experienced musculoskeletal radiologists with using 9-mhz linear array transducers (hdi 5000, advanced technology laboratories, bothell, wa). the us images were obtained from the plantar aspect of the foot in the transverse and longitudinal planes, relative to the metatarsal shafts, with each patient in a sitting position with their feet in slight plantar flexion. the diagnostic criterion for morton neuroma, as assessed by us, was a well - defined, round or ovoid, hypoechoic (relative to the adjacent muscle) mass located just proximal to the metatarsal heads in the plantar aspect of the intermetatarsal space (5). all the mr imaging studies were performed on a 1.5-t scanner (signa horizon, ge medical systems, wi). the patients were examined in the supine position with the foot placed in plantar flexion within a transmit - receive extremity coil. the imaging protocol consisted of a t1-weighted spin - echo sequence (t1wi ; tr / te, 550/9), a fast spin echo (fse) t2-weighted sequence (t2wi ; tr / te, 4000/96) and a t1-weighted fat - suppressed spin - echo sequence (contrast - enhanced fat - saturated [cefs ] t1wi ; tr / te, 617/12) that was obtained after the intravenous injection of 0.2 ml / kg gadopentetate (magnevist, schering, berlin, germany). the imaging plane was oblique coronal, and this was perpendicular to the metatarsal bones. the section thickness was 3 - 5 mm without an intersection gap, the image matrix was 256 192 or 256 256 and the field of view was 10 - 14 cm (mostly 12 cm) ; this resulted in in - plane resolution of 0.220 - 0.292 mm (pixel size). the diagnostic criterion for mr imaging was a well - demarcated ovoid or dumbbell - shaped intermetatarsal mass at the plantar aspect near the metatarsal heads, and the mass had intermediate to low signal intensity on both t1wi and t2wi (1, 15, 16). the comparison of the us and mr imaging findings was performed retrospectively by a consensus of two experienced radiologists, and then each image was correlated with the surgical and pathologic findings. the size of the lesion was measured as the largest transverse diameter on both us and mri. the fluid between the metatarsal bones (the inter - metatarsal bursa) was excluded during the measurement of the lesion on mri. in addition, we compared the t1wi with the cefs t1wi for lesion conspicuity and for detecting morton neuroma. from march 2001 to february 2005, we performed us in 58 patients, mri in 24 patients, and both mri and us in 10 patients for a total of 72 patients (63 women and 9 men, age range : 19 - 70 years, average age : 50 years) who were clinically suspected of having morton neuroma. by review of the pathologic and surgical reports on the medical records, the final study group of this report was comprised of twenty confirmed morton neuromas in 17 patients among the 72 patients : 12 neuromas (in 11 patients) were pathologically confirmed by partial neurectomy ; the remaining eight neuromas (in 6 patients) were confirmed by gross inspection at the time of surgery, and these were remedied by neurolysis. all the surgery was performed by one experienced orthopedic surgeon. the surgical decision for surgery was based on the clinical findings and the pre - operative mri and/or us reports. patients were asked to access their satisfaction with the operation results according to the system advocated by johnson. (14) as follows : 1) completely satisfied (essentially pain free, no restrictions in activity and only minor restrictions in footwear), 2) satisfied with minor reservations (occasional mild pain, minor restrictions in activity and minor restrictions in foot wear), 3) satisfied with major reservations (mild or moderate pain, moderate restrictions in activity and major restrictions in footwear, but overall improvement), 4) dissatisfied (no improvement in pain or worse pain, major restrictions in activity and footwear, or worse symptoms). the grades of the patients ' satisfaction and the difference of the grades according to the methods of treatment were analyzed. the us evaluation was performed by one of four experienced musculoskeletal radiologists with using 9-mhz linear array transducers (hdi 5000, advanced technology laboratories, bothell, wa). the us images were obtained from the plantar aspect of the foot in the transverse and longitudinal planes, relative to the metatarsal shafts, with each patient in a sitting position with their feet in slight plantar flexion. the diagnostic criterion for morton neuroma, as assessed by us, was a well - defined, round or ovoid, hypoechoic (relative to the adjacent muscle) mass located just proximal to the metatarsal heads in the plantar aspect of the intermetatarsal space (5). all the mr imaging studies were performed on a 1.5-t scanner (signa horizon, ge medical systems, wi). the patients were examined in the supine position with the foot placed in plantar flexion within a transmit - receive extremity coil. the imaging protocol consisted of a t1-weighted spin - echo sequence (t1wi ; tr / te, 550/9), a fast spin echo (fse) t2-weighted sequence (t2wi ; tr / te, 4000/96) and a t1-weighted fat - suppressed spin - echo sequence (contrast - enhanced fat - saturated [cefs ] t1wi ; tr / te, 617/12) that was obtained after the intravenous injection of 0.2 ml / kg gadopentetate (magnevist, schering, berlin, germany). the imaging plane was oblique coronal, and this was perpendicular to the metatarsal bones. the section thickness was 3 - 5 mm without an intersection gap, the image matrix was 256 192 or 256 256 and the field of view was 10 - 14 cm (mostly 12 cm) ; this resulted in in - plane resolution of 0.220 - 0.292 mm (pixel size). the diagnostic criterion for mr imaging was a well - demarcated ovoid or dumbbell - shaped intermetatarsal mass at the plantar aspect near the metatarsal heads, and the mass had intermediate to low signal intensity on both t1wi and t2wi (1, 15, 16). the comparison of the us and mr imaging findings was performed retrospectively by a consensus of two experienced radiologists, and then each image was correlated with the surgical and pathologic findings. the size of the lesion was measured as the largest transverse diameter on both us and mri. the fluid between the metatarsal bones (the inter - metatarsal bursa) was excluded during the measurement of the lesion on mri. in addition, we compared the t1wi with the cefs t1wi for lesion conspicuity and for detecting morton neuroma. among the 20 neuromas (in 17 patients), 12 neuromas (12/20, 60%) were found in the third intermetatarsal space and the other eight neuromas (8/20, 40%) were in the second intermetatarsal space (table 1) upon operation. therapeutic success was assessed at the post - operative 2-month follow - up in 13 patients because four patients who underwent excision were unfortunately lost during follow up. eleven out of the 13 patients (11/13, 85%) had near complete relief from pain, two (2/13, 15%) had moderate improvement with some remaining pain, and none of the patients became worse. complete relief or marked improvement of the pain was seen in six patients (6/7, 86%) treated by excision and in five patients (5/6, 83%) treated by neurolysis (table 1). among the confirmed 20 morton neuromas (in 17 patients), us was performed for 14 neuromas (11 patients), mri was performed for 17 neuromas (15 patients), and both us and mri were performed for 11 neuromas (9 patients). the typical appearance of morton neuroma on the us and mr images is shown in figure 1. us depicted 11 out of 14 neuromas correctly, but the remaining three neuromas were not detected. on the other hand, mri detected 13 out of 17 neuromas correctly, but the remaining four neuromas were not detected. hence, the detection rate of mri for morton neuroma was 76% (13/17). figure 2 shows the true positive and false negative lesions in the patients who underwent both us and mr imaging. us demonstrated a mass in only the third intermetatarsal space, while the mr imaging revealed a mass in only the second intermetatarsal space. three patients had false negative results on the us imaging analysis, and four patients had false negative results on the mri analysis (table 1). among them figure 3 shows the case confirmed by excision and pathologically proven, but it was false negative on mr. on us, the mean size of the measured neuromas was 4.9 1.45 mm (range : 4 - 9 mm). on mri, the mean size of the neuroma was 5.1 1.32 mm (range : 3 - 8 mm). most of the neuromas were 5 mm or less (10 of the 14 neuromas [71% ] detected on us and 10 of the 17 neuromas [59% ] detected on mri). the maximum difference in size for the same masses measured by us and mr imaging was less than 1 mm. of the 13 neuromas depicted by mr imaging, three were visualized only on t1wi, while one was noted only on the cefs t1wi. accordingly, the neuromas detected on t1wi (12/13, 92%) outnumbered those on the contrast - enhanced images (10/13, 77%) (table 1). among the 20 neuromas (in 17 patients), 12 neuromas (12/20, 60%) were found in the third intermetatarsal space and the other eight neuromas (8/20, 40%) were in the second intermetatarsal space (table 1) upon operation. therapeutic success was assessed at the post - operative 2-month follow - up in 13 patients because four patients who underwent excision were unfortunately lost during follow up. eleven out of the 13 patients (11/13, 85%) had near complete relief from pain, two (2/13, 15%) had moderate improvement with some remaining pain, and none of the patients became worse. complete relief or marked improvement of the pain was seen in six patients (6/7, 86%) treated by excision and in five patients (5/6, 83%) treated by neurolysis (table 1). among the confirmed 20 morton neuromas (in 17 patients), us was performed for 14 neuromas (11 patients), mri was performed for 17 neuromas (15 patients), and both us and mri were performed for 11 neuromas (9 patients). the typical appearance of morton neuroma on the us and mr images is shown in figure 1. us depicted 11 out of 14 neuromas correctly, but the remaining three neuromas were not detected. hence, the detection rate of us was 79% (11/14). on the other hand, mri detected 13 out of 17 neuromas correctly, but the remaining four neuromas were not detected. hence, the detection rate of mri for morton neuroma was 76% (13/17). figure 2 shows the true positive and false negative lesions in the patients who underwent both us and mr imaging. us demonstrated a mass in only the third intermetatarsal space, while the mr imaging revealed a mass in only the second intermetatarsal space. three patients had false negative results on the us imaging analysis, and four patients had false negative results on the mri analysis (table 1). among them, five patients underwent neurolysis and only one patient underwent excision. figure 3 shows the case confirmed by excision and pathologically proven, but it was false negative on mr. on us, the mean size of the measured neuromas was 4.9 1.45 mm (range : 4 - 9 mm). on mri, the mean size of the neuroma was 5.1 1.32 mm (range : 3 - 8 mm). most of the neuromas were 5 mm or less (10 of the 14 neuromas [71% ] detected on us and 10 of the 17 neuromas [59% ] detected on mri). the maximum difference in size for the same masses measured by us and mr imaging was less than 1 mm. of the 13 neuromas depicted by mr imaging, three were visualized only on t1wi, while one was noted only on the cefs t1wi. accordingly, the neuromas detected on t1wi (12/13, 92%) outnumbered those on the contrast - enhanced images (10/13, 77%) (table 1). morton neuroma was first described by thomas morton in 1876 as " a peculiar and painful affection of the fourth metatarsophalangeal articulation " (17). however, subsequent studies have shown that the third and second spaces are the more common sites for neuroma (5). our study has also demonstrated that the third space is the most common site of involvement. it is generally accepted that the development of morton neuroma may be induced by repetitive compression of the plantar nerve against the deep transverse intermetatarsal ligament, with subsequent perineural fibrosis (18). a tentative diagnosis of morton neuroma can be made at the time of clinical assessment, but imaging correlation is required for the exact localization of neuroma and for the detection of multiple lesions, and especially when the clinical findings are indeterminate. this can prevent patients from undergoing rather avoidable surgical exploration at the wrong sites, which may lead to inadvertent complications (5, 17). in addition, other causes of metatarsalgia can also be excluded via imaging modalities. the possible clinical differential diagnoses that can cause metatarsalgia include intermetatarsal bursitis, stress fractures, necrosis of the sesamoid bones, synovitis of the metatarsophalangeal joint, infection and true neoplasm (3, 8). these include intermetatarsal bursitis, ganglion cyst, synovial cyst, giant cell tumor (gct) of the adjacent tendon sheath, fibromatosis, nodular fasciitis, pigmented villonodular synovitis and physiologic fluid distention of the intermetatarsal bursa when examining by using us and mri (4, 17). an investigation using us suggested that if a mass in the interdigital space is greater than 20 mm in length, then it is an abnormality other than neuroma such as a ganglion cyst, a synovial cyst or a gct of the adjacent tendon sheath (17). several sonographic study results have disclosed a prospective sensitivity of 95 - 98% for morton neuromas and a retrospective sensitivity of up to 100% (5, 6, 9). however, a recent study by quinn. (17) revealed that 85% of neuromas with an average width of 6 mm, an average height of 9 mm and an average length of 13 mm were identified prospectively. analysis by us in our study showed a relatively low detection rate (79%) of morton neuroma. sonography is a very operator - dependent technique, for instance, the sonographer 's experience is quite important, and so erroneous detection does factor into us examinations. the size of the morton neuroma is considered as another factor contributing to the variability of detection. the diameter of the normal plantar digital nerve is 1 - 2 mm at the level of the intermetatarsal heads and the normal nerve is not readily identifiable on sonography (5, 9). in our study, the mean sizes of the masses were 4.9 mm with using us and 5.1 mm with using mri, and these values were smaller than those reported in a previous study (6.5 mm for us and 7.4 mm for mri) (11). mr imaging is a highly sensitive modality (87%) for the detection of morton neuroma (1). our mr imaging evaluation (detection rate : 76%) did not show a better detection result than that expected at the beginning of the study. two neuromas were as small as 4 mm in transverse diameter (one of these is the case presented in figure 2). that these lesions were missed was possibly due to their smaller size, and it was possibly due to the surgeon 's subjective diagnosis in the cases of surgical neurolysis in our study. we should again consider the matter of the lesions ' size. in our study, most of the neuromas that were operated upon were 5 mm or less. there was no lesion less than 3 mm detected by either the us or mri modalities. in this aspect, the size of the lesions that were operated in our study was relatively smaller as compared with previous studies (1, 3, 7, 17). the measurement of morton neuroma on the transverse mr image is dependent on the placement of the foot in the scanner. in addition, the size of the morton neuroma is significantly larger in the prone position with plantar flexion of the ankle than in the supine and upright weight - bearing positions, in which the ankle is dorsiflexed (15). our study was done with the foot placed in the supine position, which possibly caused a decreased diameter of the neuroma, although plantar flexion was applied to the ankle. the transverse diameter can be affected by the patient 's position or by the compression pressure during sonography. previous studies have demonstrated that neuromas larger than 5 mm in diameter are more symptomatic than the smaller ones (3, 5, 6). (7) showed that a more favorable clinical outcome can be expected after surgical intermetatarsal neurectomy when a morton neuroma has a transverse measurement larger than 5 mm on mri scans ; 77% of the patients in that study had a good outcome when the neuroma was greater than 5 mm, compared with only 17% of the patients had a good outcome when their neuromas measured 5 mm or less. (11) demonstrated that symptoms were not dependent on the size of the neuroma. moreover, the mr imaging diagnosis of morton neuroma does not always imply symptomatology ; thus, careful correlation between the clinical and mr imaging findings is mandatory (4). the fluid distention of the intermetatarsal bursa may mimic that of neuromas, but it may not manifest symptoms and it is typically less than 3 mm in transverse dimension (3). there are different opinions regarding the best mr imaging sequences for detecting morton neuroma (12, 15, 16). erickson. (16) reported that t1wi was the most useful sequence because neuromas with decreased signal intensity were well demarcated from the adjacent fat tissue. on the other hand, zanetti. (3) suggested that t2wi was beneficial in order to exclude other diseases that mimic neuroma, such as intermetatarsal bursitis, because the latter revealed high signal intensities. terk. (12) stressed that sequences with fat - suppression and contrast - enhancement were reliable sequences for showing high - contrast images, and their study revealed that t1wi alone failed to demonstrate the presence of 50% (3 of 6) of the neuromas. in our study, the t1wi revealed better results for the detection of morton neuroma than the cefs t1wi did. in particular, the rarely enhanced neuroma cases shown in figures 1 and 3 were better discriminated on t1wi than on cefs t1wi. however, the opposite was also true in figure 2 when the neuroma was well enhanced. we think that cefs t2wi is not obligatory for the purpose of detection alone, although it can be necessary for differentiation of neuroma from other possible lesions. the falsepositive and true - negative rates could not be obtained because our study group consisted of only surgically proven morton neuromas (including cases of neurolysis that might have been related to the surgeon 's subjectivity). in addition, performing surgical exploration in the asymptomatic intermetatarsal spaces in clinical settings is not ethically possible whether or not a suspected morton neuroma is found on imaging studies. the second limitation is the retrospective analysis of the us findings, is that, sonography is an operator - dependent method. the third limitation is that the double lesions in one patient were not separately evaluated in the clinical outcome. in summary, us and mr imaging are compatible modalities for the evaluation of morton neuroma, and both modalities have relatively high detection rates. both imaging studies can provide information on the location and size of the neuroma prior to surgery. in addition, the contrast enhanced sequence does not seem essential for the detection of neuroma. | objectivethe purpose of this study was to compare the diagnostic accuracy of both ultrasonography (us) and magnetic resonance imaging (mri) for the assessment of morton neuroma.materials and methodsour study group was comprised of 20 neuromas from 17 patients, and the neuromas were confirmed on surgery following evaluation with us, mri, or both us and mri. the diagnostic criterion for morton neuroma, as examined by us, was the presence of a round or ovoid, well - defined, hypoechoic mass. the diagnostic criterion, based on mr imaging, was a well defined mass with intermediate to low signal intensity on both the t1- and t2-weighted images. the retrospective comparison between the sonographic and mr images was done by two experienced radiologists working in consensus with the surgical and pathologic correlations.resultsthe detection rate of morton neuroma was 79% for 14 neuromas from 11 patients who had undergone us followed by an operation. the detection rate was 76% for 17 neuromas from 15 patients who had undergone mri and a subsequent operation. the mean size of the examined neuromas was 4.9 mm on the us images and it was 5.1 mm on the mri studies. ten neuromas (71%) were 5 mm or less as measured by us, and three neuromas were not detected, whereas on the mri analysis, 10 neuromas (59%) were 5 mm or less and four neuromas were not visualized. among the patients examined during postoperative follow - up, symptoms were completely relieved in 85% and the symptoms were partially relieved in 15%.conclusionus and mr imaging are comparable modalities with high detection rate for the evaluation of morton neuroma. |
the important strategy in the prevention of dental caries is by increasing the acid resistance capacity of enamel. fluoride application and carbon - dioxide (co2) laser have shown a reasonable success to enhance enamel 's resistance to acid attack in the prevention of dental caries. the anti - cariogenic effect of professional fluoride application depends on reaction products formed on enamel during the clinical treatment and their retention over time after the application. professional acidulated phosphate fluoride (apf) application is a well - known method used for dental caries prevention and its efficacy is clearly recognized on an evidence - based perspective. different types of lasers, such as ruby, co2, neodymium : yttrium - aluminum - garnet (yag) and argon with different operational modes and energy outputs have been used to investigate the possibility of dental caries prevention. esteves - oliveira. has shown that co2 laser was able to decrease the enamel caries progression by causing surface and subsurface thermal changes. pulsed co2 laser irradiation of enamel caused marked surface fusion and inhibited the progress of subsurface caries - like lesions by as much as 50%. propolis is a resinous wax - like material that is used by the bees as a glue - like matrix in their hives. it has been reported to bear antibacterial activity that may be of benefit in combating dental caries. studies on propolis applications have increased because of its therapeutic and biological properties. a comparative evaluation of these topical agents in conjunction with co2 laser was not reported. this study aimed to evaluate the surface and mineral changes on enamel before and after the application of apf gel, fluoride enhanced hydroxyapatite gel and propolis in conjunction with co2 laser using high resolution - scanning electron microscopy (hr - sem) and energy dispersion x - ray spectrometry. northrup way, bellevue, wa 98004, u.s.a.) used in this study contains 1.23% f (as sodium fluoride and hydrogen fluoride (hf), phosphoric acid and carboxymethyl cellulose as the gelling base. fluoride enhanced hydroxyapatite gel (remin - pro, voco gmbh cuxhaven, germany) used in this study contains hydroxyapatite, fluoride (1.450 ppm sodium fluoride) and xylitol. propolis (nature 's answer, hauppauge, ny 11788 - 3943), which was an alcohol free extract from the herb apis mellifera was used in this study. roots were resected and the crowns were washed in distilled water and stored in saline at the room temperature. group 2 (n = 10) : topical fluoride application followed by co2 laser irradiation. for co2 laser irradiation, a device fabricated with orthodontic wire was fixed to the laser tip such that a distance of 4 mm from the tip of the hand piece to the specimen was maintained during the irradiation. laser irradiation was carried out by a pulsed co2 laser (sunny surgical laser, model number - pc015c ; shanghai, china) at 10.6 m wavelength with the following parameters : 0.5 w, 50 s pulse duration, 1 hz repetition rate and a 0.8 mm beam diameter. the co2 laser, with an emission wavelength of 10.6 m, which is very close to the phosphate and carbonate absorption bands of dental enamel apatite, is absorbed more efficiently by dental enamel. furthermore, co2 laser at 4 w continuous wave for 15 s caused a pulpal temperature raise of 3.5 - 4.1c. at this temperature no irreversible thermal damage to the pulp will occur. in this study, only 0.5 w with 50 s pulse duration was used, which further reduces the observed pulpal temperature rise. group 3 (n = 10) : co2 laser irradiation followed by topical fluoride application. group 4 (n = 10) : co2 laser irradiation before and after topical fluoride application. the 10 crowns in each group was again sectioned into four equal parts using a diamond disc, such that it had mesio - incisal, disto - incisal, mesial - cervical and distocervical sections with dimensions of approximately 3 mm 3 mm 4 mm, rendering 40 samples in each group. subgroup c ([n = 10 ] disto - cervical half) ] : control group (untreated enamel surface). subgroup a ([n = 10 ] mesio - cervical half) ] : a single application of apf gel was made on the labial surface of the specimen with a microbrush for 1 min. subgroup r ([n = 10 ] mesio - incisal half) ] : a single application with fluoride - enhanced hydroxyapatite gel (remin - pro) was done on the labial surface of the specimen with a microbrush for 1 min. subgroup p ([n = 10 ] disto - incisal half) ] : treatment with propolis was done. all the specimens were then immersed in artificial saliva for 21 h. the surface morphology of the test samples was analyzed by sem analysis (sem, jeol model jse 5610-lv) and mineral changes by energy dispersion x - ray spectrophotometer (quanta series esem, quanta 200 netherland, fei company, philips) where the following parameters were analyzed ; total mineral content (tmc), calcium - phosphate ratio and the mean fluoride retention. two samples from each group were selected randomly for surface evaluation using sem energy dispersive x - ray analysis was used to determine calcium, phosphate and fluoride content in weight %. the principle of energy dispersive x - ray (edax) analysis is based on the energy emitted in the form of x - ray photons where the electrons from external sources hit the atoms in a material, thus generating characteristic x - rays of the element. when the sample is bombarded by the electron beam of the sem, electrons are ejected from the atoms on the specimen 's surface (secondary electrons). a resulting electron vacancy is filled by an electron from higher shell and an x - ray is emitted (characteristic x - rays) to balance the energy difference between the two electrons. the edax x - ray detector measures the number of emitted x - rays their energy. the energy of the x - ray is characteristic of the element from, which the x - ray was emitted. a spectrum of the energy versus relative counts of the detected x - rays obtained and evaluated for qualitative and quantitative determinations of the elements present in the specimen using a computer based program. the results were tabulated and statistically analyzed using the statistical package for social sciences (spss software version 10.5 chicago, usa). post hoc multiple comparison least significant difference (lsd) lattice was used to identify the significant groups. northrup way, bellevue, wa 98004, u.s.a.) used in this study contains 1.23% f (as sodium fluoride and hydrogen fluoride (hf), phosphoric acid and carboxymethyl cellulose as the gelling base. fluoride enhanced hydroxyapatite gel (remin - pro, voco gmbh cuxhaven, germany) used in this study contains hydroxyapatite, fluoride (1.450 ppm sodium fluoride) and xylitol. propolis (nature 's answer, hauppauge, ny 11788 - 3943), which was an alcohol free extract from the herb apis mellifera was used in this study. roots were resected and the crowns were washed in distilled water and stored in saline at the room temperature. group 2 (n = 10) : topical fluoride application followed by co2 laser irradiation. for co2 laser irradiation, a device fabricated with orthodontic wire was fixed to the laser tip such that a distance of 4 mm from the tip of the hand piece to the specimen was maintained during the irradiation. laser irradiation was carried out by a pulsed co2 laser (sunny surgical laser, model number - pc015c ; shanghai, china) at 10.6 m wavelength with the following parameters : 0.5 w, 50 s pulse duration, 1 hz repetition rate and a 0.8 mm beam diameter. the co2 laser, with an emission wavelength of 10.6 m, which is very close to the phosphate and carbonate absorption bands of dental enamel apatite, is absorbed more efficiently by dental enamel. furthermore, co2 laser at 4 w continuous wave for 15 s caused a pulpal temperature raise of 3.5 - 4.1c. at this temperature no irreversible thermal damage to the pulp will occur. in this study, only 0.5 w with 50 s pulse duration was used, which further reduces the observed pulpal temperature rise. group 3 (n = 10) : co2 laser irradiation followed by topical fluoride application. group 4 (n = 10) : co2 laser irradiation before and after topical fluoride application. the 10 crowns in each group was again sectioned into four equal parts using a diamond disc, such that it had mesio - incisal, disto - incisal, mesial - cervical and distocervical sections with dimensions of approximately 3 mm 3 mm 4 mm, rendering 40 samples in each group. subgroup c ([n = 10 ] disto - cervical half) ] : control group (untreated enamel surface). subgroup a ([n = 10 ] mesio - cervical half) ] : a single application of apf gel was made on the labial surface of the specimen with a microbrush for 1 min. subgroup r ([n = 10 ] mesio - incisal half) ] : a single application with fluoride - enhanced hydroxyapatite gel (remin - pro) was done on the labial surface of the specimen with a microbrush for 1 min. subgroup p ([n = 10 ] disto - incisal half) ] : treatment with propolis was done. all the specimens were then immersed in artificial saliva for 21 h. the surface morphology of the test samples was analyzed by sem analysis (sem, jeol model jse 5610-lv) and mineral changes by energy dispersion x - ray spectrophotometer (quanta series esem, quanta 200 netherland, fei company, philips) where the following parameters were analyzed ; total mineral content (tmc), calcium - phosphate ratio and the mean fluoride retention. two samples from each group were selected randomly for surface evaluation using sem energy dispersive x - ray analysis was used to determine calcium, phosphate and fluoride content in weight %. the principle of energy dispersive x - ray (edax) analysis is based on the energy emitted in the form of x - ray photons where the electrons from external sources hit the atoms in a material, thus generating characteristic x - rays of the element. when the sample is bombarded by the electron beam of the sem, electrons are ejected from the atoms on the specimen 's surface (secondary electrons). a resulting electron vacancy is filled by an electron from higher shell and an x - ray is emitted (characteristic x - rays) to balance the energy difference between the two electrons. the edax x - ray detector measures the number of emitted x - rays their energy. the energy of the x - ray is characteristic of the element from, which the x - ray was emitted. a spectrum of the energy versus relative counts of the detected x - rays obtained and evaluated for qualitative and quantitative determinations of the elements present in the specimen using a computer based program. the results were tabulated and statistically analyzed using the statistical package for social sciences (spss software version 10.5 chicago, usa). post hoc multiple comparison least significant difference (lsd) lattice was used to identify the significant groups. tmc was seen maximum in 4a (127.74 2.76) where laser irradiation was performed followed by the application of apf gel, which was again irradiated, when compared with all the other groups. fluoride retention was seen maximum in group 2a where the application of apf gel was followed by laser irradiation when compared with all other groups. the current study investigated the beneficial effects when enamel surfaces were wetted with a topical demineralizing agent before and after they were laser - irradiated. laser treatment in combination with fluoride application appears to have several advantages over fluoride application alone. following the co2 laser irradiation, the f - veneer layer on the surface along with the superficial layer of enamel surface is thermally melted, resulting in recrystallization and rearrangement of a new fluorapatite (fap) mineral. this firmly bound fluoride minimizes the mineral loss from the enamel surface thereby making it more resistant to acid attack. the results of our study have been discussed under subheadings of tmc, calcium / phosphate ratio and fluoride retention., there was no significant difference in tmc between apf (1a) and remin - pro (1r). apf gel contains 1.23% fluoride (12,300 ppm, as sodium fluoride and hf), phosphoric acid and carboxymethyl cellulose as the gelling base. the phosphoric acid, which has an acidic ph of 3.5 partly, dissolves the enamel surface. this creates a microporous surface for better penetration of fluoride into the enamel surface to form caf2. the etching pattern of apf was confirmed by the hr - sem images [figure 1 ]. hydroxyapatite and fluoride (1,450 ppm sodium fluoride) present in remin - pro may have contributed to the increase in the tmc when compared with groups 1p and 1c. comparison of mean tmc between different groups high resolution - scanning electron microscopic pictures of group 1 at 1.00 k magnification in group 2, there is a significant increase in tmc in group 2a when compared with 2r. this may be due to the presence of 0.5% phosphoric acid in apf gel, which etches the enamel surface resulting in more penetration of fluoride ions when compared to remin - pro. both groups 2a and 2r (application followed by co2 lasing) showed significant increase in tmc as compared with groups 1a and 1r respectively. this might be due to the increase in fluoride retention by transformation of hydroxyapatite crystals to fluorapatite. the above mentioned mechanism may be the reason for this marginal increase in the tmc. in group 3, group 3a (irradiation followed by apf application) showed a significant increase in tmc when compared to groups 3r, 3p and 3c. the probable reason may be the higher fluoride content (12,300 ppm) in apf as compared with 1,450 ppm fluoride in remin - pro. similarly, 3a and 3r showed a significant increase in tmc as compared to 3p and 3c. group 3a and 3r showed a significant reduction in tmc when compared with groups 2a and 2r respectively. this might be due to the lack of retention of topical agents after co2 laser irradiation. superficially located minerals may be lost by back exchange, back diffusion and migration from the enamel surface to the surrounding tissue fluid / saliva. an increase in mineral content was seen when co2 laser irradiation was done before and after the application of the topical agents. groups 4a, 4r and 4p showed the highest mineral content compared to all the other groups, which can be attributed to the multiple thermal effects caused by the laser. mrquez. in 1993 explained that 30% of the carbonate is lost between 400 and 600c and it is completely removed only after repeated irradiation beyond the melting temperature of the enamel itself (more than 800c). the complete removal of the carbonate derives both from the absorption depth of the surface and from pulse intensity and duration. so, a multiple irradiation before and after the application of topical gels might have led to the complete removal of carbonate, thereby incorporating fluoride into the enamel. table 2 shows the comparison of mean calcium / phosphate ratio between different groups. calcium / phosphate ratio was highest for the remin - pro treated groups when compared with all other groups the least calcium / phosphate ratio for group 1p can be explained by the absence of minerals present in propolis. lee. in 2004 reported that there is no significant difference between non - irradiated and irradiated enamel surface in calcium / phosphate ratio when erbium yag laser was used. however, in the present study, the increase in calcium / phosphate ratio for groups 1r, 3r and 4r might be due to the presence of hydroxyapatite crystals in remin - pro. comparison of mean calcium / phosphate ratio between different groups table 3 shows the comparison of mean fluoride retention between different groups. though, the fluoride content of apf is much higher than remin - pro there was no significant difference between group 1a and 1r. this may be due to the loss of fluoride by back exchange, back diffusion and migration when stored in artificial saliva. previous studies have shown high uptake of fluoride ions from apf gel compared with a neutral gel. depth of penetration for fluoride ion was found to be 54 m with apf as compared to 36.6 m with neutral gel. when this enamel is irradiated by laser it enhances fluoride uptake into the crystalline structure of the enamel in the form of firmly bound fluoride. hence, the mineral loss from the enamel surface is minimized resulting in significant increase in fluoride retention with group 2a when compared with group 2r. comparison of mean fluoride retention between different groups as the solubility of the crystals decreases with their increasing size, caf2 particles occurring as a result of apf application will dissolve slower than those of sodium fluoride application. topical fluoride application increases the amount of caf2 deposited on the enamel surface at low ph. this accounts for the increase of fluoride in group 3a when compared to group 3r. the loss of ions by back exchange, back diffusion and migration when immersed in artificial saliva might be the reason for decreased fluoride intake in group 3a and 3r when compared with group 2a and 2r respectively. a multiple irradiation before and after the application of topical gels probably led to the complete removal of carbonate, thereby incorporating the fluoride from apf into apatite lattice, transforming hydroxyapatite into fluorapatite. the increased fluoride retention in group 4a when compared with group 4r can be due to the depth of penetration of fluoride in apf gel as explained before. the melted and fused enamel surface could have decreased the penetration of apf gel owing to the decreased retention in group 3a when compared to group 4a. all the hr - sem images of the control group showed normal surface morphology of enamel. in figure 1a and p, etching of enamel is seen with probable deposits of caf2 on surface. figure 1r presents a relatively smooth surface when compared with 1a and 1p with surface deposits of caf2. in figure 2a, irregular surface is seen due to the formation of craters with deposits of caf2. however/, in figure 2r, fewer craters are evident with a smoother surface differentiating them. craters are differentiated from each other by smooth surface morphology. in figure 3p, there is no evidence of crater formation. large and closely packed craters with no surface deposits of caf2 are seen in figure 4a. closely packed craters resembling an island surrounded by a sea of smooth surface is noticed in figure 4r. however, in 4p, less number of craters is noticed with surface deposits present on the irregular surface. the entire laser irradiated groups revealed melting and fusion with the formation of craters on the enamel surface. the etched enamel prisms were filled with caf2 particles where co2 laser was combined with the topical agent. high resolution - scanning electron microscopic pictures of group 2 at 1.00 k magnification high resolution - scanning electron microscopic pictures of group 3 at 1.00 k magnification high resolution - scanning electron microscopic pictures of group 4 at 1.00 k magnification, there was no significant difference in tmc between apf (1a) and remin - pro (1r). apf gel contains 1.23% fluoride (12,300 ppm, as sodium fluoride and hf), phosphoric acid and carboxymethyl cellulose as the gelling base. the phosphoric acid, which has an acidic ph of 3.5 partly, dissolves the enamel surface. this creates a microporous surface for better penetration of fluoride into the enamel surface to form caf2. the etching pattern of apf was confirmed by the hr - sem images [figure 1 ]. hydroxyapatite and fluoride (1,450 ppm sodium fluoride) present in remin - pro may have contributed to the increase in the tmc when compared with groups 1p and 1c. comparison of mean tmc between different groups high resolution - scanning electron microscopic pictures of group 1 at 1.00 k magnification in group 2, there is a significant increase in tmc in group 2a when compared with 2r. this may be due to the presence of 0.5% phosphoric acid in apf gel, which etches the enamel surface resulting in more penetration of fluoride ions when compared to remin - pro. both groups 2a and 2r (application followed by co2 lasing) showed significant increase in tmc as compared with groups 1a and 1r respectively. this might be due to the increase in fluoride retention by transformation of hydroxyapatite crystals to fluorapatite. the above mentioned mechanism may be the reason for this marginal increase in the tmc. in group 3, group 3a (irradiation followed by apf application) showed a significant increase in tmc when compared to groups 3r, 3p and 3c. the probable reason may be the higher fluoride content (12,300 ppm) in apf as compared with 1,450 ppm fluoride in remin - pro. similarly, 3a and 3r showed a significant increase in tmc as compared to 3p and 3c. group 3a and 3r showed a significant reduction in tmc when compared with groups 2a and 2r respectively. this might be due to the lack of retention of topical agents after co2 laser irradiation. superficially located minerals may be lost by back exchange, back diffusion and migration from the enamel surface to the surrounding tissue fluid / saliva. an increase in mineral content was seen when co2 laser irradiation was done before and after the application of the topical agents. groups 4a, 4r and 4p showed the highest mineral content compared to all the other groups, which can be attributed to the multiple thermal effects caused by the laser. mrquez. in 1993 explained that 30% of the carbonate is lost between 400 and 600c and it is completely removed only after repeated irradiation beyond the melting temperature of the enamel itself (more than 800c). the complete removal of the carbonate derives both from the absorption depth of the surface and from pulse intensity and duration. so, a multiple irradiation before and after the application of topical gels might have led to the complete removal of carbonate, thereby incorporating fluoride into the enamel. table 2 shows the comparison of mean calcium / phosphate ratio between different groups. calcium / phosphate ratio was highest for the remin - pro treated groups when compared with all other groups the least calcium / phosphate ratio for group 1p can be explained by the absence of minerals present in propolis. lee. in 2004 reported that there is no significant difference between non - irradiated and irradiated enamel surface in calcium / phosphate ratio when erbium yag laser was used. however, in the present study, the increase in calcium / phosphate ratio for groups 1r, 3r and 4r might be due to the presence of hydroxyapatite crystals in remin - pro. though, the fluoride content of apf is much higher than remin - pro there was no significant difference between group 1a and 1r. this may be due to the loss of fluoride by back exchange, back diffusion and migration when stored in artificial saliva. previous studies have shown high uptake of fluoride ions from apf gel compared with a neutral gel. depth of penetration for fluoride ion was found to be 54 m with apf as compared to 36.6 m with neutral gel. when this enamel is irradiated by laser it enhances fluoride uptake into the crystalline structure of the enamel in the form of firmly bound fluoride. hence, the mineral loss from the enamel surface is minimized resulting in significant increase in fluoride retention with group 2a when compared with group 2r. comparison of mean fluoride retention between different groups as the solubility of the crystals decreases with their increasing size, caf2 particles occurring as a result of apf application will dissolve slower than those of sodium fluoride application. topical fluoride application increases the amount of caf2 deposited on the enamel surface at low ph. this accounts for the increase of fluoride in group 3a when compared to group 3r. the loss of ions by back exchange, back diffusion and migration when immersed in artificial saliva might be the reason for decreased fluoride intake in group 3a and 3r when compared with group 2a and 2r respectively. a multiple irradiation before and after the application of topical gels probably led to the complete removal of carbonate, thereby incorporating the fluoride from apf into apatite lattice, transforming hydroxyapatite into fluorapatite. the increased fluoride retention in group 4a when compared with group 4r can be due to the depth of penetration of fluoride in apf gel as explained before. the melted and fused enamel surface could have decreased the penetration of apf gel owing to the decreased retention in group 3a when compared to group 4a. all the hr - sem images of the control group showed normal surface morphology of enamel. in figure 1a and p, etching of enamel is seen with probable deposits of caf2 on surface. figure 1r presents a relatively smooth surface when compared with 1a and 1p with surface deposits of caf2. in figure 2a, irregular surface is seen due to the formation of craters with deposits of caf2. however/, in figure 2r, fewer craters are evident with a smoother surface differentiating them. craters are differentiated from each other by smooth surface morphology. in figure 3p, there is no evidence of crater formation. large and closely packed craters with no surface deposits of caf2 are seen in figure 4a. closely packed craters resembling an island surrounded by a sea of smooth surface is noticed in figure 4r. however, in 4p, less number of craters is noticed with surface deposits present on the irregular surface. the entire laser irradiated groups revealed melting and fusion with the formation of craters on the enamel surface. the etched enamel prisms were filled with caf2 particles where co2 laser was combined with the topical agent. high resolution - scanning electron microscopic pictures of group 2 at 1.00 k magnification high resolution - scanning electron microscopic pictures of group 3 at 1.00 k magnification high resolution - scanning electron microscopic pictures of group 4 at 1.00 within the limitations of this in - vitro study, it can be concluded that : tmc is increased in the specimen where the enamel was irradiated before and after apf gel applicationthere was an increase in calcium / phosphate ratio for specimens treated with remin - pro irrespective of the radiation protocolmaximum fluoride retention was seen in specimens where the application of apf gel was followed by laser irradiation when compared with all other groupsco2 laser irradiation, at 10.6 m, in combination with a single application of apf can increase the retention of fluoride by transforming hydroxyapatite crystals into fluorapatitethe sem images presented with craters on all the irradiated enamel surfaces. however, there was no evidence for an additional effect when the enamel was treated with apf alone. tmc is increased in the specimen where the enamel was irradiated before and after apf gel application there was an increase in calcium / phosphate ratio for specimens treated with remin - pro irrespective of the radiation protocol maximum fluoride retention was seen in specimens where the application of apf gel was followed by laser irradiation when compared with all other groups co2 laser irradiation, at 10.6 m, in combination with a single application of apf can increase the retention of fluoride by transforming hydroxyapatite crystals into fluorapatite the sem images presented with craters on all the irradiated enamel surfaces. however, there was no evidence for an additional effect when the enamel was treated with apf alone. | aim : the aim of this study was to evaluate the surface / mineral changes on enamel before and after the application of acidulated phosphate fluoride (apf) gel, fluoride enhanced hydroxyapatite gel and propolis in conjunction with carbon - dioxide (co2) laser.materials and methods : crowns of 40 human maxillary central incisors were collected and were divided into four groups of 10 each : topical fluoride application only, topical fluoride application followed by co2 laser irradiation, co2 laser irradiation followed by topical fluoride application and co2 laser irradiation before and after topical fluoride application. the 10 crowns in each group was again sectioned into four equal parts of mesio - incisal, disto - incisal, mesio - cervical and disto - cervical sections rendering 40 samples in each group. each group was again subdivided into four subgroups : subgroup c - untreated enamel surface (control). subgroup a - apf gel application, subgroup r - fluoride enhanced hydroxyapatite gel application and subgroup p - propolis application. the surface morphology of the test samples were analyzed by scanning electron microscopy and mineral changes by energy dispersion x - ray spectrophotometer.results:total mineral content is maximum in group 4a (co2 laser irradiation before and after apf gel application) and calcium / phosphate ratio is highest in group 4r (co2 laser irradiation before and after remin - pro application). group 2a (apf gel application followed by co2 laser irradiation) has the maximum fluoride retention.conclusion:laser irradiation of enamel through a topically applied apf gel is effective in the prophylaxis and management of dental caries. |
woolly hair nevus is a rare condition, characterized by unruly and tightly coiled hair, which is not genetically determined. a 5-year - old girl child presented with abnormal patch of hair since 2 years of age. her parents noticed a single patch of curling and coiling of hair along with altered texture over the left side of scalp. her parents felt the patch to be unruly and unsightly and hence attempted repeated tonsuring. in spite of this, we noticed a solitary circumscribed patch of size 64 cm located over the left frontoparietal region of scalp. the hair over the patch had an altered texture, was lighter in color, thinner, tightly coiled, and curled giving an unkempt appearance [figure 1 ]. based on the above findings, we arrived at a diagnosis of localized woolly hair nevus. a well - circumscribed patch of tightly coiled woolly hair hpe of scalp showing normal hair follicle and appendages woolly hair is characterized by tightly coiled hair occurring over the entire scalp or part of it in an individual of non - african origin. it is a nevoid condition characterized by a circumscribed patch of unruly and curled hair with an altered texture. this condition may be associated with melanocytic or epidermal nevi, mongolian spots elsewhere on the skin. ocular defects like persistent pupillary membrane, retinal defects, and precocious puberty have also been associated. woolly hair nevus is not associated with cardiac abnormalities as in carvajal or naxos disease in which desmoplakin and plakoglobin mutations are known to occur, respectively. our patient presented with an isolated woolly hair nevus without any associations, which has been reported very rarely. however, this patient must be followed up regularly to detect any cardiac defects which may present later. | woolly hair nevus is a rare non - hereditary focal condition characterized by unruly and tightly coiled hair. it can appear in childhood or adolescence and may be associated with epidermal or melanocytic nevus. patients presenting with woolly hair must be examined completely to rule out cardiofaciocutaneous and noonan syndrome. |
cl was diagnosed in patients as described elsewhere, according to characteristic lesion morphology, positive skin test results, seropositivity to leishmania antigen, and/or presence of parasites in the lesion. a total of 58 patients with lcl due to l. braziliensis (27 males ; mean age [sd ], 29.6 2.3 years) were recruited and treated in 2 outpatient clinics (jequi and jiquiri - ba, ne brazil) covering the same rural area. ten patients with lcl due to l. amazonensis (6 males ; mean age [sd ], 38.8 6 years) were recruited and treated at the professor edgar santos university hospital (salvador - ba, ne brazil). in addition, a paired sample was obtained from 13 patients at the time of definite clinical cure (range, 68417 days). patients with lcl (due to either l. braziliensis or l. amazonensis) received standard intravenous pentavalent antimony (glucantime ; rhodia, 20 mg / kg / day for 20 days). cure was defined by the complete scarring of lesions, without induration and relapse during 2 years of follow - up. although all l. amazonensis infected patients were cured within 90 days following a single treatment cycle, l. braziliensis infected patients needed a mean (sd) of 2.2 0.2 treatment cycles over 190.5 16.0 days to achieve cure, with treatment for 23 of 58 patients (39.7%) classified as failing (> 2 cycles). eight patients with dcl (3 males ; mean age [sd ], 31.5 7.1 years) infected with l. amazonensis were recruited and treated at the presidente dutra university hospital hupd (so lus - ma, ne brazil). patients with dcl had a mean disease duration (sd) of 10.9 2.1 years, during which several different therapeutic schemes (mean number [sd ] per patient, 2.7 0.9, including liposomal amphotericin b and combinations of glucantime, interferon, and pentamidine) were used, with no or only a transient clinical effect. since dcl is a rare clinical manifestation, no samples from untreated patients (at diagnosis) were available for comparison. sod1 plasma levels were quantified using a human sod1 enzyme - linked immunosorbent assay kit (calbiochem). rna was extracted from lesion biopsy specimens from patients with lcl and those with dcl, as well as skin biopsy specimens from healthy controls, using trizol, followed by an additional purification using rneasy (qiagen benelux, venlo, the netherlands). using in situ transcriptomics, we simultaneously quantified host and parasite rnas in lesion biopsy specimens from patients with lcl and those with dcl, as well as skin biopsy specimens from healthy controls, by ncounter technology (nanostring, seattle, wa), based on molecular bar coding of target rna transcripts and digital detection at the femtomolar range, using direct hybridization, without reverse transcription or amplification. human sod1, sod2, sod3, ifna1, ifna2, ifna4, ifnb1, and l. braziliensis and l. amazonensis sod1 - 5 messenger rna (mrna) levels were quantified in situ, in addition to mrnas of several housekeeping genes (gusb, g6pd, gapdh, and hprt1), for normalization, as well as leukocyte - specific genes (cd3, cd14, cd19, cd56, and cd45). briefly, monocyte - derived human macrophages were infected with l. amazonensis (mhom / br/87/ba125) and treated with sod1 (sigma) for 48 hours, followed by extensive washing, staining with hematoxylin / eosin, and counting of intracellular amastigotes (100 cells, with duplicate analysis for each sample). parametric and nonparametric tests were performed according to kolmogorov - smirnov test for normality. for multiple comparisons, the kruskal wallis test with the dunn posttest and 1-way analysis of variance with a posttest for linear trend were used. for comparison between 2 groups, the f test, the mann whitney u test, the t test, or the wilcoxon test was used. to identify biomarkers, receiver operating characteristic (roc) all tests were 2 tailed, and differences were considered significant at p values of 2 cycles) therapeutic response could be significantly discriminated through sod1 plasma levels (area under the roc curve, 0.83 ; p =.00025), authenticating its clinical utility as a biomarker (figure 1d). above a cutoff of 122 pg / ml, 9 of 22 patients (40.9%) in whom treatment was failing could be identified with 100% specificity (ie, 0 patients cured with 1 treatment cycle displayed sod1 levels of > 122 pg / ml). strikingly, at a similar cutoff of 112 pg / ml, patients with dcl could be discriminated from treatable patients with lcl (due to l. amazonensis) with 100% sensitivity and 90% specificity (area under the roc curve, 0.95 ; p =.001 ; figure 1b). figure 1.superoxide dismutase 1 (sod1) is a biomarker for therapeutic failure in cutaneous leishmaniasis. a, sod1 measurements in plasma samples from 20 healthy controls, 58 patients with localized cutaneous leishmaniasis (lcl) due to leishmania braziliensis), 10 patients with lcl due to leishmania amazonensis, and 8 patients with diffuse cutaneous leishmaniasis (dcl) due to l. amazonensis. wallis test ; and p 2 treatment cycles ; area under the receiving operating characteristic curve, 0.83 ; p =.00025, without outliers, as in panel c). superoxide dismutase 1 (sod1) is a biomarker for therapeutic failure in cutaneous leishmaniasis. a, sod1 measurements in plasma samples from 20 healthy controls, 58 patients with localized cutaneous leishmaniasis (lcl) due to leishmania braziliensis), 10 patients with lcl due to leishmania amazonensis, and 8 patients with diffuse cutaneous leishmaniasis (dcl) due to l. amazonensis. wallis test ; and p 2 treatment cycles ; area under the receiving operating characteristic curve, 0.83 ; p =.00025, without outliers, as in panel c). to test whether these high plasma sod1 levels in patients with cl might be directly related to an increased parasite burden, human macrophages from healthy donors were infected with l. amazonensis (5:1) and cultivated in the absence or presence of recombinant sod1 protein. as shown in figure 2a, sod1 treatment significantly increased parasite load (p =.042, by the t test). moreover, infected human macrophages treated with recombinant sod1 protein presented cytomorphological features (figure 2b) strikingly similar to the vacuolized and highly parasitized macrophages from cutaneous lesions of patients with dcl (figure 2c). figure 2.superoxide dismutase 1 (sod1) correlates to parasite burden in vitro and in situ in diffuse cutaneous leishmaniasis (dcl). a and b, human macrophages were infected with leishmania amazonensis (5:1 ratio) for 4 hours and then treated in the absence or presence of sod1 protein (175 u / ml) for 48 hours. a, parasite burden was quantified ; each bar represents the mean standard error of the mean for 3 donors (p =.042, by the t test). b, infected macrophages (1000 magnification) left untreated (left panel) or treated with sod1 (right panel). c, cutaneous lesion biopsy specimen from a representative patient with dcl stained with hematoxylin and eosin (1000 magnification). d, positive correlation between human sod1 and parasite sod2 (r = 0.98, p =.019) and sod4 (r = 0.99, p =.0026) messenger rna (mrna) levels (normalized to g6pd), quantified by ncounter in situ in biopsy specimens from patients with dcl (n = 4). superoxide dismutase 1 (sod1) correlates to parasite burden in vitro and in situ in diffuse cutaneous leishmaniasis (dcl). a and b, human macrophages were infected with leishmania amazonensis (5:1 ratio) for 4 hours and then treated in the absence or presence of sod1 protein (175 u / ml) for 48 hours. a, parasite burden was quantified ; each bar represents the mean standard error of the mean for 3 donors (p =.042, by the t test). b, infected macrophages (1000 magnification) left untreated (left panel) or treated with sod1 (right panel). c, cutaneous lesion biopsy specimen from a representative patient with dcl stained with hematoxylin and eosin (1000 magnification). d, positive correlation between human sod1 and parasite sod2 (r = 0.98, p =.019) and sod4 (r = 0.99, p =.0026) messenger rna (mrna) levels (normalized to g6pd), quantified by ncounter in situ in biopsy specimens from patients with dcl (n = 4). finally, using in situ transcriptomics (ncounter), we demonstrated a significant positive correlation between host sod1 mrna level and parasite sod2 (p =.019, r = 0.98) and sod4 (p =.0026, r = 0.99) mrna in dcl. taken together, these data suggest that systemic sod1 might play a causal role in both the clinical and anatomopathological phenotype of dcl. up to now, no noninvasive biomarker for therapeutic response to sb has been described in cl. in the present work, we demonstrate host sod1 as a biomarker for therapeutic failure of first - line sb in new world patients with cl. sod1 plasma levels could significantly discriminate between successful and failing therapeutic response in patients with lcl (due to l. braziliensis) and between treatable patients with lcl (due to l. amazonensis) and refractory patients with dcl. quantification of sod1 plasma level at diagnosis represents a rapid, sensitive, and inexpensive new tool in the clinical management of cl. further research will be necessary to test its predictive value in cl caused by other leishmania species, since in peru failure of antimonial therapy is significantly associated with infections due to l. braziliensis and leishmania peruviana but not with infection due to leishmania guyanensis. by identifying, at the time of diagnosis, up to 40.9% of patients (with 100% specificity) in whom antimonial therapy will fail (figure 1c), second - line treatment (eg, amphotericin b or miltefosine) could be provided as a first choice, thereby diminishing public health costs and avoiding unnecessary and prolonged exposure of the patients to the often severe side effects of intravenous pentavalent antimony therapy. although sod1 is an intracellular antioxidant enzyme, our results suggest a direct role for increased systemic (plasma) sod1 as a trigger of parasite replication in infected macrophages. elsewhere, treatment of infected human macrophages with purified sod1 in vitro led to strongly increased parasite burden and the appearance of large parasitophorous vacuoles, reminiscent of typical nodular lesions in dcl. moreover, this correlation between sod1 and parasite burden was recapitulated in situ in dcl lesions, as evidenced by a strong linear relationship (r = 0980.99) between host (human sod1) and parasite (l. amazonensis sod2 and sod4) sods. this parallel cross - regulation at the transcriptional level between superoxide - quenching enzymes that are hundreds of millions of years distant in evolution is a striking example of interkingdom signaling. to our knowledge, this is the first description of interkingdom signaling in protozoan - animal interaction. in keeping with our cytomorphological data (figure 2b), this phenomenon is highly specific for cytosolic sod1, since cross - kingdom correlations were not observed for mitochondrial sod2 or extracellular sod3 with any of the parasite mrnas. the extremely long (mean disease duration [sd ], 10.9 2.1 years) uncontrolled parasite replication in patients with dcl might have led to selection of sod - overexpressing parasite clones [7, 8 ]. alternatively, increased systemic levels of sod1 in patients with lcl and those with dcl might reflect a parasite escape mechanism from host leishmanicidal activity mediated by type i ifn, as suggested by our previous work and recently confirmed in murine and human macrophages. in agreement with this hypothesis, we found a significant positive correlation between sod1 mrna and total ifn-/ mrna levels, using in situ transcriptomics (ncounter ; supplementary figure 2a). finally, since all of our patients with dcl also experienced failure of multiple other treatment schemes (including pentamidine, amphotericin b, and ifn-, alone or in combination), an increased plasma sod1 level truly reflects broad therapeutic failure. the dramatic increase in dcl also reinforces the idea that sod1 is not a mere surrogate marker but a key molecule in dcl pathogenesis, driving perennial parasite replication and systemic dissemination, as suggested by figure 2a d. hence, sod1 is also a candidate therapeutic target in cl, reinforcing our previous suggestion of pharmacologic sod1 inhibition by detc as a viable therapeutic alternative in lcl and dcl in particular, for which no effective treatment options exist. in conclusion, our results indicate that host sod1 is a clinically useful biomarker for therapeutic failure, as well as a possible therapeutic target, in lcl and dcl. supplementary materials consist of data provided by the author that are published to benefit the reader. | we show that increased plasma superoxide dismutase 1 (sod1) levels are statistically significant predictors of the failure of pentavalent antimony treatment for cutaneous leishmaniasis caused by leishmania braziliensis. in leishmania amazonensis infected patients, host sod1 levels can be used to discriminate between localized and drug - resistant diffuse cutaneous leishmaniasis. using in situ transcriptomics (ncounter), we demonstrate a significant positive correlation between host sod1 and interferon / messenger rna (mrna) levels, as well as interkingdom correlation between host sod1 and parasite sod2/4 mrna levels. in human macrophages, in vitro treatment with sod1 increases the parasite burden and induces a diffuse cutaneous leishmaniasis like morphology. thus, sod1 is a clinically relevant biomarker and a therapeutic target in both localized and diffuse cutaneous leishmaniasis. |
kounis syndrome is the concurrence of acute coronary syndromes (acs) with conditions associated with mast cell activation including allergic or hypersensitivity as well as anaphylactic or anaphylactoid reaction.1)2) there have been a few reports on extraordinary causes other than wasp stings leading to a drug - eluting stent (des) thrombosis as a manifestation of kounis syndrome.3 - 6) as far as we knew, very late stent thrombosis (st) in a second - generation des following wasp stings has not yet been reported. we describe a case of very late st in an everolimus - eluting stent as a consequence of wasp stings and present the pathophysiology and clinical implications of this syndrome with a review of the literature. a 56-year old man was referred by an emergency physician to our hospital with an impression of st - segment elevation myocardial infarction (stemi). the patient was stung on the arm, neck and head several times by wasps while working on his field about 7 hours prior to admission. he had a mild allergic reaction involving local pain and urticarial swelling immediately after the incident without signs of anaphylaxis or shock. just a few minutes after being stung, he started complaining of chest pain and called the emergency service. his blood pressure was 120/80 mm hg, pulse rate was 90 beats per minute and electrocardiogram revealed st - segment elevation with q wave formation in the anterior leads and reciprocal st - segment depression in the inferior leads (fig. his troponin t level was elevated to 1.86 ng / ml. after being given intravenous dexamethasone and antihistamine, he had undergone an everolimus - eluting 3.515 mm stent placement (promus, boston scientific, mn, usa) in the mid - left anterior descending (lad) artery for stable angina 3 years prior in our hospital. clopidogrel (75 mg / d) was withdrawn 24 months after stent implantation, while aspirin (100 mg / d) had been continued until that day. coronary angiography demonstrated a thrombosis in the previous stent in the lad artery, completely occluding the vessel (fig. the lesion was crossed with a runthrough ns guidewire (terumo) and sequential inflations using nimbus pico (bard) 1.2512 mm, followed by 2.012 mm balloons to disperse the thrombus. next, thrombus aspiration with a thrombus aspiration catheter (thrombuster ii, kaneka corp. abciximab infusion was started, of which half of the initial bolus was given directly into the left coronary system. however, thrombolysis in myocardial infarction flow 3 was not established despite these measures. in the end, an everolimus - eluting 3.515 mm stent (promus element, boston scientific, mn we did not measure serum tryptase and histamine levels with a half life of 90 minutes and of less than 30 minutes respectively because 7 hours had passed after the onset of symptoms. he was discharged from the hospital 6 days after the index procedure with dual anti - platelet therapy (dapt). the patient is currently doing well and is being followed up in the outpatient department. stent thrombosis is the primary concern regarding long - term safety outcome in the current des era, which is a fatal complication that often leads to myocardial infarction or death. early st is likely due to clinical factors such as stemi, chronic kidney disease or premature discontinuation of clopidogrel and procedural issues such as stent malapposition, plaque protrusion or vessel dissection, while late or very late st is associated with late - acquired stent malapposition, delayed reendothelialization and neoatherosclerosis with plaque rupture.7) the occurrence of acs during the course of an allergic reaction constitutes kounis syndrome.1)2)8) st in des due to hypersensitivity reactions to components of des (metallic strut, impregnated drug and especially polymer) is known as type iii kounis syndrome.9)10) other types include patients with normal coronary arteries (type i) and patients with quiescent, pre - existing atheromatous disease (type ii). these include drugs (antibiotics, analgesics, non - steroidal anti - inflammatory drugs), conditions (asthma, food allergy, urticaria) or environmental exposures (hymenoptera and others stings, shellfish consumption, latex contact).1)2)8) myocardial infarction following hymenoptera stings (bees, wasps and hornets) is rare with less than twenty documented reports in the literature.11 - 14) furthermore, st in des leading to myocardial infarction secondary to wasp envenomation is much rarer and existing report was about first - generation des.15) to the best of our knowledge, this case is the first description of very late st in a second - generation des caused by wasp stings as a manifestation of kounis syndrome. although the exact mechanism of kounis syndrome is still under discussion, mast cell degranulation following an allergic insult is known to play a key role. chemical mediators released from mast cells such as histamine, neutral proteases (tryptase and chymase), platelet activating factors, cytokines, chemokines and metabolites of arachidonic acid (leukotrienes and thromboxane) have been incriminated to induce coronary artery spasm, to promote platelets aggregation, and to transform a pre - existing stable atheromatous plaque to a vulnerable plaque leading to rupture.2)6)9)11) other possible mechanisms involve : 1) the direct action of wasp venom constituents such as histamine and phospholipase a2,13) 2) the anaphylactic reaction itself with severe hypotension, and 3) adrenalin use which can induce coronary spasm and myocardial damage.16) our patient had previously undergone short and large - diameter (3.515 mm) stent implantation without underexpansion or dissection under non - acs conditions. the current guideline recommends at least 12 months of dapt after des implantation,17) and he had received dapt for 2 years and then aspirin until the day of admission. he developed chest pain just a few minutes after being stung by wasps, had no signs of anaphylaxis or shock and did not receive therapeutic adrenaline. based on these observations, it is reasonable that we can classify our patient as having kounis syndrome. in the present case, recent studies have shown that second - generation dess (everolimus - eluting or zotarolimuseluting stent) lead to more favorable healing profiles18) and are associated with lower rates of st compared with first - generation dess.19)20) in conclusion, kounis syndrome is an uncommon clinical entity, and its diagnosis is difficult to make owing to its variable manifestations. it is important for clinicians to keep this potential fatal scenario in mind while treating an allergic reaction associated with acute chest pain. | kounis syndrome is the concurrence of acute coronary syndromes with conditions associated with mast cell activation following an allergic insult. we report a 56-year - old man who experienced a st - segment elevation myocardial infarction after wasp stings. the patient presented without signs of anaphylaxis or shock. coronary angiography showed an everolimus - eluting stent thrombosis (st) of the left anterior descending artery occluding the vessel completely which was deployed for stable angina 3 years ago. the patient had been compliant with anti - platelet therapy, and no relevant cardiovascular events occurred until the day of admission. we interpreted our patient 's condition as a manifestation of kounis syndrome. to our knowledge, this is the first case of kounis syndrome showing very late st in a second - generation drug - eluting stent caused by wasp stings. |
colorectal cancer is a common cancer form in sweden and the incidence is slowly increasing.1 there is a known risk that a patient can have a second coexisting colorectal cancer.2 thus, most treatment guidelines include some type of colon examination in the preoperative work - up to provide the information and enable an optimizing the surgical procedure.3 this is performed parallel to the staging procedure which is aimed at identifying metastatic presence and thus for the strategic therapeutic decisions.4 a failure in attaining a full bowel exam could mean a risk of not attaining radical surgery or even fatally delaying the finding and treatment of the second cancer. the term synchronous cancer (sc) is used when there was more than one cancer at the same time. each tumor should also have a separate and definite picture of malignancy and they should also be separated by macroscopically normal bowel wall. the risk of sc in colorectal cancer has been reported at 2%3%.2,5 some known risk factors such as familiar polyposis and ulcerative colitis with dysplasia could increase the risk.6 some studies have also found an increased frequency of multiplicity in male patients.7,8 the term synchronous cancer should be distinguished from both metachronous cancer (mc) which occurs later and anastomotic recurrences by their location. the risk of developing a second and thus metachronous cancer has been reported as increased and a colon surveillance should thus be undertaken postoperatively.9,10 the influence by cancer multiplicity on the survival prognosis in colorectal cancer is less studied. most reports on this subject have not shown any significant survival difference between single and multiple colorectal cancers.1113 to our knowledge, no study has assessed any gender - related differences in prognosis with multiple cancers. still, there are several reported findings regarding the difference in prognosis between male and female patients with single tumor colorectal cancer.14,15 the aim of the study was to assess the influence of tumor multiplicity on prognosis in colorectal cancer. secondary aims were to identify associated prognostic factors and possible gender difference in survival after multiple cancers. the study was a retrospective analysis of all patients surgically treated for a colorectal adenocarcinoma during 19992008 (n = 2524) at a single centre university hospital. patient characteristics like gender and age were retrieved along with pathology data (location of tumor, stage, lymph nodes, grading and possible tumor multiplicity). both synchronous and metachronous the 5th edition of the tnm classification was used for tumor staging purpose during the period.16 for the patients having multiple tumors, the one with the most advanced tumor stage was recorded and considered as main tumor for the study. for multiple tumors was the differentiation of main lesion used in the study. the outcome parameters used was overall survival (os) and cancer specific survival (css). statistical tests performed included chi - square, independent - samples t - test or anova. all parametric tests showing statistical significance were also controlled with non - parametric methods due to the size of the sc cohort. survival was assessed by kaplan meier and comparisons between groups by log - rank test. a cox proportional hazard analysis was performed for css both overall and in the sc cohort including prognostic factors significant in univariate survival analysis. statistical analyses were performed using jmp 8.0 software (sas inc., cary, nc, usa). statistical tests performed included chi - square, independent - samples t - test or anova. all parametric tests showing statistical significance were also controlled with non - parametric methods due to the size of the sc cohort. survival was assessed by kaplan meier and comparisons between groups by log - rank test. a cox proportional hazard analysis was performed for css both overall and in the sc cohort including prognostic factors significant in univariate survival analysis. of the 2524 assessed patients, 2464 (97.6%) had a single tumor and 60 (2.4%) had a second, synchronous, tumor. the patients with sc cancers were significantly older than the single carcinoma patients (p < 0.026). the postoperative hospital stay was also longer (p < 0.0047) due to more extensive surgical procedures. there was no difference in differentiation grade, t - stage or n - stage. with sc it was more likely to have a cancer located in the right colon compared to single tumor location frequency (p < 0.001). sc was associated to more assessed lymph nodes (p < 0.001) as the resections were more extensive. there was no difference in stage distribution (p < 0.07) even though advanced disease (stage iii and iv) was less frequent in the sc group (42% vs. 52%, relative risk 0.67). the stage of the second tumor was significantly associated to the main tumor (p < 0.001). there were no significant gender related differences in characteristics or tumor pathology in the sc group. there was no difference in survival regarding multiplicity for the entire cohort (p < 0.2). females with sc had better survival than corresponding males in both os (p < 0.036) and css (p < 0.046), shown in figure 1. gender was significant within the sc cohort also in multivariate analysis (p < 0.035). of the 2524 assessed patients, 2464 (97.6%) had a single tumor and 60 (2.4%) had a second, synchronous, tumor. the patients with sc cancers were significantly older than the single carcinoma patients (p < 0.026). the postoperative hospital stay was also longer (p < 0.0047) due to more extensive surgical procedures. there was no difference in differentiation grade, t - stage or n - stage. with sc it was more likely to have a cancer located in the right colon compared to single tumor location frequency (p < 0.001). sc was associated to more assessed lymph nodes (p < 0.001) as the resections were more extensive. there was no difference in stage distribution (p < 0.07) even though advanced disease (stage iii and iv) was less frequent in the sc group (42% vs. 52%, relative risk 0.67). the stage of the second tumor was significantly associated to the main tumor (p < 0.001). there were no significant gender related differences in characteristics or tumor pathology in the sc group. there was no difference in survival regarding multiplicity for the entire cohort (p < 0.2). females with sc had better survival than corresponding males in both os (p < 0.036) and css (p < 0.046), shown in figure 1. gender was significant within the sc cohort also in multivariate analysis (p < 0.035). the term of multiple colorectal carcinomas commonly include both synchronous (sc) and metachronous (mc) tumors. an important difference is the time frame where sc means coexisting cancers and mc a second and thus later developed cancer. the incidence in our material of 2.4% and 1.5% respectively concur with previous findings.2,5 despite the low incidence, they can constitute a clinical challenge as they need to be identified to provide an optimal cancer treatment. the consequence is the need of both a preoperative colon exam to find a possible sc and the postoperative surveillance for mc or anastomotic recurrences. the risk of having a second tumor located in the right colon was high in this material (p < 0.001). thus is a full colonic examination, by radiology or endonoscopy, necessary to negate the presence of a second cancer. there were more males in the sc group which is a characteristic that concur with previous findings7,8 although the difference did not reach statistical significance. hormone effects have been suggested as testosterone can affect the immune function negatively in men and female sex steroids could have a protective immune role in human colon tumors. estrogen and progesterone receptors in colorectal cancer messenger rnas coding has also been found.15 another characteristic of the sc group is the higher age of the group and foremost of the females. the significantly higher age in this sc material do also concur with other publications.2,17,18 as females normally have longer life - spans and thus at higher age constitute a higher proportion of the cancer patients it could have been expected to find a higher female representation in the sc cohort. this aspect could strengthen the hypothesis of a higher incidence for males as discussed above. there was no significant difference in survival between the single carcinomas and the sc cohort. the sc patients were more likely to be operated with more extensive resections and thus yielding higher lymph node assessment counts. having more than one cancer should hypothetically increase the risk of at least one providing node metastasis and thus higher rates of stage iii. however, this was not observed and the frequency of advanced disease (stage iii and iv) was even less in the sc group (42% vs. 52%). the absence of statistical difference between single and multiple carcinomas regarding mortality and survival has been previously described.11,12,19,20 the finding of a better survival, both os and css, for females in the sc cohort is interesting. there was no pathology or staging (table 2) differences between the genders which could explain the result. one possibility, often difficult to negate, could be a bias due to the longer life expectancy of a female. however, the finding also on css could suggest that there could be a survival difference. jass have suggested that colorectal cancer could be a summary of several different entities, each with its own characteristic.21,22 the theory involves diverse bio - molecular differences including in microsatellite instability (msi) which has been found to be significantly higher in multiple carcinomas.2325 interestingly, one group described by jass develops through serrated polyps rather than adenomas and can be associated to females and high msi.22 other associated findings such as alterations in gene methylation have been reported by wettergren and odin, suggesting that there are changes in the bowel mucosa also at longer distances away from the tumor.26,27 the findings could support a theory of extensive mucosal changes leading to development of multiple carcinomas. further studies on the bio - molecular properties of the tumors and mucosa could be of great interest. an alternate pathway of cancer development could then hypothetically results in different cancer characteristics and even prognosis. the low incidence of metachronous cancers could suggest that the bio - molecular changes in the mucosa discussed above are reversible. the study indicates that there could be a gender associated difference in the survival prognosis in synchronous colorectal cancer. as sc also is more common at higher age a possible underlying explanation could be an alternate pathway for tumor development. the patients in the study represent a consecutive, unselected material of which we have valid clinical data. in being a single centre study, they have all been assessed and treated along the same guidelines. whilst it is, to our knowledge, one of the larger single - centre materials on the subject there is a weakness in the rather small number of sc patients due to a low incidence. we did not further analyze survival and prognosis for the mc patients, which mainly is stage dependent for the second cancer as a mc prerequisite is a good survival from the first. mc and sc are, in our opinion, two separate entities and should thus be handled in analysis and evaluation. the incidence of synchronous cancers was 2.4% with the second cancer often located in right colon. the sc patients were older than single tumor patients, had a lower frequency of stage iii / iv disease and the females with sc had a better survival prognosis than corresponding males. | aim : to assess differences in demography, pathology and prognosis with tumor multiplicity in colorectal cancer.method:a retrospective single centre study of all patients surgically treated for a colorectal cancer during 19992008 (n = 2524). patient characteristics, pathology and follow - up data were retrieved. survival was assessed by overall and cancer specific survival.results:60 (2.4%) patients had a synchronous cancer (sc), associated with right colon, higher age, more assessed lymph nodes but a lower frequency of stage iii / iv disease (42% vs. 52%). there was no overall prognostic difference between single or multiple cancer patients but females with sc had better survival than corresponding males (p < 0.046).conclusion : the incidence of synchronous cancers was 2.4% with the second cancer often located in right colon. the sc patients were older than single tumor patients, had a lower frequency of stage iii / iv disease and the females with sc had a better survival prognosis than corresponding males. |
lactic acidosis (la) is known to occur in patients of leukemia and lymphoma as a terminal event. it was first described in patients with acute leukemia by field. in 1963. diagnostic criteria of la are ph less than 7.35 along with plasma lactate concentration greater than 5 mmol / l. however, la as the initial presentation of non - hodgkins lymphoma (nhl) is extremely rare. a 35-year - old male presented with intermittent fever, loss of appetite and fatigue of 5 months duration. he was afebrile with a pulse of 140/min, and a respiratory rate of 36/minute. pallor, pedal edema along with right cervical lymphadenopathy was present. on systemic examination a firm mass of 10 cm hemoglobin was 5.1 gm / dl, wbc 9200/cu mm, platelet count 2,72,000/cu mm ; renal and liver functions were normal with serum (sr) urea 37 mg / dl, sr creatnine 0.7 mg / dl, sr bilirubin 0.5 mg / dl, sr sgot 52 units / l, sr sgpt his sr ldh was raised with a value of 876 iu / l and sr albumin was markedly low 1.8 gm / dl. blood gas analysis showed ph 7.17, pco2 23 mmhg, hco3 8.4mmol / l, serum lactate 12.7 mmol / l, suggestive of metabolic acidosis [table 1 ]. computerized tomography (ct) scan showed dilated small bowel loops with mural thickening along with the presence of homogenous mesenteric and retroperitoneal masses measuring about 7 cm along with mediastinal lymph nodes. a biopsy of the abdominal lymph node revealed nhl (subtype dlbcl), immunohistochemistry of tumor was positive for cd20 and negative for cd3 and cd10. bone marrow was not involved by abnormal lymphoid cells. as blood sugar, urea and creatinine were normal, blood cultures were sterile, no history of intake of metformin or other medication causing la and other common causes of metabolic acidosis were ruled out. the patient was started on soda bicarbonate, broad spectrum antibiotics, although no focus of infection was detected. simultaneously, he was given cyclophospamide 500 mg on day 1 and day 2, dexamethasone 8 mg three times daily day 1 to day 4 and doxorubicin 30 mg on day 3. patient 's vitals improved gradually and after 1 week, his lactate level came down along with improvement in ph and bicarbonate levels. he subsequently received six courses of r - chop (rituximab, cyclophospamide, doxorubicin, vincristine, prednisolone)-based chemotherapy. he had a partial response that was short lasting and developed progression of lymphoma within 2 months of sixth course of r - chop. showing following parameters [arterial blood gas, blood sugar, vitals ] before and after adding chemotherapy lactic acid is a degradation product of glucose in anaerobic conditions. in anaerobic conditions, there are two types of la, hypoxic (type a) and non - hypoxic (type b). malignancy is often associated with type b. causes of la in malignancy are either due to overproduction of la or under utilization of la or both. tumor cell have a different metabolic milieu as compared to non - malignant cells. rapidly dividing tumors this leads to anaerobic glycolysis with activation of ldh and production of lactate. however, hypoxia is not the only mechanism of high lactate level in malignancy. otto warburg in 1930 demonstrated that cancer cells rely on glycolysis even in the presence of oxygen, a phenomenon known as aerobic glycolysis warburg effect. apart from hypoxic environment, elevated lactate level may also occur due to liver metastasis, over expression of type ii hexokinase, regulatory effect of insulin - like growth factor. in malignant cells even under aerobic conditions there is increased activation of mitochondrial - bound type 2 hexokinase, a rate - limiting enzyme of glycolysis. this occurs due to aberrant production of insulin - like growth factors along with its binding proteins and tumor necrosis factor (tnf-) by tumor tissue. in our patient, the poor prognostic impact of la in malignancy can be judged from fact that out of the total 29 published cases of lymphoma with la, 25 eventually died (pubmed search database). hence, la in lymphoma portends a very poor prognosis. the molecular basis for this may be due to a functional impairment of cytotoxic t cells. activated t lymphocytes are also dependent on glycolysis during the period of proliferation and cytokine production and thus produce lactate. this transport requires proton - linked monocarboxylate transporters, which co - transport protons and lactate anions following a concentration gradient. but lactate produced by the tumors disrupts the lactate gradient between intracellular and extracellular compartment of cytotoxic t cells present within the tumor bed. role of buffering agents like soda bicarbonate to treat la is only supportive and temporary. anemia can rarely be a cause of la in this case as la persisted even after blood transfusion. in this case though there were other confounding factors like low albumin, b - symptoms and bulky disease that are causes of poor prognosis so we can say that la has an additive effect for poor prognosis in high - risk cases of lymphoma. the literature review of the cases of la in lymphoma also suggests that these cases were having one or other high - risk features along with la. la is rare in patients with lymphoma. it is associated with high tumor burden along with aggressive biological and clinical behavior and | lactic acidosis (la) has been reported to be associated with high grade lymphoma as a terminal event. its causes are multi - factorial. it can either occur due to overproduction of lactic acid by rapidly dividing tumor or due to its underutilization due to involvement of liver by lymphomatous deposits. the prognosis of lymphoma associated with la is dismal. we present a patient of non - hodgkins lymphoma (nhl) who presented with la, after an initial response succumbed. |
vascular smooth muscle contraction is activated by an increase in cytosolic free ca concentration ([ca]i) as a result of ca entry from the extracellular space and/or ca release from intracellular stores, primarily the sarcoplasmic reticulum (1). ca diffuses to the contractile machinery where it binds to calmodulin (cam) (2). the (ca)4-cam complex induces a conformational change in myosin light chain kinase (mlck), which involves removal of the autoinhibitory domain from the active site, thereby converting the kinase from an inactive to an active state (3). mlck is physically bound through its n - terminus to actin filaments and, upon activation, phosphorylates nearby myosin molecules (4). myosin ii filaments are composed of hexameric myosin molecules, each consisting of two heavy chains and two pairs of light chains (17-kda essential light chains (lc17) and 20-kda regulatory light chains (lc20)) located in the neck region of the myosin molecule (fig. smooth muscle myosin ii is a hexameric protein composed of two heavy chains (205 kda each) and two pairs of light chains : the 17-kda essential light chains (lc17) and the 20-kda regulatory light chains (lc20). the n - termini of the heavy chains make up most of the head domains (pink) and the c - termini of the heavy chains account for the complete coiled - coil rod domain (which is responsible for assembly of myosin filaments) and the terminal unstructured tail (black). each globular head includes an actin - binding site (blue) and an atp - binding site (green). the light chains, lc17 (yellow) and lc20 (red), are associated with the neck region. vascular smooth muscle myosin light chain diphosphorylation : mechanism, function and pathological implications. activated mlck phosphorylates ser19 of lc20 and this simple post - translational modification induces a conformational change that is transmitted to the myosin heads, resulting in actin interaction and a marked increase in the actin - activated mgatpase activity of myosin (5). the energy derived from the hydrolysis of atp then drives cross - bridge cycling and the development of force or contraction of the muscle. relaxation follows the removal of ca from the cytosol, primarily by caatpases, which pump ca out of the cell and back into the sarcoplasmic reticulum (6). mlck is inactivated as ca dissociates from cam and the autoinhibitory domain of mlck blocks the active site. phosphorylated myosin is then dephosphorylated by myosin light chain phosphatase (mlcp), a type 1 protein serine / threonine phosphatase (7). smooth muscle myosin ii is a hexameric protein composed of two heavy chains (205 kda each) and two pairs of light chains : the 17-kda essential light chains (lc17) and the 20-kda regulatory light chains (lc20). the n - termini of the heavy chains make up most of the head domains (pink) and the c - termini of the heavy chains account for the complete coiled - coil rod domain (which is responsible for assembly of myosin filaments) and the terminal unstructured tail (black). each globular head includes an actin - binding site (blue) and an atp - binding site (green). the light chains, lc17 (yellow) and lc20 (red), are associated with the neck region. walsh mp. vascular smooth muscle myosin light chain diphosphorylation : mechanism, function and pathological implications. mlcp is a trimeric phosphatase with a 38-kda catalytic subunit (pp1c), a 130-kda regulatory subunit (mypt1) and a 21-kda subunit of uncertain function. mlcp is inhibited by both protein kinase c (pkc) and rhoa / rho - associated kinase (rok) pathways. phosphorylation of the cytosolic phosphatase inhibitory protein of 17-kda (cpi-17) at thr38 by pkc converts cpi-17 to a potent inhibitor of mlcp, which is achieved by direct interaction of phosphorylated cpi-17 with pp1c (8). in addition, and apparently of greater physiological significance, rok phosphorylates mypt1 to induce inhibition of mlcp activity. rok phosphorylates mypt1 at thr697 and thr855 (rat numbering) in vitro and both phosphorylation events result in phosphatase inhibition (10). however, it appears that rok predominantly phosphorylates thr855 in intact tissues (11). activation of pkc and rok pathways, therefore, can result in decreased mlcp activity, resulting in an increase in the ratio of mlck : mlcp activity and an increase in force. since rok and novel pkc isoforms are ca - independent, this results in ca sensitization of contraction, i.e. an increase in force without an increase in [ca]i. the possibility that lc20 may also be phosphorylated at thr18 was originally demonstrated in vitro when it was shown that high concentrations of mlck phosphorylate thr18 in addition to ser19 (12). it is clear, however, that mlck does not phosphorylate thr18 of lc20 in intact smooth muscle tissues, and most contractile stimuli are associated with lc20 phosphorylation exclusively at ser19, which can be attributed to mlck (13). interest in thr18 phosphorylation was revived, however, when it was shown that treatment of smooth muscle tissues with membrane - permeant phosphatase inhibitors (such as calyculin - a) induced ca - independent contractions that correlated with diphosphorylation of lc20 at thr18 and ser19 (14). two ca - independent kinases (integrin - linked kinase (ilk) and zipper - interacting protein kinase (zipk)) were shown to be the most likely kinases responsible for lc20 diphosphorylation (15,16,17). phosphorylation of lc20 at thr18 and ser19 has been observed in several smooth muscle tissues, e.g. bovine tracheal smooth muscle in response to neural stimulation or carbachol (18, 19), rabbit thoracic aorta treated with prostaglandin - f2 (20, 21) and renal afferent arterioles stimulated with endothelin-1 (22). lc20 diphosphorylation has frequently been associated with pathophysiological conditions involving hypercontractility, including cerebral vasospasm (23), coronary (24, 25) and femoral arterial vasospasm (26), intimal hyperplasia (27) and hypertension (28). early studies comparing the properties of smooth muscle myosin phosphorylated at ser19 (by low concentrations of mlck) and at both thr18 and ser19 (by high concentrations of mlck) indicated that the additional phosphorylation at thr18 increased the actomyosin mgatpase activity some two- to three - fold (12, 29,30,31). however, the velocity of movement of myosin - coated beads along actin cables (32) or of actin filaments over immobilized myosin in the in vitro motility assay (31) was similar whether lc20 was phosphorylated at ser19 alone or at both thr18 and ser19. we recently addressed the hypothesis that phosphorylation at thr18 may enhance the level of steady - state force achieved with ser19 phosphorylation (13). to test this hypothesis the objective was to achieve stoichiometric phosphorylation of lc20 at ser19, then elicit phosphorylation at thr18 and observe whether or not there was a further increase in steady - state force. the challenge was to achieve stoichiometric phosphorylation at ser19 since this can not be done in intact tissue due to the competing actions of mlck and mlcp, which results in stable phosphorylation of lc20 at steady - state of 0.5 mol pi / mol lc20. furthermore, this problem can not be overcome by inhibition of phosphatase activity since phosphatase inhibitors such as calyculin - a and okadaic acid unmask the basal activities of ilk and zipk, which phosphorylate both thr18 and ser19 of lc20. we took advantage of the fact that protein kinases generally, including mlck, can utilize adenosine 5-o-(3-thiotriphosphate) (atps) as a substrate to thiophosphorylate their protein substrates (33), but the thiophosphorylated protein (lc20 in this case) is a very poor phosphatase substrate (34). it was necessary to use triton - skinned tissue for this experiment since the plasma membrane is impermeant to atps. stoichiometric thiophosphorylation of lc20 at ser19 in triton - skinned rat caudal arterial smooth muscle. (a) the viability of triton - skinned rat caudal arterial smooth muscle strips was initially verified by transfer from relaxing solution (pca 9) to high [ca ] (pca 4.5) solution containing atp and an atp regenerating system (rs), which induced a contractile response. tissues were then relaxed by 3 washes in pca 9 solution containing atp and rs. atp was then removed by 6 washes in pca 9 solution without atp or rs. tissues were then incubated in pca 4.5 solution containing atps (4 mm) in the absence of atp and rs. excess atps was then removed by washing twice with pca 9 solution without atp or rs. once steady - state force was established, microcystin (1 m) was added in pca 9 solution containing atp and rs. tissues were harvested at the indicated times during this protocol for phos - tag sds - page and western blotting with anti - pan lc20 (b), as shown by the arrows in (a) (the numbers correspond to the lanes in (b)) : (i) lanes 1 and 8, tissue incubated at pca 9 showing exclusively unphosphorylated lc20 ; (ii) lanes 2 and 3, pca 4.5 + atps in the absence of atp and rs ; (iii) lane 4, pca 9 in the absence of atp and rs following thiophosphorylation ; (iv) lane 5, at the plateau of force development following transfer to pca 9 solution containing atp and rs ; (v) lanes 6 and 7, following treatment with microcystin at pca 9 in the presence of atp and rs. an additional control is included in lane 9 : triton - skinned tissue treated with microcystin at pca 9 for 60 min to identify unphosphorylated (0p), monophosphorylated (1p), and diphosphorylated (2p) lc20 bands. thiophosphorylated forms of lc20 are indicated as follows : 1sp, monothiophosphorylated lc20 ; 2sp, dithiophosphorylated lc20 ; 1sp1p, lc20 thiophosphorylated at one site and myosin regulatory light chain diphosphorylation slows relaxation of arterial smooth muscle. 2012 ; 287(29) : 2406476. the american society for biochemistry and molecular biology. shows the experimental protocol and corresponding force measurements (fig. 2a) and analysis of lc20 (thio)phosphorylation by phos - tag sds - page (see below for a description of this technique, which enables the separation of unphosphorylated and phosphorylated forms of lc20) (fig. 2b). at resting tension (pca 9), lc20 is unphosphorylated (lanes 1 and 8, fig. a control contraction was elicited by increasing [ca ] to pca 4.5 in the presence of atp and relaxation followed removal of ca (fig. when basal force was restored, the tissue was washed several times in pca 9 solution without atp to remove all atp, following which atps was added at pca 4.5 to elicit close - to - stoichiometric lc20 thiophosphorylation (fig. 2b, lanes 2 and 3). contraction did not occur under these conditions since atps is not hydrolysed by the actin - activated myosin mgatpase and, therefore, atps can not support cross - bridge cycling (35,36,37). following lc20 thiophosphorylation, atps was washed out by several washes with pca 9 solution (fig. atp was then added at pca 9, whereupon the tissue contracted rapidly due to the fact that lc20 was previously thiophosphorylated. the level of force achieved during this treatment was comparable to that elicited initially by addition of atp at pca 4.5 (fig. finally, the phosphatase inhibitor microcystin was added at pca 9 in the presence of atp, whereupon ser19-thiophosphorylated lc20 was phosphorylated at thr18 (1s1p in lanes 6 and 7 of fig. small amounts of monophosphorylated (1p) and diphosphorylated (2p) lc20 were also detected due to the presence (fig. 2b, lane 5) of a small amount of unphosphorylated lc20 prior to the addition of microcystin. 2b, lane 9 shows a control triton - skinned tissue treated with microcystin and atp at pca 9 to indicate the migration of unphosphorylated (0p), monophosphorylated (1p) and diphosphorylated (2p) lc20, as previously established (13). the key finding from this experiment was that phosphorylation of lc20 at thr18 on top of close - to - stoichiometric thiophosphorylation of lc20 at ser19 did not elicit an increase in force. stoichiometric thiophosphorylation of lc20 at ser19 in triton - skinned rat caudal arterial smooth muscle. (a) the viability of triton - skinned rat caudal arterial smooth muscle strips was initially verified by transfer from relaxing solution (pca 9) to high [ca ] (pca 4.5) solution containing atp and an atp regenerating system (rs), which induced a contractile response. tissues were then relaxed by 3 washes in pca 9 solution containing atp and rs. atp was then removed by 6 washes in pca 9 solution without atp or rs. tissues were then incubated in pca 4.5 solution containing atps (4 mm) in the absence of atp and rs. excess atps was then removed by washing twice with pca 9 solution without atp or rs. once steady - state force was established, microcystin (1 m) was added in pca 9 solution containing atp and rs. tissues were harvested at the indicated times during this protocol for phos - tag sds - page and western blotting with anti - pan lc20 (b), as shown by the arrows in (a) (the numbers correspond to the lanes in (b)) : (i) lanes 1 and 8, tissue incubated at pca 9 showing exclusively unphosphorylated lc20 ; (ii) lanes 2 and 3, pca 4.5 + atps in the absence of atp and rs ; (iii) lane 4, pca 9 in the absence of atp and rs following thiophosphorylation ; (iv) lane 5, at the plateau of force development following transfer to pca 9 solution containing atp and rs ; (v) lanes 6 and 7, following treatment with microcystin at pca 9 in the presence of atp and rs. an additional control is included in lane 9 : triton - skinned tissue treated with microcystin at pca 9 for 60 min to identify unphosphorylated (0p), monophosphorylated (1p), and diphosphorylated (2p) lc20 bands. thiophosphorylated forms of lc20 are indicated as follows : 1sp, monothiophosphorylated lc20 ; 2sp, dithiophosphorylated lc20 ; 1sp1p, lc20 thiophosphorylated at one site and phosphorylated at the other. we next addressed the hypothesis that phosphorylation of lc20 at both thr18 and ser19 reduces the rate of dephosphorylation and relaxation compared to phosphorylation at ser19 alone. to test this hypothesis, lc20 was phosphorylated at ser19 only or at both thr18 and ser19 to comparable stoichiometry. this was achieved by treatment of triton - skinned rat caudal arterial smooth muscle strips with atp at pca 4.5 (for monophosphorylation at ser19) or with atp and the phosphatase inhibitor okadaic acid at pca 9 (for diphosphorylation at thr18 and ser19). the time - courses of dephosphorylation and relaxation were then followed to determine if there was a reduction in the rates of dephosphorylation and relaxation when lc20 was diphosphorylated at thr18 and ser19 compared to monophosphorylated at ser19. as shown in fig. comparison of the time courses of relaxation and lc20 dephosphorylation in triton - skinned rat caudal arterial smooth muscle following contraction with ca or okadaic acid in the absence of ca. triton - skinned tissues that had been contracted with ca (open circles) or okadaic acid (20 m) at pca 9 (closed circles) were transferred to pca 9 solution and the time courses of dephosphorylation (a) and relaxation (b) were followed. tissues were harvested at 10, 20, 30, 40, 50, 75, and 100% relaxation and lc20 phosphorylation levels were quantified by phos - tag sds - page and western blotting with anti - pan lc20. the american society for biochemistry and molecular biology., both treatments induced lc20 phosphorylation to 0.5 mol pi / mol lc20. at pca 4.5, this was exclusively ser19 phosphorylation, whereas in response to okadaic acid at pca 9, phosphorylation occurred at both thr18 and ser19 (fig. 3b) clearly shows that both dephosphorylation and relaxation rates were significantly slower when lc20 was diphosphorylated at thr18 and ser19 compared to monophosphorylated at ser19. this finding suggests a functional effect of lc20 diphosphorylation and raises the possibility that pathological situations of hypercontractility may result from impaired relaxation due to this dephosphorylation event. mlcp has been shown to dephosphorylate thr18 in addition to ser19 (38) suggesting that the same phosphatase dephosphorylates mono- and diphosphorylated lc20 in situ. comparison of the time courses of relaxation and lc20 dephosphorylation in triton - skinned rat caudal arterial smooth muscle following contraction with ca or okadaic acid in the absence of ca. triton - skinned tissues that had been contracted with ca (open circles) or okadaic acid (20 m) at pca 9 (closed circles) were transferred to pca 9 solution and the time courses of dephosphorylation (a) and relaxation (b) were followed. tissues were harvested at 10, 20, 30, 40, 50, 75, and 100% relaxation and lc20 phosphorylation levels were quantified by phos - tag sds - page and western blotting with anti - pan lc20. 4. schematic diagram illustrating the anatomical relationship of the afferent arteriole, glomerulus, and the efferent arteriole. the afferent arteriole controls the glomerular inflow resistance. this vessel must constrict rapidly in response to fluctuations in blood pressure to prevent pressure elevations from being transmitted to the downstream glomerular capillaries. when renal perfusion pressure is compromised, a sustained increase in efferent arteriolar tone maintains adequate filtration pressure within the upstream glomerular capillaries, thereby preserving renal function. provides a schematic representation of the renal microcirculation, which consists of the afferent arteriole conveying blood from the interlobular artery to the glomerular capillaries where it is filtered prior to returning to the systemic circulation via the efferent arteriole. the afferent arteriole plays a key role in regulating glomerular inflow resistance and must be able to respond very rapidly to sudden changes in systemic blood pressure in order to protect the fragile glomeruli from pressure - induced damage (39). angiotensin ii (ang ii) is a renal - selective vasoconstrictor that contributes to renal vascular resistance under normal physiological conditions and thereby plays an important role in modulating renal hemodynamics (40). endothelin-1 (et-1), on the other hand, is a renal vasoconstrictor that does not contribute to renal vascular resistance under normal physiological conditions, but is implicated in abnormal renal vasoconstriction and reduced glomerular filtration in pathological states such as diabetes and chronic kidney disease (41,42,43,44,45,46,47). schematic diagram illustrating the anatomical relationship of the afferent arteriole, glomerulus, and the efferent arteriole. this vessel must constrict rapidly in response to fluctuations in blood pressure to prevent pressure elevations from being transmitted to the downstream glomerular capillaries. when renal perfusion pressure is compromised, a sustained increase in efferent arteriolar tone maintains adequate filtration pressure within the upstream glomerular capillaries, thereby preserving renal function. (52) with permission. based on our studies of the effects of lc20 diphosphorylation described above, we developed a hypothesis that pathological situations of hypercontractility may result from impaired relaxation due to diphosphorylation of lc20 at thr18 and ser19. we have tested this hypothesis by studying the effects of two contractile stimuli, one physiological (ang ii) and one pathophysiological (et-1), on renal afferent arteriolar constriction and lc20 phosphorylation. we compared the patterns of phosphorylation of lc20 in the afferent arteriole to determine whether or not lc20 diphosphorylation is associated with the pathophysiological stimulus et-1 and not the physiological stimulus ang ii. this proved to be a challenging proposition due largely to the very small size of the afferent arteriole : a single afferent arteriole has a diameter of 1520 m, contains 4,000-fold over existing methods (50). this was achieved by : (i) the use of biotinylated secondary antibodies in conjunction with streptavidin - conjugated horseradish peroxidase, combined with enhanced chemiluminescence detection of lc20 species, (ii) fixing the lc20 on the pvdf membrane by treatment with glutaraldehyde, and (iii) incorporating cangetsignal (toyobo, japan) into the protocol. utilization of a minimum number of steps in the protocol with the least possible number of sample transfers maximized lc20 yield. the limit of detection of lc20 was thereby increased from 200 fmol (4 ng) to 0.05 fmol (1 pg) ; we estimate that a single afferent arteriole contains 2.5 fmol (50 pg) of lc20. using this approach, we succeeded in quantifying lc20 phosphorylation levels in single isolated afferent arterioles and observed that ang ii induced exclusively monophosphorylation of lc20 whereas et-1 induced diphosphorylation, both in a time- and concentration - dependent manner (22). et-1-induced diphosphorylation was confirmed to occur at thr18 and ser19 using phosphorylation site - specific antibodies. et-1-induced lc20 diphosphorylation was confirmed by the proximity ligation assay (51). furthermore, afferent arteriolar vasodilation (relaxation) occurred more slowly following washout of et-1 than ang ii (22). these findings are, therefore, consistent with the hypothesis that pathophysiological signals such as et-1 that are associated with prolonged vasoconstrictor responses involve lc20 diphosphorylation, whereas physiological signals such as ang ii induce lc20 phosphorylation exclusively at ser19. the additional phosphorylation at thr18 induced by et-1 is, therefore, proposed to account, at least in part, for the sustained contractile response of the afferent arteriole to et-1 compared to ang ii. lc20 is phosphorylated at thr18 and ser19 in a ca - independent manner by ilk and/or zipk, which are associated with the contractile machinery in vascular smooth muscle. this occurs in concert with inhibition of mlcp by rok - catalysed phosphorylation of mypt1, the regulatory and targeting subunit of the phosphatase. diphosphorylation of lc20 occurs in response to et-1 (pathological stimulus) but not ang ii (physiological stimulus) in renal afferent arterioles, and diphosphorylation of lc20 is associated with decreased rates of lc20 dephosphorylation and relaxation. ilk and zipk are, therefore, potential therapeutic targets for the treatment of diseases associated with hypercontractility, such as hypertension, cerebral vasospasm following subarachnoid hemorrhage, coronary arterial vasospasm, intimal hyperplasia, acute renal insufficiency and chronic kidney disease. | smooth muscle contraction is activated primarily by phosphorylation at ser19 of the regulatory light chain subunits (lc20) of myosin ii, catalysed by ca2+/calmodulin - dependent myosin light chain kinase. ca2 + -independent contraction can be induced by inhibition of myosin light chain phosphatase, which correlates with diphosphorylation of lc20 at ser19 and thr18, catalysed by integrin - linked kinase (ilk) and zipper - interacting protein kinase (zipk). lc20 diphosphorylation at ser19 and thr18 has been detected in mammalian vascular smooth muscle tissues in response to specific contractile stimuli (e.g. endothelin-1 stimulation of rat renal afferent arterioles) and in pathophysiological situations associated with hypercontractility (e.g. cerebral vasospasm following subarachnoid hemorrhage). comparison of the effects of lc20 monophosphorylation at ser19 and diphosphorylation at ser19 and thr18 on contraction and relaxation of triton - skinned rat caudal arterial smooth muscle revealed that phosphorylation at thr18 has no effect on steady - state force induced by ser19 phosphorylation. on the other hand, the rates of dephosphorylation and relaxation are significantly slower following diphosphorylation at thr18 and ser19 compared to monophosphorylation at ser19. we propose that this diphosphorylation mechanism underlies the prolonged contractile response of particular vascular smooth muscle tissues to specific stimuli, e.g. endothelin-1 stimulation of renal afferent arterioles, and the vasospastic behavior observed in pathological conditions such as cerebral vasospasm following subarachnoid hemorrhage and coronary arterial vasospasm. ilk and zipk may, therefore, be useful therapeutic targets for the treatment of such conditions. |
dermatofibrosarcoma protuberans (dfsp) is an uncommon, low - grade cutaneous malignancy that originates from the dermis. it can occur in any part of the body, but has predilection for the trunk, head and neck region, and the proximal extremities. the tumor begins as a small bump on the skin surface and then grows in the dermis to form a larger mass that swells and bulges outwards, hence the name protuberans. distant metastasis of dfsp is extremely rare ; however, it is a locally aggressive tumor and shows marked tendency to recur even after wide local excision. we emphasize the role of imaging in the preoperative evaluation of these tumors so that more accurate treatment plans can be instituted, leading to decreased recurrence rates. a 20-year - old male presented to our hospital with a progressively increasing swelling on the right leg for the previous 9 months. it was painless and non - tender to start with, but showed rapid growth over the last few weeks with onset of pain that was continuous and mild to moderate in intensity. there was no history of any fever, loss of weight or any trauma to the local site. the physical examination revealed an irregular, protuberant swelling with a large indurated, non - ulcerated plaque on the right leg. radiography of the right leg revealed a rounded soft tissue mass approximately 5 3 cm in size along the anteromedial aspect of the right tibia with associated cortical erosions in the tibia (fig. no soft tissue calcification or periosteal reaction was noted. magnetic resonance imaging (mri) was performed to further characterize the mass and delineate the extent of bone marrow involvement. the bone marrow of proximal metadiaphysis of the right tibia over a segment of approximately 7 cm revealed an abnormal hypointense signal on t1-weighted images and hyperintense signal on inversion recovery and t2-weighted images (fig. there was evidence of cortical breach along the anterior aspect of the tibia with a large associated soft tissue mass that was infiltrating the subcutaneous tissues and bulging anteriorly. the soft tissue was predominantly hypointense on t1-weighted images and hyperintense on t2-weighted images depicting florid enhancement after contrast administration. figure 1radiographs of the right leg, anteroposterior (a) and lateral projection (b) showing a well - defined soft tissue mass along the anteromedial aspect of the right tibia (arrowhead, a) with suggestion of cortical breach (arrow, b). figure 2mri sagittal t1-weighted (a) and fat suppressed coronal t2-weighted images (b) demonstrating abnormal marrow signal of the proximal metadiaphysis of the right tibia with sharp zone of transition. figure 3mri axial t1-weighted pre - contrast (a) and post - contrast (b) images depicting large soft tissue bulging anteromedial to the right tibia and showing florid enhancement after contrast administration. the soft tissue is seen to infiltrate the subcutaneous planes associated with cortical breach in the tibia anteriorly (arrow, b). radiographs of the right leg, anteroposterior (a) and lateral projection (b) showing a well - defined soft tissue mass along the anteromedial aspect of the right tibia (arrowhead, a) with suggestion of cortical breach (arrow, b). mri sagittal t1-weighted (a) and fat suppressed coronal t2-weighted images (b) demonstrating abnormal marrow signal of the proximal metadiaphysis of the right tibia with sharp zone of transition. mri axial t1-weighted pre - contrast (a) and post - contrast (b) images depicting large soft tissue bulging anteromedial to the right tibia and showing florid enhancement after contrast administration. mild heterogeneous enhancement is also noted in the underlying bone marrow. the soft tissue is seen to infiltrate the subcutaneous planes associated with cortical breach in the tibia anteriorly (arrow, b). the patient underwent core - needle biopsy under local anaesthesia from swelling on the right leg which showed highly cellular smears with clusters of spindle - shaped cells in a fibromyxoid background. the patient is scheduled for neoadjuvant therapy with imatinib mesylate to be followed by surgical excision of the tumor. figure 4biopsy smear showing highly cellular tumor with fibroblastic spindle cells producing storiform pattern (a) and immunohistochemical stain for cd34 (b) showing strong membranous positivity around the tumor cells. biopsy smear showing highly cellular tumor with fibroblastic spindle cells producing storiform pattern (a) and immunohistochemical stain for cd34 (b) showing strong membranous positivity around the tumor cells. dermatofibrosarcoma protuberans is a rare, painless, monoclonal, cutaneous soft tissue sarcoma of unknown cause that was first described by taylor in 1890. it constitutes approximately 1% of all soft tissue sarcomas, shows slight male preponderance and generally presents in the third and fourth decades of life. it often masquerades as a benign, indolent tumor on the trunk and proximal extremities. the surface of the tumor is characterized by irregular protuberant swellings, and a hard indurated plaque of irregular outline forms the base. it is a slow - growing neoplasm ; however in the later stages, it may show rapid growth and the lesion may become painful, ulcerated and can discharge. surgery with wide local excision or mohs micrographic surgery remains the treatment of choice in these patients. radiation therapy, hitherto with a limited role, is recently being used as an adjunct to surgical excision, primarily in cases in which the tumor is unresectable, there are positive resection margins on histology and when the surgery is going to leave major cosmetic or functional deficits. recently, a very promising neoadjuvant molecular therapy with imatinib mesylate, a potent and selective inhibitor of several protein - tyrosine kinases, is advocated in adult patients with unresectable, recurrent or metastatic dfsp. dfsp is a locally invasive fibrohistiocytic tumor with a recurrence rate of up to 25% even after wide local excision with a safety margin of 35 cm. this is attributed to the fact that dfsp extends far beyond the assessed clinical margins, spreading locally in the dermis, subcutaneous tissues and muscles. our index case illustrates that it can extend even deeper to directly involve the bone with cortical erosions and bone marrow infiltration. to the best of our knowledge such deep invasion of the tumor with infiltration into the underlying bone has not been described in the literature to date except in one case of dfsp of the scalp where the calvarium was also infiltrated. this could partly be due to the fact that imaging is rarely a part of the preoperative workup in these patients. dfsp is a low - grade malignancy with only a few sporadic cases of distant metastases. histologically, it consists of uniform but atypical spindle cells placed in a fibrotic stroma in the dermis and subcutaneous tissues exhibiting characteristic cartwheel or storiform appearance. immunohistochemistry studies have shown that dfsp stains positive for cd34 and negative for factor xiiia, which are very useful markers to differentiate dfsp from dermatofibroma. the poor prognostic indicators of dfsp include advanced age, high mitotic index, increased cellularity, dna aneuploidy and fibrosarcomatous changes within the tumor. multiple local recurrences can also predispose to distant metastasis, thus highlighting the significance of adequate initial treatment. the extent of the tumor and the degree of invasion of underlying tissues is usually assessed by physical examination and not much importance has been given to the role of imaging except to rule out metastasis. mendenhall. and mcarthur discussed the role of mri in determining deep tumor invasion. because dfsp is a locally invasive tumor with a high rate of post - operative recurrence, we advocate that imaging (preferably mri) should be done in all such cases especially those involving the extremities. mri will ascertain the exact depth of invasion by showing the tumor margins, and will guide the clinician to institute an adequate initial treatment by choosing an appropriate surgical plan with or without adjunctive chemo-/radiotherapy. this in turn will lead to a reduced rate of local recurrence and improved clinical outcome. however, the cost / benefit ratio needs to be further substantiated by larger prospective studies. | abstractdermatofibrosarcoma protuberans (dfsp) is a rare, low - grade, cutaneous neoplasm with pronounced tendency for local recurrence. a case of dfsp that showed direct infiltration into the underlying bone marrow is described. to the best of our knowledge, such direct bony involvement by dermatofibrosarcoma has not been reported in the english literature to date. the role of imaging is also discussed for planning adequate initial treatment, which will result in a lower recurrence rate and improved clinical outcome. |
rabbits are animals of a high economic and laboratory value, whereas in poland, principally in scientific and diagnostic research, mixed breed rabbits are generally used. it must also be added that although researches involving experiments on laboratory animals are conducted on mice, rats and guinea pigs, still rabbits are more convenient as laboratory animals, for example as more blood can be drawn. nevertheless, when performing observations on animals, including rabbits, including mixed breed rabbits, it is necessary to know the reference values for immuno - logical factors due to an increased possibility of changes in the elements of the immune system, while in the case of rabbits, including polish mixed breed rabbits, there are no standards for b- and t - cells. previous studies in the volume of b- and t - cells in peripheral blood were carried out abroad on rabbits of new zealand, fauve de bourgogne races, as well as lp and v genetic lines (table 1), while in poland, exclusively on mixed breed rabbits (table 2). such observations were not oriented at determining reference values and no impact of physiological properties of rabbits was analysed, such as sex, age and race, as well as environmental conditions (seasons), even though they were considered, and despite the fact that their impact was documented when analysing haematological factors [219 ]. the studies carried out in poland on polish mixed breed rabbits evidenced the impact of age [3, 8 ] and sex of the animals, as well as season of the year, while foreign studies on new zealand and angora rabbits, as well as czech races and mixed breed animals also pointed out to the impact of the age [5, 6, 1113, 15, 19 ], sex [4, 11, 14, 16, 17, 19 ], and race [7, 9, 11, 18, 19 ], as well as season [2, 16, 19 ]. foreign data percentage of b and t cells and subpopulations in peripheral blood of rabbits polish data ns not studied ; x mean value, sd standard deviation the study was aimed at developing standards for b - cells with cd19 + receptor, and t - cells with cd5 + receptor, and their subpopulations, namely t - cells with receptors cd4 +, cd8 + and cd25 + in peripheral blood of polish mixed breed rabbits, as well as at assessing the impact of four seasons and sex of the animals on such values. the study involved 200 polish mixed breed rabbits, labelled as conventional animals, originating from a licensed farm, remaining under continuous veterinary and zootechnical supervision, weighing 3.2 - 4.2 kg, aged 6 - 8 months, females and males, in four seasons of the year : spring, summer, autumn, and winter. during the experiment, the animals remained at the vivarium of the department of microbiology and department of immunology of the biology faculty at the university of szczecin, where zootechnical parameters were in line with the recommended polish standards developed in line with the european union directive as regards temperature and humidity, as well as lighting and size of cages for animals. after transportation to the department vivarium, the animals were provided with a two - week adaptation period. the animals were fed with all - mash rabbit feed (16% krlik z motycza), at a volume of 0.15 - 0.20 kg / day, and had unlimited access to water. blood for tests was drawn by establishing a port from the marginal vein of the ear, in 24-hour intervals, for three consecutive days, at 8:00 am, namely at hours 0, 24 and 48 h from commencement of the study. in blood of rabbits, the percentage of cd19 + b - cells, and cd5 + t - cells, as well as their subpopulations t - cells with receptors cd4 +, cd8 + and cd25 + was determined, according to the method described by deptua. using monoclonal antibodies (mouse anti - rabbit) (serotec, usa). blood for tests was drawn by establishing a port from the marginal vein of the ear, in 24-hour intervals, for three consecutive days, at 8:00 am, namely at hours 0, 24 and 48 h from commencement of the study. in blood of rabbits, the percentage of cd19 + b - cells, and cd5 + t - cells, as well as their subpopulations t - cells with receptors cd4 +, cd8 + and cd25 + was determined, according to the method described by deptua. the analysed samples were incubated for 45 minutes in ice, rinsed three times with cell wash (bd biosciences, usa) by centrifugation at 200 xg. to such prepared cellular sediment, 10 l of rabbit antibodies were added marked against mouse igg with fluorescein isothiocyanate (fitc). after triple repetition of the rinsing procedure in cell wash, 2000 l of lysing solution was added to samples to eliminate erythrocytes (bd facs lysing solution, bd biosciences, usa). after ten minutes of incubation in the dark, at room temperature, measurement was performed on facscan flow cytometer by becton dickinson (usa) using facsdiva software. the results of the study on b- and t - cells and their subpopulations in percentage, as obtained from three blood draws from each rabbit (at 0, 24, 48 h), performed twice at the interval of seven days in each season of the year, are presented as average values and standard deviations in table 3 and in figs. 13, as previously subjected to statistical analysis using t student test at p = 0.05. values of b and t lymphocytes in polish mixed breed rabbits in seasons of the year (without considering the sex) values of b and t lymphocytes in females of polish mixed breed rabbits in seasons of the year values of b and t lymphocytes in males polish mixed breed rabbits in seasons of the year percentage of b and t cells and subpopulations in peripheral blood of rabbits taking into consideration season and sex () number of animals ; x mean value ; sd standard deviation statistically significant difference between males and females statistically significant difference between seasons (together), where statistically significant difference between spring and summer statistically significant difference between spring and autumn statistically significant difference between spring and winter statistically significant difference between summer and autumn statistically significant difference between summer and winter statistically significant difference between autumn and winter when analysing the results obtained as regards the percentage of cd19 + b - cells and cd5 + t - cells, as well as their subpopulations (cd4 + t - cells, cd8 + t - cells, and cd25 + t - cells) (table 3), it must be stated that the values obtained in polish mixed breed rabbits can only be compared to the results of studies obtained by polish authors (table 2), also carried out on mixed breed rabbits from poland, which have been presented in the same units as in the present study. in turn, the results of foreign studies (table 1) regarding such cells, performed on pureblood rabbits (fauve de bourgogne and new zealand) and spanish mixed breed rabbits, are presented in different units, which renders it impossible to compare them to the present results. when assessing the results in the area of particular blood cells analysed, it must be stated that the values for cd19 + b - cells remain within the range from 10.76 to 12.23% (table 3), cd25 + t - cells : within the range from 12.15 to 12.85% (table 3), and are similar to the results previously obtained in polish mixed breed rabbits (table 2), although it must be added that both in the case of cd19 + b - cells and cd25 + t - cells, in the latter studies (table 2), also much lower values and much higher values (table 2) than the present ones were recorded (table 3). in turn, as regards cd5 + t - cells, their values in the present study ranged from 43.06 to 51.46%, cd4 + t - cells from 30.33 to 40.01%, while cd8 + t - cells from 13.56 to 15.77% (table 3). the results obtained for cd5 + t - cells, cd4 + t - cells, and cd8 + t - cells are actually also correlated with the results obtained in the previous studies on polish mixed breed rabbits (table 2), but no such fluctuations were determined in them, as recorded with reference to cd19 + b - cells and cd25 + t - cells. when analysing the results obtained for b- and t - cells and their subpopulations in polish mixed breed rabbits, in the aspect of the impact of the season (table 3, figs. 13) and sex of the animals (table 3, figs. 2, 3), it must be stated that both the season and sex affect values of the parameters analysed. detailed analysis of the impact of the seasons on the analysed elements of peripheral blood in rabbits without considering the sex (table 3) revealed that statistically significant differences between the values obtained in spring and summer refer to cd19 + b - cells and cd4 + t - cells ; between spring and autumn to cd5 + t - cells and cd4 + t - cells, and between spring and winter to cd4 + t - cells. the assessment also evidenced that the differences between summer and autumn are recorded in the percentage of cd19 + b - cells and cd5 + t - cells, while differences between summer and winter exclusively in the area of cd5 + t - cells, whereas differences between autumn and winter as regards cd19 + b - cells and cd5 + t - cells. to recapitulate changes regarding the impact of the seasons on the analysed b- and t - cells and their subpopulations, it can be stated that the season most significantly affects the values of cd5 + t - cells, as for this parameter, four statistically significant changes were recorded ; as well as cd19 + b - cells and cd4 + t - cells, where three statistically significant changes were recorded for each of these cells (table 3). whereas, when analysing the impact of the seasons on the factors analysed considering sex of the animals (table 3), it was evidenced that the seasons affect males and females in a different way, as in females, statistically significant values were recorded in spring, summer and winter, while in males exclusively in autumn and winter, and these in females referred to cd4 + t - cells, cd25 + t - cells, and cd8 + t - cells, while in males to cd4 + t - cells. the assessment of the impact of sex of the animals on the percentage of b- and t - cells and their subpopulations in peripheral blood of polish mixed breed rabbits (table 3) evidenced that more statistically significant values are recorded in the factors analysed in females rather than males, as for females they were recorded in spring for cd4 + t - cells, summer for cd25 + t - cells, and winter for cd8 + t - cells, while in males they were only recorded in autumn and winter and exclusively for cd4 + t - cells. this would confirm observations recorded when assessing the impact of the seasons on the analysed factors in females and males, and points out to the fact that this physiological property (sex) most strongly affects cd4 + t - cells. to conclude, it must be stated that the values of b- and t - cells and their subpopulations in peripheral blood in polish mixed breed rabbits remain within the following ranges : for cd19 + b - cells : 10.76 - 12.23%, for cd5 + t - cells : 43.06 - 51.46%, cd4 + t - cells : 30.33 - 40.01%, cd8 + t - cells : 13.56 - 15.77%, whereas for cd25 + t - cells : 12.15 - 12.85%. due to the large material which the study involved, the results should constitute reference values for such animals, the more so that they correlate to the values obtained in the previous studies also on mixed breed rabbits (table 2). the present study also revealed that both the season of the year and sex of the rabbits affect the percentage of b- and t - cells and their subpopulations in peripheral blood. in the case of season of the year, it was observed that this factor principally affects the values of cd5 + t - cells and cd19 + b - cells, as well as cd4 + t - cells, differently in males and females. in turn, in the case of sex of the animals, it was recorded that it affects the analysed immunological factors, causing more changes in females, but in both males and females these referred to cd4 + t - cells, whereas in females the changes took place in spring, summer and winter, while in males in autumn and winter. study was financed from research grant of the ministry of science and higher education / national science centre n308565240. | due to the lack of reference values for immunological parameters in polish mixed breed rabbits, the study was aimed at developing standards for b - cells with cd19 + receptor, and t - cells with cd5 + receptor, and their subpopulations, namely t - cells with receptors cd4 +, cd8 + and cd25 + in peripheral blood of polish mixed breed rabbits, as well as at assessing the impact of four seasons and sex of the animals on such values. the results of the study not only are the source of reference values, but also revealed that the season of the year and sex of the rabbits affect the percentage of b- and t - cells and their subpopulations in peripheral blood. |
retroperitoneal fibrosis (rpf) is a rare disease with peak incidence in the fifth to seventh decades of life. the symptoms of rpf may be general / nonspecific or localized (due to replacement or compression of organs). yet, definitive diagnosis can only be made based on biopsy findings. besides, magnetic resonance imaging (mri) is essential for evaluating the extent of the disease process (1). however, some patients require ureteral, intestinal, or paravascular surgery due to obstruction in spite of medical treatment. there are few reports of retroperitoneal and mediastinal fibrosis with pleural and pericardial involvement described as multifocal fibrosclerosis (2). here, we present a case of retroperitoneal fibrosis with massive mediastinal involvement extending to pleura and pericardium causing pleural, pericardial effusion, and heart failure, with improvement after methylprednisolone administration. the case was a 47-year - old man who was diagnosed with mediastinal fibrosis 5 months ago with thoracoscopic biopsy after presenting emphysematous changes, retroperitonal - paravertebral pleural thickening, and pleural effusion on thorax ct. he was admitted to internal medicine with complaints of easy fatigue, vomiting, and abdominal pain. his blood pressure was 140/80 mmhg on either arms, his heart rate was 88 beats per minute, s1 and s2 were rhythmyc, s3 and s4 were absent, and 2/6 pansystolyc murmur was heard from the apex. reticulo - nodular consolidation areas were also detected in the left side of the lung. there was a marked increase in c - reactive protein and the erythrocyte sedimentation rate (esr), but the serology for connective tissue disease and perinuclear antineutrophil cytoplasmic antibodies was negative. nevertheless, creatinine level was elevated to 3.7 mg / dl. using abdominal ultrasound, grade ii hydronephrosis was determined and mr urography was performed ; soft tissue from basal pole of both kidneys extending to minor pelvis, on paraaortocaval area and on iliac chains, was like retroperitoneal fibrosis surrounding both ureters at iliac crossing level. enlarged cardiac chambers, severe left ventricular (lv) systolic dysfunction (ejection fraction : 24%), severe mitral regurgitation, and moderate pericardial effusion were revealed by echocardiogram and conventional treatment for heart failure was started, except for inhibitors of the renin- angiotensin - aldosterone system. during the follow up, creatinine level was elevated up to 9 mg / dl in conjunction with hyperkalemia, fever, nausea, and vomiting. however, the symptoms were relieved by hemodialysis and administration of intravenous ciprofloxacin. creatinine level was also fixed at 4 - 4.5 mg / dl. additionally, nephrostomia cannula was affixed and urinary output was increased up to 6 liters per day. then, the creatinine level decreased to 1.6 mg / dl and remained stable thereafter. we were concerned about the malignancy and performed thoracoscopic biopsy from the most involved site on positron emission tomography (pet) (anterolateral mediastinum on the level of left 6 - 7 the intercostal space). pathological evaluations revealed cross - sections of thick walled vessels, hyalinated connective tissue with lenphoid cells on some areas, pulmonary hyalinated granuloma, and sclerosing mediastinitis. according to cardiac mri, we considered myocarditis as a cause of dilated cardiomyopathy (figure 1), but did not perform biopsy. initially, the patient received methylprednisolone 32 mg per day, tapering 4 mg every 2 weeks. after initiation of corticosteroid treatment, the patient felt better and denied heart failure symptoms. 1.5 months later, the control echocardiogram showed ejection fraction to be 45% (figure 2). rpf is a rare disease with peak incidence in the fifth to seventh decades of life. in the present study patient who was a 47-year - old man, however, its occasional association with autoimmune diseases and its response to corticosteroids and immunosuppressive therapy suggested that it was probably immunologically mediated. mri is also essential for evaluating the extent of the disease process (1). besides, pet can be used to guide biopsy (3). in the present study, these concepts are no established terms in the literature. after restoring the function of the involved (hollow) organs, medical therapy with prednisone, immunosuppressive drugs, or tamoxifen multifocal fibrosclerosis is a rare syndrome that is characterized by fibrosis involving multiple organ systems. however, presentation of mediastinal - retroperitoneal fibrosis is rare. in one series of 491 patients, mediastinal involvement was found in only 3.3% of the idiopathic rpf cases (2). nonetheless, there were few reported cases of pericardial involvement in this combined disorder (4). in the case reported here, the patient had retroperitoneal fibrosis and massive mediastinal fibrosis with pleuro - pericardial involvement. there were some reports of multifocal fibrosclerosis with dilated cardiomyopathy as case reports in the literature (5). to the best of our knowledge, no report of myocarditis and improvement of dilated cardiomyopathy with methylprednisolone treatment is available in the patients with multifocal fibrosclerosis. omura. in 2006 reported a case of multifocal fibrosclerosis combined with idiopathic retro- peritoneal and pericardial fibrosis who had massive pericardial effusion and died with clinical signs of cardiovascular failure despite pericardiostomy and aggressive treatment (6). early administration of steroid therapy may be beneficial for heart failure symptoms due to lv systolic dysfunction and/or pericardial involvement in the patients with multifocal fibrosclerosis. however, there is no agreement on the dose and duration of steroid therapy. | multifocal fibrosclerosis is a rare syndrome of unknown cause that is characterized by fibrosis involving multiple organ systems. definitive diagnosis can only be made based on biopsy findings. in this case, the biopsy specimen of the patient demonstrates pulmonary hyalinated granuloma or sclerosing mediastinitis. there are few reports of multiple fibrosclerosis with heart failure. here, we reported a case of retroperitoneal fibrosis with massive mediastinal involvement extending to pleura and pericardium causing pleuro- pericardial effusion with dilated cardiomyopathy. systolic dysfunction was improved and pericardial effusion disappeared with methylprednisolone treatment. |
pain is a noxious and a harmful felling of a living organism that arising from inflamed or injured tissues. otherwise, responses to noxious stimuli may be enhanced (hyperalgesia) or normally innocuous stimuli. more studies confirm that in normal conditions, a fibers are mainly relevant with non - noxious input from particular encapsulated receptors. in difference noxious stimuli are mediated by glutamate (excitatory amino acid) which acting on -amino-3-hydroxy-5-methylisoxazole (ampa) receptors (2). oxytocin is a mammalian neurohypophysial hormone that synthesized in the hypothalamic paraventricular nucleus (pvn) and supraoptic nucleus. oxytocin receptors also widely distribute in the cns, including hypothalamus, thalamus olfactory system, cortex, and dorsal horn in the spinal cord (3). nitric oxide (no) is a significant mediator of nociception in acute and chronic pain conditions (4, 5) at the peripheral and central levels (6, 7). the experimental and clinical studies demonstrated that no has analgesic potential and could induce analgesia (8). the l - arginine - no pathway has a critical role in the n - methyl - d - aspartate (nmda)-mediated and glutamate nociceptive responses. the results of considering the role of aspartame on formalin test in mice approved the activation of nmda receptors could modulate pain - related behavior via no - cyclic guanosine monophosphate (no / cgmp)-glutamate release cascade (9). no / cgmp signaling pathway has play an essential role in developing endurance to opioid analgesia (10). different biological functions of oxytocin done by it receptor that coupled to gtp binding proteins (g q/11) which stimulate together with g the activity of phospholipase c- isoforms (3). intraperitoneal or intracisternal injection of oxytocin was showed the anti - nociceptive effect in rat or mice (11, 12). moreover, when oxytocin injected into periaqueductal gray matter and raphe magnus nucleus remarkable reduced nociceptive response in rats (13, 14). direct application or electrical stimulation of the paraventricular nucleus of hypothalamus which led to endogenous released of oxytocin on the spinal cord produced a clear analgesic effect (15). intrathecally injection of naloxone before the stimulation of the paraventricular nucleus and oxytocin administration reduced significantly analgesic effect of oxytocin (6). oxytocin inhibits sensory glutamatergic transmission between afferent fibers and dorsal horn neurons in the spinal cord (16, 17). according to the above mentioned studies we aimed to determine the rolls of no on anti- nociceptive effects of oxytocin in mice. in this study 216 male albino mice (20 - 25 g) were used. animals were prepared from animal house of medical school of iran university that housed in 12 hr/12 hr light / dark cycle at 222c. food and water was freely available. the experimental protocols were approved by the animal experimentation ethics committee (aeec) of medical school of iran university. in this experiment, these chemicals were used : oxytocin, atosiban, l - name powder and l - arginine powder (sigma co., usa). the animals were divided randomly into two experimental groups, tail flick and formalin test. each experimental group consists of three main groups including : saline, l - arginine (50 mg / kg) and l - name (10 mg / kg) ip injection. 15 min after injection in each of the following groups, the animals in each groups divided to the three subgroups including : saline (n=12), oxytocin (1 mg / kg) (n=12) and oxytocin (1 mg / kg) + atosiban (1 mg / kg) (n=12) was injected ip and then after 30 min of use the formalin test and tail flick were to evaluate the response to pain. it was used to assess the anti - nociceptive effect of the drugs by measuring the latency of response (18). in this method, animal tail is exposed to a powerful light beam and the response latency period for flicking the tail off the beam is recorded (19). we apply radiant heat to the tail at 5 - 8 cm from the tip by using a tail flick apparatus. tail flick latency time was estimated as the time from the onset of the heat exposure to the withdrawal of the tail. they adjusted the intensity of radiant heat to yield the baseline latencies of 2 - 4 sec. in order to avoid tissue damages the heat stimulus was discontinued after 7 sec (cut off point = 7 sec). in this study, 216 male albino mice were divided into 18 groups : the animals were divided randomly into two experimental groups tail flick and formalin test. each experimental group consists of three main groups including : saline, l - arginine (50 mg / kg) and l - name (10 mg / kg) ip injection. 15 min after injection in each of the following groups, the animals in each groups divided to the three subgroups including : saline (n=12), oxytocin (1 mg / kg) (n=12) and oxytocin (1 mg / kg)+atosiban (1 mg / kg) (n=12) was injected ip and then after 30 minutes of use the formalin test and tail flick were to evaluate the response to pain (table 1). this interventional study was conducted using 216 male albino mice. animals were placed in acrylic testing chambers individually (30 30 30 cm) and they were allowed to acclimate for at least 60 min. we placed a mirror at a 45 angle below the floor of the chamber to allow an unobstructed view of the mouse paws. then, 20 l of formalin 2.5% was injected sc. into the plantar surface of the left hind paw. the behaviors were observed for the next 60 min and they were quantified as described by dubuisson and dennis (1977) as : 0 = normal weight bearing on the injected paw.. 2 = elevation of the injected paw so that at most the nails touch the floor.. a biphasic response of nociceptive behavior in mouse was the result of subcutaneous formalin injection. the early phase (phase 1) starts immediately after formalin application, followed by a lull and a more prolonged but delayed second phase (phase 2). average of scores was considered as the phase 1 in the first 5 min and the area under curve (auc) of pain scores during 1060 min after formalin injection was considered as phase 2 (21). time course of anti - nociceptive response was formed by plotting the mean of latency times as a function of time for of individual drug. anti - nociception was quantified as either tail flick latency time or % mpe or auc which includes both maximum effects and duration of action (18). the % mpe was calculated as [(t1 - t0) / (t2 - t0) ] 100. the auc was calculated considering tail flick latency time (tfl) from 15 to 90 post - injection based on trapezoid rules (18) as follows : auc = 15 tfl[(min 15) + (min 30) + (min 45) + (min 60) + (min 90) / 2 ]. spss 16 was applied for the analysis and the results were statistically analyzed by one - way analysis of variance (anova) followed by tukey test and p<0.05 were considered to significant. in this study 216 male albino mice (20 - 25 g) were used. animals were prepared from animal house of medical school of iran university that housed in 12 hr/12 hr light / dark cycle at 222c. food and water was freely available. the experimental protocols were approved by the animal experimentation ethics committee (aeec) of medical school of iran university. in this experiment, these chemicals were used : oxytocin, atosiban, l - name powder and l - arginine powder (sigma co., usa). the animals were divided randomly into two experimental groups, tail flick and formalin test. each experimental group consists of three main groups including : saline, l - arginine (50 mg / kg) and l - name (10 mg / kg) ip injection. 15 min after injection in each of the following groups, the animals in each groups divided to the three subgroups including : saline (n=12), oxytocin (1 mg / kg) (n=12) and oxytocin (1 mg / kg) + atosiban (1 mg / kg) (n=12) was injected ip and then after 30 min of use the formalin test and tail flick were to evaluate the response to pain. it was used to assess the anti - nociceptive effect of the drugs by measuring the latency of response (18). in this method, animal tail is exposed to a powerful light beam and the response latency period for flicking the tail off the beam is recorded (19). we apply radiant heat to the tail at 5 - 8 cm from the tip by using a tail flick apparatus. tail flick latency time was estimated as the time from the onset of the heat exposure to the withdrawal of the tail. they adjusted the intensity of radiant heat to yield the baseline latencies of 2 - 4 sec. in order to avoid tissue damages the heat stimulus was discontinued after 7 sec (cut off point = 7 sec). in this study, 216 male albino mice were divided into 18 groups : the animals were divided randomly into two experimental groups tail flick and formalin test. each experimental group consists of three main groups including : saline, l - arginine (50 mg / kg) and l - name (10 mg / kg) ip injection. 15 min after injection in each of the following groups, the animals in each groups divided to the three subgroups including : saline (n=12), oxytocin (1 mg / kg) (n=12) and oxytocin (1 mg / kg)+atosiban (1 mg / kg) (n=12) was injected ip and then after 30 minutes of use the formalin test and tail flick were to evaluate the response to pain (table 1). this interventional study was conducted using 216 male albino mice. animals were placed in acrylic testing chambers individually (30 30 30 cm) and they were allowed to acclimate for at least 60 min. we placed a mirror at a 45 angle below the floor of the chamber to allow an unobstructed view of the mouse paws. then, 20 l of formalin 2.5% was injected sc. into the plantar surface of the left hind paw. the behaviors were observed for the next 60 min and they were quantified as described by dubuisson and dennis (1977) as : 0 = normal weight bearing on the injected paw.. 2 = elevation of the injected paw so that at most the nails touch the floor. a biphasic response of nociceptive behavior in mouse was the result of subcutaneous formalin injection. the early phase (phase 1) starts immediately after formalin application, followed by a lull and a more prolonged but delayed second phase (phase 2). average of scores was considered as the phase 1 in the first 5 min and the area under curve (auc) of pain scores during 1060 min after formalin injection was considered as phase 2 (21). time course of anti - nociceptive response was formed by plotting the mean of latency times as a function of time for of individual drug. anti - nociception was quantified as either tail flick latency time or % mpe or auc which includes both maximum effects and duration of action (18). the % mpe was calculated as [(t1 - t0) / (t2 - t0) ] 100. the auc was calculated considering tail flick latency time (tfl) from 15 to 90 post - injection based on trapezoid rules (18) as follows : auc = 15 tfl[(min 15) + (min 30) + (min 45) + (min 60) + (min 90) / 2 ]. spss 16 was applied for the analysis and the results were statistically analyzed by one - way analysis of variance (anova) followed by tukey test and p<0.05 were considered to significant. the result showed that area under the curve (auc) in the acute phase of the formalin test, in sub - groups oxytocin + saline and l - name + saline were significantly decreased compared with saline + saline group (p<0.05, p<0.001), and also auc in oxytocin+ saline compared to l - name + saline and l - arginine + saline were significantly decreased (p<0.05 and p<0.01 respectively) (figure 1). comparison of auc (area under the curve) between different groups in the acute phase of the formalin test. p<0.05, p<0.001 compared to saline + saline group ; p<0.01 compared between oxt + saline and l - arginine + saline group ; p<0.05 compared between oxt + saline and l - name + saline group. statistical analyses were made using the one - way anova followed by the tukey 's test post hoc in the late phase of the formalin test also auc in sub - groups ooxytocin + saline and l - name + saline were significantly decreased compared with saline + saline group (p<0.01, p<0.001), and also auc in oxytocin + saline compared to l - name + saline and l - arginine + saline were significantly decreased (p<0.05, p<0.001 respectively) (figure 2). comparison auc (area under the curve) between different groups in the chronic phase of the formalin test. p<0.01 and p<0.001 compared to saline + saline group ; p<0.01 compared between oxt + saline and l - arginine + saline group ; p<0.05 compared between oxt + saline and l - name + saline group. statistical analyses were made using the one - way anova followed by the tukey 's test post hoc auc in the acute phase of the formalin test, in sub - groups oxytocin + l - arginine, oxytocin+ l - name and atosiban + oxytocin + saline group (figure 3). comparison auc (area under the curve) in atosiban (at)+ oxt + saline, oxt + l - name and oxt + l - arginine groups with oxt+ saline group in the acute phase of the formalin test. statistical analyses were made using the one - way anova followed by the tukey 's test post hoc but in the late phase of the formalin test auc in sub - groups oxytocin + l - arginine and atosiban + saline + oxytocin were significantly increased compared with oxytocin + saline group (p<0.05) (figure 4). comparison auc (area under the curve) in oxt+ l - name, oxt+l - arginine and atosiban (at) + oxt + saline groups with oxt + saline group in the chronic phase of the formalin test. statistical analyses were made using the one - way anova followed by the tukey 's test post hoc the tail flick test results show that the mpe (figure 5a) and auc (figure 5b), in oxytocin + saline increased significantly compared with saline + saline, l - name+ saline and l - arginine + saline groups (p<0.001), but the mpe and auc between l - name+ saline and l - arginine + saline groups with saline + saline group were not significant. furthermore, the mpe (figure 6a) and auc (figure 6b), in oxytocin + l - name increased significantly compared with oxytocin + l - arginine and oxytocin + atosiban + saline groups (p<0.001), but not significant compared to the oxytocin + l - name group. comparison between l - name + saline, l - arginine + saline and oxt + saline groups with saline + saline group in the acute phase of the tail flick test. (a) : mpe (maximum possible effect) (b) : auc (area under the curve). values are meanssem (n=12). p<0.001 compared to saline + saline group ; p<0.01 compared between oxt + saline and l - arginine + saline ; p<0.001 compared between oxt + saline and l - name + saline group. statistical analyses were made using the one - way anova followed by the tukey 's test post hoc comparison between oxt + l - name, oxt + l - arginine and oxt + at + saline groups with oxt + saline group in the chronic phase of the tail flick test. mpe (maximum possible effect) (a) and auc (area under the curve) (b). values are meanssem (n=12). p<0.001 compared to oxt + saline group ; p<0.001 compared to oxt+l - name. statistical analyses were made using the one - way anova followed by the tukey 's test post hoc in different studies, several tests were used to assess the pain in order to evaluate the analgesic effect of oxytocin, but all of them were associated with acute pain in form of thermal or mechanical. here, tail flick test related to acute pain, and formalin test was used in order to evaluate the analgesic effects of oxytocin. in this study, mice were received normal saline and oxytocin showed decreased responses in both phases of the formalin test and also decreased responses in the tail flick test. our results showed that oxytocin not only in acute pain, but also played a role in chronic pain which leading to decrease the pain responses in both phases. results of other studies have also shown that oxytocin has analgesic effect (22) and part of analgesic effect of that is related to inhibition of spinal glutamatergic transmission (23, 24). one of the proposed mechanisms for the analgesic effect of oxytocin in normal animals is the action of oxytocin on its g protein receptor which leads to metabolisation of intracellular calcium and subsequently a nonspecific cation channel open and potassium channel close (15, 25). it was demonstrated that oxytocin can block glutamate activation and causing decreased nociceptive responses in spinal cord cells (17). on the other hand glutamate nmda oxytocin is also affected on the recipient of the mu () and kappa () opioid and causing the analgesia (26). the accumulation of the effects of oxytocin, are on accumbency nuclei, limitans thalamic nucleus, motor trigeminal, sustantia gelatinosa cores, trigeminal core of the spinal cord and spinal cord (28). in another study it was showed that the injection of oxytocin into posterior vagus motor nuclei stimulates gall bladder via nmda receptor no cgmp pathway that indicates another evidence of oxytocin involvement in this pathway (29). it was also reported that in acute and chronic recurrent pain a significant change is occurred in content of oxytocin in human cerebrospinal fluid (csf) and plasma (30). a mechanism for peripheral analgesic effect of oxytocin is inhibition of membrane depolarization of sensory neurons sensitive to capsaicin and the increase in intracellular calcium (31). some studies show that injection of formalin into the metatarsus increased glutamate release only during the acute phase while in the chronic phase such change does not occur (32) and subcutaneous administration of oxytocin, reduce the inflammation which induced by carrageenan injection (33). injection of formalin intraplantar causing increase in glutamate release in acute phase (32) and increase nitrite and nitrate in spinal cord dorsal horn (34). nitrite and nitrate release induced by formalin injection may be caused by increasing glutamate levels. because oxytocin has an inhibitory effect on glutamate activity then, reduced responses in acute formalin test phase could related to decreased production of nitrite and nitrate induced by glutamate. also, in this study it was showed that anti - nociceptive effect of oxytocin in acute phase of formalin test was not antagonized by atosiban probably could due to indirect effect of oxytocin in suppress of glutamate release. it was also reported that intrathecal injection of atosiban has a hyperalgesic effect in rats with inflammation. on the other hand, an intrathecal injection of atosiban alone has no effect on the mechanical and thermal stimulation in normal rats this means that endogenous oxytocin does not interfere in spinal analgesic action in normal rats (30). but in current study atosiban antagonized anti - nociceptive effect of oxytocin in chronic phase of formalin test and this indicate oxytocin via its receptors in spinal cord dorsal horn causing anti - nociceptive effect. in a study it was reported that oxytocin reduces the pain by effect on its receptor in dorsal horn of the spinal cord (35). the results showed that in tail flick test oxytocin caused increase in latency and atosiban antagonized this effect that was expectable because these effects were shown in previous study (36). another finding of this study was that the l - name at a dose of 10 mg / kg has analgesic effect on both phases of the formalin test, which this effect was more pronounced in chronic phase. that it was predictable because, as stated before, the main effects of nitric oxide is in the chronic phase of the formalin test. other studies indicate that nos inhibitors reduce the pain that induced by formalin injection and change the electrophysiological activity of dorsal horn neurons (37, 38). l - name significantly reduced the release of glutamate and finally formalin induced nitrite and nitrate during the acute phase of the formalin test (39). this finding may have confirmed the findings of current study showed that the l - name effect on the acute phase of the formalin test. in the chronic phase of the formalin test and tail flick test groups which received oxytocin and l - arginine showed significant differences compared with group which received oxytocin and normal saline. so that l - arginine injected with oxytocin may lead to reduced analgesic effect of oxytocin while l - arginine alone has no effect on the pain response in mentioned tests. it has been reported that chronic administration of l - arginine reduces the analgesic effect of morphine (39). another study suggested that the analgesic effects of oxytocin, at least in part of its effects induced by the and opioid receptors (15). it was proposed that reduction of anti - nociceptive effect of morphine through administration of l - arginine is accompanied to reduced morphine concentration in different region of brain and spinal cord (40). some of studies showed that anti - nociceptive effect of oxytocin at least partly caused by and opioid receptors (24). these receptors are in periaqueductal grey matter (pag) and oxytocin in this region via mentioned receptors caused its anti - nociceptive effect partly and effect of l - arginine to reduce anti - nociceptive effect of oxytocin in this manner can described. the injection of l - name with oxytocin was no effect on oxytocin - induced analgesic responses. increase nitric oxide has an analgesic effect whereas l - name induces analgesic effect in some models of acute and chronic pain (38). since the l - name has a decreasing effect on the production of nitrite and nitrate produced in the spinal cord followed by formalin injection and l - arginine administration as a no donor in formalin injection can increase the levels of nitrite and nitrate surface of the spinal cord and debilitating the analgesic effect of oxytocin. administration of l - arginine in the spinal cord can increase the levels of no in the spinal cord which reduced the analgesic effect of oxytocin but l - name had no role in anti - nociceptive effect of oxytocin. the authors declare that there is no conflict of interests regarding the publication of this paper. | objective(s):analgesic effects of oxytocin and it 's the other physiological effects were well - known. the aim of present study was determination of nitric oxide role on analgesic effects of oxytocin in mice.materials and methods:216 male albino mice were divided randomly into two experimental groups, tail flick and formalin test. each experimental group consists of three main groups including : saline, l - arginine (50 mg / kg) and l - name (10 mg / kg) intraperitoneal (ip) injection. 15 min after injection in each of the following groups, the animals in each groups divided to the three subgroups including : saline (n=12), oxytocin (1 mg / kg) (n=12) and oxytocin (1 mg / kg) + atosiban (1 mg / kg) (n=12) was injected ip and then after 30 min of use the formalin test and tail flick were to evaluate the response to pain.results:area under the curve (auc) in the late phase of the formalin test, in sub - groups oxytocin + saline and l - name were significantly decreased compared with saline + saline group (p<0.05 to p < 0.001), and auc in l - arginine + saline and atosiban + saline + oxytocin were significantly increased compared with oxytocin + saline group (p<0.05). tail flick tests as well as a significant reduction in the auc in oxytocin + l - arginine and atosiban + saline + oxytocin groups were compared with oxytocin + saline group (p<0.001).conclusion : oxytocin has analgesic effects in the acute and late phase of pain in the formalin test. moreover, exogenous increasing of nitric oxide reduced the analgesic effect of oxytocin. |
depression is among the commonest of psychiatric disorders, and inflammatory mechanisms are among the very many mechanisms that have been suggested to drive its pathophysiology. interferon - related depression is important in medicine and neurology, and the last decade has seen a spurt of research in the field. this article therefore summarizes the present state of knowledge about interferons and their role in depression in humans. interferon (ifn) activity was first discovered by isaacs and lindenmann in the year 1957, when they came across a substance that interfered with the pathogenic activity of live influenza viruses in the chorioallantoic membranes of chick embryos that had previously been infected by heat - attenuated influenza viruses. ifns were the first cytokines to be discovered and the recombinant form of ifn- was the first cytokine to be approved, in 1986, to treat hairy cell leukaemia [4, 5 ]. ifn species are distinctively different from one another in their functional profile ; for example, they may exhibit antiviral and antiproliferative actvity, or they may stimulate antigen presenting cells. this variation in activity is species - specific, and in a given species the ifn secretion is specific to the cell of origin and the virus eliciting the response. ifns are classified as types i, ii, and iii (table 1), based on the cell surface receptors to which they bind. the ifn type - i family consists of the following : 13 different ifn- proteins coded by 14 ifn- genes ; ifn-, which is a product of the ifnb1 gene ; and 6 other single gene - coded ifns (ifn-, ifn-, ifn-, ifn-, ifn-, and ifn-) [7, 8 ]. type i ifns can be produced by almost all cells in the body but are predominantly secreted by leukocytes (ifn-) and fibroblasts (ifn-) [7 - 9 ]. the type ii ifn family consists of ifn-, coded by the ifng gene that is predominantly secreted by t cells and natural killer (nk) cells. ifn-1, ifn-2 and ifn-3 (also known as il-29, il-28a and il-28b, respectively) and ifn-4 (also known as ifnan) form the ifn type - iii family of cytokines that are secreted by all nucleated cells in the body. other ifns have been described in animals, but are not described here because they are out of the scope of the present article. induction of types i and iii ifns (ifn-, ifn-, and ifn- ; il-28a, il-28b, and il-29) occurs after viral infection whereas type ii (ifn-) is produced after stimulation with specific antigens such as staphylococcal enterotoxin a or b [4, 9 ]. receptors for ifn family types i and ii are present on all cells in the body and receptors for ifn family type - iii are largely expressed on epithelial cells of the gastrointestinal and reproductive tracts, and on some immune cells [7, 8, 10 ]. the effector molecules involved in ifn downstream signalling that eventually results in their biological activity have not been completely defined in most cases, but one pathway that is strongly associated with ifn signalling is the jak - stat pathway. in type - i and iii ifns, the activation of jak - stat leads to the formation of ifn - stimulated gene factor-3 (isgf3) complex which translocates to the nucleus and binds to the promoter region of ifn stimulated genes to bring about their transcription [4, 8, 10, 11 ]. type - i and type - ii ifns also follow another pathway resulting in the transcription of ifn stimulating genes (isg) by nuclear translocation and binding of stat1-stat1 homodimer to gas (ifn--activated site) elements on the promoter region of isgs. interferon (ifn) activity was first discovered by isaacs and lindenmann in the year 1957, when they came across a substance that interfered with the pathogenic activity of live influenza viruses in the chorioallantoic membranes of chick embryos that had previously been infected by heat - attenuated influenza viruses. ifns were the first cytokines to be discovered and the recombinant form of ifn- was the first cytokine to be approved, in 1986, to treat hairy cell leukaemia [4, 5 ]. ifn species are distinctively different from one another in their functional profile ; for example, they may exhibit antiviral and antiproliferative actvity, or they may stimulate antigen presenting cells. this variation in activity is species - specific, and in a given species the ifn secretion is specific to the cell of origin and the virus eliciting the response. ifns are classified as types i, ii, and iii (table 1), based on the cell surface receptors to which they bind. the ifn type - i family consists of the following : 13 different ifn- proteins coded by 14 ifn- genes ; ifn-, which is a product of the ifnb1 gene ; and 6 other single gene - coded ifns (ifn-, ifn-, ifn-, ifn-, ifn-, and ifn-) [7, 8 ]. type i ifns can be produced by almost all cells in the body but are predominantly secreted by leukocytes (ifn-) and fibroblasts (ifn-) [7 - 9 ]. the type ii ifn family consists of ifn-, coded by the ifng gene that is predominantly secreted by t cells and natural killer (nk) cells. ifn-1, ifn-2 and ifn-3 (also known as il-29, il-28a and il-28b, respectively) and ifn-4 (also known as ifnan) form the ifn type - iii family of cytokines that are secreted by all nucleated cells in the body. other ifns have been described in animals, but are not described here because they are out of the scope of the present article. induction of types i and iii ifns (ifn-, ifn-, and ifn- ; il-28a, il-28b, and il-29) occurs after viral infection whereas type ii (ifn-) is produced after stimulation with specific antigens such as staphylococcal enterotoxin a or b [4, 9 ]. receptors for ifn family types i and ii are present on all cells in the body and receptors for ifn family type - iii are largely expressed on epithelial cells of the gastrointestinal and reproductive tracts, and on some immune cells [7, 8, 10 ]. the effector molecules involved in ifn downstream signalling that eventually results in their biological activity have not been completely defined in most cases, but one pathway that is strongly associated with ifn signalling is the jak - stat pathway. in type - i and iii ifns, the activation of jak - stat leads to the formation of ifn - stimulated gene factor-3 (isgf3) complex which translocates to the nucleus and binds to the promoter region of ifn stimulated genes to bring about their transcription [4, 8, 10, 11 ]. type - i and type - ii ifns also follow another pathway resulting in the transcription of ifn stimulating genes (isg) by nuclear translocation and binding of stat1-stat1 homodimer to gas (ifn--activated site) elements on the promoter region of isgs. ifns are used for the treatment of viral hepatitis, hemato - proliferative disorders, and autoimmune disorders and malignancies because of their antiviral, antiproliferative, and immunomodulatory properties, respectively. the immunogenic property of ifn- has lead to the generation of ifn- conditioned dendritic cells to induce tumor cell death, and also to its use as an adjuvant to enhance the antitumor effect of other chemotherapeutic agents. table 2 lists the usa food and drug administration approved indications and other indications for interferon therapy [13 - 22 ]. pegylation of the ifn molecule increases the size of the molecule and thereby increases the time that the molecule persists in the body. pegylated ifn-, combined with ribavarin and protease inhibitors (optional), is the most common choice of treatment for hepatitis c infection. pegylated ifn- is administered along with nucleotide analogues such as lamivudine, adefovir, entecavir, or tenofovir for chronic hepatitis b infections. many mechanisms are suggested to mediate ifn - related benefits ; because this is a considerably speculative area, only a few, brief examples are provided. ifn- may treat multiple sclerosis by inhibiting proinflammatory cytokines such as il-17 and osteopontin ; by increasing anti - inflammatory agents such as il-10 ; by attenuating leukocyte migration across the blood - brain barrier ; and by mediating tissue repair through stimulation of the release of trophic factors such as nerve growth factor. in chronic granulomatous disease, ifn- is suggested to convey benefits by stimulation of the release of superoxide and correction of impairments in oxidative metabolism. progression of malignant osteopetrosis is arrested by ifn- therapy putatively by improving osteoclast - mediated bone resorption and leucocytic superoxide production [25 - 27 ]. the neuropsychiatric adverse effects of ifns include depression, irritability, anxiety, agitation, loss of appetite, fatigue, sleep disturbance, and impaired cognition ; quality of life and functional abilities are consequently compromised. importantly, attributing all these changes exclusively to ifn treatment can be difficult because the conditions for which ifns are prescribed are often themselves associated with neuropsychiatric symptoms [28 - 30 ]. depression as a syndrome frequently complicates ifn therapy ; the prevalence is 30 - 70%. depressive symptoms are common in the early stages of treatment, but typically peak between 4 and 16 weeks. it is not always clear to what extent the risk is due to the ifn (and specifically to the type of ifn ; e.g. ifn- vs. ifn-) and to what extent the risk is due to the clinical condition for which the ifn was prescribed. therefore, risks are described separately in a later section. here, we note that, for example, a meta - analysis of randomized controlled trials (rcts) of ifns in multiple sclerosis found no increase in the risk of depression as an adverse outcome. other meta - analyses, for example coppola. and zhuang. conclusions from individual rcts are hard to draw because these rcts would not have been adequately powered to study depression as an outcome. patients with a past history of major depression are at increased risk of ifn- related depression. the experience of certain depressive symptoms appears to predict an increased risk of depression as a syndrome ; these symptoms include psychomotor retardation, somatic symptoms, and insomnia. biochemical and other changes have also been associated with ifn- related depression ; examples include antiviral treatment - induced abnormal increase in the levels of interleukin-6, interleukin-10 and soluble interleukin-2 receptor (sil-2r), and exaggerated response of the hypothalamo - pituitary adrenal axis after the first ifn dose. possible genetic risk factors have been identified ; examples include polymorphism in the transcription initiation site of the serotonin reuptake transporter gene (5-ht transporter linked polymorphic region [5-httlpr])- presence of short allele (s) ; c-1019 g polymorphism of the transcriptional control region of the 5-ht1a receptor gene ; ag poly- morphism of the cyclo - oxygenase 2 (cox2) gene (rs4648308) ; gg polymorphism of the phospholipase a2 (pla2) gene (rs10798052) ; cc genotype of interferon alpha / beta receptor 1 (ifnar1). higher dose and longer duration of ifn treatment are also associated with a higher risk of ifn - related depression. finally, interferon treatment may interact with viral genotype, as in an increased risk of depression associated with hepatitis c viral genotype a [24, 28, 35 - 38 ]. ifn- treatment - related depression in multiple sclerosis (ms) is not completely attributable to interferon therapy as the prevalence of depressive and suicidal symptoms in patients with ms is high in comparison with the general population. ifn- therapy exacerbates depression in ms patients with a history of depression [39 - 42 ]. there does not appear to be significant literature on the association between ifn- treatment and depression as a treatment - emergent adverse effect. these are largely derived from animal models, are substantially speculative in nature, and are briefly outlined below. the interaction between immune, endocrine, and neuronal pathways is believed to play an important role in interferon - related depression. ifn therapy (,) induces hypothalamo - pituitary - adrenal axis hyperactivity to release corticotropin releasing hormone (crh) from the median eminence of the pituitary gland. crh also decreases serotonin and noradrenaline in the paraventricular nucleus, prefrontal cortex, hippocampus, and the central amygdala. these neuroendocrine and neurotransmitter changes are conventionally associated with risk of depression [28, 44 ]. ifn- is suggested to modulate mood, behaviour, and the sleep - wake cycle by the activation of the proinflammatory cytokine network that comprises ifn - induced 15 kda protein, ubiquitin - specific proteinase 18, guanylate binding protein 3, interleukin 1 (il1), interleukin 6 (il6), and tumor necrosis factor (tnf-), caspase-4, and caspase-8 or death - activating protein kinases [28, 44 ]. the possible role of proinflammatory cytokines in depression has recently been reviewed by furtado and katzman. ifn- treatment - mediated induction of c - jun n - terminal kinases (jnk), and p38 promote the expression of the beta isoform of the glucocorticoid receptor, which is an inactive form of the receptor to which glucocorticoid binding does not result in the inhibition of proinflammatory cytokine release and inhibition of crh release. these changes magnify the stress response and hence the risk of treatment - emergent depression. opioid receptor activation by ifn- and ifb- increases brain prostaglandin e2 levels, in turn increasing indolamine 2,3-dioxygenase (ido). ido increases kynureninase, which inhibits kynurenine aminotransferase, resulting in excitotoxicity due to an imbalance between the nmda receptor agonists (quinolinic acid and 3-hydroxykynurenine) and antagonist (kynurenic acid). this neurotoxic challenge causes a reduction in the density of serotonergic and adrenergic neuron, and loss of neurons in the hippocampus. these neurochemical and neurohistological changes predispose to depression [28, 44, 47 - 49 ]. in the adult mammalian brain, the dentate gyrus and the ventricular - subventricular zone on the lateral wall of the lateral ventricles harbor neural stem cells (nsc). these nscs differentiate into neurons and neuroglial cells, and interference with this and related aspects of neuroplasticity is believed to predispose to depression. some of the mechanisms described earlier, such as release of corticosteroid hormones, dampen neuroplasticity in key structures such as the hippocampus and prefrontal cortex. additionally, proinflammatory cytokines such as ifn- inhibit neurogenesis by inhibiting neural stem cell differentiation [51, 52 ]. zheng. found that ifn- administration upregulates endogenous ifn- production by activation of microglial cells, leading to inhibition of hippocampal neurogenesis. administration of minocycline, an inhibitor of microglial activation, reversed cns depression by reversing the effect of ifn- on hippocampal neurogenesis. currently, selective serotonin reuptake inhibitor (ssri) drugs such as citalopram and paroxetine are administered to treat depressive symptoms that arise after ifn therapy [54, 55 ]. paroxetine treatment has been found to attenuate anxiety symptoms, depressive symptoms, and cognitive dysfunction, but other symptoms, such as fatigue, psychomotor retardation, insomnia and anorexia do not respond. in contrast, some data suggest that bupropion and modafinil may successfully treat neurovegetative symptoms such as insomnia, loss of appetite, and fatigue in the absence of mood and cognitive symptoms [28, 57 ]. ifn- induced alteration in levels of monoamines in the brain, in areas such as the prefrontal cortex and hippocampus, may be attenuated by nonsteroidal anti - inflammatory drugs (nsaids). these drugs are commonly used to treat flu - like symptoms associated with ifn- therapy and, as an additional benefit, are also known to augment the sustained virological response rate to ifn- therapy in hepatitis c infection [13, 28 ]. the inflammatory hypothesis of depression notwithstanding, there are no suitable rct data on nsaids in the treatment of the primary symptoms of depression as an ifn - related treatment - emergent adverse effect. the only study relevant to the subject examined indomethacin augmentation (75 mg / day) vs no augmentation in metastatic malignant melanoma patients treatment with ifn- 2b. this study was small (47 evaluable patients) and hence underpowered for examining depression outcomes, short (most patients were treated for, apparently, 8 weeks, and so depression may not have had an adequate chance to develop), without a placebo control, did not describe how depression was diagnosed and evaluated, and actually found that confusion and depression was (nonsignificantly) more common in the indomethacin arm. given the well - established efficacy of ssris in this regard, it is hard to expect that nsaid rcts will be conducted in interferon - associated depression. ifn therapy decreases tetrahydrobiopterin (bh4), a cofactor required for the biosynthesis of serotonin, dopamine, epinephrine, and norepinephrine, thereby predisposing to depression. bh4 levels can be increased by blocking reactive oxygen species and reactive nitrogen species production, or by the administration of folic acid, l - methylfolate, or s - adenosyl methionine. these supplements have demonstrated varying degrees of success in the monotherapy or augmentation therapy of major depressive disorder, but treatment of ifn - related depression with these supplements has not so far been examined in randomized controlled trials and should therefore be considered as a possibility in the future. treatment - related depression and fatigue are the main causes of decreased treatment adherence to ifn regimes. measures to improve and prevent depression begin with providing the patient with support to cope with the chronic illness and the stigma attached to it, bringing about lifestyle changes, and equipping the patient with information about the adverse effects of ifn therapy. it is important to monitor the patient during the initial phase of ifn therapy for early detection of significant changes in mood (however small) in order to reduce their progression ; both psychosocial and pharmacological interventions may be implemented. udina. conducted a systematic review and meta analysis to evaluate the safety and efficacy of ssris in preventing depression induced by ifn- therapy in chronic hepatitis c patients. they identified 7 relevant randomized controlled trials (rcts) and found that the prophylactic use of ssris reduced the odds of depression by 47%, relative to placebo. one rct found that prophylactic treatment with omega-3 polyunsaturated fatty acids reduced the risk of treatment - emergent depression in hepatitis c patients receiving ifn therapy. research on hepatitis c virus replication has led to the discovery of newer, directly acting antiviral agents that target viral proteases and polymerases. addition of these new antiviral drugs to an existing antiviral regimen (telaprevir, semiprevir, faldaprevir and boceprevir) or replacing the existing antiviral regimens with only direct - acting antiviral agents (ledipasvir / sofosbuvir regimen and the ombitasvir /paritaprevir / ritonavir and dasabuvir regimen) has shown greater efficacy by sustained viral clearance, and as the required duration of antiviral therapy is reduced the duration of depression is also reduced [29, 61, 62 ]. in other words, using alternatives to ifns would also reduce the risk of treatment - emergent depression in patients for whom such alternatives exist. ifn treatment, regardless of indication, is associated with a 30 - 70% risk of treatment - emergent depression ; there is probably an interaction between ifn and the indication for which the ifn is prescribed in the mediation of this risk. many neurohormonal, neurotransmitter, neurohistological, and other mechanisms have been suggested to underlie the risk. the risk of ifn - related depression is attenuated by prophylactic treatment with ssri drugs. | abstract : backgrounddepression is among the commonest of psychiatric disorders, and inflammatory mechanisms have been suggested to play a role in its pathophysiology. interferons are a superfamily of proinflammatory cytokines that play a role in host defence mechanisms. interferons are used in the treatment of a variety of autoimmune (e.g. multiple sclerosis), viral (e.g. chronic hepatitis b and c), and malignant (e.g. malignant melanoma, hairy cell leukemia) disorders ; depression, however, is a notable and clinically troublesome adverse effect.objectivethis article seeks to present a simple explanation and update for the reader about what interferons are, how interferons are classified, the clinical conditions in which interferons are used, the occurrence of depression as a clinical adverse effect of interferon therapy, possible mechanisms that explain interferon - related depression, the treatment of interferon - related depression, and the prevention of interferon - related depression.methodsa qualitative literature review is presented.results and conclusionsirrespective of the indication for ifn therapy, ifns are associated with a 30 - 70% risk of treatment - emergent depression. this risk could be due to the ifn, or to an interaction between the ifn and the indication for which it was prescribed. various neurohormonal, neurochemical, neurohistological, and other mechanisms have been put forth to explain ifn - related depression. prophylactic treatment with antidepressants reduces the risk of ifn - related depression ; antidepressants also effectively treat the condition. recent alternatives to ifns have shown to decrease the risk of treatment - emergent depression. |
posterior cortical atrophy (pca) is a neurodegenerative syndrome characterized by progressive decline in visual processing, literacy, numeracy, and other functions that depend on parietal, occipital, and occipitotemporal brain regions (benson., 1988 ; kas., most individuals with pca have alzheimer 's disease (ad) as the underlying pathology, but pca may also be caused by corticobasal degeneration (cbd), dementia with lewy bodies (dlb), and creutzfeldt - jakob disease (cjd) (renner., 2004 ; tang - wai. although a relatively homogenous syndrome, there remains scope for improving the classification of pca through consensus criteria and establishing clinicopathological correlations (crutch., there is a need for a clearer description of the relationship and overlap between pca and other related syndromes, particularly the corticobasal syndrome (cbs). although commonly considered a selective visual syndrome, a number of patients with pca develop sensorimotor signs, often asymmetric, which are more typically seen in cbs (giorelli., 2014 ; mcmonagle., 2006 ; seguin., 2011 ; tang - wai., 2003a ; whitwell., 2010). in the original proposed criteria for pca, a normal physical examination is considered supportive of a diagnosis but not mandatory (mendez., 2002). another proposed criteria excludes early parkinsonism but recognizes that it may subsequently develop and does not state how early on its presence is acceptable (tang - wai., 2004). the prevalence of motor features in pca is currently unclear, as are other potential differences between pca patients with and without such signs. the core clinical features of cbs are progressive asymmetrical limb rigidity and apraxia (boeve., 2003). there may be additional cortical signs such as myoclonus, alien limb phenomenon and cortical sensory loss and extrapyramidal signs including tremor, bradykinesia, and dystonia. all these signs contribute to the patient experiencing clumsiness and loss of function of the affected limb. historically, these clinical features were considered to be diagnostic of cbd (a 4-repeat tau neurodegenerative disease) (dickson., 2002 ; rebeiz., 1968), however, numerous clinicopathological studies have demonstrated that cbd can cause a variety of different phenotypes including progressive supranuclear palsy syndrome, frontotemporal dementia, progressive nonfluent / agrammatic aphasia, an executive - motor syndrome, and pca (armstrong., 2013 ; josephs., 2006 ; kertesz., 2000 ; lee., 2011). furthermore, it has become apparent that cbd pathology is found at autopsy in less than half of the patients who are clinically diagnosed during life (boeve., 1999 ; josephs., 2006 ; lee., increasingly, ad is recognized as an important cause of cbs but other alternative pathologies include progressive supranuclear palsy, pick 's disease, frontotemporal lobar degeneration with tar dna binding protein inclusions, dlb, and cjd (boeve., 1999 ; hu., 2009 ; josephs., 2006 ; ling., 2010 ; the term cbs was therefore coined to refer purely to the constellation of clinical features, in recognition that they may be caused by diverse underlying pathologies (boeve. cbs terminology has been in circulation for over a decade and during this time, there has been growing appreciation of the cognitive dysfunction that may feature in the disorder (rabinovici and miller, 2012). cognitive function was initially reported to be relatively well preserved until late in the disease and initial diagnostic criteria made early dementia an exclusion criterion (lang., however, increasing numbers of studies reported cognitive symptoms early in the course of cbs or even predating the emergence of motor features (graham., 2003 ; grimes., 1999 ; although no consensus yet exists for the diagnosis of cbs, proposed criteria have subsequently included cognitive dysfunction as a supportive feature (boeve., 2003) or have given equal weight to the cognitive and motor aspects of the disorder (mathew. in addition to limb apraxia, the characteristic cognitive manifestations of cbs are frontal dysfunction and language impairment (typically nonfluent aphasia), but also dysgraphia, dyscalculia, and visuospatial deficits (graham. the relationship between cbs, frontotemporal lobar degeneration, and primary progressive aphasia has been the subject of a number of studies (josephs., 2006 ; kertesz., 2000), however, the overlap between cbs and pca has received comparatively little attention. the aims of this study were to ascertain how frequently the core features of cbs were observed in a relatively large cohort of pca patients and compare the clinical and neuroimaging profiles of pca patients with and without these signs. in line with previous evidence of an association between cbs and perirolandic atrophy irrespective of underlying pathology (lee., 2011), we hypothesized that pca patients with motor features would show greater atrophy of contralateral sensorimotor cortices. the study was conducted at the dementia research centre (drc), university college london institute of neurology, at the national hospital for neurology and neurosurgery. most of the subjects in this study had attended our specialist cognitive disorders clinic for their clinical assessment. the drc database was interrogated to identify individuals with a clinical diagnosis of pca and at least 1 magnetic resonance imaging (mri) brain scan and a neurologist then reviewed their clinical notes. subjects were included if they met the original proposed clinical criteria for pca (mendez., 2002), of presentation with progressive visual complaints, intact primary visual functions, and a predominant complex visual disorder on examination, with proportionally less impaired memory and insight. they were only included in this study if they had a clearly documented neurological examination within a year of their mri scan. a total of 44 individuals with pca were identified, along with 30 healthy controls. informed consent was obtained from all subjects according to the declaration of helsinki and the study had local ethics committee approval. some of the patients had been included in preceding studies from our group (crutch., 2011, 2013a ; lehmann., 2011a, 2011b, 2012 ; kennedy., 2012, 2013 ; yong., 2013). the same neurologist reviewed all the clinical assessment notes to ascertain the age at symptom onset, mini - mental state examination (mmse) (folstein., 1975) score and the presence of limb rigidity, apraxia, myoclonus, tremor, dystonia, and alien limb phenomenon at the time of scanning. not all patients were consistently examined for cortical sensory signs or bradykinesia so these features were not considered for the purpose of this study. if the motor signs were observed on clinical examination to affect one side only or one side more than the other, this asymmetry was documented. limb rigidity is a core feature shared by all 3 of the existing diagnostic criteria for cbs (boeve., 2003 ; lang., 1994 ; mathew., 2012) and was used to define the group membership for this study. patients were classified as pca - motor if prominent limb rigidity was present or pca - pure if absent. they were not included in the pca - motor group if a very subtle increase in limb tone was only evident on testing with synkinesis. cerebrospinal fluid (csf) was analyzed for 14 - 3 - 3 protein positivity and total tau and amyloid beta (a1 - 42) concentrations (innotest platforms, innogenetics, ghent, belgium). according to our laboratory 's local reference ranges, a csf profile is considered to show 85% sensitivity for a clinical diagnosis of ad when tau > 307pg / ml and a1 - 42 1, supportive of a diagnosis of ad (bian. the only patient with a particularly high a1 - 42 concentration for ad (patient 1), nonetheless had a tau / a1 - 42 ratio > 1 and was in the pca - pure group. this individual had a typical clinical presentation for pca but was only very mildly affected (mmse 29/30) at the time of his lp. none of the patients had a positive csf 14 - 3 - 3 protein level. there were no significant differences between the pca - motor and pca - pure groups on any neuropsychological test, including assessments of visual function and naming (see table 3). there was, however, a trend toward worse performance in gesture production in the pca - motor (mean 8.6, sd 4.16) than pca - pure group (mean 11.6, sd 4.13, p = 0.08 between groups). the pca - motor group showed lower gray matter volume in the occipital and parietal lobe regions compared with controls (peak in right lateral occipital cortex, mni [52, 64.5, 15 ]), with some additional lateral temporal lobe involvement. on visual inspection, differences appeared greater in the right hemisphere than the left (fig. a similar pattern of reduced gray matter volumes in occipital and parietal lobe regions was found in the pca - pure group compared with controls (peak in right lateral occipital cortex, mni [52, 61.5, 22.5 ]), however, asymmetry between hemispheres was less pronounced. the direct comparison of pca - motor versus pca - pure did not produce statistically significant differences after correcting for multiple comparisons (fwe p 0.9). there was a significant interaction between hemisphere and group in all regions combined (p < 0.001), thalamus (p < 0.001), and putamen (p < 0.001) but not caudate (p = 0.075). as with the cortical regions of interest, pairwise comparisons revealed that this interaction was driven by lower volumes in right hemisphere regions in the pca - motor group than pca - pure and control groups. in all subcortical regions combined and the thalamus separately, controls and pca - pure showed asymmetry with greater volume in the right hemisphere, although this asymmetry was absent in the pca - motor group. the magnitude of thalamic asymmetry did not differ between controls and pca - pure but both groups were significantly more asymmetrical than pca - motor (p < 0.001). in the putamen, evidence for a left - right difference in volume was absent in pca - motor, weak in controls and strong in pca - pure, with control and pca - pure groups both showing greater volumes on the right. evidence for a difference in the magnitude of putaminal asymmetry was absent for controls versus pca - pure, weak for controls versus pca - motor (p = 0.057) and strong for pca - motor versus pca - pure (p = 0.008). large effect sizes for the difference between pca - motor and pca - pure were found in the right thalamus and right putamen. medium effect sizes were found in the right parietal, right temporal, and right central rois. small effect sizes were found in right frontal, left parietal, left central and bilateral occipital regions, left putamen, and left thalamus (supplementary table 2). these effect sizes represent greater atrophy in the pca - motor group than the pca - pure group except for the left parietal and left occipital regions where atrophy was greater in the pca - pure group. this study demonstrates an important overlap syndrome of pca and cbs and reveals significant differences in the clinical and neuroimaging profiles of pca patients with and without the core clinical features of cbs. all patients participating in the study met the originally proposed clinical criteria for pca, of which 13 (30%) also showed prominent asymmetrical limb rigidity. limb apraxia was evident on clinical examination in both the pca - motor and pca - pure groups but was seen more frequently, and was more often observed to be asymmetrical, in the pca - motor group. this difference in asymmetry of apraxia between the groups was confirmed in the subgroup who underwent standardized assessment with the aba-2,3a. myoclonus was also seen in both groups but was more often asymmetrical in the pca - motor group. rest tremor and alien limb phenomena were only observed in the pca - motor group. other than a trend toward greater impairment on gesture production tests of praxis, no significant difference in neuropsychological measures was observed between the pca - motor and pca - pure groups. clearly, the presence of prominent limb rigidity may impair an individual 's ability to produce hand gestures so it is perhaps not surprising that more prominent and asymmetrical apraxia was observed in the pca - motor group, where rigidity was used to define group membership. teasing out the relative contribution of different motor signs can be difficult ; myoclonus, tremor, and alien limb phenomena may also impact upon gesture production. the different motor signs should perhaps, therefore, be considered less as independent observations and more as a constellation of features that contribute to difficulty using the affected limb in a significant proportion of pca patients in our cohort. neuroimaging analyses revealed overlapping but distinct patterns of tissue loss in the pca - motor and pca - pure groups. both gray and white matter volume and cortical thickness techniques revealed more asymmetry in the pca - motor than the pca - pure group compared with controls, with more pronounced atrophy and reductions in thickness in the right hemisphere in the pca - motor group. the regions found to show the greatest difference in vbm between these groups were the frontoparietal operculum, supramarginal gyrus, and middle part of the cingulate gyrus, all anterior to the maxima identified in the patient - control comparisons. these differences could not be attributed to age or disease duration and suggest a greater spatial extent of atrophy in the pca - motor than pca - pure group. the cortical thickness analysis showed a similar trend toward right - sided atrophy, and particularly emphasized the involvement of the perirolandic sensory and motor cortices (bilaterally but more on the right) in the pca - motor group. subcortical region of interest volumetric analysis revealed lower volumes of putamen and thalamus in the pca - motor group compared with the pca - pure group and healthy controls, an effect that was the strongest in the right hemisphere. asymmetry, with greater atrophy in the right hemisphere, was a prominent and distinctive feature of the pca - motor group and may underlie the left upper limb motor features that were observed in these patients. the results are consistent with the hypothesis that cbs signs in pca reflect atrophy of contralateral sensorimotor cortices. the data extend the hypothesis by demonstrating that such signs are also associated with greater tissue loss in subcortical structures, namely the putamen and thalamus. the thalamus and putamen have been found to undergo significant atrophy in ad (de jong., 2008), however, their differential involvement in atypical ad phenotypes has not, to our knowledge, been systematically evaluated. thalamic and basal ganglia volume loss on mri has also been identified in cbs, however, does not appear to differentiate between cbs cases with underlying cbd or ad pathology (josephs., 2010). in our study, the control and pca - pure groups both showed greater volumes in the right thalamus and putamen. this normal asymmetry was lost in the pca - motor group, implying that these structures had undergone a greater degree of atrophy in the right hemisphere. it seems likely that the prominent motor features in the pca - motor group reflect dysfunction of a whole network of areas involved in the planning, coordination, and execution of movement. this includes the primary motor and somatosensory cortices, premotor and supplementary motor areas, and the posterior parietal and deep subcortical structures with which they connect. it was striking that the asymmetric motor features affected the left side in all subjects in the pca - motor group. interestingly, the right side was involved more than the left in a series of cbs patients presenting with language, behavioral, or motor symptoms, with left hemispheric atrophy a frequent finding (kertesz., 2000). thus, it may be that our finding of motor features affecting the left side only reflects sampling bias in terms of the patients that are referred and labeled as having pca. patients with predominantly right hemisphere deficits affecting their vision may be more likely to present to a cognitive neurologist and be diagnosed with pca than those with predominantly left hemisphere deficits such as progressive apraxia or dysgraphia. the latter type of patient is perhaps more likely to be referred to a movement disorders specialist and, if motor features are present (which would likely show a right limb predominance), be diagnosed with cbs. supporting this hypothesis, a predominantly right - sided pattern of cortical atrophy has been reported in prior imaging studies of pca (lehmann., 2011a ; whitwell., 2007), and it has been proposed that this may be because of the relatively high proportion of patients with predominantly right hemisphere deficits in most pca cohorts (lehmann., 2011a). our data showed no difference in the symmetry of cortical thickness between controls and the pca - pure group in any cortical roi. this perhaps suggests that asymmetry in pca group studies may also be driven by the subset of subjects with additional features of cbs. despite the difference in asymmetry between the pca - motor and pca - pure groups there was considerable overlap in their overall atrophy and cortical thickness patterns, with both groups showing the greatest differences from controls in occipital and parietal regions. it is therefore not surprising that apraxia and myoclonus were observed in both groups, as parietal lobe lesions may cause both of these clinical signs (fahn., there is significant pathological overlap in the etiology of pca and cbs, with both potentially being caused by underlying ad, cbd, dlb, or cjd. some clinicopathological studies investigating cbs patients with underlying ad or cbd have indicated that behavioral and/or frontal symptoms such as early personality change predict cbd pathology whereas impairment of visuospatial skills and memory, young age at onset and myoclonus are associated with ad. the presence of asymmetrical extrapyramidal signs, apraxia, or alien limb phenomena has not generally appeared to differentiate between cbs - cbd and cbs - ad (hassan., 2011 ; hu., 2009 ; lee., 2011 ; shelley., in pca, which is characterized by prominent visuospatial impairment and in which young age at onset, myoclonus, and preservation of personality are commonly seen, additional features of cbs may still therefore associate with ad pathology. contrary to the traditional view, it is in fact cbd that often appears to present without motor symptoms (with a frontal cognitive and/or behavioral syndrome) (lee., 2011) or with motor features that are symmetrical (hassan., 2010), ad pathology was confirmed in the 2 pca - motor patients who underwent postmortem examination and was suggested by an ad - like csf profile in the 2 other pca - motor patients who underwent lp. the finding of additional lbp in the pca - motor case is intriguing, particularly given this subject 's history of extracampine hallucinations, and raises the possibility that concomitant lbp may influence the phenotype of ad. additional lbp was found in 2 of the 5 pathologically confirmed cbs - ad patients reported by josephs. (2010), one of whom developed visual hallucinations 6 years into her illness. two of the 6 patients in the tang - wai pca series with parkinsonism had ad pathology with concomitant lbp ; both subjects also had visual hallucinations, although neither the hallucinations nor parkinsonism were present initially (tang - wai., 2004). another 2 of the subjects in this series had cbd at postmortem, having shown signs of asymmetrical parkinsonism and apraxia during life, demonstrating that pca with motor features can be associated with non - ad pathology too. this has also been suggested by a previous csf study, in which 1 of the 3 pca subjects with asymmetric motor features had an ad - like csf profile but csf was normal for the other 2 (seguin., 2011). larger clinicopathological series will be needed to investigate whether ad with lbp does associate with motor features in pca and to ascertain how frequently the phenotype is caused by cbd. there is some evidence that imaging signatures may help to differentiate cbs subjects with pathologically confirmed ad (cbs - ad) from those with underlying cbd pathology. greater atrophy of temporoparietal cortex and precuneus has been observed in patients with cbs - ad whereas cbs - cbd patients demonstrated more frontal atrophy (josephs., 2010 ; whitwell., cbs patients with an ad - like csf profile have also shown greater hypoperfusion in precuneus and posterior cingulate cortex on single photon emission computed tomography scans than cbs patients with non - ad like csf (borroni., 2011). in our study, the fact that indirect (vs. controls) and direct comparisons between the pca - motor and pca - pure groups revealed predominant impairment of parietal and occipital but not more frontal regions supports the idea that the group differences reflect heterogeneity within the pca syndrome, of which ad remains the commonest underlying cause, rather than suggesting that cbd pathology accounts for the pca - motor phenotype. the pathological overlap in the etiology of pca and cbs emphasizes the need for improved clarity as to the clinical overlap between the 2 syndromes. considering current clinical criteria for pca (mendez., 2002 ; 2004) and cbs (boeve., 2003 ; lang., 1994 ; mathew., 2012), considerable overlap is evident meaning that some patients may fulfill criteria for both syndromes, as has been illustrated by a recent case report (giorelli., this is particularly apparent in more recent cbs criteria, which have emphasized early cognitive change in executive function, language, memory, and/or visuospatial processing. for example, the modified bak and hodges (cambridge) criteria for cbs could be met by pca patients with insidious onset and no sustained levodopa response (mandatory criteria), limb apraxia and language impairment (major features) and a combination of at least 2 of alien limb phenomenon, cortical sensory loss, dyscalculia, and visual dysfunction (mathew., 2012). although typically considered a progressive visual syndrome, anomia, and phonological processing deficits are common early features in pca (benson., 1988 ; crutch., 2013a ; mcmonagle., 2006). conversely, patients fulfilling cbs criteria may also fulfill pca criteria, which either have no exclusion criteria (mendez., 2002) or exclude only early parkinsonism (tang - wai. thus, individuals diagnosed with cbs who have visual complaints and signs such as myoclonus, limb apraxia, alien limb phenomenon, and cortical sensory loss would still meet current criteria for pca (rajagopal. first, although the presence of linguistic and executive dysfunction in cbs patients may not distinguish underlying pathologies (lee., 2011), the presence of cortical visual dysfunction, and other posterior cortical deficits may weight the diagnostic probabilities toward ad. consistent with this view, rabinovici and miller (2012) have speculated that some features within the modified cambridge criteria for cbs such as visuospatial dysfunction and myoclonus may be predictive of ad. there is some support for this idea from a recent study of cbs patients with amyloid imaging using pittsburgh compound b, which demonstrated greater visuospatial deficits in those with evidence of ad (amyloid) pathology than in those who were pittsburgh compound b - negative (burrell., 2013). second, the current evidence of cbs - like motor features in a substantial proportion of pca patients argues against any tendency to withhold currently available ad therapeutic treatments such as acetylcholinesterase inhibitors to pca patients with these signs. conversely, cbs patients presenting to movement disorders specialists should be examined closely for posterior cortical deficits and, if the phenotype suggests ad, offered appropriate treatment. the vast majority of patients with pca have underlying ad (de souza., 2011 ; 2004), and there is no evidence to date that the co - occurrence of cbs - like signs makes that diagnosis any less likely. in fact, the pathological and csf data in this study, although limited, were consistent with an underlying diagnosis of ad in all the pca - motor patients for whom this information was available. third, although a syndromic classification could be adequate for some types of research study (e.g., brain - behavior correlations or behavioral interventions), other investigations will need direct consideration of probable underlying pathology (e.g., clinical trials of protein - specific therapies). finally, the identification of cbs - like signs in patients who fulfill criteria for pca has a bearing upon how inclusively or exclusively pca should be defined in any future consensus criteria ; for instance, should the term pca only be applied to patients with predominant visual dysfunction (as specified by existing clinical criteria e.g., mendez. 2004) or should the syndrome encompass patients with progressive deterioration in other cognitive domains such as calculation, spelling, and praxis (aharon - peretz., 1999 ; seguin., 2011 ; snowden., 2007). inclusivity is intuitively appealing given that the term pca refers to the locus of focal atrophy rather than a particular set of clinical features. however, it might come at the cost of reduced specificity (in both syndromic and pathological terms) given reports of posterior cortical presentations with non - ad, non - cbd etiologies, for example cbs caused by a progranulin mutation presenting as progressive apraxic agraphia (passov., 2011). to our knowledge, this is the first study to compare directly the clinical and neuroimaging features of pca patients with and without the core motor features of cbs. one limitation of the study is the relatively small number of subjects, which may explain the finding that although volumetric and cortical thickness asymmetries were evident at the level of control - patient comparisons and between - patient group percentage effect maps, direct comparisons between the 2 groups did not survive correction for multiple comparisons. however, this is a common problem when studying relatively rare degenerative conditions (whitwell., 2007) and may be rectified with larger samples (lehmann., 2011a). the mri scans used in this study were acquired from scanners of different field strengths, which have the potential to introduce bias. however, the groups were well matched in terms of the proportion of scans acquired on each scanner, and scanner was included as a covariate in the imaging analyses to avoid an influence upon the results. another limitation of the study was that detailed neuropsychological data and a standardized clinical assessment of limb apraxia were only available in a subset of patients. although the neuropsychological results revealed a trend toward lower performance in gesture production in the pca - motor group, further study should investigate the cognitive correlates of pca with features of cbs in more detail. despite only having been performed in a small subgroup of patients, the apraxia battery demonstrated significantly more asymmetry and a greater severity of left upper limb apraxia in the pca - motor compared with pca - pure group. this highlights the value of applying standardized clinical assessment tools to investigate neurological signs, such as the aba-2 to evaluate apraxia, and the importance of assessing the left and right side separately in a condition like pca. the retrospective nature of this study, with reliance on the recording of neurological signs by a number of different clinicians, were inevitable limitations which we attempted to overcome by only including patients with a clearly documented full neurological examination. larger cohorts of patients, with clinicopathological correlation, will ultimately be required to further investigate the insights raised by this study. multicenter collaboration may be needed to achieve this, particularly if the potential genetic factors underlying phenotypic heterogeneity in pca are to be evaluated. the recent establishment of an international pca working party represents a positive step in taking such collaboration forward (crutch., 2013b), and in opening a dialog on the challenge of defining the syndrome of pca, with appreciation of the motor as well as cognitive features that it may entail. | posterior cortical atrophy (pca) is a neurodegenerative syndrome characterized by impaired higher visual processing skills ; however, motor features more commonly associated with corticobasal syndrome may also occur. we investigated the frequency and clinical characteristics of motor features in 44 pca patients and, with 30 controls, conducted voxel - based morphometry, cortical thickness, and subcortical volumetric analyses of their magnetic resonance imaging. prominent limb rigidity was used to define a pca - motor subgroup. a total of 30% (13) had pca - motor ; all demonstrating asymmetrical left upper limb rigidity. limb apraxia was more frequent and asymmetrical in pca - motor, as was myoclonus. tremor and alien limb phenomena only occurred in this subgroup. the subgroups did not differ in neuropsychological test performance or apolipoprotein e4 allele frequency. greater asymmetry of atrophy occurred in pca - motor, particularly involving right frontoparietal and peri - rolandic cortices, putamen, and thalamus. the 9 patients (including 4 pca - motor) with pathology or cerebrospinal fluid all showed evidence of alzheimer 's disease. our data suggest that pca patients with motor features have greater atrophy of contralateral sensorimotor areas but are still likely to have underlying alzheimer 's disease. |
deep hypothermic circulatory arrest (dhca) has become a worldwide specialized technique within cardiopulmonary bypass for adult aortic arch repair. this technique provides complete visualization of the aortic arch in a bloodless field with profound neuroprotection through deep hypothermia [1, 2 ]. deep hypothermia exponentially decreases cerebral metabolic rate, permitting the cessation of brain perfusion for aortic arch repair. since the cerebral metabolic rate is not zero during dhca, there is a risk of significant neurological ischemia, especially with dhca durations above (30 - 40) minutes in adults [3, 4 ]. in order to minimize this cerebral risk during dhca, perfusion adjuncts such as antegrade cerebral perfusion (acp) and retrograde cerebral perfusion (rcp) were introduced into clinical practice. furthermore, multiple pharmacologic agents has been utilized for augmented neuroprotection during dhca, despite the lack of definitive evidence for outcome benefit [8, 9 ]. given these variables in dhca, it is therefore possible that the conduct of adult aortic arch repair can significantly vary between institutions. although dhca for adult aortic arch repair was first reported in 1975 by griep, significant variation in the conduct of dhca has developed amongst thoracic aortic centers around the world. there are still no clinical guidelines for the practice of this specialized cpb technique in adults. controversy about the conduct of dhca for optimal neuroprotection has persisted with a lack of consensus and a paucity of randomized controlled trials. the clinical studies of adult aortic arch repair with dhca typically focus on individual institution experience. there remains a clinical gap in the definition of best dhca practice based on the evidence and expert consensus, although the development of international registries has recently begun to address these multiple limitations. in light of the above considerations, the purpose of this study was to evaluate the current practice of aortic arch repair in china to assess practice variations and determine opportunities for outcome improvement. the hypothesis of this study was that identified variations in the contemporary practice of dhca for adult aortic arch repair in china might offer future opportunities for optimization of clinical outcomes. a 10-item questionnaire was developed by the authors to assess conduct of dhca for adult aortic arch repair (see appendix 1). the questionnaire, formulated both in english and chinese, was administered at a leading thoracic aortic session at the 12 international congress of cardiothoracic and vascular anesthesia (iccva) held during 2010 in beijing, china. no patient or respondent identifiers were collected : participation in this study was on an anonymous basis. the study was granted expedited approval by the institutional review board at the university of pennsylvania. in view of the observational nature of the study, this was not a surprising observation, given that 79% of the 2010 iccva attendees were anesthesiologists. the majority of respondents were from low - volume surgical centers with less than one adult aortic arch repair per week. a minority of respondents were from high - volume centers with more than 100 adult aortic arch repairs per year (figure 1). the mean dhca time typically exceeded 30 minutes and frequently extended beyond 45 minutes (figure 2). the degree of hypothermia selected for adult aortic arch repair with dhca was typically profound with the majority of aortic centers conducting dhca at temperatures below 20 degrees celsius (figure 3). the typical clinical endpoint for cooling in dhca was a set temperature with clinical adjuncts including electroencephalography, cerebral oximetry, internal jugular venous saturation, and bispectral index monitoring (figure 4). ijv = internal jugular vein ; eeg = electroencephalography ; bis = bispectral index monitoring. the clinical site of temperature measurement varied widely with more than 60% of centers measuring temperature distal to the brain as reflected by their exclusion of tympanic and/or nasopharyngeal sites in their dhca temperature monitoring profiles (figure 5). frequency of temperature monitoring sites for quantification of brain hypothermia in adult deep hypothermic circulatory arrest. cerebral perfusion adjuncts for neuroprotection during dhca were collectively utilized at 2/3 of aortic centers as follows : rcp 16.7%, unilateral acp 37.0%, and bilateral acp 13% (figure 6). given the typically extended dhca times, these cerebral perfusion adjuncts appear to be collectively underutilized, given that they were absent in a third of centers. clinical monitoring of acp during aortic arch repair was predominantly with radial pressure monitoring and cerebral oximetry. transcranial doppler, ultrasound of aortic arch, and bispectral index monitoring were rarely utilized (figure 7). while a variety of pharmacologic agents were frequently employed as neuroprotective adjuncts, steroids collectively were a universal choice. this questionnaire study has sampled contemporary conduct of dhca around china, principally in low - volume adult dhca centers. low - volume medical centers in china tend to perform adult aortic arch repair at profound hypothermia, defined as a temperature below 20 degrees celsius being the common clinical endpoint for cooling. the preferred sites for temperature measurement appear, however, to be distal to the brain. the most common neuroprotective agents for dhca are steroids and propofol. in this described dhca practice model, there are opportunities for evidence - based practice improvement which will now be discussed in detail, taking the literature into account. the site of temperature measurement that best correlates with direct brain temperature matters in adult aortic arch repair, given that hypothermia is a potent neuroprotective strategy during dhca. while rectal and bladder sites reliably reflect core body temperature, they are too remote to track cerebral temperature kinetics accurately during the cooling and rewarming phase before and after dhca. although the esophagus was also a preferred site for temperature measurement, its accuracy as a surrogate for brain temperature is also impaired to its proximity to the heart and aorta, rendering it too reactive and reflective of blood and/or cardioplegia temperature. multiple studies have suggested that monitoring of the tympanic and/or nasal temperatures best approximate brain temperature. a major finding from our study is that neither of these two important temperature sites are monitored in more than 60% of adult aortic arch repairs with dhca in china. the typical selected site for clinical temperature measurement during surgery is distal to the brain, significantly raising the risk of underestimating the extent of brain hypothermia during dhca. this management technique may result in undercooling of the brain before dhca resulting in suboptimal neuroprotection. this practice may also result in cerebral hyperthermia after dhca resulting in suboptimal cerebral reperfusion and risk of neurological injury. based on these considerations, it is reasonable suggest that tympanic or nasopharyngeal temperature be measured as a surrogate for brain temperature during adult cardiopulmonary bypass for dhca and adult aortic arch repair [31, 32 ]. the ongoing variation in temperature management is consistent with recent data from adult general cardiopulmonary bypass. given the prolonged dhca times identified in this study, the conduct of dhca for neuroprotection is importantly, given that prolonged dhca time independently predicts for mortality, stroke and major delirium after adult aortic arch repair [34, 35 ]. although the optimal neuroprotective strategy remains controversial, plain dhca beyond 40 minutes without cerebral perfusion has a stroke rate > 10% in expert hands [36, 37 ]. these prolonged dhca times identified in this study are associated with low - volume aortic centers and therefore low - volume aortic surgeons who would be expected to take longer to repair the aortic arch. in this this would be reasonably straightforward, since at least 2/3 of centers are already familiar with these techniques. although cerebral perfusion adjuncts were frequently reported in this study, unilateral acp was the preferred technique. since dhca times are prolonged, expansion of this technique would optimize cerebral protection, since acp appears to be the most neuroprotective in extended aortic arch repair times [1, 3, 12, 35 ]. furthermore, given that it is already the predominant technique and that it is technically more straightforward than bilateral acp, adoption of unilateral acp as the routine cerebral perfusion during dhca would be likely to succeed, based on the findings of this study. unilateral acp via the right axillary artery is a mature technique that significantly improves important outcomes in aortic arch surgery. the monitoring of acp in this study consisted predominantly of two modalities, namely radial artery pressure and cerebral oximetry. multiple studies have demonstrated that cerebral oximetry enhances the conduct of acp by detecting cerebral malperfusion due to issues such as to an inadequate circle of willis and/or perfusion cannula malposition. as a consequence of these outcome benefits, cerebral oximetry has already become a routine monitor for acp at leading thoracic aortic centers [29, 30 ]. based on the recent literature and the findings of our dhca conduct study, cerebral perfusion by means of unilateral acp with monitoring of radial arterial pressure and cerebral oximetry should be encouraged as a clinical routine for adult aortic arch repair in china. the wide array and collective high frequency of neuroprotective agents administered for dhca throughout china agrees with the findings of a questionnaire study from the united kingdom. in this english study furthermore, the english study documented significant variations in drug dose, timing of administration and physician conviction about the evidence supporting these agents. a percentage of the respondents did not work primarily in china. despite these limitations, the trends in the conduct of dhca at low - volume centers in china were apparent. although this pilot study is limited and underpowered, it is an initial step in the evaluation of current dhca practice for adult aortic arch repair in china. the survey results provide a snapshot that offers a summary of the practice of adult aortic arch repair at low - volume centers in china. adult aortic arch repair in china is typically performed at profound hypothermia with a temperature below 20 degrees celsius as the preferred clinical end - point. temperature should be measured routinely more proximal to the brain with the preferred options including the tympanic and nasal sites. cerebral perfusion should be routine during dhca, with an emphasis on unilateral antegrade cerebral perfusion due to its current clinical penetration, efficacy and technical ease. monitoring of antegrade cerebral perfusion during dhca should routinely include radial arterial pressure and cerebral oximetry. this study has identified opportunities for practice improvement for the conduct of adult dhca in china. the development and dissemination of a consensus - based guideline would enhance this process significantly. | introductiondeep hypothermic circulatory arrest for adult aortic arch repair is still associated with significant mortality and morbidity. furthermore, there is still significant variation in the conduct of this complex perioperative technique. this variation in deep hypothermic circulatory arrest practice has not been adequately characterized and may offer multiple opportunities for outcome enhancement. the hypothesis of this study was that the current practice of adult deep hypothermic circulatory arrest in china has significant variations that might offer therapeutic opportunities for reduction of procedural risk.methodsan adult deep hypothermic circulatory arrest questionnaire was developed and then administered at a thoracic aortic session at the international cardiothoracic and vascular anesthesia congress convened in beijing during 2010. the data was abstracted and analyzed.resultsthe majority of the 56 respondents were anesthesiologists based in china at low - volume deep hypothermic circulatory arrest centers. the typical aortic arch repair had a prolonged deep hypothermic circulatory arrest time at profound hypothermia. the target temperature for deep hypothermic circulatory arrest was frequently measured distal to the brain. the most common perfusion adjunct was antegrade cerebral perfusion, typically monitored with radial arterial pressure and cerebral venous oximetry. the preferred neuroprotective agents were steroids and propofol.conclusionsthe identified opportunities for outcome improvement in this delineated deep hypothermic circulatory arrest model include nasal / tympanic temperature measurement and routine cerebral perfusion, preferably with unilateral antegrade cerebral perfusion monitored with radial artery pressure and cerebral oximetry. development and dissemination of an evidence - based consensus would enhance these practice - improvement opportunities. |
we report a genome - wide association study to iron status. we identify an association of snps in tpmrss6 to serum iron (rs855791, combined p = 1.51020), transferrin saturation (combined p = 2.21023), and erythrocyte mean cell volume (mcv, combined p = 1.11010). we also find suggestive evidence of association with blood haemoglobin levels (combined p = 5.3107). these findings demonstrate the involvement of tmprss6 in control of iron homeostasis and in normal erythropoiesis. |
|
although the most critical risk factor for development of copd is cigarette smoking, 20%30% of copd patients have never smoked.13 occupational exposures and air pollution have been associated with development and progression of copd.4,5 inhalation of airborne pollutants, including oxidant gases such as ozone, nitrogen dioxide, or particulate air pollution, may lead to activation of pulmonary inflammatory processes and lung damage.6 heavy metal exposure may also contribute to increased oxidative stress, disruption of barrier mechanisms, and impaired dna repair, resulting in inflammation and tissue destruction in the lungs, manifesting clinically as obstructive lung disease.6 only a few observational studies have demonstrated the association between pulmonary disease and heavy metal exposure (including lead and cadmium).79 recently, a study of a large sample of the us population found a significant relationship between obstructive lung disease and concentrations of cadmium and lead in the blood.10 it also demonstrated a dose - dependent inverse association between forced expiratory volume in 1 second (fev1) % predicted and serum heavy lead and cadmium levels.10 lead and cadmium can enter the body through the various routes of ingestion, inhalation, and skin absorption.8,9,11,12 in previous studies of the korean population, the systemic effects of lead and cadmium on renal function and diabetes were reported.13,14 lead and cadmium levels in the blood were associated with reduced epidermal growth factor receptor, but were not associated with prevalence of diabetes in the general korean population. however, their effect on the lung has not been evaluated in the korean population. the aim of this study was to assess the association between lead and cadmium concentrations in the blood and lung function in a large representative sample of the korean population. this cross - sectional study analyzed pooled data during 2 years (20082009) of the korean national health and nutrition examination surveys (knhanes) iv (20072009) and the 3 years of knhanes v (20102012). knhanes is an ongoing cross - sectional survey of the civilian, non - institutionalized korean population.15 the methodology of the survey has been described previously.3 a multistage, stratified, probability sampling method was used, and households for sampling units were selected based on age, sex, and geographical area. participants were informed that their household had been randomly selected to participate in this survey performed by the korean centers for disease control and prevention. they were given the right to refuse, and all participants signed an informed consent form. the survey comprised a health interview survey, a nutrition survey, and a health examination survey. data were collected by household interviews and by direct standardized physical examinations and fasting blood sampling conducted in mobile health examination centers. spirometry was performed by specially trained technicians, using the same type of dry rolling seal spirometer (model 2130, sensormedics corporation, torba linda, ca, usa) for all subjects. two trained nurses reviewed the test results and provided quality control feedback to the technicians. among 44,433 subjects whom participated in the survey between 2008 and 2012, we identified 5,972 subjects aged 20 years who completed spirometry according to the american thoracic society guidelines and whose lead and cadmium levels in the blood were measured.16 the korean centers for disease control and prevention obtained written and informed consent from all participants, and the institutional review board at severance hospital approved the study protocol (4 - 2013 - 0803). cigarette smoking status was categorized according to questionnaire items, including have you smoked at least 100 cigarettes in your entire life ? and are you currently smoking ?. all self - reported non - active smokers were classified as former smokers (smoked at least 100 cigarettes in their entire life) or never smokers (smoked less than 100 cigarettes in their entire life) based on survey question responses. obstructive lung function (olf) was defined as pre - bronchodilator fev1/forced vital capacity (fvc) < 0.7.17 blood samples were collected in fasting state during the surveys with prior agreement. graphite - furnace atomic absorption spectrometry with zeeman background correction (analyst 600 ; perkin elmer, finland) was used to measure lead and cadmium in blood. all blood metal analyses were performed at the neodin medical institute, a laboratory certified by the korean ministry of health and welfare. subjects were categorized into quartiles for each heavy metal as the 25th percentile (group 1), the 50th percentile (group 2), the 75th percentile (group 3), and the 100th percentile (group 4). categorical variables were analyzed using chi - square tests and continuous variables were analyzed using a t - test between non - olf and olf groups. the blood levels of lead and cadmium were log - transformed because the distribution of lead and cadmium levels was likely skewed in the rightward direction. analysis of covariance was used to estimate the adjusted means of continuous variables (ie, blood lead and cadmium levels, fev1, fvc, and fev1/fvc ratio), with independent variables (ie, age, sex, body mass index [bmi ], and smoking status). to compare the adjusted means for blood lead and cadmium levels, adjusted factors include age, sex, bmi, and smoking status. to compare the adjusted means of the fev1, fvc, and fev1/fvc ratio, blood lead and cadmium levels multivariate linear regression adjusted for age, sex, bmi, and smoking status was performed to evaluate the effect of blood lead and cadmium levels on lung function. the prevalence of olf was calculated in the quartile groups using multivariate logistic regression with adjustment for age, sex, and bmi. this cross - sectional study analyzed pooled data during 2 years (20082009) of the korean national health and nutrition examination surveys (knhanes) iv (20072009) and the 3 years of knhanes v (20102012). knhanes is an ongoing cross - sectional survey of the civilian, non - institutionalized korean population.15 the methodology of the survey has been described previously.3 a multistage, stratified, probability sampling method was used, and households for sampling units were selected based on age, sex, and geographical area. participants were informed that their household had been randomly selected to participate in this survey performed by the korean centers for disease control and prevention. they were given the right to refuse, and all participants signed an informed consent form. the survey comprised a health interview survey, a nutrition survey, and a health examination survey. data were collected by household interviews and by direct standardized physical examinations and fasting blood sampling conducted in mobile health examination centers. spirometry was performed by specially trained technicians, using the same type of dry rolling seal spirometer (model 2130, sensormedics corporation, torba linda, ca, usa) for all subjects. two trained nurses reviewed the test results and provided quality control feedback to the technicians. among 44,433 subjects whom participated in the survey between 2008 and 2012, we identified 5,972 subjects aged 20 years who completed spirometry according to the american thoracic society guidelines and whose lead and cadmium levels in the blood were measured.16 the korean centers for disease control and prevention obtained written and informed consent from all participants, and the institutional review board at severance hospital approved the study protocol (4 - 2013 - 0803). cigarette smoking status was categorized according to questionnaire items, including have you smoked at least 100 cigarettes in your entire life ? and are you currently smoking ?. all self - reported non - active smokers were classified as former smokers (smoked at least 100 cigarettes in their entire life) or never smokers (smoked less than 100 cigarettes in their entire life) based on survey question responses. obstructive lung function (olf) was defined as pre - bronchodilator fev1/forced vital capacity (fvc) < 0.7.17 graphite - furnace atomic absorption spectrometry with zeeman background correction (analyst 600 ; perkin elmer, finland) was used to measure lead and cadmium in blood. all blood metal analyses were performed at the neodin medical institute, a laboratory certified by the korean ministry of health and welfare. subjects were categorized into quartiles for each heavy metal as the 25th percentile (group 1), the 50th percentile (group 2), the 75th percentile (group 3), and the 100th percentile (group 4). categorical variables were analyzed using chi - square tests and continuous variables were analyzed using a t - test between non - olf and olf groups. the blood levels of lead and cadmium were log - transformed because the distribution of lead and cadmium levels was likely skewed in the rightward direction. analysis of covariance was used to estimate the adjusted means of continuous variables (ie, blood lead and cadmium levels, fev1, fvc, and fev1/fvc ratio), with independent variables (ie, age, sex, body mass index [bmi ], and smoking status). to compare the adjusted means for blood lead and cadmium levels, adjusted factors include age, sex, bmi, and smoking status. to compare the adjusted means of the fev1, fvc, and fev1/fvc ratio, blood lead and cadmium levels multivariate linear regression adjusted for age, sex, bmi, and smoking status was performed to evaluate the effect of blood lead and cadmium levels on lung function. the prevalence of olf was calculated in the quartile groups using multivariate logistic regression with adjustment for age, sex, and bmi. table 1 displays the adjusted mean blood lead and cadmium concentrations for the main covariates, including age, sex, bmi, and smoking. the blood lead level increased with age until 60 years, was higher in men than in women (2.92 g / dl vs 2.33 g / dl ; p<0.001), and was higher in current smokers than in former or never smokers (2.93 g / dl vs 2.66 g / dl and 2.49 g / dl ; p<0.001). the blood cadmium level increased with age until 60 years, was higher in women than in men (0.96 g / dl vs 1.56 g / dl ; p<0.001), and was higher in current smokers than in former or never smokers (1.68 g / dl vs 1.17 g / dl and 1.09 g / dl ; p<0.001). table 2 demonstrates the mean for fev1, fvc, and fev1/fvc ratio by quartile of blood lead and cadmium levels after adjusting for age, sex, bmi, and smoking status. the means for fev1, fvc, and fev1/fvc ratio according to stratification of age, sex, bmi, and smoking status are presented in tables s1 and s2. fev1 and fvc was lowest in the lowest quartile (group 1) of lead concentration (1.85 g / l) compared with the other three quartile groups, and the dose however, the fev1/fvc ratio was lower in the highest quartile of lead concentration than in the lowest quartile (78.4% vs 79.0% ; p=0.025). there was no difference in fev1 between the lowest quartile (0.77 g / l) and highest quartile (1.57 fvc was higher in subjects in the highest quartile than in those in the lowest quartile, but the dose response relationship was not significant. the fev1/fvc ratio was lower in the highest quartile than in the lowest quartile (78.3% vs 79.2% ; p<0.001). table 3 shows the adjusted estimates of lead and cadmium levels associated with lung function according to multiple linear regression after log - transformation. on adjustment for age, sex, and smoking status, the fev1/fvc ratio decreased with increasing concentrations of lead (estimated 0.002 ; p=0.007) and cadmium (estimated 0.005 ; p=0.001). however, blood levels of lead and cadmium were not significantly related to fev1 or fvc. on stratification for smoking status (never, former, and current), the blood lead level was associated with fev1/fvc only in never smokers (estimated= 0.003, p=0.007) while the blood cadmium level was associated with fev1/fvc in both former and current smokers (estimated= 0.011, p=0.016 and estimated= 0.008, p=0.002, respectively). among the 5,972 subjects, 5,298 (88.7%) was classified as the non - olf group and 674 (11.3%) as the olf group. the olf group was older than the non - olf group (59.7 years vs 49.3 years ; p<0.001) and contained a higher percentage of males (75.6% vs 48.0% ; p<0.001) than the non - olf group. moreover, the olf group contained a higher proportion of ever smokers (70.4% vs 41.8% ; p<0.001). the mean levels of lead (2.77 g / dl vs 2.36 g / dl ; p<0.001) and cadmium (1.18 g / dl vs 1.06 g / dl ; p<0.001) in the olf group were higher than in the non - olf group. regardless of smoking status, lead levels in the blood were all higher in the olf group than in the non - olf group. however, cadmium levels were higher in the olf group than in the non - olf group among ever smokers. figure 1 demonstrates the prevalence of olf in the quartile groups according to lead and cadmium levels. we observed that the prevalence of olf increased among current smokers when lead levels increased (p=0.004), but there was no significant dose the prevalence of olf increased among former and current smokers when cadmium levels increased (p<0.004), but there was no significant dose figure 2 demonstrates the odds ratios and 95% confidence intervals for the prevalence of olf in the quartile groups compared to the reference group of the lowest quartile according to lead and cadmium levels. there was no significant association between the prevalence of olf and lead concentrations in never, former, or current smokers. however, the risk for olf was significantly higher for subjects in the highest quartile of cadmium concentration (odds ratio 1.94 ; 95% confidence interval 1.063.57) than for those in the lowest quartile among current smokers. table 1 displays the adjusted mean blood lead and cadmium concentrations for the main covariates, including age, sex, bmi, and smoking. the blood lead level increased with age until 60 years, was higher in men than in women (2.92 g / dl vs 2.33 g / dl ; p<0.001), and was higher in current smokers than in former or never smokers (2.93 g / dl vs 2.66 g / dl and 2.49 g / dl ; p<0.001). the blood cadmium level increased with age until 60 years, was higher in women than in men (0.96 g / dl vs 1.56 g / dl ; p<0.001), and was higher in current smokers than in former or never smokers (1.68 g / dl vs 1.17 g / dl and 1.09 g / dl ; p<0.001) table 2 demonstrates the mean for fev1, fvc, and fev1/fvc ratio by quartile of blood lead and cadmium levels after adjusting for age, sex, bmi, and smoking status. the means for fev1, fvc, and fev1/fvc ratio according to stratification of age, sex, bmi, and smoking status are presented in tables s1 and s2. fev1 and fvc was lowest in the lowest quartile (group 1) of lead concentration (1.85 g / l) compared with the other three quartile groups, and the dose however, the fev1/fvc ratio was lower in the highest quartile of lead concentration than in the lowest quartile (78.4% vs 79.0% ; p=0.025). there was no difference in fev1 between the lowest quartile (0.77 g / l) and highest quartile (1.57 g / l) of cadmium concentration. fvc was higher in subjects in the highest quartile than in those in the lowest quartile, but the dose response relationship was not significant. the fev1/fvc ratio was lower in the highest quartile than in the lowest quartile (78.3% vs 79.2% ; p<0.001). table 3 shows the adjusted estimates of lead and cadmium levels associated with lung function according to multiple linear regression after log - transformation. on adjustment for age, sex, and smoking status, the fev1/fvc ratio decreased with increasing concentrations of lead (estimated 0.002 ; p=0.007) and cadmium (estimated 0.005 ; p=0.001). however, blood levels of lead and cadmium were not significantly related to fev1 or fvc. on stratification for smoking status (never, former, and current), the blood lead level was associated with fev1/fvc only in never smokers (estimated= 0.003, p=0.007) while the blood cadmium level was associated with fev1/fvc in both former and current smokers (estimated= 0.011, p=0.016 and estimated= 0.008, p=0.002, respectively). among the 5,972 subjects, 5,298 (88.7%) was classified as the non - olf group and 674 (11.3%) as the olf group. the olf group was older than the non - olf group (59.7 years vs 49.3 years ; p<0.001) and contained a higher percentage of males (75.6% vs 48.0% ; p<0.001) than the non - olf group. moreover, the olf group contained a higher proportion of ever smokers (70.4% vs 41.8% ; p<0.001). the mean levels of lead (2.77 g / dl vs 2.36 g / dl ; p<0.001) and cadmium (1.18 g / dl vs 1.06 g / dl ; p<0.001) in the olf group were higher than in the non - olf group. regardless of smoking status, lead levels in the blood were all higher in the olf group than in the non - olf group. however, cadmium levels were higher in the olf group than in the non - olf group among ever smokers. figure 1 demonstrates the prevalence of olf in the quartile groups according to lead and cadmium levels. we observed that the prevalence of olf increased among current smokers when lead levels increased (p=0.004), but there was no significant dose the prevalence of olf increased among former and current smokers when cadmium levels increased (p<0.004), but there was no significant dose figure 2 demonstrates the odds ratios and 95% confidence intervals for the prevalence of olf in the quartile groups compared to the reference group of the lowest quartile according to lead and cadmium levels. there was no significant association between the prevalence of olf and lead concentrations in never, former, or current smokers. however, the risk for olf was significantly higher for subjects in the highest quartile of cadmium concentration (odds ratio 1.94 ; 95% confidence interval 1.063.57) than for those in the lowest quartile among current smokers. in this study, we demonstrated a significant association between the fev1/fvc ratio and lead and cadmium levels in the blood in a large nationally representative sample of the korean population. upon adjusted analysis, the olf group had higher levels of lead and cadmium than the non - olf group and the prevalence of olf increased as the level of lead and cadmium increased, especially among current smokers. according to adjusted analysis, the risk of olf was higher in subjects with cadmium concentrations in the highest quartile when compared with those with the lowest quartile among current smokers. although the levels of lead and cadmium were associated with the fev1/fvc ratio and prevalence of olf, overall levels of heavy metals in the blood were lower than those stated by current safety standards.18 for both lead and cadmium, blood levels of 5 g / dl or higher are considered to increase the risk of adverse systemic health effects.19,20 recently, rokadia and agarwal reported a significant relationship between heavy metal exposure based on blood levels of lead and cadmium and obstructive lung disease in a large representative sample in the usa.10 the risk of obstructive lung disease was elevated with increased concentrations of lead and cadmium. a dose response effect between increasing cadmium concentration and progressively worsening lung function (fev1 % predicted) was observed only in smokers. however, a dose - dependent inverse association between increasing lead concentration and worsening lung function (fev1 % predicted) was observed in both smokers and never smokers. they suggested that cadmium may mediate the association between smoking and obstructive lung disease.10 our study also analyzed the relationship of blood lead and cadmium levels with lung function and prevalence of olf. compared with the study of rokadia and agarwal our study showed a higher level of lead and a lower level of cadmium in blood. a higher proportion of subjects in their study were current smokers, which could be one of the reasons for the higher blood level of cadmium. moreover, as the food chain is a major route of lead exposure, a higher level of cadmium may be related to boiled rice, which is a staple food in korea.21 particulate matter (pm)10 is one of the sources of heavy metals. over 53% of pm10 in south korea is estimated to be emitted from the vehicles with diesel engines.22 according to the study reported by kim the average daily concentrations of pm10 in the seven korean cities were similar to that described in the world health organization global guidelines for ambient air quality.21 we included not only the fev1, but also the fev1/fvc ratio as indicators of airway obstruction. although we failed to demonstrate a relationship between fev1 and blood heavy metal levels, the fev1/fvc ratio decreased with increasing concentrations of lead levels in never smokers and cadmium levels in ever smokers. a different distribution of blood lead and cadmium levels would contribute to the different relationship between blood heavy metal levels and lung function parameters when compared with rokadia and agarwal. among ever smokers, the risk of olf was elevated with increased concentrations of cadmium only. in the case of lead, the difference was not statistically significant between the different concentration quartiles regardless of smoking status. therefore, this study also supports the previous report that cadmium may be associated with smoking - related risks of olf. ingestion is a major source of exposure in the general nonsmoking population, whereas inhalation exposure is primarily seen in smokers.8,11 cigarette smoking is a major source of cadmium exposure and increases the level of cadmium in the blood of smokers as much as four to five times that in non - smokers.24 chronic exposure to cadmium leads to renal glomerular and tubular damage, disorders of calcium and bone metabolism, malignancy, and cardiovascular and respiratory disease.25 the mechanisms of the toxicity of heavy metals in the lung are still unclear. however, the induction of oxidative stress, disruption of barrier mechanisms and the extracellular matrix, and possible impaired dna repair and apoptosis were considered to be related to the mechanism of cadmium toxicity in the lung according to the experimental models.23,2629 cadmium directly affects adherence junction proteins, resulting in barrier function disruption, disorga - nizes the collagen cross - linking and elastin stabilizing the extracellular matrix, and accelerates collagen and elastin damage leading to emphysema.23,29 cadmium also generates reactive oxygen species and induces impaired dna repair and apoptosis.26,28,3032 among never smokers, occupational cadmium exposure has been considered a risk factor for the development of olf.4 increased urinary cadmium was associated with worse lung function and smoking - related emphysema.8,33 these negative effects are due to low excretion rate (a half - life as long as 1520 years) of cadmium and its tendency for accumulation.34 lead intake in humans occurs through ingestion, inhalation, and the skin. thus, human exposure to lead occurs through the food chain and drinking water, which is the major exposure pathway for the general non - smoking adult population. lead exposure through inhalation in the form of dust or vapor depends on several factors, such as occupation, tobacco use, and leisure activities.9,12 cigarettes contain nearly 2.4 g / g of lead, of which 5% is inhaled and the remainder is found in the ash and side stream smoke.12,35 although the respiratory system is one of the main routes of entry for lead, there are a limited number of studies regarding the effect of lead on the lungs, and most of these studies described the impact of lead on the hematopoietic, cardiovascular, reproductive, and nervous systems, as well as on renal disease.36,37 lymphocyte and monocyte infiltration and collagen accumulation were evident in the interalveolar septa in the lung tissues of rats exposed to lead.38 risk for lung cancer was reported among lead smelter workers in a lead cohort study.39 pulmonary function was worse in battery and exhaust workers, who showed higher blood levels of lead than the controls.9 likewise, we also found that the fev1/fvc ratio was worse as the blood lead levels increased. first, it was a cross - sectional observational study, so it is difficult to clarify the cause - and - effect relationship between cadmium and lead levels and lung function. second, questions related to occupational exposure to lead or cadmium were not specifi - cally asked, and data regarding dietary intake and amount of smoking were not considered in the analysis. however, the aim of this study was to investigate the relationship between heavy metal levels in the blood and lung function regardless of exposure and dietary intake. subjects who are exposed to heavy metals through occupation, high dietary intake, and large amounts of smoking would likely show high levels of heavy metals in the blood. lastly, the blood lead and cadmium levels were generally in the normal range because most participants in knhanes are probably not exposed to an environment that is extremely contaminated with such chemicals. therefore, there would be a limit to our ability to demonstrate a relationship between abnormally high blood levels of heavy metals and lung function. in conclusion, we demonstrated a significant association between fev1/fvc ratio and blood concentrations of lead and cadmium in the general korean population. the olf group had higher blood levels of lead and cadmium than the non - olf group. the risk for olf was elevated with increased concentrations of cadmium, especially among smokers. however, additional research with more etiologies is needed to elucidate the association between heavy metals and lung function. mean and mean differences in fev1, fvc, and fev1/fvc (%) according to age, sex, bmi, and smoking, adjusted for all other variables including blood lead level data are presented as the adjusted mean (se) and mean difference (se) unless otherwise indicated ; subjects were categorized into four groups for age, bmi, and blood lead level as the 25th percentile, the 50th percentile, the 75th percentile, and the 100th percentile. abbreviations : bmi, body mass index ; se, standard error ; fev1, forced expiratory volume in 1 second ; fvc, forced vital capacity ; ref, reference. mean and mean differences in fev1, fvc, and fev1/fvc (%) according to age, sex, bmi, and smoking, adjusted for all other variables including blood cadmium level data are presented as the adjusted mean (se) and mean difference (se) unless otherwise indicated ; subjects were categorized into four groups for age, bmi, and blood cadmium level as the 25th percentile, the 50th percentile, the 75th percentile, and the 100th percentile. abbreviations : bmi, body mass index ; se, standard error ; fev1, forced expiratory volume in 1 second ; fvc, forced vital capacity ; ref, reference. | backgroundheavy metal exposure may contribute to inflammation in the lungs via increased oxidative stress, resulting in tissue destruction and obstructive lung function (olf). in this study, we evaluated the relationship between lead and cadmium levels in blood, and lung function in the korean population.methodspooled cross - sectional data from 5,972 subjects who participated in the korean national health and nutrition examination survey 20082012 were used for this study. olf was defined as forced expiratory volume in 1 second / forced vital capacity (fev1/fvc) < 0.7. graphite - furnace atomic absorption spectrometry was used to measure levels of lead and cadmium in blood.resultsadjusted means for age, sex, body mass index, and smoking status in blood lead and cadmium levels were increased with age and were higher in men and current smokers. the fev1/fvc ratio was lower in the highest quartile group of lead (78.4% vs 79.0% ; p=0.025) and cadmium (78.3% vs 79.2% ; p<0.001) concentrations, compared with those in the lowest quartile groups. multiple linear regression demonstrated an inverse relationship between the fev1/fvc ratio and concentrations of lead (estimated 0.002 ; p=0.007) and cadmium (estimated 0.005 ; p=0.001). of the 5,972 subjects, 674 (11.3%) were classified into the olf group. among current smokers, the risk of olf was higher in subjects in the highest quartile group of cadmium concentration than in those in the lowest quartile group (odds ratio 1.94 ; 95% confidence interval 1.063.57).conclusionwe demonstrated a significant association between the fev1/fvc ratio and blood concentrations of lead and cadmium in the korean population. the risk for olf was elevated with increasing concentrations of cadmium among current smokers. |
the association of increased serum levels of acute - phase proteins with the progression of atherosclerosis and with the occurrence of atherosclerosis - related adverse events, such as coronary heart disease and myocardial infarction (mi), has been well documented in several epidemiological studies.1 - 6) currently, the pentraxin protein family is divided into two subfamilies based on size : the classical " short " pentraxin (25 kda) and the " long " pentraxin (40 - 50 kda). pentraxin 3 (ptx3) is a " long " pentraxin that is highly expressed in the heart, whereas c - reactive protein (crp) is a " short " pentraxin and is produced from the liver.7) in several recent studies,8)9) ptx3 appeared to be not only an early indicator of irreversible myocyte injury, but also a prognostic marker in patients with acute myocardial infarction (ami). the global registry of acute coronary events (grace) risk score,10)11) designed in 94 hospitals and 14 countries, has been used as a tool to predict death in - hospital12) and death after discharge13) in patients with acute coronary syndrome (acs). the grace risk score is represented by the following three categories ; st segment elevation mi (stemi), non - st segment elevation mi (nstemi), and unstable angina pectoris (uap). acs represents a broad spectrum of ischemic myocardial events including ua, nstemi, and stemi that are associated with high morbidity and mortality despite early diagnosis, medical intervention and management.14) our hypothesis is that ptx3 is a prognostic biomarker in patients with acs. we estimated the all - cause mortality or death / mi, in - hospital and to 6 months, using the grace risk scores and compared these estimates to serum ptx3 concentrations. the aim of this study was to prove whether the value of ptx3 could be a prognostic marker, with the use of the grace risk assessment tool, in acs patients. mary 's hospital, 137 patient subjects with acs, with or without st segment elevation, underwent percutaneous coronary intervention (pci) ; those who had no prior pci and/or follow - up coronary angiography were enrolled. there were 108 male and 29 female patients enrolled, with a mean age of 6112 years. patients were informed of the investigative nature of the study, and written informed consent was obtained before enrollment. patients with acs were classified into the following standard subtypes : stemi, nstemi and uap. the grace diagnostic criteria of inclusion for ami, according to the rationale and design of the grace investigators, was met if patients had a cardiac ischemic symptom and at least one of the following increases in cardiac enzymes : 1) creatine kinase mb fraction (ck - mb) > 2 times upper limit of the hospital 's normal range, and/or 2) positive troponin t result.10) nstemi was defined as occurrence of acute mi with positive cardiac enzyme results, with or without accompanying electrocardiographic changes other than st segment elevation. stemi was defined as persistent st segment elevation of 1 mm in 2 contiguous electrocardiographic leads or the presence of a new left bundle branch block with positive cardiac enzyme results.10) the diagnostic inclusion criteria for uap, according to the rationale and design of the grace investigators, was met if patients had a cardiac ischemic symptom with serial enzymes and st segment elevation negative for mi.10) patients were excluded if they had 1) prior pci and/or follow - up coronary angiogram, or 2) prior coronary artery bypass graft (cabg). each patient 's individual grace risk score, including the parameters of age, heart rate, systolic blood pressure, serum creatinine level, killip class, presence of cardiac arrest at admission, st segment deviation, and elevated cardiac enzymes for all - cause mortality, in - hospital and to 6 months, was calculated using the published risk score calculator from the grace registry. full details of the grace risk assessment tool have been previously published.10) we estimated the all - cause mortality or death / mi, in - hospital and to 6 months, using the grace risk scores and compared it with serum ptx3 concentrations. a coronary angiogram was performed using the judkins ' method, following the puncture of the femoral artery or via a radial artery approach according to current guidelines from the american college of cardiology / american heart association / society for cardiovascular angiography and intervention (acc / aha / scai) 2005 guideline update for pci.15) significant stenosis was defined as a diameter stenosis of 50% or greater. a standard antiplatelet therapy and other medications for acs were provided according to current guidelines from the acc / aha16)17) and the european society of cardiology (esc).18) in all patients, aspirin (300 mg / day) and clopidogrel (600 mg / day) were loaded before procedure. an intravenous bolus of 100 u / kg weight of unfractionated heparin was given, and then additional heparin boluses were given to maintain an activated clotting time of 250 - 300 seconds during the procedure.19)20) during the procedure, blood was drawn into ethylenediaminetetraacetic acid vacuum containers. ptx3 was assayed with a noncommercial enzyme linked immuno sorbent assay (elisa), based on the monoclonal antibody mnb10 and rabbit anti - serum. group comparisons for continuous variables of baseline clinical characteristics were performed using the analysis of variance test, and analysis for categorical data was performed using the test. comparisons between the groups for serum ptx3 concentration were analyzed using an independent t - test, which was conducted using the sas statistical software, version 9.1 (sas institute, cary, nc, usa). in multivariate logistic regression analysis, the value for median serum ptx3 concentration was used as a cut - off point to determine an independent parameter for all - cause mortality in - hospital and to 6 months. mary 's hospital, 137 patient subjects with acs, with or without st segment elevation, underwent percutaneous coronary intervention (pci) ; those who had no prior pci and/or follow - up coronary angiography were enrolled. there were 108 male and 29 female patients enrolled, with a mean age of 6112 years. patients were informed of the investigative nature of the study, and written informed consent was obtained before enrollment. patients with acs were classified into the following standard subtypes : stemi, nstemi and uap. the grace diagnostic criteria of inclusion for ami, according to the rationale and design of the grace investigators, was met if patients had a cardiac ischemic symptom and at least one of the following increases in cardiac enzymes : 1) creatine kinase mb fraction (ck - mb) > 2 times upper limit of the hospital 's normal range, and/or 2) positive troponin t result.10) nstemi was defined as occurrence of acute mi with positive cardiac enzyme results, with or without accompanying electrocardiographic changes other than st segment elevation. stemi was defined as persistent st segment elevation of 1 mm in 2 contiguous electrocardiographic leads or the presence of a new left bundle branch block with positive cardiac enzyme results.10) the diagnostic inclusion criteria for uap, according to the rationale and design of the grace investigators, was met if patients had a cardiac ischemic symptom with serial enzymes and st segment elevation negative for mi.10) patients were excluded if they had 1) prior pci and/or follow - up coronary angiogram, or 2) prior coronary artery bypass graft (cabg). each patient 's individual grace risk score, including the parameters of age, heart rate, systolic blood pressure, serum creatinine level, killip class, presence of cardiac arrest at admission, st segment deviation, and elevated cardiac enzymes for all - cause mortality, in - hospital and to 6 months, was calculated using the published risk score calculator from the grace registry. full details of the grace risk assessment tool have been previously published.10) we estimated the all - cause mortality or death / mi, in - hospital and to 6 months, using the grace risk scores and compared it with serum ptx3 concentrations. a coronary angiogram was performed using the judkins ' method, following the puncture of the femoral artery or via a radial artery approach according to current guidelines from the american college of cardiology / american heart association / society for cardiovascular angiography and intervention (acc / aha / scai) 2005 guideline update for pci.15) significant stenosis was defined as a diameter stenosis of 50% or greater. a standard antiplatelet therapy and other medications for acs were provided according to current guidelines from the acc / aha16)17) and the european society of cardiology (esc).18) in all patients, aspirin (300 mg / day) and clopidogrel (600 mg / day) were loaded before procedure. an intravenous bolus of 100 u / kg weight of unfractionated heparin was given, and then additional heparin boluses were given to maintain an activated clotting time of 250 - 300 seconds during the procedure.19)20) ptx3 was assayed with a noncommercial enzyme linked immuno sorbent assay (elisa), based on the monoclonal antibody mnb10 and rabbit anti - serum. group comparisons for continuous variables of baseline clinical characteristics were performed using the analysis of variance test, and analysis for categorical data was performed using the test. comparisons between the groups for serum ptx3 concentration were analyzed using an independent t - test, which was conducted using the sas statistical software, version 9.1 (sas institute, cary, nc, usa). in multivariate logistic regression analysis, the value for median serum ptx3 concentration was used as a cut - off point to determine an independent parameter for all - cause mortality in - hospital and to 6 months. a total of 137 consecutive patients with acs (mean age, 6112 years, m : f ratio 108 : 29), including 76 (55.5%) with stemi, 38 (27.7%) with nstemi, and 23 (16.6%) with uap, were studied. the baseline clinical and laboratory findings of the three groups were summarized in table 1. the serum ptx3 concentration was not correlated with crp (r=0.199, p=0.058), ck - mb (r=0.022, p=0.830), ischemia modified albumin (r=-0.103, p=0.375), brain natriuretic peptide albumin (r=0.159, p=0.296) and pro - brain natriuretic peptide (r=0.260, p=0.074). the serum ptx3 concentration was significantly correlated with troponin t (r=0.332, p=0.001) (fig. the serum ptx3 concentration was significantly correlated to death / mi in - hospital (r=0.242, p=0.015) and death / mi to 6 months (r=0.227, p=0.023). the serum ptx3 concentration was not correlated to all - cause mortality in - hospital (r=0.112, p=0.269) and to 6 months (r=0.132, p=0.191) (table 2). the serum ptx3 concentration exhibited a significant increase in stemi (2.42.1 ng / ml) as compared to the uap group (1.30.9 ng / ml) with a p=0.017. but there was no significant difference between the nstemi and uap groups (1.91.4 ng / ml vs. 1.30.9 ng / ml, p=0.083, respectively), as well as between the stemi and nstemi groups (2.42.1 ng / ml vs. 1.91.4 ng / ml, p=0.185, respectively) (fig. 2). among the parameters determining the grace risk scores, the degree of killip class in congestive heart failure (chf) was independently associated with the supramedian ptx3 concentration [odds ratio : 4.221 (95% confidence interval : 1.038 - 4.787), p=0.040 ] (table 3). the cut - off value of serum ptx3 concentration (0.88 ng / ml) shows a sensitivity (87.5%) and a specificity (69.1%) for predicting the probability of all - cause mortality in - hospital (> 3%), as the highest tertile of grace risk assessment, and the cut - off value of serum ptx3 concentration (0.92 ng / ml) shows a sensitivity (78.2%) and a specificity (50.0%) for predicting the probability of death / mi in - hospital (> 5%) (fig. a total of 137 consecutive patients with acs (mean age, 6112 years, m : f ratio 108 : 29), including 76 (55.5%) with stemi, 38 (27.7%) with nstemi, and 23 (16.6%) with uap, were studied. the baseline clinical and laboratory findings of the three groups were summarized in table 1. the serum ptx3 concentration was not correlated with crp (r=0.199, p=0.058), ck - mb (r=0.022, p=0.830), ischemia modified albumin (r=-0.103, p=0.375), brain natriuretic peptide albumin (r=0.159, p=0.296) and pro - brain natriuretic peptide (r=0.260, p=0.074). the serum ptx3 concentration was significantly correlated with troponin t (r=0.332, p=0.001) (fig. the serum ptx3 concentration was significantly correlated to death / mi in - hospital (r=0.242, p=0.015) and death / mi to 6 months (r=0.227, p=0.023). the serum ptx3 concentration was not correlated to all - cause mortality in - hospital (r=0.112, p=0.269) and to 6 months (r=0.132, p=0.191) (table 2). the serum ptx3 concentration exhibited a significant increase in stemi (2.42.1 ng / ml) as compared to the uap group (1.30.9 ng / ml) with a p=0.017. but there was no significant difference between the nstemi and uap groups (1.91.4 ng / ml vs. 1.30.9 ng / ml, p=0.083, respectively), as well as between the stemi and nstemi groups (2.42.1 ng / ml vs. 1.91.4 ng / ml, p=0.185, respectively) (fig. 2). among the parameters determining the grace risk scores, the degree of killip class in congestive heart failure (chf) was independently associated with the supramedian ptx3 concentration [odds ratio : 4.221 (95% confidence interval : 1.038 - 4.787), p=0.040 ] (table 3). the cut - off value of serum ptx3 concentration (0.88 ng / ml) shows a sensitivity (87.5%) and a specificity (69.1%) for predicting the probability of all - cause mortality in - hospital (> 3%), as the highest tertile of grace risk assessment, and the cut - off value of serum ptx3 concentration (0.92 ng / ml) shows a sensitivity (78.2%) and a specificity (50.0%) for predicting the probability of death / mi in - hospital (> 5%) (fig. although crp has been used as a worldwide diagnostic biomarker in ischemic heart diseases, the increased serum crp levels in the acute conditions such as acs have been considered a nonspecific response to myocardial injury,21) and the actual role of crp in the pathogenesis of heart damage is still debated.22)23) peri.8) reported serum ptx3 as an early indicator of ami in humans and with no correlation between serum concentrations of ptx3 and crp. the grace risk scoring system, a multinational registry involving all subsets of acs including stemi, nstemi and uap, derived from clinical parameters at the time of hospitalization, was found to accurately predict mortality at 6 months.10) parameters in this grace scoring system are age, history of chf, history of mi, elevated resting heart rate, low systolic blood pressure on arrival, st - segment depression, elevated initial serum creatinine, and elevated cardiac enzymes in - hospital.10) recently, latini.9) reported the acute - phase protein ptx3 as a predictor of 3-month mortality after adjustment for major risk factors and other acute - phase prognostic markers. in our results, the role of ptx3 as a prognostic biomarker was shown by an increased serum ptx3 that was closely related to death due to mi, in - hospital or to 6 months, in acs patients, including stemi, nstemi, and uap groups. recently, several studies have mentioned that the plasma ptx3 level had increased in patients with heart failure and was independently associated with an increased risk for cardiac events.24)25) suzuki.24) demonstrated that the concentration of plasma ptx3 levels was significantly higher in patients with heart failure than in control subjects and increased with advancing new york heat association (nyha) functional class, especially in severe patients with heart failure and nyha class iii or iv. in this study, the serum ptx3 concentration was significantly correlated to troponin t and the degree of killip class, in chf, among the parameters determining the grace risk scores, and the degree of killip class was independently associated with an incremental change in the serum ptx3 level. to establish the role of ptx3 in the pathophysiology of chf, further investigations are required in larger populations via multicenter trials. inflammatory mediators are intimately associated with the cascade of events leading to atherosclerotic plaque initiation, development, and rupture. a study by inoue.26) compared 52 patients with stable angina pectoris (sap) to 16 patients with uap and reported that ptx3 was not associated with coronary risk factors including hypertension, diabetes mellitus and hyperlipidemia ; the value of ptx3 was significantly higher in the uap than in the sap group. they suggested that the levels of plasma ptx3 had increased in patients with arterial inflammation, especially uap, and that the detection of ptx3 was due to ptx3 having originated from the atherosclerotic plaque itself, thereby reflecting active atherosclerosis. therefore, ' ptx3 ' will be useful for the prediction of uap. in contrast, salio.27) reported, in a mouse model, that ptx3 plays a nonredundant, regulatory, cardioprotective role in ami and suggested that modulation of the complement cascade contributes to the cardioprotective function of ptx3. although our data found much evidence converging to support inoue 's report, we need to conduct further research in a larger population. kotooka.28) reported that pci also induces a significant inflammatory reaction in the injured vessel wall and enhances plasma ptx3 concentration that leads to the development of neointimal thickening and restenosis after coronary stenting. however, to elucidate the mechanism of in - stent restenosis after pci, more analysis of ptx3 is warranted. first, there is the limitation of " time gap " between the sampling of ptx3 during the procedure and the calculation of grace risk score at admission, including the difference of " door to balloon time " (stemi : nstemi : uap ; 2.62.4 : 8.99.7 : 17.27.2, respectively, p=0.001). second, despite several studies indicating ptx3 as a prognostic biomarker of acs, a normal range for ptx3 levels has not been established. last, our investigators suggest that the actual long - term outcomes in acs patient subjects could be confirmed via future follow - up coronary angiography or telephone interview. the killip class that reflects chf is an independent factor associated with an incremental change in the serum ptx3 level. our investigators suggest that the serum ptx3 level provides important information for risk stratification of chf diagnosis, among the parameters determining grace risk scores of acs subjects, including subtypes stemi, nstemi and uap. first, there is the limitation of " time gap " between the sampling of ptx3 during the procedure and the calculation of grace risk score at admission, including the difference of " door to balloon time " (stemi : nstemi : uap ; 2.62.4 : 8.99.7 : 17.27.2, respectively, p=0.001). second, despite several studies indicating ptx3 as a prognostic biomarker of acs, a normal range for ptx3 levels has not been established. last, our investigators suggest that the actual long - term outcomes in acs patient subjects could be confirmed via future follow - up coronary angiography or telephone interview. the killip class that reflects chf is an independent factor associated with an incremental change in the serum ptx3 level. our investigators suggest that the serum ptx3 level provides important information for risk stratification of chf diagnosis, among the parameters determining grace risk scores of acs subjects, including subtypes stemi, nstemi and uap. | background and objectivespentraxin 3 (ptx3) was shown to be elevated in the acute phase of acute myocardial infarction (ami) and to have prognostic significance in ami patients. the aim of this study was to estimate whether the value of ptx3 could be used as a prognostic biomarker, with the global registry of acute coronary events (grace) risk assessment tool, in patients with acute coronary syndrome (acs).subjects and methodsbetween july 2007 and june 2008, 137 patient subjects (mean age : 6112 years, m : f=108 : 29) with acs who underwent coronary intervention, but did not have a prior percutaneous coronary intervention (pci) and/or follow - up coronary angiogram, were enrolled. we estimated the all - cause mortality or death / mi, in - hospital and to 6 months, using the grace risk scores and compared these estimates with serum ptx3 concentrations.resultsthe serum ptx3 concentration showed a significant increase in st segment elevation myocardial infarction (stemi) greater than the unstable angina pectoris (uap) group (2.42.1 ng / ml vs. 1.30.9 ng / ml, p= 0.017, respectively), but did not show a significant difference between non - st segment elevation myocardial infarction (nstemi) and the uap group (1.91.4 ng / ml vs. 1.30.9 ng / ml, p=0.083, respectively). the serum ptx3 concentration was closely related to death / mi in - hospital (r=0.242, p=0.015) and death / mi to 6 months (r=0.224, p=0.023), respectively. the serum ptx3 concentration was not related to all - cause mortality in - hospital (r=0.112, p=0.269) and to 6 months (r=0.132, p=0.191), respectively. among the parameters determining the grace risk scores, the degree of killip class in congestive heart failure (chf) was independently associated with the supramedian ptx3 concentration [odds ratio : 2.229 (95% confidence interval : 1.038 - 4.787), p=0.040].conclusionthe serum ptx3 level provides important information for the risk stratification of chf among the parameters determining the grace risk scores in subjects with acs. |
hypertensive disease, in which there is persistent pathologic elevation of arterial pressure and increased total peripheral resistance, is associated with vascular lesions in the brain, heart, kidneys, and eyes. elevation of systemic blood pressure causes both focal and generalized retinal arteriolar constriction, presumably mediated by autoregulation. a prolonged duration of particularly high blood pressure can be associated with a breakdown of the inner blood - retinal barrier, with extravasation of plasma and red blood cells. retinal hemorrhages, cottonwool spots, intraretinal lipid, and, in severe cases, the development of a macular star configuration of intraretinal lipid can be seen [13 ]. when the choroidal vessels are severely affected by elevated blood pressure, as in acute hypertension, fibrinoid necrosis of choroidal arterioles can cause occlusion of areas of choriocapillaris, with a subsequent breakdown of the outer blood - retinal barrier. in severe cases the optic nerve can be involved. although the retinal vascular changes and optic neuropathy are well known, hypertensive choroidopathy usually does not receive as much attention. hypertensive choroidopathy has been reported in toxemia of pregnancy, renal disease, pheochromocytoma, and malignant hypertension. a 50-year - old man presented with a painless loss of vision in his both eyes and dull, pressure - like frontal headache. the best - corrected visual acuity (bcva) was 20/200 and 20/50 in the right and left eyes, respectively. he had a history of anterior ischemic optic neuropathy in the right eye 30 years ago. slit - lamp examination showed serous retinal detachment in both eyes and optic disc swelling in the left eye (figures 1 and 2). retinal arteriolar narrowing, vascular tortuosity, and arteriovenous nicking were identified in both eyes. fundus fluorescein angiography (fa) showed window defect associated with the macular cystoid change. indocyanine green angiography (ia) showed decreased perfusion of the choroid at the macula in both eyes. he had a history of hypertension 1 year ago, but had no medical treatment. on posttreatment day 30, the serous retinal detachment disappeared in both eyes (figures 3 and 4). his bcva was recovered to 20/500 and 20/16 in the right and left eyes, respectively. the optic disc in the right eye remained pale due to anterior ischemic optic neuropathy 30 years ago. severe systemic hypertension is associated with significant damage of end organs, such as eyes, heart, central nervous system, and kidneys. the ophthalmic artery branch of the internal carotid artery supplies the optic nerve and retina, extraocular muscles, and eyelids. branches of ophthalmic artery include the central retinal artery and short and long posterior ciliary arteries. the central retinal artery and vein supply the inner (anterior) two thirds of the retina. the choroidal circulation receives blood primarily from the short and long posterior ciliary arteries and delivers blood to the retinal pigment epithelium, optic nerve, and outer (posterior) one third of the retina. the retinal photoreceptors and pigment epithelium are nourished by an inner layer of the choroid which is called the choriocapillaris. accelerated hypertension and/or ophthalmic / ciliary artery occlusion may result in choroidal ischemia. with complete ophthalmic artery occlusion, both compromise of ciliary arteries may occur without retinal artery involvement, leading to choroidal ischemia, which causes hypertensive choroidopathy. the rpe becomes necrotic ; this may result in serous retinal detachment and/or localized pigment epithelial detachment. some of these are attributed to a breakdown of the inner blood - retinal barrier with retinal endothelial cell decompensation. it is notable that no active leakage is observed in the area with serous retinal detachment in our patient. ia shows hypofluorescence along the retinal artery. although it is unclear that this finding is cause or effect, it may play a role in the pathogenesis of this case. the narrowed arterioles, vascular tortuosity, and arteriolovenous nicking in the retinal vessels were also observed. it seems that the patient had a history of longstanding chronic hypertension, and a sudden bp elevation triggered it off and formed this condition. after antihypertension treatment, the serous retinal detachment disappeared, and his bcva was recovered. in most cases with hypertensive choroidopathy, visual acuity returns to normal by controlling their bp. however, there is a case reporting that the visual acuity was not recovered in spite of being controlled the bp. a patient with those findings should be considered as hypertensive choroidopathy and treated with antihypertension therapy as soon as possible. | purpose. we report a case of hypertensive choroidopathy with bilateral serous retinal detachments. patient. a 50-year - old man underwent bilateral serous retinal detachments. retinal arteriolar narrowing, vascular tortuosity, and arteriovenous nicking were identified in both eyes. the blood pressure was 206/125 mmhg. the patient was diagnosed with bilateral hypertensive choroidopathy and treated with oral antihypertensive treatment. results and discussion. one month after antihypertensive treatment, the serous retinal detachments resolved and the visual acuity improved. a patient with those findings should be considered as having hypertensive choroidopathy and treated as soon as possible. |
exposure to disinfection by - products (dbps) of drinking water is multiroute and occurs in households serviced by municipal water treatment facilities that disinfect the water as a necessary step to halt the spread of waterborne infectious diseases. biomarkers of the two most abundant groups of dbps of chlorination, exhaled breath levels of trihalomethanes (thms) and urinary levels of two haloacetic acids, were compared to exposure estimates calculated from in - home tap water concentrations and responses to a questionnaire related to water usage. background thm breath concentrations were uniformly low. strong relationships were identified between the thm breath concentrations collected after a shower and both the thm water concentration and the thm exposure from a shower, after adjusting for the postshower delay time in collecting the breath sample. urinary haloacetic acid excretion rates were not correlated to water concentrations. urinary trichloroacetic acid excretion rates were correlated with ingestion exposure, and that correlation was stronger in a subset of individuals who consumed beverages primarily within their home where the concentration measurements were made. no correlation was observed between an average 48-hr exposure estimate and the urinary dichloroacetic acid excretion rate, presumably because of its short biological half - life. valid biomarkers were identified for dbp exposures, but the time between the exposure and sample collection should be considered to account for different metabolic rates among the dbps. further, using water concentration as an exposure estimate can introduce misclassification of exposure for dbps whose primary route is ingestion due to the great variability in the amount of water ingested across a population.imagesfigure 1figure 2figure 3figure 4figure 5figure 6 |
|
it is characterized by a quick loss of renal function, which develops over hours to days. problems causing obstruction in the urinary system are considered under the topic of post - renal failure. different precipitating factors that cause obstruction throughout the ureteral trace, urine bladder tumors, and urethral obstructions consequently leads to post - renal failure. there are multiple well - known etiologies for acute renal failure, but labial fusion in postmenopausal female is a quite rarely encountered pathology among obstructive uropathies and only a few cases have been reported on the association of arf and labial fusion in the postmenopausal female. it is most commonly seen in prepubertal girls (especially in the first 2 years of life) and rarely older women,. the etiological factor is an association with low estrogen levels, chronic inflammation / irritation of the vulval skin, lichen sclerosus and absence of sexual activity. most of the time, clinical presentation of labial fusion is urinary complaints as urinary incontinence, urinary frequency, voiding dysfunction and recurrent urinary tract infections,. we presented a rare case with acute renal failure due to total labial fusion and successful surgical management of a postmenopausal woman with total labial adhesions. a 92-year - old woman was referred to urogynecologic evaluation for urinary retention for the last 3 days. she described difficulty voiding, urgency, urinary incontinence, urinary tract infection, vaginal pressure, vulvar itching or irritation for the last 4 years. she had been evaluated by gynecology and obstetrics department and treated with topical estrogens therapy for 4 weeks without any improvement or side effects. on urogynecological examination, the external genitalia revealed an atrophic vulva and fused labia minora at the midline. the fused labia completely covered the vaginal introitus, clitoris, and the external urethral meatus (fig. laboratory results were as follows : bun:68 mg / dl, cr:5,6 mg / dl, na:139 meq / l, k:5.1 meq / l, crp:10.7 mg / dl. the patient was hospitalized for further analysis and treatment. on her ultrasonographic examination ; localization, parenchyma echogenicity were normal ; there was not solid or cystic lesion but moderate pelvocaliectasis in both kidneys. abdominal and pelvic tomography showed normal gynecologic anatomy and there was no extrarenal pathology. with the suspicion of urethral obstruction and post - renal acute renal failure development due to labial fusion, 16 gauge catheter was inserted percutaneously into the bladder under ultrasonography guidance to achieve a suprapubic urine diversion. renal functions returned to normal levels (bun was decreased to 21 mg / dl from 68 mg / dl, serum cr was decreased to 0,9 mg / dl from 5.6 mg / dl) within 4 days. according to result of urine culture antibiotherapy 2). there were no anatomical abnormalities in the vaginal canal, cervix and urethral meatus. 3 - 0 vicryl rapide stitches were continuously applied to the edges of skin and vaginal mucosa to form contact with each other (fig. 3). punch biopsie of the vulvar adhesions was acquired at the time of surgery. patient was discharged with instructions to perform twice daily topical estrogen and steroids (clobetasol 0.05%) to the vaginal introitus for 4 weeks. the patient was seen for postoperative evaluation at 3 months follow - up after surgery. she reported complete resolution of all urinary symptoms and no recurrence of labial fusion was noted (fig. urologic pathologies causing acute postrenal failure typically result from obstruction of urinary flow and the frequency varies among age groups. prostatic hypertrophy and malignancies are the most common cause of obstruction in the advanced age groups and vesicoureteral reflux, bladder dysfunction (including neurogenic bladder), and ureteropelvic junction obstructions in the childhood lead to renal disease. although they are rare, urinary prolapses and labial fusions, are usually encountered in older women. most of the published data of labial fusion in the postmenopausal female population are case reports, at the same time symptoms in this literature are with related urinary complaints. agglutination initially occurs only in the posterior aspect of the labia and urethra is partially obstructed. in most advanced cases the urethral and vaginal orifices are completely covered by fusion. when the urine can not freely exit the vagina, it can lead to urinary retention and recurrent urinary tract infections. in addition,, postmenopausal females with symptomatic labial fusion present with vulvar pruritis, dyspareunia, urinary incontinence, urinary retention, difficulty in voiding, frequency and dysuria. it has been associated with recurrent trauma, vulvovaginitis and inflammation caused by an infection, mechanical irritation, low endogenous estrogen, atopic eczema or lack of intercourse as causative factors,. an alternative etiology for these adhesions may include vulvar dystrophies such as lichen sclerosis. in this case, biopsy findings showed lichen sclerosus and it seems that the hypoestrogenic state, lichen sclerosus and lack of intercourse were the main participant for the labial fusion. the first - line management of labial adhesions in the postmenopausal patient is topical estrogen or steroids replacement therapy, although it has not high success rate. when the topical oestrogens therapy failed, labial separation by means of blunt / sharp dissection is required. in our case, local estrogen treatment was not effective and we performed labial separation by blunt dissection. postoperative topical steroids and estrogen therapy and daily manual separation of the labia can be used to prevent recurrence of the adhesions. in summary, we report a case of postmenopausal woman who presented with labial fusion - related urinary retantion and acute renal failure and these adhesions was treated with a combination of surgery and topical steroids and estrogen therapy with complete resolution of the urinary symptoms. faruk doan and serdar baaranolu (1)(3) (1) the conception and design of the study, or acquisition of data, or analysis and interpretation of data. (2) drafting the article or revising it critically for important intellectual content. (3) final approval of the version to be submitted. | acute renal failure is characterized by rapidly disruption in kidney function and postrenal causes typically result from obstruction of urinary flow. multiple etiologies were described for acute renal failure, but labial fusion in postmenopausal female is a quite rarely encountered pathology among postrenal causes. only a few cases have been presented in postmenopausal women presenting with urinary retention. we present a case with acute renal failure due to complete labial fusion in a postmenopausal woman and its treatment. |
scheuermann s disease (juvenile kyphosis dorsalis) is a structural kyphosis of the thoracic spine initially described by scheuermann in 1921. it occurs commonly in adolescents (0.48.3% of the general population) and in most cases is characterized by minimal deformity and few clinical symptoms. the purpose of the present paper is to present the case of a patient with scheuermann s disease and severe neurological deficit due to a thoracic disc hernia at the level of kyphos, to review the literature and compare with previously published similar cases. he had gradually developed a gait disorder and bilateral numbness of lower limbs in the past 5 months. during that period he was unable to walk and a week before his admission he developed spastic paraplegia. he had a muscle strength of grade ii according to the medical research council (mrc) scale. a barely detectable contraction could be seen below the knees by palpation over the muscles (m1 on the mrc scale). knee and ankle reflexes were brisk bilaterally, clonus was present in both ankles as well. light touch and pin prick sensation were diminished over both lower limbs and absent from the knees downward. rectal tone and sensation while urinating were decreased. plain radiographs of the spine in standing position revealed anterior wedging of more than 5 of several adjacent vertebrae (t7:12, t8:14, t9:17, t10:15) at the apex of the kyphosis and vertebral endplate irregularities. the thoracic kyphosis from t5 to t12 measured 66 (fig. 1). a magnetic resonance imaging scan revealed thoracic disc heniation with spinal cord compression at t8t9 level (apex of the kyphosis). the intervertebral spaces from t6 to t10 were also very narrow and the vertebral bodies had an anterior wedging (figs. 2, 3). 1a, b anteroposterior and lateral radiographs of the thoracic spine in standing position, at the time of admission. 2a, b magnetic resonance imaging scan revealed thoracic disc herniation with spinal cord compression at t8t9 level (apex of the kyphosis)fig. 3three - dimensional reconstruction computed tomography of the thoracic spine preoperatively a, b anteroposterior and lateral radiographs of the thoracic spine in standing position, at the time of admission. the thoracic kyphosis from t5 to t12 is 66 a, b magnetic resonance imaging scan revealed thoracic disc herniation with spinal cord compression at t8t9 level (apex of the kyphosis) three - dimensional reconstruction computed tomography of the thoracic spine preoperatively surgical treatment was decided based on the severity of the neurological deficit. a right seventh rib transthoracic approach to the spinal column was performed followed by decompression at t8t9 level. we performed an anterior fusion using plate, screws, an interbody titanium cage and also a posterior fusion from t6 to t12 using a double - rod multihook and transpedicular screws segmental instrumentation system. bone grafts were applied between t8 and t9 and intertransversaly from t7 to t10 (fig. 4).fig. note the anterior and posterior spinal fusion a, b postoperative anteroposterior and lateral radiographs of the thoracic spine. note the anterior and posterior spinal fusion postoperatively the patient had a surprisingly rapid improvement of the neurological deficit. four weeks after the operation he could walk steadily and 2 months later his neurological examination was entirely normal. at 2 years follow - up the patient had a normal gait, he was symptoms free and there was no increase of the spinal deformity. scheuermann in 1921 described a condition, which he called juvenile dorsal kyphosis, distinguishing it from the more common postural kyphosis. scheuermann proposed that the kyphosis resulted from avascular necrosis of the ring apophysis of the vertebral body. schmorl suggested that the vertebral wedging was caused by herniation of disc material into the vertebral body (schmorl s nodes). according to ippolito and ponseti a biochemical abnormality of the collagen and matrix of the vertebral endplate cartilage may be another contributing factor. bradford. claimed that osteoporosis may be responsible for the development of scheuermann s disease. mechanical factors and repetitive trauma have been also considered to play a significant role in the appearance of the disease. case reports in monozygotic twins support the theory that there is also a genetic contribution. in conclusion, the criteria for the diagnosis of scheuermann s disease are : (1) more than 5 of wedging of at least three adjacent vertebrae at the apex of the kyphosis, (2) endplates irregularities and (3) a thoracic kyphosis of more than 45. our patient had typical roentgenografic features of scheuermann s disease and his kyphosis was 66 from t5 to t12. neurological complications in scheuermann s disease are rare [24, 7, 11, 15, 18, 21, 24 ]. three different types of neural compression have been reported : (1) extradural spinal cyst, (2) compression of the cord at the apex of the kyphos and (3) disk hernia at the apex of the kyphos. to the best of our knowledge only 20 cases fall in the last category [24, 8, 12, 14, 17, 2124 ]. table 1cases of scheuermann s disease causing spinal cord compression as the result of thoracic disc herniationreferenceslevelage / sexfindingsappro achprocedureresults (follow up)muller t1040 mparaplegianot reportednot complete recoveryvan landingham t7t8t917 mspastic paraparesis, no sphincter dysfunctionpt7t9 laminectomycomplete recovery (4 months)roth. t9t1061 mspastic paraparesispt9t10 laminectomyparaplegiaturinese and raven t5t7t816 mspastic paraparesis, sphincter dysfunctionbed rest, minerva jacketcomplete recovery bradford and garcia t7t816 mspastic paraparesispt7t9 laminectomyresidual hypereflexia(120 months) ryan and taylor t8t918 mspastic paraparesistt8t10 partial vertebrectomy, anterior spinal fusionspastic paraparesis(36 months)yablon. t7t829 mspastic paraparesis, sphincter dysfunctionct / tt7t8 discectomy and fusioncomplete recovery (14 months)lesoin. (six cases) t9t1049 fmonoparesis (left)pt8t10 laminectomynot complete recovery (12 months)t8t955 fspastic paraparesistt8t9 discectomysmall motor deficit (8 months)t11t1261 mmonoparesis (right)pposterior spinal fusionnot complete recovery (10 months)t8t927 mlower back pain, babinski s sign (right)plt8t9 discectomy, t7t10 posterior spinal fusioncomplete recovery (3 months)t8t930 mlower back pain, slight motor deficit (left)plt8t9 discectomy, t8t9 posterior spinal fusioncomplete recovery (3 months)t8t935 mspastic paraparesisplt8t9 discectomy, t8t9 posterior spinal fusionsmall motor deficit (3 months)bohlman and zdeblick (two cases)t11t12t12l138 fmonoparesis. back and leg pain (for 16 years)ctt11l1 discectomy and fusioncomplete recovery (36 months)t8t925 fback and leg pain (for 7 years)tt8t9 discectomy and fusionsignificant pain relief (26 months)stambough. t6t7t821 mspastic paraparesistt6t8 discectomy, anterior spinal fusion complete recovery (24 months)bhojraj and dandawate (three cases)t11t1216 mspastic paraparesis, urinary hesitancypt10t12 laminectomy, posterior interbody fusion complete recovery (36 months)t12l124 mspastic paraparesis, urinary hesitancypt12l1 laminectomy, posterior interbody fusioncomplete recovery (24 months)t11t1216 fspastic paraparesispt11t12 laminectomy, posterior interbody fusiontransient worsening postoperatively, subsequently complete recovery (15 months)chiu and luk t11l235 fspastic paraparesistt11l2 discectomy, spinal fusion small motor deficit (24 months)this report (2005)t8t914 mrapidly progressive spastic paraparesis, finally spastic paraplegiatt8t9 discectomy, anterior fusion, t6t12 posterior fusioncomplete recovery (25 months)m male, f female, p posterior, t transthoracic, ct costotransversectomy, pl posterolateral cases of scheuermann s disease causing spinal cord compression as the result of thoracic disc herniation m male, f female, p posterior, t transthoracic, ct costotransversectomy, pl posterolateral despite the fact that this condition has a uniform sex distribution [15, 20 ], only 6 of all 20 cases were female. males with scheuermann s disease are at greater risk for the development of spinal cord compression in the second decade of life [1, 15 ]. this is in agreement with our case (male, 14 years old). this difference between the sexes is probably due to the fact that males have more longitudinal spinal growth than females and their maximum growth in trunk length, as well as the maximum deformity of the kyphosis, occurs about 2 years later. in all cases in which the degree of deformity was reported, the average angle was only 56.3. the severity of the neurological complications had no obvious correlation with the magnitude of the deformity [11, 18 ]. in our case. found that in 43 cases with neurological deficits secondary to spinal deformity (what ever the etiology) the average angle of kyphosis was 95. he suggested that the greater the angle of kyphosis, the greater the risk of neurological impairment. neurological complications are less likely to occur when the deformity is present over a large number of segments, instead of sharply angular deformities. it is interesting that a relatively small disc herniation such as in our case produces such a major neurological deficit. factors that may influence the onset of cord compromise are the tenuous vascularization and the relatively small canal diameter of the thoracic cord. additionally, in young patients the disc material is not degenerated and can act as a solid mass. bradford and garcia suggested that the high incidence of schmorl s nodes in scheuermann s disease can prevent disc herniation by decompressing the disc space. in our case there were no schmorl s nodes either at this level or at any other level. surgical treatment is indicated in the cases of scheuermann s disease with acute cord compression and generally combines anterior release with posterior instrumentation and fusion. a posterior decompression is ineffective because the compressive force is acting from the front [11, 13, 15, 18 ]. although some authors have advocated posterior laminectomy and decompression, patterson and arbit showed that 45% of patients undergoing laminectomies for thoracic disc herniations either had no relief or deteriorated. for the 20 reported cases with thoracic disc herniation and scheuermann s disease six patients were treated with anterior spinal fusion, four patients with laminectomy, four with posterior spinal fusion, three patients with interbody fusion and pedicular screw plate fixation and one patient was treated with discectomy without spinal fusion. only one patient was treated conservatively with bed rest and minerva jacket without any decompressive surgery. in one case the treatment was not reported. if a significant or progressive kyphosis, i.e. 55 or more exists, a combined posterior spinal fusion and instrumentation should be considered [18, 21 ]. due to the age of the described patient and to the degree of kyphosis we performed discectomy, decompression, anterior and also posterior fusion using a double - rod multihook and transpedicular screws segmental instrumentation system. the majority of the reported cases had good results. in 10 out of 20 cases the patients had complete recovery while only in one case the final outcome was paraplegia. our patient had an excellent result with complete recovery in 3 months. at the final follow - up 2 years postoperatively, he is neurologically entirely normal and the spinal fusion is solid. spastic paraparesis was the most common symptom in all cases but neurological symptoms were not so severe to result in paraplegia. it seems that when symptomatic compression of the spinal cord occurs, surgery is the best option. thoracic disc herniation is an extremely rare complication of scheuermann s disease, resulting in cord compression and marked neurological deficit, most commonly in young patients. this rare form of spinal cord compression once demonstrated, should be treated as soon as possible with surgical decompression and stabilization of the spine anteroposteriorly. | we present the case of a 14-year - old male with scheuermann s disease and significant neurological deficit due to thoracic disk herniation at the apex of kyphosis. he was treated with an anterior decompression, anterior and posterior fusion in the same setting using plate, cage and a segmental instrumentation system. the patient had an excellent outcome with complete neurological recovery. |
conventional endodontic treatment has experienced an impressive progression over the last decades basically through a more efficient desinfection of the root canal system supported by new irrigation and instrumentation methods combined with increasing information about morphological complexities. the success of root canal therapy is dependent on a thorough knowledge of the root and root canal morphology in order to locate the root canals and properly clean, shape, and obturate the canal space in three dimensions, thus the study of root and canal anatomy has endodontic and anthropologic significance. in fact it is important to be familiar with variations in tooth anatomy because such knowledge can aid in locating canals and their subsequent management. techniques and recommendations for the restoration of endodontically treated teeth have developed from the use of rigid prefabricated metal posts to composite resins and fiber reinforced composite posts. the use of fiber posts in combination with adhesive materials for definite restorations has also experienced a progressive development. fiber posts together with composite cores as foundation materials for the restoration of endodontically treated teeth are widely accepted as a viable alternative to cast posts of 2/3 of the determined root canal length. when considering the anatomy of human teeth, the number of roots and root canal incidence varies greatly in the literature. however, studies that determine the frequency and localization of root canal curvatures in relation to the initial straight distance are extremely rare. when a post insertion becomes necessary the precise knowledge of the root canal morphology is fundamental in order to avoid root canal perforations. hence, the aim of this clinical study was to develop a standardised radiographic investigation technique in order to determine the root canal morphology of mandibular premolars regarding length and curvatures of the canals to provide information for subsequent post insertion. in this study recently extracted human mandibular premolars (n = 282) were used. the teeth were collected from the department of oral surgery and private dental center practices. exclusion criteria for further detailed analysis were the following : teeth with a non - definable cemento - enamel - junction (cej) or apex, endodontically treated teeth, a non - definable clinical crown and/or root, teeth with root caries, crowns or extensive fillings and type ii and type iv root canal configurations. a specially developed fixation device was employed in order to be able to reproduce the radiographic parameters. the teeth were digitally radiographed (heliodent md, sirona benzheim, germany / merlin 2.1) in a bucco - lingual plane, with an exposure time of 0.2 sec (60 kv) and with the parallel technique. the reliability of the x - ray beam was controlled throughout the entire investigation by means of an aluminium key (hounsfield - scale). radiographs were taken horizontally and in 20 from the mesial and distal tooth axis aspects. a horizontal line between the mesial and distal cej served as the coronal reference level. the intersection point in the middle of the root canal was used as a reference for the straight lines and tangents. to achieve objective results and guarantee accuracy, all relevant distances, angles, tangents and reference level (cej) were determined by an experienced endodontist. the length of the straight distance between the cej to the first curvature was recorded. the corresponding angles (angle values more than 5 degree) were determined as the angle between distance i (cej to the first curvature) and distance ii (first curvature to the possible second curvature or to the radiological apex) as well as between distance iii (second curvature to the radiological apex). the mean values of the measurements of ten pilot radiographs that were made with the parallel technique and horizontal projection were used as a reference when importing the images (jepg - format) into adobe photoshop 7.0 (36 pixels = 1 mm and 1 pixel = 0.027 mm). the data were collected with microsoft excel 2003and after transformation of data statistical analysis was performed with statistical package spss(version 14.0). for categorical characteristics frequency and relative frequency and for metrical characteristics mean, standard deviation and also median were calculated. the statistical significance between categorical item position (first vs. second ; and statistically significant differences between position and (separately also side) concerning total root canal length and median angle for the first curvature were determined with the wilcoxon - mann - whitney test. the analyses of data was done in an explorative manner and the outcome of a statistic test with p - value < 0.05 is called significant. in the present investigation a total of 282 human mandibular premolars were examined. after considering exclusion criteria all first left premolars (n = 107) and first right premolars (n = 100) as well as all second left premolars (n = 32) and all second right premolars (n = 43) showed only one root canal. the values for the total root canal length of the first and second premolars (left and right side) are demonstrated in figure 1. the mean value of distance i (cej to the first curvature) was for the first left premolar 10.9 mm and for the first right premolar 10.8 mm ; for the second left premolar there was a mean value of 12.0 mm and for the second right premolar of 10.9 mm (figure 2). the difference in mean length of distance i was significant for the first and second premolars (p < 0.001) but not for left and right side (p < 0.9). for the second straight distance (first curvature to the second curvature) following mean values could be found : first left premolar : 3.15 mm ; first right premolar : 4.19 mm ; second left premolar : 4.34 mm and second right premolar : 4.24 mm (figure 3). the third distance (second curvature to the radiological apex) demonstrated mean values for the first left premolar of 3.22 mm, for the first right premolar mean value of 2.69 mm, for the second left premolar mean value of 4.32 mm and for the second right premolar mean value of 3.41 mm (figure 4). the mean angle for the first curvature was for the first left premolar 18 and for the first right premolar 14. for the second left premolar mean values of 19 and in the second right premolar values of 13 were recorded (figure 5). the difference in mean angle for the first curvature was significant for first and second premolar (p < 0.001) but not for left and right side (p < 0.7). the corresponding angle ii between the second and third straight distance showed mean values of 24.5 for the first left premolar, for the first right premolar a value of 20, for the second left premolar a mean value of 12 and for the second right premolar of 21. second root canal curvatures could be found in a high percentage. the first left premolars showed two root canal curvatures in 24.2% of all cases, the first right premolars in 37.2%, the second left premolars in 4.5% and the second right premolars in 34.3%. when comparing the left and the right premolars (first and second premolars), no significant differences could be found with regard to all determined parameters ; therefore the first premolars (left and right side) as well as the second premolars (left and right side) were added together. the first as well as the second premolars showed sigmoid graphs. in both cases slight plateaus in the initial and final course could be observed. this evaluation demonstrates that root canal curvatures could be found in a high frequency from 9 to 12 mm of the initial root length (figure 6 and 7). the distances were recorded between the cemento - enamel junction and the radiological apex. measured length of the distance 5) for all mandibular premolars. measured length of the distance ii between the first and a second curvature, if present in mandibular premolars. measured length (distance iii) between the last curvature and the radiological apex. measured angles of the first curvature of all investigated mandibular premolars. cumulative frequency and relationship between the length of the distance i and the appearance of a first curvature for the fist mandibular premolars (left and right side together) cumulative frequency and relationship between the length of the distance i and the appearance of a first curvature for the second mandibular premolars (left and right side together). in the present study the localisation and frequency of root canal curvatures in mandibular premolars were determined. according to our exclusion criteria only premolars with one root canal were recorded. most commonly the mandibular premolars showed only one root canal. in the study of sert. a total of 1400 extracted mandibular permanent teeth from an indigenous turkish population were evaluated. the authors demonstrated that 62% of mandibular first premolars and 71% of second premolars had a single canal and these morphological characteristics of teeth in this turkish population were consistent with those of other studies performed on different populations. numerous authors have dealt with the question of the anatomy and morphology of root canals paying special attention to the curvatures and their corresponding angles. dobo. examined a mathematical description of root canal forms using a differential geometrical pattern analysis and computer graphics. the measurements of 433 extracted human roots were carried out on isometric radiographs taken from a clinical view. several studies evaluated the configuration of root canal systems, the root canal path morphological variations as well as the angles of root canal curvatures. in most of these studies including our own the method according to schneider has been applied in order to determine root canal curvatures. in our study the initial straight distance (cemento - enamel - junction to the first curvature) showed mean values from 10.8 mm to 12.2 mm for the first and second mandibular premolars, respectively. measured the root canal curvatures taking into account the differences between dental morphotypes and their modifications after mechanical instrumentation. despite different techniques and diverse methods of investigation the information gained is still insufficient regarding the relevant length and straight distances that are necessary for the successful placement of cores for definite restorations after endodontic treatments. it is essential that the core is placed in a central position within the root canal access. any deviation from the original canal path will increase the possibility of a permanent stress in the root ; which may lead to endodontic treatment failure, root canal fracture up to the loss of teeth. the initial straight length and the corresponding first angles are the landmarks of which an operator should be aware when placing a core. it is recommended to not only consider the total length of the root canal but also the first straight distance up to the appearance of a first curvature. the present data provide evidence that the first root canal curvature appears after 9 mm of the initial straight length. this means that first curvatures will occur in the first half of the total canal length. in conclusion we could demonstrate that the probability of the appearance of a root canal curvature in human mandibular premolars has a sigmoid line. the determined line graphs prove that there is an increasing tendency of curvatures in root canal length ranging from 9 to 12 mm and that in mandibular premolars great deviation from the original canal path can be expected 9 mm from the cemento - enamel - junction. | the aim of the present roentgenographic in vitro study was to determine the initial straight length from the cemento - enamel junction (cej) to the appearance of a root canal curvature in human mandibular premolars. a total number of 282 mandibular premolars were examined. exclusion criteria comprised root caries, extensive restorations and endodontically treated teeth. the teeth were fixed and digitally radiographed by means of a specially developed fixation device with standardized and reproducible distances with the parallel technique (heliodent md ; merlin 2.1). the distances from the cej to the first curvature (> 5) (distance i), from the first curvature to a second curvature (distance ii), and from the first or second curvature to the radiological apex (distance iii) were recorded. the lengths of the initial straight distance and the appearance of a curvature were statistically analyzed and related to each other. in first mandibular premolars, the mean value for distance i was 10.9 mm, for distance ii 3.7 mm and for distance iii 3.04 mm. the mean values for the second mandibular premolars were 1.1 mm in distance i, 4.3 mm in distance ii and 3.1 mm in distance iii. no statistically significant differences between left and right mandibular premolars could be observed regarding the canal curvature location and the angle values. the results of this investigation show that curvatures are increasingly observed 9 to 12 mm from the original path in mandibular premolars. |
the kaiser permanente northern california diabetes registry (also referred to here as the registry) is a well - characterized population, maintained continuously since 1993, that has been the basis for extensive epidemiological research (1113). registry eligibility is based on multiple sources of data, including pharmacy records, laboratory data, and outpatient, emergency room, and hospitalization diagnoses of diabetes. kaiser clinicians are encouraged to provide diabetes care according to internal care guidelines that mirror national clinical practice guidelines (general treatment goals : a1c 80 years, this was statistically significant only for a1c 9.0%. age - stratified results : adjusted analyses models adjusted for sex ; race / ethnicity ; duration of diabetes ; systolic blood pressure ; use of insulin, sulfonylurea, or thiazolidinedione ; smoking status ; glucose - monitoring adherence ; gfr (chronic kidney disease stages 15) ; microalbuminuria ; and proteinuria. in analyses of effect modification, the relationships between a1c and mortality or the combined outcomes were not significantly different for those with differing durations of diabetes (data not shown). in a sensitivity analysis using extended cox models that accounted for the time - varying nature of a1c, the overall forms of the relationships between a1c and complications did not change from the baseline analyses, although the strengths of the associations weakened, particularly for chronic complication events (data not shown). for extended cox models of the any complication outcome, a1c was significantly associated with a higher risk of events at a1c 8.0%, instead of a1c 6.0%, whereas for the any complication or death outcome, a1c became significantly associated with higher risk at a1c 10%, instead of a1c 8.0%. the clinical uncertainty surrounding the care of older diabetic patients can be lessened with more in - depth study of this important subpopulation (16). with our large, contemporary, geriatric cohort, we found a u - shaped relationship between a1c and mortality for the overall cohort and for each age category. this u - shaped relationship was not commonly reported in older epidemiological studies but has been found in more recent studies. using datasets from the 1990s, blaum. (17) found a linear relationship between a1c and mortality, whereas nelson. (18) found that an a1c 8.0% was significantly associated with an increased risk of mortality. general population of diabetic patients and found a u - shaped association, with the risk of mortality elevated at low glucose levels (a1c 6.16.6%) and at high glucose levels (a1c 10.111.2%). likewise, post hoc analyses of the accord trial results have revealed a u - shaped a1c - mortality relationship in the control arm (19). in contrast, analyses of the intensive arm have revealed a linear a1c - mortality association. the accord findings suggest that glucose - lowering treatments may alter the relationship between glucose levels and mortality. considering all of these studies in total, the differences between the older and more recent studies are likely attributed to secular changes in glycemic control levels, greater use of combination therapies, and the arrival of newer therapeutic classes. in our cohort, sulfonylureas were the most frequently used oral agents, with heavy use of tolazamide and glyburide. it remains to be seen whether observations of an elevated risk of mortality at low a1c levels represent an actual effect of glucose control or are a result of other factors associated with low a1c levels. older patients with lower a1c levels may suffer from poor nutritional status, frailty, or sarcopenia, each of which may contribute to an elevated mortality risk (20). the possibility that factors other than glucose control may explain the a1c - mortality relationship is reinforced by the observation of a u - shaped mortality curve in a nondiabetic population (21). the relationship between low a1c and mortality clearly deserves additional study, especially in the elderly. our findings regarding a1c and the incidence of chronic complications are consistent with previous literature, primarily conducted in younger patients, demonstrating a continuous relationship between glycemic control and microvascular and cardiovascular complications (7,22). importantly, our analyses of these outcomes indicate that these continuous relationships also exist among the oldest patients, conditioned on survival. for the overall study population, for patients aged > 70 years, a statistically significant higher risk was evident above a 7.0% threshold. the most important results from our study concern the distinctions between the risk of any complication versus the most inclusive outcome, any complication or death. unlike the risk of any complication, the risk of any complication or death significantly increased relative to the reference group after a1c levels exceeded 8.0%. this outcome integrates the u - shaped curve associated with mortality and the continuous curve associated with complications. findings for this outcome identify glycemic thresholds that minimize mortality while enhancing quality of life through the prevention of complications. the relationship between baseline a1c and the any complication or mortality outcome differed modestly by age - group, suggesting the impact of competing mortality. within each a1c strata above the reference level, the hr attenuated with increasing age. thus, although the general pattern was similar, the slopes became less steep and less statistically significant with advancing age. the a1c 8.0% threshold appeared to demarcate a risk increase for patients aged 6079 years. for patients aged > 80 years, the point estimate for a1c 8.08.9% indicated an increased risk, but this result was not statistically different from the reference ; instead, there was a 9.0% threshold for these oldest patients. the differences in results for those aged 80 years versus those aged 6079 years may be attributed to mortality becoming an increasingly random event (with respect to diabetes) as age increases (23). given the limitations of observational research and our short follow - up time, we can not assume that our findings have a purely causal basis, and, thus, relationships described in this article should be subjected to additional research. residual confounding or reverse causality might explain an apparent short - term increase of complications or increased mortality. we also based our primary conclusions on the relationship between baseline a1c and time to event, consistent with the approach used in most previous studies. we find that when we account for the time - varying nature of a1c, the relationship between a1c and chronic complications actually weakens, whereas the relationship with acute metabolic events actually strengthens. these differences were anticipated, given that a time - dependent exposure analyzed with the extended cox model is more sensitive to short - term effects, whereas a fixed baseline risk factor analyzed with the standard cox model is more sensitive to long - term effects (24). in addition, our conclusions regarding a1c thresholds might have differed with the use of even more granular increments of a1c (e.g., half - point increments). numerous results revealed point estimates that indicated a positive association but with cis bracketing unity. although we evaluated multiple outcomes, we did not evaluate the risk of hypoglycemia, which is another important clinical consideration. our cohort was limited to patients enrolled in an integrated, managed - care system, where diabetes care may differ somewhat from that provided in other settings. previous comparisons of diabetes care in kaiser with that of other managed - care settings have found that the quality of kaiser s care is representative of typical care across the u.s. this cohort had relatively good glycemic control on average but did include sufficient numbers of individuals with very high a1c levels to evaluate outcomes across the spectrum of a1c levels. with respect to prevention of complications, our results indicate that older people have a graded relationship between a1c and complications. on the other hand, we observed a distinct u - shaped relationship between a1c and mortality. our results suggest that a1c in older patients should be maintained below 8.0% to prevent both complications and mortality, with the caution that a1c levels < 6% were associated with an increased mortality risk. additional research is needed to identify the mechanisms that underlie the increased mortality among those with very low a1c. in addition, ongoing research on care individualization in the elderly suggests that life expectancy (2), comorbid conditions (3), and patient preferences (25) may be important considerations in setting glycemic goals below 8.0%. although we await the findings from this important research, the observational data presented here provide additional guidance for caring for the rapidly growing population of older diabetic patients. | objectiveto identify the range of glycemic levels associated with the lowest rates of complications and mortality in older diabetic patients.research design and methodswe conducted a retrospective cohort study (20042008) of 71,092 patients with type 2 diabetes, aged 60 years, enrolled in kaiser permanente northern california. we specified cox proportional hazards models to evaluate the relationships between baseline glycated hemoglobin (a1c) and subsequent outcomes (nonfatal complications [acute metabolic, microvascular, and cardiovascular events ] and mortality).resultsthe cohort (aged 71.0 7.4 years [means sd ]) had a mean a1c of 7.0 1.2%. the risk of any nonfatal complication rose monotonically for levels of a1c > 6.0% (e.g., adjusted hazard ratio 1.09 [95% ci 1.021.16 ] for a1c 6.06.9% and 1.86 [1.632.13 ] for a1c 11.0%). mortality had a u - shaped relationship with a1c. compared with the risk with a1c < 6.0%, mortality risk was lower for a1c levels between 6.0 and 9.0% (e.g., 0.83 [0.760.90 ] for a1c 7.07.9%) and higher at a1c 11.0% (1.31 [1.091.57 ]). risk of any end point (complication or death) became significantly higher at a1c 8.0%. patterns generally were consistent across age - groups (6069, 7079, and 80 years).conclusionsobserved relationships between a1c and combined end points support setting a target of a1c < 8.0% for older patients, with the caution that a1cs < 6.0% were associated with increased mortality risk. additional research is needed to evaluate the low a1c mortality relationship, as well as protocols for individualizing diabetes care. |
photosystem ii (psii) offers a biological and sustainable route of photochemical water oxidation to o2 and can provide protons and electrons for the generation of solar fuels, such as h2. we present a rational strategy to electrostatically improve the orientation of psii from a thermophilic cyanobacterium, thermosynechococcus elongatus, on a nanostructured indium tin oxide (ito) electrode and to covalently immobilize psii on the electrode. the ito electrode was modified with a self - assembled monolayer (sam) of phosphonic acid ito linkers with a dangling carboxylate moiety. the negatively charged carboxylate attracts the positive dipole on the electron acceptor side of psii via coulomb interactions. covalent attachment of psii in its electrostatically improved orientation to the sam - modified ito electrode was accomplished via an amide bond to further enhance red - light - driven, direct electron transfer and stability of the psii hybrid photoelectrode. |
|
diabetes mellitus type 2 (t2 dm) is a chronic disease that has been increasing globally over the past 2 decades including in thailand1. it is a significant health problem with microangiopathy and macroangiopathy resulting in many complications, i.e, neuropathy2, retinopathy3, nephropathy4, and coronary artery disease5. in addition, hyperglycemia - induced microangiopathy via increased oxidative stress has also been shown to impair pulmonary function5. lung impairment due to microangiopathy is indicated by a decrease in spirometric parameters, forced vital capacity (fvc), and the forced expiratory volume in the first second of expiration (fev1)6,7,8. human autopsy9, 10 and transbronchial biopsy studies11 of diabetic patients have revealed an increase in alveolar - capillary basement membrane thickness, which may contribute to the limitation of lung expansion caused by an enlarged interstitium and decreased diffusion because of the thickening and fibrotic changes in the alveolar - capillary and pulmonary arteriole basement membranes6, 12. in fact, glycemic status was negatively correlated with the dynamic lung functions in t2 dm patients13. in addition, impaired lipid metabolism indicated by an increase of body fat mass14 and chronic low - grade tissue inflammation14, autonomic neuropathy involving the respiratory muscles15, and loss of elastic recoil according to collagen glycosylation of lung parenchyma16 are considered to contribute to respiratory impairments in t2 dm patients. therefore, the modalities that improve glycemic status and control lipid metabolism, e.g, exercise, diet restriction, and intake of medicinal herbs, may be useful in improving the pulmonary functions of t2 dm patients. low - intensity exercise is known to effectively reduce body mass and fat mass17, 18, glucose and triglyceride levels19, and blood pressure and waist and hip circumferences18. in addition, it is known to increase lipid oxidation and insulin sensitivity in patients with metabolic syndrome20, provide an anti - inflammation effect21, decrease hba1c22 and oxidative stress23, and increase lipid oxidation in patients with t2dm24. the arm swing exercise (ase), a low - intensity exercise, is easy and convenient to perform without any equipment. we previously demonstrated that performance of the ase for 8 weeks conclusively improved hyperglycemia via improvement of oxidative stress in t2dm23. we also demonstrated that, in untrained men and women, fat was used as a major source of energy for low - intensity exercise more than in the case of higher - intensity exercise25. the ase may thus increase fat usage, leading to improvement of the lipid profile and a reduction in fat mass. we hypothesized that the ase may have beneficial effects on pulmonary functions via improvement of hyperglycemia, antioxidant activity, and fat metabolism in the t2 dm patients. in this study, we aimed to investigate the effects of the ase on dynamic pulmonary function of overweight t2 dm patients. in relation to the effects of the ase on the pulmonary functions, the effects of the ase on oxidative stress, lipid profiles, obesity, and glycemia of t2 dm patients were investigated. twenty - four thai patients with t2 dm (20 women and 4 men) were recruited in khon kaen province, thailand. their mean age (se) was 59.51.46 years, and they had no cardiovascular and/or respiratory complications. they were informed verbally and in writing before signing a consent form approved by the ethical committee of khon kaen university in accordance with the 1964 declaration of helsinki. if the subjects could not attend 90% of the total exercise sessions or could not maintain their usual therapy for at least 80% of all interventions throughout the experiment, they were excluded from the study. all subjects maintained their sedentary daily lives for the first 8 weeks (control period), and then they performed the ase for 8 weeks (30 minutes per day, 3 days per week) (ase period). on the first day of the ase period, the participants learned how to perform the ase correctly in our laboratory. they then performed it with video tape recorder monitoring at home for the following 8 weeks. once a week, all subjects were telephoned to check on their ase training. anthropometric parameters and body composition were measured before and after each period. at the same points of time, blood samples were collected from the antecubital vein to determine glucose, lipid, hba1c, malondialdehyde (mda), reduced glutathione (gsh), oxidized glutathione (gssg), and insulin concentrations. the ase is a traditional chinese exercise with an intensity of approximately 23% of the maximal oxygen consumption (unpublished data). in starting position of the ase, each subject stood with his / her head erect, but relaxed, with the mouth naturally closed and the tip of the tongue placed against the hard palate and with the trunk of the body straight. they gazed forward with their eyes focused on a point while they concentrated their minds on swinging their arms. the arms initially hung naturally at the sides with the palms of both hands facing backward and with the fingers spreading naturally. the feet were firmly placed on the ground, at shoulder width apart. then both arms were swung forward about 30 degrees with a smooth and even force and then backward to about 60 degrees. however, during the first week of the training, the speed of swinging was actually 30 times / minute. body weight and height were measured without shoes using a balance beam scale. the body mass index (bmi) was calculated from the body weight (kg) and height (m). waist circumference was measured at the midpoint between the lower margin of the last palpable rib and the top of the iliac crest. body fat was determined by measuring the skinfold thickness at 4 points on the right side of the body including the biceps, triceps, supra - iliac crest, and the subscapular area. to assess pulmonary functions, forced expiratory volume in the first second (fev1) and forced vital capacity (fvc) were measured using a vitalograph 2120 according to the ats (american thoracic society) criteria. maximal voluntary ventilation (mvv) was calculated from fev1 by the following equation : mvv = fev1 (l) 4026. at each visit, one milliliter of blood was collected into tubes containing fluoride - oxalate for subsequent determination of whole blood glucose by using glucose oxidase and l - lactate oxidase methods (yellow springs instrument analyzer, ysi, 2300 stat plus). after placing 4 ml into edta and 2 ml into clotting tubes, all samples were placed immediately on ice. the tubes were then centrifuged at 3,000 g for 15 min to remove red blood cells, and the serum and plasma were separated. the serum obtained was used to analyze tc, hdl, ldl, tg, and hscrp levels using standard automated laboratory methods (roche integra 800, roche, basel, switzerland) and to analyze insulin by using the radioimmunoassay technique. these methods are routinely used in srinagarind hospital, faculty of medicine, khon kaen university. two milliliters of residual plasma was used for analysis of mda by the authors. insulin sensitivity was examined using homeostatic model assessment - insulin resistance (homa - ir)27. the basis of the tba method is the reaction of mda with 0.6% of tba at low ph and 95 c (boiled for 30 min) to form a colored complex. acid hydrolysis and heat are necessary to release mda bound to the amino groups of proteins and other amino compounds. the mda - tba complex, with an absorption at 532 nm, was measured using a spectrophotometer (genesys 20, sn:35 gk 130009 ; thermo fisher scientific, waltham, ma, usa). the serum hscrp concentration was determined using a roche / hitachi cobas c system (cobas c 501, roche). the hscrp level was determined using a particle - enhanced immunoturbidimetric method, in which formation agglutinates of human crp with latex particles coated with monoclonal anti - crp antibody was determined turbidimetrically. ongoing diabetes therapies that patients had been receiving, such as pharmacotherapy, dietary control, and exercise, were not modified during the study period. the data from 3 days of records (2 days during the week and 1 day on the weekend) for dietary intake and physical activity were averaged to estimate daily energy intake and expenditure. a two - way anova with repeated measures (within subject factors of exercise and time) was used to analyze all dependent variables with the sigmastat version 2 software. backward stepwise regression was used to analyze correlation between parameters at each time point. the percentage of body fat was found to be significantly reduced after the ase compared with that before the ase (p<0.05). all other anthropometric parameters were not significantly changed by the ase (table 1table 1.anthropometric parameters and body composition of the subjects during the control and ase periodscontrol (n=24)ase (n=24)beforeafterbeforeafterage (yrs)59.57.159.77.259.77.259.77.2height (cm)156.57.3156.57.3156.57.3156.57.3body mass (kg)63.67.664.112.164.112.164.311.8bmi25.93.826.110.026.14.025.84.5waist (cm)92.610.793.810.893.810.892.811.3hip (cm)98.08.597.48.497.48.496.88.8waist to hip ratio0.90.11.00.11.00.11.00.1% body fat41.76.141.86.041.86.040.86.0fat mass (kg)27.36.626.86.226.86.226.86.6fat free mass (kg)37.96.337.75.837.75.838.65.9rest hr (/min)71.19.670.810.470.810.471.88.3data are expressed as means se (n = 20 women and 4 men). analysis was performed using the paired t - test for within groups and analysis of covariance between groups. significant difference after exercise (adjusted by its baseline) between groups : p<0.05ase : arm swing exercise ; bmi : body mass index). the changes in mean daily dietary intakes were similar after both periods (table 2table 2.daily dietary intake and total energy expenditure during the control and ase periodscontrol (n=24)ase (n=24)beforeafterbeforeafterdietary intake (mj / day)6.880.46.980.46.760.36.770.5total energy expenditure (mj / day)6.540.36.740.36.880.59.880.5data are expressed as means se (n = 20 women and 4 men). significant difference after exercise (adjusted by its baseline) between groups : p<0.05. ase : arm swing exercise). the mean total energy expenditure after the exercise period was significantly higher than that after the control period after adjustment with the pre - exercise values (p<0.05, table 2). drug therapies, eating situations, and momentum did not change throughout the study period of 8 weeks. data are expressed as means se (n = 20 women and 4 men). analysis was performed using the paired t - test for within groups and analysis of covariance between groups. significant difference after exercise (adjusted by its baseline) between groups : p<0.05 ase : arm swing exercise ; bmi : body mass index data are expressed as means se (n = 20 women and 4 men). significant difference after exercise (adjusted by its baseline) between groups : p<0.05. ase : arm swing exercise hba1c, ldl, mda, and gssg were significantly lowered after 8 weeks of the ase (p<0.05). however, there were no significant differences in fbg, insulin, lipid profiles, and hscrp concentrations. also, homa - ir was not altered after the ase (table 3table 3.blood parameters in the control and ase periodscontrol (n=24)ase (n=24)beforeafterbeforeafterhba1c (%) 9.50.49.10.48.80.48.40.5fbg (mg / dl)15612150101541014410insulin (pmol / l)28.23.827.03.824.95.129.35.8homa - ir11.42.410.42.110.42.710.42.1hdl (mg / dl)483483514483ldl (mg / dl)1136125811461075tg (mg / dl)19524185171922320725tc (mg / dl)20072061019991977hscrp (mg / dl)8.32.011.05.56.10.95.10.7mda (m)1.80.21.80.11.80.21.30.1gsh (m)538.724.1581.915.2524.719.3566.217.7gssg (m)21.31.919.01.220.91.314.70.8gssg / gsh0.040.010.030.010.040.000.030.00data are expressed as means se (n = 20 women and 4 men). analysis was performed using the paired t - test for within groups and analysis of covariance between groups. significantly different from before exercise within group : p<0.05 ; p<0.01 ; p<0.001.significant difference after exercise (adjusted by its baseline) between groups : p<0.05 ; # # p<0.01. ase : arm swing exercise ; hba1c : haemoglobin a1c ; fbg : fasting blood glucose ; homa - ir : homeostatic model assessment - insulin resistance ; hdl : high - density lipoprotein ; ldl : low - density lipoprotein ; tg : triglycerides ; tc : total cholesterol ; hscrp : high - sensitive c - reactive protein ; mda : malondialdehyde ; gssg : oxidized glutathione ; gsh : reduced glutathione). in all the participants, data are expressed as means se (n = 20 women and 4 men). analysis was performed using the paired t - test for within groups and analysis of covariance between groups. significantly different from before exercise within group : p<0.05 ; p<0.01 ; p<0.001. significant difference after exercise (adjusted by its baseline) between groups : p<0.05 ; # # p<0.01. ase : arm swing exercise ; hba1c : haemoglobin a1c ; fbg : fasting blood glucose ; homa - ir : homeostatic model assessment - insulin resistance ; hdl : high - density lipoprotein ; ldl : low - density lipoprotein ; tg : triglycerides ; tc : total cholesterol ; hscrp : high - sensitive c - reactive protein ; mda : malondialdehyde ; gssg : oxidized glutathione ; gsh : reduced glutathione all dynamic lung parameters were within normal ranges (table 4table 4.pulmonary function tests and predicted values in the control and ase periodscontrol (n=24)ase (n=24)beforeafterbeforeafterfev1 (l)1.910.11.840.091.840.092.00.10fvc (l)2.210.142.080.122.080.122.290.13fev1/fvc (%) 89.01.2388.51.2588.51.2588.50.91mvv (l / min)76.23.8373.53.7073.53.7079.84.05values are expressed as means se (n = 20 women and 4 men). significant difference after exercise (adjusted by its baseline) between groups : p<0.05. fev1 : forced expiratory volume in first second ; fvc : forced vital capacity ; mvv : maximal voluntary ventilation). fev1, fvc, and mvv were significantly increased at the end of the ase period (p<0.05) (table 4). values are expressed as means se (n = 20 women and 4 men). significant difference after exercise (adjusted by its baseline) between groups : p<0.05. fev1 : forced expiratory volume in first second ; fvc : forced vital capacity ; mvv : maximal voluntary ventilation the present results showed that ase training slightly improved the dynamic lung volumes including fev1, fvc, and mvv of overweight t2 dm patients. this may have been due to a reduction of hyperglycemia and fat metabolism and a decrease in obesity. the results support our hypothesis that ase training may have beneficial effects on pulmonary function via reduced hyperglycemia, fat metabolism, and oxidative stress in overweight t2 dm patients. moreover, due to the movement of both arms and rhythmic breathing during the ase, the ase training may mobilize the chest wall and stimulate all the respiratory muscles (intercostals, diaphragm, abdominals, and scalenii) to do more work during the period of exercise. this is supported by a previous study that demonstrated that exercise at low levels of intensity increased expiratory muscle activity in healthy men29. in addition, although the expired gas composition was not measured, ventilatory efficiency (increased ventilation (ve)/carbon dioxide output (vco2) slope) may be improved by ase training. this is supported by a previous study demonstrating that weight reduction resulting from ase training may improve ventilatory efficiency during graded exercise in obese children30. the reductions in hyperglycemia (decreased hba1c) and oxidative stress (after the ase) are supported by our previous study23 in that the hypoglycemic effect of the ase might be attributed to a reduction in oxidative stress or exercise per se. this may result in decreased nonenzymatic glycosylation of tissue proteins and the formation of advanced glycosylation end products, resulting in microvascular complications31, 32 in various organ systems including the alveolar - capillary network in the lung33, 34 moreover, it may attenuate reduced pulmonary elastic recoil. thus, the decrease in hba1c may have improved the lung function of the subjects after the ase training in this study. it is known that normal lung mechanics and gas exchange are affected by the integrity of pulmonary connective tissue and microvasculature. abnormalities in either of these two structural components of the lung may result in the development of pulmonary dysfunction34. in a previous report, it was reported that a 10% decrease in fev1 was related to a 12% increase in all - cause mortality8. the measured airflow limitation is expected to increase all - cause mortality in patients with diabetes. rigorous blood management may reduce the risk of death through improved ventilatory function independent of other beneficial effects. the ase decreased obesity and increased the dynamic lung volumes. the fact that a reduction in body fat or obesity improved the pulmonary functions after the ase training in this study is consistent with many previous studies investigating low - intensity exercise training in patients with diabetes24, patients with metabolic syndrome20, and obese subjects35. moreover, miyatake,.36 reported that reduction of body fat by low - intensity exercise in obesity leads to increased lung elasticity, which is reflected in improvements in fev1, fvc, and mvv. the presence of extensive microvascular circulation and abundant connective tissue in the lungs raises the possibility that lung tissue may be affected by a microangiopathy process and nonenzymatic glycosylation of tissue proteins. the decrease in body fat in this study may be due to increased fat oxidation during the exercise. although we did not measure fat oxidation during the exercise, previous studies support this finding25, 37. (2002) demonstrated that low - intensity exercise contributed to increased fat oxidation during exercise in obese subjects. our previous study showed that fat was mostly used as an energy source during low - intensity exercise compared with higher - intensity exercise in young lean thai individuals25. the reason for this result could be due to a lower rate of glycolysis resulting in lower malonyl coa production from a low level of muscle contraction during low - intensity exercise. malonyl coa inhibits carnitine palmitoyl transferase (cpt), which carries free fatty acid into mitochondria for fat oxidation38. therefore, with a lower level of malonyl coa, more fat is taken up and oxidized during the exercise. however, we did not measure the amount of fat oxidation or the fat source that was used during the exercise. instead, we used lipid profiles from routine clinical investigation to indicate the source of fat in the blood stream during rest in this study, and it was found that it was unchanged by the ase. free fatty acids from either adipocytes or intramuscular triglycerides may be the source of fat involved in the increased fat oxidation during exercise in this study. thus, further research investigating fat oxidation and the fat source during the ase needs to be performed. in summary, the present results indicate that the ase can be an alternative mode of exercise to reduce pulmonary function impairment of t2 dm patients, especially pulmonary function impairment. this reduction of pulmonary function impairment as a result of the ase may be due to the improvement of hyperglycemia and fat metabolism and the decrease in percent body fat. | [purpose ] obesity and hyperglycemia play roles in the impairment of pulmonary function in type 2 diabetes mellitus (t2 dm) patients. low - intensity exercise is known to reduce body fat and improve hyperglycemia. the arm swing exercise (ase), a low - intensity exercise, is easy and convenient to perform without any equipment and is suitable for daily practice. therefore, we aimed to investigate the effects of ase on lung function and obesity in overweight t2 dm patients. [subjects and methods ] twenty - four subjects continued their daily life routines for 8 weeks (control period), and then performed ase for 8 weeks (30 minutes per day, 3 days per week) (ase period). pulmonary function tests were performed, and fasting blood glucose, haemoglobin a1c (hba1c), lipid profiles, high - sensitive c - reactive protein (hscrp), insulin concentration, and anthropometric parameters were measured before and after each period. [results ] after the ase period, the forced vital capacity, forced expiratory volume in the first second of expiration, and maximal voluntary ventilation were increased when compared with after the control period. hba1c, a low - density lipoprotein, malondialdehyde, oxidized glutathione, and the percent body fat were significantly decreased when compared with after the control period. however, other parameters, such as lung volume, anthropometric parameters, and fasting blood glucose, insulin, high - density lipoprotein, triglycerides, total cholesterol and glutathione concentrations, showed no differences between the two periods. [conclusion ] these data suggest that there is improvement of pulmonary functions in t2 dm patients after ase training. |
the results of the latest large trial in patients with cardiogenic shock (cs), namely the triumph trial, were recently published in journal of the american medical association. about 6 to 9% of myocardial infarctions (mis), mostly with st elevation, is complicated by cs, which is the leading cause of death. the shock trial has shown the benefit of early revascularization in decreasing the rate of death, although the in - hospital and long - term mortality remains high. as long ago as 1939, mi was shown to be associated with an inflammatory process, when mallory and white described the time - related appearance of infiltrating cells. later, it was also reported that after being activated in vivo, macrophage cytotoxicity was mediating an l - arginine - dependent biochemical pathway that synthesized l - citrulline and nitric oxide (no). no is also a powerful vasodilator that may alter cardiac contractile function, with a positive inotropic effect at low level and negative at higher levels. in the shock trial, many patients had evidence, at shock onset, of systemic inflammatory response syndrome with fever, leukocytosis and decreased systemic vascular resistance confirming the classic notion that cs leads to a compensatory vasoconstriction [6 - 8 ]. this inappropriate systemic vasodilatation might be related to no overproduction that can contribute to a vicious cycle of aggravation of cs. inhibition of no synthase (nos) was theoretically appealing, targeting a new pathophysiological approach of cs in mi. the triumph study was a prospective, international, multi - center, randomized, double - blind, placebo - controlled trial testing the hypothesis that tilarginine (a non - specific inhibitor of nos), when compared with placebo, would reduce 30-day mortality by 25% in patients with mi complicated by refractory cs despite successful revascularization of the infarct - related artery. patients received a 1.0 mg / kg intravenous bolus of the drug followed by 5 hours of intravenous infusion of the drug at 1.0 mg / kg per hour or of a matching placebo. the major outcome was 30-day all - causes overall mortality, and stratification by age (less than 75 years or 75 years and over) was performed. the secondary outcome included duration and resolution of shock, new york heart association functional class at day 30, and 6-month mortality. the study was planned to include 658 treated patients in 130 centers for 90% power of detecting a 25% decrease in mortality. finally, the study stopped enrolment after 398 patients on the basis of interim efficacy and futility analyses planned at 50% and 75% of enrolment. although tilarginine increased systolic blood pressure by 5 mmhg (7 mmhg versus 12 mmhg ; p = 0.01) at 2 hours, no effect on mortality was observed at 30 days. there was also no difference in secondary outcomes such as resolution or duration of the cs, new york heart association functional class and 6-month mortality. there was, however, a 6% absolute increase in 30-day mortality in the tilarginine group (48%, versus 42% in the placebo) that was qualified by ndrepepa and colleagues in their editorial in the same issue of jama as a disturbing event if this difference did not reach statistical significance (p = 0.24). we can reasonably wonder whether this difference would have been significant if the total planned enrolment had been reached. it is noteworthy that dzavic and colleagues recently published a study assessing the effect of the inhibition of nos on hemodynamics in patients with persistent cs after mi despite successful revascularization. as opposed to the triumph study, this study, which used a bolus and 5-hour infusions of n - monomethyl - l - arginine (0.15, 0.5, 1.0 or 1.5 mg / kg per hour) compared with placebo, did not increase the mean arterial pressure at 2 hours (primary outcome). another international randomized placebo - controlled trial of n - monomethyl - l - arginine hydrochloride at a dose ranging from 0.5 to 20 mg / kg per hour for 7 or 14 days for septic shock was also stopped prematurely because of an increased 28-day mortality (59% versus 49% ; p < 0.001). all these randomized studies are disappointing because hope for a new therapeutic approach to cs had been raised by human pilot studies. cotter and colleagues reported that inhibition of the no pathway reduces 30-day mortality from 67% to 27% in a small randomized study (not placebo - controlled), with increased blood pressure and urine output ; this was the basis for the drug dosage and treatment duration for the triumph study. this again proves that a placebo - controlled double - blind study remains mandatory for evaluating new treatment modalities and is what evidence - based medicine is all about. furthermore, the tilarginine - induced increase in systolic blood pressure leads to questions about the use of systolic blood pressure as a surrogate endpoint to predict outcome in cs. overall, treatments targeting the inflammatory cascade, especially the inhibition of the no pathway, remain as deceiving in mi as in sepsis. this might be related to the use of a non - specific inhibitor of nos. more importantly, our group showed recently that, in patients with various degrees of sepsis and inflammation, no overproduction leads to the very early production of peroxynitrite, which irreversibly inactivates proteins (including contractile proteins), suggesting that inhibiting the no pathway probably comes too late and can not restore an already impaired contractile function. the triumph study gave strong indications for stopping any further trial with non - specific nos inhibitors in cs and possibly also in all other cardiovascular diseases. a better understanding of the physiopathology of the production of tissue - specific and systemic biomarkers is needed to develop new agents that have the potential to be effective in mi - induced cs. while we wait for new treatment modalities, the prevention of cs with early acute mi primary angioplasty remains the gold standard. percutaneous left - ventricle - assisting devices may serve as a bridge to recovery or final treatment, namely transplantation. | the triumph study, recently published in journal of the american medical association, was a prospective randomized placebo - controlled trial testing the hypothesis that tilarginine (a non - specific inhibitor of nitric oxide synthase), when compared with placebo, would reduce 30-day mortality by 25% in patients with myocardial infarction complicated by refractory cardiogenic shock despite successful revascularization of the infarct - related artery. patients received an intravenous bolus of the drug followed by 5 hours of intravenous infusion of the drug or a matching placebo. although tilarginine increased systolic blood pressure by 5 mmhg at 2 hours, no effect on mortality was observed at 30 days. there was, however, a 6% absolute increase in 30-day mortality in the tilarginine group (48%, versus 42% in the placebo). this definitive trial gave strong indications for stopping any further trial using non - specific inhibitors of nitric oxide synthase in cardiogenic shock and possibly also in any other cardiovascular area. |
patient 1 was a 74-year - old italian man who came to the emergency department (ed) of vittorio emanuele hospital in catania, italy, in july 2012. patient 2 was 65-year - old german woman who arrived in rome from frankfurt in march 2011 and came directly from the airport to the ed of the university of rome medical center. patient 3 was a 40-year - old japanese man who came to the ed of the catholic university medical center in rome in february 2012, 3 days after arriving in the city. all 3 patients had sudden - onset hemoptysis, dyspnea, and fever (temperature 37.538.5c), which had rapidly worsened over 23 h. their medical histories were unremarkable. all 3 patients had acute respiratory failure requiring ventilator support and hemoconcentration ; hyponatremia ; increased levels of serum creatinine, lactate dehydrogenase, lactic acid, and brain natriuretic peptides ; leukocytosis (7,0008,000 cells / mm, 3,2004,000 neutrophils) ; and increased levels of c - reactive protein (> 400 mg / ml) and d - dimer (> 2,000 g / ml). computed tomography of the chest showed patchy opacification throughout the lungs and multifocal confluent parenchymal opacities (figure, panel a). bronchoalveolar lavages were bright red and contained numerous erythrocytes, gram - positive cocci resembling streptococci, and no polymorphonuclear leukocytes. in spite of aggressive supportive care and empirical therapy with ceftriaxone (2 g intravenously) and levofloxacin (500 mg intravenously), the conditions of the patients deteriorated rapidly, and all 3 died of massive pulmonary hemorrhage 12 h after symptom onset. a) computed tomographic image of the chest of a 74-year - old patient (patient 1) with fatal hemorrhagic pneumonia, catania, italy, showing multifocal confluent parenchymal opacities. c) microscopic evidence of necrosis and bacteria in the lungs (original magnification 40). autopsy specimens showed bilateral hemorrhagic pleural effusions (1,5002,000 cells / ml), heavy, blood - engorged lungs (1,6001,700 g), and patent hilar structures, but no thoracic or abdominal lymphadenopathy. microscopic analysis of the lungs showed necrosis and bacteria (figure, panel c). admission blood cultures (3 sets / patient) were positive at the 12-h reading. s. pyogenes was identified by using matrix - assisted laser desorption ionization time - of - flight mass spectrometry (bruker daltonik, breman, germany) and isolated in all culture bottles, bronchoalveolar lavage cultures (pure colonies, 10 cfu / ml), and postmortem lung tissue cultures. all isolates were susceptible to erythromycin, tetracycline, amoxicillin, penicillin, and clindamycin by etest (biomrieux, marcy letoile, france). results were interpreted according to european committee on antimicrobial susceptibility testing breakpoints (www.eucast.org/clinical_breakpoints). results of testing for urinary legionella pneumophila and s. pneumoniae antigens, -glucan, galactomannan, and hiv and toxicology panels were negative for all 3 patients. commercially available pcrs for respiratory tract samples showed negative results for major respiratory viruses and bacterial pathogens. the emm typing, which was performed by pcr using protocols and the database of the centers for disease control and prevention (atlanta, ga, usa ; www.cdc.gov/ncidod/biotech/strep/m-proteingene_typing.htm), showed that all 3 gas strains were emm - type 1 and had identical sequences at the 5 end of the emm gene, indicative of the emm 1.0 allele. strains were tested for multiple virulence genes (table) by using pcr and primers described elsewhere (11) or designed with the vectornti program (invitrogen, carlsbad, ca, usa). they were identical in terms of the spe genotype (spea+, speb+, spec, speg+, spei, spej+, smez+, ssa) ; the presence of slo, saga, sagbc, and sda1 genes ; and the absence of pam, prtf, and sof genes. multilocus sequence typing was performed as described (http://spyogenes.mlst.net/) and showed an identical sequence type (st) (st28/cc28) for the isolates from patients 1 and 3 and a new single - locus variant of st28 (designated st648) for the isolate from patient 2. all cases were caused by gas strains harboring the emm1.0 allele and sda1, smez, spea, speb, speg, and spej genes. slo, streptolysin o ; saga / bc, streptolysin s - associated gene a protein ; smez-2 mitogenic exotoxin z ; spea, streptococcal pyrogenic toxin a ; speb, streptococcal cysteine protease ; spec, streptococcal pyrogenic toxin c ; speg, streptococcal pyrogenic toxin g ; spei, streptococcal pyrogenic toxin i ; spej ; streptococcal pyrogenic toxin j ; prtf, fibronectin - binding protein ; pam, plasminogen - binding protein ; sof serum opacity factor ; ssa streptococcal superantigen ; sda1, streptodornase d. primers indicated in boldface were created with the vectornt program (invitrogen, carlsbad, ca, usa). a total of 1.3%23.8% invasive gas infections involve pneumonia, but these infections are more common in developing countries (1,6,7,12). however, despite early aggressive supportive care and empirical antimicrobial drug therapy, which was later confirmed to be appropriate by antibiogram results, all 3 patients we describe died within 812 h of symptom onset from massive pulmonary bleeding and acute respiratory failure. the roles of gas in the rapid progression of disease were highlighted by the abundance of gas found the lungs, extensive and severe pulmonary damage, and virulence factor profiles of the isolates, all of which included sda1, smez, spea, speb, speg, spej, and emm-1 genes (4,5). invasive bacterial disease requires virulence factors that facilitate interactions of the microbe with host tissues and subvert defenses of the immune system. in the emm1 gas clone, progression to systemic infection is also favored by mutations in the 2-component control of virulence regulatory system, which enhances resistance to subepithelial immune defenses and facilitates deep - tissue penetration. these mutations markedly alter transcription profiles of invasive gas isolates than those of pharyngeal mucosal isolates (35,8), strongly upregulating sda1 transcription and markedly downregulating expression of the gene encoding cysteine protease speb (612). the sda1 gene facilitates avoidance of neutrophil extracellular traps by the pathogen and serves as a selective force for a control of virulence regulatory system mutation (7,13). speb protease enables accumulation and activation of broad - spectrum host protease plasmin on the microbial cell surface, thereby promoting infection spread to normally sterile sites (2,3,14). invasive gas strains also produce increased levels of toxins, including some that destroy immune cells, and superantigens (e.g., spea, spej) that dysregulate the immune response of the host (3). host factors also affect clinical presentation and disease progression, which explains why diseases of different severity can be caused by genetically indistinguishable emm1 strains with no evidence of regulatory gene mutation (2,4,7). elucidation of these host and bacterial factors involved in the pathogenesis of these rare but life - threatening infections may be useful for improving disease prognosis (6). | we report 3 cases of fulminant hemorrhagic pneumonia in previously health patients. sudden - onset hemoptysis and dyspnea developed ; all 3 patients and died < 12 h later of massive pulmonary bleeding, despite aggressive supportive care. postmortem analysis showed that the illnesses were caused by group a streptococcus emm1/sequence type 28 strains. |
bladder cancer is the ninth most common cancer worldwide, with 380,000 new cases reported annually. the ratio of male : female bladder cancer patients is 3.8:1. according to data from the united states, 15,250 deaths from bladder cancer are expected to occur in 2013. moreover, according to the surveillance, epidemiology and end results database, there has been no significant change in bladder cancer deaths over the last 30 years. bladder cancer is a heterogeneous disease, with 70% of patients presenting with superficial tumors that tend to recur, but are generally not life threatening, and 30% presenting as muscle - invasive disease associated with a high risk of death from distant metastases. transitional cell carcinoma accounts for more than 90% of all bladder cancers, followed by squamous cell carcinomas (5%), adenocarcinomas (2%), and undifferentiated cancers (8 mm and abdominal nodes > 10 mm in maximum short - axis diameter that are detected by ct or mri should be regarded as pathologically enlarged. ct and mri have low sensitivity (48%-87%) for lymph node metastasis because they evaluate the lymph node based on its size, and it is well known that metastasis may exist in normal - sized lymph nodes. accordingly, positron emission tomography / computed tomography (pet / ct) is added upon detection of abnormal nodes because the anatomic views provide more accurate data. furthermore, tests with high sensitivity and specificity are needed in these patients to predict residual disease and monitor treatment response. in this context, f - fluorodeoxyglucose - positron emission tomography / computed tomography (f - fdg - pet / ct), in which particularly functional and anatomic images are processed, is the most important diagnostic tool. therefore, the present study was conducted to retrospectively review the contribution of f - fdg - pet / ct to detection of metastatic bladder cancer. the histology of the lesions (if available), or all of the clinical and radiological investigations (ct, mri) were used as references. a total of 7,938 patients were evaluated and 10,553 f - fdg - pet / ct scans were performed in the department of nuclear medicine, sifa university, izmir, turkey between july 2007 and april 2013. of this group, 79 patients underwent f - fdg - pet / ct because of suspicion of metastatic bladder cancer. sixty - nine of these patients (87.3%) were male and ten (12.7%) were female. the mean age was 66.1 years and the standard deviation was 10.7 years (range, 21 to 85 years). all procedures were conducted in accordance with the ethical standards of the responsible committee on human experimentation and with the helsinki declaration of 1975, as revised in 2000. additional informed consent was obtained from all patients for which identifying information is included in this article. data on histological sub - types of bladder cancer based on pathological and immunohistochemical investigations were available for 75 patients (94.9%). overall, 69 patients (87.3%) had high - grade transitional cell carcinoma (tcca), three (3.8%) had low - grade tcca, two (2.5%) had undifferentiated carcinoma, one (1.2%) had squamous cell carcinoma, and data on histological sub - type were unavailable for four patients (5%). these patients were retrospectively evaluated and their pathological and f - fdg - pet / ct findings were recorded. f - fdg was synthesized using an in - house cyclotron (rds 111 cyclotron, siemens healthcare, erlangen, germany) and an automated synthesis system according to a previously authorized procedure. after five hours of fasting, the blood glucose level of each patient was measured and the patient was then intravenously injected with 370 mbq of f - fdg. one hour after f - fdg injection, a ct scan of the area from the vertex to the proximal thigh was performed without contrast agent, and these images were then used for attenuation correction and image fusion. this was followed by whole - body three - dimensional pet acquisition with eight bed positions that each consisted of 3 minutes of emission scan time using a dedicated pet / ct scanner (hi - rez biograph 6, siemens healthcare). this scanner provides an in - plane spatial resolution of 4.8 mm and an axial field view of 16.2 cm. the pet data were then reconstructed using a gaussian filter with an ordered - subset expectation maximization algorithm (3 iterations, 8 subsets), reoriented in transverse, coronal and sagittal planes, and assessed by comparison with corresponding ct images. pet scans were analyzed visually and semi - quantitatively using maximum standardized uptake value (suvmax) measurement. suv was expressed in terms of body weight (suvbw, g / ml). parameters such as patient 's weight (kg), height (cm), radioactivity during injection (mbq), residual radioactivity (mbq) after the injection, starting time of injection, and half life of the radioisotope (taken to be 109.8 minutes for f - fdg) were calculated automatically by the software. two physicians experienced in nuclear medicine blindly and independently reviewed the hybrid f - fdg - pet / ct scans to determine if they were positive or negative for primary tumor sites. every focal tracer uptake that deviated from physiological distribution was considered to favor disease spread. the background deviation and difference in activity between suspected lesions and the surrounding tissues were used to differentiate benign from malignant lesions. f - fdg was synthesized using an in - house cyclotron (rds 111 cyclotron, siemens healthcare, erlangen, germany) and an automated synthesis system according to a previously authorized procedure. after five hours of fasting, the blood glucose level of each patient was measured and the patient was then intravenously injected with 370 mbq of f - fdg. one hour after f - fdg injection, a ct scan of the area from the vertex to the proximal thigh was performed without contrast agent, and these images were then used for attenuation correction and image fusion. this was followed by whole - body three - dimensional pet acquisition with eight bed positions that each consisted of 3 minutes of emission scan time using a dedicated pet / ct scanner (hi - rez biograph 6, siemens healthcare). this scanner provides an in - plane spatial resolution of 4.8 mm and an axial field view of 16.2 cm. the pet data were then reconstructed using a gaussian filter with an ordered - subset expectation maximization algorithm (3 iterations, 8 subsets), reoriented in transverse, coronal and sagittal planes, and assessed by comparison with corresponding ct images. pet scans were analyzed visually and semi - quantitatively using maximum standardized uptake value (suvmax) measurement. suv was expressed in terms of body weight (suvbw, g / ml). parameters such as patient 's weight (kg), height (cm), radioactivity during injection (mbq), residual radioactivity (mbq) after the injection, starting time of injection, and half life of the radioisotope (taken to be 109.8 minutes for f - fdg) were calculated automatically by the software. two physicians experienced in nuclear medicine blindly and independently reviewed the hybrid f - fdg - pet / ct scans to determine if they were positive or negative for primary tumor sites. every focal tracer uptake that deviated from physiological distribution was considered to favor disease spread. the background deviation and difference in activity between suspected lesions and the surrounding tissues were used to differentiate benign from malignant lesions. f - fdg - pet / ct imaging was negative in 24 patients (30.4%) and positive in 55 (69.6%). there were widespread metastases with high suv values (mean, 8.3 ; range, 3.3 to 20.9) involving at least three organs (i.e., lungs or liver, bones, lymph nodes) in ten patients (12.7%), lymph node metastases in 24 (30.3% ; mean suvmax, 8.1), lung metastases in 18 (22.8% ; mean suvmax, 7.5), bone metastases in 15 (19% ; mean suvmax, 7.8), soft - tissue metastases in four (5% ; mean suvmax, 11.4), liver metastases in three (3.8% ; mean suvmax, 8.3), peritonitis carcinomatosa in two (2.5% ; mean suvmax, 6.6), cerebral metastasis in one (1.2% ; mean suvmax, 11) and concomitant upper tract urothelial carcinoma (utuc) in one (1.2% ; mean suvmax, 14). 1. grade and histological sub - types of the bladder cancer and pet / ct results were assessed. according to the grading system of the international society of urological pathology (isup) and european association of urology (eau), pet / ct was negative in three patients (100%) with low - grade disease, while it was negative in 18 patients (26%) and positive in 51 patients (74%) in the group of high - grade disease, and negative in all patients in the group of squamous cell carcinoma, positive in all patients in the group of undifferentiated carcinoma, and negative in three patients (75%) and positive in one patient (25%) in the group of carcinoma of unknown histological sub - type (table 2). a significant correlation was observed between f - fdg - pet / ct results and histological degree (p < 0.05). the sensitivity, specificity, positive predictive value (ppv), negative predictive value (npv), and accuracy of f - fdg - pet / ct were 89%, 78%, 90%, 75%, and 86%, respectively. metastatic bladder carcinoma has a poor prognosis, and survival decreases parallel to the stage of disease, with a dramatic decrease occurring in the presence of metastatic disease. overall, 10% to 15% of patients with metastatic cancer are metastatic at the time of diagnosis. additionally, the rate of local recurrence is about 30% after radical cystectomy, and development of metastatic disease is more common in muscular invasive bladder carcinomas. even though the disease does not begin with metastases, metastasis occurs in 24 months in almost half of the bladder cancers treated with radical methods. accordingly, making accurate diagnoses and monitoring responses to treatment are of vital importance. currently, there is no diagnostic tool capable of detecting occult metastases with high accuracy. among all metastases, those in the visceral organs are markers of very poor prognosis in terms of survival. however, accurately staging bladder cancer through conventional diagnostic methods is still currently challenging. the success rate of clinical staging (bimanual exam, ct, mri) has been reported as 70% in the literature. in patient - based analyses, it has been shown that f - fdg - pet / ct leads to changes in the therapeutic plan in 68% of patients because it can detect 40% more cases compared to conventional investigations based on ct and mri. moreover, f - fdg - pet / ct has been found to provide additional diagnostic data for clinical management of the disease owing to the high sensitivity and specificity of metastatic muscle - invasive bladder carcinoma (mibc) (figs evaluated the diagnostic capacity of pet / ct retrospectively in patients with mibc and found that clinical management had changed in 17% of the patients. conducted a meta - analysis that revealed that diagnostic accuracy was sufficient in staging and restaging with f - fdg - pet / ct in patients with mibc and metastatic bladder cancer in their meta - analysis, while no diagnostic capacity of f - fdg - pet / ct was observed for detecting bladder wall lesions with primary malignancy. because it is excreted with urine, fdg may not play an important role in evaluation of bladder and detrusor lesions ; however, it was shown to be useful for staging and determining metastatic disease. overall, tests with high sensitivity and specificity are needed to predict residual disease and monitor treatment response in such patients. in this context, f - fdg - pet / ct in which particularly functional and anatomic images are processed is a very important diagnostic tool. in the present study, patients undergoing pet / ct screening upon suspicion of metastatic disease were evaluated retrospectively, and the capacity of pet / ct to detect metastatic disease was investigated. the most distinctive feature of cancer tissue is that it shows higher glucose metabolism than normal tissues (warburg effect). high uptake of f - fdg in cancerous lesions of transitional carcinoma was first demonstrated by harney. in rats.. found that metabolism - based anatomical information gathered by the addition of f - fdg - pet to ct provided high diagnostic accuracy in preoperative staging of invasive transitional cancers, particularly invasive bladder carcinoma. f - fdg - pet / ct is now an established standard for preoperative staging and detection of metastatic lesions of bladder cancer. during systemic circulation, f - fdg undergoes glomerular filtration and is not absorbed, but largely excreted in the urine. this poses a problem to identification of kidney, ureter, bladder, and prostate tumors. another limitation is the faint f - fdg uptake by some malignant neoplasms, such as renal, prostate, and hepatocellular carcinomas. an important reason for decreased sensitivity is that primary tumors can express low levels of glucose transporters such as glut-1, which are responsible for the accumulation of f - fdg. use of urinary activity of f - fdg in diagnosis of primary tumors is currently still challenging ; however, oral hyperhydration, forced diuresis with furosemide, evacuating the bladder with a catheter, and taking late pelvic images partially eliminates such problems. thus, urinary activity of f - fdg was only a limitation of our study as it relates to utucs. f - fdg activity of the bladder in metastases of pelvic lymph nodes was recorded as a feature partially limiting the evaluations owing to superposition. diuresis has been shown to effectively decrease background radioactivity in the urinary tract and hence facilitate the identification of hypermetabolic lesions on f - fdg - pet. found a sensitivity of 54% when f - fdg - pet / ct was applied to detect malignant areas on the bladder wall in 11 patients with mibc. in a similar study, harkirat. found sensitivity and specificity of 86.7% and 100%, respectively, for detection of primary lesions with f - fdg - pet / ct in 22 patients with mibc. sensitivity and specificity rates given in both studies were found using late pelvic images taken along with forced diuresis. in a study of 51 patients, swinnen. compared the f - fdg - pet / ct results of patients with mibc for whom radical cystectomy was scheduled with pathological results obtained by extended pelvic lymph node dissection. the sensitivity, specificity, and accuracy of f - fdg - pet / ct were found to be 46%, 97%, and 84%, respectively. in a similar study, lodde. found a ppv of 100% for f - fdg - pet / ct applied to detect lymph node metastasis, and a higher specificity rate compared to ct (33% vs. 57%). taken together, these previous studies indicate the superiority of f - fdg - pet / ct on ct for detection of lymph node metastasis (figs. 5, 6). found a sensitivity, specificity, ppv, and npv of 70%, 94%, 78%, and 91%, respectively in a f - fdg - pet / ct investigation of 43 patients with stage t2/3n0m0 urothelial cancer. specifically, they found occult metastatic disease in seven of 42 patients and that preoperative f - fdg - pet / ct might be influential in the decision of whether or not to conduct treatment prior to radical cystectomy. the relationship between pet findings and survival was also assessed in that study, and the results showed a 24-month recurrence - free survival of 24% among pet - positive patients, compared to a survival of 55% among pet - negative patients. jensen. compared f - fdg - pet / ct and mri for n - staging prior to radical cystectomy in 18 patients and found specificity rates of 93% and 80%, respectively, which were significantly different. additionally, the npvs were found to be 87.5% and 80%, respectively, although these values were not statistically significant.. found sensitivity, specificity, and accuracy rates of 60%, 88%, and 78%, respectively, for the detection of metastatic disease by f - fdg - pet / ct in 55 patients with mibc. in that series apolo. evaluated 47 patients for diagnosis of metastatic disease and 135 individual metastatic lesions and found a sensitivity of 88% and specificity of 87% upon organ - based analyses. in that study, f - fdg - pet / ct was found to lead to changes in the therapeutic plan in 68% of the patients because it could detect 40% more cases than conventional investigations using ct and mri. the authors concluded that f - fdg - pet / ct has excellent sensitivity and specificity for detection of metastatic bladder cancer and provides additional diagnostic information that enhances clinical management relative to ct / mri alone. in the present study, specificity, sensitivity, accuracy rates, ppv, and npv were found to be 89%, 78%, 90% (50/55), 75% (18/24), and 86%, respectively, which was in accordance with the results of previous studies. liu. found a sensitivity of 77% and specificity of 97% for f - fdg - pet / ct when detecting metastatic disease in 46 chemotherapy - negative patients. in a recent systemic review and meta - analysis by lu., a sensitivity of 89% and specificity of 82% were found for detection of metastatic lesions in bladder cancer. in that meta - analysis, the authors found that diagnostic accuracy was sufficient in staging and restaging with f - fdg - pet / ct for patients with mibc and metastatic bladder cancer, while no diagnostic capacity of f - fdg - pet / ct was observed during detection of bladder wall lesions with primary malignancy. because of its urinary excretion, f - fdg may not play an important role in evaluation of bladder and detrusor lesions ; however, the authors found that it might be useful for staging and in determining metastatic disease. in a study conducted in 2014, mertens. evaluated the relationship of f - fdg - pet / ct results with mortality in patients with mibc (n=211 ; median follow - up, 18 months). in that study, disease - specific survival was 50 months in pet - negative patients, while it fell to 16 months in pet - positive patients the presence of extravesical disease was found to be an independent prognostic factor for mortality in pet - positive patients. studies have also been conducted to investigate the diagnostic performance of alternative diagnostic tools to f - fdg - pet / ct. in a study using choline, golan. evaluated 20 patients for a total of 51 lesions with abnormal activity. for all lesions, the ppv was 84.7% for 11choline - pet / ct, while it was 90.7% for f - fdg - pet / ct. that study indicated that 11choline - pet / ct was not superior to f - fdg - pet / ct for detecting metastatic bladder cancer, despite its histopathological correlation disadvantage. the diagnostic performance of f - fdg - pet / ct applied to metastatic bladder cancer reported in previous studies is summarized in table 3. the metabolic rate of low grade transitional cell carcinomas is close to that of normal tissues. the increased glucose metabolism in patients with high grade mibc allows visualization of the lesions on the detector due to increased fdg uptake. false - positive or false - negative findings of fdg uptake can not be explained solely by glucose metabolism of tumor tissue. previous studies have demonstrated that f - fdg - pet / ct scans can only provide information in the presence of a number of increased tumor cells with abnormal glucose metabolism (10 - 10). such diagnostic failures are particularly important in solid organ metastases, such as those found in the lungs and liver. in general, f - fdg - pet / ct can not accurately evaluate metastases measuring less than 5 mm in size. it is unknown why lung lesions below this threshold do not produce high suvs ; however, it may be caused by motion artifacts and low metabolic activity of the metastatic lesion. the reduction of motion artifacts using certain techniques, achieving a better spatial resolution and finding a higher cutoff suv values for such lesions can increase diagnostic accuracy. the findings of pet / ct scans must be verified by histopathological work - up to confirm disease recurrence. unfortunately, this is seldom possible in daily practice owing to clinical reasons, feasibility of the procedure and effective advantages of this approach in the absence of a radical surgical intent. in our study, histological confirmation was available in 14 patients, while all others were compared based on clinical and radiological findings. additionally, there may have been some selection bias since it is likely that only metastatic bladder carcinoma patients suspected to have recurrence were referred for pet / ct. the present study retrospectively reviewed the contribution of f - fdg - pet / ct to detection of metastatic bladder cancer and found it to be consistent with the results of previous studies. the most important parameters limiting the current study and similar ones in the literature were a low correlation of histopathology, inability to prevent respiratory artifacts when detecting lung carcinomas smaller than 5 mm and thus inability to diagnose microscopic disease with high accuracy. it is believed that f - fdg - pet / ct may be useful in the diagnosis of metastatic bladder cancer owing to its high sensitivity and ppvs. additionally, it may be useful to evaluation of the response to systemic chemotherapy due to its high performance. | purposethe purpose of this study was to retrospectively investigate the contribution of 18f - fluorodeoxyglucose - positron emission tomography / computed tomography (18f - fdg - pet / ct) to detection of metastatic bladder cancer.materials and methodsthe present study included 79 patients (69 men and 10 women) undergoing 18f - fdg - pet / ct upon suspicion of metastatic bladder cancer between july 2007 and april 2013. the mean age was 66.1 years with a standard deviation of 10.7 years (range, 21 to 85 years). patients were required to fast for 6 hours prior to scanning, and whole - body pet scanning from the skull base to the upper thighs was performed approximately 1 hour after intravenous injection of 555 mbq of 18f - fdg. whole body ct scanning was performed in the cranio - caudal direction. fdg - pet images were reconstructed using ct data for attenuation correction. suspicious recurrent or metastatic lesions were confirmed by histopathology or clinical follow-up.resultsthe sensitivity, specificity, positive predictive value, negative predictive value, and accuracy of 18f - fdg - pet / ct were 89%, 78%, 90%, 75%, and 86%, respectively.conclusion18f-fdg-pet/ct can detect metastases with high sensitivity and positive predictive values in patients with metastatic bladder carcinoma. |
punctate inner choroidopathy (pic), an idiopathic primary choriocapillaritis, affects especially young myopic women. multiple yellowish white dots (100 - 300 m) can aggregate in the inner choroid or retinal pigment epithelial layer, resulting in exudative retinal detachment. choroidal neovascularization (cnv) secondary to pic is the most vision - impairing complication next to subretinal fibrosis. due to cnv maculopathy, clinical diagnosis is based on funduscopy, angiography with fluorescein (fa) or indocyanine green (icga) and spectral - domain optical coherence tomography (sd - oct). additionally autofluorescence images can provide further information due to autofluorescent spots in active and hypofluorescent spots in scar regions. a 29-year - old woman was referred to our department of ophthalmology with impaired visual acuity, photopsia and a central scotoma at her right eye (re) for 2 weeks. neither operation nor laser surgery was done before, and no additional ocular or systemic diseases were known. best corrected visual acuity (bcva) was 0.3 (re, 8.50 sph) and 1.0 at the left eye (le, 6.50 sph). vitreoretinal glitter (glitzerbeete) at the inferior part of the retina and multiple yellowish dots at the posterior pole without other signs of inflammation (fig. 1a), being hyperfluorescent (early phase) with a diffuse leak (late phase) in fa (fig. blood chemistry and count (except decreased basophil granulocytes) as well as immunoglobulins (igm and igg) for borrelia burgdorferi, treponema pallidum (tpha) were normal. starting with an anti - inflammatory therapy (prednisolone acetate eye drops) in our policlinic resulted in a discrete improvement of bcva (0.5 re) after already 4 days until 0.8 bcva after 2 months. as paracentral scotoma occurred at that point of follow - up, further fa revealed a classic cnv. because of this cnv, an intravitreal injection of anti - vascular endothelial growth factor (vegf, bevacizumab, 1 mg/0.05 ml) was administered, stabilizing bcva at 0.8 - 1.0 in the following months. three months after the first anti - vegf injection, the patient was referred again because of spreading of central scotoma (re : bcva 0.8). now a systemic anti - inflammatory therapy with prednisone (120 mg) and azathioprine (2 mg / kg body weight / day) was started. two more intravitreal injections of bevacizumab (1 mg/0.05 ml, bcva at injection 2 : 0.5 ; bcva at injection 3 : 0.8 ; re) were administered. under this therapy, afterwards bcva decreased again (0.2) with recurrence of cnv and increased spreading in the central part of the fovea. on the patient 's demand, no further intravitreal injection of anti - vegf was done, but local and systemic therapy were continued. bcva stabilized at 0.5 under azathioprine and tapered prednisone medication without cnv activity in sd - oct. rates of 69 - 75% were reported in the literature, yet treatment is still a challenge. only few cases have been published reporting the use of local or systemic anti - inflammatory medications (e.g. corticosteroids, immunomodulators), argon laser photocoagulation, photodynamic therapy (pdt), retinal surgery of cnv or intravitreal anti - vegf injections. systemic corticosteroids were applied successfully in the treatment of juxtafoveal (bcva increase 1/10 - 6.7/10) and subfoveal cnv (average bcva increase 6/18 - 6/12). laser photocoagulation is discussed controversially because of an increased risk of generating cnv, scare growth and the potential of reaching foveal structures. an increase in bcva was also observed for the combination of pdt with systemic corticosteroids (mean : 8.6 letters, follow - up 12 months, number of pdt : 2) or with intravitreal triamcinolone (bcva 0.52 - 0.20, follow - up 12 months). submacular surgery can be considered for subfoveal cnv, yet a 66.7% recurrence of cnv was reported. no studies are available for surgical treatment of extrafoveal cnv at this moment. a further option in medical treatment either bevacizumab (1.25 mg/0.05 ml) or ranibizumab (0.5 mg/0.1 ml) resulted in an improved bcva (mean : 6485 etdrs letters, follow - up 87.2 weeks). in our patient, after resolution of the acute pic inflammation, resulting in a rapid increase of bcva from 0.3 to 0.8, a classic cnv decreased bcva due to macula involvement. an intravitreal anti - vegf injection (bevacizumab) was given, and bcva increased up to 1.0. after 3 months, a recurrence of cnv occurred, systemic immunosuppression was intensified (prednisone and azathioprine), and two additionally bevacizumab injections were applied. a further recurrence of cnv after 5 months (bcva 0.2) was treated without anti - vegf injection (considering the patient 's desire), but with continuation of local and systemic immunosuppression, resulting in a lasting improvement of bcva (0.5) and stabilizing cnv in sd - oct. it is not a matter of course that a combined therapy, as in the presented case, does always lead to this good visual outcome. whether a combination of distinct therapeutic options, a single medical treatment or a simple wait and see regime is the best therapy for pic remains open, as pic can also show a spontaneous resolution combined therapy of immunosuppression with intravitreal anti - vegf injections should be considered as therapeutic strategy in the management of recurrent cnv associated with pic. the patient has consented to the submission of the case report for submission to this journal. all authors certify that they have no affiliations with or involvement in any organization or entity with any financial interest (such as honoraria, educational grants, participation in speakers ' bureaus, membership, employment, consultancies, stock ownership, or other equity interest, and expert testimony or patent - licensing arrangements), or non - financial interest (such as personal or professional relationships, affiliations, knowledge or beliefs) in the subject matter or materials discussed in this paper. | purposechoroidal neovascularization (cnv) associated with punctate inner choroidopathy (pic) is a rare clinical entity, yet still a challenge for medical treatment. a case of a young myopic woman developing cnv secondary to unilateral pic is presented. clinical morphology, diagnostic procedure and follow - up are reported.case reporta 29-year - old woman presented with multiple yellowish dots at the posterior pole. no other signs of inflammation could be seen. angiography with fluorescein yielded hyperfluorescent signals in the affected areas with a diffuse leak, and sd - oct showed a slightly elevated retinal pigment epithelial layer, consistent with the diagnosis of pic. additionally a classic cnv was observed.resultsanti-inflammatory therapy with local prednisolone acetate eye drops in combination with intravitreal injection of anti - vascular endothelial growth factor (vegf, bevacizumab) yielded an increased best - corrected visual acuity. as cnv reappeared, systemic medication with prednisone and azathioprine in combination with two further intravitreal injections of anti - vegf stabilized cnv and increased visual acuity again.conclusioncombined therapy of immunosuppression with intravitreal anti - vegf injections can be considered as therapeutic strategy in the management of recurrent cnv associated with pic. |
during january august 2013, we collected rodents and shrews in jiaonan county, shandong province, china (1193012030e, 35353608 n). the animals were trapped once a month by using mouse traps baited with peanuts ; a different trap site was used each month. the traps were set before sunset outside human dwellings in rural areas and collected the next morning. we classified the rodents and shrews according to appearance (hair color) and body structures (i.e., shape of mouth, teeth, tail, ratio of tail length to body length, cheek pouch). after the animals were euthanized, we collected blood samples from their hearts onto absorbent paper strips (10 mm 30 mm). animal use and sample collection protocols were approved by the bioethics committee of the school of public health, shandong university. before testing the serum samples for the presence of sftsv, we evaluated the sensitivity and specificity of a double - antigen sandwich elisa kit (wuxi xinlianxin biotech co, wuxi city, china) for detecting sftsv in rodent serum. to do this, we used an indirect immunofluorescence assay (ifa) as a standard to test rodent serum samples for sftsv and compared the results with those from the elisa. a total of 68 kunming albino mice (shandong university experimental animal center, jinan, china) were used for the tests : 36 were injected with sftsv, and 32 (controls) were injected intraperitoneally with saline solution. on days 7, 12, 17, and 21 after injection, 9 infected and 8 control mice were euthanized, and serum samples from the mice were tested for sftsv antibody by ifa and elisa. of the 36 serum samples from the sftsv - inoculated mice, 33 were positive for sftsv by ifa and elisa and 3 were positive by ifa only. all 32 serum samples from the control mice were negative for sftsv by ifa and elisa. thus, under these laboratory conditions and compared with the ifa, the elisa had a sensitivity of 91.7% and specificity of 100%, suggesting that the elisa could be used to test serum samples from the field - collected rodents. kits for shrews were not commercially available in china, so we were unable to test the sensitivity and specificity of the elisa for detecting sftsv in serum from shrews. we collected 89 asian house shrews (suncus murinus) and 666 rodents in the field during january the rodents included 186 striped field mice (apodemus agrarius), 182 house mice (mus musculus), 156 brown rats (rattus norvegicus), 125 greater long - tailed hamsters (cricetulus tyiton), and 17 chinese hamsters (cricetulus barabensis). serum samples from the rodents and shrews were tested for igg and igm to sftsv by using the elisa as described previously (810). serum samples on absorbent paper were each reconstituted by adding 150 l of phosphate - buffered saline, and 75 l of each sample was added to a well of the elisa plate. elisa results showed that sftsv seroprevalence was higher among asian house shrews (4.5%, 4/89) than among rodents (0.9%, 6/666) (p = 0.014). among the rodents, sftsv seropositivity was higher in house mice (1.1%, 2/182) and striped field mice (1.1%, 2/186) than in other rodent species (table). however, the seropositivity rate was not significantly different among the rodent species (p = 0.691). in addition, the seropositivity rate did not differ significantly by month (p = 0.411). total rna was extracted from homogenized animal spleens by using the rneasy mini kit (qiagen, hilden, germany), which was used as a template for sftsv amplification performed by using the access rt - pcr system (promega, madison, wi, usa). primers for reverse transcription pcr (rt - pcr) were designed from the m segments of the sftsv genome. outside pcr primers were 5-tctgcagttcagactcaggga-3 and 5-gacgtgtattgctgttttccc-3 ; nested pcr primers were 5-tgttgcttgtcagcctatgac-3 and 5-caaccaatgatcctgagtgga-3. the pcr products (674 bp) were cloned and sequenced for both strands at least 3 times. amplification results showed that the sftsv positivity rate was higher among shrews (2.6%, 2/77) than among rodents (0.7%, 3/440), but the difference was not significant (p = 0.162) (table). the pcr positivity rate differed by month : the rate was 4.7% (4/86) for animals trapped in march, 1.6% (1/62) for animals trapped in june, and 0 for animals collected during the other 6 months (p = 0.043). phylogenetic analysis indicated that the sftsv sequences from the rodents and shrews were closely related to each other (98.5% 99.7% homology) and highly homologous (95.3% to 99.7%) to the corresponding sequences of sftsv from a human (genbank accession no. jf267784), and ticks (genbank accession nos. kc473541 and jq684872) (figure). phylogenetic analysis of severe fever with thrombocytopenia syndrome virus (sftsv) amplified from the spleens of asian house shrew and rodents. the neighbor - joining phylogenetic tree was constructed by using mega 5.2 software(http://www.megasoftware.net/).genbank accession numbers precede isolate names on the right side of the figure. two previous studies demonstrated that rodents in china were seronegative for sftsv (7,12). however, negative results might have been caused by small sample sizes or by using rodents that were collected from sites where sftsv was not endemic. the serologic and rt - pcr results in our study show that rodents and shrews in eastern china are seropositive for sftsv. we also attempted to amplify s segments of the genomes of sftsv isolates, but results were positive for only 1 animal. it is possible that in our study, the primer for the s segment was not as sensitive as that for the m segment. most animal species that have been investigated for the presence of sftsv have been positive for the virus, including rodents, shrews, goats, cattle, dogs, and chickens (5,810). goats have usually shown high seroprevalence to sftsv but very low virus loads and short periods of sftsv viremia (9). rodents experimentally infected with sftsv usually have long periods of viremia and high virus loads in the blood (13,14). cross - sectional analysis indicated that the sftsv infection rate among rodents and shrews did not differ substantially by month during the 8-month study period, but the pcr positivity rate was highest for animals collected during march. the variation between months can probably be explained by the fact that the animals were collected from different sites each month ; the rates of infection among animals at the different sites may have differed. in conclusion, our findings show that the asian house shrew and different varieties of rodents are potential animal hosts of sftsv. further studies are needed to determine which of the many animal hosts of sftsv can most effectively transmit the virus to ticks, the probable vector of sftsv transmission to humans. | to evaluate the role of small mammals as hosts of severe fever with thrombocytopenia syndrome virus (sftsv), we tested serum samples from rodents and shrews in china, collected in 2013. sftsv antibodies and rna were detected, suggesting that rodents and shrews might be hosts for sftsv. |
urinary stone disease, or urolithiasis, is one of the most common afflictions of modern society.1 it is a common urologic disease with prevalence of about 1%20% that is increasing throughout the world. urinary stone incidence in iran is high.2,3 the highest incidence was reported in ilam province, western iran, at 3222 per 100,000 people per year.4 the incidence in qom province is 234 per 100,000 people per year.4 urinary stone analysis is important in determining the possible etiology and pathophysiology of stone formation. a better understanding of stone composition may help prevent urinary stone formation.5 incidence and composition of urinary stones has wide geographic variation. people believe that the quality of water supply and its mineral content, specifically calcium, may contribute to urinary stone formation.6 mineral content of tap water differs dramatically throughout iran depending on the water source. qom province, located in central iran s desert, has a hot and dry environment, which may influence the prevalence or quality of stone formation. in this prospective study, the prevalence of different biochemical forms of urinary stones was analyzed and its relationship with tap water hardness was evaluated. from march 2008 to july 2011 all stones retrieved from patients with renal or ureteral stones were sent for biochemical analysis. to rule out the effects of infravesical obstruction, bladder stone cases were excluded. analysis was performed in two nonprofit private medical laboratories (boo - ali and danesh medical laboratory). gender and age of patients, water source, and composition of stones were analyzed. stones were obtained by spontaneous passage, surgical manipulation (open or endoscopic surgery), or after extracorporeal shockwave lithotripsy. included patients were residents of qom for at least 5 years, and all consumed city tap water as drinking or cooking water. each stone sample was washed, dried, and crushed and then analysis was performed using semiquantative chemical analysis technique (merckognost urinary analysis kit ; merck, darmstadt, germany). there were 255 patients included in the analysis, 212 were males (83%) and 43 were females (17%) aged 14 to 84 years. all of the stones except one were mixed calculi, evidenced by major and minor stone components. the most frequent major component of stones was calcium oxalate (73%), followed by uric acid (24%), ammonium urate (2%), and cystine (1%). table 3 and table 4 show the sex distribution of calculi patients based on the major and minor component of stones, respectively. the mean age of calculi patients was 42.4 years (median 45 years, standard deviation 11.87 years). hardness range is 3901202 ppm with a mean of 651 ppm.7 its tap water ranks number one among iran s 28 provinces for hardness. water hardness is defined as the molar sum of calcium and magnesium found in water.4,8 on the basis of water quality association classification, water hardness data were classified into five groups : soft (180 ppm).9 with a daily water intake of 2 l, inhabitants in areas with very hard water receive at least 360 mg of calcium daily (30% of reference value).4 the quality of qom province tap water is very hard (443.7 ; table 6). in recent years, the use of treated home water by miniature house desalination plants has become very common. comparing the results of this study with those from previous studies,1012 no significant difference (p > 0.05) in biochemical stone analysis distribution between qom province and other provinces with softer drinking water was found. calcium oxalate stones were present as calcium oxalate dihydrate (weddelite) or monohydrate (whewellite). these calcium oxalate stone subtypes were not evaluated in this study. mehrsai evaluated urinary calculi in two large urban areas of iran with much softer drinking water and found that the most common stone type was weddelite, seen in 77% of mixed stones. in another similar iranian study of 103 stones, the most common component was whewellite (81.5%).12 in sun study of 177 urinary stones, whewellite (50%) and weddelite (15%) were found to be the most common stone. similar to the results in this current study, another study from iran showed that the most common component of stone in 165 pediatric urolithiasis cases was calcium oxalate.11 the facilitative role or protective role of water hardness in stone formation is controversial and still to be proven.1416 although the lithogenic effects of water hardness is not proven, it has been shown in some studies that the calcium quantity of tap water may cause hypercalciuria with concomitant hypooxaluria.14,17 bellizi observed that drinking soft water is preferable to hard water, as it is associated with a lower risk of calcium stone recurrence. in contrast, sierakowski found that living in areas with a hard water supply is related to less urolithiasis formation. on the basis of this study, there is no relationship between the quality of tap water and the distribution pattern of urinary stones. although there is a conflict between water hardness and incidence of urinary stone formation, no correlation was found between water hardness and the type of urinary stones in qom province. | purposethe aim of this study was to evaluate the biochemical stone composition in general population of qom province, central iran, and its relationship with high tap water hardness.materials and methodsin a prospective study, from march 2008 to july 2011, biochemical analysis of urinary stones in patients living in qom province for at least 5 years was performed. stones were retrieved by spontaneous passage, endoscopic or open surgery, and after extracorporeal shockwave lithotripsy. demographic findings and the drinking water supply of patients were evaluated and compared with biochemical stone analysis.resultsstone analysis was performed in 255 patients. the most dominant composition of urinary stones was calcium oxalate (73%), followed by uric acid (24%), ammonium urate (2%), and cystine (1%). the peak incidence of urinary stone was in patients in their forties. overall male to female ratio was 4.93:1.conclusionthe dominant stone composition in inhabitants of central iran, where tap water hardness is high, was calcium oxalate stones. on the basis of this study, biochemical urinary stone composition of qom does not differ from other regions of iran with lower water hardness. |
with an ageing population, the prevalence of dementia will continue to rise in the coming decades, placing a high burden on social and economic resources. since effective treatments are lacking, prevention of dementia deserves high priority [1, 2 ]. in recent years, a relationship has been found between vascular disease and cognitive impairment in elderly patients with mental illness. therefore, it is important to identify modifiable vascular risk factors, which could be used in preventing or delaying the onset of dementia. evidence has emerged that proper control of vascular disorders and maintenance of active lifestyle may prevent or delay the onset and progression of dementia [2, 3 ]. n - terminal pro - brain natriuretic peptide (nt - probnp) and brain natriuretic peptide (bnp) have an established role in identifying patients with heart failure, but these markers are also increased in myocardial ischaemia / coronary artery disease [4, 5, 6 ]. in previous studies in elderly patients with mental illness [7, 8 ], we observed an increased frequency of pathological values of serum nt - probnp in patients with vascular disease compared to patients without vascular disease. we concluded that the serum nt - probnp level might be useful to identify patients in need of control and treatment of vascular risk factors and also provided prognostic information. since many clinical and epidemiological studies published during the last 3 decades show that even mild hyperhomocysteinaemia is associated with vascular disease [9, 10, 11, 12 ], we investigated elderly patients with mental disease with regard to plasma homocysteine (thcy) and the presence of vascular disease [13, 14, 15 ]. briefly, our findings showed that patients with mental illness and any forms of vascular disease had significantly higher plasma thcy concentrations than patients without vascular disease, and that elevated plasma thcy in mental illness was mainly associated with the presence of vascular disease and not related to the specific psychogeriatric diagnosis. in the present study, we investigated nt - probnp levels in different forms of vascular disease in elderly patients with mental illness. furthermore, since serum nt - probnp level has been associated with an increased risk of both cardiac [4, 5, 6 ] and noncardiac vascular diseases and might detect subclinical vascular disease, we have used serum nt - probnp level and the presence or absence of vascular disease according to the medical records to categorize patients in four groups. group i consisted of patients with vascular disease and an elevated level of serum nt - probnp, whereas patients in group ii also showed the presence of vascular disease but with a normal level of serum nt - probnp. patients in group iii had no clinically overt vascular disease but an elevated level of serum nt - probnp, and patients in group iv showed no vascular disease and had a normal level of serum nt - probnp. in order to study the possible use of serum nt - probnp to evaluate vascular disease in elderly patients with mental illness, we investigated the distribution of different diagnoses, survival time, cognition (mini - mental state examination, mmse, score), brain imaging (computed tomography, ct, scan), renal function, and plasma thcy in these four groups. the present study population consisted of 447 patients consecutively enrolled [187 males and 265 females, with a median age of 75 years (1090th percentiles, 5587) ] who were referred to the psychogeriatric department at the lund university hospital for diagnostic assessments and treatment. patients on any kind of ongoing vitamin substitution were excluded from the study. the diagnosis was based on psychiatric, neurological, somatic, and laboratory investigations, psychometric testing, measurements of regional cerebral blood flow, electroencephalography, and ct scan. the patients were classified into two groups on the basis of brain imaging findings : one group with normal findings (n = 217) and a second group with pathological findings (n = 177), showing white matter lesions and/or cerebral infarction. the majority of the patients were living in their own homes, alone or with relatives. dementia was diagnosed in 211 patients, 77 patients were diagnosed with alzheimer 's disease (ad), 89 patients with vascular dementia (vad), and 45 patients with other types of dementia (mainly mixed vad and ad). in total, 236 patients were diagnosed with mental diseases without dementia (non - dementia), 51 patients with depression, 6 patients with confusional states, 24 patients with other psychiatric disorders (mainly psychosis), and 122 patients with mild cognitive impairment (mci). in addition, 33 patients presented with subjective symptoms of cognitive impairment but normal psychometric tests. furthermore, patients with vad fulfilled the ninds - airen criteria for vad, and patients with ad were diagnosed in accordance with the nincds - adrda criteria. survival time was determined as months at the end of the study (6 years) or months until death. informed consent to participate was given by all subjects (or by relatives, if the patients were unable to communicate). the patients (n = 447) were divided into different groups according to the presence of a diagnosis and/or symptoms indicating vascular disease in their medical records. one group (n = 277) consisted of patients with any form of vascular disease and included diagnoses / symptoms such as vad, cerebral infarction, transient ischaemic attacks, myocardial infarction, angina pectoris, peripheral vascular disease, atrial fibrillation, and hypertension. a subgroup of these patients (n = 104) consisted of patients with manifest occlusive arteriosclerotic vascular disease (called manifest vascular disease) and included diagnoses / symptoms such as cerebral infarction, transient ischaemic attacks, myocardial infarction, angina pectoris, or occlusive peripheral vascular disease. in 99 patients, hypertension was observed as the vascular disease. cerebral infarction or transient ischaemic attacks were observed in 64 patients, myocardial infarction or angina pectoris in 40 patients, atrial fibrillation was diagnosed in 37 patients, and heart failure without any other vascular disease was diagnosed in 12 patients. in 170 patients, there was no indication of any vascular disease. blood samples for thcy determination were collected in evacuated tubes containing edta at about 8 a.m. after an overnight fast and centrifuged within 15 min at 3,000 g for 5 min. total plasma thcy was measured with high - performance liquid chromatography after reduction of disulphide bonds with dithiothreitol and deproteinization with sulphosalicylic acid. serum cystatin c measurements were performed by a polystyrene - enhanced turbidimetric method (dakocytomation, copenhagen, denmark). l for subjects below 50 years of age and 1.44 mg / l for subjects above 50 years of age. the serum level of nt - probnp was determined using an immunoassay (modular analytics e170 ; roche diagnostics, mannheim, germany). the mann - whitney u test was used at the 5% level of significance to evaluate the study. the present study population consisted of 447 patients consecutively enrolled [187 males and 265 females, with a median age of 75 years (1090th percentiles, 5587) ] who were referred to the psychogeriatric department at the lund university hospital for diagnostic assessments and treatment. patients on any kind of ongoing vitamin substitution were excluded from the study. the diagnosis was based on psychiatric, neurological, somatic, and laboratory investigations, psychometric testing, measurements of regional cerebral blood flow, electroencephalography, and ct scan. the patients were classified into two groups on the basis of brain imaging findings : one group with normal findings (n = 217) and a second group with pathological findings (n = 177), showing white matter lesions and/or cerebral infarction. the majority of the patients were living in their own homes, alone or with relatives. dementia was diagnosed in 211 patients, 77 patients were diagnosed with alzheimer 's disease (ad), 89 patients with vascular dementia (vad), and 45 patients with other types of dementia (mainly mixed vad and ad). in total, 236 patients were diagnosed with mental diseases without dementia (non - dementia), 51 patients with depression, 6 patients with confusional states, 24 patients with other psychiatric disorders (mainly psychosis), and 122 patients with mild cognitive impairment (mci). in addition, 33 patients presented with subjective symptoms of cognitive impairment but normal psychometric tests. furthermore, patients with vad fulfilled the ninds - airen criteria for vad, and patients with ad were diagnosed in accordance with the nincds - adrda criteria. survival time was determined as months at the end of the study (6 years) or months until death. informed consent to participate was given by all subjects (or by relatives, if the patients were unable to communicate). the patients (n = 447) were divided into different groups according to the presence of a diagnosis and/or symptoms indicating vascular disease in their medical records. one group (n = 277) consisted of patients with any form of vascular disease and included diagnoses / symptoms such as vad, cerebral infarction, transient ischaemic attacks, myocardial infarction, angina pectoris, peripheral vascular disease, atrial fibrillation, and hypertension. a subgroup of these patients (n = 104) consisted of patients with manifest occlusive arteriosclerotic vascular disease (called manifest vascular disease) and included diagnoses / symptoms such as cerebral infarction, transient ischaemic attacks, myocardial infarction, angina pectoris, or occlusive peripheral vascular disease. in 99 patients, hypertension was observed as the vascular disease. cerebral infarction or transient ischaemic attacks were observed in 64 patients, myocardial infarction or angina pectoris in 40 patients, atrial fibrillation was diagnosed in 37 patients, and heart failure without any other vascular disease was diagnosed in 12 patients. in 170 patients, there was no indication of any vascular disease. blood samples for thcy determination were collected in evacuated tubes containing edta at about 8 a.m. after an overnight fast and centrifuged within 15 min at 3,000 g for 5 min. total plasma thcy was measured with high - performance liquid chromatography after reduction of disulphide bonds with dithiothreitol and deproteinization with sulphosalicylic acid. serum cystatin c measurements were performed by a polystyrene - enhanced turbidimetric method (dakocytomation, copenhagen, denmark). the upper reference limits for serum cystatin c are 1.15 mg / l for subjects below 50 years of age and 1.44 mg / l for subjects above 50 years of age. the serum level of nt - probnp was determined using an immunoassay (modular analytics e170 ; roche diagnostics, mannheim, germany). the upper reference limit is 300 ng / l. the mann - whitney u test was used at the 5% level of significance to evaluate the study. levels of serum nt - probnp, plasma thcy, and serum cystatin c were elevated in all groups of patients with different forms of vascular disease compared to patients without vascular disease (table 1). furthermore, correction for the age difference between patients with and without vascular disease did not change the significant elevations of serum nt - probnp, plasma thcy, and serum cystatin c (data not shown). notably, the levels of serum nt - probnp were particularly increased in patients with atrial fibrillation. patients with hypertension exhibited similar serum nt - probnp level than the other groups of patients with vascular disease. patients without vascular disease according to their medical records but with an elevated level of nt - probnp showed elevated levels of plasma thcy and serum cystatin c compared to patients with vascular disease but a normal level of serum nt - probnp (table 2). all patients were divided into four groups depending on their level of nt - probnp and the presence or absence of vascular disease according to their medical records (table 3). group i consisted of patients with vascular disease and an elevated level of serum nt- probnp, whereas patients in group ii also showed the presence of vascular disease but with a normal level of serum nt - probnp. patients in group iii had no clinically overt vascular disease but an elevated level of serum nt - probnp, and patients in group iv showed no vascular disease and had a normal level of serum nt - probnp. in groups i iii, the levels of serum nt - probnp, plasma thcy, and serum cystatin c were elevated, and the survival time was lower than in group iv. the mmse score was lower and the frequencies of pathological ct findings were higher in groups i and ii than in group iv. the patients in group i were older and showed increased plasma thcy and serum cystatin c levels, lower mmse score, shorter survival time, and an increased percentage of pathological ct findings compared to the patients in group ii. the distribution of the main diagnoses (vad, ad, mci, and depression) in the four subgroups is presented in table 4. patients with ad were substantially observed in all groups, whereas only a few patients with mci (n = 3) and depression (n = 2) were observed in group iii. patients with vad and an elevated level of serum nt - probnp (group i) were older (p < 0.001) and showed a shorter survival time (p < 0.001) than patients with a normal level of serum nt - probnp (group ii). patients with ad in group i were older and showed an increased serum cystatin c level (plasma thcy was almost significantly increased, p = 0.07) compared to those in group iv, whereas patients in group ii did not differ in any parameter from patients in group iv. patients with ad and an elevated serum nt - probnp (groups i and iii) were older and showed increased levels of plasma thcy and serum cystatin c as well as an increased percentage of pathological ct findings compared to patients with a normal level of serum nt - probnp (groups ii and iv) (table 5). patients with mci in group i were older and showed increased levels of plasma thcy and serum cystatin c, decreased mmse score, shorter survival time, and an increased percentage of pathological ct findings compared to patients in group iv (table 4). likewise, patients with mci in group ii were older and showed increased levels of plasma thcy and serum cystatin c and an increased percentage of pathological ct findings compared to patients in group iv. patients with depression in group i were older and showed increased levels of plasma thcy and serum cystatin c and a decreased mmse score compared to patients in group iv, whereas patients with depression in group ii did not differ in any parameter from patients in group iv. levels of serum nt - probnp, plasma thcy, and serum cystatin c were elevated in all groups of patients with different forms of vascular disease compared to patients without vascular disease (table 1). furthermore, correction for the age difference between patients with and without vascular disease did not change the significant elevations of serum nt - probnp, plasma thcy, and serum cystatin c (data not shown). notably, the levels of serum nt - probnp were particularly increased in patients with atrial fibrillation. patients with hypertension exhibited similar serum nt - probnp level than the other groups of patients with vascular disease. patients without vascular disease according to their medical records but with an elevated level of nt - probnp showed elevated levels of plasma thcy and serum cystatin c compared to patients with vascular disease but a normal level of serum nt - probnp (table 2). all patients were divided into four groups depending on their level of nt - probnp and the presence or absence of vascular disease according to their medical records (table 3). group i consisted of patients with vascular disease and an elevated level of serum nt- probnp, whereas patients in group ii also showed the presence of vascular disease but with a normal level of serum nt - probnp. patients in group iii had no clinically overt vascular disease but an elevated level of serum nt - probnp, and patients in group iv showed no vascular disease and had a normal level of serum nt - probnp. in groups i iii, the levels of serum nt - probnp, plasma thcy, and serum cystatin c were elevated, and the survival time was lower than in group iv. the mmse score was lower and the frequencies of pathological ct findings were higher in groups i and ii than in group iv. the patients in group i were older and showed increased plasma thcy and serum cystatin c levels, lower mmse score, shorter survival time, and an increased percentage of pathological ct findings compared to the patients in group ii. the distribution of the main diagnoses (vad, ad, mci, and depression) in the four subgroups is presented in table 4. patients with ad were substantially observed in all groups, whereas only a few patients with mci (n = 3) and depression (n = 2) were observed in group iii. patients with vad and an elevated level of serum nt - probnp (group i) were older (p < 0.001) and showed a shorter survival time (p < 0.001) than patients with a normal level of serum nt - probnp (group ii). patients with ad in group i were older and showed an increased serum cystatin c level (plasma thcy was almost significantly increased, p = 0.07) compared to those in group iv, whereas patients in group ii did not differ in any parameter from patients in group iv. patients with ad and an elevated serum nt - probnp (groups i and iii) were older and showed increased levels of plasma thcy and serum cystatin c as well as an increased percentage of pathological ct findings compared to patients with a normal level of serum nt - probnp (groups ii and iv) (table 5). patients with mci in group i were older and showed increased levels of plasma thcy and serum cystatin c, decreased mmse score, shorter survival time, and an increased percentage of pathological ct findings compared to patients in group iv (table 4). likewise, patients with mci in group ii were older and showed increased levels of plasma thcy and serum cystatin c and an increased percentage of pathological ct findings compared to patients in group iv. patients with depression in group i were older and showed increased levels of plasma thcy and serum cystatin c and a decreased mmse score compared to patients in group iv, whereas patients with depression in group ii did not differ in any parameter from patients in group iv. the present study shows that patients with different forms of vascular disease exhibited an elevated level of nt - probnp compared to patients without vascular disease. thus, these findings are in agreement with previous reports suggesting that the presence of cardiovascular disease increases the level of serum nt - probnp [4, 5, 6, 16 ]. about half of the patients classified as having vascular disease according to their medical records showed normal levels of serum nt - probnp. a possible reason for this discrepancy is that their vascular disease did not significantly involve the heart. the elevated levels of serum nt - probnp in 23 patients diagnosed as having no vascular disease according to their medical records might be attributed to renal impairment and/or subclinical cardiovascular disease. the increase of serum nt - probnp levels in most of the different forms of vascular disease suggests similar cardiac involvement irrespective of whether the vascular disease is of cerebral or extracerebral origin, occlusive or not occlusive, or only manifests itself as hypertension. thus, this finding indicates a generalized vascular disease also in patients diagnosed with cerebral vascular disease. the level of serum nt - probnp was, however, particularly increased in patients with atrial fibrillations, which is in agreement with a highly elevated serum nt - probnp level in atrial distention [4, 5, 6 ]. as previously shown, plasma thcy was also elevated to a similar extent in the different forms of vascular disease compared to patients without vascular disease. likewise, the level of serum cystatin c was increased to a similar extent in the different forms of vascular disease, which indicates similar renal impairment in all these vascular diseases. furthermore, in patients without vascular disease but with an elevated level of serum nt - probnp, the levels of plasma thcy and serum cystatin c were increased compared to patients with vascular disease but a normal level of serum nt - probnp. this finding indicates that the serum nt - probnp level might be a better indicator of the severity of the vascular disease than solely the diagnosis and/or presence of symptoms of vascular disease. renal impairment is known to increase the serum level of nt - probnp [4, 5, 6 ], and it is therefore expected that patients with an elevated level of serum nt - probnp also show a lowered renal function (as judged by serum cystatin c) compared to patients with a normal level of nt - probnp. cystatin c is a sensitive marker of renal impairment, and chronic renal disease is known to be an important cardiovascular risk factor [24, 25 ]. this fact is in agreement with our findings from previous studies [7, 8 ] and from the present study, where we observed that serum cystatin c is associated with serum nt - probnp and plasma thcy levels, the presence of vascular disease, and pathological ct findings (indicating cerebrovascular disease). as described in the results section, all patients were divided into four groups according to their level of serum nt - probnp and the presence or absence of vascular disease as indicated in the medical records. patients in group i could be regarded as having a more severe form of vascular disease than those in group ii, which was supported by the findings that patients in group ii were younger, showed lower plasma thcy and serum cystatin c levels, higher mmse score, a lower percentage of pathological ct findings, and a longer survival time than patients in group i. all patients in groups i iii could be regarded as patients with vascular disease, even if the cardiovascular disease in group iii was only manifested as an elevated level of serum nt - probnp. patients in group iv represent a group of patients without any signs of vascular disease. consequently, patients in groups i iii showed higher plasma thcy and serum cystatin c levels and a shorter survival time, and patients in groups i and ii also showed a lower mmse score and higher percentage of pathological ct findings than patients in group iv. these findings indicate that the presence or absence of vascular disease according to the medical records means that some patients with cardiovascular disorders are classified as having no vascular disease despite an elevation of their serum nt - probnp levels. the distribution of the main diagnoses (vad, ad, mci, and depression) in the different groups of vascular disease shows that patients with vad in group i exhibited a somewhat higher age and a shorter survival time than patients in group ii. furthermore, an elevated level of serum nt - probnp in patients with vad in group i indicates that these patients also suffer from cardiovascular disease in addition to their cerebral vascular disease. the shorter survival time in these patients might thus be attributed to a more generalized vascular disease. subgrouping of the other main diagnoses (ad, mci, and depression) in these four subgroups showed that plasma thcy, renal function (as judged by serum cystatin c), mmse score, survival time, and percentage of pathological ct findings differed between the groups. these findings indicate that the determination of serum nt - probnp might be useful in the evaluation of vascular disease in elderly patients with mental illness. few patients with mci or depression were observed in group iii, which indicates a significant agreement between serum nt - probnp level and the presence or absence of vascular disease according to medical records. however, patients with ad were substantially represented in all four groups, and serum cystatin c was elevated in groups i and iii compared to group iv, whereas plasma thcy showed a tendency to increase (p = 0.07) only in group i. it is particularly interesting that a substantial proportion of the patients with ad (group iii) without vascular disease had an elevated level of serum nt - probnp, indicating subclinical cardiovascular disease. patients with ad in groups i and iii might have a more severe form of vascular disease than the patients in group ii, which is reflected by the fact that, although there was no significant decrease in the mmse score and survival time, patients with ad and elevated serum nt - probnp level (groups i and iii) were older, showed lower renal function, an increased plasma thcy level, and a higher percentage of pathological ct findings compared to patients with ad and a normal level of serum nt - probnp (groups ii and iv). this finding supports the hypothesis that neurovascular interactions in the development and/or progression of ad have been underappreciated. therefore, it is important to determine the serum nt - probnp level in patients with ad to detect those in need of treatment of their vascular disease in order to prevent or delay cognitive impairment. the present study shows that patients with different forms of vascular disease exhibited an elevated level of nt - probnp compared to patients without vascular disease. thus, these findings are in agreement with previous reports suggesting that the presence of cardiovascular disease increases the level of serum nt - probnp [4, 5, 6, 16 ]. about half of the patients classified as having vascular disease according to their medical records showed normal levels of serum nt - probnp. a possible reason for this discrepancy is that their vascular disease did not significantly involve the heart. the elevated levels of serum nt - probnp in 23 patients diagnosed as having no vascular disease according to their medical records might be attributed to renal impairment and/or subclinical cardiovascular disease. the increase of serum nt - probnp levels in most of the different forms of vascular disease suggests similar cardiac involvement irrespective of whether the vascular disease is of cerebral or extracerebral origin, occlusive or not occlusive, or only manifests itself as hypertension. thus, this finding indicates a generalized vascular disease also in patients diagnosed with cerebral vascular disease. the level of serum nt - probnp was, however, particularly increased in patients with atrial fibrillations, which is in agreement with a highly elevated serum nt - probnp level in atrial distention [4, 5, 6 ]. as previously shown, plasma thcy was also elevated to a similar extent in the different forms of vascular disease compared to patients without vascular disease. likewise, the level of serum cystatin c was increased to a similar extent in the different forms of vascular disease, which indicates similar renal impairment in all these vascular diseases. furthermore, in patients without vascular disease but with an elevated level of serum nt - probnp, the levels of plasma thcy and serum cystatin c were increased compared to patients with vascular disease but a normal level of serum nt - probnp. this finding indicates that the serum nt - probnp level might be a better indicator of the severity of the vascular disease than solely the diagnosis and/or presence of symptoms of vascular disease. renal impairment is known to increase the serum level of nt - probnp [4, 5, 6 ], and it is therefore expected that patients with an elevated level of serum nt - probnp also show a lowered renal function (as judged by serum cystatin c) compared to patients with a normal level of nt - probnp. cystatin c is a sensitive marker of renal impairment, and chronic renal disease is known to be an important cardiovascular risk factor [24, 25 ]. this fact is in agreement with our findings from previous studies [7, 8 ] and from the present study, where we observed that serum cystatin c is associated with serum nt - probnp and plasma thcy levels, the presence of vascular disease, and pathological ct findings (indicating cerebrovascular disease). as described in the results section, all patients were divided into four groups according to their level of serum nt - probnp and the presence or absence of vascular disease as indicated in the medical records. patients in group i could be regarded as having a more severe form of vascular disease than those in group ii, which was supported by the findings that patients in group ii were younger, showed lower plasma thcy and serum cystatin c levels, higher mmse score, a lower percentage of pathological ct findings, and a longer survival time than patients in group i. all patients in groups i iii could be regarded as patients with vascular disease, even if the cardiovascular disease in group iii was only manifested as an elevated level of serum nt - probnp. patients in group iv represent a group of patients without any signs of vascular disease. consequently, patients in groups i iii showed higher plasma thcy and serum cystatin c levels and a shorter survival time, and patients in groups i and ii also showed a lower mmse score and higher percentage of pathological ct findings than patients in group iv. these findings indicate that the presence or absence of vascular disease according to the medical records means that some patients with cardiovascular disorders are classified as having no vascular disease despite an elevation of their serum nt - probnp levels. the distribution of the main diagnoses (vad, ad, mci, and depression) in the different groups of vascular disease shows that patients with vad in group i exhibited a somewhat higher age and a shorter survival time than patients in group ii. furthermore, an elevated level of serum nt - probnp in patients with vad in group i indicates that these patients also suffer from cardiovascular disease in addition to their cerebral vascular disease. the shorter survival time in these patients might thus be attributed to a more generalized vascular disease. subgrouping of the other main diagnoses (ad, mci, and depression) in these four subgroups showed that plasma thcy, renal function (as judged by serum cystatin c), mmse score, survival time, and percentage of pathological ct findings differed between the groups. these findings indicate that the determination of serum nt - probnp might be useful in the evaluation of vascular disease in elderly patients with mental illness. few patients with mci or depression were observed in group iii, which indicates a significant agreement between serum nt - probnp level and the presence or absence of vascular disease according to medical records. however, patients with ad were substantially represented in all four groups, and serum cystatin c was elevated in groups i and iii compared to group iv, whereas plasma thcy showed a tendency to increase (p = 0.07) only in group i. it is particularly interesting that a substantial proportion of the patients with ad (group iii) without vascular disease had an elevated level of serum nt - probnp, indicating subclinical cardiovascular disease. patients with ad in groups i and iii might have a more severe form of vascular disease than the patients in group ii, which is reflected by the fact that, although there was no significant decrease in the mmse score and survival time, patients with ad and elevated serum nt - probnp level (groups i and iii) were older, showed lower renal function, an increased plasma thcy level, and a higher percentage of pathological ct findings compared to patients with ad and a normal level of serum nt - probnp (groups ii and iv). this finding supports the hypothesis that neurovascular interactions in the development and/or progression of ad have been underappreciated. therefore, it is important to determine the serum nt - probnp level in patients with ad to detect those in need of treatment of their vascular disease in order to prevent or delay cognitive impairment. the main finding in the present study is that serum nt - probnp levels are similarly increased in most of the different forms of vascular disease, which suggests similar cardiac involvement irrespective of whether the vascular disease is of cerebral or extracerebral origin, occlusive or not occlusive, or only manifests itself as hypertension. furthermore, patients with vascular disease and an elevated serum nt - probnp level (group i) had a lower cognition level, shorter survival time, lower renal function, and a higher percentage of pathological ct findings than patients with vascular disease and a normal nt - probnp level (group ii). thus, an elevated serum nt - probnp level might detect patients who have a more severe cardiovascular disease and therefore a higher risk of rapid progression of their vascular disease and mental illness. these patients are in need of more intensive control and treatment of their vascular disease to prevent or delay cognitive impairment. | backgroundserum n - terminal pro - brain natriuretic peptide (nt - probnp) is regarded as a sensitive marker of cardiovascular disease. vascular disease plays an important role in cognitive impairment.methodin 447 elderly patients with mental illness, serum nt - probnp level and the presence or absence of vascular disease according to the medical record were used to categorize patients in different subgroups of vascular disease.results and conclusionpatients with vascular disease and elevated serum nt - probnp level had a lower cognition level, shorter survival time, lower renal function and a higher percentage of pathological brain imaging than patients with vascular disease and normal nt - probnp level. thus, elevated serum nt - probnp level might be helpful to detect patients who have a more severe cardiovascular disease. |
a glomus body, or glomus apparatus, is a neuromyoarterial structure in the dermis layer of the skin, involved in body temperature regulation. it consists of an arterio - venous shunt surrounded by a capsule of connective tissue. in response to sympathetic stimuli, glomus body induces vasoconstriction in the shunt arterioles, controlling blood flow and skin temperature1,3,10,12). glomus tumor or glomangioma is a kind of perivascular tumor and a rare benign neoplasm arising from the glomus body. the vast majority of the tumors are found under the nail, on the fingertip or in the foot3,8,10,11). rarely, they may present in other body areas such as tympanic membrane, gastrointestinal organ, glans penis, or trachea4,8). since normal human nervous system does not contain glomus bodies, glomus tumors affecting peripheral nerves are extremely rare. the glomus tumor in the peripheral nerve is known as one of the mesenchymal tumors originating in the epineurium9,10,13). they are often associated with constant or episodic shooting pain that is generally unresponsive to conventional therapies. the authors report a case of glomus tumor in the femoral nerve branch with a review of literature. a 56-year - old man presented with severe lancinating pain at left anterior thigh for nine years, one year after accidentally bumping his left thigh to a tree. he initially visited the other medical center where he was diagnosed with a mass lesion in the left thigh. he was referred to the neurosurgery department for evaluation and surgical management. on physical examination, severe direct tenderness in the left anterior thigh was observed. the range of motion in the extremities was full, but pain was provoked by physical irritation or by knee extension. electromyography (emg) and nerve conduction velocity were consistent with left femoral neuropathy of moderate degree and chronic partial axonotmesis state. the magnetic resonance images showed a well - defined, enhancing mass of 2.5 cm in diameter at left mid - thigh level, in between the rectus femoris, vastus laterlis, and vastus intermedius muscles (fig. the mass was formed along a muscular branch of the femoral nerve, and thus resembled a neurogenic tumor of femoral nerve branch, such as schwannoma. the tan, pinkish white tumor was oval in shape with moderate vascularity, and well demarcated with the nerve tissue (fig. the cellular borders were sharply defined and angulated, and dilated vessels were surrounded by the tumor cells. the immunohistochemical staining showed positive for smooth muscle antigen (sma) and negative for s-100 protein, and the ki-67 proliferative index was less than 1.0% (fig. a glomus tumors, a benign neoplasm arising from the glomus body, usually occurs in the subungal region, on the fingertip or in the foot3). the tumor was first described by hoyer in 1877, while the first complete clinical description was given by barre and masson in 19245,9). glomus tumors are made up of afferent arterioles, anastomotic vessel, and collecting venules accompanying modified smooth - muscle cells. anastomoses of the afferent arterioles with collecting veins are called sucquet - hoyer canals and the entire complex, with abundant unmyelinated nerve fibers, is surrounded by a collagenous capsule5,9,12). episodic pain, abrupt and lancinating in nature, is the most common symptom at presentation. this pain can be provoked by pressure or cold and often unresponsive to conventional therapies. interruption of afferent blood flow may be effective, which is the basis of the tourniquet test3,5). multiple variant is not common, and approximately 10% of these tumors occur in multiples4,6,9). an association with neurofibromatosis type 1 has also been rarely mentioned in multiple variant glomus tumors12). glomus tumor associated with apparent peripheral nerve is extremely exceptional, despite normal glomus bodies have a microanatomical connection with small, unmyelinated nerve fibers14). so far, only nine cases including the present case have been documented to our knowledge1,2,7,9,13 - 16). the tumors have affected various sites such as the common peroneal nerve16), the radial nerve13), the sciatic nerve9), the tibial nerve15), a digital branch of the ulnar nerve7), a dermal nerve in the shoulder1), the median nerve9), and the sural nerve2). the present case is the first report of a glomus tumor associated with the femoral nerve branch. all lesions occurred in adults : six in male patients and three in female patients. the nine tumors reported ranged from 1 mm to 7 cm in size and had benign clinical and pathological nature. all the patients clinically improved with surgical excision and no evidence of recurrence was reported. the rare occurrence of glomus tumors in nerves where normal glomus bodies have not been found can be approached by a number of theories7). first, the tumor might infiltrate from an extraneural tissue such as accompanying vessels by direct extension. second hypothesis is that tumors are developed from a possible normal intraneural glomus body or ectopic glomus cells, but such histological findings have never been described in nerves so far. the third possibility is that the tumor developed through differentiation from unspecialized perivascular wall, or pericytes in particular. pericytes are also modified smooth - muscle cells, widely distributed around small - sized vessels like vasa nervorum. also, smooth - muscle cell and glomus tumor cell show a resemblance in immunophenotype study (sma+, collagen iv+, s100-, and epithelial membrane antigen ; ema-). the differentiation of pericytes into tumor cells can be a potential explanation for the origin of glomus tumors where glomus body do not exist in general3,5 - 8,10,12). in this case, we are in favor of first and the third hypotheses, because the tumor was obviously connected to a small vessel and the tumor was discrete to the associated neural tissue. when a patient complains severe lancinating pain aggravated by exercise or physical irritation, and especially has history of trauma as is this case, surgeons easily consider the diagnosis of painful neuroma when presenting at an uncommon site such as a nerve, other entities including a schwannoma, a meningioma, an epithelioid leiomyosarcoma, a metastatic melanoma, a carcinoma or a glomus tumor should be considered as differential diagnosis10). mere medication and loose observation may be catastrophic, and image study and surgical confirmation must be considered at an early stage. operative excision has benefits in both diagnosis and curative treatment of the tumor affecting peripheral nerves. although glomus tumors are closely associated with the functioning peripheral nerves, complete surgical excision can be achieved without difficulty thorough microsurgical techniques. according to the literatures along with our experience on a glomus tumor in the peripheral nerve, a nerve - sparing surgical excision is the curative treatment of choice. when a tumor is deeply seated between muscles and is without a palpable mass, it can be hard to locate the exact lesion site. at first surgery in the present case, the authors were able to remove the tumor successfully with the aid of intraoperative ultrasonography. intraoperative emg monitoring may also be helpful, but it was omitted in the present case because the operation was performed under spinal anesthesia. the debilitating lancinating pain was resolved and no recurrence was seen after total resection of the tumor as were the reported cases. a glomus tumor can be encountered at an uncommon site, such as a peripheral nerve. severe shooting pain and pressure tenderness are characteristic clinical features. | the glomus tumor of the peripheral nerve is one of the mesenchymal tumors originating in the epineurium, and is extremely rare. a 56-year - old man presented complaining of lancinating pain on the left thigh, which was provoked by pressure or exercise. subsequent image study revealed a mass in the femoral nerve. total surgical excision with the aid of intraoperative ultrasonography was performed and the pain was successfully controlled. the authors report an unusual case of a patient diagnosed with glomus tumor in peripheral nerve, with a review of the clinical features, imaging, and pathological findings. |
forensic odontology is a legal field of dentistry, which deals with the proper handling and examination of dental evidence and with the proper evaluation and presentation of dental findings in the interest of justice. a working classification about the interrelationship of nine individual dental specialties with forensic odontology was formulated, and a detailed review about the relationship of these dental specialties with forensic odontology was ascertained. the main objective of this study is to find the relationship of forensic odontology with various dental specialties in the articles published in the journal of forensic odonto - stomatology from 2005 to 2012. all of the protocols for this study were performed in accordance with the declaration of helsinki. the author has no known conflict of interest associated with the study and there has been no significant financial support for this work that could have influenced its outcome. a total of 16 issues of journal of forensic odonto - stomatology from 2005 to 2012 were analyzed. this was available on the journal website http://www.iofos.eu/jfosonline2.html (last accessed on 2013 dec 30). the article contents were scrutinized based on the relationship of forensic odontology with other dental specialties. the contents of the published articles were categorized into nine individual dental specialty articles based on the new working classification proposed for forensic odontology. the dental specialties considered were oral pathology and microbiology, oral medicine and radiology, oral and maxillofacial surgery, pedodontics, periodontics, conservative dentistry and endodontics, prosthodontics, orthodontics and finally community dentistry. the section on editorial, book review and conference proceedings in journal of forensic odonto - stomatology were excluded from the study. the relationship of forensic odontology with various dental specialties in the articles published in the journal of forensic odonto - stomatology from 2005 to 2012 is summarized in table 1. the relationship of forensic odontology with various dental specialities in the articles published in the journal of forensic odonto - stomatology from 2005 to 2012 there is a paucity of information about the relationship of forensic odontology with various dental specialties in the articles published in the journal of forensic odonto - stomatology. regarding the relationship with various dental specialties, the maximum number of published articles were related to oral medicine and radiology (20) and community dentistry (20), followed by orthodontics (18), prosthodontics (15), and oral pathology and microbiology (8), pedodontics (7), oral and maxillofacial surgery (4) and conservative dentistry and endodontics (3). two articles dealing with forensic anthropology were excluded from the study since it has no relationship with dental specialties based on the new working classification for forensic odontology. in a recent study done on publication trends of a forensic odontology journal from india, regarding the relationship of forensic odontology with various dental specialties, the maximum numbers of published articles were related to oral medicine and radiology (30), followed by oral pathology and microbiology (16), prosthodontics (14), and orthodontics (10) and community dentistry (5). regarding the relationship of forensic odontology with various dental specialties, the maximum number of published articles were related to oral medicine and radiology in both journals (journal of forensic odonto - stomatology and journal of forensic dental sciences). among the articles published in journal of forensic odonto - stomatology, mass disasters (10) and bite mark analysis (10) followed by sexual dimorphism (8) and dental fraud and malpractice (8) followed by craniofacial superimposition (6) and identification (6) form the major attraction of the contributors. in journal of forensic dental sciences, cheiloscopy (12) followed by palatal rugoscopy (9), sexual dimorphism (6) and cephalometrics (4) form the major attraction of the contributors. in journal of forensic dental sciences, the two dental specialties such as oral and maxillofacial surgery and periodontics were untouched over 4 years publication. under periodontics specialty, the editorial board should include articles about age estimation using periodontosis (gum recession), root transparency and root length and identification using gingival morphology and pathology and thickness and widening of periodontal ligament and pathology and status of alveolar bone. the main limitation of this study is that the data is taken from only one journal to study the relationship of forensic odontology with various dental specialties. to sum up, this paper has tried to evaluate the new working classification proposed for forensic odontology based on its relationship with other dental specialties. | background : there is a paucity of information about the relationship of forensic odontology with various dental specialties in the articles published in the journal of forensic odonto - stomatology. this study aimed to find the relationship of forensic odontology with various dental specialties in the articles published in the journal of forensic odonto - stomatology from 2005 to 2012 over an 8-year period.methods:bibliometric analysis was performed using web - based search during december 2013.results:out of the total 97 published articles, the maximum number of published articles were related to oral medicine and radiology (20) and community dentistry (20), followed by orthodontics (18), prosthodontics (15), and oral pathology and microbiology (8), pedodontics (7), oral and maxillofacial surgery (4) and conservative dentistry and endodontics (3). among the articles published in journal of forensic odonto - stomatology, mass disasters (10) and bite mark analysis (10), followed by sexual dimorphism (8) and dental fraud and malpractice (8), followed by craniofacial superimposition (6) and identification (6) form the major attraction of the contributors.conclusion:this paper has tried to evaluate the new working classification proposed for forensic odontology based on its relationship with other dental specialties. |
the prevalence of type 2 diabetes mellitus (t2 dm) has significantly increased worldwide in the past 25 years [1, 2 ]. dr is one of the most common microvascular complications of diabetes mellitus (dm) and is the leading cause of visual impairment and blindness in working - aged people. in recent years, the prevalence of dr is rapidly increasing [3, 4 ], as the number of people with t2 dm increased. the results of a cross - sectional study in a multiethnic asian population showed that the overall age - standardized prevalence of dr was 25.4% (20%, 24.8%, and 28.9% in chinese, malays, and indians, resp. more than 50% of t2 dm patients likely suffer from dr within twenty years after diagnosis. because the symptoms of dr are not apparent in early stages of this disease, patients often miss the best opportunity for treatment when diagnosed, leading to a high rate of blindness. according to the world health organization (who), dr accounts for 4.8% of the total cases of blindness (thirty - seven million worldwide) in 2006. therefore, it is important to investigate the risk factors that promote or predict dr. diabetic nephropathy (dn), also known as diabetic kidney disease or diabetic glomerulosclerosis, is another major complication of dm and the leading cause of end - stage renal disease (esrd). previous studies have shown that microalbuminuria not only is an important clinical marker for dn, but also is closely associated with the progression of dr. however, suffering from dr and the appearance of microalbuminuria do not occur at the same time. gfr describes the flow rate of filtered fluid through the kidney and can be estimated using formulas, thereafter referred to as estimated gfr (egfr). unlike microalbuminuria, gfr increases during the early stages of dm due to high blood sugar and decreases during the later stages of dm, reflecting a decline in renal function. that is to say, changes in gfr appear earlier than microalbuminuria in diabetic patients. past studies have reported that gfr is but one variable of many that affects the likelihood of developing dr and the other complications of dm [9, 10 ]. in addition, due to the limited medical condition, routine funduscopic examination or microalbuminuria can not be performed in primary hospital in rural china, especially poverty - stricken areas. so we wondered if egfr could be used for the early detection of dr, in order to screen it in the general population. hence, our researchers are embarking on a series of studies to investigate the relationship between gfr and dr, and this is the baseline study. the aim of this study was to evaluate the prevalence of dr in hospital - based t2 dm patients and investigate the correlation between gfr and dr, so that gfr could be used for dr screening, especially in primary hospital of poor areas. dm patients were admitted to the department of endocrinology and ophthalmology of the first affiliated hospital in china medical university from september 2010 to march 2012. a total of 1613 patients, 844 (52.3%) males and 769 (47.7%) females, with t2 dm were enrolled in this study after rigorous diagnosis and exclusion criteria. the project was performed in accordance with the principles of the declaration of helsinki and approved through the ethics committee of china medical university. the dr severity was classified according to the international clinical diabetic retinopathy disease severity scale. patients were excluded if they had type 1 diabetes mellitus, acute metabolic disorders (such as diabetic ketoacidosis and a hyperglycemic hyperosmolar state), opaque refractive media of one or both eyes (affecting fundus observation), or other eye diseases or serious illnesses (such as cancer). because dn is often complicated with dr, these patients were not excluded to avoid selection bias. information, including the age, gender, duration of diabetes, family history of diabetes, and history of hypertension, was collected for each patient. the blood pressure was measured during the medical examination and recorded as the means of two measurements after the patients rested for 5 minutes. fasting blood was drawn from the cubital vein and used for biochemical assays, including fasting blood glucose (fbg), glycosylated hemoglobin (hba1c), triglycerides (tg), total cholesterol (tc), high density lipoprotein cholesterol (hdl - c), low - density lipoprotein cholesterol (ldl - c), serum creatinine (scr), and blood urea nitrogen (bun). for the 2-hour postprandial glucose (2hpg) measurement, blood was drawn at 2 hours after ingestion of 75 g glucose powder or bread (equivalent amount of carbohydrates). all samples were measured using the architect c8000 biochemical analyzer (toshiba, tokyo, japan). the unit of scr in the ckd - epi formula should be mg / dl, while the levels of scr through colorimetric method were in 1 mg / dl = 17.1 mol / l and put it into the formula to obtain egfr. direct ophthalmoscopy and fundus photography were conducted after the participants were administered mydriatic eye drops to dilate the pupils. the center of the macula and optic disc of both eyes was photographed using a 45-degree digital camera (cr - dgi, canon, japan). if there were different opinions, they would discuss to make decision or consult the superior. based on the results of the assessment, the subjects were divided into two groups : a dr group and a non - dr (dm without dr) group. there were 550 patients in dr group (male 269, female 281) and 1063 patients in ndr group (male 575, female 488). all statistical analyses were performed using the statistical package from the social sciences (spss) version 19.0, empowerstats (http://www.empowerstats.com/), and medcalc software programs. the basic description and logistic regression analyses were performed using spss 19.0 software. the stratified analysis, the interaction test, covariate screening, and curve fitting were performed using empowerstats statistical software. medcalc was used to draw the receiver operating characteristic curve (roc curve), a graphical plot illustrating the performance of a binary classifier system with varying discrimination thresholds. the numerical variables of normal distribution were expressed as the means standard deviation (means sd) and percentage (%). the independent samples t - test was used to analyze the continuous variables, whereas the odds ratio (or) and chi - square () test was used to analyze the categorical variables. based on the exclusion criteria, 1613 t2 dm patients aged 54.75 12.19 years were selected into this study. among these subjects, no differences in tg, dbp, and bun were detected between the dr and ndr groups. in contrast, statistically significant differences were detected for age (p = 0.003), family history of dm (p = 0.036), duration of dm (p 10% change in the regression coefficient after introduction into the basic model. the results showed that the sbp, fbg, 2hpg, hba1c, and the dm duration met the filter criteria (or change was 13.5, 13.4, 16.5, 18.5, and 39.0, resp.). after the adjustment of the variables affecting the relationship between egfr and dr, result of univariate analysis suggested that egfr remained significantly associated with dr (p < 0.001) (table 4). in addition, smooth curve fitting was performed after the adjustment of all variables, and the resultant curve exhibited a two - stage change and a breakpoint (figure 1). when the egfr value was more than the point, the risk of dr was low ; however if the value was less than the point, the risk of dr significantly increased. the saturation effects were analyzed based on the curve, and the data indicated that the inflection point was 99.4 ml / min (34th percentile). before and after the adjustment of the covariates, the logarithmic likelihood ratio test p value decreased from 0.050 to 0.036 (table 5). diabetic retinopathy is one of the most common microvascular complications of dm. with an increase in morbidity of dm, the prevalence of dr has increased yearly, becoming the leading cause of visual impairment and blindness in working - aged people. thus, it is important to characterize the incidence of dr and identify key factors for predicting it. similar to other hospital - based epidemiologic studies in urban china, the prevalence of dr in the this study was 34.1%, which is much higher than in europe, the united states, south korea, and the other developed countries [17, 18 ]. this potentially reflects the higher incidence of dm in china and the poor knowledge or less attention to the complications of dm, particularly dr. to reduce the prevalence of dm and slow down the progression of dr, further efforts should be exerted on concerning the public health education of dm and the complications of it. many studies have described the risk factors for dr, which primarily include the extended duration of dm, old age, hyperglycemia, hyperlipidemia, proteinuria, severe obesity, alcohol consumption, genetic factors, and the expression of a variety of hormones, such as growth hormone [2023 ]. similarly, the present study confirmed that age, extended duration of dm, high blood sugar, high blood pressure, and hyperlipidemia were significantly associated with dr. in addition, we also showed that egfr was negatively correlated with dr, consistent with previous studies [13, 24 ]. these results suggest that measurements of egfr might help to predict the early stage of dr. then we successively conducted stratified analysis, interaction test, and covariate screening to get rid of the factors that affect the relationship between dr and egfr. after the adjustment of these influence factors, the results still suggested that egfr was significantly associated with dr. the graphical representation of the relationship between them displayed a two - stage pattern and that the value of egfr less than or equal to 99.4 ml / min was significantly correlated with dr. the auc was 0.591815, a value between 0.5 and 0.7, indicating that the diagnostic value was not very useful, likely reflecting a bias in this study based on the fact that absence of the related variables with gfr, like urine protein or microalbumin. in addition, recent studies have shown that the incidence of kidney disease in some diabetic patients was independent of dn, referred to as nondiabetic renal disease (ndrd) [25, 26 ]. dn and dr normally appear in the same person at the same time, so we can not artificially exclude the patients suffering from dn. however, ndrd patients may consist in the study population and their results could reduce the value of gfr, which affected the results of experimental. gfr is an important indicator of kidney function and an important factor in the diagnosis of diabetic nephropathy. although the direct relationship between gfr and other microangiopathy of dm has not been fully established, high levels of gfr have been negatively associated with the onset of macroangiopathy, such as coronary artery disease [28, 29 ]. a recent study has also confirmed that dr is closely associated with regional arterial stiffness. many studies have confirmed that both dr and dn are microvascular complications with similar pathological bases, associated with dm [3133 ]. a report from the atherosclerosis risk in communities (aric) study demonstrated that retinopathy and renal dysfunction have a strong association, independent of age, diabetes, hypertension, and other risk factors. systemic markers of inflammation and endothelial dysfunction associated with retinal vascular abnormalities could contribute to the development of kidney disease. animal studies have also shown that pathological changes in the retina are highly associated with renal microcirculation. for dm patients, dr and dn have a common pathological basis and a similar course of evolution. hyperglycemia causes glomerular hyperperfusion and high filtration, leading to an increase of gfr during the early stages of t2 dm. the accumulation of advanced glycation end products, due to hyperglycemia, promotes mesangial proliferation and basement membrane thickening in the glomerulus. in addition, the activation of the polyol pathway, the protein kinase c pathway, the pentose phosphate pathway, oxidative stress, and various cytokines cause a range of variations in kidney, which include capillary obstruction, a reduction of podocyte proliferation, the loss of the urinary proteins, and a decline in renal function. with further thickening of the glomerular basement membrane, the mesangial matrix increases, resulting in the appearance of cracks and an increase in urinary protein leakage. accordingly, changes in gfr appear earlier than those in urine protein levels, and these changes remain throughout the entire course of dm. the pathological mechanisms described above are similar to those observed in the retina. as in the kidney, the high blood sugar exerts deleterious effects on the retina, which include the apoptosis of muller cells, ganglion cells, and pericytes, the thickening of the capillary basement membrane, and the proliferation of endothelial cells in the retina. these effects lead to pathological changes in dr, including nonperfusive capillaries, the appearance of microaneurysms, and exudation. hence, gfr not only may be an important clinical marker for dn, but also could be correlated with dr. taken together, these data highlight the use of egfr as a predictor of dr. however, the results of the present study are important to the primary hospital for dr screening, especially to the ones with limited resources in china. first, this study was a retrospective case - control study, including hospital - based patients with dm. second, dr was diagnosed using ophthalmoscopy and fundus photography, but not fundus fluorescein angiography (ffa). third, the gfr values were estimated by formula, and some of the factors associated with gfr, such as urinary protein excretion or microalbuminuria, were not included in this study. therefore, a long - term follow - up study should be performed in the future. moreover, more factors should be included in this study to provide an in - depth examination of the relationship and mechanism of gfr and dr. in summary, the results of the present study indicate that gfr may have certain implications for dr, which is important to dr screening in primary hospital of china, especially in poverty - stricken areas. | diabetic retinopathy (dr) is the leading cause of visual impairment and blindness in working - aged people. several studies have suggested that glomerular filtration rate (gfr) was correlated with dr. this is a hospital - based study and the aim of it was to examine the relationship between the gfr and dr in patients with type 2 diabetes mellitus (t2 dm). we used ckd - epi equation to estimate gfr and spss 19.0 and empowerstats software to assess their relationship. among the 1613 participants (aged 54.75 12.19 years), 550 (34.1%) patients suffered from dr. the multivariate analysis revealed that the risk factors for dr include age (p < 0.001, or = 0.940), duration of diabetes (p < 0.001, or = 1.163), hemoglobin a1c (p = 0.007, or = 1.224), systolic blood pressure (p < 0.001, or = 1.032), diastolic blood pressure (p = 0.007, or = 0.953), high density lipoprotein cholesterol (p = 0.024, or = 3.884), and egfr (p = 0.010, or = 0.973). through stratified analysis and saturation effect analysis, our data suggests that egfr of 99.4 ml / min or lower might imply the early stage of dr in diabetic patients. thus, the evaluation of egfr has clinical significance for the early diagnosis of dr. |
non - melanoma skin cancer (nmsc) affects close to 1 million americans annually. although metastases are rare, their high incidence and frequent recurrence in affected individuals make nmscs the 4th most costly cancers of the medicare population. nsmc is comprised of two subtypes squamous cell carcinomas (scc) and basal cell carcinomas (bcc). the majority of nmscs are of the bcc subtype in older, white subjects (4:1 ratio of bcc : scc). public health education campaigns advocate sunscreen use and sun avoidance for prevention, but the incidence of nmsc continue to rise [2, 3 ]. nmsc is caused at least in part by sunlight and sunlight is also the primary source of vitamin d. the level of 25(oh)d, the major circulating form of vitamin d, is widely accepted as the best indicator of vitamin d status and vitamin d deficiency occurs if 25(oh)d levels are 70 years of age in the us population[16, 19 ]. subjects with nmsc diagnosis had slightly lower levels of outdoor walking activity (p = 0.02) and minimally higher (22 iu) daily vitamin d intake (p = 0.05). the average age of skin cancer development was 61 12 years, approximately 10 years prior to the median age at which blood for assessing vitamin d status was collected.table 1baseline characteristics of men with and without non - melanoma skin cancer (nmsc)characteristicsnmsc (n = 178)no nmsc (n = 930)p - valuemean (sd) age, years73.6 (5.7)73.2 (5.6)0.35 bmi, kg / m27.2 (3.6)27.6 (3.7)0.13 daily vitamin d intake, iu182 (125)160 (114)0.05 daily calcium intake, iu821 (415)807 (385)0.66 outdoor walking activity14.3 (13.1)17.1 (18.8)0.02number (%) current smokers2 (1.1%)31 (3.3%)0.11 spent > 1 week confined to bed8 (4.5%)37 (3.9%)0.75 season of blood draw winter33 (19%)202 (22%)0.58 spring47 (26%)244 (26%) summer49 (27%)268 (29%) fall49 (27%)216 (23%)clinic minneapolis21 (12%)164 (17%)0.03 pittsburgh28 (16%)199 (21%) portland29 (16%)140 (15%) birmingham33 (18%)134 (14%) palo alto25 (14%)143 (15%) san diego42 (24%)150 (16%)education elementary2 (1.1%)15 (1.6%)0.54 high school35 (20%)212 (23%) college70 (39%)381 (41%)combined intake from diet and supplements baseline characteristics of men with and without non - melanoma skin cancer (nmsc) combined intake from diet and supplements as a measure of consistency, we investigated the association of known predictors to serum 25(oh)d levels in univariate analyses. as expected, increasing age was significantly associated with decreasing 25(oh)d levels (p 32 ng / ml) had a 43% lower odds compared to subjects with insufficient levels (or : 0.57, 95% ci : 0.330.98, p = 0.045) in the base model, and the association approached but did not reach statistical significance after further adjustment for walking and cigarette use. the association between 25(oh)d and nmsc risk was not significantly modified by age, clinic site, or walking activity (pinteraction > 0.05).table 3association of increasing serum 25(oh)d levels with non- melanoma skin cancer25(oh)d (ng / ml)odds ratio (or) and 95% cibase modelfully adjusted modelq1 (32 ng / ml appear to have a 40% lower risk of nmsc and perhaps raising the 25(oh)d levels may be protective. laboratory studies have also shown that vitamin d may be protective as 1.25(oh)d2 inhibits scc cell lines, and mice deleted for the vitamin d receptor exhibit scc and bcc tumors [27, 28 ]. consistent with this hypothesis, we detected a trend of reduced risk of incident nmsc among subjects with higher 25(oh)d levels. another possible explanation is that nmsc subjects may have lower 25(oh)d levels due to sun avoidance behaviors after their nmsc diagnosis. a prospective study of 25(oh)d and incident nmsc cases is needed to further explore the possible protective effect of vitamin d on non - melanoma skin cancer. | to determine the relationship between 25(oh) vitamin d levels and non - melanoma skin cancer (nmsc), we performed a nested case control study in ambulatory, elderly men enrolled in the osteoporotic fractures in men (mros) study. health habit and medical history, including self - reported history of nmsc were recorded and 25(oh)d levels were measured on serum collected at baseline from a random sample of caucasian mros subjects. mean age (73 5), bmi, daily vitamin d and calcium intake were similar in the men with (n = 178) and without nmsc (n = 930), but higher levels of 25(oh)d were associated with a decreased risk of having a history of nmsc (ptrend = 0.04). men in the highest quintile of 25(oh)d (> 30 ng / ml) had 47% lower odds of nmsc (95% ci : 0.300.93, p = 0.026) compared to those in the lowest quintile. our results suggest that a diagnosis of nmsc is not a surrogate for adequate 25(oh)d levels or increased uv exposure, and high 25(oh)d levels may be associated with a reduced risk of nmsc. |
the term dementia describes a collection of symptoms including a decline in memory, reasoning and communication skills and a gradual loss of skills needed to carry out every day living. approximately 700 000 people in the uk suffer from dementia, costing the economy 17 billion a year. over the next 30 years the number of people with dementia is forecast to double, with costs trebling to over 50 billion a year. estimations suggest that only one - third of people with dementia receive a formal diagnosis leading to a lower level of access to management interventions such as medication and social support that could improve outcome. as there is no known cure for dementia the aim of current clinical management is to reduce the risk of developing dementia and minimise its consequences. prospective studies show an increase in risk for dementia if the person has or reports they have depression. however, contradictory evidence exists on whether the relationship between depression and later dementia is similar in men and women. the chsa (community health status assessment) however found that depression increased the risk of vascular dementia in both sexes. less is known about the role of premorbid anxiety despite evidence of close co - morbidity with depression and evidence that anxiety may be a predisposing factor for depression. one recent prospective cohort study (gallacher.) reported that after adjustment for age, vascular risk factors and premorbid cognitive function, higher anxiety levels were significantly associated with cognitive impairment and non - vascular dementia in a male population. however they did not adjust for possible co - morbid depression and comment that further study is required to distinguish whether the association between anxiety and dementia is independent of the relationship between depression and dementia. this study aimed to examine relative associations of a prior anxiety diagnosis, or a prior depression diagnosis, with future diagnosis of dementia in primary care. recognition of predisposing factors for dementia should alert primary care physicians to the increased risk of dementia, in order to facilitate the early recognition and management of this disease. the setting for this study is the consultations in primary care archive (cipca). cipca is a high quality, validated database, containing recorded consultation data from 13 general practices in north staffordshire, uk from 1998. ethical approval for the use of cipca was granted by the north staffordshire research ethics committee. cipca practices utilise read codes to record consultation data, a common method in uk primary care. they make up a hierarchical thesaurus stored by the computer. clinical information is stored as data which is retrievable and analysable. cases and controls were identified from the 10 practices which contributed consultation data to cipca for the entire study period (2000 to 2008). in 2008, dementia cases were identified by a read coded (codes available on request) primary care consultation (or documentation from specialist services) in the period 200308, with no prior read code for dementia, from 2000 onwards and were aged 65 years or more at time of first diagnosis. patients had to be fully registered at least 3 years prior to the date of dementia diagnosis and have consulted a primary care physician in the year preceding their diagnosis. this timeframe was chosen to allow for a 3-year run - in period (2000 to 2003) to ensure that only people with a newly coded diagnosis of dementia were included. research has shown that patients may wait up to 3 years before consulting a primary care physician after their initial symptoms appear. the lower age limit of 65 years was chosen to coincide with the international classification of disease version10 definition of late - onset dementia. patients with diagnostic read codes of dementia subtypes including lewy body dementia, frontotemporal dementia and hiv associated dementia were also excluded as they have potentially different aetiologies. patients in the control group were randomly selected via the statistical package for social sciences (random number generation command, version 20, spss inc., chicago, il). a ratio of between three and four controls to one case were frequency matched by age group at diagnosis, gender, practice and consultation in the same year as the case s first dementia diagnosis. the controls had no dementia diagnosis for the entire time period 200008, had to have registration at the practice for at least 3 years prior to the year of diagnosis of their matched case and had a recorded consultation in the year of diagnosis of the matched case. matching factors were age and gender, due to the differences in the risk factors for dementia by gender and the rising incidence of dementia associated with age, and gp practice, due to possible differences between practices in socio - economic status and diagnosis or recording practice. a review of the literature on risk factors for dementia was completed by the first author (cb). two practicing primary care physicians (first author and last author) independently reviewed the risk factors to identify those factors accessible within routinely collected primary care records. the two reviewers then discussed the inclusion of the risk factors at a final consensus meeting. read codes for each risk factor (available on request) were identified using the uktc (uk terminology centre) clinical terminology browser. the database of raw read codes was also hand searched for relevant read codes to ensure that categories of codes were not missed. the risk factors identified using the above methods were alcohol misuse, smoking, obesity, hypertension, ischemic heart disease, cerebrovascular disease, hypotension, dyslipidaemia, diabetes, anxiety and depression. the lifestyle variables including alcohol misuse, smoking and obesity were found to be poorly coded (e.g. only 4 people had a read code for smoking) and were not included in further analyses. risk factor information was extracted from the primary care records for each case and control from 1 january 2000 up to the date of diagnosis for the cases. unconditional logistic regression was used to assess both the unadjusted and adjusted association of each risk factor with dementia after controlling for the matched criteria, with odds ratios and 95% confidence intervals reported. finally an interaction term of anxiety with depression was included in the adjusted model due to evidence that anxiety and depression often coexist clinically. multivariable analyses were also stratified by gender to assess whether any association between anxiety and depression with dementia was consistent between genders. the setting for this study is the consultations in primary care archive (cipca). cipca is a high quality, validated database, containing recorded consultation data from 13 general practices in north staffordshire, uk from 1998. ethical approval for the use of cipca was granted by the north staffordshire research ethics committee. cipca practices utilise read codes to record consultation data, a common method in uk primary care. they make up a hierarchical thesaurus stored by the computer. clinical information is stored as data which is retrievable and analysable. cases and controls were identified from the 10 practices which contributed consultation data to cipca for the entire study period (2000 to 2008). in 2008, dementia cases were identified by a read coded (codes available on request) primary care consultation (or documentation from specialist services) in the period 200308, with no prior read code for dementia, from 2000 onwards and were aged 65 years or more at time of first diagnosis. patients had to be fully registered at least 3 years prior to the date of dementia diagnosis and have consulted a primary care physician in the year preceding their diagnosis. this timeframe was chosen to allow for a 3-year run - in period (2000 to 2003) to ensure that only people with a newly coded diagnosis of dementia were included. research has shown that patients may wait up to 3 years before consulting a primary care physician after their initial symptoms appear. the lower age limit of 65 years was chosen to coincide with the international classification of disease version10 definition of late - onset dementia. patients with diagnostic read codes of dementia subtypes including lewy body dementia, frontotemporal dementia and hiv associated dementia were also excluded as they have potentially different aetiologies. patients in the control group were randomly selected via the statistical package for social sciences (random number generation command, version 20, spss inc., chicago, il). a ratio of between three and four controls to one case were frequency matched by age group at diagnosis, gender, practice and consultation in the same year as the case s first dementia diagnosis. the controls had no dementia diagnosis for the entire time period 200008, had to have registration at the practice for at least 3 years prior to the year of diagnosis of their matched case and had a recorded consultation in the year of diagnosis of the matched case. matching factors were age and gender, due to the differences in the risk factors for dementia by gender and the rising incidence of dementia associated with age, and gp practice, due to possible differences between practices in socio - economic status and diagnosis or recording practice. a review of the literature on risk factors for dementia was completed by the first author (cb). two practicing primary care physicians (first author and last author) independently reviewed the risk factors to identify those factors accessible within routinely collected primary care records. the two reviewers then discussed the inclusion of the risk factors at a final consensus meeting. read codes for each risk factor (available on request) were identified using the uktc (uk terminology centre) clinical terminology browser. the database of raw read codes was also hand searched for relevant read codes to ensure that categories of codes were not missed. the risk factors identified using the above methods were alcohol misuse, smoking, obesity, hypertension, ischemic heart disease, cerebrovascular disease, hypotension, dyslipidaemia, diabetes, anxiety and depression. the lifestyle variables including alcohol misuse, smoking and obesity were found to be poorly coded (e.g. only 4 people had a read code for smoking) and were not included in further analyses. risk factor information was extracted from the primary care records for each case and control from 1 january 2000 up to the date of diagnosis for the cases. unconditional logistic regression was used to assess both the unadjusted and adjusted association of each risk factor with dementia after controlling for the matched criteria, with odds ratios and 95% confidence intervals reported. finally an interaction term of anxiety with depression was included in the adjusted model due to evidence that anxiety and depression often coexist clinically. multivariable analyses were also stratified by gender to assess whether any association between anxiety and depression with dementia was consistent between genders. four hundred cases of patients with a new dementia diagnosis were identified with 1353 controls. all cases were frequency matched with at least three controls (mean number of controls per case was 3.38) ; this number varied due to differences in number of eligible controls between practices particularly for the 92 + year group. the mean ages were 80.87 (sd 6.19) for controls and 81.40 (sd 6.5) for cases, 63% of the controls and 62% of the cases were female. one hundred and twenty two (31%) of cases had a prior diagnosis of anxiety compared to 14% of controls. prior diagnosis of depression was also higher in some cases (10% versus 5%). unadjusted analysis showed the presence of a prior read code for anxiety [or 2.76 (95% ci 2.113.62) ], depression [or 2.19 (95% ci 1.443.31) ] and cerebrovascular disease [or 1.97 (95% ci 1.422.73) ] and increased the odds of a later dementia diagnosis. an anxiety diagnosis remained significantly associated with future dementia [or 2.67 (95% ci 2.013.54) ] after adjustment, but depression was not significantly associated [or1.54 (95% ci 0.992.39) ], (table 1). however examination of the interaction analysis showed that having a depression diagnosis alone was significantly associated with dementia [or 2.54 (95% ci 1.394.63) ] compared to those with neither anxiety or depression but that this association was less strong than the effect of having depression with anxiety [or 2.85 (95% ci 1.605.07) ] or having only anxiety [or 2.97 (95% ci 2.214.00) ], (table 2). of the other risk factors, a previous diagnosis of cerebrovascular disease [or 2.18 (95% ci 1.553.07) ] increased the odds of dementia but a previous diagnosis of hypertension or dyslipidaemia decreased the odds of dementia [adjusted or 0.69 (95% ci 0.540.87) ] and [adjusted or 0.68 (95% ci 0.460.99) ] respectively. stratification by gender (table 3) indicated that the association of depression only with dementia was higher in males than females. there was less of a difference between genders on the association of anxiety only and both depression and anxiety with future dementia. this study considered the association of diagnoses of anxiety and depression with the future outcome of a dementia diagnosis. a history of anxiety independently increased the odds of being diagnosed with dementia in a primary care setting. having depression without anxiety was also significantly associated with being diagnosed with dementia, however, having a diagnosis of depression alongside anxiety did not increase the likelihood of a dementia diagnosis compared to having just an anxiety diagnosis. anxiety was independently associated with a future dementia diagnosis and was more prevalent within the cohort compared to depression. this is suggestive that anxiety represents a more important risk factor for dementia than had been previously thought, and along with depression represents an affective risk component that could be screened for within primary care. one potential explanatory factor is that anxiety was being diagnosed by primary care physicians in patients experiencing mild cognitive impairment (mci), preceding a later diagnosis of dementia. this concurs with previous work, which suggested that anxiety in patients with mci does strongly predispose to progression to a dementia diagnosis.. also showed that high trait anxiety was an independent risk factor for developing cognitive impairment and non - vascular dementia., did not find a long - term effect for cognitive decline in patients with anxiety. they measured self - reported symptoms of anxiety using hads - a (the hospital anxiety and depression scale anxiety). however their analysis used the scale score of the hads - a which may not be reflective of the clinically relevant levels of anxiety that may incur a read code from a primary care physician. one physiological explanation why chronic anxiety may contribute to cognitive decline is sapolsky s glucocorticoid cascade hypothesis. this hypothesis suggests that high levels of glucocorticoids, brought about by prolonged stress from anxiety and depression, can lead to neurotoxicity and atrophy within the hippocampus which is associated with memory processes. it seems clinically reasonable to postulate that, in a similar way to depression, patients may experience and present with anxiety symptoms as a direct cause of the insight they have into their early experiences of mci. however felt that the long run - in period of their study meant that their results were unlikely to be explained by this hypothesis and prefer an explanation including a common biological pathway linking anxiety, depression and dementia (possibly serotonergic). this study demonstrated differences in the association of dementia and depression between male and females. prevalence of depression in the male control group was lower than in the female controls. lower consultation rates and later presentation of depression in men may be a confounding factor, as the severity of depression in females and males may differ. a male patient presenting with depression vascular depression has been postulated as an accelerant of dementia and cardiovascular disease being more common in men may explain this study s finding. as depression in women is more common and the cause of their depression more heterogeneous, such an association in this group would be masked. cerebrovascular disease was a significant risk factor for dementia as would be expected from previous studies. hypertension and dyslipidaemia appeared to decrease the odds for developing dementia, an unexpected result although the results were close to non - significance. it is likely that the patients identified had controlled disease (unlike in population studies) and were on medication that may represent a confounding factor. the results for diabetes (a well recognised independent risk factor) were also unexpectedly non - significant. by setting the study in the consulting primary care population, using routinely recorded data, the findings are applicable to the primary care population. the sample size was large however, it did not include patients who do not use primary care services. this study is based on anxiety and depression presented by patients rather than self - reported. it is possible that some diagnoses were not coded or mis - coded, although the quality control measures in place around the database should decrease this risk. due to the nature of the read code system and the anonymised dataset we were unable to obtain information on the severity of dementia or risk factors such as lifestyle variables, as well as background information such as socio - economic status. the selection criteria for the study subjects were specific to ensure only patients with late - onset dementia were included ; however it was not possible to differentiate between dementia subtypes. to reduce the chance of risk factor variables not being identified in the premorbid time frame, the cases had to have at least 3 years registration prior to the date of dementia diagnosis and had to have consulted in the year preceding the dementia diagnosis, as did the matched controls. a total of 662 people with a dementia code had to be excluded from the cohort as they lacked 3 years continuous registration prior to their diagnosis. this loss of potential cases decreased the sample size but increased the internal validity of the study as only people with a theoretically new diagnosis of dementia were included. this patient movement is likely to represent the migratory nature of patients with dementia and reflect the findings of rait. where more than twice the number of people with dementia than without dementia moved between practices. it is possible that the study could have excluded patients with the more severe and advanced cases of dementia (i.e. those not able to function in their own homes and needing to move into residential or nursing care) and hence not be entirely representative of the true community sample of people with dementia. this study also only looked at co - morbidities in the recent past (up to 8 years) before dementia was diagnosed, meaning it could not look at long - term effects of disease. it was also not possible to analyse all recognised risk factors due to lack of read coded data found in primary care records, such as apolipoprotein e4 status. furthermore even though this study used at least a 3-year exposure timescale before diagnosis, we can not be completely certain of the temporal relationship between exposure and disease outcome using a case - control design because of the insidious and latent aspects of dementia. further prospective studies are needed to investigate the influence of prior depression and anxiety as a cause for dementia. the findings presented are based on the frequency matching of cases and controls rather than perfect matching for two reasons. first, the frequency matching selection increased the power and efficiency of the study. second, previous studies found that unconditional logistic regression with adjustments of match variables can derive similar estimates with the conditional logistic regression where perfect matching of cases and controls were required. anxiety was independently associated with a future dementia diagnosis and was more prevalent within the cohort compared to depression. this is suggestive that anxiety represents a more important risk factor for dementia than had been previously thought, and along with depression represents an affective risk component that could be screened for within primary care. one potential explanatory factor is that anxiety was being diagnosed by primary care physicians in patients experiencing mild cognitive impairment (mci), preceding a later diagnosis of dementia. this concurs with previous work, which suggested that anxiety in patients with mci does strongly predispose to progression to a dementia diagnosis.. also showed that high trait anxiety was an independent risk factor for developing cognitive impairment and non - vascular dementia., did not find a long - term effect for cognitive decline in patients with anxiety. they measured self - reported symptoms of anxiety using hads - a (the hospital anxiety and depression scale anxiety). however their analysis used the scale score of the hads - a which may not be reflective of the clinically relevant levels of anxiety that may incur a read code from a primary care physician. one physiological explanation why chronic anxiety may contribute to cognitive decline is sapolsky s glucocorticoid cascade hypothesis. this hypothesis suggests that high levels of glucocorticoids, brought about by prolonged stress from anxiety and depression, can lead to neurotoxicity and atrophy within the hippocampus which is associated with memory processes. it seems clinically reasonable to postulate that, in a similar way to depression, patients may experience and present with anxiety symptoms as a direct cause of the insight they have into their early experiences of mci.. however felt that the long run - in period of their study meant that their results were unlikely to be explained by this hypothesis and prefer an explanation including a common biological pathway linking anxiety, depression and dementia (possibly serotonergic). this study demonstrated differences in the association of dementia and depression between male and females. prevalence of depression in the male control group was lower than in the female controls. lower consultation rates and later presentation of depression in men may be a confounding factor, as the severity of depression in females and males may differ. a male patient presenting with depression vascular depression has been postulated as an accelerant of dementia and cardiovascular disease being more common in men may explain this study s finding. as depression in women is more common and the cause of their depression more heterogeneous, such an association in this group would be masked. cerebrovascular disease was a significant risk factor for dementia as would be expected from previous studies. hypertension and dyslipidaemia appeared to decrease the odds for developing dementia, an unexpected result although the results were close to non - significance. it is likely that the patients identified had controlled disease (unlike in population studies) and were on medication that may represent a confounding factor. the results for diabetes (a well recognised independent risk factor) were also unexpectedly non - significant. by setting the study in the consulting primary care population, using routinely recorded data, the findings are applicable to the primary care population. the sample size was large however, it did not include patients who do not use primary care services. this study is based on anxiety and depression presented by patients rather than self - reported. it is possible that some diagnoses were not coded or mis - coded, although the quality control measures in place around the database should decrease this risk. due to the nature of the read code system and the anonymised dataset we were unable to obtain information on the severity of dementia or risk factors such as lifestyle variables, as well as background information such as socio - economic status. the selection criteria for the study subjects were specific to ensure only patients with late - onset dementia were included ; however it was not possible to differentiate between dementia subtypes. to reduce the chance of risk factor variables not being identified in the premorbid time frame, the cases had to have at least 3 years registration prior to the date of dementia diagnosis and had to have consulted in the year preceding the dementia diagnosis, as did the matched controls. a total of 662 people with a dementia code had to be excluded from the cohort as they lacked 3 years continuous registration prior to their diagnosis. this loss of potential cases decreased the sample size but increased the internal validity of the study as only people with a theoretically new diagnosis of dementia were included. this patient movement is likely to represent the migratory nature of patients with dementia and reflect the findings of rait. where more than twice the number of people with dementia than without dementia moved between practices. it is possible that the study could have excluded patients with the more severe and advanced cases of dementia (i.e. those not able to function in their own homes and needing to move into residential or nursing care) and hence not be entirely representative of the true community sample of people with dementia. this study also only looked at co - morbidities in the recent past (up to 8 years) before dementia was diagnosed, meaning it could not look at long - term effects of disease. it was also not possible to analyse all recognised risk factors due to lack of read coded data found in primary care records, such as apolipoprotein e4 status. furthermore even though this study used at least a 3-year exposure timescale before diagnosis, we can not be completely certain of the temporal relationship between exposure and disease outcome using a case - control design because of the insidious and latent aspects of dementia. further prospective studies are needed to investigate the influence of prior depression and anxiety as a cause for dementia. the findings presented are based on the frequency matching of cases and controls rather than perfect matching for two reasons. first, the frequency matching selection increased the power and efficiency of the study. second, previous studies found that unconditional logistic regression with adjustments of match variables can derive similar estimates with the conditional logistic regression where perfect matching of cases and controls were required. this study supports observations that anxiety independently increases the likelihood of later being diagnosed with dementia. in order to support current national guidelines and strategies to improve the rate of earlier diagnosis of dementia and hence access to holistic management, clinicians should be vigilant to symptoms of cognitive impairment especially in older patients with a past history of anxiety, depression and cerebrovascular disease. unadjusted and adjusted associations of risk factors with future diagnosis of dementia controlling for age, gender, practice and year of case diagnosis of dementia. association of having diagnosis of both depression and anxiety on future diagnosis of dementia multivariable model controlling for age, gender, practice, year of case diagnosis of dementia and all risk factors and including interaction of anxiety with depression. association of depression and anxiety with diagnosis of dementia by gender multivariable model controlling for age, gender, practice, year of case diagnosis of dementia, and all risk factors and including interaction of anxiety with depression. cipca was funded by the north staffordshire primary care research consortium and the national coordinating centre for research capacity development. christian mallen is funded by an arthritis research uk clinician scientist award. ethical approval : use of the cipca database for anonymised patient research was granted by the north staffordshire research ethics committee. | background.depression is identified as a risk factor for dementia. little research has been carried out on the importance of anxiety, despite strong evidence of co - morbidity with depression.objective.to examine the association of anxiety and depression with future dementia diagnosis.methods.this case - control study was set in the consultations in primary care archive. cases (n = 400), were patients aged > 65 years old. about 1353 controls were matched to cases by gender, practice, age group and year of case diagnosis. read codes of risk factors for dementia were searched in patient records. the associations of prior consultations for anxiety and depression, with future diagnosis of dementia were determined using multivariable logistic regression.results.a past anxiety diagnosis was associated with a future dementia diagnosis [odds ratio 2.76 (95% confidence interval 2.113.62) ]. the association of depression with dementia was attenuated by the high prevalence of anxiety within those who have depression. including an interaction of depression and anxiety showed that having only depression was associated with future dementia diagnosis but a diagnosis of depression alongside anxiety did not increase the likelihood of a dementia diagnosis compared to having just an anxiety diagnosis.conclusion.prior diagnosis of anxiety was strongly associated with dementia diagnosis after adjustment for other risk factors. the independent effect of depression was weaker compared to anxiety. given the higher prevalence of anxiety primary care physicians should consider anxiety as well as depression as premorbid risk factors of dementia to improve early recognition and facilitate greater access to services. |
the current standard of treatment for locally advanced rectal cancer (uicc stages ii and iii) includes a 5-fluorouracil (5-fu)-based preoperative radiochemotherapy (rct), total mesorectal excision, and postoperative chemotherapy [1, 2 ]. several randomized clinical trials during the last decades have demonstrated that neoadjuvant 5-fu - based rct significantly improves locoregional control of rectal cancer [3, 4 ]. today, the limitation of the prognosis of individual patients is mainly determined by the occurrence of distant metastases in 3040% of patients. this led to the intensification of systemic therapy through integration of platinum derivatives, an approach that not only promises a therapeutic benefit but simultaneously bears the risk of increased toxicity. subsequently, to avoid unnecessary toxicity, more individualized and risk - adapted treatment approaches are needed and are currently being validated in several ongoing clinical trials. however, in rectal cancer, reliable biomarkers to predict the response to neoadjuvant rct, individual prognosis and occurrence of treatment - associated toxicity have not yet been established as part of the clinical routine. the adjuvant treatment strategy with 5-fu in combination with leucovorin and oxaliplatin is well established and has been used for nearly 10 years in the adjuvant treatment of uicc iii colon cancer. the neoadjuvant and adjuvant treatment with folfox against locally advanced rectal cancer (uicc ii and iii) is integrated in several randomized phase iii multicenter trials such as the cao / aro / aio-04 trial of the german rectal cancer study group. the cao / aro / aio-04 regimen consists of intravenous oxaliplatin (80 mg / m) combined with leucovorin (400 mg / m) and subsequent 5-fu infusion (2,400 mg / m), repeated every 14 days over 4 months (8 cycles). oxaliplatin is a platinum derivative whose therapeutic effect is based on alkylating effects. the platinum compound binds to dna forming cross - links, which inhibit dna replication and transcription, and so result in cell death [9, 10 ]. for patients with chronic renal failure (creatinine clearance 145 gy) 2 years before as a treatment for prostate cancer (ct2b, cnx, cm0, gleason score 6), the standard treatment of neoadjuvant rct with 50.4 gy and concomitant 5-fu (+ / oxaliplatin) was not possible. an abdomino - perineal rectum exstirpation with implantation of a descendostoma was performed to remove the rectal cancer. the histopathological work - up revealed a pt3a, pn2b (21/31), cm0, l1, v0, g3, r0 (uicc iiib) adenocarcinoma and thus adjuvant chemotherapy was strongly suggested according to the vote of the institutional interdisciplinary tumor board. eight weeks after surgery, the first cycle of adjuvant chemotherapy with 5-fu, leucovorin and oxaliplatin (folfox-6) was scheduled. the cycle consisted of a bimonthly regimen with intravenous oxaliplatin (80 mg / m) and leucovorin (400 mg / m) administered on day 1. 5-fu 2,400 mg / m followed on day 1 as a continuous infusion for 46 h. during the following 3 days, the patient developed fever that resolved spontaneously. fourteen days later, the patient showed disseminated petechiae with secondary hemorrhage, along with edema on both legs and interdigital ulceration. he reported that he had experienced arthralgia in his knees and elbows 4 days after the first dose of chemotherapy. his blood count showed microcytic, hypochromic anemia, leukocytosis of 13,900/l, elevated c - reactive protein of 90.1 mg / l, and an increase in the retention parameters (urea 25 mg / dl), indicating an affliction of the kidneys. the chemotherapy was interrupted and the patient was admitted to the department of dermatology. on examination, there was palpable purpura with petechial hemorrhage on the lower limb in addition to massive edema on both lower legs (fig. 1). some petechiae were also found on the lower arms and the abdomen. the patient did not complain about abdominal pain and 3 tests for occult blood in the stool were negative. after 2 days, the renal parameters were rising (creatinine 1.33 mg / dl ; normal range 0.51.0 mg / dl) and the patient developed proteinuria of 1,200 mg / day in the 24-hour urine collection. because of the putative renal involvement, therapy with a high - dose corticosteroid (prednisolone 80 mg / day), a proton pump inhibitor (pantoprazole 40 mg / day) and osteoporosis prophylaxis (calcium carbonate and cholecalciferol 500 mg and 10 g b.i.d. in addition, the patient was prescribed an ace - inhibitor (ramipril 2.5 mg / day) for renal protection. an infectious origin of the leukocytoclastic vasculitis was considered implausible because there were no respective clinical symptoms and serological tests were negative for hepatitis a, b and c as well as for an infection with streptococci. g / l), c4 (0.25 g / l), p - anca - if (1:80), were not elevated and no circulating immune complexes were detected. a punch biopsy from the active area of the frontal aspect of the right lower leg showed typical features of leukocytoclastic vasculitis (fig. nuclear dust in the higher corium, extravasated erythrocytes, focal small - vessel edema, endothelial cell swelling within the vessels and fibrinoid deposition. direct immunofluorescence revealed igm, iga, c3, and fibrinogen deposition in the small vessels of the dermis. in our opinion, there was strong evidence for drug - induced toxicity as the cause of the vasculitis, so chemotherapy with oxaliplatin was discontinued. the patient was treated with prednisolone at a decreasing dosage for the next 6 weeks. under the steroid therapy after 2 weeks, there was evidence of hematuria (> 20 erythrocytes) and proteinuria (745 the urine analysis showed an increase in renal parameters with creatinine 2.41mg / dl, urea 43 mg / dl, egfr 26.3, a proteinuria of 1,800 mg / day in a 24-hour urine collection, and a creatinine clearance of 40.1 ml / min. the patient was admitted to the department of nephrology with the clinical diagnosis of acute renal failure, presumably as a consequence of acute glomerulonephritis. the percutaneous renal biopsy showed a focal segmental extravascular necrotizing proliferating glomerulonephritis. because gbm - antibodies (0.4 u / ml) or cryoglobulins (< 0.2%) were not detectable, the most likely cause of renal failure was a renal manifestation of the leukocytoclastic vasculitis. under high - dose steroid therapy (prednisolone 250 mg for 3 days followed by tapered doses), the renal function improved slowly. unfortunately, during further follow - up, the patient had developed tumor progression with pulmonary metastases at the 12-month follow - up visit. consequently, a palliative regimen with folfiri (5-fu, leucovorin and irinotecan) was scheduled. under this treatment recent mri and ct scans revealed a progressive disease with new metastasis - like lesions in the thoracic spine and suspect lymph nodes in the retroperitoneal, iliacal and inguinal region. we also treated a 71-year - old male patient with similar symptoms after chemotherapy with folfox-6 and bevacizumab for colon cancer with hepatic metastases [pt3, pn0 (0/33), pm1 (hepatic), g2, r0 ]. initially, he had received surgical treatment with a right hemicolectomy and an atypical liver resection of some of the lesions. after the subsequent postoperative chemotherapy with folfox-6 and bevacizumab for 4 cycles, restaging was performed. due to the remaining hepatic metastases, a right hemihepatectomy was performed. except for increased s - ana - if activity (1:320), the rheumatoid factors were negative. a punch biopsy from an active hemorrhagic lesion again confirmed the diagnosis of a leukocytoclastic vasculitis. shortly after diagnosis, the patient showed clinical symptoms of acute renal failure and his renal parameters increased to a serum creatinine of 2.5 mg / dl and an urea of 69 mg / dl, necessitating forced diuresis in addition to systemic corticosteroids for the next 2 months. the nephrotic syndrome with microhematuria persisted for 2 months of continued cortisone therapy. a renal biopsy was repeated 2 months later and showed an iga nephritis with focal segmental and global glomerulosclerosis. as treatment for the chronic renal failure grade iii, assuming that drug toxicity was the cause of the vasculitis, the supporting chemotherapy was prematurely terminated. within the following 12 months, the patient regretfully developed new metastases in the right lung segment and also showed bifocal liver metastases in the remaining left liver lobe. the dose reduction was 75% and he received additional fluids for renal protection. under this treatment, the patient again suffered from acute or chronic renal failure, which made hemodialysis necessary. oxaliplatin is a third - generation platinum alkylating agent currently used to treat a great number of malignancies, including both locally advanced and metastatic colorectal cancer. unfortunately, the use of oxaliplatin is associated with a plethora of adverse effects. while some of these effects, like nausea or thrombocytopenia, are common reactions to many cytostatic drugs, oxaliplatin has been reported to induce some rather unique side effects. with the report of these 2 cases, we have documented a very rare oxaliplatin - induced side effect with a potentially dramatic impact on the affected patients. physicians should be aware of this rare, yet potentially detrimental adverse effect of oxaliplatin when employing it as a standard chemotherapeutic substance or as a part of novel combination therapies. to our knowledge, there has been only 1 case report prior to our observations reporting leukocytoclastic vasculitis as an adverse effect of treatment with oxaliplatin. | leukocytoclastic vasculitis is a multicausal systemic inflammatory disease of the small vessels, histologically characterized by inflammation and deposition of both nuclear debris and fibrin in dermal postcapillary venules. the clinical picture typically involves palpable purpura of the lower legs and may be associated with general symptoms such as fatigue, arthralgia and fever. involvement of the internal organs, most notably the kidneys, the central nervous system or the eyes, is possible and determines the prognosis. oxaliplatin - induced leukocytoclastic vasculitis is a very rare event that limits treatment options in affected patients. we report 2 patients who developed the condition under chemotherapy for advanced rectal and metastatic colon carcinoma, respectively ; a termination of the therapy was therefore necessary. while current therapies for colorectal cancer include the combination of multimodal treatment with new and targeted agents, rare and unusual side effects elicited by established agents also need to be taken into account for the clinical management. |
wilson 's disease (wd) is an autosomal recessive disease, involving a defect of copper transport by hepatic lysosomes, caused by mutations in the atp7b gene that lies on chromosome 13q14.3. reduced biliary excretion of copper results in a net positive copper balance and copper deposition in the liver, brain, kidneys, and skeletal system. wd is one of the few curable disorders provided ; it is diagnosed and treated early. we report a young man presenting with extrapyramidal signs and mutism, who was initially treated as a psychiatric disorder. a young male presented with the chief complaints of withdrawn behavior, decreased verbal output, and decreased self - care for the last 9 months followed by tremulousness, increased salivation, and slowness of activities for the last 6 months. he would not be affected emotionally by the events taking place in the household, as opposed to his usual self. he would not participate in the household activities and would do anything only on the insistence of his family members. previously, he used to work in the fields and feed the animals, but, after the onset of the illness, gradually he stopped doing these things and would stay at home most of the time. at the start of the illness, he would initiate conversation at times, but, over a month, his interaction reduced so much that he would reply only when spoken to. at times, he would wander in the fields but would come back home. occasionally, once in 5 - 6 days, he would be seen smiling to self, but when asked about it, he would deny any such thing. over a period of 3 months, he had stopped taking a bath regularly and often would not even change his clothes when not insisted. he was shown to several faith healers during the course of the initial 3 months, but there was no improvement in his condition. after about 3 months into the illness, there was a discrete episode of the patient wandering away from his house at night. he was found in the morning and did not recall any of the events at night and simply said that he had reached the place in the morning itself. following that incident, the patient stopped taking food himself and had to be fed by the mother. he remained withdrawn and apathetic and was unable to carry out the activities of daily living. initially, tablet risperidone 2 mg bd was given and was subsequently replaced by tablet olanzapine 10 mg hs when no response was obtained in 2 weeks. about 4 months from the start of the illness and after about a week of starting medications, the parents also noticed that the patient had developed tremulousness of both hands which was interfering with the day - to - day activities. it was also noticed that the salivation had increased and over a period of 3 weeks, drooling of saliva from the mouth was noticed. the patient was then taken to a neurologist 2 months later, and medications were started, the records of which are unavailable. on general physical examination, the patient had a dystonic facies with a vacuous smile and pooling of saliva in the mouth. on neurological examination, higher mental function examination was not possible as the patient was mute. however, comprehension was intact as the patient was following commands such as being asked to raise his respective hand. motor examination revealed bilaterally symmetrical rigidity with dystonic finger posturing and striatal toe with postural tremors. laboratory investigations revealed markedly decreased serum ceruloplasmin (3 mg / dl ; normal range 15 - 45 mg / dl) and markedly elevated 24 h urinary copper (262.02 g / day ; normal range 15 - 60 g / day). magnetic resonance imaging brain revealed signal intensity alterations in bilateral basal ganglia [figure 1 ] and thalami [figure 2 ]. gradient - recalled echo sequence showed blooming in bilateral basal ganglia [figure 3 ]. the parents and siblings were also examined and did not show a kf ring ; serum ceruloplasmin was also normal. coronal t2-weighted image showing hyperintense lesions in bilateral basal ganglia bilateral thalamic hyperintensities seen on a t2-weighted image gradient recalled echo images showing blooming effect in bilateral basal ganglia the patient was started on tablet d - penicillamine 100 mg bd. our patient presented with mutism, a vacuous smile, parkinsonian features, dystonic finger posturing, and bilateral striatal toes. bedside, examination revealed a brownish pigmentation in the upper part of the cornea, which was confirmed to be kf ring on slit lamp examination, and had a low serum ceruloplasmin with increased urinary copper excretion. he was, however, misdiagnosed to be suffering from a psychiatric disorder at the initial consultation with a psychiatrist and prescribed neuroleptic drugs. a correct diagnosis of wd was made, after a delay of 9 months, when he came for consultation to us. in a consecutive series of 307 patients seen over a period of 30 years in a tertiary care hospital, diagnostic errors by referring doctors it is noteworthy that 37 patients were misdiagnosed during the first evaluation even in the tertiary care hospital. incorrect diagnoses were as diverse as flat feet, myxedema, myasthenia gravis, encephalitis, multiple sclerosis, parkinson 's disease, schizophrenia, depression, anxiety state, etc. hu. noted that among 1011 cases of hepatolenticular degeneration, 516 cases were initially misdiagnosed, 193 cases failed to be diagnosed as a specific disease, and only 302 cases were correctly diagnosed within 3 months after the onset. the curative effect was better in the group with early diagnosis than in the groups with misdiagnosis and without a precise diagnosis (p < 0.01). it has been reported that early manifestations of wd are generally hepatic or neurological (40% each) while the remainder present with psychiatric, hematological, renal, or osteochondrotic symptoms. walshe and yealland analyzed the initial diagnosis of 136 patients with wd and observed that it fell into four groups, that is, organic disorder other than wd 25.7%, psychiatric illness 23.5%, seizure disorder 19.1%, and wd 31.6%.. there are several neuropsychiatric symptom clusters established for wd patients : personality disorders, mood disorders, cognitive deficits, psychotic manifestations, etc. psychiatric symptoms can occur before, concurrent with or after the diagnosis and treatment for wd. in the brain, copper is commonly deposited in the basal ganglia, particularly in the putamen and globus pallidus. damage to these areas leads to the neuropsychiatric symptoms seen in wd. according to a recent review, 30 - 40% of patients have psychiatric manifestations at the time of diagnosis, and about 20% have already seen a psychiatrist prior to the diagnosis of wd. the causes for delay in diagnosis are varied and include rarity of the disease, protean clinical manifestations, lack of awareness among treating physicians, laboratory errors in the estimation of copper and ceruloplasmin concentrations and evaluation for kf rings by an inexperienced ophthalmologist. the patients presenting with behavioral problems often receive antipsychotic agents. with the evolution of extrapyramidal symptoms, they are diagnosed as having a drug - related adverse event, although these are the hallmark of neurological wd. in our case, the cause of the delay in diagnosis was mainly the predominant psychiatric presentation in the patient and also the delay in seeking help from proper health professionals. furthermore, the development of extrapyramidal symptoms in the patient further complicated the case as its occurrence after taking medications could be due to medications itself that are drug - induced parkinsonism as well as could have been an independent neurological symptom of wd. this delay could have been prevented, had a proper neurological examination been done at the first referral, and laboratory investigations conducted early. we believe that diagnostic possibility of wd should be considered in all young patients presenting with recent onset behavioral and personality changes. screening tests for all suspected patients should include slit lamp examination for kf ring by an experienced ophthalmologist, abdominal ultrasound for architectural changes in liver, serum copper and ceruloplasmin, and 24 h urinary copper from a reliable laboratory. the diagnosis of wd is not difficult if the clinician thinks of it and includes it in his differential diagnosis. however, it needs to be emphasized that there is no typical clinical picture and even in the same family, the presentation may be different. | therapeutic outcome of wilson 's disease significantly depends upon its early recognition. as wilson 's disease is a rare disorder with protean manifestations, its diagnosis and subsequent treatment are often delayed. we elaborate here the case of a young boy who had initially presented with psychiatrc symptoms suggestive of dissociative fugue followed by withdrawn behaviour and was treated by a psychiatrist with minimal response. this was associated with symptoms of tremors, hypersalivation, and slowness of movements. this case highlights the delay in diagnosing wilson 's disease when faced with the case of a young adult with psychiatric manifestations. it is extremely important for physicians, psychiatrists and health professionals at primary care level to recognize and diagnose this treatable disease at an early stage. |
sodium bromate and potassium bromate are strong oxidants that are widely used in hair permanent wave neutralizers, reagents of printing or dyeing and other chemical processes. hair wave permanent neutralizing solutions typically contain 2 - 10% sodium or potassium bromate, which are colorless, odorless and tasteless. clinical manifestations of bromate intoxication include vomiting, diarrhea, central nervous system symptoms, oliguric or non - oliguric acute renal failure, hemolytic anemia, and deafness. hearing impairment is rather common and is usually rapidly progressive, bilateral, and of severe to profound sensorineural type of hearing loss (snhl). although many investigators have studied the characteristics of hearing impairment, cochlear implantation (ci) after bromate intoxication has been rarely documented. we hereby present a case of successful ci in bromate - induced bilateral sudden total deafness. she had accidentally ingested a cold wave neutralizer. within one hour after the ingestion, she developed nausea, vomiting, and diffuse abdominal pain. her past history included hypertension, left hemiparesis due to previous brain hemorrhage and infarction and depressive disorder. upon arrival in the emergency room of a local hospital, she received intravenous hydration and furosemide injection. one day later, she was referred to our hospital with decreased urinary output and reduced mental state. four days after admission, her kidney function was normalized and mentality was recovered to an alert state. 1b) and v - wave was not detectable at 90 db in the auditory brainstem response. she was diagnosed as having bromate - induced sudden deafness and steroid was administered systematically for a week with tapering for another week. nucleus 24re was implanted without any intra - operative problems and the neural response telemetry showed satisfactory values. six months after the implant, ci - aided pta showed a threshold of 30 db (fig., she comprehended 70% of the sentences, 85% of the words and 68% in the korean version of the central institute for the deaf test. hearing problems may be diagnosed with a delay after bromate intoxication due to other life - threatening symptoms such as acute renal failure which generally occurs within 1 hour after the ingestion. however, the onset of bromate - induced hearing loss is actually rapid, occurring within 4 - 16 hours of ingestion. like many other ototoxins, the degree of hearing impairment is severe to profound, and is irreversible in most cases. since they are usually transient, loop diuretics including furosemide are ototoxic in themselves. in the present case, the patient received furosemide during the primary treatment, which may have aggravated the ototoxic effects of bromate. previous studies using guinea pigs and sodium bromate demonstrated severe collapse of the reissner 's membrane, hair cell degeneration and damage of the stria vascularis. the ototoxicity may be ascribed to a decrease in enzyme activities which leads to damage of the stria vascularis with degenerative changes in outer hair cells on the other hand, dizziness associated with bromated - induced vestibulotoxicity is not common. the dizziness could be secondary to other systemic toxicities such as lightheadedness or general malaise. to our knowledge, there has only been one report in the english literature of ci performed in patients deafened due to bromated - ingestion. in this case, the diagnosis of hearing loss was delayed for at least 6 months after bromate ingestion. in our case, deafness was diagnosed right after the recovery of consciousness and the intervention with ci was done 3 months after the diagnosis. in both cases, the outcome of ci was good. other potential drugs with ototoxicity should be avoided and early monitoring of hearing level is needed. | despite the well - established nature of bromate - induced ototoxicity, cochlear implantation after bromate intoxication has been rarely documented. we hereby present a case of a 51-year - old female deafened completely after bromate ingestion. her hearing was not restored by systemic steroid treatment and hearing aids were of no use. a cochlear implantation was performed on her right ear 3 months after the bromate ingestion. in bromate intoxication cases, early monitoring of hearing level is necessary and other drugs with potential ototoxicity should be avoided. the outcome of cochlear implantation was excellent in this case of bromate - induced deafness. |
the local institutional review board approved this retrospective study, and patients provided a written informed consent for the procedure. we def ined outpatient day - care management as a clinical process where the patients get a procedure on the day of admission and are subsequently get discharged on the same day for the diagnosis or on the following day for the neurointervention, which is generally performed under general anesthesia (fig. we analyzed 412 uias in 345 patients who were referred to the neurointervention clinic of the asan medical center due to known cerebral aneurysms and underwent cerebral angiography or neurointervention during the recent four years between january 1, 2011 and december 31, 2014. we excluded the patients who have aneurysms associated with other cerebrovascular diseases or patients with aneurysms in the head and neck or spine. we also assessed the results of cerebral angiography including serious complications which required additional management or emergency surgery and the process of the patients, and outcome. after the decision was made for patients with uias to undergo a cerebral angiography in the outpatient clinic, they underwent pre - admission study (chest pa, electrocardiography (ecg), blood test, urine analysis) and attended the neuroangio - suite in the morning of the reserved day. oral intake (breakfast) was prohibited for about two hours before the procedure. after a short period of post - procedural observation (4 to 6h), the majority of patients who have been performed uncomplicated cerebral angiography were discharged on the same day. the angiography was performed via a transfemoral or transradial approach by an insertion of a 4f sheath. both the internal carotid arteriograms and the dominant or ipsilateral (lesion side) vertebral arteriogram were performed using a 4f angiocatheter. these angiographic procedures were identifical to what would have been done as an inpatient procedure. after the procedure, manual compression of the puncture site was applied using apad hemostasis device (t & l, seoul, korea) which was designed to promote bleeding control. the preparation before the procedure was the same as that for cerebral angiography except that general anesthesia was used. a 6 - 7f guiding catheter was introduced into the cervical distal of targeted internal carotid artery or vertebral artery. neuroform stent (boston scientific corp, fremont, ca) or enterprise stent (codman neurovascular, miami, fl) was used in patients who were performed stent - assisted coiling. the patients received clopidogrel 75 mg daily at least 4 days before the procedure and continued for 3 - 6 months, and aspirin 100 mg daily for a year. all endovascular procedures were performed with patients under systemic heparinization with a range of 200 - 250 seconds of activated clotting time. during the procedure, the patient 's vital signs were monitored by the arterial line via the radial artery. after the procedure, each patient was sent to the intensive care unit (icu). from the icu all patients were discharged or transferred to another department if further management or procedure was required. we assessed the patient after angiography on whether there was any aneurysm corresponding to mra or cta. treatment options were discussed with the patients and their family with an explanation of the natural risk of the aneurysm. minor stroke was defined as a new, nondisabling neurologic deficit or as an increase in the national institutes of health stroke scale (nihss) by 3 (points), but which completely resolved within 30 days. after the decision was made for patients with uias to undergo a cerebral angiography in the outpatient clinic, they underwent pre - admission study (chest pa, electrocardiography (ecg), blood test, urine analysis) and attended the neuroangio - suite in the morning of the reserved day. oral intake (breakfast) was prohibited for about two hours before the procedure. after a short period of post - procedural observation (4 to 6h), the majority of patients who have been performed uncomplicated cerebral angiography were discharged on the same day. the angiography was performed via a transfemoral or transradial approach by an insertion of a 4f sheath. both the internal carotid arteriograms and the dominant or ipsilateral (lesion side) vertebral arteriogram were performed using a 4f angiocatheter. these angiographic procedures were identifical to what would have been done as an inpatient procedure. after the procedure, manual compression of the puncture site was applied using apad hemostasis device (t & l, seoul, korea) which was designed to promote bleeding control. the preparation before the procedure was the same as that for cerebral angiography except that general anesthesia was used. a 6 - 7f guiding catheter was introduced into the cervical distal of targeted internal carotid artery or vertebral artery. neuroform stent (boston scientific corp, fremont, ca) or enterprise stent (codman neurovascular, miami, fl) was used in patients who were performed stent - assisted coiling. the patients received clopidogrel 75 mg daily at least 4 days before the procedure and continued for 3 - 6 months, and aspirin 100 mg daily for a year. all endovascular procedures were performed with patients under systemic heparinization with a range of 200 - 250 seconds of activated clotting time. during the procedure, the patient 's vital signs were monitored by the arterial line via the radial artery. after the procedure, each patient was sent to the intensive care unit (icu). from the icu all patients were discharged or transferred to another department if further management or procedure was required. we assessed the patient after angiography on whether there was any aneurysm corresponding to mra or cta. treatment options were discussed with the patients and their family with an explanation of the natural risk of the aneurysm. minor stroke was defined as a new, nondisabling neurologic deficit or as an increase in the national institutes of health stroke scale (nihss) by 3 (points), but which completely resolved within 30 days. there were 403 aneurysms in 345 patients who underwent cerebral angiography and neurointervention at our institution between january 1, 2011 and december 31, 2014. there were 141 (41%) diagnostic catheter angiographies, 202 neurointerventional procedures (59%) and 2 (0.6%) neurointerventional procedures followed by operation. angiographic results showed a single aneurysm (n=283, 82%) or multiple aneurysms (n=62, 18%). no aneurysm was found in 58 patients who were reported as having an aneurysm in mra or cta. among 345 patients with aneurysms, coiling was performed in 202 patients (59%), surgical clipping in 14 (4%), coiling followed by clipping in 2 (0.6%) and cerebral angiography follow up in 127 (37%). of these aneurysms, the maximum diameter of 154 aneurysms was 4 mm, 166 aneurysms had diameters of 4 - 10 mm, 19 aneurysms had diameters greater than 10 mm (table 1). there were 3 giant thrombosed or fusiform aneurysms, 2 recurred aneurysms and 1 dissecting aneurysm whose sizes were not measurable. the mean hospital stay for neurointervention was 2.1 days. in the follow - up, there were recurrent aneurysms in 9 patients who underwent 2 procedures without further event. after neurointerventional procedures, there were 4 (2%) adverse events including 3 minor and 1 major ischemic strokes. our study revealed that day - care management of uias resulted in 2% adverse events and 4.5% recurrence that required additional coil embolization without further event. outcome of outpatient neurointervention of uias in this study was comparable to other studies regarding endovascular treatment for inpatients with uias (table 2). the mean duration of hospital stay for neurointervention procedures for patients with uias was 2.1 days which were much shorter than those in a study performed by the national evidence - based healthcare collaborating agency (22 days for surgical clipping and 12 days for neurointerventional coiling). in one study of patient with ruptured and unruptured aneurysms, neurointerventional coiling, compared with surgical clipping, was associated a shorter length of hospitalization, but higher hospital cost. in another study, coiling compared to clipping was associated with a signif icantly shorter hospital stay and lower total hospital charges. in addition to reducing the hospitalization period and total hospital charges by using a neurointerventional procedure compared to surgery, our study demonstrated the possibility that day - care neurointerventional coiling can be used to treat uias. the advantage of day - care procedures was rapid admission process on an outpatient basis. the simplification of the admission process can be achieved by close communication in the outpatient clinics by admitting to an intermediary care unit in the angiosuite. after 6 hours of admission, patients who underwent uncomplicated cerebral angiography was be discharged on the same day. aneurysms considered as having relatively higher risks for rupture were scheduled after discussion with patients and their family for subsequent management. although in our study there were no reported significant adverse events after cerebral angiography and 4 strokes (2%) after neurointerventional procedures, there was a higher complication rate as 25% in which some patients require further treatment. therefore, improvement of procedural outcome as well as management process might affect difference in adverse events even though study population was different among the studies. firstly, we did not perform a comparative study with surgical clipping for the same category of the patients even though outcome of endovascular therapy was known to be better. it could provide rapid patient flow in the hospital, shorten hospital stay and obtain better outcome, and is expected to reduce hospital costs furthermore, the availability of such outpatient management can contribute to meet higher standard of medical need of a large volume of patients with uias. | purposeday - care management of unruptured intracranial aneurysms can shorten hospital stay, reduce medical cost and improve outcome. we present the process, outcome and duration of hospital stay for the management of unruptured intracranial aneurysms via a neurointervention clinic in a single center during the past four years.materials and methodswe analyzed 403 patients who were referred to neurointervention clinic at asan medical center for aneurysm evaluation between january 1, 2011 and december 31, 2014. there were 141 (41%) diagnostic catheter angiographies, 202 (59%) neurointerventional procedures and 2 (0.6%) neurointerventional procedures followed by operation. we analyzed the process, outcome of angiography or neurointervention, and duration of hospital stay.resultsthere was no aneurysm in 58 patients who were reported as having an aneurysm in mra or cta (14 %). among 345 patients with aneurysm, there were 283 patients with a single aneurysm (82%) and 62 patients with multiple aneurysms (n=62, 18%). aneurysm coiling was performed in 202 patients (59%), surgical clipping in 14 patients (4%), coiling followed by clipping in 2 patients (0.6%) and no intervention was required in 127 patients (37%). the hospital stay for diagnostic angiography was less than 6 hours and the mean duration of hospital stay was 2.1 days for neurointervention. there were 4 procedure - related adverse events (2%) including 3 minor and 1 major ischemic strokes.conclusionour study revealed that day - care management of unruptured intracranial aneurysms could be performed without an additional risk. it could enable rapid patient flow, shorten hospital stay and thus reduce hospital costs. |
Subsets and Splits
No saved queries yet
Save your SQL queries to embed, download, and access them later. Queries will appear here once saved.